text
stringlengths
0
868k
A 60-year - old lady presented to our sister department of medical gastroenterology at a tertiary health care institute with a history of an increasing mass in the right upper abdomen of one and a half year duration . She also had a history of weight loss due to early satiety and decreasing appetite . She had been evaluated with abdominal cect 14 months before by some local doctor which had shown a mass lesion in the right lobe of the liver . All her systemic examinations were normal except a big nodular mass in the right hypochondrium merging with the liver . The department of medical gastroenterology considered her for a repeat workup, with abdominal mri, rbc trigged nuclear scan of the liver, serum tumor markers and routine base investigations . Mri showed a nodular mass lesion arising from the right lobe of the liver, crossing towards the left lobe with involvement of the right portal vein, with areas of cystic changes and hemorrhage within the lesion (fig . Her tumor markers, including -fetoprotein, cea, ca 19 - 9 and hcg, were all within normal limits . She was also subjected to upper and lower gastrointestinal endoscopy to rule out any occult primary lesion in the gastrointestinal tract . Routine laboratory investigations including liver function tests, hemogram, kidney function, chest x - ray and ecg were within fairly normal limits, her coagulogram revealing pt elevated by 3 s. serology was negative for hepatitis b and c. she was also subjected to usg guided fnac which was inconclusive and revealed only blood cells . After complete workup with a tentative diagnosis of fibrolamellar hepatocellular carcinoma the patient was referred to our department for surgical intervention . She was offered a diagnostic and if possible curative laparotomy after repeat imaging (abdominal cect) as she had again lapsed a period of 34 months after her workup . Due to monitoring constraints, her attenders did not agree to get an abdominal ct but were ready for any possible surgical intervention with the minimum of a biopsy to plan further treatment . On exploration the patient was found to have nodular bilobular disease occupying almost all of the liver . There were areas of boggy swelling in between firm nodules predominantly on the inferior surface of liver suggestive of bleeding within the tumor on aspiration . The lesion involving both lobes of the liver was too big and multicentric for any resectional procedure and so a biopsy from the lesion was taken safely . After getting her histopathological report the patient was referred to a medical oncologist for further treatment . This is the first case of fibrosarcoma of the liver reported at our institute . On light microscopy the tumor revealed homogeneous, spindle - shaped cells with abundant collagen fibers showing a classic herringbone pattern (fig . Tissue samples were then sent to another referral cancer hospital for immunohistochemistry where immunoreactive vimentin was found in the tumor cells . Electron microscopically, the tumor cells were rich in rough endoplasmic reticulum without a basement membrane and were surrounded by large amounts of collagen fibers . The purpose of this case report is to share information on a rare tumor of the liver, a primary fibrosarcoma, as up to the late seventies the literature about this entity was restricted to autopsy diagnosis . To our knowledge there are case reports from various parts of the world [2, 3], but there are no series of cases of primary fibrosarcoma of the liver . Etiologically exposure to cadmium has been linked to carcinogenesis of this disease in animal models . Described a series of 20 cases of sarcomatous tumors of the liver, of which angiosarcoma was the commonest, and concluded that primary treatment is surgery with survival depending on the degree of differentiation . From the available literature, primary treatment to be considered for fibrosarcoma of the liver is surgery with curative intent . In a recent article from sloan - kettering cancer center, between 1981 and 2004 they identified only 30 cases of primary liver sarcomas of which most cases (10) were hemangioendotheliomas and only 3 were diagnosed to be primary fibrosarcoma . Only 11 of these patients underwent r0 resection and this group of resected tumors had a 5-year survival rate of 65% . Unfortunately our patient presented quite late in the course of disease even if we consider her first ct scan done one and a half year back . There is a report of one patient with primary fibrosarcoma presenting with frequent episodes of hypoglycemia, where insulin - like growth factor ii was intensely stained in the golgi area of the tumor cells, suggesting its role in the mechanism of hypoglycemia . On histopathological examination these neoplasms show typical light microscopic features like that of malignant rhabdoid tumor with filamentous cytoplasmic inclusions (fig . 4), and on electron microscopic examination show staining for both cytokeratin and vimentin by immunohistochemistry . After making a diagnosis of primary fibrosarcoma of the liver at an inoperable stage, an extensive review of the literature regarding the role of other treatment modalities was done which was not encouraging [5, 8]. Though few reports recommend chemotherapy in liver metastasis of retroperitoneal fibrosarcoma consisting of cyclophosphamide, vincristine, farmorubicin, and dacarbazine, there is no definite role as treatment for primary lesion of liver . Overall the prognosis reported by most of the authors is dismal [1, 2, 3, 10]. We conclude by passing on the message that this rare entity does exist and is an area for workup to make guidelines for management of such tumors . This may be one of the few reported cases of primary hepatic fibrosarcoma confirmed by immunohistochemistry and electron microscopy.
Abnormal spinal curvature may be idiopathic or secondary to dystrophic etiologies, such as congenital, traumatic, and malignant causes . Initial assessment and followup of patients with an abnormal spinal curvature have routinely been performed using plain radiographs . To evaluate dystrophic features, magnetic resonance imaging (mri) computed tomography (ct) is proving to be of benefit in the assessment of patients with an abnormal spinal curvature [410]. Recent advances in multidetector ct (mdct) technique allow the evaluation of the spine in multiple 2-d planes (figures 1(a) and 2(a)) and with a three - dimensional volume - rendered series (3-d vr) (figures 1(b) and 2(b)). In addition, the data from the mdct study can also be used to generate a translucent display, a computer - generated image set that provides 3-d images of the spine enabling assessment of surgical instrumentation through the bony structures (figures 2(c) and 2(d)). The 3-d vr series, including the translucent display, which are generated by computer manipulation of the axial ct source data without additional radiation, have led to a growth in demand for mdct for the imaging of the spine by the spine surgeons at our institution, a major cancer center . However, to the best of our knowledge, there are no reports in the literature on the use of mdct with the 3-d vr series and the translucent display for evaluation of abnormal spinal curvature, which requires additional time for processing and interpretation . We tested the hypothesis that the 3-d vr series, including the translucent display, provides additional information beyond that of the 2-d orthogonal mdct in the evaluation of abnormal spinal curvature in patients treated at a cancer center . The institutional review board of the university of texas md anderson cancer center approved this study and waived the requirements for an informed consent . Mdct studies of the spine in patients who had a history of possible primary or metastatic disease to the spine or neurofibromatosis type 1 and an abnormal spinal curvature greater than 25 degrees, as assessed on mdct, were included in our study . Measurements of spinal curvature were made on the 2-d coronal or sagittal reconstructed ct images, as described in the literature [4, 5]. The review of the imaging studies and clinical data was performed by 3 neuroradiologists (jmd, lk, and ngt) in a consensus fashion . The 3-d vr series, including translucent display, was compared to the 2-d orthogonal mdct studies without the 3-d vr series in the assessment of the following 3 categories: spinal curvature; bony definition (deformity, fusion, and destruction); additional findings (mass lesions, fractures, and instrumentation). For each patient, the 3-d vr series was given a score of 1 if it was judged to be helpful in the evaluation of the aforementioned 3 categories (48 patients 3 categories = 144 total possible categories) and a score of 0 if it was not helpful . Mdct examinations were performed on a multidetector ct scanner (ge medical systems) to yield imaging in the axial plane using the following parameters: 140 kv, 220250 ma, and a 1.25 mm slice thickness . The mdct examinations were performed without (n = 41), with (n = 3), or without and with (n = 4) intravenous contrast (optiray, mallinckrodt inc ., bone algorithm and soft tissue images were available and reviewed in all patients' mdct studies . Postprocessing was then performed by a trained technologist on an advantage aw4.2 workstation (ge medical systems) using volume view software (ge medical systems). The post - processing provided imaging in the sagittal and coronal planes in all patients, and these images, together with the axial source images, are hereafter referred to as the 2-d orthogonal mdct study . In addition, 3-d vr images of the spine (figures 1(b) and 2(b)) and the translucent display (figures 2(c) and 2(d)), for patients in whom surgical instrumentation was placed for the stabilization of abnormal spinal curvature, were provided . The study included 48 patients (35 female and 13 male; ages 1272, mean age, 48 years), as summarized in table 1 . Twenty - four patients had a dextroscoliotic curvature measuring between 26 and 93 degrees (mean, 45.5), 9 patients had a levoscoliotic curvature measuring between 25 and 72 degrees (mean, 35.2 degrees), and 15 patients had a kyphotic curvature of measuring between 27 and 89 degrees (mean 48.1 degrees). Twenty - six patients had a 3-d vr series without a transparent display and 22 patients had a 3-d vr series with a transparent display . The 3-d vr series was rated as helpful when compared to the 2-d orthogonal mdct study in 38 of 48 (79.2%) patients; in 10 of 48 (20.8%) patients, the 3-d vr series was rated as not helpful . Helpful in 63 of 144 (43.8%) total possible categories (table 2). This included the assessment of the spinal curvature in 32 of 48 (66.7%) patients, including dextroscoliosis (n = 16, 2683, mean 50.6), levoscoliosis (n = 8, 2572, mean 35.3), and kyphosis (n = 8; 4289, mean 58.9). The 3-d vr series was rated as not helpful in 16 of 48 patients (33.3%), including those with dextroscoliosis (n = 8; 2949, mean 35.4), levoscoliosis (n = 1, 35), and kyphosis (n = 7; 2747, mean 35.7). The 3-d vr series was rated as helpful in the bone definition category for 14 of 48 (29.2%) patients, including bone deformity (n = 6), bony fusion (n = 4), bony destruction (n = 2), anterolisthesis (n = 2), and the additional findings category, including surgical instrumentation, in 17 patients, specifically, for the assessment of the fusion rods (n = 15) or an anterior fusion plate and pedicular screws (n = 2). Figure 1 shows 2-d orthogonal mdct and 3-d vr images from patient no . 11, a 16-year - old male who presented with a kyphotic curvature secondary to a recurrent juvenile pilocytic astrocytoma of the thoracic spinal cord . The 3-d vr images were scored as 1, helpful in the evaluation of the spinal curvature as the spine is out of plane on 2-d orthogonal mdct imaging . 4, a 61-year - old woman who underwent correction of an abnormal spinal curvature at an outside institution . The patient had a levoscoliotic curvature of the thoracic spine to such a degree the spinal column and instrumentation could not be visualized as one structure on a single, 2-d orthogonal mdct image . The transparent display was helpful in demonstrating the scoliotic curvature and the position and integrity of the instrumentation . Helpful in comparison to the corresponding 2-d orthogonal mdct in the assessment of abnormal spinal curvature in 38 of 48 patients, specifically in the evaluation of abnormal curvature in 32 patients, bony definition in 14 patients, and additional findings, including surgical instrumentation, in 17 patients . These findings confirm our hypothesis that the 3-d vr series, including the translucent display, is of additional benefit in the assessment of abnormal spinal curvature in patients treated at a major cancer center . As not all patients had abnormalities in each of the 3 categories, that is, surgical instrumentation, the percentage of cases where the 3-d vr was helpful is likely higher than what we report, further supporting our hypothesis . When reviewing an mdct study of abnormal spinal curvature, the 3-d vr series can be assessed before the 2-d orthogonal mdct study . As the spinal deformity in these patients is often out of the plane of imaging on a single, 2-d orthogonal mdct image (figures 1(a) and 2(a)), the 3-d vr sequence provides comprehensive assessment of the entire spine on a single 3-d image; this image can then be rotated and viewed from 360 degrees . In our study, we found this more beneficial in patients with a greater degree of dextroscoliotic than kyphotic curvature and more helpful for a greater degree of abnormal spinal curvature . Not only can the 3-d vr series evaluate the shape of the spine, but also aid in the detection of a rotatory component, anterolisthesis, and the apex of the curvature . In addition, with the 3-d vr series, the number of vertebral bodies can be counted in a single view; this assures that the numbering assignment will be correct if an anomalous number of spinal segments are present . This is more difficult to determine on orthogonal 2-d mdct as the spine is often out of the plane of imaging due to the spinal curvature . The 3-d vr series can also evaluate the vertebral bodies for evidence of dysplasia, fracture, or bony destruction . Previous authors [1012] have demonstrated that ct is better than plain radiographs for the evaluation of spine abnormalities . State that when a complex osseous deformity is present, radiographs are inadequate for complete evaluation and the use of ct is mandatory, especially when surgery is planned . Our result takes this evaluation as a step further and demonstrate that the 3-d vr series would benefit 2-d orthogonal mdct in the evaluation of vertebral anomalies as the 14 studies scored a helpful rating in the evaluation of the bony structures, including 4 cases with prior surgical bony fusion . In the post - operative patient, the 3-d vr series with translucent display may be used to assess surgical instrumentation . This technique allows the visualization of the instrumentation through the bone and can also be rotated and viewed in 360 degrees, including in oblique planes . As the surgical instrumentation is visualized as one component on a single image, and the position and integrity of support rods and pedicular screws are assessed, coloring of the spinal instrumentation is also possible (figure 2(d)). In every case with surgical instrumentation in our study, in fact, our referring spine surgeons insist on inclusion of the 3-d vr series for the evaluation of the spine and the transparent display for a comprehensive overview of the surgical instrumentation . Further study can be undertaken to determine if the 3-d vr series with translucent display can be used to evaluate surgical instrumentation following spinal surgery in the general population with an abnormal spinal curvature and to evaluate associated complications . As recent advances in mdct technology have led to a significant reduction in streak artifact related to metallic hardware [13, 14]. Mdct with vr series may lead to better evaluation of the postoperative spine and possibly easier detection of complications . It should be noted, though, that the interpreting radiologist must be careful not to mistake streak artifact that extends through the surgical instrumentation of the breakage of hardware . The purpose of this study was to determine if the 3-d vr images provide additional information to the orthogonal 2-d mdct dataset and the results support our hypothesis . We are not suggesting that 3-d vr can replace the orthogonal 2-d mdct; rather 3-d vr is complementary . One limitation of the study is that this is a very select group of patients, mainly those presenting for treatment of their disease to a major cancer center . Computed tomography has been described in the measurement of scoliosis, including the rotatory component [1519]. Further study will be necessary to determine if the 3-d vr series can be for evaluation and measurement of abnormal curvature in the general population, including for idiopathic scoliosis . One negative aspect of mdct is that patients are imaged in the recumbent position and the use of ionizing radiation . The downside of patient positioning also applies to the reconstructed 3-d vr series; however, no addition radiation is necessary for computer generation of the 3-d vr series or the translucent display . Herein, we have illustrated the added benefit of 3-d vr imaging and the translucent display to axial and 2-d orthogonal mdct imaging of the spine for the evaluation of abnormal spinal curvature among patients at a major cancer center . Failure to recognize the etiology of spinal curvature, such as syndromic deformities, fractures, or malignancies of the spine, can affect treatment and management outcomes for patients . The translucent display series provides a more comprehensive evaluation of surgical instrumentation following correction of an abnormal spinal curvature or resection of malignancy . It is, therefore, beneficial for spine surgeons and radiologists involved in the care of patients with abnormal spinal curvature to be aware of the benefits of the 3-d vr series and the translucent display.
In response to the changing needs of the community, dental practice is subject to constant changes . These changes, in turn, influence patient expectations from dentists . To successfully serve the community as a health care professional, dentists must be competent not only in their clinical practice, but also in some non - clinical aspects of their practice . Previous studies in the united states, france, the netherlands, and mexico have shown some deficiencies in non - clinical competencies including legal and financial performance, time and quality management, occupational health and practice organization among dentists and dental students . In order to improve non - clinical competencies of dentists, various approaches have been implemented such as holding educational courses for dental students, revision of dental curricula [810] and holding continuing education programs for dentists . Dentists in iran are trained based on a national dental curriculum focusing mainly on clinical competencies, with no specific course on non - clinical domains such as professional health, communication skills, practice management or evidence - based dentistry . Moreover, the discipline - based nature of the curriculum acts as a barrier against integrated and comprehensive education . Although the revised national curriculum debuted in 2012 attempts to cover some of the above - mentioned deficiencies, some problems still remain among the practicing dentists . This calls for specific courses in the form of continuing education programs in order to make dentists competent in non - clinical domains of dental practice . In the current study, we designed, implemented and evaluated the efficacy of a comprehensive course on non - clinical competencies that dentists must possess for a successful dental practice . This interventional study with a before - after design was performed in the school of dentistry, tehran university of medical sciences in 2010 . First, in an expert panel of five academic staff members and five general practitioners, the topics for a course on successful dental practice were derived through a nominal group technique . Based on the consensus of the participants, 12 topics were chosen that are not covered by the national dental curriculum either partially or completely and there was a need for complementary or continuing education courses on them . The course plans for the 12 topics (table 1) were designed by the expert panel members in the form of a two - day course . The derived topics and the subheadings of the two - day educational course on successful dental practice for dentists in order to acquire an adequate sample, three different sampling approaches were implemented . First, a short message introducing the program was sent to 1000 randomly selected cellphone numbers of dentists practicing in tehran province . Third, the chief dental officers of tehran city informed the dentists working in health centers about this course . They were invited to participate in the program, which was conducted in january 2010, at the school of dentistry, tehran university of medical sciences . Based on the derived course topics, a questionnaire was designed to assess the participants opinion about the necessity of attending the program on each topic for dentists, their self - assessed awareness of each topic and their knowledge of the course contents . Age, sex and work experience (in months) were asked as demographic information of subjects . Some questions regarding the quality and efficacy of the course were also included in the post - test questionnaire . The participants were asked to express their level of agreement with the necessity to receive training on each topic covered in the course using a five - point likert scale from 1 meaning no necessity to 5 meaning maximum necessity . The dentists were asked to report their knowledge of the course (separately for each topic) using a five - point likert scale from 1 meaning no knowledge to 5 meaning maximum knowledge . An anonymous questionnaire was administered among the participating dentists on the first day before commencement of the program as pre - test . The same questionnaire, with additional questions about the quality and efficacy of the course, was completed by the dentists at the end of the course on the second day . Each participant assigned a three - digit code to the pre - test questionnaire to be re - entered in post - test questionnaire . First, in an expert panel of five academic staff members and five general practitioners, the topics for a course on successful dental practice were derived through a nominal group technique . Based on the consensus of the participants, 12 topics were chosen that are not covered by the national dental curriculum either partially or completely and there was a need for complementary or continuing education courses on them . The course plans for the 12 topics (table 1) were designed by the expert panel members in the form of a two - day course . The derived topics and the subheadings of the two - day educational course on successful dental practice for dentists first, a short message introducing the program was sent to 1000 randomly selected cellphone numbers of dentists practicing in tehran province . Third, the chief dental officers of tehran city informed the dentists working in health centers about this course . The program was explained to the volunteer dentists . They were invited to participate in the program, which was conducted in january 2010, at the school of dentistry, tehran university of medical sciences . Based on the derived course topics, a questionnaire was designed to assess the participants opinion about the necessity of attending the program on each topic for dentists, their self - assessed awareness of each topic and their knowledge of the course contents . Age, sex and work experience (in months) were asked as demographic information of subjects . Some questions regarding the quality and efficacy of the course were also included in the post - test questionnaire . The participants were asked to express their level of agreement with the necessity to receive training on each topic covered in the course using a five - point likert scale from 1 meaning no necessity to 5 meaning maximum necessity . The dentists were asked to report their knowledge of the course (separately for each topic) using a five - point likert scale from 1 meaning no knowledge to 5 meaning maximum knowledge . An anonymous questionnaire was administered among the participating dentists on the first day before commencement of the program as pre - test . The same questionnaire, with additional questions about the quality and efficacy of the course, was completed by the dentists at the end of the course on the second day . Each participant assigned a three - digit code to the pre - test questionnaire to be re - entered in post - test questionnaire . Forty - six dentists with a mean age of 40.8 years (range 25 to 58 years) participated in this study . The mean work experience of the participants was 163.3 months (range 10 to 480 months).table 2 shows the distribution of responses regarding the necessity for training on each specified topic before and after participation in the course . As seen in table 2, at least two - thirds of the participants in both pre- and post - tests stated that they believed training on all topics was necessary (a score of 4 or 5). In terms of necessity of receiving training on each topic before the course, the highest priority was given to ergonomics and occupational health as 93.4% of the respondents gave a score of 4 or 5 to this topic . The topic with the least priority before the course was workplace design since 67.4% of the participants gave a score of 4 or 5 to this topic . After the course, the most necessary topic was reported to be management of medical emergencies (95.6% gave a score of 4 or 5), and the least necessary topic covered by the training course was documentation principles and it applications in dentistry (68.9% gave a score of 4 or 5). Before attending the course, less than 40% of the participants assessed their level of knowledge to be high (a score of 4 or 5) about 10 of the 12 topics . However, this value decreased to two topics after the course (table 3). Distribution of the responses by a group of dentists (n=46 *) regarding the necessity of training on each specified topic using a five - point likert scale from 1 (the least) to 5 (the most) before and after participation in a course on successful dental practice the maximum number of unanswered questions was 2 . Distribution of the responses by a group of dentists (n=46 *) regarding the self - assessed knowledge about each specified topic using a five - point likert scale from 1 (the least) to 5 (the most) before and after participation in a course on successful dental practice the maximum unanswered questions was 2 in pre - test and 7 in post - test . The opinion of the participants regarding the necessity of receiving training on two topics significantly changed after the course and they gave a higher priority to ergonomics and professional health and communication skills in post - test compared to the pre - test (p<0.05) (table 4). The self - assessed knowledge of the dentists improved significantly after attending the course on seven topics including the ergonomics and occupational health, workplace design, documentation principles and it application in dentistry, national rules and regulations of dental practice, medical emergencies, dental ethics and communication skills (p<0.05) (table 4). Comparison of pre- and post - teat scores of self - perceived need for education and self - assessed knowledge about each specified topic among a group of dentists (n=46) attending a course on successful dental practice wilcoxon signed - rank test regarding the quality and efficacy of the course, more than 70% of the participants were completely satisfied or satisfied with practical implication of the course, conformity of course contents with the title and course settings . Moreover, 87% of the participants completely agreed or agreed that more training in this field was required . In the present study, a course on successful dental practice was designed and its effect on self - assessed need for training and self - assessed knowledge in this regard was investigated through a before - after design . The course mainly focused on non - clinical competencies that a general dentist should possess . Designing a comprehensive course covering a wide range of topics related to successful dental practice, focusing on weaknesses of the national dental curriculum and implementing the views of the dentists as the main stakeholders in designing the course can be considered as the strengths of our study . On the other hand, lack of a control group, short - term evaluation and using a questionnaire for the course evaluation were weaknesses of our study . However, with regard to the fact that no similar course in iran or elsewhere was found, designing such a course per se was one of the main goals, which was achieved . A study aiming to explore important aspects of practice and patient management among dental residents and their views on the level of undergraduate training regarding these subjects was done in the united states . The results showed that the most important topics included time management, multidisciplinary coordination and total quality management . Respondents considered dealing with health care payers to be important to their future practices while this topic received low priority in their curriculum . Another study in france on senior dental students who had the experience of working as associates in dental offices as a part of their undergraduate training showed that the two most reported problems included time management (90%) and administrative matters (85%). A study in the netherlands on newly qualified dentists showed that the most frequently reported factors responsible for being unprepared for practice were law and insurance matters (61.2%), practice organization (56.6%) and staff management (55.2%). In our study, ergonomics and professional health received the highest priority in self - perceived educational needs expressed by dentists . This finding confirms the studies reporting the high prevalence of musculoskeletal disorders among dentists [1416] and emphasizes on providing the dentists with sufficient training in this regard, similar to previous studies [17, 18]. The second important topic according to the dentists perspectives was management of medical emergencies in the dental office . This is in line with previous studies in iran [1921] and other countries [2224] calling for more emphasis on this topic in undergraduate dental curricula and continuing education programs . Moreover, only 19.6% of the participants reported to have sufficient knowledge on this topic . More than 80% of the dentists reported insufficient knowledge about this topic and also workplace design . This shows that although the dentists rated their self - assessed knowledge as low on this topic, they gave a lower priority to further education on this topic compared to other topics . However, it should be noted that more than two - thirds of the dentists felt that there was a need for more training even on this topic . In general, these findings show the deficiency of the national dental curriculum and continuing education programs in non - clinical aspects of dental practice . In seven out of 12 topics, this increase was significant in ergonomics and professional health and communication skills, showing that the course successfully revealed the need for further education among the participants . This increase was significant for seven of the 12 topics, showing that the course in general was successful in enhancing the self - assessed knowledge of the dentists in short - term . The respondents also believed that the course was successful as most of them were satisfied with the course content and conduction . Since no similar course has been reported in previous studies, it was impossible to compare our results with those of other studies . Studies on educational interventions covering some of our topics for dental students [6,7, 25] have reported positive results in increasing the knowledge and improving the attitudes of the participants . In conclusion, a need for more training on non - clinical domains of dental practice was evident among the dentists . The designed course seemed to be successful in revealing the participants need for further education . With regard to the satisfaction rate of the attendants
To study the influence of increased worldwide dengue activity on international travelers, 2,259 patients were studied retrospectively for dengue antibodies after returning from dengue - endemic countries . A 36-month period from january 1996 to december 1998 was compared with a 27-month period from january 2002 to march 2004 . We recruited travelers who came to the travel clinic of the berlin institute of tropical medicine, germany, with fever (n = 1,091) or diarrhea without fever (n = 1,168) and for whom serum samples were available . Thus, 2,259 patients' serum samples were tested for anti - dengue igm and igg by using an igm - capture elisa and an igg indirect elisa (panbio pty ltd ., a probable acute infection was defined according to manufacturer's instruction as having a sample: calibrator absorbance ratio of igm 1.0 . Acute probable primary infection was characterized by the elevation of igm 1.0 with igg 4.0, and acute secondary infection was characterized by the elevation of igg 4.0 (13). For a more specific diagnosis, all serum samples from patients with probable dengue infections were then investigated by using e / m and nonstructural protein ns1 serotype - specific igm elisas and ns1 serotype - specific igg elisa as described previously (11,12). Furthermore, an additional confirmatory testing was performed by using immunofluorescence assays (euroimmun ag, luebeck, germany), and if these results were contrary, sera collected during the acute phase of illness were processed by using polymerase chain reaction assays to detect viral nucleic acid . Among the recruited patients, 1,163 (51.5%) antibodies were detected by the screening test in 127 (5.6%) serum samples, indicating probable acute dengue infection . The more specific analysis confirmed infection in 64 cases (2.8% prevalence), including 8 (12.5%) patients with secondary immune response . One of these 8 secondary and none of the 56 primary infections led clinically to dhf . Among 1,091 patients with fever and 1,168 diarrhea patients without fever, 51 (4.7%) and 13 (1.1%), respectively, had an acute dengue infection . The highest prevalence of dengue antibodies (4.6%), indicating acute infection, was found in patients returning from asia (n = 1,020) (table 1), including southeast asia (7.4% of 500 total travelers and 11% of 310 febrile travelers) and the indian subcontinent (1.8%). Traveling in southeast asia was associated with a significantly higher risk compared to other disease - endemic areas in africa and latin america (odds ratio 5.3, 95% confidence interval 3.29.0). Comparing patients with and without acute dengue infection, no significant difference was seen in the median length of travel (28 vs. 24 days, respectively, p = 0.083, mann - whitney test) or the median age of the patients (32 vs. 33 years, respectively, p = 0.58, mann - whitney test). Patients 3044 years of age had the highest antibody prevalence (37 [3.8%] of 966). * four patients are not included in this analysis since they traveled to> 1 continent . When patients from 1996 to 1998 (n = 1,073) were compared with those from 2002 to 2004 (n = 1,186), a slight increase was seen in the overall prevalence, from 2.7% to 3.0%, although this finding was not significant (p = 0.63). The figure shows annual dengue prevalence among travelers to thailand and to the indian subcontinent, highlighting that infection rates fluctuate strongly between years and between quarters within years . In the last quarter of 1997 and 1998, 64 travelers returned from thailand, and 14 (22%) acquired an acute dengue infection . Among those, 5 were infected by the serotype denv-1, 3 by denv-2, and 4 by denv-3 (table 2). In 2 cases lines indicate acute dengue infection after returning from thailand (n = 223) or from the indian subcontinent (n = 495), both with and without fever, and in the total febrile population returning from all travel destinations (n = 1,091). In this study population, 4.7% of all febrile patients returning from different areas of the tropics had dengue antibodies that indicated acute infection . This number underlines the effect on international travelers to dengue - endemic areas . As long as no dengue vaccine is commercially available, among patients without fever, 13 (1.1%) had detectable dengue antibodies compatible with acute dengue infection, which underscores that symptoms commonly associated with dengue, such as fever, myalgia, arthralgia, and exanthema, are helpful for diagnosis when present, but the absence of typical symptoms does not exclude infection . A study on 483 cases of imported dengue infections in europe showed that dhf developed in 2.7% of the patients; immigrants from dengue - endemic countries returning to europe after visiting their home country were at higher risk for more severe disease than europeans (9). However, immigrants from dengue - endemic countries have a higher prevalence of dengue antibodies from previous infections . In our population, all 54 patients with primary dengue infection had classical dengue fever, and 1 of 8 patients with secondary dengue infection had dhf . The patient with dhf was born in sri lanka and immigrated to germany 2 decades ago . These observations might be taken as more evidence for the importance of letting patients know that they have been infected with dengue and should, therefore, protect themselves from infection with subsequent serotypes . Fluctuations in prevalence between years, especially the maximal prevalence in 1998, correspond to similar observations on record . In a study conducted among israeli travelers to southeast asia from 1994 to 1998, a sharp increase in incidence was noted in 1998 compared with previous years (14). Similar to the worldwide increase of cases reported to the world health organization, the number of swedish travelers returning from southeast asia with dengue fever was considerably higher in 1998 than during previous years (3). Decreasing resources for vectorborne infectious disease prevention and control (15) might have contributed to this epidemic in southeast asia, which followed the economic crisis in 1997 . The risk among a cohort of dutch short - term travelers to dengue - endemic areas in asia from 1991 to 1992 showed marked seasonal variation for the indian subcontinent (7). In our population, such seasonal variations were not detectable . The infection rates were more influenced by major outbreaks, such as the one in india in 2003 or in southeast asia in 1997 to 1998 . Similar findings have been described for israeli travelers during their trip to thailand in 1998 (14) and in german travelers to brazil and thailand in 2001 and 2002, respectively (4). To screen our samples, elisa - based tests for igm and igg igm elisas had a sensitivity of 100% in primary infections and 99% in secondary infections . The specificity was 100% in non - flavivirus infections and 80% in japanese encephalitis virus infections when an igg sample: calibrator absorbance ratio of 3.0 was used as a cutoff (13). However, because our study was retrospective, only single serum samples were available from each traveler . To increase specificity, all serum samples that indicated probable infections were further investigated with more specific elisa techniques . By using virus - infected culture supernatants as the source of viral antigens, the e / m - specific capture igm has been found to differentiate reliably between japanese encephalitis, dengue, west nile virus, and yellow fever (12). Furthermore, an ns1 isotype- and serotype - specific elisa can reliably differentiate japanese encephalitis virus infection, japanese encephalitis virus vaccination, and primary and secondary dengue virus infection (11). In primary infection, igm is detectable 38 days from the onset of symptoms (8); thus, some of our travelers might have had false - negative test results if samples were taken during the acute phase of illness . Therefore, the true infection rates in our study might have been higher than the numbers indicated by single - sample serology . Overall, we demonstrated an almost stable rate of dengue infections among berlin institute of tropical medicine patients returning from all tropical regions when recent years are compared with the mid-1990s . Large outbreaks like those in 19971998 in southeast asia (especially thailand) and 2003 in major cities of india, all popular tourist destinations, contributed to the numbers . Quarterly and annual fluctuations might lead to misinterpretation of probable trends if data are derived only from short - term observations . In addition, this variability underscores the importance of tourists' seeking information before traveling to dengue - endemic areas.
A 55-year - old, postmenopausal woman was presented to the emergency department with a chief complaint of left lower quadrant pain, constipation, anorexia, nausea and vomiting of 4 days duration . Her medications included calcium, vitamin d, acetaminophen, glucosamine, and chondroitin sulfate . On physical examination, she had a pulse of 113/min, blood pressure of 108/72 mmhg, respiratory rate of 18/min, and temperature of 37c . Laboratory studies included wbc 18,700/l with 89.6% granulocytes, hemoglobin 13.4 g / dl, and platelet count 234,000/l . The glucose, electrolytes, bicarbonate, lactate, and renal and liver function tests were all within normal limits . Ct scan of the abdomen and pelvis with oral and intravenous contrast showed abundant stool in the colon, particularly in the sigmoid colon with surrounding extensive infiltrative changes, wall thickening, and 6.5 cm dilation of the colon (fig . 2). Image depicting large fecal load, sigmoid wall thickening and extensive peri - colonic infiltrative change . Magnified image depicting a single focus of free air within the peritoneal cavity indicative of perforation . The patient was admitted to the medical service and given intravenous fluids, ciprofloxacin, and metronidazole . Oral colace and, she complained of severe abdominal pain and had diffuse abdominal tenderness with rebound tenderness and further abdominal distension . Surgical consultation was obtained and an emergent exploratory laparotomy was performed which revealed extensive fecal peritonitis . The peritoneal cavity was thoroughly lavaged and a hartmann procedure was performed with resection of the perforated sigmoid colon, creation of a proximal end colostomy, and closure of the rectal stump . The resected specimen was sent to the pathology department and peritoneal fluid was sent for cultures . Green exudate and multiple adhesions . Gross examination showed a 2.0-cm perforation, which was 5.5 cm from one resection margin . A mucosal ulceration with an overlying fecaloma (hard localized accumulation of stool) was seen around the perforation . The mucosal surface of the colon also showed prominent pink tan to red, congested circular folds and there were multiple diverticula . Microscopic examination showed a perforation of the colonic wall with mucosal necrosis, acute and chronic inflammation and granulation tissue (fig . 3). Hematoxylin and eosin staining of colonic biopsy specimen showing acute and chronic inflammation . The culture of the peritoneal fluid was positive for extended - spectrum beta - lactamase negative escherichia coli sensitive to cephalosporins and carbapenems . Her postoperative course was complicated by hospital - acquired pneumonia, which was successfully treated with intravenous cefepime . Stercoral perforation of the colon was initially described by berry in 1894 (9). However, it was the cause of 3.2% of colonic perforations in one series (1) and present in 2.2% of randomly selected autopsy examinations (10). Cases of stercoral perforation of the colon are likely both under - reported and are often not recognized . With an aging population and an increase in life expectancy, there are many people who survive with debilitating conditions . Sick elderly people, bed bound or minimally active, who are on multiple medications that affect bowel motility are prone to constipation . Long - standing constipation and fecaloma formation in the distal colon exert persistent pressure over the bowel wall leading to ischemic necrosis of the colonic mucosa and ultimately stercoral perforation (1, 2). Old age, chronic constipation, abnormal bowel motility, and increased intraluminal colonic pressure underlie the pathogenesis of both stercoral colitis and diverticular diseases (1, 2, 7, 8). Despite some similarities in pathogenesis, the ability to differentiate the cause of perforation in a patient with both of these entities has not been addressed . Both stercoral perforation and diverticular disease commonly occur in the sigmoid colon because this is the narrowest portion of the large intestine and stool gets progressively more dehydrated as water gets absorbed along the colon . These factors all contribute to significantly increased intraluminal pressure in the sigmoid colon (1, 2, 7, 8)., they exert prolonged localized pressure and compromise microcirculation of the bowel wall, particularly over the antimesenteric aspect where the blood supply is poor . These events culminate in stercoral ulcer formation and perforation (1, 2). The clinical presentation of stercoral perforation and diverticulitis with or without perforation can be similar (14, 11). Stercoral perforation of the sigmoid colon usually presents with features of diffuse peritonitis and pneumoperitoneum (4) but can present with localized peritonitis (1720%) (1, 2) and can masquerade as diverticulitis or diverticular perforation (5). Signs of hollow viscus perforation mandate urgent exploratory laparotomy regardless of the cause; however, identifying the cause of localized peritonitis guides appropriate management . In contrast to diverticular perforations, stercoral perforations present with the proximal colon loaded with multiple fecalomas (63%). Inflammatory and necrotic process involves a longer segment of colon beyond the area of perforation . The perforations can be multiple (2128%) (1, 2). In selected cases of perforated diverticulitis, medical management or however, stercoral perforation mandates immediate surgical intervention (1, 2). In a patient with history of constipation, local or generalized peritonitis, palpable abdominal mass, stool impaction on rectal examination, pneumoperitoneum, fecal loading, or calcified feces on abdominal radiograph ct scan findings of fecal impaction or fecaloma, focal thickening of colonic wall, stranding of pericolonic fat, and presence of extraluminal gas bubbles or an abscess can assist in the preoperative diagnosis of stercoral perforation with the latter three findings absent in simple fecal impaction (3). The intraoperative findings include generalized peritonitis, fecaloma formation, colonic dilatation, edema of adjacent bowel wall, and ulcerations on the antimesenteric border usually measuring 110 cm, which are occasionally multiple (2128%). If frank perforation occurs, fecal material is found within the peritoneal cavity in close proximity to the perforation site (1, 2). Histopathological findings include ischemic necrosis and nonspecific inflammatory changes (1, 2, 10). Surgical management of stercoral perforation includes open laparotomy, massive peritoneal lavage, and hartmann's procedure with colostomy or segmental resection with primary anastomosis and diverting colostomy . The latter can be performed in patients with limited intraperitoneal septic condition and acceptable general condition and has the advantage of simple closure of diverting colostomy in future (1, 4, 17). In patients with stercoral perforation of colon, additional stercoral ulcers initially not visible may extend over a large colonic segment, bearing the risk of second perforation (1). Substantial colonic dilation and the presence of multiple fecalomas may indicate additional stercoral ulcers (1). In fact, stercoral perforation has been reported to recur proximal to an end colostomy (18). Therefore, the management of the proximal colon should be a definitive part of the operative management (2). Intraoperatively, colon disimpaction, colonoscopy, identification of additional stercoral ulcers, and removal of entire pathologically altered or dilated colon segments may avoid second perforation and further complications . Treatment of intra - abdominal sepsis can be achieved by massive peritoneal lavage, perforation control, and institution of broad - spectrum intravenous antibiotics . Peritoneal fluid culture in stercoral perforation is positive for gram - negative and anaerobic organism (e.g., e. coli, enteroccocus faecalis, and b. fragilis), so patients should at least be treated with antibiotics effective against these organisms (4). A favorable outcome in the treatment of stercoral perforation depends on adequate resuscitation, generous removal of all diseased colonic tissue, extensive peritoneal lavage, aggressive therapy to counteract peritonitis, including broad - spectrum antibiotics, and appropriate treatment of any comorbid medical condition (4). Most importantly, fecaloma may be present for months to years, before they cause complications (2), hence, chronic constipation and fecal impaction should be managed timely and adequately to avoid potential life - threatening complications . High index of suspicion is needed to diagnose stercoral perforation of the colon in patients presenting with localized or generalized peritonitis . Early recognition of stercoral perforation in patients with concomitant diverticular diseases is important as it can help the physician to decide the appropriate treatment plan . The authors have not received any funding or benefits from industry or elsewhere to conduct this study.
We retrospectively analyzed the outcomes of 19 patients (mean age, 67.9 years; 2 men and 17 women) who were treated using the scd method for a lumbar spinal stenosis with degenerative spondylolisthesis from 2010 to 2013 . The average follow - up period was 37 months (range, 25 to 56 months). All patients had radiating pain and neurologic intermittent claudication (nic) due to a spinal stenosis . Magnetic resonance imaging showed central and lateral recess stenosis at the degenerative spondylolisthesis site in all patients . From 2010 to 2013, there was one patient with meyerding grade ii spondylolisthesis and no patient with meyerding grade iii spondylolisthesis . The follow - up period of patients with meyerding grade ii spondylolisthesis was too short (5 months). Single - level degenerative spondylolisthesis was observed at l4 on 5 in 13 of 19 patients, l3 on 4 in four patients, and l5 on s1 in one patient . Double - level degenerative spondylolisthesis was observed at l3 on 4 and l4 on 5 in one patient . No instability was detected on a preoperative lumbar spine dynamic (flexion / extension) radiological study . A median skin excision was used, soft tissue was detached, and the supraspinous ligament was detached from the spinous process, and moved to the side with multifidus muscle . The inferior one - quarter of the upper - level vertebral spinous process was removed, if needed, to enhance vision . The ligamentum flavum was detached from the inferior one - third of the lamina using a currette . After thinning the lamina with a high speed burr, a partial laminectomy was performed using a kerrison rongeur . It is important that ligamentum flavum must not be removed before thinning the lamina with a high speed burr . By maintaining ligamentum flavum finally, the total ligamentum flavum was removed en - bloc by detaching the ligamentum flavum from the inner side of the lamina to the inner side of the posterior facet (figs . 1 and 2). The detached supraspinous ligament was returned to its original position, and sutured with surrounding fascia . Ambulation was permitted beginning on postoperative day 1, and patients were encouraged to use a corset for 6 weeks . Preoperative and postoperative symptom relief was estimated using the visual analogue scale (vas) score and the oswestry disability index (odi) before surgery and at follow - up days . Patients were evaluated for vas score and odi after 3, 6 month post - surgery and every 1 year subsequently . These results were used to estimate slip percentage and slip angle and assess instability and progression of lumbar degenerative spondylolisthesis . Slip percentage and slip angle we estimated dynamic slip percentage (preoperative and postoperative change in the slip percentage) and dynamic slip angle (preoperative and postoperative change in the slip angle), and analyzed the occurrence of vertebral instability . The wilcoxon signed - rank test was performed to detect postoperative changes using ibm spss ver . A median skin excision was used, soft tissue was detached, and the supraspinous ligament was detached from the spinous process, and moved to the side with multifidus muscle . The inferior one - quarter of the upper - level vertebral spinous process was removed, if needed, to enhance vision . The ligamentum flavum was detached from the inferior one - third of the lamina using a currette . After thinning the lamina with a high speed burr, a partial laminectomy was performed using a kerrison rongeur . It is important that ligamentum flavum must not be removed before thinning the lamina with a high speed burr . By maintaining ligamentum flavum finally, the total ligamentum flavum was removed en - bloc by detaching the ligamentum flavum from the inner side of the lamina to the inner side of the posterior facet (figs . 1 and 2). The detached supraspinous ligament was returned to its original position, and sutured with surrounding fascia . Ambulation was permitted beginning on postoperative day 1, and patients were encouraged to use a corset for 6 weeks . Preoperative and postoperative symptom relief was estimated using the visual analogue scale (vas) score and the oswestry disability index (odi) before surgery and at follow - up days . Patients were evaluated for vas score and odi after 3, 6 month post - surgery and every 1 year subsequently . These results were used to estimate slip percentage and slip angle and assess instability and progression of lumbar degenerative spondylolisthesis . Slip percentage and slip angle we estimated dynamic slip percentage (preoperative and postoperative change in the slip percentage) and dynamic slip angle (preoperative and postoperative change in the slip angle), and analyzed the occurrence of vertebral instability . The wilcoxon signed - rank test was performed to detect postoperative changes using ibm spss ver . 21.0 (ibm co., armonk, ny, usa). A p - value the mean vas score of back pain decreased from 6.3 to 4.3, and the mean vas score for lower leg radiating pain also decreased from 8.3 to 2.5 (p <0.01). The average odi score (maximum, 45 points) improved significantly from 25.3 preoperatively to 10.3 postoperatively (p <0.01). The change in slip percentage increased from 10% to 12.2% postoperatively, but the difference was not significant . The dynamic slip percentage did not show significant change postoperatively (5.2% vs. 5.8%). Slip angle in the scd group also did not change (3.2 vs. 3.6) at the last follow - up . The mean vas score of back pain decreased from 6.3 to 4.3, and the mean vas score for lower leg radiating pain also decreased from 8.3 to 2.5 (p <0.01). The average odi score (maximum, 45 points) improved significantly from 25.3 preoperatively to 10.3 postoperatively (p <0.01). The change in slip percentage increased from 10% to 12.2% postoperatively, but the difference was not significant . The dynamic slip percentage did not show significant change postoperatively (5.2% vs. 5.8%). Slip angle in the scd group also did not change (3.2 vs. 3.6) at the last follow - up . Newman and stone8) described degenerative spondylolisthesis as a disease in which a vertebral body slips anteriorly with no neural arch abnormality . Degenerative spondylolisthesis tends to be accompanied by spinal stenosis, and typically shows degeneration of the posterior facet or intervertebral disc, and ligament laxity . So far, decompression with fusion is reportedly better than decompression - only surgery.91011) in particular, a broad range of decompression techniques lead to poor outcomes, as compared to decompression with fusion.12) according to the spinal degeneration theory suggested by kirkaldy - willis, spinal segment stability is maintained in patients with degenerative spondylolisthesis,1314) and good surgical outcomes occur if sufficient decompression is performed preserving structures that affect posterior spinal stability . Thus, studies on decompression - only surgery with minimal excision to treat patients with degenerative spondylolisthesis were recently conducted . Weiner et al.5) reported a surgical procedure that restores the native position of the spinous process after a spinous process osteotomy and decompression to maintain stability by preserving the interspinous and supraspinous ligaments . Recently, various techniques using unilateral approach and bilateral decompression have been used in an attempt to minimize postoperative vertebral instability.67) the scd technique has been introduced to prevent postoperative vertebral instability.15) collectively, ours and previous results suggested that scd technique could be applied for treatment of degenerative spondylolisthesis without instability and also for spondylolisthesis with instability preoperatively . If spinal segment stability is maintained postoperatively and sufficient decompression is achieved, surgical effect is well maintained . We carried out another study on the effect of scd technique for spondylolisthesis with segmental instability . The follow - up period was short yet, studies to evaluate the effect of scd technique for spondylolisthesis with instability after sufficient follow - up period are currently ongoing . Anatomical research about ligamentum flavum by okuda et al.16) suggested that ligamentum flavum degenerate, ossify, and calcify in patients with degenerative spondylosis, and that these changes are more severe if spondylolisthesis is present . Another research by okuda et al.17) showed that nerve root compression is most severe in the proximal portion of the ligamentum flavum because the ligamentum flavum is thickest in this area (fig . The proximal border of the ligamentum flavum is attached to upper level vertebra at the inner surface of lamina almost horizontally and just below the pedicle; thus nerve root is compressed continuously when the ligamentum flavum is not completely removed.17) however, we can determine whether decompression is sufficient by observing the ligamentum flavum removed by en - bloc resection . Zander et al.18) reported that a unilateral medial hemifacetectomy can induce vertebral instability, and hamasaki et al.19) reported that a bilateral medial facetectomy for the medial one - third of the posterior facet could induce vertebral instability . Actually, in patients who have spinal stenosis with degenerative spondylolisthesis, cause of nerve root compression is ligamentum flavum hypertrophy at lateral recess, and facet hypertrophy is not cause of nerve root compression . So medial facetectomy is unnecessary for decompression of nerve root, and scd technique can decompress nerve root sufficiently, maintaining spinal segmental stability . In addition, abumi et al.20) conducted a biomechanical study demonstrating that spinal instability does not develop when the posterior facet is preserved with only the interspinous and supraspinous ligaments detached . According to these studies, the scd technique, which decompress posteriorly by total excision of the ligamentum flavum with preservation of the supraspinous ligament and posterior facet, improves clinical outcomes and does not lead to spinal instability . Thus, the scd technique can be applied to patients who have a spinal stenosis with degenerative spondylolisthesis (fig . Slip angle, we demonstrated that decompression through a total ligamentum flavectomy preserving the facet joint results in clinical improvement without causing vertebral instability . The limitation of scd technique is that this technique is not suitable for bilateral foraminal stenosis . There has been consensus that posterior lumbar interbody fusion is suitable for treatment of bilateral foraminal stenosis . However, the spinal stenosis with degenerative spondylolisthesis and unilateral foraminal stenosis can be treated using scd technique and lateral fenestration technique simultaneously . Hence, degenerative spondylolisthesis without foraminal stenosis, in which especially nic is main symptom, is an absolute indication for scd, and degenerative spondylolisthesis with unilateral foraminal stenosis is a relative indication for scd . Decompression alone can reduce preoperative back pain but some preoperative back pain remains because it usually results from degeneration of facet joint degeneration or intervertebral disc . Long term follow - up observations to assess instability and radiological exacerbations of spondylolisthesis are needed . Although a prospective randomized controlled clinical study is needed, our results showed that decompression surgery using the scd technique was effective and less invasive for patients with spinal stenosis and degenerative spondylolisthesis . In conclusion, the scd technique, which decompress posteriorly by en - bloc total ligamentum flavectomy and preserve posterior facet, was clinically effective and does not lead to postoperative spinal instability.
In the last two decades, a large research effort has been devoted to quantum dots (qds), the quantum wires, qd chains, nanoholes and pits [1 - 8] due to their modified density of states, fascinating optoelectronic properties and device applications for lasers, photodetectors and other electronic devices . Among quantum dots, pits and wires fabrication techniques, the self - organized stranski krastanow method is an important one by which dislocation - free dots, elongated islands and wires can be produced . Indeed, above a certain critical thickness, the growth mode switches from the conventional layer - by - layer (i.e., two - dimensional, 2d) to a 3d growth mode due to the accumulation of the elastic energy in the strained layer that, first, partially relaxes by spontaneously nucleating small islands of strained material and, later, by creating misfit dislocations . The elastic strain caused by lattice mismatch can also be relaxed by the formation of undulations, pits and their combination [5 - 8]. Depending on the growth conditions, the elastic strain can be relaxed by the formation of either quantum wires and quantum dots, or even unique island extensive experimental results suggest that surface morphologies are relying on growth conditions and matrix materials . On the basis of an atomistic model, it is shown that the energy change due to the step formation is negative or positive depending upon the sign of the misfit . The step formation energy can even be negative for compressive misfit stress in the heterolayer, while it is definitely positive for tensile misfit stress . This conclusion is in contrast to the classical model where the step energy is always positive and independent of the sign of the misfit . The step formation energy influences the critical thickness and the energy barrier for dislocation nucleation . Using a simple atomistic simulation, it is shown that the critical thickness depends upon the sign of the misfit . For example, it changes from 4 nm for ge films on si(100) substrates to 6 nm for si films on ge(100) substrates having the same misfit . The investigations of the surface morphology evolution of strained inas / gaas films at different growth conditions demonstrated that there are at least three different strain relaxation mechanisms for the same material system . That is, depending on the growth conditions, the elastic strain can be relaxed by the formation of either quantum wires or quantum dots, or even unique island pit pairs . . Both the island height and the pit depth can be much greater than the average layer thickness . This suggests that considerable mass transport from substrate into the islands is taking place during the growth . However, during heteroepitaxy, when the layer becomes sufficiently thick, the pits are eventually filled up either by the lateral overgrowth or by the expanding islands, forming nearly pure island morphology at the surface . The detailed analysis of the surface dynamics during phase transitions of gaas(100) and unusual role of the substrate at droplet - induced gaas / algaas qd pairs growth also confirm this assumption . From the industrial point of view, the narrow band gap iii v semiconductor materials like inas, gasb, insb and their ternary and quaternary alloys are particularly interesting and useful since they are potentially promising to access mid - infrared and far infrared wavelength regions . These materials would provide the next generation of leds, lasers and photodiodes for applications such as infrared gas sensors, for molecular spectroscopy, thermal imaging, photovoltaic (pv) and thermo - photovoltaic cells (tpv). The application of the inassbp and other similar quaternary materials opens up interesting physical and technological prospects for the dirigible growth of qds, the pits and dots pits cooperative systems . Independent variations of the third and fourth components provide corresponding sign of the misfit; i.e., providing the tensile or compressive misfit stress . At the first case, elastic strain will be relaxed by the formation of qds, but at the second one by the pits . In this article, an example of inassbp quaternary qds, the pits and dots pits cooperative structure growth on inas(100) substrates by lpe, as well as the interaction and surface morphology of the dots pits combinations are presented and investigated . The samples are grown by lpe using a slide - boat crucible . To ensure a high purity of the epitaxial layers, the inas(100) substrates have a 11 mm diameter are undoped, with a background electron concentration of n = 2 10 cm . The inas0,742 sb0,08 p0,178 quaternary alloy used here as basis composite is conveniently lattice - matched to inas . The lpe growth solution components undoped inas, undoped inp and sb (6 n) are solved in a in (7 n) solution that has been first homogenized for 1 h at t = 580 c and then 3 h at the initial growth temperature of t = 550 c to equilibrate the system thermodynamically . To expect the strain - induced qds and pits formation, the undoped and supersaturated by antimony and phosphorus liquid phase was used to provide a different sign of lattice mismatch up to 4% between the inas substrate and inassbp epilayer . To initiate the growth of qds and pits, an oversaturation of the liquid phase is developed by decreasing the initial growth temperature up to 2 c at the slower ramp rate . The high - resolution scanning electron microscope (sem - edxa fei nova 600dual beam) is used to study the strain - induced inassbp qds 1) that the pits (large and small) like the islands primarily formed into truncated reverse pyramids . The edxa measurements shown that, at first, either islands or pits edges have a quaternary composition and that on average, they are enriched by antimony and by phosphorus, respectively . In our inassbp quaternary experimental system, the nucleation mechanism of qds and the exposure of wetting layer (and inas substrate) at pits are quite interesting, but very complicated for explanation result . From a physical perspective, we have assumed that simultaneous nucleation of the islands and pits are occurring due to variable curvature (the tensile or compressive local perturbations) of the wetting layer . We suggest that at the perturbed sites, the wetting layer surface is strained, and the depositing material will prefer not to remain at these sites, but rather diffuse away . After that occurs, the strain relaxation is performed at the adatoms (sb and p) surface diffusion in opposite directions, leaving behind the islands and the pits on the surface . In this scenario, corners or edges of the pits and islands are the most preferred sites to attach newly deposited materials, because at these regions, the strain energy is most relieved . The islands (or pits) at these relaxed regions will grow rapidly at the expense of the material around the pits (or dots). The fact that the large pits are deeper (up to 100 nm and more) than the wetting layer thickness implies that the arsenic atoms are also pumped out from the substrate and probably replaced by the phosphorus atoms . The similar cooperative nucleation of the dots pits pairs was detected at the growth of inas qds on gaas substrate, gaas / algaas qd pairs and at the growth of in 0.53 ga0.47 as layers on inp(001) substrate . The effect of island density on pit nucleation in in0.27 ga0.73 as films grown on gaas(001) substrate is discussed in . Large pits banded by the quantum wires in order to be confident, we calculated the gibbs free energy of inassbp quaternary alloy, as well as separately of inas - insb, inas - inp and insb - inp ternary alloys . We found that at t = 550 c (our growth temperature), the gibbs energy has the minimal value at x = 0.39 for inas1xsbx and at y = 0.52 for inas1ypy alloys . Otherwise, for the insb1zpz ternary alloy at the same temperature, the sufficiently wide immiscibility gap is exist at 0.05 <z <0.97 . In this concentration range, the gibbs energy increases (from the both sides) and the mixing of these binary compounds becomes energetically not preferable . This result marginally proves our assumption that at the nucleation of inassbp quaternary dots and pits, the surface diffusion of the antimony and phosphorus in opposite direction has to be energetically more preferable . In addition, note that with the increasing of the liquid phase initial concentration, the islands and pits shape transformation from the truncated pyramids to ellipsoidal and globe shape was detected . Figure 2a displays the sem and afm images of the inassbp unencapsulated dots pits cooperative structure in plain view for the surface area of s = 4 m . In this figure the qds and pits are clearly visible and quite uniformly distributed over the substrate surface . Figures 1b, 1c and 2b2d show that cooperative nucleation of the dots pits structures is occurring . In pits are banded by quantum wires and that the qds are banded by pits (in the form of nano - camomile). B, c and d enlarged view of the mentioned by red, blue and green ovals related regions . White ovals qds, black ovals pits our statistical explorations show that the small qds average density ranges from 0.8 to 2 10 cm, with heights and widths dimensions from 2 to 20 nm and 5 to 45 nm, respectively . The average density of the small pits is equal to (610) 10 cm with dimensions of 540 nm in width and depth . Surface density of the large dots and pits is less by almost on two orders of magnitude . Small qds and pit amount, and surface density versus their average diameter calculated from the surface of s = 4 m is detected and displayed in fig . Dependence of the inassbp strain - induced qds and pits amount (a, b) and surface density (c, d) versus their average diameter (s = 4 m). Slezov approximations we used the fourier transform infrared spectrometry (ftir nicolet / nexus) to investigate the transmission spectra (see fig . 4) of an unencapsulated inassbp dots pits cooperative structure at room temperature . As a test sample the result shows the displacement of the absorption edge toward the long wavelength region from = 3.44 m (for test sample) to = 3.85 m, as well as the enlargement of the absorption spectrum up to = 2.75 m short wavelength region . We assume that this effect is the result of the absorption by the qds through the permitted energy sub - band . Pits cooperative structure grown on inas(100) substrate schematic diagram showing the type ii inassbp / inas qds is presented in fig . 1 . Whereis the planck constant, is the light holes effective mass, is the average diameter of qds andis the integer . The similar approach was applied in . For our experimental system (at light holes confinements), (at), (at), sub - band depth . Numerical value for the light holes effective mass for our inas1xysbxpy quaternary system was calculated by the linear approximation of the corresponding values for binary compounds at x = 0.04 and y = 0.08 . Schematic view of the zone diagram showing the type ii inassbp / inas qds pits cooperative structure . Numerical values for b, c, d and e energies are approximate and based on ftir measurements and calculations finally, note that at the growth of diode heterostructures with the quantum dots and pits inside p n junction spatial charge region, the main challenge to overcome is providing the lateral overgrowth of the pits (providing reverse qds) and keeping the dots size during epitaxy of the cap epilayer . We assume that by using step - cooling lpe, the growth of the cap epilayer from the strongly cooled liquid phase will address this problem . Thus, we have presented an example of the inassbp quaternary qds, pits and dots pits cooperative structures growth on the inas(100) substrates by lpe . The interaction and surface morphology of the dots pits combinations were investigated . Lifshits slezov - like distribution for the amount and surface density of small qds, and pits versus their average diameter was experimentally detected . Application of the inassbp and other similar quaternary materials opens up interesting physical and technological prospects for the dirigible growth of qds, pits and dots pits cooperative systems . By the corresponding and independent variations of the v - group elements concentrations, the results of our study can be also used for producing controlled arrays of strain - induced qds, which is very important for the fabrication of wide - band photodiodes, thermo - photovoltaic cells and other inas - based mid - infrared devices . This work was carried out in the frame of armenian national governmental program for nano - electronics and istc grant a1232 . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
Combinations of dental and skeletal factors ranging from mild to severe are multiple characters of this discrepancy . The treatment protocols for class ii can vary widely according to professional ability, time of treatment, severity of malocclusion and patient compliance . One of the recommended therapeutic approaches to class ii malocclusion in growing patients is functional jaw orthopedics for mandibular advancement . Fixed devices for sagittal advancement of the mandible can be used in association with fixed mechanotherapy and is a recent advancement . The effects of several compliance - free appliances for mandibular anterior repositioning in association with fixed appliances have been investigated . The forsus (forsus fatigue resistant device [ffrd]) is a semirigid telescoping system incorporating a superelastic nickel - titanium coil spring that can be assembled chair - side . It is compatible with complete fixed orthodontic appliances and can be incorporated into pre - existing appliances . Forsus ffrd attaches at the maxillary first molar and onto the mandibular archwire, distal to either the canine or first premolar bracket, creating a mesial force on the mandibular arch and a distal force on the maxillary arch . As the coil is compressed, opposing forces thus, the spring exerts equal and opposite forces onto the maxillary molars as well as the mandibular incisors . The intrusive force on maxillary molars can decrease posterior vertical dimension, and the intrusive force on mandibular incisors will bring about their intrusion . This appliance shows a greater range in activation and a less likelihood of breakage when compared to other inter arch compression springs . Teuscher suggested that forward and downward growth of the maxilla could be altered using headgear, and the mandible could also change its growth direction to a forward and upward position with condylar adaptation . A combination of forsus ffrd and headgear can bring about dramatic changes in the management of space deficiency and correction of class ii malocclusions . A 13-year - old male patient reported to the author's private clinic with a chief complaint of unerupted teeth in the upper front region and sought treatment for the same . Extra orally patient presented with a symmetrical face, convex profile and competent lips [figure 1]. Intraoral examination revealed class ii molar relation on both sides, deep bite, ectopically erupting and blocked out maxillary canines, upper left lateral incisor was in cross bite and crowding in the mandibular anterior teeth and insufficient space for 33 . On radiographic examination, it was observed that the patient also has a deficient and backwardly placed mandible [figure 2]. Pretreatment extraoral and intraoral photographs pretreatment lateral cephalogram and opg the following treatment objectives were established: to correct the skeletal and dental class ii malocclusion, which would include restriction of maxilla and advancement of mandibleto correct crowding in both the arches and space management for ectopically erupting canineto achieve ideal overjet and overbiteto improve his facial appearance . To correct the skeletal and dental class ii malocclusion, which would include restriction of maxilla and advancement of mandible to correct crowding in both the arches and space management for ectopically erupting canine to achieve ideal overjet and overbite to improve his facial appearance . This would help to manage space for ectopically erupting canines along with open coil spring . A fixed orthodontic appliance (mbt 0.022 3 m unitek) was initially bonded to the maxillary arch and 0.016 niti round arch wire was placed in the maxillary arch for the initial leveling and aligning phase [figure 4]. Headgear therapy was started along with orthodontic strap up to distalize molars and to restrict downward and forward growth of the maxilla [figure 3]. (a - c) leveling and aligning with 0.016 ss and creating space for ectopic canines . (g - i) finishing and detailing after sagittal correction space was created for the ectopically erupting maxillary canines using open coil niti springs, which were placed between the maxillary lateral incisors and first premolars [figure 4]. Once sufficient space was created by headgear and open coil spring, the maxillary canines were bonded and ligated to the arch wire . The ligature was activated periodically till the canines were brought into the maxillary arch . After the canines had been brought into their respective places, the maxillary arch wire was engaged into the canine brackets . The lower arch was bonded 1-month after commencement of treatment and 0.016 round niti wire was placed in the mandibular arch . The 016 round niti wires were then followed by the 019 025 rectangular niti wires . Then 0.019 0.025 rectangular stainless steel wires were placed in the upper and the lower arch . After 9 months of commencement of treatment, forsus ffrd was placed [figure 4]. The total treatment time was about 18 months with satisfactory results [figure 5]. The molar relationship was corrected from a class ii to a class i. ideal overjet, and overbite were established [figure 5]. The deep bite and cross bite were corrected along with the correction of the ectopically erupted maxillary canines . Periodontal evaluation showed acceptable gingival contour and adequate width of keratinized attached gingival tissue around the maxillary canines . A fixed retainer was bonded in the lower arch and a removable retainer with anterior bite plane was placed in the upper arch . Occlusion remained stable 2 and 3 years after the orthodontic treatment [figures 7 and 8]. Post treatment photographs post treatment lateral cephalogram and opg post retention photographs after 2 years post retention photographs after 3 years the following treatment objectives were established: to correct the skeletal and dental class ii malocclusion, which would include restriction of maxilla and advancement of mandibleto correct crowding in both the arches and space management for ectopically erupting canineto achieve ideal overjet and overbiteto improve his facial appearance . To correct the skeletal and dental class ii malocclusion, which would include restriction of maxilla and advancement of mandible to correct crowding in both the arches and space management for ectopically erupting canine to achieve ideal overjet and overbite to improve his facial appearance . This would help to manage space for ectopically erupting canines along with open coil spring . A fixed orthodontic appliance (mbt 0.022 3 m unitek) was initially bonded to the maxillary arch and 0.016 niti round arch wire was placed in the maxillary arch for the initial leveling and aligning phase [figure 4]. Headgear therapy was started along with orthodontic strap up to distalize molars and to restrict downward and forward growth of the maxilla [figure 3]. (a - c) leveling and aligning with 0.016 ss and creating space for ectopic canines . (g - i) finishing and detailing after sagittal correction space was created for the ectopically erupting maxillary canines using open coil niti springs, which were placed between the maxillary lateral incisors and first premolars [figure 4]. Once sufficient space was created by headgear and open coil spring, the maxillary canines were bonded and ligated to the arch wire . The ligature was activated periodically till the canines were brought into the maxillary arch . After the canines had been brought into their respective places, the maxillary arch wire was engaged into the canine brackets . The lower arch was bonded 1-month after commencement of treatment and 0.016 round niti wire was placed in the mandibular arch . The 016 round niti wires were then followed by the 019 025 rectangular niti wires . Then 0.019 0.025 rectangular stainless steel wires were placed in the upper and the lower arch . After 9 months of commencement of treatment, forsus ffrd was placed [figure 4]. The total treatment time was about 18 months with satisfactory results [figure 5]. The molar relationship was corrected from a class ii to a class i. ideal overjet, and overbite were established [figure 5]. The deep bite and cross bite were corrected along with the correction of the ectopically erupted maxillary canines . Periodontal evaluation showed acceptable gingival contour and adequate width of keratinized attached gingival tissue around the maxillary canines . A fixed retainer was bonded in the lower arch and a removable retainer with anterior bite plane was placed in the upper arch . Occlusion remained stable 2 and 3 years after the orthodontic treatment [figures 7 and 8]. Post treatment photographs post treatment lateral cephalogram and opg post retention photographs after 2 years post retention photographs after 3 years optimal timing for class ii treatment with fixed functional appliance is at the pubertal growth spurt with enhanced mandibular skeletal changes and minimal dentoalveolar compensation . Studies have shown that functional appliances improve the sagittal effect on the mandible by a significant overjet reduction . Skeletal changes in functional appliances are brought about by stimulation of condylar growth as well as remodeling of fossa . Besides the sagittal skeletal base improvement influencing overjet, the dentoalveolar effect on overjet is brought about by retroclination of maxillary and proclination of mandibular incisors . The use of headgear not only restricts the sagittal growth of the maxilla but also moves posterior teeth backward . However, combination of extra oral and functional appliances seem to affect the sagittal intermaxillary relationship by acting mainly on the mandibular skeletal base and also having effect on dentitions . Ruf and pancherz reported that herbst and multibracket appliance combination was found to be a powerful tool for nonsurgical nonextraction treatment of class ii div 1 subjects in early and late adulthood . As opposed to rigid fixed functional devices, the spring of the ffrd allows flexibility in the position of the mandible . Since it is fixed in the patient's mouth, the clinicians do not have to rely on a patient's cooperation . In this case, space for the alignment of ectopically erupting canines was created partly by open coil spring and partly by molar distalization . (2) distalization of maxillary molars . (3) correction of ectopically erupting canine (4) retrusion of maxillary incisors . (5) extrusion of posteriors . (6) intrusion of lower anteriors, (7) correction of overjet and overbite . The treatment results showed a balanced facial profile, good interdigitations, improvement in maxillomandibular relationship . This case report demonstrates the efficiency of the combined clinical use of headgear and forsus with fixed appliance to distalize the maxillary molar and also to advance the mandible.
Spontaneous ovarian hyperstimulation syndrome (sohss) is now a recognized entity, defined as ohss appearing in patients with no history of stimulatory infertility treatment . Ohss, which otherwise may occur in normal pregnancies (type i ohss), is now reported to be associated with mutated fsh receptor (fshr) gene, which may lead to recurrent sohss in patients presenting the mutations . Type ii is secondary to high levels of human chorionic gonadotropin (hcg), while type iii coexists with hypothyroidism . A 29-year - old female married since 1 year, primigravida with 3 months amenorrhea and ultrasonographic gestational age of 8 weeks and 5 days, presented with acute onset of abdominal distension, vulval edema and breathlessness . There was no vomiting, trauma, fever, bleeding, or spotting per vaginum . She had regular past menstrual cycles and no symptoms suggestive of renal, cardiac, or liver disorders . Ultrasonography done a few weeks prior to presentation revealed a normal intrauterine pregnancy and adnexae [figure 1]. Ultrasonography images showing normal endometrial cavity (intrauterine pregnancy) and bilateral ovaries the patient was conscious, cooperative, afebrile, with no tachycardia and normotensive . Abdominal examination revealed shiny skin, tense ascites with no guarding, rigidity, or tenderness . History was reconfirmed; patient had not sought any medical advice or treatment for fertility enhancement . Blood investigations revealed hyponatremia (125 meq / l) and hypoalbuminemia (3.4 gm / dl). Hemoglobin, white blood cell count, platelet count, coagulation profile, liver enzymes, blood urea nitrogen, and serum creatinine were normal . Estradiol was elevated at 12927 pg / dl (normal range 188 - 2497 pg / dl). Ultrasonography revealed a multiloculated cystic lesion of size 17 cm 11 cm with vascularity within the wall of cystic lesion . Features of ohss were confirmed on magnetic resonance imaging (mri) [figure 3]. Ultrasonography b - mode images show intrauterine fetus with multiple cysts involving both the right and left ovary . There is mild free fluid in the intra - peritoneal cavity with left pleural effusion t2-weighted magnetic resonance imaging pelvic coronal images show t2-hypo intense lesion in the intrauterine cavity suggestive of fetus . There are hyper intense multiple cysts seen without any mural nodule arising from both right (in right iliac fossa) and left ovary (in pouch of douglas) vital parameters, intake - output, and abdominal girth were monitored . Additional intravenous fluids were omitted, oral fluids were encouraged, and diuretics were initially required . Intravenous albumin infusion was instituted (25 g in 0.1 l solution per day for 7 days). No interventional procedure was done for ascites and pleural effusion, both of which reduced, along with the adnexal mass . Unfractionated heparin 5000 u subcutaneous injection twice daily was instituted and continued for 9 days . Regular ultrasonographic monitoring showed further reduction in size of adnexal mass . At 40 weeks gestation, patient underwent cesarean section in view of nonprogress of labor and delivered a healthy male of 2.85 kg . Intraoperatively, an left ovarian simple cyst of 5 cm 5 cm was observed, for which no intervention was done . Postoperative mri revealed simple left ovarian cyst of 2 cm 2 cm, right side normal and involuting uterus [figure 4]. T2-weighted magnetic resonance imaging pelvis images 6 weeks postpartum show complete resolution of bilateral cystic lesions with a single follicular cyst in the left ovary and multiple small follicles in the right ovary to investigate further, if ovarian hyperstimulation observed in this patient was due to any mutation in fshr gene, the patient was called back after delivery . The entire exonic region of fshr gene was screened for known / novel mutations as described earlier . To our interest, we identified a novel heterozygous mutation in fshr gene leading to a change at amino acid position 449 [figure 5]. This was observed to be a transversion at nucleotide position 1346 (act to aat) in exon 10 yielding a threonine to asparagine (thrasn) substitution in the transmembrane domain helix 3 of the fshr . (a) electropherogram of 5-3 strand of the exon 10 of fshr gene, showing a wild type sequences (upper panel) of a control subject and heterozygous mutant sequence (lower panel) resulting in change of nucleotide c to a / c (1346 position) leading to thrasn substitution identified in patient who developed spontaneous ovarian hyperstimulation syndrome during pregnancy . The majority of ohss cases are usually iatrogenic and are induced by exogenous hormonal therapy . The pathophysiology is one of the fluid extravasations, and the mediator appears to vascular endothelial growth factor . With respect to the severity of clinical picture, it can be classified into: grade 1: abdominal distension and discomfortgrade 2: grade 1 + nausea, vomiting, and/or diarrhea, ovaries 512 cmgrade 3: grade 2 and ultrasonic evidence of ascitesgrade 4: grade 3 and/or hydrothorax or dyspneagrade 5: all above with hemoconcentration, coagulation abnormalities, and diminished renal perfusion (critical ohss). Grade 1: abdominal distension and discomfort grade 2: grade 1 + nausea, vomiting, and/or diarrhea, ovaries 512 cm grade 3: grade 2 and ultrasonic evidence of ascites grade 4: grade 3 and/or hydrothorax or dyspnea grade 5: all above with hemoconcentration, coagulation abnormalities, and diminished renal perfusion (critical ohss). However, it is now being recognized and slowly coming to light, in the form of individual case reports that a similar clinical picture can occur in patients, unrelated to exogenous hormone administration . After a sufficient number of cases of sohss were reported based on the underlying primary abnormality and the triggers leading to the sohss, de leener et al ., have proposed a 4-group classification for this abnormality, which is shown in table 1 . Classification of fsh receptor mutation our patient was classified as type 1 critical sohss in pregnancy and managed as per existing guidelines . Though the reports of successful completion of pregnancies complicated by sohss have been few, the conservative management recommended by the existing guidelines is validated by these few successful outcomes . The understanding of the molecular basis of sohss is very recent, evident by the fact that the first recognition of a mutation in the fshr gene resulting in ohss was described very recently . Interestingly, all the activating mutations of fshr gene reported in women till date are associated with sohss leading to the activation of the receptor . These mutations have been reported to cause loss of ligand binding specificity and increased response to hcg (especially in first trimester when the levels of hcg are high) resulting in hyperstimulation . This mutation leads to the substitution of threonine to asparagine at amino acid position 449 in fshr . However, the functional analysis of this mutation needs to be investigated to understand the pathophysiology at the molecular level . In the wake of this finding at this point in time, much is yet to be understood about sohss and the molecular mechanisms behind it, and hence the reason of presenting this case report: a novel mutation in a condition, not fully understood . The general gynecologist / obstetrician should have a high index of suspicion for sohss, as this entity can have several implications . Genetic analysis should be considered in all patients with sohss to improve our understanding of this entity, paving way for an earlier recognition and improved management of this condition.
Damage often occurs to the supraspinatus muscle, which is one of the components of the shoulder, with repetitive use and small impacts1 . This is mainly because the strength of the small muscles of the shoulder joint that endure the stress from repetitive use is small3 . The supraspinatus muscle is the muscle that forms the rotator cuff of the shoulder joints, and it is located on the top of the scapula . It plays a role in raising the arms above the head . Functional disability does not occur in accordance with the level of pain, but sometimes disability does occur in daily life when the level of pain is severe2, 4 . Furthermore, according to previous research, the main reason for damage of the supraspinatus muscle is unstable adjustment of the humeral head by the spheroidal joint or ball and socket joint6 . Also, when exercise is performed that utilizes the shoulder joint, the supraspinatus, which is the small rotator muscle, has to endure it . According to previous research, 190 out of 191 rotator cuff tear patients had rupture of the supraspinatus muscle7 . Patients with a damaged supraspinatus muscle must go through a period of inflammation and convalescence that has no relationship with the decision regarding surgical treatment . A previous study on the treatment process for patients after a rupture in the rotator cuff reported that inflammatory response of a subacromial mucous cyst induces a patient s symptoms8 . In this kind of damage in the rotator cuff, there is a high interest in reducing pain through improvement of blood flow within the muscle . Also, with the purpose of rehabilitation, even after surgery, exercise utilizing the proprioceptive neuromuscular facilitation (pnf) method is executed within the range of no pain to normalize the supraspinatus muscle and at the same time maintain suitable stability for performance of functional activities . In other words, the pnf treatment method is an important treatment to enhance the flexibility, stability, strength, and neuromuscular control of the supraspinatus muscle9 . However, damage to the supraspinatus muscle of the shoulder joint has a high possibility of recurrence . There is little information regarding pnf treatment methods in this area, and the treatment results are controversial . Thus, the present study examined the muscle recovery level in detail by determining the speed of blood flow within the muscle and change in pain subjectively after treatment with simple exercise and pnf treatment methods in for supraspinatus muscle tear patients . It was approved by kyungsung university s human research ethics committee . Written informed consent was obtained from all subjects after a full explanation of the experimental purpose and the protocol of the study . The subjects of this study were patients who had visited a hospital due to shoulder joint pain and had been diagnosed with a muscle tear on mri . They included patients who had a normal range of movement in the shoulder joint, had a post - trauma medical history, or had had shoulder joint surgery and those who had been diagnosed with two or more instances of complete rupture of the supraspinatus muscle, adhesive capsulitis, or shoulder instability . The patients performed rehabilitation exercise for 12 weeks, and their physical characteristics are shown in table 1table 1.general characteristics of the subjectssubjectpnf (n=10)se (n=10)age (years)47.3 3.350.2 4.4weight (kg)63.6 2.559.7 4.1height (cm)161.3 2.6163.41 1.4mean sd . The aim of this research was to examine in detail the types of influence on the subjective pain level and speed of blood flow in the supraspinatus muscle resulting from pnf rehabilitation exercise and simple exercise treatments performed for 12 weeks . Thus, the subjects were subjected to testing and then engaged in the rehabilitation treatment for 12 weeks . After the completion of the treatment term, the same tests as before the 12 weeks of treatment were performed using the same methods . Two rehabilitation methods, the pnf treatment method and simple exercise method, were used . The subjects warmed up 10 minutes in the same way for both methods, and the exercises were mostly stretching and were performed in the range of no pain and within the range of movement of the shoulder joint . The pnf method was used to increase the range of movement of the shoulder joint with pain in the supraspinatus muscle using relaxation techniques such as contract - relax in extension - adduct - internal rotation and flexion - abduction - external rotation . The treatment was performed within the range in which pain did not occur for 10 minutes, and the combination of isotonics facilitation method was used within the range of movement to increase muscular strength . The simple exercise was performed to improve the muscle strength and instability of the aching part through hold - relax and repetitive stretching within the range of movement of the joints in which pain did not occur . After this exercise was finished, all patients performed finishing exercises - static and dynamic stretching - for about 10 minutes . To determine the recovery level of the supraspinatus muscle, an ultrasonic doppler blood flow meter (es-1000sp ii, hadeco, kawasaki, japan) was used to measure the speed of blood flow in the supraspinatus muscle . The area of the supraspinatus muscle rupture was measured a total of 12 times (every tuesdays). The visual analogue scale (vas) was used to determine the level of pain . The first measurement was obtained before participation in the rehabilitation treatment, and a total of 12 measurements were obtained (once a week). To measure the functional aspects of daily life actions after rupture of the supraspinatus muscle, the disabilities of the arm, shoulder, and hand (dash) questionnaire was used . The dash questionnaire has 21 items related to everyday actions (opening a sealed container, writing letters, opening a door with a key, preparing a meal, opening a door, placing an item on a shelf higher than the head, drawing up chores, taking care of a garden or gardening, laying out bedding, carrying a shopping bag or briefcase, carrying a heavy item (over 5 kg), changing a light bulb, washing or drying your hair, washing your back while showering, putting on a sweater, using a knife when cooking, other activities like card games or knitting, activities consuming a lot of energy such as hammering, activities using the arms such as badminton or throwing a frisbee, moving an item to another spot, and sexual life), items related to six symptoms (pain, pain during a certain activity, tingling, indigestion, stiffness, and sleeping disorder), and items related to 3 social functions (difficulty in social life with neighbors, limitations when working or during other activities, and decline in confidence). Pasw statistics 18.0 was used to calculate the average and standard deviation for all data in this study . The difference in dash score, change in subjective pain, and change in speed of blood flow in the supraspinatus muscle of pnf exercise and simple exercise groups were analyzed in peated measures anova . As a result of observing 20 patients who had a rupture in the supraspinatus muscle for changes in speed of blood flow in the muslce, subjective pain, and dash csore after 12 weeks of pnf treatment and simple exercise, a significant difference was not found between the two groups, which had identical target . Change in the speed of blood flow in the supraspinatus muscle between before and after pnf treatment and simple exercise . The speed of blood flow in the supraspinatus muscle changed between before and after the pnf treatment and simple exercise for 12 weeks . The speed of blood flow in the pnf treatment group was initially 7.8 m / sec (sd=2.47). Four weeks later, it was 8.75 m / sec (sd=3.75); 8 weeks later, it was 13.22 m / sec (sd=7.34); and 12 weeks later, it was 13.41 m / sec (sd=6.32). In the simple exercise group, it was 8.14 m / sec (sd=2.64) before treatment . Four weeks later, it was 9.35 m / sec (sd=3.87); 8 weeks later, it was 9.33 m / sec (sd=4.21); and 12 weeks later, it was 8.2 m / sec (sd=5.11). Change in subjective pain (vas) between before and after pnf treatment and simple exercise . When looking at the change in subjective pain (vas) between before and after pnf treatment and simple exercise, pnf the pnf treatment group showed a vas score of 4.33.1 before treatment and a vas score of 3.62.5 after 12 weeks . The simple exercise group showed a vas score of 4.72.6 before treatment and a vas score of 3.73.7 after 12 weeks . As a result, change in dash score between before and after pnf treatment and simple exercise . When looking at the results of the dash questionnaires administered before and after pnf treatment and simple exercise, the pnf treatment group showed a dash score of 23.110.2 before treatment and a dash score of 13.16.7 after 12 weeks, indicating a significant decrease (p<0.05). The simple exercise group showed a dash score of 21.311.2 before treatment and a dash score of 18.17.5 after 12 weeks, indicating a significant difference (p<0.05). In this research, 20 shoulder joint rupture patients were subjected to pnf treatment or simple exercise therapy for 12 weeks to observe their influences on the speed of blood flow in the supraspinatus muscle, change in subjective pain, and functional aspects of the shoulder joint; thus, the factors above were analyzed, and they are discussed below . The muscles in the human shoulder joint are divided into the deltoid, subscapularis muscle, supraspinatus muscle, teres minor muscle, and teres major muscle . These muscles play a role in moving the shoulder joint in flexion, extension, abduction, adduction, internal rotation, and external rotation . It appears that rupture of the supraspinatus muscle occurs mostly from rupture of the rotator cuff of the muscles2 . This lesion in particular results in the most limitation and highest pain level compared with other parts of the rotator cuff10 . This is because rupture easily occurs in the joint capsule, and the ligament is also damaged due to repetitive movement in the area of the supraspinatus muscle . The diagnosis for the supraspinatus muscle was confirmed by a radiology specialist through echography in this study . In 1984, crass first used echography to diagnose rotator cuff rupture, and it was found that echography had a level of accuracy similar to mri11 . According previous research, 8090% of cases of supraspinatus muscle rupture can be determined through echography12 . In this context, analysis of our supraspinatus muscle patients revealed that, the pnf treatment group showed an average increase of 71% in the speed of blood flow between before and after treatment . As a result, through the exercise on advance study shoulder joint pain patients, it showed that the increase in bloodstream speed of muscle, research related to pain relief, and the increase in blood flow of muscle were correspondent with partial . The results of the present research indicate that the pnf treatment method is more effective for muscle function recovery in patients . On the other hand, regarding the change in subjective pain, there was an average decrease of 16% between before and after the pnf treatment, whereas the average decrease was 21% between before and after simple exercise . This relaxes the contract of peripheral vascular and hypertonic of sympathetic nervous system due to hypertonic muscle due to advanced research pain . Moreover, blood circulation is accelerated for excrete colorific substances, which cuts the circulation of vicious circle14, 15 it showed different results with the research . Blood flow increased by 71% as a result of pnf treatment, and the level of subjective pain decreased by 16% . Blood flow increased by 0.7% as a result of simple exercise, and the level of subjective pain decreased by 21% . A significant change was not found statistically of subjective pain decrease, increase of blood flow, and the results of advanced research . In the dash items concerning the functional aspects of patients with a damaged supraspinatus muscle, the total average score decreased by an average of 43% as a result of pnf treatment, but they did not show decrease rate in the requirements of using the hand such as writing, opening a door, and preparing a meal, which they felt uncomfortableness . The total average score decreased by an average of 15% as a result of simple exercise . There was no decrease in scores for putting an item on a shelf higher than the head, washing or drying your hair, and putting on a sweater . Thus, supraspinatus muscle rupture patients would not be satisfied with a treatment that results in a decrease in the total average dash score . The total average score decreased, but both treatment methods had certain limitations that have clinical implications . The methods used for treatment in this research show difference with the research of advanced researchers . Decrease in pain was identified in the increase of blood flow, but this has a possibility of an error during the diagnosis through echography of the damage level of the supraspinatus muscle16 . The supraspinatus muscle rupture patients did not experience pain, but there was an advanced research that patients had limitations in everyday activity like dash17 . These were limitation of this research, and future research should use mri and echography for diagnosis both and only utilize patients who experiencing their first case of supraspinatus muscle damage to reduce the level of errors.
The global prevalence of diabetes mellitus has been remarkably increased during the last two decades and has reached from almost 30 million cases in 1985 to 285 million cases in 2010 (1). The prevalence of diabetes in iran was about 7.7% in 2005 (2), and this amount reached 8.7% in 2007 (2). Obviously, many factors are required to meet the needs of the patients with diabetes . Although, complete treatment of diabetes is a long way ahead, medical care and sociopsychological support have great effects on its acute and chronic outcomes (3). In light of high prevalence of this disease, it has become the subject of significant research in different clinical areas . Because of the increased prevalence of diabetes and its complex etiology, adaptation mechanisms are needed to make a change in the concepts of diabetes management and the treatment programs that have been considered so far . This change should be from the physical variables to sociopsychological factors which may be effective on the disease management and its outcomes (4). In addition, the new treatment recommendations have specifically confirmed the importance of the integration of sociopsychological concepts with the usual care of patients with diabetes . This new approach helps them achieve suitable control over their glucose level and leads to the person's high compatibility (5). Marital satisfaction is a situation in which husband and wife have a sense of happiness and are satisfied from each other most of the times . Satisfactory relationships between couples can be measured by mutual love, the amount of caring from each other, and understanding of each other (6). According to winch (as cited in olia), marital satisfaction is the adaptation between the individual's present situation in marital relationships and his or her expected situation . Marital satisfaction does not appear from thin air and its development needs the effort of the couple . The study results show that the outcome of marital satisfaction (supporting each other) can affect people s health (7). Furthermore, a positive correlation has been found between marital conflict, anxiety, depression, and the low level of physical health (8). Literature review in iran and other countries revealed that there has been no study about the relationship between marital satisfaction and compatibility with diabetes in patients with type 2 diabetes . Despite benefiting from multiple therapeutic interventions like diets, regular exercise, weight control, chemotherapies, and epidemiologic investigations the aim of the present study was to investigate the relationship between marital satisfactions with compatibility with type 2 diabetes . This study method was descriptive - correlative . The sample consisted of patients (20 - 60 years old) with diabetes who refereed to diabetes clinic in meybod, iran . The patients with the following criteria were enrolled in the study: being 20 to 60 years old, having diagnosed their disease at least one year before the study, visiting one of the physicians in the diabetes clinic, and having medical case with the physician . The people who had the following exclusion criteria were omitted from the study: having history of other physical diseases except the ones related to diabetes symptoms, and having mental retardation or other psychological disorders before diabetes diagnosis . According to the mentioned criteria, 160 patients from the clinic members (103 females and 57 males) were randomly selected . The sample size was determined based on random sample size formula of krejcie (9) which estimated to be 160 out of community of 280 patients . At first the list of the names of all people who were at that age range they were called and those who had the criteria for entering into the study were chosen and invited for participating in the study . The questionnaires that were used in this study they believed that this scale is related to the changes that happen during the individual's life (10). This questionnaire included 47 questions rated in a 5-point scale from completely agree to completely disagree . The validity of the instruments was also calculated by content validity method and its reliability was calculated by retest method (0.82) that was significant (11). The factors are family relationships, relationship with friends, dependency and independency conflicts, physical image, and the attitude toward the disease . These factors show how diabetes affects the individual's way of living and his or her compatibility . Those responses that show positive compatibility with diabetes were given the score of 1 and those which show negative compatibility were given 0 . The reliability of this questionnaire with retest method on 15 patients with diabetes was found 0.73 after 5 weeks, and its content validity was confirmed by 3 psychologists and endocrinologists and psychiatric nursing . They believed that this scale is related to the changes that happen during the individual's life (10). This questionnaire included 47 questions rated in a 5-point scale from completely agree to completely disagree . The validity of the instruments was also calculated by content validity method and its reliability was calculated by retest method (0.82) that was significant (11). The factors are family relationships, relationship with friends, dependency and independency conflicts, physical image, and the attitude toward the disease . These factors show how diabetes affects the individual's way of living and his or her compatibility . Those responses that show positive compatibility with diabetes were given the score of 1 and those which show negative compatibility were given 0 . The reliability of this questionnaire with retest method on 15 patients with diabetes was found 0.73 after 5 weeks, and its content validity was confirmed by 3 psychologists and endocrinologists and psychiatric nursing . Most of the study samples were in the age range of 41 - 50 with the frequency of 50 which involves 31.2% of the participants and the least frequency was in the age range of 21 - 30 with 11 (6.8%) participants . Also, most of the participants were women 103 (64.4%). Table 1 shows the mean and standard deviation of marital satisfaction and the aspects of compatibility with diabetes in the sample group . Table 1 shows that the mean and standard deviation of marital satisfaction in the sample group are respectively 136.9 and 14.07, and the mean and standard deviation of compatibility with diabetes are respectively 40.12 and 3.33 . Table 2 shows the result of anova (analysis of variance) on the mean of marital satisfaction score in two groups (men and women with diabetes). Table 2 shows that, there is no significant difference between women and men with diabetes regarding marital satisfaction (p = 0.3). Table 3 shows the correlation between marital satisfaction and aspects of compatibility with diabetes in women and men with diabetes . Table 3 shows that a positive, significant relationship exists between marital satisfaction and compatibility with diabetes in women (p = 0.006; r = 0.26). It means that as marital satisfaction increases in women with diabetes, compatibility with diabetes will also increase . However, there is no significant relationship between marital satisfaction and compatibility with diabetes in men with diabetes (p = 0.87; r = 0.02). Also, there is no significant relationship between aspects of compatibility with diabetes and marital satisfaction in women and men . As it was mentioned, the present study was carried out to investigate the relationship between marital satisfaction and compatibility with diabetes in patients with type 2 diabetes . The results revealed that a positive significant relationship exists between marital satisfaction and compatibility with diabetes in women . It means that by increasing marital satisfaction, compatibility with diabetes increases and vice versa . In fact, marital satisfaction affects people's mental health and these result are in consistent with the results of other studies (12, 13) in which the relationship between mental health and marital satisfaction were investigated in people with chronic diseases . The results of the other studies (14, 15) in which the relationship between family support and blood glucose control was investigated in elderly with type 2 diabetes revealed that family support increases marital satisfaction which is in line with increasing the elderly mental health . Elder and george (16) also cited in their study that close relationships are the main source of pleasure and support during life . People who have closer relationships are in better physical and mental health condition (16, 17) which is consistent with the results of this study . Lal and bartle - haring (18) investigated marital satisfaction in patients with chronic lung diseases and their results also revealed that marital satisfaction was related to psychological improvement which could affect and alleviate their chronic pains . Whitsitt (19) investigated coping strategies and compatibility with coronary artery diseases in couples and the results showed that marital quality can affect better compatibility with the disease . 20) revealed in their studies that the relationship between the couples can reinforce the behaviors related to health and lead to people's improvement . Therefore, this issue destroys the balance of suitable behaviors and leads to loss of intimacy . Marital satisfaction is considered as a continuum and an evolutionary process between husband and wife . Marital satisfaction includes some elements such as self - esteem, self - effectiveness, domination, and control over life . The weakness in any of these factors leads to the reduction in individual's health and ability for dealing with his or her present conditions . In fact, marital satisfaction acts as a protective and reinforcing factor for the patient . When marital satisfaction is high, domination, control, and life expectancy will increase in the person and he or she tries more to improve himself or herself . When marital satisfaction is high, the person also benefits from the advantages of this relationship which occurs in a substitutive way and he or she can adopt his or her condition . In this study the interaction of variables like occupation, education, duration of marriage, number of children, personality, place of living, and other effective social and cultural variables were not examined with the test variables . Therefore, it is suggested that the relationship of test variables with other variables such as age, gender, education, duration of marriage, and personality be investigated in different cities . In addition, this study has its own limitations like the small number of the subjects who were a group of patients referred to the hospitals in meybod . So, further studies should be done, in different cities and on other age groups with other instruments and the results should be compared . In the future studies it is important to consider other psychological factors too, since investigating possible interactive effects of some personal issues in predicting compatibility with type 2 diabetes can help us in explaining problems regarding diabetes management in a more suitable way.
The estimated number of population with obesity around the world is 1.5 billion in 2012 and it continues to rise . The increases of obesity affect all classes of socioeconomic status (ses) with certain difference in both developed countries and developing countries in recent decades [1, 2]. As a result, burdens of diseases from chronic noncommunicable diseases associated with obesity such as cardiovascular diseases, diabetes, metabolic syndrome, and hypertension are increasing [3, 4]. The world health organization has recently set obesity as one of the key indicators for global action on noncommunicable diseases . Studies have shown that the direction of association between obesity and ses varied by population and economic status of the countries . In the developed countries, individuals with lower socioeconomic status were more likely to be obese than those in the higher socioeconomic group [6, 7]. For the developing world where countries are in the transition of epidemiological period, pattern of obesity has varied by gender and socioeconomic status . The reversal association between ses and obesity in developing countries has been observed earlier in women . In thailand, a previous national health examination study showed that the prevalence of obesity increased approximately by 60% during 19912004 . The surveys also reported that the distribution of overweight and obesity varied by education level, with significantly higher prevalence in men with high education level, but in women with low education level . It is not clear whether the pattern has been changed in the recent national health survey . In the present study, we reported the prevalence of the latest national health examination survey in 2009 and the trends of body mass index and prevalence of obesity from 1991 to 2009 . We also examined the pattern of association between obesity and education level by sex, age group, and area of residence during 19912009 . Nhes is nationally representative of health examination survey of thai population conducted in 1990, 1997, 2004, and 2009 . The survey was conducted by the national health examination survey office, health system research institute, thailand . In each survey, the sampling technique has been described elsewhere [9, 10]. For the nhes iv, briefly, the sampling unit in the first stage was province in each region, the second was the district, and the third stage was village in rural areas and enumeration unit in urban areas . The final sample size collected was 20,450 with a response rate of 93.1% . In this study, we included those aged 20 years and over with a total of 19,181 in the analysis . The sample sizes for the 1990, 1997, and 2004 surveys were, 15124, 7726, and 41630, respectively . This study was approved by the ethical review committee for research in human subjects, faculty of medicine, ramathibodi hospital, mahidol university . Weight was measured while participants wore light cloths; height was measured at standing without shoes . Body mass index was calculated as weight in kilograms divided by height in meters squared . Obesity was defined using criteria for asian population, at a cut - off point of bmi 25 kg / m as obesity due to the higher risk of developing diabetes and obesity - related diseases compared to western population . Consequently, bmi was divided into 4 categories: overweight: bmi 23<25, obesity class i: bmi 25<30, and obesity class ii: bmi 30 kg / m . Education was categorized into four groups: less than primary, primary, secondary or vocational, and university education . All the statistical analyses were taken into account the complex survey design using stata software 10.1 (stat corp . Age - adjusted mean of bmi and age - adjusted prevalence of obesity were calculated according to sex, area of residence (urban / rural), and level of education . The age and sex adjusted mean and prevalence of obesity were standardized using the standard population of the estimated 2004 population . For the 2009 survey, multinomial logistic regression models were used to assess the association of the ordinal scale of bmi categories: overweight and obesity class i and obesity class ii with independent variables of educational levels controlling for age, smoking, area of residence, and geographic regions (north, northeastern, central, south, and bangkok). We assessed the interaction by adding multiplicative interaction terms of area of residence and indicators variables for education levels in the models and found no significant interaction at p value <0.10 . In the trend analysis between 1991 and 2009, we restricted the age group to those 2059 years old, because the bmi data for those aged 60 years were not available in the 1997 survey . Sample size for those aged 2059 years in each survey included a total of 11,218, 3,062, 19,962, and 10,103 for years 1991, 1997, 2004, and 2009, respectively . We used linear regression to evaluate the average change of bmi per decade by using bmi of each survey as dependent variable and the survey year as independent variable controlling for age, area of residence, and educational levels . Logistic regression was used to examine the linear trends in sex - specific prevalence of overweight and obesity class i and class ii, separately over the four surveys by educational level with year of survey as a continuous variable controlling for age and area of residence . In 2009, overall, age - adjusted mean bmi among thai adults aged 20 years was 23.9 kg / m (95% ci 23.6, 24.2 kg / m). Women had higher bmi than men (24.4 kg / m (95% ci 24.1, 24.8) versus 23.3 kg / m (95% ci 23.0, 23.6), p <0.001). Age - adjusted prevalence of overweight, obesity class i, and obesity class ii was 17.5% (95% ci 16.7, 18.4%), 26.0% (95% ci 24.1, 28.0%), and 9.0% (95% ci 7.9, 10.2%), respectively . The corresponding prevalence, except for overweight, was higher in women than in men (17.0% (95% ci 16.1, 17.9%), 29.0% (95% ci 26.5, 31.6%), and 11.5% (95% ci 10.1, 12.9%) in women and 18.2% (95 ci 16.8, 19.6%), 22.8% (95% ci 20.1, 25.7%), and 6.3% (95% ci 5.1, 7.6%) in men, resp ., all p values <0.05). Table 1 shows the prevalence of overweight and obesity overall and by sex, age, area of residence, and educational levels . For men, obesity class i and class ii prevalence were significantly higher in urban than in rural areas (all p <0.001); however, for women, only obesity class ii prevalence was significantly higher in urban than in rural areas (p = 0.006). The pattern of obesity prevalence by education levels varied according to sex . Among men in rural areas, the prevalence of obesity class i was higher among those with higher education levels and was highest among the university group, but, among men in urban areas, the prevalence of the obesity class i was relatively uniform by educational levels . For women, there was no significant difference in prevalence of obesity class i and class ii across educational levels; however, the prevalence of obesity class i was highest in the primary education level . Table 2 shows adjusted odds ratios of overweight and obesity associated with age, areas of residence, and educational levels in 2009 . After controlling for age and area of residence, for men, education was positively associated with overweight and obesity class i with highest odds ratios among those with university education but was not significantly associated with obesity class ii . For women, the adjusted odds of overweight and obesity appeared to be significantly highest in the primary education group and lowest in the university education group as compared to the less than primary education group . During 1991 and 2009, the overall age - adjusted prevalence of obesity class i and class ii in thai adults aged 2059 years increased significantly by the year of survey, whereas overweight prevalence was relatively stable . For men, the prevalence of obesity class i increased from 12.5% in 1991 to 16.6% in 1997, 19.9% in 2004, and 23.5% in 2009, and the corresponding prevalence of obesity class ii was 1.7%, 4.3%, 5.4%, and 6.8%, respectively . For women, the corresponding prevalence for obesity class i was 20.2%, 24.9%, 28.5%, and 29.4% and for obesity class ii was 5.9%, 8.8%, 10.3%, and 12.1%, respectively . Figure 1 shows the trends in prevalence for men and women in urban / rural areas . Obesity class i and class ii prevalence for all subgroups, except for women in urban areas, increased significantly across 19912009 . Figure 2 shows increasing trends in age - adjusted mean bmi by survey year according to sex, area of residence, age groups, and education levels . Overall, the bmi trends increased for all subgroups with certain extent . In men, the adjusted mean bmi increased from 21.6 kg / m in 1991 to 23.3 kg / m in 2009, and the corresponding mean bmi in women was 22.8 kg / m and 24.4 kg / m, respectively . In linear regression analysis, the average increased bmi per decade was 0.8 kg / m (p <0.001) for men and 0.9 kg / m (p <0.001) for women . The mean bmi increased across all educational levels . For men, the rates of increase were highest among those with secondary education of 1.0 kg / m per decade and for women with primary education group with the same rate . Women with university attainment had the lowest rate of increase in bmi (0.7 kg / m) per decade . Table 3 shows that there were significant increases in annual prevalence odds of obesity class i and class ii in both men and women between 1991 and 2009 . According to educational levels, for men, increases of obesity class i were significant for those with primary and secondary education levels (p <0.001 and 0.002, resp .) And increases in obesity class ii were significant for both with less than primary education and secondary education group (p = 0.03 and 0.02, resp . ). Among women, for obesity class i, the increase was significant in the primary education group (p <0.001) and for obesity class ii was significant in both primary and secondary education groups (<0.001 and 0.012, resp . ). The prevalence of overweight and obesity defined by bmi in thai population from 1991 to 2009 linearly increased with an average of 0.95 kg / m per decade and affected all ses groups . Compared to previous surveys, the prevalence as well as mean bmi increased dramatically during 19912009 with no sign of leveling off . The average increased bmi was higher than that of the global increase of 0.4 - 0.5 kg / m and was one of the highest among the southeast asian countries with an average increase per decade of 0.7 kg / m in men and 1.0 kg / m in women . With regard to ses classes, in 2009, obesity class i (bmi 2529.9 kg / m) was positively associated with higher education in men but was negatively associated in women . However, the higher annual increment in mean bmi and obesity class i was found in the primary education level in both men and women . This might suggest that there is a tendency of a shift in obesity toward the lower educational group in men in the near future . Compared to other countries in asia, the rise in bmi and prevalence of obesity in thailand was consistent with the findings of other asian countries [1315]. In low income and middle income countries, individuals in the high ses urban areas are the first to have high prevalence of obesity and the prevalence shifts to the lower ses as economic growth increases . The pattern of shift in women concurred with studies in other middle income countries where obesity rapidly increases in the lowest income groups [2, 12, 16, 17]. The lower obesity among men in low ses has been explained and shared by the common nature that men in the lower ses were in occupation with higher energy expenditure [6, 7, 18]. The more affluent men have greater access to food supply and are less physically active . In addition, the cultural preference of fat body shape among men also plays role, as a larger body size is more likely to be valued as a sign of prowess . Education might be a protective factor for people in high income countries, and for women in low or middle countries, but it might hardly apply for men . Studies in several countries revealed that the most common association pattern was the nonsignificant or curvilinear relationship among men particularly in medium and high human index countries with a higher percentage of countries in medium human development index having a positive relationship [18, 19]. The higher prevalence of obesity among the primary education women might also reflect inequity in knowledge and access to healthy lifestyle, as women in the lower education are less aware and accessible to better food choice . However, in developing countries, it is less clear whether there are differences in energy expenditure and a trend towards less physical activity and less concern to have leisure - time exercise . Research about the influence of lifestyle and obesogenic environment on obesity associated with ses in developing countries deserves further study . Although there are limited studies to explain the casual factor of the current increasing trends in thai population, imbalance of energy intake and expenditures, in general, are implicated in the rising of obesity . The association of urbanization with higher obesity prevalence had been reported in our previous studies and others [13, 16]. Globalization of the fast food and processed food makes the cheap and high energy food more accessible throughout the country . Availability of food due to reduction in the cost of food has been implicated as a major driver of increase of the global obesity during the past 2 decades, and thailand is no exception . The thai gross national product (gnp) has continuously grown from million thai baht 2,082 in 1991 to 3,008, 3,278, and 4064 in the years 1997, 2004, and 2009, respectively . The lack of excess food consumption to the poor becomes uncommon, although lack of access to healthy food is possible . The poor choice might be due to access to information related to healthy food and less health concern or unawareness of the association between health consequences of excess energy intake . Thus, low ses groups can easily access cheap high energy diet which leads to gain weight . Increases in food supply are the major determinants of weight gain of the populations . In some middle income countries, the concurrent trends in adoption of knowledge of obesity harm to health might weaken the positive relationship between ses and obesity; however, this is still not the case in men with higher education in thai population [2, 6, 7]. Multifaceted initiatives and multisectoral coordination across several sectors of government, ngo, industries, and civil society are needed . Currently, the thai ministry of public health has launched a program so - called thailand healthy lifestyle plan aimed at reducing the morbidity and mortality of cardiovascular diseases and targeted on health program to promote physical activity and healthy dietary intake . Given the relationship between obesity and ses, it is particularly important to tackle the obesogenic environment and ensure that the programs reach all ses groups . The thai health promotion foundation, a nonprofit agency with ear mark budget from excise tax of tobacco, has sponsored national campaigns and messages on benefit of proper weight in addition to the regular programs of the ministry of public health . The messages about obesity contribution to adverse health consequences have been publicized in multimedia including tv programs . However, effectiveness of these national programs and whether the messages reached all ses groups need further evaluation . Secondly, data of causal factors such as changes in energy intake, physical activity, and factors related to energy imbalance to explain the determinants of increase in obesity were limited . Finally, the educational attainment only reflected on part of the ses and more complete data on income might add more information and get a better picture of the associations . The implication of this study is that more stringent intervention to curb the obesity trends in thai population is needed . As obesity increases the risk of several chronic diseases which are leading to daly loss in thai population, without implementation of effective and integrated strategies, the burden caused by obesity will not be likely to decrease [9, 23]. Policy and environment must be designed and modified to promote healthier choice on diet and physical activity for all ses groups . Furthermore, strategies to increase the access to information on causes and burden of obesity among the lower ses group must be implemented . In conclusion, the present study demonstrated the increasing trends in bmi and obesity prevalence in all ses groups with a likelihood of higher rates among those with lower education and in rural residents during 19912009.
They originate either in bone (osseous plasmacytoma) or in soft tissues (extramedullary plasmacytoma). It can occur as the sole manifestation of plasma cell neoplasm, as a metastasis from another extramedullary plasmacytoma or as a consequence of multiple myeloma . It has no characteristics of multiple myeloma, but the development of multiple myeloma has been observed in 836% of patients months or years later . These plasma cell tumors can occur anywhere and have to be differentiated from other neoplasms, infectious processes and chloromas . The head and neck region has been reported as a frequent site for amyloid deposits . One of the most common forms of amyloid proteins are amyloid light chain (al - type), which is derived from plasma cells, contains immunoglobulin light chains and is associated with plasma cell dyscrasias . Fine needle aspiration smears of a 50-year - old female patient with cervical lymphadenopathy were sent to the department of pathology without any clinical details . Cytology smears (giemsa stain) showed sparse cellular aspirate with amorphous granular basophilic material, predominantly scattered lymphocytes, plasma cells and occasional epithelioid cells [figure 1]. This amorphous material was interpreted as caseous necrosis and the possibility of tuberculous lymphadenitis was suggested . Subsequently, patient's clinical findings were provided with the request for review of slides as the patient had not responded to antituberculous treatment . In the details provided, a nasal growth was also mentioned to be present in the lateral wall of the nasal cavity, which was globular, firm and pink in colour and measured 3 2 2 cm . Lymph node aspirate showing amorphous granular basophilic material which mimicked caseous necrosis (giemsa, 400) repeat aspiration from the cervical lymph node, imprint smears and biopsy from the growth were performed . Repeat aspiration and imprint smears revealed high cellularity with amorphous basophilic material, large number of plasma cells with varying degree of maturity, myeloma cells and occasional scattered epithelioid cells . An occasional foreign body type, multinucleated giant cell with intracytoplasmic amorphous basophilic material was also seen . Plasma cells had prominent eccentric nuclei, coarse chromatin, perinuclear halo and basophilic cytoplasm and myeloma cells had fine chromatin, prominent nucleoli and little or no halo . Presence of numerous plasma cells and myeloma cells raised the possibility of plasmacytoma [figure 2]. The amorphous extracellular material and similar intracytoplasmic material within giant cells raised the possibility of amyloid within the cells . Subsequent congo red staining of the cytology and histopathology slides, showed the amorphous material to be orange - red in color . It gave an apple - green birefringence when viewed under polarized light, confirming it to be amyloid . Thus, the diagnosis of plasmacytoma with amyloidosis was suggested and confirmed by a histopathology study of the biopsy tissue . There was no clinical, radiological or laboratory evidence of plasma cell dyscrasias or systemic amyloidosis . Repeat lymph node aspirate showing plasma cells (uninucleate and binucleate), myeloma cells, scattered lymphocytes and amorphous basophilic material (giemsa, 400) extramedullary plasmacytoma is a soft tissue neoplastic lesion that is made up of monoclonal plasma cells (plasma cell dyscrasias). It can be primary, without evidence of disease in other foci, or part of a systemic process during the course of multiple myeloma . Thus, these patients should be carefully evaluated for the presence of disseminated disease / multiple myeloma before arriving at a diagnosis of extramedullary plasmacytoma . Studies should include complete blood cell count, serum calcium levels, radiologic skeletal survey, magnetic resonance imaging (mri) of the spine, pelvis, humeri and femurs, immunoelectrophoretic examination of serum and urine, 2 microglobulin assay and bone marrow biopsies . Diagnosis should be made only if all studies for disseminated disease are negative, as was seen in our case . These tumors can occur anywhere in the body, but nearly 8090% of all extramedullary plasmacytoma occur in the head and neck region . Most of these cases arise in the aerodigestive tract, probably because of the abundance of lymphatic tissue in this area . In one study the frequently affected sites in decreasing order of frequency included nasal cavity or paranasal sinuses, nasopharynx, oropharynx and larynx . Extramedullary plasmacytoma occurs in patients between 50 and 60 years of age, and is more common in men (4:1). Plasmacytomas arising in the nasal cavity or nasopharynx usually present as a soft bleeding mass or as a polypoid mass, covered mostly by an intact overlying mucosa . Cervical lymphadenopathy and nasal discharge may be the associated presenting symptoms in an occasional patient . Microscopic examination of cytological smears show numerous plasma cells, including binucleate, multinucleate and pleomorphic forms . On histopathological examination, plasmacytomas are very vascular tumors with minimal stromal component and sheets of plasma cells with varying degrees of differentiation and immature plasma cells . Differential diagnosis of plasmacytoma includes plasma cell granuloma, plasmacytoid lymphoma and large cell lymphoma of immunoblastic type . Immunocytochemical study with antibody to kappa and lambda light chains is an important approach to differentiate these conditions . Kappa or lambda light chain - restricted population confirms the diagnosis of plasmacytoma and suggests a pathogenetic relationship between plasmacytoma and amyloid deposition . Sakai et al . Diagnosed extramedullary plasmacytoma of the tonsil by demonstrating diffuse immunoreactivity for lambda light chains within plasmacytoid cells . Immunoblastic lymphomas usually involve lymph nodes and show cytoplasmic igm heavy chain (igg and iga heavy chains in plasmacytomas) and express pan b cell surface antigens . Eilam et al . Reported a case of plasmacytoma of the nasal cavity that involved the palate, ethmoidal and maxillary sinuses and contained deposits of amyloid . Reported a case of extramedullary plasmacytoma of the parotid gland with extensive amyloid deposition masking the cytologic and histopathologic picture . Amyloid refers to the extracellular fibrillar proteinaceous substance deposited in various tissues and organs of the body in a wide variety of clinical settings clinically, the symptoms depend on the magnitude of the deposits and on the particular sites or the organs affected . Regarding its imaging appearance, affected bony conchae and sinus walls show a fluffy appearance adjacent to amyloid deposit on computed tomography scan; calcification has been mentioned as a nonspecific finding . Foreign body giant cell reaction may be evoked about the amyloid deposits, as was also seen in our case . It can be seen on mri as a peripheral enhancement in the region of amyloid deposits with contrast material administration . Differential diagnosis of this material on lymph node cytology smears include caseous necrosis, tumor necrosis and colloid . Completely amorphous granular material without identifiable cell remnants suggest caseous necrosis, seen predominantly in tuberculosis caused by mycobacteria and other bacterial diseases and fungal infections . The type of granulomatous reaction, clinical details and bacteriological data are necessary to differentiate these conditions . Neoplastic conditions, specially the lymphomas (non - hodgkin's and hodgkin's) and metastatic carcinomas, show tumor necrosis and therefore should be excluded . Tumor necrosis appears as numerous cell shadows with pyknotic nuclei it may be homogenous or granular, resembling caseous necrosis . Colloid appears as a dense, blob - like material with sharp outlines on cytology smears from the thyroid . Rectal / bone marrow biopsy and fine needle aspiration of abdominal subcutaneous fat is suggested to rule out systemic amyloidosis . The diagnosis of amyloid is based almost entirely on its staining characteristics . With light microscope and standard tissue stains differentiation between amyloid and other amorphous eosinphilic substances, such as hyaline material, collagen and fibrin, is impossible . Thioflavin t and other fluorescent dyes offer greater sensitivity in detection of amyloid but both hyaline and fibrin give positive results . Thus, the gold standard for diagnosis of amyloid is congo red staining, which stains the tissue pink or red in color by light microscopy and gives green birefringence by polarized microscopy due to a -pleated sheet conformation of amyloid fibrils.
Owing to its complex anatomy, the shoulder is the most mobile joint in the human body . It also has to be able to bear heavy loads, especially in athletes and those carrying out heavy manual work . Load resistance is ensured by dynamic and static stabilizers of the shoulder joint [13]. A wide range of mobility is, however, hardly compatible with load resistance and the shoulder joint is the most frequently dislocated of all human joints . The incidence of shoulder dislocation has been estimated at 11.2/100 000/year, affecting 2% of the general population . Of all shoulder dislocations, 85% are post - traumatic anterior dislocations [1,46]. A characteristic of the shoulder joint is a tendency towards repeated dislocations following an initial event . Patients with a history of shoulder dislocation at 20 years of age or earlier have a 66100% risk of repeat dislocation, with the figure falling to 1363% for the age range of 2139 years and 016% in those over 40 years of age . The most characteristic intraarticular lesions seen on arthroscopy include the bankart lesion and a compression fracture of the humeral head . Open surgery was the gold standard in the operative treatment of shoulder instability for many years . Owing to the dynamic development of surgical techniques, arthroscopic methods have been enjoying increasing popularity . The advantages of arthroscopic techniques include low invasiveness, minor tissue damage, good exposure of the joint, minor post - operative pain, and shorter times to resumption of daily activities . However, even though arthroscopic procedures have been in use for a number of years and carry many advantages, the rate of recurrences and complications continues to be high [1624]. To analyze late outcomes of arthroscopic repair of bankart lesions in patients with post - traumatic anterior shoulder instability and non - engaging hill - sachs lesion with special regard to the incidence and causes of recurrences and complications to analyze late outcomes of arthroscopic repair of bankart lesions in patients with post - traumatic anterior shoulder instability and non - engaging hill - sachs lesion with special regard to the incidence and causes of recurrences and complications . This study presents the findings of a retrospective analysis of 92 patients (92 shoulders) with anterior post - traumatic shoulder instability who were operated on at department vi of the regional trauma hospital in piekary slaskie between january 2002 and january 2007 . The study group comprised of 18 (19.6%) women and 74 (80.4%) men . The time between the initial dislocation and surgery was 0.54.8 years, mean 2.5 years . A total of 84 (91.3%) patients were right - handed and 8 (8.7%) were left - handed . The right shoulder was operated on in 81 (88%) cases, the left shoulder in 11 (12%). The basic characteristics of the study group are presented in table 1 . During the examination, a diagnosis of post - traumatic anterior instability of the shoulder joint was made in patients with a documented (medical records, imaging studies) history of at least two shoulder joint dislocations . If a recurrence had been due to another high - energy trauma (e.g., during contact sport practice), it was regarded as a sequela of a new injury rather than a complication . History taking involved detailed questions about the number of dislocations, date and circumstances of the initial dislocation, circumstances of subsequent dislocations, a sense of apprehension, past treatment and the degree of daily activity: practising sport and the type of occupation . A physical examination included the apprehension test, anterior drawer test, posterior apprehension test, posterior drawer test and sulcus test in all patients . All patients enrolled in the study underwent a ct scan in order to assess damage to bone tissue: bony bankart lesions, hill - sachs lesions and an mri scan to assess damage of soft tissues: rotator cuff tears, superior labral antero - posterior lesion (slap lesion), humeral avulsion glenohumeral ligament (hagl), rotator interval lesions . All patients were operated on by the same surgeon under general anaesthesia in a lateral decubitus position . The weight was chosen so as to afford the best possible visualization of the joint . The type of bankart lesion was assessed, and any additional lesions, such as rotator cuff tears, superior labral antero - posterior lesion (slap lesion), humeral avulsion of the glenohumeral ligament (hagl), rotator interval lesions, bony bankart lesions or engaging hill - sachs lesions, were identified . The hill - sachs lesion was assessed according to the criteria presented by burkchard and de beer (engaging / non - engaging). The working cannula was always positioned in the anterior inferior portal using the inside - in technique . After insertion of a cannula, the glenoid labrum and glenohumeral ligaments were separated from the glenoid and the antero - inferior bony part of the glenoid was scarified with a rasp . The labroligamentous complex was always reconstructed with fastak 2.8 mm suture anchors (fastak, arthrex, naples, florida). Two or three implants were used, depending on the extent of injury . In each patient, the most distant implant (at 5:30 in the right shoulder, at 6:30 in the left shoulder) was mounted first, followed by mounting an implant at 3:30 for the right shoulder and 8:30 for the left and, in patients who received 3 implants, at 2:30 and 9: 30 respectively . The dunkan loop knot was used in each case . A diagnosis of anterior post - traumatic shoulder instability based on: a history of 2 or more documented dislocations, a positive apprehension test and anterior drawer test on physical examination, no previous surgery, no bony lesions of the acetabulum as confirmed by a ct scan, presence of a bankart lesion confirmed by an mri scan and a non - engaging hill - sachs lesion with a definitive diagnosis ascertained intraoperatively . Posterior instability, multidirectional instability, voluntary instability diagnosed on history taking and confirmed by physical testing, glenoid fracture documented by a ct scan, previous surgery for shoulder instability, joint laxity, anatomic variants, neurological symptoms, additional problems: rotator cuff tears, superior labral antero - posterior lesion (slap lesion), humeral avulsion glenohumeral ligament (hagl), rotator interval lesions, bony bankart lesions, engaging hill - sachs lesions diagnosed on the basis of history and physical examination, with a definitive diagnosis ascertained intraoperatively . After surgery, the joint was immobilized in adduction and internal rotation for 4 weeks . During this period of immobilization, the patients were instructed to exercise their hand joints and the elbow joint 34 times daily for 10 minutes, making extension, flexion and rotatory movements . Gradual rehabilitation began in week 5, with unloaded exercises, improving muscle strength via isometric exercises, and active exercises (elevation and abduction without loading). Normal activity was resumed after 25 months, mean: 3.5 months, after the surgery . During a post - operative follow - up examination, performed after operation from 6 to 12.5 years, mean 8.2 ., by members of our shoulder team, patients were asked if they had resumed activities such as sport or employment and if they experienced any pain . Any recurrences of dislocations and/or subluxations were recorded together with the degree of limitation of daily activity . A physical examination involved the apprehension test, the anterior drawer test and range of motion assessment . A precise analysis of treatment outcomes was afforded by comparing pre- and post - operative questionnaires according to the rowe scale and the university of california at los angeles rating system (ucla). The duration of surgery, length of hospital stay and the rate and types of recurrences and complications were also noted . The statistical analysis to confirm or reject the presence of correlations between the patients medical conditions, their causes and surgical treatment outcomes expressed according to the ucla and rowe scales employed a number of statistical tests and methods . Pearson s linear correlation coefficients (r) were calculated for interval variables (age, treatment outcomes, etc . ). Multiple regression was also used to evaluate the effect of the test variables on the values of the dependent variables . The t test was also used to evaluate significance of differences if a sample was large enough (n>50). Some results measured according to scales employing different values were unified before they were compared . History taking involved detailed questions about the number of dislocations, date and circumstances of the initial dislocation, circumstances of subsequent dislocations, a sense of apprehension, past treatment and the degree of daily activity: practising sport and the type of occupation . A physical examination included the apprehension test, anterior drawer test, posterior apprehension test, posterior drawer test and sulcus test in all patients . All patients enrolled in the study underwent a ct scan in order to assess damage to bone tissue: bony bankart lesions, hill - sachs lesions and an mri scan to assess damage of soft tissues: rotator cuff tears, superior labral antero - posterior lesion (slap lesion), humeral avulsion glenohumeral ligament (hagl), rotator interval lesions . All patients were operated on by the same surgeon under general anaesthesia in a lateral decubitus position . The weight was chosen so as to afford the best possible visualization of the joint . The type of bankart lesion was assessed, and any additional lesions, such as rotator cuff tears, superior labral antero - posterior lesion (slap lesion), humeral avulsion of the glenohumeral ligament (hagl), rotator interval lesions, bony bankart lesions or engaging hill - sachs lesions, were identified . The hill - sachs lesion was assessed according to the criteria presented by burkchard and de beer (engaging / non - engaging). The working cannula was always positioned in the anterior inferior portal using the inside - in technique . After insertion of a cannula, the glenoid labrum and glenohumeral ligaments were separated from the glenoid and the antero - inferior bony part of the glenoid was scarified with a rasp . The labroligamentous complex was always reconstructed with fastak 2.8 mm suture anchors (fastak, arthrex, naples, florida). Two or three implants were used, depending on the extent of injury . In each patient, the most distant implant (at 5:30 in the right shoulder, at 6:30 in the left shoulder) was mounted first, followed by mounting an implant at 3:30 for the right shoulder and 8:30 for the left and, in patients who received 3 implants, at 2:30 and 9: 30 respectively . A diagnosis of anterior post - traumatic shoulder instability based on: a history of 2 or more documented dislocations, a positive apprehension test and anterior drawer test on physical examination, no previous surgery, no bony lesions of the acetabulum as confirmed by a ct scan, presence of a bankart lesion confirmed by an mri scan and a non - engaging hill - sachs lesion with a definitive diagnosis ascertained intraoperatively . Posterior instability, multidirectional instability, voluntary instability diagnosed on history taking and confirmed by physical testing, glenoid fracture documented by a ct scan, previous surgery for shoulder instability, joint laxity, anatomic variants, neurological symptoms, additional problems: rotator cuff tears, superior labral antero - posterior lesion (slap lesion), humeral avulsion glenohumeral ligament (hagl), rotator interval lesions, bony bankart lesions, engaging hill - sachs lesions diagnosed on the basis of history and physical examination, with a definitive diagnosis ascertained intraoperatively . After surgery, the joint was immobilized in adduction and internal rotation for 4 weeks . During this period of immobilization, the patients were instructed to exercise their hand joints and the elbow joint 34 times daily for 10 minutes, making extension, flexion and rotatory movements . Gradual rehabilitation began in week 5, with unloaded exercises, improving muscle strength via isometric exercises, and active exercises (elevation and abduction without loading). Normal activity was resumed after 25 months, mean: 3.5 months, after the surgery . During a post - operative follow - up examination, performed after operation from 6 to 12.5 years, mean 8.2 ., by members of our shoulder team, patients were asked if they had resumed activities such as sport or employment and if they experienced any pain . Any recurrences of dislocations and/or subluxations were recorded together with the degree of limitation of daily activity . A physical examination involved the apprehension test, the anterior drawer test and range of motion assessment . A precise analysis of treatment outcomes was afforded by comparing pre- and post - operative questionnaires according to the rowe scale and the university of california at los angeles rating system (ucla). The duration of surgery, length of hospital stay and the rate and types of recurrences and complications were also noted . The statistical analysis to confirm or reject the presence of correlations between the patients medical conditions, their causes and surgical treatment outcomes expressed according to pearson s linear correlation coefficients (r) were calculated for interval variables (age, treatment outcomes, etc . ). Multiple regression was also used to evaluate the effect of the test variables on the values of the dependent variables . The t test was also used to evaluate significance of differences if a sample was large enough (n>50). Some results measured according to scales employing different values were unified before they were compared . All patients had sustained their initial dislocation as a result of an injury . In 56 (60.8%) cases, these were sports injuries, and in 36 (39.2%), the causes were various types of high - energy injuries . The number of dislocations per patient ranged from 2 to 30 (figure 1). In 49 (53.3%) cases, all those patients received three implants . In 43 (46.7%) cases, the zone of injury extended from 3 to 6 oclock and two implants were used . Based on the 4-level rowe scale, there were 71 (81.5%) excellent results, 12 (12.6%) good results, 5 (5.3%) satisfactory results and 2 (2.1%) poor results in the study group (figure 2). The mean pre - operative rowe score was 41 (range: 1580), compared to a mean post - operative score of 90 (range: 25100). That was a statistically significant improvement (p=0.00) in treatment outcomes according to the rowe scale post - operatively . Pre - operative ucla scores were 1124, mean 19.9, compared to post - operative scores of 1235, mean 33.5, representing a statistically significant improvement in ucla scores post - surgery at p=0.00 . The pre and post - operative rowe and ucla scores are presented in table 3 . For better visibility of the differences, rowe scores are grouped in 10-point intervals (figure 3) and ucla scores are grouped in 5-point intervals (figure 4). An analysis of correlations between the two scores pre and post - surgery revealed a significant (p=0.001) correlation between pre - operative rowe scores and post - operative ucla and a significant correlation (p=0.0001) between post - operative rowe scores and post - operative ucla (table 4). No statistically significant correlation was found between age, sex, handedness, age at first dislocation and interval between the first dislocation and surgery and treatment outcomes according to either scale . The outcomes of patients with a labral injury between 2 and 6 oclock, who received 3 implants, were also compared with those of patients with a labral injury between 3 and 6 oclock, who received 2 implants . No statistically significant correlations were ascertained in the two groups between the rowe and ucla scores as outcome markers vs. extent of injury or number of implants . Post - surgery, 4 (4.3%) patients had a positive apprehension test, and 2 (2.1%) had a positive anterior drawer test . The observed limitation of external rotation compared to the healthy limb was 025, mean 6. the duration of hospital stay was from 2 to 5 days, mean 3 days . The duration of the operation was 20110 minutes, mean 35 minutes . 87 (94.6%) of the patients fully resumed their activities from the period before the initial dislocation, with 5 (5.4%) reporting functional limitation of various severity . In 4 (4.3%) patients, the limitation was due to fear of new dislocation and in 1 (1.1%) it was due to a limited range of motion . There were 9 (9.7%) cases of recurrence in the study group in 6 male and 3 female patients . The mean interval between surgery and re - dislocation was 2 years (range: 0.52.5 years). All cases were due to the patient suffering another high - energy injury . In 7 cases, re - dislocation occurred during intensive contact sport practice, including 3 re - dislocations during football practice, 1 during basketball practice, 2 during handball practice, and 1 during judo practice . One re - dislocation occurred while the patient was practising a non - contact sport (snowboarding) and one was the result of an accident at work (fall from a height). Of the patients with a recurrence, 6 required surgery, which was performed as an arthroscopic procedure in 4 patients and as an open procedure (latarjet procedure) in 2 . Three patients with re - dislocation were treated conservatively with 4 weeks of immobilization followed by rehabilitation . In the group of patients with recurrences, analysis of the causes of recurrences showed a statistically significant correlation between recurrences and the practising of contact sports (p=0.0001). Apart from the re - dislocations, one cause of a neurological complication (axillary nerve praxia) was noted (1.1%). A number of surgical methods are used in the operative treatment of post - traumatic anterior shoulder instability . The main criterion underlying the choice of a particular technique is the predicted risk of subsequent dislocation following surgery . The literature indicates that the risk of recurrence depends on age, sex, number of previous dislocations, everyday activity, the extent of fracture of the glenoid and the presence of a hill - sachs lesion . Until quite recently, open procedures were regarded as a gold standard in the treatment of shoulder instability, with proponents of open surgery arguing primarily that arthroscopic techniques were associated with a higher rate of recurrences . The arthroscopic approach is now gaining in popularity and more and more authors are reporting good treatment outcomes that are not different from those obtained following open surgery [2931]. At the same time, the recurrence and complication rates continue to be high [1618]. Our study enrolled a selected group of patients as homogeneous as possible with regard to intraarticular lesions . This made possible the exclusion of patients presenting lesions that could influence treatment outcomes . To this end, we only enrolled patients with the bankart lesion and the non - engaging hill sachs lesion . All patients in our study presented the bankart lesion and 98% also presented the hill sachs lesion . Similar results were obtained by yiannakopoulos in an investigation of the incidence of intraarticular lesions in patients with post - traumatic anterior shoulder instability in a group of 104 patients, where the bankart lesion was found in 97% of the study group and the hill sachs lesion in 93% . The inclusion criteria described above did not involve any limitations with regard to epidemiological data or the level of daily activity . This made possible an evaluation of treatment outcomes in a group of patients with specific patterns of injury while also accounting for the effect on these outcomes of such variables as age, sex, number of previous dislocations or time from the first dislocation to surgery . Existing publications describe late outcomes of post - traumatic anterior shoulder instability, but there still is a scarcity of studies involving large homogeneous samples . The present paper describes treatment outcomes in a group of 92 patients (92 shoulders) followed up for a mean of 8.2 years . An evaluation in terms of rowe scores yielded 71 (81.5%) excellent, 12 (12.6%) good, 5 (5.3%) satisfactory and 2 (2.1%) poor outcomes . The post - operative rowe scores (mean: 90, range: 25100) represented a statistically significant improvement . Our results were compatible with late outcomes presented by other authors: franceschi (8 years follow up) reports rowe scores of 88, kim (6.4 years follow up) had rowe scores of 90 and castagna (10.9 years follow up) reported a rowe score of 80 . Outcomes according to the ucla scores were also significantly better post - surgery with a range of 12 to 35 and a mean score of 33.5 . These were also not different from those reported by other authors: ee 32.4 (2 years follow up) or castagna 32 (10.9 years of follow up). Accordingly, an important aspect of the study was the evaluation of the percentage of patients who were able to resume the level of activity that they had enjoyed prior to the initial dislocation . The patients in our study experienced 9 (9.7%) recurrences, all of which were due to another high - energy trauma (table 5). Kim et al . Reported a recurrence rate of 6%, including two recurrences related to an injury; castagna recorded a recurrence rate of 23%, where 16% were not related to an injury and 7% were post - traumatic; and franceschi reported a recurrence rate of 17% . Of the patients with a recurrence in our study, 6 required repeat surgery, with 4 arthroscopic procedures and 2 open procedures (latarjet procedure). Three patients did not need repeat surgery . Of the patients who suffered re - dislocations, one experienced re - dislocations following conservative treatment, but he did not agree to have another surgery and his treatment outcome remains poor . The remaining patients, 611 (mean 9) years since surgery, have remained free of signs of instability and have resumed their previous activity levels . An analysis of treatment outcomes accounting for the effect of epidemiological factors and daily activity on treatment outcomes failed to reveal a statistically significant correlation between age at first dislocation, sex, number of dislocations, time between first dislocation and surgery or the number of implants . Similar data have been obtained by: boileau et al . And ee et al . . The finding of no correlation between age / sex and treatment outcomes is not consistent with other reports . There was one case of axillary nerve praxia in our sample that was due to malpositioning of an implant (figure 5). The female patient was re - operated and the implant was removed and a new one was placed at a different location . After the second operation, the symptoms resolved over 4 months . The implant protruded above glenoid surface and over 2 years (during which the patient did not report to the hospital) destroyed the articular surface of the humeral head, which eventually led to extensive damage to the articular surface and deformity of the humeral head (figure 6). The underlying cause, as in the patients described above, was malpositioning of the implant and also the fact that the patient worked as a security guard . The patient is not being prepared for shoulder joint capoplasty and his treatment outcome, just like the outcome of the patient discussed above who did not agree to undergo another surgery, remains poor . Recapitulating this discussion, it should also be mentioned that many authors will still choose open surgical techniques for shoulder joint instability, basing their decisions mainly on data suggesting a lower incidence of post - operative recurrences . However, the results obtained and presented in this paper contradict the validity of this approach to the treatment of shoulder joint instability . It is our opinion, and it has been corroborated by data from other authors, that arthroscopic treatment using suture anchors is just as effective and is not associated with a higher incidence of recurrences, while its advantages include its low invasiveness and quick resumption of pre - surgery activity levels . First, the study was retrospective and it was not randomized and there was no control group . With rigorous criteria for qualifying patients for surgery, as described in this article, arthroscopic treatment of post - traumatic anterior shoulder instability produces good outcomes and low recurrences and complication rates irrespective of the number of previous dislocations, age, or sex.
Colorectal cancer is one of the most commonly diagnosed malignancies in western countries and represents a major cause of morbidity and mortality associated with cancer 1 . Detection and endoscopic resection of early stage colorectal tumors as well as precursor lesions is a well established approach to prevention and treatment of colorectal cancer . Endoscopic mucosal resection (emr) is usually used for endoscopic removal of flat and sessile lesions of the large bowel . For tumors measuring 20 mm it is especially difficult to determine the lateral spread of the tumor to ensure complete removal . Piecemeal resection is associated with a higher rate of local tumor recurrence in comparison with en bloc emr 2 3 4 . Endoscopic submucosal dissection (esd) is a novel therapeutic procedure with the major advantage being its ability to achieve a high level of en bloc resection and low level of local recurrence for flat and sessile colorectal lesions regardless of size . On the other hand, colorectal esd is associated with significant technical difficulty, longer procedure time, and increased risk of complications, especially perforations, in comparison with emr 5 6 . Colorectal esd is considered to be a more difficult and dangerous procedure than gastric esd . In japan, it is necessary to gain experience in gastric esd before starting to practice esd in the colon, usually under the supervision of an expert 7 8 . In western countries, it is very difficult to follow the same learning pattern because of the different epidemiological situation (the incidence of gastric cancer is higher in japan and a lower percentage of cancers are diagnosed at an early stage in the west) and the very limited number of practitioners with expertise in colorectal esd 8 . Several factors have been implicated in an increased risk of incomplete or complicated dissection 9 10 . It is important to establish a better approach to the difficulties of implementing colorectal esd during the learning period in western settings, as well as the factors associated with the risk of complications . We report our experience with esd for sessile and flat rectal and sigmoid colon lesions in a high - volume center in russia . During the period from november 2009 to september 2013, 44 patients with sessile and flat rectal and sigmoid colon lesions underwent esd at the department of endoscopy, vladivostok clinical railway hospital (russia). The clinical indications for esd included sessile and flat rectal and sigmoid colon lesions with one of the following features: (1) tumor size 20 mm; (2) tumor recurrence after previous emr . All of the relevant data have been taken from the standard esd protocol adopted by the department . Lesion size has been estimated by comparison with the span of open (7 mm) biopsy forceps (fb-24u-1; olympus, japan). The colonic preparation was achieved by administration of a split - dose (2 and 2 liters) of macrogol 4000 solution (beaufour ipsen international, france) before the procedure . All of the patients underwent conscious sedation using the intravenous administration of propofol and analgesia with fentanyl . One endoscopist with experience in endoscopic mucosal resection in the large bowel (more than 200 cases) performed all procedures . Procedure time, tumor size and location, gross morphology, the presence of fibrosis, and morphological findings were analyzed . The main outcomes were en bloc and r0 resection rate, and number of perforations . For an analysis of the learning curve, the whole study time was divided into two periods: first period: resections 1 22, the degree of submucosal fibrosis was classified into three types: f0, no fibrosis; f1; mild fibrosis; f2, severe fibrosis 10 . Total procedure time was defined as the time between the beginning of the submucosal injection and the completion of the dissection . Complications were classified as immediate (during the procedure) or delayed (after completion of the procedure). Perforation was defined as a hole in the muscle layer detectable endoscopically with free air outside the colonic lumen demonstrated on image studies . Bleeding was considered clinically relevant in the case of a hemoglobin drop 1 g / dl . The esd procedure was classified as technically difficult in the case of procedure time> 120 minutes and/or piecemeal resection . Esd procedures were conducted with a gastroscope (eg-530 d, fujifilm europe gmbh, germany) with a disposable distal attachment (d-201, olympus, japan or dh-28gr, 29cr; fujifilm medical co., japan) on the tip . A vio 200 d electrosurgical unit (erbe elektromedizin, germany) was used for electrical cutting and coagulation . Carbon dioxide insufflation with a gw-1 delivery system (fujifilm europe gmbh, germany) was used in all esd cases . A 10% glycerin solution was used for submucosal injections using a 21-gauge injection needle (nm-400l-0421, olympus, japan) outside the tumor margin . A flush knife or flush knife - bt with a 2.0-mm - long tip (fujifilm europe gmbh, germany) connected to a waterjet pump was used to perform all steps in the esd procedure: mucosal cut (endo cut i regime, effect 2, duration 3, interval 3), submucosal dissection (forced coag regime, effect 2, 40 w), and small - vessel coagulation (soft coagulation regime, effect 7, 100 w). Submucosal injection of 10% glycerin solution (via injection needle) and waterjet injection of saline solution using the flush knife were repeated during the procedure to maintain sufficient submucosal elevation during the procedure . A hemostatic forceps (coagrasper, fd-411ur, olympus) was used to prevent or stop significant bleeding from large vessels and to coagulate visible vessels in the post - procedure ulcer base (soft coagulation the specimen was stretched and pinned onto a hard plate before being sent to the pathology department . Histological evaluation was performed according to the standard principles for colorectal emr and esd specimens 11 . The pathological diagnosis was based on the vienna classification of gastrointestinal epithelial neoplasia 12 . En bloc resection was defined as when the lesion was resected as a whole piece, and r0 resection was when the resected specimen was revealed to be free of tumor in both vertical and lateral margins . Local recurrence was defined as a histopathologically confirmed neoplastic lesion found at the site of the esd scar . All patients received detailed information about the procedure, alternative approaches, risks of complications and additional surgery, and provided written informed consent before participating in any protocol - specific procedures . All data were analyzed using the chi - squared test and fisher s exact tests . For lesion size and procedure time, the pearson correlation coefficient was used to measure the strength of the association between two variables . Forty - four patients took part in the study (23 men, 21 women). The mean age of the patients was 63.84 1.46 years (range 41 the mean size of the tumors was 34.77 3.26 mm (range 10 120 mm). All tumors were situated in the rectum or sigmoid colon . According to the paris classification correlation between the serial number of the esd procedure and both the tumor size and procedure time was weak (r = 0.19 and 0.17, respectively). Table 1 shows the tumor characteristics, resection rates, and procedure time during the two study periods . In 37 cases (84.1%), four tumors were removed in two fragments, and three tumors in three to four fragments . The mean size of the lesions removed in piecemeal fashion was higher than that for tumors resected en bloc, 44.0 4.55 mm and 33.03 3.73 mm, respectively, but the difference was not statistically significant (p = 0.22). Histological examination revealed low grade dysplasia, high grade dysplasia and cancer in 10, 22, and 12 cases, respectively . Lgd, low grade dysplasia; hgd, high grade dysplasia . The mean procedure time was 119.95 11.22 minutes (range 25 360 minutes). There was a high direct positive correlation between tumor size and operation time (r = 0.83, p <0.0001, 0.95 and 0.99 confidence interval for rho 0.71 0.904). Operation time was shorter in the en bloc resection group than in the piecemeal group, 108.75 12.03 minutes and 179.14 19.85 minutes, respectively (p = 0.019). The mean procedure time did not differ between the first and second 22 esd interventions: 101.85 11.74 minutes and 136.47 18.18 minutes, respectively (p = 0.12). Severe, mild and absent submucosal fibrosis were diagnosed in 15.9%, 15.9%, and 68.2% of cases, respectively . Tumor size was not a significant predictor of severe fibrosis, although the mean size of the lesions with f2 fibrosis was higher than that for tumors with f0 f1 fibrosis, 40.0 5.34 mm and 33.78 3.74 mm, respectively (p = 0.49). Three out of seven f2 tumors were flat (two lst - ng (laterally spreading tumor, non - granular type) and one iia) and four were sessile (is). One lesion (lst - ng) was situated on the anastomotic site and in one case (iia), there was a recurrence after unsuccessful emr . Severe submucosal fibrosis was diagnosed in four out of seven cases of piecemeal esd and in three cases of en bloc resection (p = 0.0074). The procedure in patients with f0 f1 fibrosis was shorter than in patients with f2 fibrosis, 111.75 12.22 minutes and 162.28 23.88 minutes, respectively, but the difference did not reach the level of statistical significance (p = 0.093). All cases of perforation were diagnosed during the procedure and were successfully treated with endoscopic clipping . A sigmoid colon perforation treated with endoclips is shown in fig . 1 . Endoscopic submucosal dissection (esd) in the sigmoid colon . A laterally spreading tumor, non - granular, pseudo - depressed type (lst - ng - pd) in the sigmoid colon; b marking around the tumor borders; c dissection of the submucosa (f2 fibrosis); d visible perforation hole; e perforation was closed with clips and endoloops; f scar 4 months later . Three perforations occurred during the first half and two during the second half of the esd procedures . There was no difference between procedures complicated by perforation and uneventful esd by tumor size (31.0 6.0 mm and 35.25 3.61 mm, respectively p = 0.68) and resection time (104.0 23.48 minutes and 122.0 12.35 minutes, respectively p = 0.62). At the same time, severe submucosal fibrosis was diagnosed in four out of five cases complicated by perforation and in three cases of uneventful esd (p = 0.0012). Table 2 shows the comparison of tumor and procedure characteristics in patients with and without perforations associated with the esd procedure . In total, 19 procedures (43.1%) were classified as technically difficult due to the following factors: procedure time> 120 minutes, 12 patients; combination of procedure time> 120 minutes and piecemeal resection, six patients; and piecemeal resection, one patient . Mean tumor size was significantly larger in the difficult esd group compared with the standard esd group, 48.31 5.96 and 24.48 1.75 mm, respectively (p = 0.0001). The majority of difficult esd procedures were performed for tumors of the sigmoid colon, but the difference did not reach a level of significance (p = 0.06). Table 3 shows a comparison of the tumor characteristics in the standard and difficult esd groups . No cases of clinically significant intraprocedural or postprocedural hemorrhage were noted . There were two cases of self - limited postprocedural hemorrhage, and no cases of surgery or death associated with complications of esd . Two patients had cancer with submucosal invasion> 1 mm and one had a blood vessel invasion . Endoscopic mucosal resection (emr) is a well - established method for treatment of colorectal epithelial neoplasms . In lesions larger than 20 mm and in cases of severe submucosal fibrosis, emr often results in piecemeal resection associated with the difficulties of histopathological assessment of r0 resection, the risk of incomplete resection and local recurrence 2 3 4 . Endoscopic submucosal dissection (esd) is a relatively new technique that is now established in japan for en bloc resection of large benign and early malignant lesions 13 . While esd reduces local recurrence rates compared to emr, it is technically challenging, risky, and time consuming 5 6 14 . Compared with gastric lesions, esd in the colorectum is more difficult owing to anatomical features owing to its technical difficulty, complication risks, and relatively long learning curve, esd for colorectal lesions is rarely used in western countries and emr is currently the standard treatment . A step - by - step approach to accumulating experience in colorectal esd is desirable for adopting this technique 7 8 . Before first attempting esd in the large bowel, experience with at least 30 gastric esd cases has been recommended in japan 16 17 . In the west, opportunities to follow a japanese esd training algorithm are limited by the low rates of early gastric cancer 8 18 . At the same time, a number of authors have reported a relatively rapid learning curve and low complication rats for colorectal esd 19 20 21 . Several factors, including tumor location and size as well as severe submucosal fibrosis have been implicated in an increased risk for incomplete or complicated dissection 9 10 . The incidence and implications of these factors during the learning curve have as yet not been well established . In this single - center study, the results of 44 esd procedures for rectal and sigmoid colon lesions have been described . All interventions have been performed by a single specialist with experience in endoscopic mucosal resection in the large bowel and with limited experience (19 cases) of gastric esd . The en bloc and r0 resection rates were the same 84.1% . These figures are lower than reported by authors from high volume asian centers 14 22 23, but comparable to en bloc and r0 resection rates according to european data 19 21 24 . Procedure time in the study (120 minutes) was much longer than reported by japanese authors 14 22 23 . However, the current results are comparable to western data presented by probst et al . Larger tumor size and piecemeal resection were associated with longer procedure times in the current series . Tumor size is regarded as one of the factors predicting the procedural time of esd, at least for gastric lesions 25 26 . Inability to perform en bloc esd usually reflects a difficult procedure that, in turn, leads to increased time required for the intervention 9 . In this study, at the same time, larger tumor size was the single significant risk factor for technically difficult esd . Almost two - thirds of difficult esds were performed for lesions of the sigmoid colon . 10 reported that, in cases of lesions with severe (f2) fibrosis, the rate of complete en bloc resection was low, and did not improve significantly even with growing operator experience . Several studies have demonstrated that the presence of fibrosis is an independent risk factor for perforation during colorectal esd 10 27 . At the same time, tumor size and location are conceded by several authors to be factors associated with difficult esd and increased risk of perforation 9 28 . Several factors have been implicated as a cause of severe submucosal fibrosis: previous emr attempts, multiple biopsies and inflammatory bowel disease . There are also reports that the macroscopic characteristics of the lesions can be used to predict the risk of fibrosis, but the results are still controversial . Different authors have suggested that the incidence of f2 fibrosis was higher in lst - g (laterally spreading tumor, granular type) 10 or lst - ng and large is tumors 9 . In our series, f2 fibrosis was reliably predicted by patient s history (previous unsuccessful emr) and characteristics of the lesion (tumor on the anastomosis site) in two cases . In another five cases of severe fibrosis, large (> 40 mm in diameter) sessile lesions (four tumors) prevailed . A relatively long period of growth in combination with chronic traumatization due to peristaltic movements can explain the high risk of fibrosis in such lesions . The possible role of endoscopic biopsy has not been analyzed owing to lack of relevant data . The number of perforations (11.4%) in our study was high in comparison to most of the published data (1.8 7.4%) 14 21 22 . To the best of our knowledge, the highest level of perforations during colorectal esd (20.4%) was reported by kim et al . The level of perforations would have been regarded as unacceptable if surgery had been required for correction . Fortunately, most perforations can be managed successfully with nonsurgical treatment 14 22 23 27 . We failed to show any difference in procedure time, en bloc resection rate as well as in the number of perforations between the first and second 22 interventions . Probst et al . Reported that a clear learning curve was apparent over time, with resection rates increasing and procedure times decreasing significantly after the first 25 esd procedures in the rectosigmoid 19 ., the operating time per square centimeter significantly decreased after 20 esd procedures 20 . At the same time, based on their analysis of 120 colorectal esds, hotta et al . Concluded that approximately 40 procedures were sufficient to acquire skill in avoiding perforations during the esd procedure, and approximately 80 procedures must be carried out to acquire skill with esd for large colorectal tumors 28 . According to sakamoto et al ., trainee endoscopists with experience in gastric esd can perform it safely and independently in the colon after preparatory training and experience with 30 cases . At the same time, the authors mentioned that the procedure time and en bloc resection rate were not significantly different among the training periods 29 . Saito et al . Reported that the risk of perforation was related to the number of esd procedures performed, that is, the risk is higher when the endoscopist had performed less than 100 procedures 30 . The main limitations of this study include the fact that it was a single center study and limited to lesions of the distal colon . We can conclude that esd in the distal colon is feasible, effective, and a relatively safe procedure for western endoscopists . Despite the substantial rate of perforations, severe submucosal fibrosis was an important factor associated with a low rate of en bloc resection and a high risk of perforation during the learning curve for colorectal esd . It might be reasonable to start with smaller lesions and avoid cases with predictable f2 fibrosis during the training period . Colorectal esd is associated with a relatively long learning curve, and 22 esd cases might not be sufficient to improve en bloc resection rates, reduce procedure times and the number of perforations during a further 22 resections . Prospective randomized trials comparing emr and esd are awaited in europe to demonstrate the long - term results, the benefit of esd over piecemeal emr and also to determine the indications for esd vs. emr in different clinical settings.
A - t is a neurodegenerative disease characterized by progressive cerebellar degeneration, immunodeficiency, cancer predisposition, premature aging, growth retardation, gonadal atrophy, high sensitivity to ionizing radiation, and genomic instability [16]. Many studies have suggested that a deficiency in the ability to repair dna double - strand breaks (dsbs) is the main cause of the a - t phenotype . A major breakthrough in understanding the pathophysiology of a - t came with the identification of the defective gene, atm (ataxia - telangiectasia mutated), which is mutationally inactivated in individuals with the disease . The identification of atm has facilitated rapid progress in understanding many aspects of the molecular basis of this disease . The atm protein is a serine - threonine kinase that undergoes autophosphorylation in response to dna damage and subsequently initiates a signaling cascade that involves the phosphorylation of several down - stream substrates, including p53, p53bp1, chk2, brca1, and trf2 [7, 9, 10]. Recently, substantial insight has been obtained regarding the mechanism by which atm signals to effector proteins after dna double - strand breaks have occurred . Although atm is an essential factor for sensing and signaling the repair of dsbs, other factors such as the mrn complex (mre11/rad50/nbs1) may play an important upstream role in the activation of atm . In addition, atm is a member of a large protein complex called the brca1-associated genome surveillance complex, suggesting that dna damage recognition and signaling also involve other proteins, several of which are substrates for atm . A vast amount of literature has demonstrated the role of atm in regulating a damage response pathway that ultimately leads to cell cycle checkpoint arrest, dna repair, or apoptosis . Understanding this role of atm has explained the predisposition of a - t patients to develop immunodeficiency and cancer but has not explained the observed neurodegeneration . A global quantitative analysis of proteins associated with the a - t phenotype from a - t patient samples has not yet been reported but might shed new light on this dilemma . One of the goals of proteomics is to measure and characterize the protein expression profiles in specific tissues and biofluids . Even though a tremendous effort has been made to improve proteomic technologies, there are still numerous challenges associated with even the most advanced technologies when analyzing global protein expression due to the inherent complexity of clinically relevant biological samples . These challenges include: (1) the sensitivity of the instrument and its ability to identify novel proteins, (2) the need to be moderate to high throughput, (3) the wide range of protein masses and abundances (dynamic range) that need to be covered, (4) the ability to quantitatively analyze protein expression and posttranslational modifications, and (5) access to the appropriate tissue and/or biofluid . With the recent development of a label - free protein quantification technology, large - scale and highthroughput analysis of complex biological samples has become possible which has overcome some of the challenges in proteomics [1518]. This unique technology combines a proprietary sample preparation protocol, the lc / ms method, and statistical data analysis tools to quantitatively analyze proteins from whole tissue homogenates, cell lysates, or depleted serum / plasma samples . In this work, we used cerebrospinal fluid (csf) samples from a - t patients and age- and gender - matched unaffected controls to identify and verify potential biomarkers of a - t . Csf was selected as it has been shown to be a relevant biological sample to study other neurodegenerative diseases such as alzheimer's disease (ad), and to study changes in the predominant clinical phenotype of a - t (neurodegeneration) that have not been addressed in previous studies [2022]. Urea, ammonium carbonate, ammonium bicarbonate, mass - spectrometry grade formic acid, 2-iodoethanol, triethylphosphine and proteoprep spin cartridges were all purchased from sigma - aldrich (st . Louis, mo, usa). Hplc - grade water and acetonitrile were from burdick & jackson (muskegon, mich, usa). We contacted all adults (18 years of age) with a - t followed at the a - t clinical center at johns hopkins medical center . The diagnosis of a - t was made by the combination of three observations: (1) characteristic neurologic abnormalities such as oculomotor apraxia, bulbar dysfunction and postural instability, (2) occulocutaneous telangiectasia, and (3) at least two of the following laboratory abnormalities: elevated serum alpha - fetoprotein level, absence of atm on a western blot, increased rate of x - ray induced chromosomal breakage in comparison to a control population, and/or mutations in both alleles of the atm gene . Controls were otherwise healthy individuals having a lumbar puncture performed for a clinical indication (e.g., suspected pseudotumor cerebri or evaluation of chronic headache) and found not to have another neurologic disease . The institutional review board of the johns hopkins medical institutions approved the study, and informed consent was obtained from every subject . The csf samples were collected at johns hopkins hospital (baltimore, md, usa). The first 4 ml of csf were used for standard chemistry and hematology tests . The next 1 ml was collected for proteomic analysis, immediately transported to the laboratory, and frozen at 80c . The a - t group consisted of eight patients, six women and two men, ranging in age from 20 to 26 years old (mean s.d ., 22.17 2.13 years) (table 1). As determined by the bradford protein assay, the total csf protein concentration in all samples ranged from 211.5 g / ml to 441.5 g / ml with a mean of 288.5 93 g / ml . The control group consisted of five gender- and age - matched healthy controls . In the control group, the mean csf protein concentration was 200.7 81 g / ml, ranging from 98.9 g / ml to 369.9 g / ml . Aliquots of csf were stored in polypropylene tubes at 80c until use . The two most abundant serum proteins, albumin, and igg were removed from the csf samples using proteoprep spin columns . Depleted csf samples were denatured by 8 m urea for 1 h with agitation at room temperature . Chicken lysozyme (0.25 g, used as qa / qc reagent) and a volatile reduction / alkylation solution (97.5% acetonitrile, 2% iodoethanol, and 0.5% triethylphosphine) were added to each sample, and the solutions were incubated at 37c for 1 h according to a previously published procedure . The resulting pellets were redissolved in 100 l of 100 mm ammonium bicarbonate (ph 8) containing 0.4 g of modified trypsin (promega) and incubated for 4 h at 37c . After a second addition of trypsin all samples containing the tryptic peptides were filtered through a 0.45-m filter (millipore, billerica, mass, usa) to avoid column clogging in lc / ms analysis . Tryptic peptides (2 g) were analyzed by a thermo - fisher scientific ltq linear ion - trap quadrupole mass spectrometer interfaced with a nano - electrospray ion source built in - house . The trapping column (nanoease, c18 column, 18 m 23.5 mm, waters, milford, mass, usa) and analytical column (nanoacquity uplc beh c18 column, 1.7 m, 100 m 100 mm, waters) were used for peptide separation . Solvent a contained 99.9% hplc - grade water and 0.1% formic acid, and solvent b contained 99.9% hplc - grade acetonitrile and 0.1% of formic acid . The peptides were eluted with a linear gradient from 5 to 50% solvent b developed over 150 min at a flow rate of 200 nl / min, and effluent was electrosprayed into the ltq mass spectrometer . Triple - play mode (ms scan, zoom scan, and ms / ms scan). Protein database searches against the international protein index (ipi) human database (v3.60) and the ncbi non - redundant - homo sapiens database (updated in june 2009) were carried out by both the sequest (thermo - fisher scientific, waltham, mass) and x!tandem (an open - source software available from the global proteome machine organization, http://www.thegpm.org/) database searching algorithms . Identified proteins were categorized into two priority groups based on the quality of the peptide identification and the number of unique peptides identified . All the proteins were identified with at least one best peptide identified at a confidence level 90% (q - value 0.1, q - value represents a false - discovery - rate or fdr which was described previously [14, 21]) or higher . Proteins were assigned to priority 1 if two or more unique peptides were identified or priority 2 if only a single peptide was identified . Peptides assigned to proteins with a confidence level of less than 90% were filtered out of this study . The estimation of the confidence levels, which is based on a random forest recursive partition supervised learning algorithm was described previously . Protein quantification was carried out using a proprietary protein quantification algorithm licensed from eli lilly & company (indianapolis, ind, usa) as described previously . Briefly, once the raw files were acquired from the ltq, all extracted ion chromatograms (xics) were aligned by retention time . To be used in the protein quantification procedure, each aligned peak must match the parent ion, charge state, fragment ions (ms / ms data), and retention time (within a 1-min window). After alignment, the area - under - the - curve (auc) for each individually aligned peak from each sample was measured, quantile normalized, and compared for relative abundance . Quantile normalization was employed to ensure that every sample has a peptide intensity histogram of the same scale, location, and shape . This normalization removes trends introduced by technical variations including sample handling, sample preparation, total protein differences, and changes in instrument sensitivity while running multiple samples . If multiple peptides have the same protein identification, then their quantile normalized log2 intensities were averaged to obtain log2 protein intensities . The log2 protein intensity is the final quantity that is fit by a separate anova statistical model for each protein (1)log2(intensity)= group + sample(group). Group effect refers to the effect caused by the experimental conditions or treatments being evaluated . All of the injections were randomized, and the same person operated the instrument for all samples in this study . The inverse log2 of each sample's mean was calculated to determine the fold - change between groups . Lda was performed using jmp (version 8) to separate the a - t group from the control group . The individual protein intensities of 13 priority 1 proteins that showed significant expression changes were used as input for this analysis . The least number of proteins that gave the best discrimination between the two groups were selected as biomarker candidates . After lda, a list of five proteins that could be used to distinguish a - t from normal samples was created and analyzed by pathway studio (v6.0) (ariadne, rockville, md, usa) in an attempt to link them with the key a - t protein atm . Briefly, the proteins' corresponding gene list was run against the resnet database that is equipped with functional relationships from other scientific literature and commercial databases . Add shortest path and protein . Protein interactions and the biological processes in which they were involved were noted . The information received was further explored in the literature to determine the interactions and regulatory relationships between the proteins of interest and atm . To verify and validate the candidate biomarkers of a - t, an mrm - based targeted proteomic analysis was performed to quantify the relative protein expression levels between the control and a - t patient samples . An ab / sciex 4000 qtrap mass spectrometer interfaced with a dionex ultimate 3000 hplc system was used for this targeted proteomic quantification study . In this study, five candidate proteins (listed in table 4) were selected for verification / validation . The analytes, which were the same tryptic peptides used for the label - free discovery study, were first loaded onto a trapping column (75 m i.d . 20 mm) and then onto an analytical column (75 m i.d . 150 mm packed in - house with c18 3 m reversed phase resin), where they were eluted using a gradient of 545% acetonitrile with 0.1% formic acid at a flow rate of 300 nl / min over 60 min . Source temperature was set at 160c, and source voltage was set at 2400 v. the collision energy (ce) for each transition was calculated from the equations ce = 0.05 * (m / z) + 8 for (m + 2h) ions and ce = 0.044 * (m / z) + 8 for (m + 3h) ions . The declustering potential (dp) was set at 100 v, and a dwell time of 2030 ms was used to maximize the number of transitions per mrm experiment . To characterize the alterations in protein expression related to a - t, we performed lc / ms - based quantitative proteomic analysis of csf from control and a - t patients . A total of 477 proteins were identified and quantified with high confidence in the samples . The expression levels of 13 proteins from priority 1 and 7 proteins from priority 2 were statistically significantly changed (listed in table 3). The 13 significantly changed proteins from the priority 1 group were further analyzed by linear discriminant analysis (lda) and pathway analysis for their roles in biological processes . Expression differences of proenkephalin - a (penk, p01210), isoform 1 of extracellular matrix protein 1 (ecm1, q16610), secretogranin-2 (scg2, p13521), isoform 1 of cd166 antigen (alcam, q13740), and insulin - like growth factor binding protein 7 (igfbp7, q16270) can clearly discriminate a - t samples from healthy controls.the literature search results demonstrate that these five proteins are involved in either human cancers or neurodegenerative processes [2642]. Figure 2 shows a protein - protein interaction network linking these five proteins to atm from the pathway analysis . For qa / qc purpose, chicken lysozyme was spiked into every individual sample at a constant amount (10 ng chicken lysozyme/2 g of sample) before tryptic digestion . After averaging these peptide concentration values, a 1.099 fold - change was observed with a q - value of 0.77 (77% fdr), suggesting this observed small change is not statistically significant and the data obtained from this study was reliable . Mrm results demonstrate the same direction of protein expression changes (up- or downregulation) as compared to the global discovery study, even though the absolute fold - change may be slightly different in some cases, likely due to differences in the platform used . In this targeted proteomic study, we were able to detect and quantify four out of the five proteins of interest . Unfortunately, we were unable to confidently detect the mrm peptide sspsfsslhyqdagnyvceta from alcam due to its low abundance . All of the mrm peptides and transitions for each protein of interest are listed in table 4 . Much of the effort in proteomics has been devoted to improve the sensitivity of the instrument and measurement accuracy . At the present time, there is no consensus within the field of proteomics on any one technology that can attain complete and quantitative protein coverage of all proteins in a given tissue or biofluid . The most commonly used proteomic approach, the so called bottom - up approach, utilizes a two - step approach: peptide separation followed by peptide / protein identification and quantification by mass spectrometry (ms). Two - dimensional gel electrophoresis (2de) has been the workhorse for protein separation in proteomics research efforts in the past decade, but its inability to widen the protein dynamic range and its low throughput remain its biggest disadvantages and thus limit its utility in large - scale and highthroughput proteomic analysis . One alternative approach to 2de is the nongel - based liquid chromatography mass spectrometry - based shotgun proteomic technology [4346]. It provides a powerful analytical platform to resolve and identify thousands of proteins from a complex biological sample in a single experiment . This approach is rapid and more sensitive, and it increases the protein dynamic range 3- to 4-fold as compared to 2de . The hallmark of this method is its ability for high - throughput large - scale proteomic analysis [47, 48]. Although some success using isotopic labeling technology in combination with mass spectrometry for protein quantification has been reported, recently developed label - free protein quantification technology has become a major platform for biomarker discovery primarily due to the high costs of the labeling reagents, especially for a large - scale study . In this study, we used a peak - intensity - based label - free protein quantification method that was previously applied for many other studies [14, 15, 17, 18]. One challenge to studying the neurodegeneration seen in a - t is access to affected brain tissue . For this reason, we chose csf to analyze since this biofluid is in direct contact with the brain and studies of other neurodegenerative diseases have shown that disease - specific changes in the brain can be detected [2022]. A recent study by cheema et al ., using analysis of atm - mediated gene and protein expression in a - t fibroblasts found a completely different set of proteins than those observed in our csf study and highlights the importance of selecting a clinically relevant tissue for biomarker discovery . In this proteomic study, we did not detect a - t - related proteins, such as atm - related protein kinases or their substrates . This could be due to the inability of current lc / ms technology to confidently detect low - abundance proteins . However, the advantages of the method far outweigh this limitation . Firstly, proteomic analysis ignores transcripts that may never be translated by detecting only the end products of gene activity, giving it an advantage over genomic analysis . Secondly, the lc / ms - based label - free protein quantification technology used here has proven itself a powerful tool to resolve and identify thousands of proteins from complex biological samples [16, 50]. It is a method that compares the relative expression levels of the same protein under different physiological conditions . The method is rapid highthroughput, and more sensitive than many other proteomic platforms, and it increases the protein dynamic range 3- to 4-fold compared to the conventional 2d gel - based proteomic platform . During the development of the method, chicken lysozyme was used for qa / qc purposes, and the method has since been robustly tested on many different types of samples [1518]. Automation allows it to be applied to large - scale proteomic analysis; thus, it has become a tool of choice for biomarker discovery [15, 51]. The inclusion of statistics in both the experimental design and data analysis allows for the detection of small but statistically significant changes not offered by other methods . We are, therefore, confident in the qualitative and quantitative data produced by this method . A. statistical motivationthe size of the treatment or disease effect (signal) needs to be evaluated relative to the sample and replicate variation (noise). If the data have multiple sources of random variation such as biological samples and replicates then the data are modeled as a linear mixed model (a generalization of an anova, analysis of variance). This kind of model, especially when applied to complex experimental designs, cannot be handled by introductory methods such as t - tests . The exact scale of the protein expression used in the model can make a difference in the sensitivity . There is usually a large technical variation introduced by the act of measurement in any omics study . Randomization of measurement order will eliminate the bias, but it is still extremely important to normalize or mathematically calibrate the measurement . This is a highly technical matter but can be viewed as similar to mathematically resetting a scale to zero before each measurement . We use a statistically based method called quantile normalization which was the result of considerable research on genomic data . Measures of expression are usually on an arbitrary scale, it is best to evaluate ratios or their equivalent differences on the log scale . Log base 2 is chosen because a unit difference on the log scale is equivalent to a two - fold change . The size of the treatment or disease effect (signal) needs to be evaluated relative to the sample and replicate variation (noise). If the data have multiple sources of random variation such as biological samples and replicates then the data are modeled as a linear mixed model (a generalization of an anova, analysis of variance). This kind of model, especially when applied to complex experimental designs, cannot be handled by introductory methods such as t - tests . The exact scale of the protein expression used in the model can make a difference in the sensitivity . There is usually a large technical variation introduced by the act of measurement in any omics study . Randomization of measurement order will eliminate the bias, but it is still extremely important to normalize or mathematically calibrate the measurement . This is a highly technical matter but can be viewed as similar to mathematically resetting a scale to zero before each measurement . We use a statistically based method called quantile normalization which was the result of considerable research on genomic data . Because omics measures of expression are usually on an arbitrary scale, it is best to evaluate ratios or their equivalent differences on the log scale . Log base 2 is chosen because a unit difference on the log scale is equivalent to a two - fold change . B. five biomarker candidate proteinsfrom the lda, five candidate proteins whose relative expression levels could be used to precisely discriminate control samples from a - t patient samples were discovered . After reviewing the literature, all of these proteins were found to play some role in either cancer or neurodegenerative processes, or both, which lends support to these proteins being viable biomarkers of a - t . The first of these five proteins is proenkephalin - a (penk), which is an opioid neuropeptide precursor, a neuroendocrine hormone, and a cytokine . It is involved in pain perception, modulation of the immune system, anticonvulsant activity, and the neurodegenerative disorder huntington's disease [27, 30]. It is also involved in several cancers, including breast cancer and prolactin - secreting pituitary adenoma [26, 28, 29]. This protein was found 30% overexpressed in a - t samples.isoform 1 of extracellular matrix protein 1 (ecm1), which is 42% over - expressed in a - t samples, is involved in many cancers, including breast, esophageal, laryngeal, thyroid, and lung cancers and may play a role in angiogenesis . It is mutated in lipoid proteinosis, a dermatological disease in which patients may develop neurological abnormalities such as temporal lobe epilepsy and mental retardation .the third protein, the neuroendocrine prohormone secretogranin 2 (scg2), has a role in both neurological processes and cancer . Scg2 is over - expressed by 35% in the a - t patients and is involved with the packaging and sorting of peptide hormones and neuropeptides into secretory vesicles . Secretogranin 2 has also been suggested to be involved in neuroendocrine tumors and amyotrophic lateral sclerosis (a neurodegenerative disorder) [39, 40].the fourth protein, isoform 1 of cd166 antigen (alcam), which has a role in cancer and neurological disorders [3337], was found to be 52% over - expressed in the a - t samples . It is involved in neurite extension by neurons in chickens and in the neurodegenerative disorder multiple sclerosis . In addition, cd166 plays a role in many cancers, including melanoma, prostate, colorectal, pancreas, and breast [33, 36, 37].the final protein, insulin - like growth factor binding protein 7 (igfbp7), is downregulated 46% in a - t compared to control samples . Additionally, it is involved in several types of cancers, including colorectal and inflammatory breast cancers [41, 42]. From the lda, five candidate proteins whose relative expression levels could be used to precisely discriminate control samples from a - t patient samples were discovered . After reviewing the literature, all of these proteins were found to play some role in either cancer or neurodegenerative processes, or both, which lends support to these proteins being viable biomarkers of a - t . The first of these five proteins is proenkephalin - a (penk), which is an opioid neuropeptide precursor, a neuroendocrine hormone, and a cytokine . It is involved in pain perception, modulation of the immune system, anticonvulsant activity, and the neurodegenerative disorder huntington's disease [27, 30]. It is also involved in several cancers, including breast cancer and prolactin - secreting pituitary adenoma [26, 28, 29]. Isoform 1 of extracellular matrix protein 1 (ecm1), which is 42% over - expressed in a - t samples, is involved in many cancers, including breast, esophageal, laryngeal, thyroid, and lung cancers and may play a role in angiogenesis . It is mutated in lipoid proteinosis, a dermatological disease in which patients may develop neurological abnormalities such as temporal lobe epilepsy and mental retardation . The third protein, the neuroendocrine prohormone secretogranin 2 (scg2), has a role in both neurological processes and cancer . Scg2 is over - expressed by 35% in the a - t patients and is involved with the packaging and sorting of peptide hormones and neuropeptides into secretory vesicles . Secretogranin 2 has also been suggested to be involved in neuroendocrine tumors and amyotrophic lateral sclerosis (a neurodegenerative disorder) [39, 40]. The fourth protein, isoform 1 of cd166 antigen (alcam), which has a role in cancer and neurological disorders [3337], was found to be 52% over - expressed in the a - t samples . It is involved in neurite extension by neurons in chickens and in the neurodegenerative disorder multiple sclerosis . In addition, cd166 plays a role in many cancers, including melanoma, prostate, colorectal, pancreas, and breast [33, 36, 37]. The final protein, insulin - like growth factor binding protein 7 (igfbp7), is downregulated 46% in a - t compared to control samples . Additionally, it is involved in several types of cancers, including colorectal and inflammatory breast cancers [41, 42]. C. other priority 1 proteinsthe remaining eight significantly changed proteins in the priority group 1 are sparc (secreted protein acidic and rich in cysteine), neurosecretory protein vgf, tpp1 (cdna flj56402, highly similar to tripeptidyl - peptidase 1), neurocan core protein, chromogranin a, cathepsin d, sod3 (extracellular superoxide dismutase), and enpp2 (isoform 1 of ectonucleotide pyrophosphatase / phosphodiesterase family member 2) (table 3). Among these proteins, sparc, neurosecretory protein vgf, tpp1, and sod3 are of particular interest because they have been implicated in neurodegenerative processes.sparc is a unique matricellular glycoprotein involved in many types of diseases including cancer, inflammation, and neurodegeneration [5254]. Its function is associated with cell development, remodeling, cell turnover, and tissue repair . Our observed downregulation (1.47-fold) of this protein in a - t patients implicates deficiencies associated with these cellular functions in this disease.neurosecretory protein vgf has been identified by many proteomic studies [5557]. This gene is specifically expressed in a subpopulation of neuroendocrine cells and is upregulated by nerve growth factor . However, its exact function remains to be discovered.tpp1 (cdna flj56402, highly similar to tripeptidyl - peptidase 1), also known as cln2, is a member of the family of serine - carboxyl proteinases and plays a crucial role in lysosomal protein degradation; a deficiency in this enzyme leads to fatal neurodegenerative disease . Tpp1 is expected to be down - regulated in a - t patients, which is what we observed (down - regulated 1.44-fold).sod3 is an antioxidant enzyme associated with many pathways and diseases . Its association with neurodegeneration has been reported previously in a study of antioxidant gene therapy . Down - regulation (1.37-fold) of this protein in a - t patients would suggest less of a protective effect by sod3 . Importantly, a large body of evidence suggests that oxidative stress plays some role in the pathophysiology of a - t . As a recent example, one group has shown that atm can be directly activated by oxidation in the absence of dna double - strand breaks, implying that atm may act as a redox sensor capable of regulating cellular responses to oxidative stress as well as genotoxic stress . The remaining eight significantly changed proteins in the priority group 1 are sparc (secreted protein acidic and rich in cysteine), neurosecretory protein vgf, tpp1 (cdna flj56402, highly similar to tripeptidyl - peptidase 1), neurocan core protein, chromogranin a, cathepsin d, sod3 (extracellular superoxide dismutase), and enpp2 (isoform 1 of ectonucleotide pyrophosphatase / phosphodiesterase family member 2) (table 3). Among these proteins, sparc, neurosecretory protein vgf, tpp1, and sod3 are of particular interest because they have been implicated in neurodegenerative processes . Sparc is a unique matricellular glycoprotein involved in many types of diseases including cancer, inflammation, and neurodegeneration [5254]. Its function is associated with cell development, remodeling, cell turnover, and tissue repair . Our observed downregulation (1.47-fold) of this protein in a - t patients implicates deficiencies associated with these cellular functions in this disease . This gene is specifically expressed in a subpopulation of neuroendocrine cells and is upregulated by nerve growth factor . Tpp1 (cdna flj56402, highly similar to tripeptidyl - peptidase 1), also known as cln2, is a member of the family of serine - carboxyl proteinases and plays a crucial role in lysosomal protein degradation; a deficiency in this enzyme leads to fatal neurodegenerative disease . Tpp1 is expected to be down - regulated in a - t patients, which is what we observed (down - regulated 1.44-fold). Its association with neurodegeneration has been reported previously in a study of antioxidant gene therapy . Down - regulation (1.37-fold) of this protein in a - t patients would suggest less of a protective effect by sod3 . Importantly, a large body of evidence suggests that oxidative stress plays some role in the pathophysiology of a - t . As a recent example, one group has shown that atm can be directly activated by oxidation in the absence of dna double - strand breaks, implying that atm may act as a redox sensor capable of regulating cellular responses to oxidative stress as well as genotoxic stress . We identified novel csf biomarker candidates for a - t from the 13 priority 1 proteins with significant absolute fold - changes of at least 1.3 (30% increase or decrease) (q <0.05). Lda was applied to assess the ability of individual and/or combinations of these proteins to correctly classify individuals into the control or disease group . The selectivity and specificity from the lda was high, suggesting that it is possible to correctly assign individuals to the proper group (control or a - t patient) when the expression levels of these biomarker candidates are accurately measured in the csf . Findings from our study confirm that the mass spectrometry - based label - free protein quantification and mrm technologies can be used successfully for biomarker discovery and validation . First, the current study constituted a small sample size, and further validation studies with a larger set of patient cohort samples are necessary . Second, the fold - changes observed in the study are relatively small, which require high measurement precision to produce high quality, clinically valid data . Thus, mass spectrometry - based methods may not be a practical approach for clinical applications . Third, csf may not be an ideal biospecimens for prognostic applications due to the invasiveness involved in sample collection . Future studies involving serum or plasma samples would make this biomarker discovery strategy even more attractive with the hope that such noninvasive biospecimens can be incorporated into routine clinical practice and utilized in clinical trials for the assessment of potential therapeutic compounds.
Congenital bochdalek hernia (cbh) develops as a result of the inappropriate fusion of the pleuroperitoneal fold and septum transversum at the site of the posterolateral lumbocostal trigone at the sixth week of gestation . This entity was first described by mccauley in 1754 and then by vincent alexander bochdalek in 1848 . This type of diaphragmatic hernia is considered a perinatal disease that presents a few hours after birth, or in early infancy, and it is associated with significant morbidity and mortality . Cbh in adults is very rare; it remains asymptomatic until adulthood and generally presents with thoracic and/or abdominal symptoms aggravated in supine position . We present a case of left - sided congenital bochdalek hernia that remained asymptomatic and was discovered incidentally during secondary cytoreductive surgery for epithelial ovarian cancer; in this patient, a iatrogenic diaphragmatic defect was found, hyperthermic intraperitoneal chemotherapy (hipec) was performed and early postoperative bilateral anterior thalamic infarction developed . A 46-year - old female patient with a bmi of 25 was referred to our tertiary center (cerrahpasa medical faculty, gynecological oncology unit) in august 2016 with the diagnosis of platinum - resistant ovarian cancer . Positron emission tomography and computed tomography (ct) revealed implants on the right diaphragmatic surface after first - line adjuvant chemotherapy . She has never had any thoracic or abdominal symptoms and no history of major trauma . Initial preoperative evaluation of the patient revealed no significant sign of diaphragmatic hernia . Her physical examination was normal, including chest auscultation sounds and chest x - ray . Thoracic ct did not reveal any abnormal image that could be evaluated as a diaphragmatic hernia . She was placed in flank position, and, under general anesthesia, laparotomy was performed . An oval defect with the dimensions of 3 4 cm was seen in the left posterolateral site of the diaphragm (fig . The most distal portion of the inferior lobe of the left lung was visible through the defect during inspiration and expiration movements . Drainage chest tubes were inserted bilaterally via the 6th intercostal spaces to avoid leakage of the chemotherapeutic agents across repaired diaphragm and postoperative massive pleural effusion . The tissue around the congenital left - sided defect was excised circularly and the defect itself was repaired with interrupted nonabsorbable monofilament sutures . After complete cytoreduction had been achieved, hyperthermic intraperitoneal chemotherapy with doxorubicin 35 mg / m and paclitaxel 175 mg / m for 60 min at 42.5c was delivered . No leakage via drainage tubes from the thoracic cavity was noted during the procedure . During the surgery, the patient was managed by standard monitoring, which involved continuous monitoring of electrocardiography, invasive blood pressure, central venous pressure, pulse oximetry, body temperature and hourly urine output . Arterial samples were drawn at regular periods for the determination of electrolytes, acid base status and hematocrit . Finally, the operation lasted 4 h. at the end of the surgery, the patient remained intubated and was transferred to the intensive care unit for monitoring ongoing resuscitation along with fluid and electrolyte management . The patient was extubated 10 h after completion of surgery, and was transferred to the service on the 2nd postoperative day . Prophylactic enoxaparin 4,000 iu was started 6 h after surgery . On the 3rd and 4th postoperative day, excessive sleepiness throughout the day and dyspraxia was noted . Bilateral anterior thalamic infarction caused by emboli that block the thalamosubthalamic artery the dose of enoxaparin was changed from 4,000 iu once a day to 800 iu twice a day . Follow - up at 4 months after surgery showed no evidence of recurrence and no symptom regarding thalamic infarct . Cbh generally presents in newborns with severe respiratory failure or in infancy due to herniation and/or strangulation of the abdominal contents . One of the best studies concerning the incidence of the defect in adults was carried out by mullins et al ., who reviewed 13,138 ct scans . Their study revealed an incidence of 0.17%, with 68% being right - sided defects and 77% of the patients being female . Since the second study summarized symptomatic cases, demographics identified were different than those in asymptomatic ones . This difference showed that more cases of right - sided cbh in females may remain silent than left - sided cases . These data were supported by several case reports . Nevertheless, in our case, the defect was noted on the left side . Also, no herniation of intestinal loops was noted, and the patient has never had any thoracic or abdominal symptom that might be related to diaphragmatic hernia . Diagnosis of the disease might be carried out by chest ct when there are clinically unexplained thoracic and abdominal symptoms . The chest ct of our patient did not reveal any of the above - mentioned patterns . There are several cases concerning surgical repair of the defect both laparoscopic, via laparotomy, and through the thoracic cavity . We performed upper midline incision for laparotomy, and there was no need for another access to carry out the repair of the diaphragmatic defect . Repair of diaphragmatic defect can be performed by various techniques, using absorbable or nonabsorbable sutures in an interrupted or continuous fashion . From our point of view, surgeons may choose any of them provided that they are comfortable with the procedure . The main reason for using bilateral chest tubes was to prevent massive pleural effusion due to hipec . In addition, intra - abdominal pressure increases during hipec, which may subsequently cause a cephalad shift of the diaphragm to increase peak airway pressures and reduce residual capacity . Chest drains which were inserted prior to hipec reduce the increase in peak airway pressure, and by this way, the length of the intubation period and hospital stay can be decreased . Malignancy itself, hipec, central venous cannulation, the position of the patient's neck, sudden blood loss and a long duration of the operation were noted as possible risk factors in our case . In conclusion, although congenital bochdalek hernia commonly occurs in the newborn and infancy period, it must not be excluded in the case of unexplained abdominal and/or thoracic symptoms in adults . Despite the fact that this kind of rare condition presents with pain, obstruction symptoms or pulmonary symptoms, it can be silent until discovered incidentally . Secondly, cerebral embolism should be suspected in the presence of any neurological symptom in postoperative patients.
According to gtr hypothesis, explained by melcher, placing a barrier between the overlying gingival tissues and the defect space hinders the faster - moving epithelium and connective tissue from migrating into the wound space, and this provides a great chance for cementum, periodontal ligament, and bone cells to dominate the defect . Also, it was declared that membranes can create a space, which stabilize the blood clot and facilitates the progenitor cells differentiation . Since nayman for the first time investigated the capacity of membranes in treatment of human bone defects, numerous studies have evaluated the effectiveness of different membranes in animal[1247] and human[814] models but unfortunately they were not conclusive enough . Through research of articles showed that the use of non - absorbable membranes in treatment of alveolar bone defect is widely accepted among clinicians . Although, polytetrafluoroethylene (ptfe) is the mostly used membranes, but difficulty in handling, bacterial contamination and soft tissue irritation have been proposed as its main shortcomings and the use of ptfe has been diminished consequently . Apart from these problems, the need of secondary surgery for removing non - absorbable membranes has restricted their use and absorbable membranes were introduced to the gtr treatments . Bio absorbable membranes are mainly prepared from dura mater, poly glycolic acid, poly lactic acid and collagen . Promoting progenitor cells adhesion and chemotaxi and physiologic degradation are indispensable characteristics of an ideal membrane and this properties can be provided in collagen made membranes . Collagen fibers provide a structural elasticity during the crystalline phase of bone regeneration and these properties of collagen ensure perfect tissue integration and adequate wound healing . Micro - architecture and cross - links are properties that collagen membranes may differ in and these characteristics define collagen structural durability, stiffness and degradation time . Although, promising results have been shown by the use of collagen barriers, but several complications such as early degradation, epithelial down growth along the material, and premature loss of the material were reported following the use of collagen membranes . According to all aforementioned statements, there are no appropriate criteria for choosing cell occlusive collagen membranes . Also, there is no conclusive study regarding the efficacy and superiority of different collagen membranes . As a result, this study was designed to histologically and histomorphometrically investigate the efficacy of three types of absorbable collagen membrane of biomend, biogide and cytoplast rtm in treatment of dehiscence defects in canine model . This was a 8 weeks experimental animal study which was held with the cooperation of professor torabinejad research center and this study was approved by the local ethical committee of isfahan university of medical science . Four healthy adult native female dogs (12 months old; weighting 20 to 25 kg) were included . Animals were anesthetized using injection of acepromazine 2% (neurotrano, alfasan, woerden, holland; 0.02 ml / kg), ketamine hcl 10% (ketamine alfasan, woerden, holland; 10 mg / kg). After the injection of atropine 0.1% (atropine, alfasan, woerden, holland; 0.02 - 0.04 mg / kg) dogs were intubated and halothane gas (halothane bp, nicholas piramal india limited, india) was used to maintain the anesthesia . Co. tehran, iran) infiltration was placed in the mucobuccal fold to control the pain and bleeding during the surgical procedure . Oral prophylaxis was performed with chlorhexidine solution 0.2% prior to surgery . After a sulcular incision from mandibular canine to first molar, a muco - periosteal flap was elevated by an elevator to expose the underlying alveolar bone . Using a carbide bur, bone chisel and curette, four critical size periodontal dehiscences were created in each side of the mandible (8 dehiscences in each dog) by removing 5 5 mm of bone and cementum from the roots of the canines and the distal roots of the 2, 3, 4 premolars [figure 1]. At the apical end of each defect, 2) as a reference point for histomorphometric assessment . Then defects were rinsed by normal saline . In each side, one defect was left uncovered as a control site and three other defects were randomly covered with three commercially available collagen membranes including: four dehiscences were created in each side of the mandible cytoplast rtm (cyt): is a type 1 collagen derived from bovine flexor achilles tendon (osteogenics biomedical, inc . Biomend (bm): is a type 1 collagen derived from bovine flexor achilles tendon (biomend, zimmer dental inc, carlsbad, usa). Biogide (bg): is a type 1 bilayer collagen derived from porcine derma (geistlich biomaterials, inc ., wolhusen, switzerland). Each membrane was placed directly on the dehiscence defect according to manufacturer's instruction . Membranes were extended at least 2 mm beyond the defect's borders [figure 2]. Membranes were placed on the dehiscence defect the flap was then repositioned and sutured using 0 - 3ptfe (osteogenics after consciousness, tramadol 50 mg (tehran chemie pharmaceutical co. tehran - iran, 5 mg / kg) and ceftriaxone 1gr (ceftrax, jaberebne haian pharmaceutical mfg.co, tehran - iran) were intramuscularly injected to dogs for 7 days, and animals were fed on soft diets for 14 days following the surgery . The operation sites were cleaned with 0.2% chlorhexidine solution twice a day and sutures were removed after 14 days postoperatively . There was no post operative complication, such as sign of infection and abscesses or allergic reactions during the entire period of the experiment . Dogs were sacrificed via intravenous injections of ketamine, magnesium sulfate and acepromazineat two time intervals(4 and 8 weeks, two dogs at each time point). The mandibles were then removed and fixed in a 10% buffered formalin solution for 48 h. each specimen was isolated, rinsed in distilled water, demineralized with nitric acid (solution 5%) for a period of 4 weeks, then dehydrated and embedded in paraffin . Several histologic sections of each defect site were cut in 5 m thickness buccolingually with a microtome (accu - cut srm . The histological sections were stained with h and e)hematoxylin and eosin method) and investigated under optical microscope (nikon e400, japan) by a blinded pathologist . 1, sbmu, iran) software . Using the apical limit of the notch as a reference point, the following measurements were made: (1) thickness of new cementum (nct), (2) height of newly regenerated bone (nbh), (3) thickness of newly regenerated bone (nbt) and (4) distance between the reference point and the apical junctional epithelium attachment (dje). Structure of the periodontal ligament (pdl) were classified to organized pdl, which characterized by dense connective tissue and regularly oriented fibers from alveolar bone toward cementum surface or disorganized pdl with irregularly oriented fibers according to histological surveys . Then the regenerated pdl was scored based on the following observations: 0: disorganized pdl 1: organized pdl 2: more organized pdl . Also, the inflammatory score was assessed under the optical microscope according to presence of inflammatory cells based on the following observations: score 0: <10% inflammatory cells, score 1: 10 - 30% inflammatory cells, score 2: 30 - 50% inflammatory cells, score 3:> 50% inflammatory cells . Significant differences among groups were identified by one - way anova with tukey's post - hoc test, mann - withney, kruskal - wallis and fisher's exact tests (= 0.05) dogs were sacrificed via intravenous injections of ketamine, magnesium sulfate and acepromazineat two time intervals(4 and 8 weeks, two dogs at each time point). The mandibles were then removed and fixed in a 10% buffered formalin solution for 48 h. each specimen was isolated, rinsed in distilled water, demineralized with nitric acid (solution 5%) for a period of 4 weeks, then dehydrated and embedded in paraffin . Several histologic sections of each defect site were cut in 5 m thickness buccolingually with a microtome (accu - cut srm . The histological sections were stained with h and e)hematoxylin and eosin method) and investigated under optical microscope (nikon e400, japan) by a blinded pathologist . 1, sbmu, iran) software . Using the apical limit of the notch as a reference point, the following measurements were made: (1) thickness of new cementum (nct), (2) height of newly regenerated bone (nbh), (3) thickness of newly regenerated bone (nbt) and (4) distance between the reference point and the apical junctional epithelium attachment (dje). Structure of the periodontal ligament (pdl) were classified to organized pdl, which characterized by dense connective tissue and regularly oriented fibers from alveolar bone toward cementum surface or disorganized pdl with irregularly oriented fibers according to histological surveys . Then the regenerated pdl was scored based on the following observations: 0: disorganized pdl 1: organized pdl 2: more organized pdl . Also, the inflammatory score was assessed under the optical microscope according to presence of inflammatory cells based on the following observations: score 0: <10% inflammatory cells, score 1: 10 - 30% inflammatory cells, score 2: 30 - 50% inflammatory cells, score 3:> 50% inflammatory cells . Data were analyzed using statistical analysis software spss 16(spss spss inc ., chicago, usa). Significant differences among groups were identified by one - way anova with tukey's post - hoc test, mann - withney, kruskal - wallis and fisher's exact tests (= 0.05) photomicrographs of periodontal regeneration in different groups at 4 weeks: (a) bg membrane (b) bm membrane (c) control group d) cyt membrane . H&e; original magnification 12 () apical notch, () new alveolar crest, () apical of junctional epithelium photomicrographs of periodontal regeneration in different groups at 8 weeks: (a) bg membrane (b) bm membrane (c) control group d) cyt membrane . H&e; original magnification 12 () apical notch, () new alveolar crest, () apical of junctional epithelium chronic inflammatory response was present in treatment and control specimens . All cases showed score 0 (less than <10% inflammatory cells) regarding the inflammatory response except for one control group which showed score 1 (10 - 30%) over 4 weeks . After 4 and 8 weeks, organized pdl was formed in all groups except for control . The quality of regenerated pdl was more organized after 8 weeks compared to 4 weeks in treatment groups . The quality of regenerated pdl showed significant difference between treatment and control groups at 8 weeks (p = 0/038) [table 1]. Histological measurements for newly pdl (n=8 specimen measurements per group) at 4 weeks, the amount of regenerated woven bone was more than lamellar bone (mature bone) in treatment groups . As time elapse, the amount of lamellar bone increased compared to woven bone and it reached to its highest rate in biomend group . The amount of regenerated lamellar and woven bone showed no significant difference between treatment and control groups (p4 week lb = 0.95 p4 week wb = 0.07) [table 2]. Histomorphometric measurements for newly formed tissues (n = specimen measurements per group) none of the membranes were present after 4 weeks . Although the maximum amount of nct was regenerated in cyt group, this parameter showed no significant difference between groups in both 4 and 8 weeks (p4 weeks = 0.06 p8 weeks = 0.44). There was a significant difference between all treatment and control groups regarding the mean amount of vertical bone formation (nbh) after 4 and 8 weeks (p <0.05) except bm at 4 weeks . Nbh reached its highest rate in cyt and bg groups after 4 and 8 weeks respectively [table 2]. Significant differences in treatment groups were observed between cyt and bm (p = 0.02) at 4 weeks and cyt, bm (p = 0.03) and bg, bm at 8 weeks . The amount of nbt was statistically different in bg and cyt groups after 4 weeks and bg and bm groups at 8 weeks compared to control . The maximum amount of nbt was obtained in bg group and this amount showed a significant difference compared to cyt and bm groups after 4 weeks (p = 0.000 and p = 0.03). There was no significant difference between all treatment groups regarding the amount of nbt at 8 weeks [table 2]. It was shown that the amount of dje was significantly different between all treatment and control groups after 4 and 8 weeks [table 2]. Dje reached its highest rate in bm and cyt groups after 4 and 8 weeks, respectively . But, there was no significant difference between treatment groups after 4 and 8 weeks (p> 0.05). Photomicrographs of periodontal regeneration in different groups at 4 weeks: (a) bg membrane (b) bm membrane (c) control group d) cyt membrane . H&e; original magnification 12 () apical notch, () new alveolar crest, () apical of junctional epithelium photomicrographs of periodontal regeneration in different groups at 8 weeks: (a) bg membrane (b) bm membrane (c) control group d) cyt membrane . H&e; original magnification 12 () apical notch, () new alveolar crest, () apical of junctional epithelium chronic inflammatory response was present in treatment and control specimens . All cases showed score 0 (less than <10% inflammatory cells) regarding the inflammatory response except for one control group which showed score 1 (10 - 30%) over 4 weeks . After 4 and 8 weeks, organized pdl was formed in all groups except for control . The quality of regenerated pdl was more organized after 8 weeks compared to 4 weeks in treatment groups . The quality of regenerated pdl showed significant difference between treatment and control groups at 8 weeks (p = 0/038) [table 1]. Histological measurements for newly pdl (n=8 specimen measurements per group) at 4 weeks, the amount of regenerated woven bone was more than lamellar bone (mature bone) in treatment groups . As time elapse, the amount of lamellar bone increased compared to woven bone and it reached to its highest rate in biomend group . The amount of regenerated lamellar and woven bone showed no significant difference between treatment and control groups (p4 week lb = 0.95 p4 week wb = 0.07) [table 2]. Histomorphometric measurements for newly formed tissues (n = specimen measurements per group) none of the membranes were present after 4 weeks . Although the maximum amount of nct was regenerated in cyt group, this parameter showed no significant difference between groups in both 4 and 8 weeks (p4 weeks = 0.06 p8 weeks = 0.44). There was a significant difference between all treatment and control groups regarding the mean amount of vertical bone formation (nbh) after 4 and 8 weeks (p <0.05) except bm at 4 weeks . Nbh reached its highest rate in cyt and bg groups after 4 and 8 weeks respectively [table 2]. Significant differences in treatment groups were observed between cyt and bm (p = 0.02) at 4 weeks and cyt, bm (p = 0.03) and bg, bm at 8 weeks . The amount of nbt was statistically different in bg and cyt groups after 4 weeks and bg and bm groups at 8 weeks compared to control . The maximum amount of nbt was obtained in bg group and this amount showed a significant difference compared to cyt and bm groups after 4 weeks (p = 0.000 and p = 0.03). There was no significant difference between all treatment groups regarding the amount of nbt at 8 weeks [table 2]. It was shown that the amount of dje was significantly different between all treatment and control groups after 4 and 8 weeks [table 2]. Dje reached its highest rate in bm and cyt groups after 4 and 8 weeks, respectively . But, there was no significant difference between treatment groups after 4 and 8 weeks (p> 0.05). One of the main notable features of membranes is that they preserve the defect space and stabilization of coagulum and hinder the migration of epithelial cells into the defect . To fulfill this aim, membranes structural durability should prevent membranes to collapse into the defect . In the present study, 5 5 mm dehiscences were created in the mandible of dogs . In this critical size, membranes are stable enough and do not collapse into the defects . In the present study, there was significant difference between treatment groups regarding the quality of regenerated pdl at 8 weeks . As time elapse, the more organized pdl increased in treatment groups and this may indicate that pdl maturation requires time and early loss of membranes may jeopardize the maturation process . Also, there was no sign of organized pdl in control group as defects were repopulated by epithelial cells and a true, well - structured pdl was not formed in those defects . In the present study, the distance between the reference point and apical of junctional epithelial attachment (bone and connective tissue attachment) was assessed histomorphometrically . This distance showed a significant difference between all treatment and control groups but there was no significant difference among treatment groups . The control group showed the least distance and it indicates that in the absence of membrane, the epithelium will down growth the defect . Clinically, this histologic finding can be attributed to an increase in clinical pocket depth . In christgau studies, clinical attachment gain and pocket reduction was observed with the use of bio absorbable membranes but there was no definite histological confirmation for these studies . The present study is in agreement with mentioned studies and can histologically approve the clinical findings . In the histological surveys, cellular cementum was found in groups, which were capable of cementum regeneration and this is in agreement with araujo et al ., study who also confirmed the formation of cellular cementum in defects with bg resorbable membrane . Although, the cementum thickness was greater in all treatment groups compared to control, there was no significant difference between them and this is in accordance with gineste l study which showed that there is no significant difference between biomend treated and control groups regarding the formation of new cementum . According to obrien, biodegradable membrane hinders the down growth of epithelium and increase the regeneration rate of cementum and connective tissue attachment . This study also highlighted this statement that in all treatment groups, membranes effectively prevent this movement as it can be seen in new cementum thickness compared to control group . The mean height of newly regenerated bone (nbh) showed a significant difference between all treatment and control groups (p <0.05) except for bm at 4 weeks . Among the experimental groups, bone height reached its highest rate in cyt and bg groups after 4 and 8 weeks, respectively . This may indicate that cyt membrane can accelerate the bone regeneration process and the regeneration of new bone can be expected in less time with the use of cyt membrane . The minimum amount of nbh was observed in bm group in 4 weeks and this amount increased significantly as time elapse . It may show that bone maturation requires more time in bm group compared to others . This difference between experimental groups may emphasize that the varied properties of these membranes like their pore sizes may affect the pattern of cell immigration and adhesion . The amount of nbt was statistically different in bg and cyt groups at 4 weeks and bg and bm groups at 8 weeks compared to control . And gineste l., study that showed collagen membranes regenerated significantly more bone compared to control group . Oh et al ., compared the efficacy of bio - gide and biomend extend membranes for the treatment of implant dehiscence defects and showed that there is no significant difference among groups regarding the amount of new bone fill (bf) at 4 weeks . However, at 16 weeks, it was noted that membrane - treated groups showed significantly higher rate of bf compared to controls . According to histological examinations, in the membrane - treated sites the bone was regenerated completely at the notches and the new bone was partially regenerated in other sites of dehiscences and this is in accordance with other studies . Woven bone is a weak poorly organized structure (teimori 21) and it is the first tissue which is formed in bone regeneration process . This is while, for the regeneration of well - structured lamellar bone, hydroxyapatite crystals should be deposited by osteoblast cells . In the second mineralization phase, the mineral contents of lamellar bone and also the size of hydroxyapatite crystals increase and theses phenomenon require time (teimori 21). In the present study, also, the control group showed the highest rate of woven bone in 8 weeks . In the present study, none of the membranes were observed after 4 weeks and this time was less than what was expected by manufacturers . The degradation of membranes maybe explained by the enzymatic activity of macrophages and polymorph nuclear leukocytes of the host . The presence of inflammatory cells can accelerate the degradation process, but in the present study, there was a mild inflammatory reaction at the site and this accelerated degradation time can be attributed to different enzymatic activity of dogs compared to humans . The first 3 to 4 weeks has been regarded as a critical time for appropriate healing . The results of the present study are in agreement with mentioned statements as all membranes regenerated the periodontal structures while there was no sign of any membrane after 4 weeks . So, it can be hypothesized that 4 weeks is the minimum required time for a membrane to be effective . In all samples after 4 and 8 weeks except for one control specimen, less than 10% inflammatory cells were observed and this indicates that the use of bio absorbable membrane do not induce foreign body reaction and these membranes are biocompatible . This finding is in agreement with rothamal and gineste studies which showed that bio - gide and bio - mend collagen bio absorbable membranes do not initiate any inflammatory or foreign body responses . Although, all three membranes were successful in regeneration of periodontal attachment apparatus to some extent, but the amount of nct, dje, nbt and nbh was different among experimental groups and the reason is yet unknown . It has been mentioned that different structural and physical characteristics in conjunction with variable degradation times may highly affect the regenerative outcome of membranes . The membrane - treated groups had a statistically significant increase in bone formation and connective tissue attachment compared to control groups . The highest rate of vertical and horizontal bone formation was observed in bg group . According to result of the present study, it was concluded that all three collagen membranes were capable of regenerating the lost periodontal apparatus to some extent.
A 78-year old male with past medical history significant for chronic shortness of breath (for the last two years), chronic systolic heart failure secondary to non - ischemic dilated cardiomyopathy, pulmonary hypertension, essential hypertension, coal miner s pneumoconiosis, and chronic obstructive lung disease was found to have bilateral pulmonary nodules on pre - operative chest x - ray . The work - up for the pulmonary nodules was initially planned on an outpatient basis . However, two weeks later the patient was admitted to the hospital with progressive shortness of breath . Upon admission, vital signs included temperature 35.8c, pulse 56 beats / min, respiratory rate 22 breaths / min, and blood pressure 110/54 mmhg . On review of systems he reported decreased appetite for the past three months and a 20 pound weight loss . He denied hematuria, rhinorrhea, rashes, sinus pain, muscle aches, ear ache, hearing loss or hemoptysis . Blood urea nitrogen was 18 mg / dl, creatinine 1.2 mg / dl, glomerular filtration rate 59 ml / min . Chest x - ray revealed bilateral hilar and right upper lobe areas of infiltrate increased from the prior imaging examination . Computed tomography (ct) scan revealed multiple cavitary lesions, the largest on the right, with a large air fluid level suspicious for infection . The day after admission the patient underwent ct guided fine needle aspiration of the right lung . All blood cultures were the negative and so were cultures of the pleural fluid and the surgical specimen . However, the antibiotics were soon discontinued secondary to low suspicion for the presence of active infection . At that point the diagnosis of vasculitis was entertained and a vasculitis panel was significant for elevated sedimentation rate at 84 mm / h . Anti - glomerular basement membrane antibody level was negative, but proteinase 3-anti - neutrophil cytoplasmic antibody (pr3-anca) level was elevated at 3.8 units . Stool studies were positive for clostridium difficile for which the patient was started on flagyl . Repeat urinalysis showed brown colored urine with ph 6, specific gravity 1.023, moderate occult blood, bile negative, small leukocyte esterase, nitrate negative, 9 - 10 red blood cells (rbc)/high power field (hpf), 9 - 10 white blood cells / hpf, rare squamous epithelial cells, rare hyaline casts, 30a protein . Kidney biopsy was inadequate for diagnosis . During the course of his treatment he also completed 5 cycles of plasmapheresis . Wegener s granulomatosis (wg) is anca associated vasculitis of small and medium sized vessels . The disease has variable presentation and diagnosis is made on the basis of clinical, laboratory, pathologic and imaging studies . Usually patients present with upper respiratory tract symptoms such as nasal ulcer, nasal discharge, rhinorrhea and sinus pain . Kidney involvement manifests as acute renal failure with red cells, red cell casts and proteinuria . Although wg is mainly characterized by respiratory disease and nephritis, it can also affect the nervous system, heart, eyes, skin, joints and spleen . The diagnostic criteria published by the american college of rheumatology include nasal or oral inflammation with ulcers or purulent bloody discharge; chest radiograph showing nodules, cavities or infiltrates; urinary sediment with red cell casts or microscopic hematuria; granulomatous inflammation on lung biopsy . Infection could serve as a trigger for disease expression and is an established factor for disease relapse . Under the effect of unknown antigen, neutrophils express cytoplasmic pr3, which leads to the production of anti - pr3 antibodies . Laboratory studies include leukocytosis, elevated erythrocyte sedimentation rate, normocytic anemia, positive anca and rheumatoid factor . Potential biopsy sites include affected areas such as nasal sinus, muscle, temporal artery, kidney, lung . Kidney biopsies are done in patients with urinary sediment abnormalities, proteinuria or change in renal function . On histologic examination wg is characterized by vasculitis, inflammatory infiltration of medium and small vessels, and necrotizing granuloma formation . The limited form of wegener s usually does not affect the function of vital organs . The systemic form of wg is more common and only 25% of patients will have limited wg . Some authors state that the limited form may evolve into systemic disease, implying that the two forms are different stages of progression of the same disease . They further state that the lack of progression in some of the cases is due to improved treatment modalities . C - anca is present in 50% of patients with the limited form and 80% of patients with the systemic form of the disease . Initially our patient was found to have bilateral pulmonary nodules on preoperative chest x - ray . Differential diagnosis at that time included more common conditions such as lung metastasis, tuberculosis, sarcoidosis, rheumatoid nodules, lung infection (bacterial or fungal). The presence of vasculitic process was investigated after the above mentioned conditions were ruled out . The patient did not present with upper respiratory findings or findings indicative of kidney involvement . Due to the absence of such findings he later developed diarrhea and was diagnosed with clostridium difficile infection . At that time the patient developed systemic manifestations of wg including renal failure, vasculitic rash and hemoptysis . The degree of kidney involvement could not be assessed secondary to failure to obtain satisfactory biopsy specimen . The infection could have triggered the evolvement of his limited wg into systemic disease, supporting the theory that those two forms are different stages of the same disease entity . The patient s condition rapidly transformed from a limited form to a systemic form of wg in the course of two weeks . This highlights the importance of timely treatment in patients with limited wg in order to prevent disease progression . When left untreated, wg is usually fatal . Wg that does not involve the kidneys or other vital organs can be treated with less toxic regimens such as methotrexate or azathioprine . Limited wg may progress to involve kidneys and other organs and hence should be treated and closely monitored . However, patients do not always present with the triad and a high index of clinical suspicion is needed in order to make a prompt diagnosis . When patients present with limited disease, without renal involvement, diagnosis is delayed and immunosuppressive treatment is not recommended . There are no clear guidelines on how limited wg should be approached, followed up, or treated . Our case demonstrates that limited wg can evolve into systemic disease secondary to environmental triggers such as infection . This supports the notion that the two forms represent different stages of the same disease.
Perforation of the biliary system occurs most frequently in the gallbladder, usually associated with (and complicating upto 10% cases of) acute cholecystitis . Perforation of the extrahepatic biliary tree is a rare entity, accounting for less than 10% of intraperitoneal biliary rupture . Bile duct perforation is most commonly described in infants related to congenital biliary system anomalies . Aetiology in the adult is commonly attributable to intramural infection, necrosis of the wall of the bile duct secondary to thrombosis, increased intraductal pressure secondary to obstruction, cirrhosis, and direct erosion by calculi . Overall, 70% of cases are related to calculi . The incidence of biliary tract disease during pregnancy ranges from 0.050.3% . Despite these apparent low figures, complications from gallstones represent the most common general surgical condition requiring surgical intervention, second only to appendicitis . Indications for intervention of gallstones during pregnancy include obstructive jaundice, acute cholecystitis, or pancreatitis failing medical management . We present the case of a young woman diagnosed with gallstones in late pregnancy, complicated by acute gallstone pancreatitis and subsequently spontaneous common bile duct perforation . A twenty - year - old primigravida woman was planned for elective caesarean section due to breech presentation . The patient had a past medical history of -thalassemia trait, but was not normally on regular medication . Her mother had previously undergone a cholecystectomy for gallstones . At 34 weeks gestation, she presented acutely with a two - week history of worsening abdominal pain localised to the epigastric region, associated with vomiting . On examination, blood results revealed raised inflammatory markers (wbc 14.4 [4.011.0], neutrophils 11.9 [2.07.5], crp 60 [07.5]) and evidence of pancreatitis (amylase 1369 iu / l [36128]), mildly raised bilirubin (24 mol / l [020]) and raised alkaline phosphatase (183 an abdominal ultrasound revealed multiple small gallstones and a thickened gallbladder wall, but no evidence of a dilated intra or extrahepatic biliary system . The patient was treated conservatively, rapidly improved, and liver function tests normalised . An emergency caesarean section was performed and a term baby delivered, but no obvious cause was found to explain her clinical condition . The following day her clinical condition worsened, with progressive abdominal pain and a metabolic acidosis . She required aggressive resuscitation, inotropic, and ventilatory support and was, therefore, admitted to the intensive care unit . A computed tomography (ct) revealed extensive free peritoneal fluid and gas of which the aetiology was not apparent . The patient underwent a prompt laparotomy and was found to have generalised biliary peritonitis . The gallbladder was intact but a 2 mm perforation was found on the anterior surface of a dilated common bile duct (12 mm). On table cholangiography suggested obstruction of the distal common bile duct caused by a 5 mm gallstone impacted within the distal common bile duct . The calculus was removed, and the duct was repaired over a t - tube . A t - tube cholangiogram was performed after 4 weeks, and the tube was uneventfully removed (figure 1). Although the pathogenesis of spontaneous biliary perforation is poorly understood, recognised mechanisms include the following: calculous perforation at the site of impaction; calculous erosion without impaction; increased canalicular pressure due to obstruction by tumour, stone, or spasm of the sphincter of oddi; intramural infection; mural vessel infarction leading to mural necrosis; or rupture of a biliary tract anomaly such as cyst or diverticulum . Thus, because perforation of the biliary system is a recognised complication of cholelithiasis, the diagnosis should be suspected if a perihepatic abscess or peritonitis is combined with biliary stone disease . As early as 1882, freeland reported the first case of extrahepatic biliary system rupture in an adult (diagnosed at autopsy), an entity that was subsequently first described in pregnancy by piotrowski et al . Over a century later . Since this time, very few cases of spontaneous common bile duct perforation in adults have been reported in the literature, with cases occurring during pregnancy being even more scarce . The importance of this clinical scenario lies in the potential serious morbidity and not infrequent mortality associated with missed biliary system perforation . Petrozza et al . Described two cases of gallbladder perforation due to cholelithiasis in the early postpartum period . Both cases presented a diagnostic dilemma, and it was concluded that a history of cholelithiasis in a patient with persistent intra - abdominal symptoms in the postpartum period must alert to prompt investigation and early management ., one patient was found to have suffered gallbladder rupture as a result of cholecystitis, and in the second, a common bile duct perforation was found at laparotomy with no obvious precipitating cause . . Also drew attention to the similarity of symptoms of gallbladder disease in pregnancy to mild pre - eclampsia, having in common hypertension, epigastric pain, and mildly deranged liver function tests . These cases highlight the importance of recognising the possibility of delayed diagnosis of cholelithiasis as a result of nonspecific abdominal symptoms during pregnancy and indicate early investigation and treatment in order to reduce serious morbidity . . Block and kelly reported the optimum time for surgical management of gallstone pancreatitis to be in the second trimester or early postpartum period, in order to minimise maternal / fetal mortality and recurrent pancreatitis . Unfortunately, in those women presenting late in pregnancy (as in the case described), the balance of risk favours watchful waiting until after delivery followed by elective cholecystectomy . Certainly, this risks early recurrence of acute pancreatitis, as well as rare but severe consequences such as biliary peritonitis . Whether an early endoscopic retrograde cholangiopancreaticography (ercp) and sphincterotomy in those cases presenting with gallstone pancreatitis can be an acceptable temporary preventive measure is unclear, but undertaking ercp is not without risk, and the potential risks should be considered carefully in individual cases . In this particular case, it is impossible to know whether the eroding calculus had been present during the initial episode of pancreatitis . Magnetic resonance scanning is a commonly used imaging modality in obstetrics, considered to be safe and avoiding the use of ionising radiation . Therefore, magnetic resonance cholangiopancreatography (mrcp) would have been a reasonable next investigation during this patient s initial presentation, and if a ductal stone had been revealed, then the indication for ercp may have been clearer . On the other hand, neonatal and postnatal care of babies born early have progressed significantly, suggesting the possibility of induction of labour perhaps at 3638 weeks gestation in severely symptomatic or high - risk patients . Of course, every case must be considered individually, taking into account maternal and fetal history and health.
Optimal phosphate balance is important for many physiological functions from cell signaling to energy metabolism to skeletal mineralization . Inadequate phosphate balance disrupts a multitude of physiological processes, and can cause or exacerbate age - associated disorders, cardiovascular calcification and bone mineralization defects . Physiologic phosphate balance is maintained by interactions among the intestine, kidney, parathyroid gland and bone . Phosphate absorption takes place mostly in the small intestine, and the sodium - dependent phosphate (napi) co - transporter, napi-2b, facilitates such absorption . Of relevance, the intestinal napi-2b activity is influenced by 1,25-dihydroxyvitamin d, which can increase the expression of intestinal napi-2b protein to augment intestinal phosphate uptake by the enterocytes . Likewise, renal phosphate reabsorption is mostly accomplished by the napi-2a and napi-2c co - transporters . Parathyroid hormone (pth) increases urinary phosphate excretion by reducing napi - dependent phosphate uptake in the proximal tubular epithelial cells . Recent studies have shown that bone - derived fibroblast growth factor 23 (fgf23) and kidney - derived klotho can also directly suppress sodium phosphate co - transporter activities . In addition to intestine and kidney, bone also plays a major role in maintaining phosphate balance . When serum phosphate levels are low, the bone releases additional phosphate to maintain the homeostatic balance by increasing resorption, a process that is mostly influenced by the activity of pth and 1,25-dihydroxyvitamin d. pth alters receptor activator of nuclear factor kappa - b ligand - osteoprotegerin (rankl / opg) balance, by acting on the stromal cells to stimulate rankl expression, and also by reducing the expression of opg and vitamin d. on the other hand, pth stimulates osteoclast differentiation and activity, resulting in increased bone resorption . Furthermore, pth and 1,25-dihydroxyvitamin d can induce skeletal fgf23 production to regulate serum phosphate levels and thereby can influence bone resorption . Fgf23 is a 30 kda protein that is proteolytically processed to smaller n - terminal (18 kda) and c - terminal tail (12 kda) fragments . Structural analysis of fgf23 protein found a fgf receptor (fgfr)-binding domain at the n - terminal and a potential klotho - interacting site at the c - terminal tail . Recent studies have shown that the c - terminal tail determines the functionality of fgf23 protein . For instance, when the c - terminal tail of the fgf2 protein was replaced with the c - terminal tail of fgf23, the chimeric protein containing the n - terminal of fgf2 and c - terminal tail of fgf23 could act as a phosphatonin, and could also reduce renal 1(oh) synthesis . It is worth mentioning that the presence of the c - terminal tail of fgf23 in the chimeric protein paved the way for the klotho interaction . Recently, family with sequence similarity 20, member c (fam20c) has shown to phosphorylate fgf23 on a ser - x - glu motif, and such phosphorylation promotes fgf23 proteolysis by furin through blocking o - glycosylation by polypeptide n - acetylgalactosaminyltransferase 3 (galnac - t3). This observation suggests that interplay between phosphorylation and o - glycosylation of fgf23 may be a critical posttranslational mechanism by which the activity of secreted fgf23 protein is determined . Once secreted as a bioactive protein, fgf23, in presence of klotho, can induce downstream signaling molecules, as demonstrated by the activation of early growth response element-1 (egr-1) and the phosphorylation of fgf receptor substrate-2a, extracellular signal - regulated kinase (erk), p38, jun n - terminal kinase (jnk), and akt . Of relevance, these signaling phosphoproteins were detected only when cells were challenged with both fgf23 and klotho, and not in cells treated with fgf23 without klotho . In accord with these in vitro observations, in vivo studies have shown that bioactive fgf23 protein could significantly reduce serum phosphate level in wild - type and fgf23 knockout mice, but failed to exert such phosphate lowering effects in fgf23/klotho double knockout mice, again suggesting that without klotho, fgf23 loses its phosphate regulating abilities . Moreover, the fgf23-induced hypophosphatemic phenotype of hyp mutant mice was reversed to hyperphosphatemia in the hyp / klotho double mutant mice, despite significantly higher serum fgf23 levels in double mutants . In a similar line of observation, an inactivating mutation in the human klotho gene resulted in severe hyperphosphatemia in a tumoral calcinosis patient, despite high serum fgf23 levels . Summarizing these above - mentioned observations, an indispensable role of klotho in fgf23-mediated urinary phosphate excretion is obvious . One of the possible mechanisms of fgf23-induced urinary phosphate excretion is that it suppresses napi-2a and napi-2c co - transporters, either directly or through influencing pth activity . Pth, an 84 amino acid protein, is produced in response to low levels of serum calcium and secreted pth acts on the bone and kidney to increase serum calcium level . Low serum calcium levels reduce calcium - sensor receptor (car) signaling and allow active pth to be secreted, which then binds to the pth receptor 1, a seven transmembrane g - protein coupled receptor, to activate the pka, pkc, and mapk pathways in kidney and bone . In addition to serum calcium, vitamin d can also suppress pth expression and parathyroid hyperplasia . It is believed that fgf23 and pth mutually regulate each other in a negative feedback loop, where pth stimulates fgf23 production and fgf23 in turn suppresses pth synthesis . When pth was genetically ablated from fgf23 knockout mice, serum calcium levels were normalized in double mutant (fgf23/pth) mice, despite high serum 1,25-dihydroxyvitamin d and high serum phosphate levels, suggesting that some of the biochemical changes documented in fgf23 mice are mediated by pth . It is a well - known fact that continuous administration of pth for a prolonged period can reduce bone mass . However, when fgf23 mice were challenged with constant pth infusion through osmotic minipumps for 3 weeks, pth - induced bone loss was more severe, suggesting that fgf23 might exert a protective effect against the long - term catabolic effects of pth on bone . In a mouse model of hyperparathyroidism, fgf23 levels positively correlated with those of pth, but inversely with serum phosphate levels . Presence of both klotho and fgf receptors in the parathyroid glands raised the possibility that parathyroid gland might be a target organ for fgf23 activities . Using bovine parathyroid cells, on the other hand, other studies have claimed that the activation of the pth receptor in bone via the pka signaling pathway suppresses the wnt inhibitor sclerostin, thereby allowing wnt signaling to increase fgf23 synthesis . It is, however, worth mentioning that reducing wnt signaling in vivo, by genetically inactivating its co - receptor, low - density lipoprotein receptor - related protein 6 (lrp6), did not affect fgf23-induced hypophosphatemia in hyp mice, as shown in hyp / lrp6 double mutant mice . Furthermore, injection of bioactive fgf23 protein into lrp6 mutant mice reduced serum phosphate levels to a similar degree as fgf23 injection into wild - type mice, providing a genetic and pharmacological evidence for a wnt - independent function of fgf23 in the regulation of phosphate homeostasis . (this issue) claimed that pth, by activating nuclear orphan receptor (nurr1), can increase the transcription of fgf23 in bone cells . Structural analysis has found that nurr1 protein is lacking a ligand - binding cavity, and therefore may act as a ligand - independent transcription factor . In the fgf23 promoter region, the presence of nurr1 response elements raises the possibility of its role in fgf23 synthesis . In a cell - based system, through over - expression and knock down of nurr1, an association between pth and fgf23 is suggested . Moreover, in a rat model of chronic kidney disease (ckd), increased nurr1 mrna and protein levels were associated with increased fgf23 mrna expression, calcimimetic treatment of these ckd animals reduced pth and fgf23 levels, along with decreased calvarial nurr1 mrna and protein expression . Despite the presence of nurr1 responsive elements in fgf23 promoter regions, the functionality of nurr1 responsive elements in fgf23 synthesis is not yet defined, and without mutagenesis studies, whether increased expression of nurr1 and fgf23 is a mutual regulation or merely an epiphenomenon, could not be established . Moreover, to provide in vivo direct evidence, further studies will be needed to show that inactivating pth signaling, by targeting its receptors, can block pth induced nurr1 and fgf23 expression in long bones . It is also worth mentioning that pth induced fgf23 synthesis is a cell - line specific phenomenon . For instance, while pth can induce fgf23 in umr106 cell lines, no such response of pth on fgf23 is noted in ros16/2.8 cells . Despite a better understanding of fgf23 biology in systemic regulation of phosphate turnover, factors inducing its skeletal expression are not yet fully documented . 1,25-dihydroxyvitamin d, phosphate, calcium, iron, leptin, acidosis, secreted klotho and pth are the factors currently known to induce fgf23 production (fig . 1). It is a well - accepted fact that pth can induce the synthesis of 1,25-dihydroxyvitamin d in the kidney, and that, in turn, 1,25-dihydroxyvitamin d can inhibit pth secretion by the parathyroid glands . Recent studies have claimed that 1,25-dihydroxyvitamin d can stimulate fgf23 production in bone and that fgf23 can suppress 1,25-dihydroxyvitamin d production and pth secretion . The ability of pth to directly stimulate fgf23 expression forms an endocrine regulatory feedback loop to control mineral ion metabolism . Studies, as the one highlighted here, will help us to understand molecular regulation of fgf23 synthesis and identify its yet to be documented functions.
Extraction of viral rna, rt - pcr and nucleotide sequencing: the isolation and characterization of apmv / shimane/67 have been previously described . Viral genomic rna was extracted from infected allantoic fluid using qiaamp viral rna mini kit (qiagen, tokyo, japan), according to the manufacturer s instructions manual . The cdna of the apmv / shimane67 genome was synthesized using primescript reverse transcriptase (takara bio, otsu, japan) and amplified using sapphireamp fast pcr master mix (takara bio) and pairs of oligonucleotide primers . After purification from agarose gel using qiaquick gel extraction kit (qiagen), pcr products were sequenced using bigdye terminater v3.1 sequencing kit (applied biosystems, foster city, ca, u.s.a .) And analyzed using the 3130 xl genetic analyzer (applied biosystems). Determination of 3- and 5-ends of the viral genome sequence: the 3-end of the viral genome (le region) sequence of apmv / shimane67 was determined by a method previously described . To determine the 5-end of the viral genome (tr region), cdna from the 5-end of the genome was amplified using smart pcr cdna synthesis kit (clontech, palo alto, ca, u.s.a .) And virus - specific primers, according to the manufacturer s instructions manual . Analysis of nucleotide and deduced amino acid sequences: the molecular weight (mw) and isoelectric point (pi) of protein were calculated by compute pi / mw tool (http://web.expasy.org/compute_pi/). The transmembrane region of hn protein was predicted by the sosui system (http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html). The alignment of nt and deduced amino acid (aa) sequences and calculation of evolutionary distance in nt substitutions per site were conducted using the clustal x program . Phylogenetic trees were generated by neighbor - joining method with 1,000 bootstraps using clustal x program and then visualized with njplot . The nucleotide sequence data reported in this study have been deposited in the ddbj database under the accession number lc041132 . Whole genome sequences of other apmvs for comparison with apmv / shimane67 were from the following sources (abbreviation and accession number): apmv-1/goose / alaska/415/91 (apmv-1/415, ab524405); apmv-1 strain lasota (apmv-1/lasota, af077761); apmv-1 strain sf02 (apmv-1/sf02, af473851); apmv-2/chicken / california / yucaipa/56 (apmv-2/yukaipa, eu338414); apmv-2/finch / northern ireland / bangor/73 (apmv-2/bangor, hm159995); apmv-3/parakeet / netherland/449/75 (apmv-3/nld, eu403085); apmv-3/turkey / wisconsin/68 (apmv-3/wi, eu782025); apmv-4/duck / hong kong / d3/75 (apmv-4/hk / d3, fj177514); apmv-4/kr / yj/06 (apmv-4/kr / yj, eu877976); apmv-5/budgerigar / kunitachi/74 (apmv-5/kunitachi, gu206351); apmv-6/duck / hong kong/18/199/77 (apmv-6/hk / d199, eu622637); apmv-6/duck / italy/4524 - 2/07 (apmv-6/ita/4524 - 2, gq406232); apmv-7/dove / tennessee/4/75 (apmv-7/tn, fj231524); apmv-8/goose / delaware/1053/76 (apmv-8/de, fj215863); apmv-8/pintail / wakuya/20/78 (apmv-8/wakuya, fj215864); apmv-9/duck / new york/22/78 (apmv-9/ny, eu910942); apmv-10/penguin / falkland islands/324/2007 (apmv-10/flk, hm147142); apmv-11/common snipe / france/100212/2010 (apmv-11/fra, jq886184); and apmv-12/wigeon / italy/3920 - 1/2005 (apmv-12/ita/3920 - 1, kc333050). Genomic features of apmv / shimane67: the genome characteristics of apmv / shimane67 and some other apmvs are summarized in table 1table 1.comparison of nucleotide and amino acid length between apmv / shimane67, apmv-1, -9 and-12geneapmv / shimane67apmv-1/lasotaapmv-1/415apmv-1/sf02apmv-9/nyapmv-12/ita/3920 - 1full genome (nt)16,14615,18615,19815,19215,43815,132leader (nt)555555555555trailer (nt)7761141141144760n3-noncoding (nt)606666666666orf (nt)1,4821,4701,4701,4701,4701,4825-noncoding (nt)179210210217192162total (nt)1,7211,7461,7461,7531,7281,710amino acid493489489489489493n - p intergenic (nt)14221197p3-noncoding (nt)9583838311395orf (nt)1,1941,1881,2001,1881,2601,2185-noncoding (nt)223180180180248190total (nt)1,5121,4511,4631,4511,6211,503amino acid397395399395419405p - m intergenic (nt)111163m3-noncoding (nt)343434343434orf (nt)1,1011,0951,0951,0951,0951,0955-noncoding (nt)200112112112161151total (nt)1,3351,2411,2411,2411,2901,280amino acid366364364364364364m - f intergenic (nt)21113011f 3-noncoding (nt)454646465552orf (nt)1,6381,6621,6621,6621,6561,6415-noncoding (nt)1758484846788total (nt)1,8581,7921,7921,7921,7781,781amino acid545553553553551546f - hn intergenic (nt)143131312261hn3-noncoding (nt)929191919791orf (nt)1,8331,7341,8511,7161,7401,8455-noncoding (nt)14517759195293136total (nt)2,0702,0022,0012,0022,1302,072amino acid610577616571579614hn - l intergenic (nt)25474847042l3-noncoding (nt)131111111111orf (nt)6,6006,6156,6156,6156,6336,6095-noncoding (nt)15077777769106total (nt)6,7636,7036,7036,7036,7136,727amino acid2,2012,2042,2042,2042,2102,202a) the nucleotide sequence of apmv / shimane67 f gene was reported by yamamoto et al . .. the genome of apmv / shimane67 comprised 16,146 nt that was slightly au - rich (a 25.9%, c 22.1%, g 20.5% and u 31.5%). The genome of apmv / shimane67 contained six viral protein genes in the order 3-n - p - m - f - hn - l-5, which was identical to other apmvs, except for apmv-6 . The sh protein gene existing in the apmv-6 genome was not present in the apmv / shimane67 genome . The full genome sequence of apmv / shimane67 had the highest nt identity with apmv-12/ita/3920 - 1 (62.2%), intermediate nt identities with apmv-1 and -9 (53.7%55.0%), and lower nt identities with apmv-2, -3, -4, -5, -6, -7, -8, -10 and -11 (41.9%44.8%) (table 2table 2.nucleotide (nt) and deduced amino acid (aa) sequence identities between apmv / shimane67 and other apmvs (%) virusfull genomenp vmhnlntaantaaaantaantaantaaapmv-1/lasota55.058.657.953.842.338.556.753.356.955.156.654.4apmv-1/41555.059.058.353.640.534.956.553.956.155.356.755.6apmv-1/sf0254.658.456.452.342.837.656.352.856.155.157.055.5apmv-2/yucaipa44.847.939.839.624.225.243.127.844.434.146.337.5apmv-2/bangor44.647.039.340.122.924.443.827.843.334.546.432.0apmv-3/nld41.948.538.741.023.720.540.225.243.837.243.633.2apmv-3/wi41.947.738.640.024.219.341.125.545.436.943.833.4apmv-4/hk / d342.348.837.040.521.724.139.424.544.236.543.432.5apmv-4/kr / yj42.348.437.039.722.525.140.824.444.036.343.132.6apmv-5/kunitachi43.548.736.940.922.925.243.429.943.433.846.437.5apmv-6/hk / d19942.949.140.641.322.426.743.629.644.331.947.538.4apmv-6/ita/4524 - 243.449.040.242.922.726.143.630.442.930.747.638.5apmv-7/tn44.849.139.138.720.026.744.230.345.237.947.540.3apmv-8/de44.847.839.240.624.927.242.429.543.834.247.139.1apmv-8/wakuya44.747.739.440.625.226.742.028.743.433.847.339.1apmv-9/ny53.758.656.051.240.432.155.350.854.554.756.053.4apmv-10/flk44.647.940.439.023.323.342.028.143.435.246.438.0apmv-11/fra43.048.140.240.123.726.638.925.845.537.447.040.1apmv/12/ita/3920 - 162.267.674.461.451.345.265.173.661.360.563.165.5). A) the nucleotide sequence of apmv / shimane67 f gene was reported by yamamoto et al . . The le sequence of apmv / shimane67 was 55 nt in length, which was the same as that of other apmvs . In contrast, the tr sequence of apmv / shimane67 was 776 nt in length, which was the longest in the avulavirus genus . Marcos et al . Reported that the first 18 nt of the le and tr regions and thrice - repeated motif (3-nnnngc-5) at 7390 nt of the apmv-1 genomic and antigenomic rna functioned as promoters of viral genome replication . Fourteen nt of the le and tr sequences, with the exception of the 9th nt from the 3- and 5-terminal of the genome, were complementary in the apmv / shimane67 genome (fig . Alignment of the (b) 3-leader and (c) 5-trailer regions of the sequences from apmv / shimane67 and other apmvs . Identical nucleotides with apmv / shimane67 and gaps are shown by dots and dashes, respectively . Twelve nt of the 3 le and 11 nt of the 5 tr of the apmv / shimane67 genome were relatively conserved with those of other apmvs and were completely matched with apmv-1 (fig . The three times repeated motifs, 3-gguggc-5, 3-acaagc-5 and 3-ucaggc-5, and 3-auuucc-5, 3-uccagc-5 and 3-uucagc-5 were found in 7390 nt from the 3-terminus of the genome and antigenome of apmv / shimane67, respectively . The gs signal of apmv / shimane67 was well preserved, and its consensus sequence was acgggcagaa 2. (a) the gene - start, gene - end and intergenic sequences of apmv / shimane67 . (b) alignment of the consensus gene - start and gene - end sequences from apmv / shimane67 and other apmvs . In contrast, the preservation of ge signal sequences of apmv / shimane67 was relatively low . The consensus sequence of the apmv / shimane67 ge signal was ttaaga56, whereas that of the m gene diverged at positions 1 (a), 2 (a), 3 (t) and 5 (t). The hn gene had one nt difference at the fifth position (t); whereas the l gene also contained two nt differences at the second (a) and third (g) positions . Apmv / shimane67 gs and ge sequences had similarities with those of apmv-1, -9 and -12 (fig . P - m, m - f, f - hn and hn - l junctions was 14 nt, one nt, two nt, 14 nt and 25 nt, respectively . The last nt at igs of apmv / shimane67 was t at all times, and this could act with the gs sequences to initiate mrna transcription . Alignment of the (b) 3-leader and (c) 5-trailer regions of the sequences from apmv / shimane67 and other apmvs . Identical nucleotides with apmv / shimane67 and gaps are shown by dots and dashes, respectively . (a) the gene - start, gene - end and intergenic sequences of apmv / shimane67 . (b) alignment of the consensus gene - start and gene - end sequences from apmv / shimane67 and other apmvs . N gene and n protein: the n gene of apmv / shimane67 was 1,721 nt in length and contained an open reading frame (orf) that encoded 493 aa, with mw of 54,045 da and pi of 5.29 . The nt sequence of apmv / shimane67 n gene orf was 67.6% identical with apmv-12/ita/3920 - 1, 58.4%59.0% identical with apmv-1 and -9, and 47.0%49.1% identical with the rest of the apmvs . The predicted aa sequence of apmv / shimane67 n gene demonstrated 74.4%, 56.0%58.3% and 36.9%40.6% identities with apmv-12/ita/3920 - 1, apmv-1 and -9 and the rest of the apmvs, respectively (table 2). There are three highly conserved regions [region 1, qxw(i, v)xxxk(a, c)xt; region 2, fxxt(i, l)(r, k)(g, a)(l, i, v)xt; and region 3, fxxxxypxxsamg] (where x represents any amino acid and represents an aromatic amino acid and, either of the residues in parentheses can be present at that position) in the central domain of the n protein of the subfamily paramyxovirinae . Among these regions, region 3 is particularly important, because this region is thought to be involved in the n the n protein of apmv / shimane67 contained aa sequences similar to these motifs: qiwvtlakamt, ffltlkygint and fapaeyslmysfsmg (fig . The motifs are shown at the upper lines (x and represent any amino acid and aromatic amino acid, respectively). Numbers indicate the amino acid positions of the apmv / shimane67 n protein . ). The 7th (p) and 13th (a) aa of region 3 motif were replaced with s and s, respectively . The aa sequence of region 2 was completely identical among apmv / shimane67, apmv-1 and apmv-12 . The motifs are shown at the upper lines (x and represent any amino acid and aromatic amino acid, respectively). P gene and p / v proteins: the p gene of apmv / shimane67 genome was 1,512 nt long . The p gene of avulaviruses encodes two proteins, p and v [35, 38]. The p protein is expressed from mrna that is directly transcribed from the genomic rna . The nt identities of apmv / shimane67 p protein orf were 61.4% with apmv-12/ita/3920 - 1, 51.2%53.8% with apmv-1 and -9, and 38.7%42.9% with the other remaining apmvs (table 2). The v proteins is produced through mrna that contains insertion of one non - template g residues at the rna editing site . The nt at positions 436444 of the p gene orf, 5-aaaaaaggg-3 (mrna sense), was predicted as the rna editing site of apmv / shimane67 (fig . 4.alignment of (a) nucleotide sequences of rna editing sites (mrna sense) and (b) c - terminal regions of v protein . Numbers indicate the nucleotide or amino acid positions of the (a) p gene orf and (b) v protein of apmv / shimane67, respectively . ). This nt sequence was completely identical with that of apmv-5/kunitachi, apmv-6/hk / d199, apmv-7/tn, apmv-9/ny and apmv-12/ita/3920 - 1 . The deduced aa lengths of p and v proteins were 397 aa (mw 41,992 da, pi 6.22) and 241 aa (mw 25,929 da, pi 4.80), respectively . These two proteins shared the n - terminal 148 aa . The aa identities in p and v proteins between apmv / shimane67 and other apmvs were comparatively low, ranging from 20.0% (apmv-7/tn) to 51.3% (apmv-12/ita/3920 - 1) and 19.3% (apmv-3/wi) to 45.2% (apmv-12/ita/3920 - 1), respectively (table 2). Seven cysteine residues (c, c, c, c, c, c and c) and the hrre and wcnp motifs were conserved at the c - terminus of apmv / shimane67 v protein as well as in other apmvs (fig . 4b). Alignment of (a) nucleotide sequences of rna editing sites (mrna sense) and (b) c - terminal regions of v protein . Numbers indicate the nucleotide or amino acid positions of the (a) p gene orf and (b) v protein of apmv / shimane67, respectively . M gene and m protein: the m gene of apmv / shimane67 contained 1,335 nt and encoded a protein with 366 aa with mw of 39,902 da and pi of 9.63 . The orf and predicted aa sequence of apmv / shimane67 m gene had identities in 65.1% and 73.6% with apmv-12/ita/3920 - 1, 55.3%56.7% and 50.8%53.9% with apmv-1 and -9, and 38.9%44.2% and 24.4%30.4% with the remaining apmvs, respectively (table 2). There are two functional aa sequences one is nuclear localization signal (nls), and the other is the late domain in the m protein of apmv-1 [7, 10]. Nls comprised a bipartite clustering of basic amino acids (e.g., rkgkkvtfdklekkirs of apmv-1/lasota m protein). In the apmv / shimane67 m protein, the putative bipartite nls motif (kgnkisvdklelkirr) was found at positions 248263 aa (fig . 5afig . 5.alignment of (a) putative bipartite nuclear localization signal and (b) late domain of apmv m protein . Numbers indicate the amino acid positions of the apmv / shimane67 m protein . ). The fpiv late domain that contributes to efficient viral release and replication was at positions 2326 aa of the apmv-1 m protein . Furthermore, a comparable sequence motif in other apmv m proteins was reported [37, 44, 45]. A similar aa sequence motif (fpvv) was found at positions 2326 aa in the m protein of apmv / shimane67 (fig . 5b). Alignment of (a) putative bipartite nuclear localization signal and (b) late domain of apmv m protein . Hn gene and hn protein: the hn gene for apmv / shimane67 comprised 2,070 nt with one orf that encoded a protein with 610 aa with mw of 67,492 da and pi of 5.42 . The nt and deduced aa of apmv / shimane67 hn gene had the highest identities with apmv-12/ita/3920 - 1 at 61.3% and 60.5%, followed by that with apmv-1 and -9 at 54.5%56.9% and 54.7%55.3%, and other apmvs at 42.9%45.5% and 30.7%37.9%, respectively (table 2). The transmembrane region of apmv / shimane67 hn protein was predicted at positions 2547 by the sosui system . Five n - glycosylation motifs (n - x - s / t) were found at positions 119, 341, 392, 481 and 604 aa of apmv / shimane67 hn protein (table 3table 3.comparison of amino acid position and sequences of functional domains of the hn protein between apmv / shimane67 and other apmvsvirusamino acid positions of potential n - linked glycosylation sitesialic acid - binding motifsialic acid - binding and neuraminidase activity apmv / shimane67119, 341, 392, 481, 604nrkscsr, i, d, k, e, y, y, e, r, r, y, e apmv-1/lasota119, 341, 433, 481, 538 ................. apmv-2/yucaipa119, 278, 345, 392, 481 ................. apmv-3/nld33, 53, 58, 115, 309, 322, 380, 493, 494 ................. apmv-4/hk / d311, 57, 142, 322, 380, 392, 443 ................. apmv-5/kunitachi60, 119, 148, 278, 346, 392 ................. apmv-6/hk / d199119, 278, 346, 377, 392, 438, 483 ................. apmv-7/tn60, 119, 145, 278, 343, 377, 392, 484, 513, 564 ................. apmv-8/de119, 278, 392, 507 ................. apmv-9/ny119, 147, 228, 341, 348, 433, 481 ................. apmv-10/flk119, 147, 278, 352, 432, ................. apmv-11/fra147, 150, 266, 278, 345, 392, 431, 479, 484 ................. apmv-12/ita/3920 - 1119, 147, 341, 348, 594 ................. a) numbering of amino acid residues corresponds to apmv / shimane67 hn protein sequnece . B) the identical amino acids between apmv / shimane67 and other apmvs are shown by dot . ). Two of these, at positions 119 and 392 aa, were relatively conserved among avulaviruses, because the hn proteins of apmv-1, -2, -5, -6, -7, -8, -9, -10 and -12, and apmv-2, -4, -5, -6, -7, -8 and -11 also contained the n - glycosylation motif at positions corresponding to the 119 and 392 aa, respectively . The sialic acid - binding motif nrkscs preserved among hn proteins of paramyxoviruses was identified at positions 234239 of the hn protein of apmv / shimane67 (table 3). Twelve aa (r, i, d, k, e, y, y, e, r, r, y and e) engaged in sialic acid - binding and neuraminidase (na) activity of apmv-1 [8, 9, 14] were also completely conserved in the hn protein of apmv / shimane67 (table 3). Moreover, the hn protein of other apmvs perfectly possessed these aa . The aa sequence alignment of hn protein from apmvs demonstrated that the hn protein of apmv / shimane67, apmv-9/mallard / italy/5709/2007 and apmv-12/ita/3920 - 1 contained aa sequences corresponding to the 45 aa extension, which was found in the c - terminal end of hn protein of lentogenic apmv-1, such as strains d26, ulster and 415 (fig . 6.alignment of c - terminal 45 extension of apmv-1 hn protein and the corresponding regions of apmv / shimane67, apmv-9 and 12 . The genbank accession of apmv-1/d26, ulster and apmv-9/ita/5709 is m19432, m19478 and gu068587, respectively . ). The removal of c - terminal 42 aa extension by proteolytic cleavage converts into the biologically active form of lentogenic apmv-1 hn protein [27, 28]. Recently, yuan et al . Demonstrated that the c - terminal 45 aa extension of lentogenic apmv-1 hn protein autoinhibited receptor binding and catalytic activities by blocking the na - active and second sialic binding sites . In addition, the intermolecular disulfide bond formed by the cysteine residue at 596 aa in the c - terminal extension was critical for the expression of autoinhibition of hn activities . Although there was no cysteine residue and aa identity in the c - terminal extension region of apmv / shimane67, the three extreme c - terminal residues (swp), which masked the na active site in the apmv-1 hn protein, were identical to apmv-1 . A) numbering of amino acid residues corresponds to apmv / shimane67 hn protein sequnece . B) the identical amino acids between apmv / shimane67 and other apmvs are shown by dot . Alignment of c - terminal 45 extension of apmv-1 hn protein and the corresponding regions of apmv / shimane67, apmv-9 and 12 . The genbank accession of apmv-1/d26, ulster and apmv-9/ita/5709 is m19432, m19478 and gu068587, respectively . L gene and l protein: the apmv / shimane67 l gene was 6,763 nt long and encoded a single orf, giving a deduced protein of 2,199 aa (mw 248,209 da and pi 6.86). The orf and aa sequences of apmv / shimane67 l gene were 63.1% and 65.5% identical with apmv-12/ita/3920 - 1, and 56.0%57.0% and 53.4%55.6% identical with apmv-1 and -9, respectively . In contrast, fewer identities (43.1%47.6% in nt and 32.0%40.3% in aa sequences) were observed between apmv / shimane67 and apmv-2 to -8, apmv-10 and apmv-11 (table 2). The l protein of non - segmented negative - strand rna viruses contains six conserved aa domains (i - vi). Among these domains, domain iii corresponding to at positions 635826 aa of apmv / shimane67 was relatively highly conserved among avulaviruses (fig . 7afig . 7.alignment of (a) the conserved domain iii of l protein of non - segmented negative strand rna viruses and (b) the putative atp - binding site of the l protein . The qgdnq and k - x18 - 21g - x - g - x - g motifs are underscored . Numbers indicate the amino acid positions of the apmv / shimane67 l protein . ). The qgdnq sequence, identified in the motif c of domain iii as the putative active site for nucleotide polymerization, was found on the apmv / shimane67 l protein at positions 747751 aa . The putative atp - binding site comprising k - x1821-g - x - g - x - g was found at positions 17561782 aa of domain iv of apmv / shimane67 l protein (fig . 7b) [12, 32]. Alignment of (a) the conserved domain iii of l protein of non - segmented negative strand rna viruses and (b) the putative atp - binding site of the l protein . The qgdnq and k - x18 - 21g - x - g - x - g motifs are underscored . Phylogenetic analysis: to understand genetic relationships, phylogenetic trees were constructed based on the nt sequences of full length genome and the n, p, m, hn and l genes of apmv / shimane67 and other viruses from the five members of the family paramyxovirinae (avulavirus, henipavirus, morbillivirus, respirovirus and rubulavirus) (fig . 8fig . The numbers at the branches represent bootstrap values from 1,000 replicates . The number of nucleotide substitutions per site (scale bar) is shown . And supplementary figs . Essentially, all trees demonstrated similar grouping patterns, except for apmv-7 and -11, and clearly divided according to the five classifications of paramyxoviruses . Apmv / shimane67 was classified as a member of the genus avulavirus, but distinct from other apmvs . The apmv / shimane67 fell into the group that comprised apmv-1, -9 and -12 and had the closest relationship with apmv-12/ita/3920 - 1 . In the present study, we determined the nt sequences of n, p, m, hn and l genes, le, tr and igs of apmv / shimane67 . Together with our previous study of the f gene sequencing, whole genome sequencing of apmv / shimane67 was completed . The genome of apmv / shimane67 basically had following common features with other apmvs: agreement with the rule of six; gene order (3-n - p - m - f - hn - l-5) and existence of gs and ge signal, and igs; complementation of 3- and 5-terminus sequence; existence of three times repeated motif; existence of the putative rna editing site of p gene . In addition, the coding proteins of apmv / shimane67 genome contained following conserved aa sequence motifs with other apmvs: n protein self - assembly motif; cysteine - rich region and hrre and wcnp motifs of v protein; putative bipartite nls motif and the late domain of m protein; amino acids constituting the sialic acid binding site of hn protein; putative active site for nucleotide polymerization and atp - binding site of l protein . These nt and aa characteristics of apmv / shimane67 can contribute to the efficient replication and transcription of viral genome, and viral growth . By contrast, the genome of apmv / shimane67 had differences with other apmvs in terms of some details, such as the nt length of whole genome, six genes (n, p, m, f, hn and l) and igs, and predicted aa length of six genes, which were almost unique in apmv / shimane67 (table 1). The genome size of apmv / shimane67 was 16,146 nt long . This genome size is different from any other known apmvs genome and was the fifth longest among apmvs . With the exception of apmv / shimane67, there are four apmvs, which have genome longer than 16,000 nt: apmv-3 with 16,18216,272 nt; apmv-5 with 17,262 nt; apmv-6 with 16,17416,236 nt; and apmv-11 with 17,412 nt [3, 6, 17, 18, 37, 42, 45]. The relatively large genome size of apmv / shimane67 is attributable to its long tr sequence (776 nt). The tr sequence longer than 700 nt was also found in apmv-3/nld genome . However, the significance of these long tr sequence is unclear, and a further study is needed to clarify this issue . The phylogenetic trees indicated that apmv / shimane67 had the closest relationship with apmv-12/ita/3920 - 1 . When comparing full genome sequences, the evolutionary distance between apmv / shimane67 and apmv-12/ita/3920 - 1 was 0.357 nt substitutions per site . This distance was longer than those observed within serotypes, such as the distance between apmv-2/yucaipa and apmv-2/bangor at 0.291, apmv-3/nld and apmv-3/wi at 0.292, and apmv-6/twn / y1 and apmv-6/ita/4524 - 2 at 0.265 . These strains were antigenically and genetically divided into subgroups in each serotype [2, 18, 39, 45]. Thus, the apmv / shimane67 and apmv-12/ita/3920 - 1 had greater degrees of genetic diversity than that found within the subgroups of apmv-2, -3 or -6 . Although there are no defined genetic criteria to differentiate the typing of apmvs, recent studies attempted and demonstrated that classification based on genetic analysis was correlated with conventional serotyping [3, 22, 35, 41]. Our previous serological analysis demonstrated that apmv / shimane67 was distinct from apmv-1, -2, -3, -4, -6 and -7 . Moreover, sequence analysis of f gene of apmv / shimane67 indicated that apmv / shimane67 was genetically diverse from other apmv serotypes . Thus, the results obtained in this study emphasized the possibility that apmv / shimane67 would be a novel apmv type . Quite recently, karamendin et al . Reported the whole genome sequence of a novel apmv isolated from a white fronted goose in northern kazakhstan (genbank accession number ku64513). The genome length of apmv / shimane67 is 150 nt longer than that of kazakhstan apmv, while genome nt identity of these strains was very high (approximately 96%). The deduced aa sequence identities of the n, p, m, f, hn and l proteins between apmv / shimane67 and kazakhstan apmv are 99.6%, 99.2%, 98.9%, 99.6%, 99.1% and 99.6%, respectively . Although there is no serological evidence for the close relationship between apmv / shimane67 and kazakhstan apmv, the genomic similarities of apmv / shimane67 and kazakhstan apmv suggest that these two strains would be classified as the same serotype, apmv-13.
In fixed orthodontic treatment, brackets were used for transferring orthodontic forces to the teeth . At first, to attach the brackets to the tooth, orthodontic bands were used and after welding brackets to bands, they were cemented to the tooth . In 1955, buonocore introduced the acid - etch technique that was gradually used in different dental treatments . In 1965, newman used direct bonding of orthodontic brackets that was considered as the first step in application of appliances with the improvement of esthetic presentation . This technique was developed rapidly due to its simplicity, efficacy and providing more esthetic qualities . For achieving successful bonding, the bonding agent must penetrate to the enamel surface, have easy clinical use, dimensional stability and enough bond strength . The bond strength of orthodontic brackets should be enough to not cause bonding failure and delay in treatment and it also should have adequate resistance against chewing forces and stresses from archwires . On the other hand, easy debonding of the brackets without any damage to the teeth needs sufficient and safe bond strength . According to few stages for bonding of orthodontic brackets and related problems in the conventional system, other techniques such as application of self - etch primers or laser irradiation was suggested to simplify the bonding procedure . In the acid - etching technique, microporosity was produced on the enamel surface to provide micromechanical bonding . Enamel etching with phosphoric acid results in loss of the superficial layer of the enamel and dissolution of the enamel subsurface . The amount of enamel loss depends on phosphoric acid concentration and the time of application . Laser etching was performed by the erbium family with two different wavelengths (2940 and 2780 nm). This technique has some advantages such as having no vibration or heat and producing a surface which is acid resistant by altering the calcium to phosphor ratio and formation of less soluble compounds . There are some studies which have evaluated the effect of laser etching on bond strength of orthodontic brackets with controversial results . So, the purpose of this study was to compare shear bond strength (sbs) of orthodontic brackets bonded to enamel prepared by er: yag laser with two different powers and conventional acid - etching . Forty - five human premolars extracted for orthodontic purposes were selected for this study . In transillumination examination, the teeth showed healthy enamel on the buccal surface, without attrition, fracture, restoration, congenital anomalies and structural defects . There was no history of chemical substance application such as hydrogen peroxide for these teeth . After rinsing the teeth, they were placed in 0.5% chloramine t for inhibiting bacterial growth for 2 hours . The teeth were divided into three groups according to conditioning method: group 1: conventional etching with 37% phosphoric acid; group 2: laser irradiation by er: yag laser with output power of 1w; and finally group 3: laser irradiation with er: yag laser with output power of 1.5w . In group 1, the samples were etched with 37% phosphoric acid gel (3 m, dental products, st.poul) for 15 sec, then rinsed for 15 sec with water spray and dried with air spray for 10 sec in a 2 cm distance above the surface of the enamel . Laser irradiation in group 2 and 3 was carried out by er: yag laser (us20d, deka, italy) with a 2940 nm wavelength . The area was marked before irradiation . In group 2, laser was used with an output power of 1w, energy of 100 mj and frequency of 10 hz . These parameters were 1.5 w, 150 mj and 10 hz, respectively for group 3 . The handpiece of laser was used 5 mm above the surface in non - contact mode and sweeping motion . Subsequently, the adhesive kit (transbond xt, 3 m, unitek) was used . The adhesive paste was placed on the bracket base and the brackets were placed on the enamel with a 300 gr compressive force with gauge for 10 sec to produce uniform thickness . The resin was polymerized by led (mectron, starlight pro gac, italy) with a 440480 nm wavelength and 400 mw / cm intensity for 40 sec . Consequently, the samples were thermocycled for 200 cycles between 5c and 55c water baths with 30 sec dwell time for each . The specimens were mounted in auto - cure acrylic resin and the shear bond strength was measured by using a universal testing machine with a crosshead speed of 0.5 mm per second . After debonding, the amount of resin remaining on the teeth was determined using the adhesive remnant index (ari) scored 1 to 5 (table 1) by stereomicroscope (nikon d - cs, japan) with 10x magnification . One - way analysis of variance was used to compare shear bond strengths and the kruskal - wallis test was performed to evaluate differences in the ari for different etching types . The mean and standard deviation of the conventional acid - etch group, laser group (1w) and laser group (1.5w) was 3.82 1.16, 6.97 3.64 and 6.93 4.87, respectively . There was no significant difference between laser group (1.5w) and laser group (1w) (p=1.000) and conventional group (p=0.085), but there was a significant difference between laser group (1w) and conventional group (p=0.016). According to graph 1, the variances of values of the laser samples bond strengths was higher than the acid - etch group . Table 2 shows the frequency distribution of ari degrees in the three groups . According to the kruskal - wallis test there are some studies which evaluate the enamel preparation by laser irradiation for orthodontic brackets . The aim of this study was to assess the shear bond strength of orthodontic brackets bonded to enamel prepared by er: yag laser or acid - etch . The bond strength of light curing composites may be influenced by thermal changes of the oral cavity and the quality of polymerization . Thermocycling is a common method for stimulating this condition; therefore, we used this technique in this research . The result of this study showed that both laser groups had higher bond strengths than the acid - etch group . Although this difference was significant between the laser group with an output power of 1w and the acid - etch group, the laser group with an output power of 1.5w showed no significant difference with the acid - etch group . According to usumez s study, laser irradiation with a power of 2w in comparison with the acid - etch technique showed similar shear bond strengths, but application of laser with a power of 1w showed a lower bond strength . On the other hand, gokcelik et al.s study which assessed the shear bond strength of samples prepared by er: yag laser and acid - etch found no significant difference between these two groups . Controversial results were obtained from different studies which evaluated the effect of laser irradiation compared to conventional methods due to different study designs and various parameters used in these studies . Morphological changes of enamel produced after laser irradiation depends on the energy density of the laser, the time of exposure, the distance of the laser handpiece from the surface and percentage of water irrigation . Samples irradiated with 1.5w power showed no significant difference compared to laser group with 1w power which is in agreement with the results obtained from basaran s study . In the present study, the laser groups showed higher bond strengths with higher standard deviations compared to the acid - etch group . This finding reduced the credibility of laser application for enamel preparation, considered as an unfavorable characteristic . In similarity, usumez et al . Reported higher distribution coefficient for shear bond strength of orthodontic brackets in laser prepared surfaces . The reason may be related to the irregular etching pattern of surfaces irradiated by laser . Sasaki et al . Found that preparation of enamel surfaces by er: yag laser cannot be done homogeneously . Surfaces irradiated by laser showed some areas which were similar to unlased enamel surfaces but surface preparation by acid etch technique showed more homogeneous patterns which was like honey comb pattern that is favorable structure for adhesion process . Higher standard deviations in the laser groups may be associated with intrinsic nature differences of the teeth collected from different people, time of storage and environmental effects on the tooth after extraction . In order to control these problems, animal teeth can be used because numerous tooth samples can be provided from an animal . Among different animals maijer and smith stated that bond strength of 8 mpa is essential for orthodontic treatment . In this study, the mean of shear bond strength in the three groups was below the suggested value . Cerekja and cakirer showed that that thermocycling process reduced the shear bond strength of orthodontic brackets . In addition, daub confirmed that this condition was due to differences in thermal expansion coefficients of the adhesive, brackets and enamel . Two thirds of the samples showed an ari degree of 4 or 5 which showed that the highest debonding happened in resin to teeth contact surface which needs less cleaning of debonded enamel leading to reduction of abrasion risk to the enamel, but it is better to have debonding in resin - bracket contact or inside the resin because the less adhesive remaining on the tooth, the more stress affecting the enamel surface in clinical condition, this kind of debonding is rare because providing favorable etching in enamel surface is difficult due to lack of controlling humidity, time and cooperation of patients in preparing the surfaces . In addition, the structural pattern of the bracket base makes debonding in the resin bracket contact surface uncommon . In contrast to these results, lee in the evaluation of bonded brackets observed that samples prepared by acid - etch technique or er: yag laser irradiation showed more fracture pattern in resin - bracket contact surface . These different results may be contributed to the debonding test procedure, which was tensile bond strength in lee s study . Valletta reported that debonding happened in bracket resin surface in tensile bond strength and in resin tooth contact surface in shear bond strength . : yag laser with an output power of 2 w and frequency of 2 hz showed no significant increase in shear bond strength compared to the control group . In the present study, ari degree among the two laser groups and between laser groups and in contrast, gokcelik showed higher ari degrees in er: yag laser compared to the acid - etch group . In laboratory conditions, loading forces to brackets were different from clinical conditions . In clinical conditions, besides, in the oral cavity, there are different kinds of stresses such as thermal changes, humidity and microbial plaque that make the simulation condition in laboratory difficult . Although bond strength tests are still far from ideal, attempts should be made to standardize these tests to make comparisons easier . The shear bond strength of bracket to laser - prepared enamel with two different powers of 1 and 1.5 w was similar and laser groups showed higher bond strengths than the acid etch group . However, high variances of values in bond strength of irradiated enamel should be considered to find the appropriate parameters for applying er: yag laser as a favorable alternative for surface conditioning.
To determine the prevalence and clinical characteristics of hbov, we investigated the presence of this virus in children with respiratory tract infection in our region (gipuzkoa, basque country, spain). Among the first patients in whom hbov was detected in nasopharyngeal aspirates, we found two 12-month - old children with diarrhea in addition to respiratory symptoms . Because animal parvoviruses are frequently associated with enteritis in young animals (6), we investigated the presence of hbov in the diarrheal feces of both children . Hbov was detected in both samples, and no other intestinal pathogens were identified . To rule out the possibility that this result could have been due to fecal contamination resulting from swallowing respiratory secretions, and to determine whether the gastrointestinal tract is affected by this new respiratory virus, we studied its presence in patient feces in 527 episodes of acute gastroenteritis, unrelated to respiratory infection, in children <3 years of age, mainly from nonhospital centers (ambulatory clinics). Viral dna and rna were obtained from nasopharyngeal aspirates and stool specimens with an automatic extractor biorobot m48 (qiagen, hilden, germany) by using the magattract virus mini m48 kit (qiagen). Cdna was obtained by using m - mulv reverse transcriptase (promega, madison, wi, usa) and random primers . Aliquots of the dna and cdna were frozen at 40c until pcr for hbov detection was performed . Respiratory samples were investigated for respiratory syncytial virus, influenza viruses a and b, parainfluenza virus types 14, and adenovirus by cell culture and pcr . Rhinovirus, coronavirus (nl63 coronavirus included), and metapneumovirus were studied by pcr alone . Yersinia enterocolitica, campylobacter spp ., and enteroinvasive escherichia coli o157 by standard culture methods . Hbov detection was performed by pcr with primers derived from the np1 gene (1). Positive samples were retested and confirmed as positive by using a second pcr assay with primers derived from another location in the hbov genome (vp1 gene) (7). Amplified np1 and vp1 gene fragments (354 bp and 403 bp, respectively) were sequenced and analyzed by using the blast software (www.ncbi.nlm.nih.gov/blast). Each pcr run included a negative control (water) that was treated as the clinical sample throughout, and pcr was performed with the usual precautions to avoid contamination . Of the 527 stool samples analyzed from december 2005 through march 2006, hbov was detected in 48 (9.1%). From a second group of 520 children <3 years of age who came to the pediatric emergency unit of our hospital with an episode of acute respiratory infection during the same period, a similar frequency of hbov detection was obtained (40/520, 7.7%) when nasopharyngeal aspirates were tested . Analysis of np1 and vp1 partial gene sequences obtained from all fecal and respiratory hbov - positive samples showed a similarity of> 95% with previously published hbov sequences . Of 40 hbov - positive respiratory samples, 25 (62.5%) showed coinfection with other viruses (respiratory syncytial virus in 13, rhinovirus in 3, influenza a in 3, coronavirus oc43 in 2, adenovirus in 1, influenza b in 1, respiratory syncytial virus and coronavirus oc43 in 1, and influenza a and rhinovirus in 1). Of the 48 hbov - positive fecal samples, 28 (58.3%) showed coinfection with another intestinal pathogen (salmonella enteritidis in 1, campylobacter jejuni in 5, rotavirus in 14, norovirus in 7, and c. jejuni and norovirus in 1). In this study, simultaneous detection of hbov and the incidence of coinfection in respiratory illness was similar to that observed in studies that were not limited to specimens that had already tested negative for other microorganisms and in which a wide number of agents were investigated (4). Adenoviruses have been associated with infection of the colon and the gut and are a cause of severe gastroenteritis in nonindustrialized countries . In this study, coinfection of adenovirus and hbov was detected in 1 respiratory specimen but these viruses together were not detected in any fecal sample . Hbov and parvovirus b19 are the only 2 species of the parvoviridae family that have been associated with disease in humans . To date, hbov has only been detected in samples from the respiratory tract and has been associated with both upper and lower respiratory tract disease in infants and young children . The results of our study show that hbov is also present in the gastrointestinal tract in children with gastroenteritis with or without symptoms of respiratory infection . The fecal excretion adds new concern about the transmission of hbov . To our knowledge, this report is the first to document hbov in human feces . The high frequency of hbov detection in the feces of children with gastroenteritis and the absence of any other intestinal pathogen suggest that this new virus species is an enteric, as well as a respiratory, pathogen . Further investigations to confirm this preliminary hypothesis and gain greater knowledge of the association between hbov and enteric disease are required.
A 64-year - old caucasian male presented to the emergency room complaining of progressive fatigue for 3 months which had progressed to the point of hindering his usual activities of daily living (adl). He had recently visited his primary care provider for evaluation of a non - productive cough and exertional shortness of breath . Initial investigations in the emergency room revealed severe anemia and a positive stool guaiac test . Gastric and transbronchial biopsies were suggestive of extra - nodal marginal zone b - cell lymphoma with simultaneous metastasis to the bronchi . He was treated symptomatically with transfusion of packed red blood cells (prbc) and intravenous iron followed by radiotherapy . Helicobacter pylori infection was ruled out eliminating the possibility of treating him with eradication therapy . Although the stomach is the most common and most extensively studied site of involvement of malt lymphomas, they can also emerge in many other locations . Malt lymphomas have a high tendency to disseminate to other sites; therefore, extensive staging may be necessary to look for suspicious lesions . A 64-year - old caucasian male presented to the emergency room complaining of progressive fatigue, light - headedness, shortness of breath, and an intermittent cough . He reported waking up with extreme malaise and inability to ambulate on the day of presentation . However, upon further questioning, it became evident that his symptoms had started 3 months prior and had gradually progressed in severity . He had been on a camping trip in the rocky mountains of colorado and stayed in a yurt for one and half months before presentation; the trip was cut short due to his shortness of breath and decreased exercise tolerance . He had seen his primary care provider for these symptoms and a chest x - ray showed bilateral upper and lower lobe alveolar infiltrates . Review of systems was significant for unintentional weight loss of 810 pounds over a period of 2 years; he denied nausea, vomiting, diarrhea, and/or melena . Physical examination was significant for pale skin and conjunctiva and a 3/6 systolic murmur best heard at the left sternal border . Laboratory investigations showed hematocrit of 11.3% and hemoglobin of 3.7 gm / dl, and the stool guaiac test was positive . Computed tomography (ct) of the chest with intravenous contrast showed bilateral pulmonary opacities and mediastinal lymphadenopathy in the perivascular and posterior mediastinum (fig . Ct of the abdomen and pelvis with contrast showed severe gastric wall thickening involving the proximal body and fundus with surrounding inflammatory changes (fig . Gastric pathology showed an intense infiltrate of small, mature lymphocytes extending to the epithelium and obliteration of normal glandular architecture; immune - histochemical staining showed cd20 + and abnormal dim cd43 co - expression (figs . 3 and 4) and bcl2 + and low to moderate ki-67 proliferation index suggestive of extra - nodal marginal zone b - cell lymphoma of mucosal - associated lymphoid tissue . Helicobacter pylori was not identified on immunohistochemical staining and a serological analysis of igg antibodies was negative ruling out previous exposure . Serological analysis to rule out chronic infective etiology for immune stimulation from blastomyces, coccidioides, histoplasma, legionella, mycoplasma, aspergillus, and hepatitis b or c was negative . Subsequently, he also underwent bronchoscopy with transbronchial biopsy of the right upper and middle lobes, which showed atypical lymphoid infiltrate consistent with involvement from known malt lymphoma with cd20 + and dim cd43 co - expression (figs . 5 and 6). He underwent radiation therapy for malt lymphoma of the stomach due to gastric bleeding and severe anemia requiring multiple transfusions . Radiation treatment was given with 15 mv photons with an ap / pa treatment technique using mlc shaping with ct based three - dimensional treatment and planning . Immunotherapy with rituximab was considered . However, since the only symptomatic manifestations were related to his severe anemia secondary to the gastric involvement of his lymphoma, he was treated as localized disease . He is been closely followed by his oncologist and has been undergoing surveillance ct - scan of his chest / abdomen every 6 months and yearly pet scan . He has not required any chemotherapy or further radiation therapy and his lymphoma has remained stable . Malt - type lymphoma, also known as extra - nodal marginal type b - cell lymphoma, is an extra - nodal lymphoma arising in a number of epithelial tissues including stomach, lung, salivary glands, skin, etc . Pseudo - lymphoma due to its tendency to remain localized to the tissue of origin for a prolonged period of time; however, it is now recognized as a clonal b - cell neoplasm that frequently recurs locally and has potential for systemic spread and transformation to a high grade b - cell lymphoma . Extra - nodal marginal zone lymphoma of the lung is sometimes referred to as bronchial - associated lymphoid tissue lymphoma (balt lymphoma). It has been suggested that these lymphomas are the result of chronic immune stimulation, often due to bacterial, viral, or autoimmune antigens; a good example is the well - known association between chronic gastritis due to helicobacter pylori and the development of gastric malt lymphoma (10). It is postulated that these lymphomas arise from post - germinal center memory b cells with the potential to differentiate into marginal zone cells or plasma cells . At least four different chromosomal translocations have been identified in these lymphomas, namely t(14, 18), t(11, 18), t(1, 14), and t(3, 14) (11). Chronic immune stimulation has been thought to trigger an interaction between antigens and receptors on the cell surface; this causes the b - cell lymphoma (bcl-10) protein to bind to the malt lymphoma associated translocation (malt1) protein which in turn activates a set of genes that promote survival of extra - nodal marginal zone lymphoma cells (12). Although the stomach is the most commonly involved site, the evidence shows that malt lymphomas can involve a variety of organs like the lungs, breasts, thyroid, salivary glands, lacrimal glands, soft tissues, skin, etc . In a retrospective study of 35 patients with malt lymphoma, 2 out of 24 patients were found to have multifocal disease with involvement of lung and colon, whereas 6 out of 11 patients with extra - gastric primary malt lymphoma were found to have synchronous involvement of different anatomic sites (13). Another case series of 140 patients with malt lymphoma demonstrated multi - organ involvement in 25% of patients with gastric malt and in 46% of patients in non - gastric malt (14). Due to these observations, it is recommended that patients newly diagnosed with malt lymphoma undergo extensive diagnostic staging prior to initiation of any therapy . Some of the routine investigation modalities outlined for staging include ophthalmologic examination, otolaryngologic evaluation including sonogram of salivary glands or mri if indicated . Ct of the thorax and abdomen, endoscopy with sonography of upper gastrointestinal (gi) tract and biopsies, and colonoscopy and bone marrow biopsy as indicated should also be considered for staging purposes (13). A retrospective study conducted on 21 patients diagnosed with balt lymphoma to identify common imaging findings concluded that a single nodular or consolidative pattern was observed in 33%, multiple nodules or multiple areas of consolidation was observed in 43%, bronchiectasis / bronchiolitis in 14%, and diffuse interstitial lung disease (dild) was seen in 10% of the patient population (15). This is a case of gastric malt lymphoma with either synchronous or disseminated malt lymphoma with involvement of lung or balt lymphoma; this patient had bilateral opacities seen on ct chest . These findings are consistent with those seen in previous studies (16, 17). Presentation varies widely depending on the involved organ(s), a potential source of chronic immune stimulation may not always be apparent as evident in this case . Non - invasive helicobacter pylori testing as stool antigen or blood antibody test should be tested if helicobacter pylori is negative by histopathology . Malt lymphomas were once thought to be localized to one organ, but this concept has since been disproved; multiple case reports and case series have demonstrated its multi - organ involvement at presentation or on subsequent staging . Therefore, thorough staging and diagnostic work up should be completed on all newly diagnosed malt lymphoma cases before initiation of any treatment . Bs, the principal author, and bk conceived the idea and critically reviewed the manuscript, whereas bs and ah drafted the manuscript.
The introduction of prostate - specific antigen (psa) screening over the last two decades has resulted in stage migration of prostate cancer . Radical prostatectomy (rp) for organ - confined prostate cancer is an effective treatment option but can result in erectile dysfunction (ed) and incontinence in a significant proportion of patients . The prevalence of urinary incontinence following ralp ranges from 4% to 31% . With an increasing number of men being diagnosed at a younger age, achieving the trifecta goals is of utmost importance to improving the quality of life . Accomplishing negative surgical margins while preserving functional outcomes of sexual function and continence plays a significant role in determining the success of surgical intervention, particularly since the advent of nerve sparing (ns) rp . With more than 60% of rp being performed robotically, robot - assisted laparoscopic prostatectomy (ralp) has largely replaced the standard open radical prostatectomy (orp) and laparoscopic radical prostatectomy (lrp) as a surgical treatment option for prostate cancer . A meta - analysis by tewari et al . In 2012 has demonstrated that margin rates are comparable between ralp and orp, with lrp demonstrating an increased risk for positive surgical margins (psm). The meta - analysis also revealed that the robotic approach is the safest in terms of perioperative complications . Recent evidence suggests that ns not only improves sexual function but also enhances continence recovery . It is in the pursuit of these improved oncological outcomes along with preservation of sexual function and continence that ralp can have the greatest impact . In this review, we describe the neuroanatomical concepts and recent developments in the ns technique of ralp with a view to improving the trifecta outcomes . The pioneering contributions of walsh et al . In 1982 on the anatomic dissection for preservation of the neurovascular bundles (nvbs) remains one of the most significant landmarks in urological history . The inferior hypogastric plexus, comprised of the sympathetic fibers from t11-l2 ganglia and the parasympathetics from the ventral rami of s2-s4 spinal nerves, sends efferents to the pelvic viscera . The parasympathetics from this plexus situated behind the rectum travel past the seminal vesicles and along the posterolateral aspect of the prostate and descend posterior and lateral to the urethra before they penetrate the urogenital diaphragm to continue posterior to the dorsal penile artery . Because of the reversal of steps of rp with the robotic approach and the advantages of ralp that include seven degrees of freedom, improved ergonomics and three - dimensional vision, the anatomical foundations of the neuronal architecture were re - visited by tewari et al . The course of the nvbs from its origin in the pelvic plexus down to its course along the urethra using the minimally invasive approach was studied using cadaveric models . The nvbs were found to be situated typically in an anterolateral location, but were found to occupy the posterolateral aspect on rare occasions . Described that this network of interconnecting neural fibers around the prostate and seminal vesicles was arranged as a hammock in a trizonal distribution . Takenaka et al . Described the fan - like distribution of the parasympathetic fibers lying about 2 cm distal to the prostato vesical junction on the posterolateral aspect of the prostate . Takenaka and tewari et al . Have also demonstrated the presence and the distribution of the autonomic ganglion cells in the pelvic plexus and around the bladder and the prostate . Additionally, the nvbs were found to be occupying a potential avascular triangular space bounded by the anterior layer of the denonvillier's fascia posteriorly, prostatic fascia medially and the lateral pelvic fascia laterally . Additional erectile nerves in the veil of aphrodite along the anterolateral aspect of the prostate were identified by menon and colleagues . Costello et al . Identified that the array of nerve fibers coursing along the posterolateral aspect of the prostate inferior to the tip of the seminal vesicles formed a more well - defined bundle at the mid - prostatic position before re - diverging near the apex . According to another report, a reasonable amount of nerves were identified on the ventral aspect of the prostate in addition to the classical posterolateral location . Trizonal neural architecture the trizonal neural architecture is comprised of the proximal neurovascular plate (pnp), predominant neurovascular bundle (pnb) and accessory neural pathways (anp) arranged around the prostate as a neural hammock [figure 1]. The trizonal neural network comprising of the proximal neurovascular plate (pnp), the predominant neurovascular bundles (pnb) and accessory neural pathways (anp) form a neural hammock around the prostate . Medical animation representing the neural hammock the pnp is situated lateral to the bladder neck and seminal vesicles (sv) and is intermingled with branches of the inferior vesical vasculature . It is located 5 mm lateral to the sv, within 6 mm of the bladder neck, 5 mm of the endopelvic fascia and overlaps 5 mm of the prostate . It is the integrating center for the processing and relaying of erectogenic neural impulses and is prone to injury during incision of the endopelvic fascia, incision of the prostate - vesical junction, lateral dissection of the sv, application of a bulldog clamp and division of prostatic pedicles . Enclosed within the layers of the levator fascia and/or lateral pelvic fascia and within the groove between the prostate and the rectum lies the pnb, which carries neural impulses to the erectile tissue and exhibits a variable course, shape and size . The pnb was thickest at the base, and was most variable in course and architecture near the apex . In 66% of the cases, a medial extension was noted behind the prostate, which converged medially at the apex in 33% of the cases . The ganglion cells in the pnb are attached to the prostatic capsule or embedded within the capsule; hence, the need for cautious, athermal dissection to avoid injury . Pnbs are prone to injury during the dissection of endopelvic fascia, controlling the pedicles, during release of nvbs, apical transection and urethral anastomosis . Anps are putative accessory neural pathways within the layers of levator and/or lateral pelvic fascia, on the anterolateral (42%) and occasionally on the posterolateral aspect of the prostate (25%). Anps may be damaged during dissection of the endopelvic fascia, suturing the dorsal venous complex while applying back - bleeding suture during posterior dissection, controlling the pedicle, release of nvbs, during apical transection or while performing urethral anastomosis . The steps of ralp during which each of these trizonal neural structures are likely to be injured and the preventive measures to be taken to avoid such injury have been previously described by tewari et al . Establishing a clear anatomical map of the neurovascular structures related to ralp has empowered surgeons with the knowledge to enhance their ns technique, which is crucial for functional recovery . The majority of the fibers of the nvbs lie in between the prostatic fascia (medial layer of the lateral pelvic fascia) and the levator fascia (lateral layer of the lateral pelvic fascia). Various terminologies have been coined to describe the incisions through the planes around the prostate during ns ralp . The veil of aphrodite technique proposed by menon involves anterior incision of the prostatic fascia to enter the plane between the prostatic capsule and the prostatic fascia . This follows the posterior and the posterolateral dissection in the plane between the prostatic fascia and the denonvillier's fascia . The periprostatic tissue hanging from the bladder neck down toward the urethro apical junction is known as the veil of aphrodite . The technique was refined in 2009, in which the anterior prostatic fascial tissue, adherent to the capsule, dorsal venous complex and the pubovesical ligaments, was preserved . Adopting this modification known as the superveil technique, it was believed that the nerves interposed between the 11-o clock and the 1-o clock positions were preserved . Another conventional nomenclature used for the ns approach is the intrafascial, intrafascial and extrafascial approach [table 1]. Intrafascial, interfascial and extrafascial approach we now routinely adopt the athermal, traction - free, risk - stratified graded ns approach described below to optimize our oncological and functional outcomes . Various modifications have been made to the technique of ns ralp over the last decade . In an attempt to minimize thermal and ischemic damage to the delicate neurovascular tissues, tewari et al . Introduced the concept of athermal robotic technique (art) in 2005 . Based on the understanding of the trizonal neural anatomy and by adopting the art, 45% sexual function was achieved at 6 weeks . Technical feasibility of the athermal technique has been proven even in large prostates . In a study of 215 patients who had ralp, 87% of those who had bilateral ns, are <70 years and were pre - operatively potent, were potent at 1 year following surgery . The overall psm rate was 6.5% . In a study comparing monopolar cautery, bipolar cautery and a cautery - free technique, ahlering et al . Noticed nearly a five - fold improvement of potency recovery at 3 and 9 months with the cautery - free approach . A cumulative analysis of eight studies in a systematic review by ficarra et al . Revealed better potency outcomes with the athermal ns technique at 3, 6 and 12 months . It is hence believed that avoiding / minimizing thermal energy, particularly while dissecting the nvbs, results in better functional outcomes . Traction - free technique another modification adopted to the ns technique is a traction - free approach . Undue stretch on the nvb causes mechanical trauma resulting in axonotemesis and disruption of the vasa nervorum thus resulting in neural and vascular insults . In addition, tissue hypoxia can result due to injury to the accessory pudendal arteries that run along the anterolateral surface of the bladder and the prostate in 70% of the cases . Such vascular insults account for hypoxia, nutrient deficiency, free radical formation and accumulation of neurotoxic elements that result in ischemia and delayed recovery . It is hypothesized that reducing or avoiding traction on the nvb minimizes the chances of stretch - induced axonotemesis and tissue hypoxia thus resulting in better functional outcomes . The lack of tactile feedback in robotic surgery poses a challenge in detecting excessive traction placed on the neurovasculature during the procedure . In an attempt to overcome this drawback, tewari et al . Developed the concept of real - time intraoperative penile oxygenation monitoring as a surrogate for identifying traction . This involved the use of an auditory probe that provided feedback in the form of an alarm when the tissue oxygenation dropped below 85% . Subtle, deliberate modifications to certain steps during the procedure, based on this auditory feedback, resulted in maintenance of penile oxygenation at or above 85% during the surgery . Using this device, tewari et al . Reported that a significantly higher proportion of patients with bilateral ns in the study group had no ed when compared with the control group at 6 and 52 weeks post - ralp . 93.9% and 78.4% of patients in the study and control groups, respectively, had a shim score 17 at 1 year . The overall psm rates in the study and control groups were 9.4% and 9.9%, respectively . Feedback obtained by real - time tissue oxygen monitoring has allowed subtle technical adjustments thus amounting to improved functional outcomes . Risk - stratified graded ns the concept of graded ns approach to improve sexual outcomes was introduced in 2008 . In an attempt to balance the competing goals of oncological cure and sexual recovery, a novel risk stratification strategy has been proposed [figures 24] [table 2]. Based on several pre - operative parameters including psa, clinical stage, gleason grade on biopsy and pre - operative magnetic resonance imaging (mri) findings, patients are categorized into one of four risk grades, where risk grade 1 patients receive ns grade 1 and so on for risk grades 2 - 4 . By adopting this risk - stratified approach for neural hammock preservation during ralp, tewari et al . Were able to improve potency outcomes without compromising oncological outcomes in a cohort of 1263 patients . The authors reported higher rates of intercourse (90.9% and 62% for grades 1 and 4 ns, respectively) and return to baseline sexual function (81.7% and 54.4% for grades 1 and 4, respectively) in patients who had greater degrees (lower grades) of ns . The overall psm rates for patients with ns grades 1, 2, 3 and 4 were 9.9%, 8.1%, 7.2% and 8.7%, respectively (p = 0.64). With increasing degree of ns, psm rates were not significantly elevated; potency outcomes, however, were significantly better . (a) medical animation . (b) diagrammatic representation of the layers of fascia enveloping the prostatic capsule, showing the planes of dissection . Lpf = lateral pelvic fascia medial layer, i.e., prostatic fascia; lf = lateral pelvic fascia lateral layer, i.e., levator fascia; la = levator ani . B reproduced with permission from risk stratification algorithm for athermal nerve sparing robotic radical prostatectomy . (ece = extracapsular extension; mp mri = multiparametric magnetic resonance imaging) pre - operative multiparametric magnetic resonance imaging in risk stratification and intraoperative planning for graded nerve spare, intraoperative views and corresponding histology from the edge for grade 1 (a, b, c), grade 2 (d, e, f), grade 3 (g, h, i) and grade 4 (j, k, l) nerve spare . (c capsule; bv blood vessel; f periprostatic fat; n nerve bundle). The red arrow in j points to the site of extracapsular extension grades of nerve sparing robotic radical prostatectomy schatloff et al described a five - point ns grading system based on intraoperative visual cues . According to their system, a non - ns procedure was assigned grade 1 and the best ns (95%) was graded as 5, with <50%, 50% and 75% ns being coded as grades 2, 3 and 4, respectively . According to a subjective model of a four - point ns score (nss) grading system proposed by moskovic et al ., where nss 1 meant complete preservation (i.e. Full ns) and 4 was complete resection (i.e. Non - ns), a lower nss was one of the independent predictors of sexual function recovery at 24 months . Available data support the fact that cavernosal preservation during ralp is no longer an all or none phenomenon, but is a graded entity . Intra - operative frozen sections rp involves interplay between competing goals of cancer extirpation, ns, post - operative recovery of urinary continence and potency . This requires precise dissection in an appropriate plane to achieve effective cancer control by avoiding psms and performing adequate ns concurrently . At present various studies have gauged the utility of intraoperative frozen section analysis performed at different sites of the prostate / periprostatic soft tissue, and the results vary widely . This variation is mostly due to differences in sampling methods (sites or whole margins) and sites . Neurovascular structure adjacent frozen section examination (neurosafe) technique of intraoperative frozen section (ifs) analysis allows real - time histological evaluation and helps in performing a ns procedure without compromising oncological safety . This technique enables real - time histologic monitoring of the oncologic safety of an ns procedure . Also, patients with a neurosafe - detected psm were converted to a prognostically more favorable nsm status by secondary wide resection . In this study, a false - negative ifs result was reported in 2.5% of the cases . In this context, our group is currently developing an mri - guided intraoperative frozen section technique [figure 5]. (a) t2-weighted mri and (b) diffusion - weighted imaging (dwi) demonstrating a left - sided lesion (marked in green). (c, d) a radical prostatectomy specimen (p) with left lateral margin transected for intraoperative frozen section (left true margin marked in blue, false left margin in yellow inked as red at the apex). (e) intraoperative frozen section from the left margin (blue and yellow represent true and false margins, respectively). (b = base; a = apex; sv = seminal vesicles) localization by imaging modalities infiltration of the neoplastic cells around the cavernosal nerve fibers and extraprostatic extension are microscopic phenomena that cannot be visualized intraoperatively even with the 10 - 12 magnification of the stereoscope of the davinci system . The inability to identify malignant cells and their association with nerves can result in incomplete removal of the cancerous tissue resulting in psm, post - operative impotence due to damage to / excision of the cavernous nerves or a combination of both . In order to maintain the delicate balance between oncological control and preserving functional outcomes, it is crucial for the surgeon to be able to identify and better define the nvb in relation to the prostate in real - time . Optical magnification with surgical loupes, intraoperative nerve stimulation and real - time robotic transrectal ultrasound (trus robot) have been attempted . Diffusion tensor magnetic resonance imaging (dti) dti is an emerging technology to facilitate treatment planning . It is based on the sensitivity of the water protons measured in the microstructural environment . Its utility in human prostates was first reported by sinha in 2004 . In a recent study using dti along with mp mri, the authors demonstrated that of dti, 2d - t2-weighted mri and 3d - t2-weighted mri, only dti fiber tracking allowed assessment of the entire periprostatic nervous plexus and of all the fibers bilaterally at all levels in all the 33 patients included in the study . The authors concluded that this information could be useful for guiding proper ns surgery using an intrafascial or extrafascial robotic approach or even the graded ns approach, thereby ensuring recovery of erectile function after rp . Figure 6 depicts the fiber tracts from an ex vivo robotic radical prostatectomy specimen using high - resolution dti . Dti seems to have a promising role in the future for nvb preservation during rp . The various colors represent the fibers in and around the prostate multi - photon microscopy (mpm) access to high - resolution real - time imaging of the prostatic capsule, apex, sphincter and the surrounding neurovascular structures is likely to improve oncological and functional outcomes . Mpm is one such novel optical imaging technology that relies on the simultaneous absorption of two or three low - energy (near - infrared) photons to cause a non - linear excitation, which reduces the potential for cellular damage . By adopting a stepwise approach for imaging, researchers were able to identify the cavernous nerve, major pelvic ganglion, prostatic capsule, prostatic acini, fat, vessels and pathological changes in rat models and ex vivo human prostatectomy specimens [figure 7]. Real - time tissue imaging may help surgeons to localize the nerves in relation to the cancerous tissues and potentially identify possible perineural invasion and extraprostatic extension in real time . This would then minimize nerve damage thus enhancing sexual outcomes and reduce the incidence of psm . Like most technological innovations, mpm imaging will have to face several potential challenges before it can be integrated into real - time applications . (a, b) lateral pelvic fascia showing a large artery (a), fibrocollagenous connective tissue stroma (s) and fat (c) on mpm image (a) and histology slide (b). Note the empty lumen of the artery in a and b. (c) surgical apical margin showing a small nerve (arrow). Small arrowhead points to collagen and the large arrowhead points to elastin in the connective tissue stroma . Note the empty lumen (arrow) as opposed to the wavy nerve fibers in c and e. (e) higher magnification image of a small nerve bundle at the surgical margin showing fluorescence that derives from the axoplasm or cytoplasm of the schwann cells . (f) prostatic capsule showing an underlying prostatic acinus (pa), capsule (c), periprostatic connective tissue (s) and fat (f). (g, h) higher magnification of prostatic acini imaged using three detector channels . Cells emit mostly in the 420 - 530 nm range and thus appear green in the color - coding scheme . By contrast, the gland - associated punctate fluorescence (which could represent lipofuscin deposits) emits over a broader wavelength range and thus appears blue in the color - coding scheme (arrows point to bona fide cells with distinct nuclei). Color - coding of mpm images: red, second harmonic generation (shg) (355 - 420 nm); green, short - wavelength autofluorescence (420 - 530 nm); blue, long - wavelength autofluorescence (530 - 650 nm). Scale bars: a, c, d, h 500 m; e 67 m; f, g 100 m [reproduced and edited with permission from 31] optical coherence tomography (oct) oct provides real - time, high - resolution, cross - sectional tissue imaging by measuring the back scatter near - infrared radiation . It is non - invasive and the energy utilized does not cause mechanical damage . Given its fiberoptic nature delivery system, portability and low cost, it can readily be integrated into endoscopic / laparoscopic surgical equipment and probes . The drawback, however, is the inadequate resolution quality for tissues> 1 mm deep . Using oct, the cavernous nerve was distinguished as an intense linear structure separate from the adjacent tissues in in vivo experiments on sprague dawley rats; however, the discrimination between adjacent prostatic tissues and nerves was not adequate in ex vivo human prostatectomy specimens . In a feasibility study by dangle et al ., in which oct was used on 100 ex vivo human prostatectomy specimens to identify psm and extraprostatic extension (epe), the results were compared against the gold standard histopathology . The reported sensitivity and specificity for psm were 70% and 84%, respectively, with 33% and 96% positive predictive value (ppv) and negative predictive value (npv). The sensitivity, specificity, ppv and npv for epe and sv invasion (svi) were 46%, 84%, 50%, 92% and 33%, 97%, 33% and 97%, respectively . This study established the template for the visual oct characteristics of the prostate, sv and cancerous tissue . With its high npv, oct could be useful to rule out psm, epe and svi . In vivo studies have recently tested the feasibility of oct in prostate biopsies for diagnostic purposes and reported a 81% concordance with histopathological findings . Oct might have a potential role in the future both in the diagnostic and the therapeutic pathways . Localization by physiological stimulation a number of nerve mapping technologies have been investigated to aid in localization of periprostatic nerves for augmenting ns during radical prostatectomy . Mapping is usually performed by stimulating a nerve either by optical or by electrical means and then detecting a physiologic response, such as penile tumescence / detumescence, intracavernosal pressure, intraurethral pressure, impedance or an action potential . Characteristics of the nerve stimulation devices dye - based visualization nerves can be stained using fluorescent dyes and can be identified based on specific characteristics such as the method of delivery, nerve specificity, time for staining and resolution . When applied directly by local infiltration into the base of the penis, these dyes travel via the retrograde transport mechanism along the erectile nerves . Systemic administration of the dye results in labeling of all or most of the nerves, and hence the labeled nerves may not be responsible for erectile function . Local injections have a limited utility as well, as they label only one nerve fiber tract at a time . In addition, axonal transport is a slow process and can take a long time, sometimes up to several months . Currently, indocyanine green and fluorescein are the only fda - approved dyes that have been studied in rp . Other examples of nerve dyes include compounds from avelas and general electric, fluorescent cholera toxin subunit b, indocyanine green, fluorescent - inactivated herpes simplex 2 and fluoro - gold . Neurovascular bundle reconstruction wide excision of the nvbs is a prudent approach followed by most surgeons when there is a high index of suspicion of ece and nvb invasion by tumor based on pre - operative parameters . While there are a few existing options to choose from, namely sural nerve grafting, use of embryonic stem cells or growth factors to enhance neural regeneration, entubulization model of cavernosal nerve or nerve advancement with end - to - end reconstruction, none of them are employed routinely . Nerve advancement technique (nat) is one such technique based on neuroscientific concepts of peripheral nerve repair that attempts to establish continuity between the proximal and distal nerve stumps by end - to - end anastomosis of the partially resected nvb [figure 8]. Terzis et al . Reported that if continuity is restored by end - to - end suturing, bands of bungner arise from axons upstream of the point of transection and grow along the glial columns in the distal nerve stump to eventually re - innervate the denervated structures . Tewari et al . Performed nerve advancement and end - to - end, tension - free anastomosis of the proximal and distal neural stumps following partial resection of nvbs in a pilot study of seven pre - operatively potent, high - risk patients . They reported that nat is technically feasible, oncologically safe and is associated with promising sexual outcomes . (b) black arrow heads mark the approximated ends of neurovascular bundles using the nerve advancement technique (nat) the pioneering contributions of walsh et al . In 1982 on the anatomic dissection for preservation of the neurovascular bundles (nvbs) remains one of the most significant landmarks in urological history . The inferior hypogastric plexus, comprised of the sympathetic fibers from t11-l2 ganglia and the parasympathetics from the ventral rami of s2-s4 spinal nerves, sends efferents to the pelvic viscera . The parasympathetics from this plexus situated behind the rectum travel past the seminal vesicles and along the posterolateral aspect of the prostate and descend posterior and lateral to the urethra before they penetrate the urogenital diaphragm to continue posterior to the dorsal penile artery . Because of the reversal of steps of rp with the robotic approach and the advantages of ralp that include seven degrees of freedom, improved ergonomics and three - dimensional vision, the anatomical foundations of the neuronal architecture were re - visited by tewari et al . The course of the nvbs from its origin in the pelvic plexus down to its course along the urethra using the minimally invasive approach was studied using cadaveric models . The nvbs were found to be situated typically in an anterolateral location, but were found to occupy the posterolateral aspect on rare occasions . Described that this network of interconnecting neural fibers around the prostate and seminal vesicles was arranged as a hammock in a trizonal distribution . Takenaka et al . Described the fan - like distribution of the parasympathetic fibers lying about 2 cm distal to the prostato vesical junction on the posterolateral aspect of the prostate . Takenaka and tewari et al . Have also demonstrated the presence and the distribution of the autonomic ganglion cells in the pelvic plexus and around the bladder and the prostate . Additionally, the nvbs were found to be occupying a potential avascular triangular space bounded by the anterior layer of the denonvillier's fascia posteriorly, prostatic fascia medially and the lateral pelvic fascia laterally . Additional erectile nerves in the veil of aphrodite along the anterolateral aspect of the prostate were identified by menon and colleagues . Costello et al . Identified that the array of nerve fibers coursing along the posterolateral aspect of the prostate inferior to the tip of the seminal vesicles formed a more well - defined bundle at the mid - prostatic position before re - diverging near the apex . According to another report, a reasonable amount of nerves were identified on the ventral aspect of the prostate in addition to the classical posterolateral location . Trizonal neural architecture the trizonal neural architecture is comprised of the proximal neurovascular plate (pnp), predominant neurovascular bundle (pnb) and accessory neural pathways (anp) arranged around the prostate as a neural hammock [figure 1]. The trizonal neural network comprising of the proximal neurovascular plate (pnp), the predominant neurovascular bundles (pnb) and accessory neural pathways (anp) form a neural hammock around the prostate . Medical animation representing the neural hammock the pnp is situated lateral to the bladder neck and seminal vesicles (sv) and is intermingled with branches of the inferior vesical vasculature . It is located 5 mm lateral to the sv, within 6 mm of the bladder neck, 5 mm of the endopelvic fascia and overlaps 5 mm of the prostate . It is the integrating center for the processing and relaying of erectogenic neural impulses and is prone to injury during incision of the endopelvic fascia, incision of the prostate - vesical junction, lateral dissection of the sv, application of a bulldog clamp and division of prostatic pedicles . Enclosed within the layers of the levator fascia and/or lateral pelvic fascia and within the groove between the prostate and the rectum lies the pnb, which carries neural impulses to the erectile tissue and exhibits a variable course, shape and size . The pnb was thickest at the base, and was most variable in course and architecture near the apex . In 66% of the cases, a medial extension was noted behind the prostate, which converged medially at the apex in 33% of the cases . The ganglion cells in the pnb are attached to the prostatic capsule or embedded within the capsule; hence, the need for cautious, athermal dissection to avoid injury . Pnbs are prone to injury during the dissection of endopelvic fascia, controlling the pedicles, during release of nvbs, apical transection and urethral anastomosis . Anps are putative accessory neural pathways within the layers of levator and/or lateral pelvic fascia, on the anterolateral (42%) and occasionally on the posterolateral aspect of the prostate (25%). Anps may be damaged during dissection of the endopelvic fascia, suturing the dorsal venous complex while applying back - bleeding suture during posterior dissection, controlling the pedicle, release of nvbs, during apical transection or while performing urethral anastomosis . The steps of ralp during which each of these trizonal neural structures are likely to be injured and the preventive measures to be taken to avoid such injury have been previously described by tewari et al . Establishing a clear anatomical map of the neurovascular structures related to ralp has empowered surgeons with the knowledge to enhance their ns technique, which is crucial for functional recovery . The majority of the fibers of the nvbs lie in between the prostatic fascia (medial layer of the lateral pelvic fascia) and the levator fascia (lateral layer of the lateral pelvic fascia). Various terminologies have been coined to describe the incisions through the planes around the prostate during ns ralp . The veil of aphrodite technique proposed by menon involves anterior incision of the prostatic fascia to enter the plane between the prostatic capsule and the prostatic fascia . This follows the posterior and the posterolateral dissection in the plane between the prostatic fascia and the denonvillier's fascia . The periprostatic tissue hanging from the bladder neck down toward the urethro apical junction is known as the veil of aphrodite . The technique was refined in 2009, in which the anterior prostatic fascial tissue, adherent to the capsule, dorsal venous complex and the pubovesical ligaments, was preserved . Adopting this modification known as the superveil technique, it was believed that the nerves interposed between the 11-o clock and the 1-o clock positions were preserved . Another conventional nomenclature used for the ns approach is the intrafascial, intrafascial and extrafascial approach [table 1]. Intrafascial, interfascial and extrafascial approach we now routinely adopt the athermal, traction - free, risk - stratified graded ns approach described below to optimize our oncological and functional outcomes . Various modifications have been made to the technique of ns ralp over the last decade . In an attempt to minimize thermal and ischemic damage to the delicate neurovascular tissues, tewari et al . Introduced the concept of athermal robotic technique (art) in 2005 . Based on the understanding of the trizonal neural anatomy and by adopting the art, 45% sexual function was achieved at 6 weeks . Technical feasibility of the athermal technique has been proven even in large prostates . In a study of 215 patients who had ralp, 87% of those who had bilateral ns, are <70 years and were pre - operatively potent, were potent at 1 year following surgery . The overall psm rate was 6.5% . In a study comparing monopolar cautery, bipolar cautery and a cautery - free technique, ahlering et al . Noticed nearly a five - fold improvement of potency recovery at 3 and 9 months with the cautery - free approach . A cumulative analysis of eight studies in a systematic review by ficarra et al . Revealed better potency outcomes with the athermal ns technique at 3, 6 and 12 months . It is hence believed that avoiding / minimizing thermal energy, particularly while dissecting the nvbs, results in better functional outcomes . Traction - free technique another modification adopted to the ns technique is a traction - free approach . Undue stretch on the nvb causes mechanical trauma resulting in axonotemesis and disruption of the vasa nervorum thus resulting in neural and vascular insults . In addition, tissue hypoxia can result due to injury to the accessory pudendal arteries that run along the anterolateral surface of the bladder and the prostate in 70% of the cases . Such vascular insults account for hypoxia, nutrient deficiency, free radical formation and accumulation of neurotoxic elements that result in ischemia and delayed recovery . It is hypothesized that reducing or avoiding traction on the nvb minimizes the chances of stretch - induced axonotemesis and tissue hypoxia thus resulting in better functional outcomes . The lack of tactile feedback in robotic surgery poses a challenge in detecting excessive traction placed on the neurovasculature during the procedure . In an attempt to overcome this drawback, tewari et al . Developed the concept of real - time intraoperative penile oxygenation monitoring as a surrogate for identifying traction . This involved the use of an auditory probe that provided feedback in the form of an alarm when the tissue oxygenation dropped below 85% . Subtle, deliberate modifications to certain steps during the procedure, based on this auditory feedback, resulted in maintenance of penile oxygenation at or above 85% during the surgery . Using this device, tewari et al . Reported that a significantly higher proportion of patients with bilateral ns in the study group had no ed when compared with the control group at 6 and 52 weeks post - ralp . 93.9% and 78.4% of patients in the study and control groups, respectively, had a shim score 17 at 1 year . The overall psm rates in the study and control groups were 9.4% and 9.9%, respectively . Feedback obtained by real - time tissue oxygen monitoring has allowed subtle technical adjustments thus amounting to improved functional outcomes . Risk - stratified graded ns the concept of graded ns approach to improve sexual outcomes was introduced in 2008 . In an attempt to balance the competing goals of oncological cure and sexual recovery, a novel risk stratification strategy based on several pre - operative parameters including psa, clinical stage, gleason grade on biopsy and pre - operative magnetic resonance imaging (mri) findings, patients are categorized into one of four risk grades, where risk grade 1 patients receive ns grade 1 and so on for risk grades 2 - 4 . By adopting this risk - stratified approach for neural hammock preservation during ralp, tewari et al . Were able to improve potency outcomes without compromising oncological outcomes in a cohort of 1263 patients . The authors reported higher rates of intercourse (90.9% and 62% for grades 1 and 4 ns, respectively) and return to baseline sexual function (81.7% and 54.4% for grades 1 and 4, respectively) in patients who had greater degrees (lower grades) of ns . The overall psm rates for patients with ns grades 1, 2, 3 and 4 were 9.9%, 8.1%, 7.2% and 8.7%, respectively (p = 0.64). With increasing degree of ns, psm rates were not significantly elevated; potency outcomes, however, were significantly better . (a) medical animation . (b) diagrammatic representation of the layers of fascia enveloping the prostatic capsule, showing the planes of dissection . Lpf = lateral pelvic fascia medial layer, i.e., prostatic fascia; lf = lateral pelvic fascia lateral layer, i.e., levator fascia; la = levator ani . B reproduced with permission from risk stratification algorithm for athermal nerve sparing robotic radical prostatectomy . (ece = extracapsular extension; mp mri = multiparametric magnetic resonance imaging) pre - operative multiparametric magnetic resonance imaging in risk stratification and intraoperative planning for graded nerve spare, intraoperative views and corresponding histology from the edge for grade 1 (a, b, c), grade 2 (d, e, f), grade 3 (g, h, i) and grade 4 (j, k, l) nerve spare . (c capsule; bv blood vessel; f periprostatic fat; n nerve bundle). The red arrow in j points to the site of extracapsular extension grades of nerve sparing robotic radical prostatectomy schatloff et al described a five - point ns grading system based on intraoperative visual cues . According to their system, a non - ns procedure was assigned grade 1 and the best ns (95%) was graded as 5, with <50%, 50% and 75% ns being coded as grades 2, 3 and 4, respectively . According to a subjective model of a four - point ns score (nss) grading system proposed by moskovic et al ., where nss 1 meant complete preservation (i.e. Full ns) and 4 was complete resection (i.e. Non - ns), a lower nss was one of the independent predictors of sexual function recovery at 24 months . Available data support the fact that cavernosal preservation during ralp is no longer an all or none phenomenon, but is a graded entity . Intra - operative frozen sections rp involves interplay between competing goals of cancer extirpation, ns, post - operative recovery of urinary continence and potency . This requires precise dissection in an appropriate plane to achieve effective cancer control by avoiding psms and performing adequate ns concurrently . At present various studies have gauged the utility of intraoperative frozen section analysis performed at different sites of the prostate / periprostatic soft tissue, and the results vary widely . This variation is mostly due to differences in sampling methods (sites or whole margins) and sites . Neurovascular structure adjacent frozen section examination (neurosafe) technique of intraoperative frozen section (ifs) analysis allows real - time histological evaluation and helps in performing a ns procedure without compromising oncological safety . This technique enables real - time histologic monitoring of the oncologic safety of an ns procedure . Also, patients with a neurosafe - detected psm were converted to a prognostically more favorable nsm status by secondary wide resection . In this study, a false - negative ifs result was reported in 2.5% of the cases . In this context, our group is currently developing an mri - guided intraoperative frozen section technique [figure 5]. (a) t2-weighted mri and (b) diffusion - weighted imaging (dwi) demonstrating a left - sided lesion (marked in green). (c, d) a radical prostatectomy specimen (p) with left lateral margin transected for intraoperative frozen section (left true margin marked in blue, false left margin in yellow inked as red at the apex). (e) intraoperative frozen section from the left margin (blue and yellow represent true and false margins, respectively). (b = base; a = apex; sv = seminal vesicles) localization by imaging modalities infiltration of the neoplastic cells around the cavernosal nerve fibers and extraprostatic extension are microscopic phenomena that cannot be visualized intraoperatively even with the 10 - 12 magnification of the stereoscope of the davinci system . The inability to identify malignant cells and their association with nerves can result in incomplete removal of the cancerous tissue resulting in psm, post - operative impotence due to damage to / excision of the cavernous nerves or a combination of both . In order to maintain the delicate balance between oncological control and preserving functional outcomes, it is crucial for the surgeon to be able to identify and better define the nvb in relation to the prostate in real - time . Optical magnification with surgical loupes, intraoperative nerve stimulation and real - time robotic transrectal ultrasound (trus robot) have been attempted . Diffusion tensor magnetic resonance imaging (dti) dti is an emerging technology to facilitate treatment planning . It is based on the sensitivity of the water protons measured in the microstructural environment . Its utility in human prostates was first reported by sinha in 2004 . In a recent study using dti along with mp mri, the authors demonstrated that of dti, 2d - t2-weighted mri and 3d - t2-weighted mri, only dti fiber tracking allowed assessment of the entire periprostatic nervous plexus and of all the fibers bilaterally at all levels in all the 33 patients included in the study . The authors concluded that this information could be useful for guiding proper ns surgery using an intrafascial or extrafascial robotic approach or even the graded ns approach, thereby ensuring recovery of erectile function after rp . Figure 6 depicts the fiber tracts from an ex vivo robotic radical prostatectomy specimen using high - resolution dti . Dti seems to have a promising role in the future for nvb preservation during rp . The various colors represent the fibers in and around the prostate multi - photon microscopy (mpm) access to high - resolution real - time imaging of the prostatic capsule, apex, sphincter and the surrounding neurovascular structures is likely to improve oncological and functional outcomes . Mpm is one such novel optical imaging technology that relies on the simultaneous absorption of two or three low - energy (near - infrared) photons to cause a non - linear excitation, which reduces the potential for cellular damage . By adopting a stepwise approach for imaging, researchers were able to identify the cavernous nerve, major pelvic ganglion, prostatic capsule, prostatic acini, fat, vessels and pathological changes in rat models and ex vivo human prostatectomy specimens [figure 7]. Real - time tissue imaging may help surgeons to localize the nerves in relation to the cancerous tissues and potentially identify possible perineural invasion and extraprostatic extension in real time . This would then minimize nerve damage thus enhancing sexual outcomes and reduce the incidence of psm . Like most technological innovations, mpm imaging will have to face several potential challenges before it can be integrated into real - time applications . (a, b) lateral pelvic fascia showing a large artery (a), fibrocollagenous connective tissue stroma (s) and fat (c) on mpm image (a) and histology slide (b). Note the empty lumen of the artery in a and b. (c) surgical apical margin showing a small nerve (arrow). Small arrowhead points to collagen and the large arrowhead points to elastin in the connective tissue stroma . (d) surgical apical margin showing a small artery . Note the empty lumen (arrow) as opposed to the wavy nerve fibers in c and e. (e) higher magnification image of a small nerve bundle at the surgical margin showing fluorescence that derives from the axoplasm or cytoplasm of the schwann cells . (f) prostatic capsule showing an underlying prostatic acinus (pa), capsule (c), periprostatic connective tissue (s) and fat (f). (g, h) higher magnification of prostatic acini imaged using three detector channels . Cells emit mostly in the 420 - 530 nm range and thus appear green in the color - coding scheme . By contrast, the gland - associated punctate fluorescence (which could represent lipofuscin deposits) emits over a broader wavelength range and thus appears blue in the color - coding scheme (arrows point to bona fide cells with distinct nuclei). Color - coding of mpm images: red, second harmonic generation (shg) (355 - 420 nm); green, short - wavelength autofluorescence (420 - 530 nm); blue, long - wavelength autofluorescence (530 - 650 nm). Scale bars: a, c, d, h 500 m; e 67 m; f, g 100 m [reproduced and edited with permission from 31] optical coherence tomography (oct) oct provides real - time, high - resolution, cross - sectional tissue imaging by measuring the back scatter near - infrared radiation . Given its fiberoptic nature delivery system, portability and low cost, it can readily be integrated into endoscopic / laparoscopic surgical equipment and probes . The drawback, however, is the inadequate resolution quality for tissues> 1 mm deep . Using oct, the cavernous nerve was distinguished as an intense linear structure separate from the adjacent tissues in in vivo experiments on sprague dawley rats; however, the discrimination between adjacent prostatic tissues and nerves was not adequate in ex vivo human prostatectomy specimens . In a feasibility study by dangle et al ., in which oct was used on 100 ex vivo human prostatectomy specimens to identify psm and extraprostatic extension (epe), the results were compared against the gold standard histopathology . The reported sensitivity and specificity for psm were 70% and 84%, respectively, with 33% and 96% positive predictive value (ppv) and negative predictive value (npv). The sensitivity, specificity, ppv and npv for epe and sv invasion (svi) were 46%, 84%, 50%, 92% and 33%, 97%, 33% and 97%, respectively . This study established the template for the visual oct characteristics of the prostate, sv and cancerous tissue . With its high npv, oct could be useful to rule out psm, epe and svi . In vivo studies have recently tested the feasibility of oct in prostate biopsies for diagnostic purposes and reported a 81% concordance with histopathological findings . Oct might have a potential role in the future both in the diagnostic and the therapeutic pathways . Localization by physiological stimulation a number of nerve mapping technologies have been investigated to aid in localization of periprostatic nerves for augmenting ns during radical prostatectomy . Mapping is usually performed by stimulating a nerve either by optical or by electrical means and then detecting a physiologic response, such as penile tumescence / detumescence, intracavernosal pressure, intraurethral pressure, impedance or an action potential . Characteristics of the nerve stimulation devices dye - based visualization nerves can be stained using fluorescent dyes and can be identified based on specific characteristics such as the method of delivery, nerve specificity, time for staining and resolution . When applied directly by local infiltration into the base of the penis, these dyes travel via the retrograde transport mechanism along the erectile nerves . Systemic administration of the dye results in labeling of all or most of the nerves, and hence the labeled nerves may not be responsible for erectile function . Local injections have a limited utility as well, as they label only one nerve fiber tract at a time . In addition, axonal transport is a slow process and can take a long time, sometimes up to several months . Currently, indocyanine green and fluorescein are the only fda - approved dyes that have been studied in rp . Other examples of nerve dyes include compounds from avelas and general electric, fluorescent cholera toxin subunit b, indocyanine green, fluorescent - inactivated herpes simplex 2 and fluoro - gold . Neurovascular bundle reconstruction wide excision of the nvbs is a prudent approach followed by most surgeons when there is a high index of suspicion of ece and nvb invasion by tumor based on pre - operative parameters . While there are a few existing options to choose from, namely sural nerve grafting, use of embryonic stem cells or growth factors to enhance neural regeneration, entubulization model of cavernosal nerve or nerve advancement with end - to - end reconstruction, none of them are employed routinely . Nerve advancement technique (nat) is one such technique based on neuroscientific concepts of peripheral nerve repair that attempts to establish continuity between the proximal and distal nerve stumps by end - to - end anastomosis of the partially resected nvb [figure 8]. Reported that if continuity is restored by end - to - end suturing, bands of bungner arise from axons upstream of the point of transection and grow along the glial columns in the distal nerve stump to eventually re - innervate the denervated structures . Tewari et al . Performed nerve advancement and end - to - end, tension - free anastomosis of the proximal and distal neural stumps following partial resection of nvbs in a pilot study of seven pre - operatively potent, high - risk patients . They reported that nat is technically feasible, oncologically safe and is associated with promising sexual outcomes . (b) black arrow heads mark the approximated ends of neurovascular bundles using the nerve advancement technique (nat) the pioneering contributions of walsh et al . In 1982 on the anatomic dissection for preservation of the neurovascular bundles (nvbs) remains one of the most significant landmarks in urological history . The inferior hypogastric plexus, comprised of the sympathetic fibers from t11-l2 ganglia and the parasympathetics from the ventral rami of s2-s4 spinal nerves, sends efferents to the pelvic viscera . The parasympathetics from this plexus situated behind the rectum travel past the seminal vesicles and along the posterolateral aspect of the prostate and descend posterior and lateral to the urethra before they penetrate the urogenital diaphragm to continue posterior to the dorsal penile artery . Because of the reversal of steps of rp with the robotic approach and the advantages of ralp that include seven degrees of freedom, improved ergonomics and three - dimensional vision, the anatomical foundations of the neuronal architecture were re - visited by tewari et al . The course of the nvbs from its origin in the pelvic plexus down to its course along the urethra using the minimally invasive approach was studied using cadaveric models . The nvbs were found to be situated typically in an anterolateral location, but were found to occupy the posterolateral aspect on rare occasions . Described that this network of interconnecting neural fibers around the prostate and seminal vesicles was arranged as a hammock in a trizonal distribution . Takenaka et al . Described the fan - like distribution of the parasympathetic fibers lying about 2 cm distal to the prostato vesical junction on the posterolateral aspect of the prostate . Takenaka and tewari et al . Have also demonstrated the presence and the distribution of the autonomic ganglion cells in the pelvic plexus and around the bladder and the prostate . Additionally, the nvbs were found to be occupying a potential avascular triangular space bounded by the anterior layer of the denonvillier's fascia posteriorly, prostatic fascia medially and the lateral pelvic fascia laterally . Additional erectile nerves in the veil of aphrodite along the anterolateral aspect of the prostate were identified by menon and colleagues . Costello et al . Identified that the array of nerve fibers coursing along the posterolateral aspect of the prostate inferior to the tip of the seminal vesicles formed a more well - defined bundle at the mid - prostatic position before re - diverging near the apex . According to another report, a reasonable amount of nerves were identified on the ventral aspect of the prostate in addition to the classical posterolateral location . Trizonal neural architecture the trizonal neural architecture is comprised of the proximal neurovascular plate (pnp), predominant neurovascular bundle (pnb) and accessory neural pathways (anp) arranged around the prostate as a neural hammock [figure 1]. The trizonal neural network comprising of the proximal neurovascular plate (pnp), the predominant neurovascular bundles (pnb) and accessory neural pathways (anp) form a neural hammock around the prostate . Medical animation representing the neural hammock the pnp is situated lateral to the bladder neck and seminal vesicles (sv) and is intermingled with branches of the inferior vesical vasculature . It is located 5 mm lateral to the sv, within 6 mm of the bladder neck, 5 mm of the endopelvic fascia and overlaps 5 mm of the prostate . It is the integrating center for the processing and relaying of erectogenic neural impulses and is prone to injury during incision of the endopelvic fascia, incision of the prostate - vesical junction, lateral dissection of the sv, application of a bulldog clamp and division of prostatic pedicles . Enclosed within the layers of the levator fascia and/or lateral pelvic fascia and within the groove between the prostate and the rectum lies the pnb, which carries neural impulses to the erectile tissue and exhibits a variable course, shape and size . The pnb was thickest at the base, and was most variable in course and architecture near the apex . In 66% of the cases, a medial extension was noted behind the prostate, which converged medially at the apex in 33% of the cases . The ganglion cells in the pnb are attached to the prostatic capsule or embedded within the capsule; hence, the need for cautious, athermal dissection to avoid injury . Pnbs are prone to injury during the dissection of endopelvic fascia, controlling the pedicles, during release of nvbs, apical transection and urethral anastomosis . Anps are putative accessory neural pathways within the layers of levator and/or lateral pelvic fascia, on the anterolateral (42%) and occasionally on the posterolateral aspect of the prostate (25%). Anps may be damaged during dissection of the endopelvic fascia, suturing the dorsal venous complex while applying back - bleeding suture during posterior dissection, controlling the pedicle, release of nvbs, during apical transection or while performing urethral anastomosis . The steps of ralp during which each of these trizonal neural structures are likely to be injured and the preventive measures to be taken to avoid such injury have been previously described by tewari et al . Establishing a clear anatomical map of the neurovascular structures related to ralp has empowered surgeons with the knowledge to enhance their ns technique, which is crucial for functional recovery . The majority of the fibers of the nvbs lie in between the prostatic fascia (medial layer of the lateral pelvic fascia) and the levator fascia (lateral layer of the lateral pelvic fascia). Various terminologies have been coined to describe the incisions through the planes around the prostate during ns ralp . The veil of aphrodite technique proposed by menon involves anterior incision of the prostatic fascia to enter the plane between the prostatic capsule and the prostatic fascia . This follows the posterior and the posterolateral dissection in the plane between the prostatic fascia and the denonvillier's fascia . The periprostatic tissue hanging from the bladder neck down toward the urethro apical junction is known as the veil of aphrodite . The technique was refined in 2009, in which the anterior prostatic fascial tissue, adherent to the capsule, dorsal venous complex and the pubovesical ligaments, was preserved . Adopting this modification known as the superveil technique, it was believed that the nerves interposed between the 11-o clock and the 1-o clock positions were preserved . Another conventional nomenclature used for the ns approach is the intrafascial, intrafascial and extrafascial approach [table 1]. Intrafascial, interfascial and extrafascial approach we now routinely adopt the athermal, traction - free, risk - stratified graded ns approach described below to optimize our oncological and functional outcomes . Various modifications have been made to the technique of ns ralp over the last decade . In an attempt to minimize thermal and ischemic damage to the delicate neurovascular tissues, tewari et al . Introduced the concept of athermal robotic technique (art) in 2005 . Based on the understanding of the trizonal neural anatomy and by adopting the art, 45% sexual function was achieved at 6 weeks . Technical feasibility of the athermal technique has been proven even in large prostates . In a study of 215 patients who had ralp, 87% of those who had bilateral ns, are <70 years and were pre - operatively potent, were potent at 1 year following surgery . The overall psm rate was 6.5% . In a study comparing monopolar cautery, bipolar cautery and a cautery - free technique, ahlering et al . Noticed nearly a five - fold improvement of potency recovery at 3 and 9 months with the cautery - free approach . A cumulative analysis of eight studies in a systematic review by ficarra et al . Revealed better potency outcomes with the athermal ns technique at 3, 6 and 12 months . It is hence believed that avoiding / minimizing thermal energy, particularly while dissecting the nvbs, results in better functional outcomes . Traction - free technique another modification adopted to the ns technique is a traction - free approach . Undue stretch on the nvb causes mechanical trauma resulting in axonotemesis and disruption of the vasa nervorum thus resulting in neural and vascular insults . In addition, tissue hypoxia can result due to injury to the accessory pudendal arteries that run along the anterolateral surface of the bladder and the prostate in 70% of the cases . Such vascular insults account for hypoxia, nutrient deficiency, free radical formation and accumulation of neurotoxic elements that result in ischemia and delayed recovery . It is hypothesized that reducing or avoiding traction on the nvb minimizes the chances of stretch - induced axonotemesis and tissue hypoxia thus resulting in better functional outcomes . The lack of tactile feedback in robotic surgery poses a challenge in detecting excessive traction placed on the neurovasculature during the procedure . In an attempt to overcome this drawback, tewari et al . Developed the concept of real - time intraoperative penile oxygenation monitoring as a surrogate for identifying traction . This involved the use of an auditory probe that provided feedback in the form of an alarm when the tissue oxygenation dropped below 85% . Subtle, deliberate modifications to certain steps during the procedure, based on this auditory feedback, resulted in maintenance of penile oxygenation at or above 85% during the surgery . Using this device, tewari et al . Reported that a significantly higher proportion of patients with bilateral ns in the study group had no ed when compared with the control group at 6 and 52 weeks post - ralp . 93.9% and 78.4% of patients in the study and control groups, respectively, had a shim score 17 at 1 year . The overall psm rates in the study and control groups were 9.4% and 9.9%, respectively . Feedback obtained by real - time tissue oxygen monitoring has allowed subtle technical adjustments thus amounting to improved functional outcomes . Risk - stratified graded ns the concept of graded ns approach to improve sexual outcomes was introduced in 2008 . In an attempt to balance the competing goals of oncological cure and sexual recovery, a novel risk stratification strategy based on several pre - operative parameters including psa, clinical stage, gleason grade on biopsy and pre - operative magnetic resonance imaging (mri) findings, patients are categorized into one of four risk grades, where risk grade 1 patients receive ns grade 1 and so on for risk grades 2 - 4 . By adopting this risk - stratified approach for neural hammock preservation during ralp, tewari et al . Were able to improve potency outcomes without compromising oncological outcomes in a cohort of 1263 patients . The authors reported higher rates of intercourse (90.9% and 62% for grades 1 and 4 ns, respectively) and return to baseline sexual function (81.7% and 54.4% for grades 1 and 4, respectively) in patients who had greater degrees (lower grades) of ns . The overall psm rates for patients with ns grades 1, 2, 3 and 4 were 9.9%, 8.1%, 7.2% and 8.7%, respectively (p = 0.64). With increasing degree of ns, psm rates were not significantly elevated; potency outcomes, however, were significantly better . (b) diagrammatic representation of the layers of fascia enveloping the prostatic capsule, showing the planes of dissection . Lpf = lateral pelvic fascia medial layer, i.e., prostatic fascia; lf = lateral pelvic fascia lateral layer, i.e., levator fascia; la = levator ani . B reproduced with permission from risk stratification algorithm for athermal nerve sparing robotic radical prostatectomy . (ece = extracapsular extension; mp mri = multiparametric magnetic resonance imaging) pre - operative multiparametric magnetic resonance imaging in risk stratification and intraoperative planning for graded nerve spare, intraoperative views and corresponding histology from the edge for grade 1 (a, b, c), grade 2 (d, e, f), grade 3 (g, h, i) and grade 4 (j, k, l) nerve spare . (c capsule; bv blood vessel; f periprostatic fat; n nerve bundle). The red arrow in j points to the site of extracapsular extension grades of nerve sparing robotic radical prostatectomy schatloff et al described a five - point ns grading system based on intraoperative visual cues . According to their system, a non - ns procedure was assigned grade 1 and the best ns (95%) was graded as 5, with <50%, 50% and 75% ns being coded as grades 2, 3 and 4, respectively . According to a subjective model of a four - point ns score (nss) grading system proposed by moskovic et al ., where nss 1 meant complete preservation (i.e. Full ns) and 4 was complete resection (i.e. Non - ns), a lower nss was one of the independent predictors of sexual function recovery at 24 months . Available data support the fact that cavernosal preservation during ralp is no longer an all or none phenomenon, but is a graded entity . Intra - operative frozen sections rp involves interplay between competing goals of cancer extirpation, ns, post - operative recovery of urinary continence and potency . This requires precise dissection in an appropriate plane to achieve effective cancer control by avoiding psms and performing adequate ns concurrently . At present various studies have gauged the utility of intraoperative frozen section analysis performed at different sites of the prostate / periprostatic soft tissue, and the results vary widely . This variation is mostly due to differences in sampling methods (sites or whole margins) and sites . Neurovascular structure adjacent frozen section examination (neurosafe) technique of intraoperative frozen section (ifs) analysis allows real - time histological evaluation and helps in performing a ns procedure without compromising oncological safety . This technique enables real - time histologic monitoring of the oncologic safety of an ns procedure . Also, patients with a neurosafe - detected psm were converted to a prognostically more favorable nsm status by secondary wide resection . In this study, a false - negative ifs result was reported in 2.5% of the cases . In this context, our group is currently developing an mri - guided intraoperative frozen section technique [figure 5]. (a) t2-weighted mri and (b) diffusion - weighted imaging (dwi) demonstrating a left - sided lesion (marked in green). (c, d) a radical prostatectomy specimen (p) with left lateral margin transected for intraoperative frozen section (left true margin marked in blue, false left margin in yellow inked as red at the apex). (e) intraoperative frozen section from the left margin (blue and yellow represent true and false margins, respectively). Localization by imaging modalities infiltration of the neoplastic cells around the cavernosal nerve fibers and extraprostatic extension are microscopic phenomena that cannot be visualized intraoperatively even with the 10 - 12 magnification of the stereoscope of the davinci system . The inability to identify malignant cells and their association with nerves can result in incomplete removal of the cancerous tissue resulting in psm, post - operative impotence due to damage to / excision of the cavernous nerves or a combination of both . In order to maintain the delicate balance between oncological control and preserving functional outcomes, it is crucial for the surgeon to be able to identify and better define the nvb in relation to the prostate in real - time . Optical magnification with surgical loupes, intraoperative nerve stimulation and real - time robotic transrectal ultrasound (trus robot) have been attempted . Diffusion tensor magnetic resonance imaging (dti) dti is an emerging technology to facilitate treatment planning . It is based on the sensitivity of the water protons measured in the microstructural environment . Its utility in human prostates was first reported by sinha in 2004 . In a recent study using dti along with mp mri, the authors demonstrated that of dti, 2d - t2-weighted mri and 3d - t2-weighted mri, only dti fiber tracking allowed assessment of the entire periprostatic nervous plexus and of all the fibers bilaterally at all levels in all the 33 patients included in the study . The authors concluded that this information could be useful for guiding proper ns surgery using an intrafascial or extrafascial robotic approach or even the graded ns approach, thereby ensuring recovery of erectile function after rp . Figure 6 depicts the fiber tracts from an ex vivo robotic radical prostatectomy specimen using high - resolution dti . Dti seems to have a promising role in the future for nvb preservation during rp . The various colors represent the fibers in and around the prostate multi - photon microscopy (mpm) access to high - resolution real - time imaging of the prostatic capsule, apex, sphincter and the surrounding neurovascular structures is likely to improve oncological and functional outcomes . Mpm is one such novel optical imaging technology that relies on the simultaneous absorption of two or three low - energy (near - infrared) photons to cause a non - linear excitation, which reduces the potential for cellular damage . By adopting a stepwise approach for imaging, researchers were able to identify the cavernous nerve, major pelvic ganglion, prostatic capsule, prostatic acini, fat, vessels and pathological changes in rat models and ex vivo human prostatectomy specimens [figure 7]. Real - time tissue imaging may help surgeons to localize the nerves in relation to the cancerous tissues and potentially identify possible perineural invasion and extraprostatic extension in real time . This would then minimize nerve damage thus enhancing sexual outcomes and reduce the incidence of psm . Like most technological innovations, mpm imaging will have to face several potential challenges before it can be integrated into real - time applications . (a, b) lateral pelvic fascia showing a large artery (a), fibrocollagenous connective tissue stroma (s) and fat (c) on mpm image (a) and histology slide (b). Note the empty lumen of the artery in a and b. (c) surgical apical margin showing a small nerve (arrow). Small arrowhead points to collagen and the large arrowhead points to elastin in the connective tissue stroma . (d) surgical apical margin showing a small artery . Note the empty lumen (arrow) as opposed to the wavy nerve fibers in c and e. (e) higher magnification image of a small nerve bundle at the surgical margin showing fluorescence that derives from the axoplasm or cytoplasm of the schwann cells . (f) prostatic capsule showing an underlying prostatic acinus (pa), capsule (c), periprostatic connective tissue (s) and fat (f). (g, h) higher magnification of prostatic acini imaged using three detector channels . Cells emit mostly in the 420 - 530 nm range and thus appear green in the color - coding scheme . By contrast, the gland - associated punctate fluorescence (which could represent lipofuscin deposits) emits over a broader wavelength range and thus appears blue in the color - coding scheme (arrows point to bona fide cells with distinct nuclei). Color - coding of mpm images: red, second harmonic generation (shg) (355 - 420 nm); green, short - wavelength autofluorescence (420 - 530 nm); blue, long - wavelength autofluorescence (530 - 650 nm). Scale bars: a, c, d, h 500 m; e 67 m; f, g 100 m [reproduced and edited with permission from 31] optical coherence tomography (oct) oct provides real - time, high - resolution, cross - sectional tissue imaging by measuring the back scatter near - infrared radiation . It is non - invasive and the energy utilized does not cause mechanical damage . Given its fiberoptic nature delivery system, portability and low cost, it can readily be integrated into endoscopic / laparoscopic surgical equipment and probes . The drawback, however, is the inadequate resolution quality for tissues> 1 mm deep . Using oct, the cavernous nerve was distinguished as an intense linear structure separate from the adjacent tissues in in vivo experiments on sprague dawley rats; however, the discrimination between adjacent prostatic tissues and nerves was not adequate in ex vivo human prostatectomy specimens . In a feasibility study by dangle et al ., in which oct was used on 100 ex vivo human prostatectomy specimens to identify psm and extraprostatic extension (epe), the results were compared against the gold standard histopathology . The reported sensitivity and specificity for psm were 70% and 84%, respectively, with 33% and 96% positive predictive value (ppv) and negative predictive value (npv). The sensitivity, specificity, ppv and npv for epe and sv invasion (svi) were 46%, 84%, 50%, 92% and 33%, 97%, 33% and 97%, respectively . This study established the template for the visual oct characteristics of the prostate, sv and cancerous tissue . With its high npv, oct could be useful to rule out psm, epe and svi . In vivo studies have recently tested the feasibility of oct in prostate biopsies for diagnostic purposes and reported a 81% concordance with histopathological findings . Oct might have a potential role in the future both in the diagnostic and the therapeutic pathways . Localization by physiological stimulation a number of nerve mapping technologies have been investigated to aid in localization of periprostatic nerves for augmenting ns during radical prostatectomy . Mapping is usually performed by stimulating a nerve either by optical or by electrical means and then detecting a physiologic response, such as penile tumescence / detumescence, intracavernosal pressure, intraurethral pressure, impedance or an action potential . Characteristics of the nerve stimulation devices dye - based visualization nerves can be stained using fluorescent dyes and can be identified based on specific characteristics such as the method of delivery, nerve specificity, time for staining and resolution . When applied directly by local infiltration into the base of the penis, these dyes travel via the retrograde transport mechanism along the erectile nerves . Systemic administration of the dye results in labeling of all or most of the nerves, and hence the labeled nerves may not be responsible for erectile function . Local injections have a limited utility as well, as they label only one nerve fiber tract at a time . In addition, axonal transport is a slow process and can take a long time, sometimes up to several months . Currently, indocyanine green and fluorescein are the only fda - approved dyes that have been studied in rp . Other examples of nerve dyes include compounds from avelas and general electric, fluorescent cholera toxin subunit b, indocyanine green, fluorescent - inactivated herpes simplex 2 and fluoro - gold . Neurovascular bundle reconstruction wide excision of the nvbs is a prudent approach followed by most surgeons when there is a high index of suspicion of ece and nvb invasion by tumor based on pre - operative parameters . While there are a few existing options to choose from, namely sural nerve grafting, use of embryonic stem cells or growth factors to enhance neural regeneration, entubulization model of cavernosal nerve or nerve advancement with end - to - end reconstruction, none of them are employed routinely . Nerve advancement technique (nat) is one such technique based on neuroscientific concepts of peripheral nerve repair that attempts to establish continuity between the proximal and distal nerve stumps by end - to - end anastomosis of the partially resected nvb [figure 8]. Reported that if continuity is restored by end - to - end suturing, bands of bungner arise from axons upstream of the point of transection and grow along the glial columns in the distal nerve stump to eventually re - innervate the denervated structures . Tewari et al . Performed nerve advancement and end - to - end, tension - free anastomosis of the proximal and distal neural stumps following partial resection of nvbs in a pilot study of seven pre - operatively potent, high - risk patients . They reported that nat is technically feasible, oncologically safe and is associated with promising sexual outcomes . (b) black arrow heads mark the approximated ends of neurovascular bundles using the nerve advancement technique (nat) much of the success achieved in the last decade in terms of improved trifecta outcomes following robotic radical prostatectomy relates to the adoption of an athermal, traction - free, risk - stratified, graded nerve spare approach to preserve the neural hammock . Innovative techniques to incorporate real - time intraoperative imaging and nerve mapping methodologies to identify and preserve the cavernosal nerves seem to have a challenging but promising role in the future.
In previous works we compared the performances of an x - ray tes microcalorimeter under ac and dc bias by measuring the iv characteristic, the noise, the impedance and the x - ray response at perpendicular magnetic field b=0 . The tests were carried out both with an sron pixel and a gsfc pixel [1, 2]. With respect to the dc bias case, under ac bias we observe a smaller (about 15%) current output at small voltage bias low in the transition, a low tes current and temperature sensitivity, a slightly worse integrated nep resolution and about a factor two x - ray resolution degradation . In order to better understand the reasons for the suboptimal performance of the tess under ac bias we thoroughly studied the effect of the perpendicular magnetic field and the voltage bias on the detector response . Here we present the results obtained with a gsfc pixel read out both in the ac and dc configuration . A schematic drawings of the read - out circuit used for the ac measurements described here is shown in fig . 1 . A superconducting flux transformer is used between the squid amplifier and the tes microcalorimeter to improve the impedance matching between the tes and squid amplifier . 1schematic drawing of the ac bias and read - out circuit used for the tes microcalorimeter . A superconducting flux transformer is used to improve the impedance matching between the squid amplifier and the tes microcalorimeter schematic drawing of the ac bias and read - out circuit used for the tes microcalorimeter . A superconducting flux transformer is used to improve the impedance matching between the squid amplifier and the tes microcalorimeter the tes microcalorimeter is tested using a superconducting transformer with inductances lp=100 nh and ls=6.4 h, and estimated mutual inductance m = klsnp / ns=760 nh, nr = ns / np=8 coil turns ratio and with lp connected to the tes . The impedance of the lc circuit seen by the tes is then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$z_{lc,\mathit{tes}}=z_{lc}/n_{r}^{2}$\end{document}. The lc resonator consists of an hybrid filter with a lithographic nb - film coil with l<10 nh and commercial high - q np0 smd capacitors with c=10010 nf . The circuit has an additive total stray inductance of about lstray200 nh . The intrinsic resonator factor of the lc resonator is 35020, limited by losses in the lumped elements circuit . As amplifiers we used a nist squid arrays consisting of a series of 100 dc - squid with input - feedback coil turns ratio of 3:1, and input inductance lin=70 nh . The input current noise is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\sim} 4~\mathrm{pa}/\sqrt{\mathrm{hz}}$\end{document} at t<1 k. the squid amplifier is operated in a standard analogue flux - locked - loop (fll) mode using commercial magnicon electronics, which linearises the squid response . Only at frequencies below f<700 khz for this reason our experiments are carried out at a resonant frequency of 470 khz . The circuit resonant frequency is defined by the capacitor c and the total inductance \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$l_{\mathit{tot}}=l_{\mathit{in}}+l+l_{\mathit{stray}}+l_{\mathit{fb}}+l_{s}-m_{\mathit{ps}}^{2}/(l_{p})$\end{document}, where the last term accounts for the screening effect of the superconducting transformer and lfb is an inductance generated by the squid feedback loop . From the measured resonant frequency and the filter capacitance reported above we get ltot=1.1 h . The effective inductance seen by the tes is leff, tes=1.1 h / nr=17 nh . In the experiment described here we used an xray tes microcalorimeter from the gsfc . It is a 150150 m pixel from a uniform 88 array [3, 4], where a tes is coupled to a micron - thick overhanging au / bi x - ray absorber . The sensor is a mo / au proximity - effect bilayer with a transition temperature of tc=95 mk, and a normal state resistance of rn=7 m. when the gsfc pixel is dc biased good baseline and x - ray energy resolution is observed . The x - ray resolution is comparable to the baseline resolution and is generally of the order of 2.32.5 ev . The pixel responsivity and noise strongly depends on the perpendicular magnetic field applied to the tes . In fig . We show the integrate nep (denep) as a function of the applied magnetic field b and for different bias current . At this pixel the pattern observed is due to the dependency of the detector critical current on the magnetic field as a result of the tes behaving as a weak - link . The shift of the josephson patterns along the applied magnetic field is due to the self magnetic field generated by the dc current flowing through the leads connecting the tes . 2(color online) integrated nep as a function of magnetic field and for several bias point with tes dc biased (a) and ac biased (b). The cancelling magnetic field for the dc and ac bias pixels are respectively 228 and 68 mgauss . The points in red up triangles are the results of measurements taken under identical experimental condition, but on a different day (color online) integrated nep as a function of magnetic field and for several bias point with tes dc biased (a) and ac biased (b). The cancelling magnetic field for the dc and the points in red up triangles are the results of measurements taken under identical experimental condition, but on a different day under ac bias we measured the denep as a function of the applied perpendicular magnetic field b as well . At this pixel, under ac bias: the fraunhofer - like oscillations are visible, but the pattern is more noisy and less reproducible than under dc bias; the baseline resolution is slightly worse and strongly depends on the bias voltage . While the former effect is likely due to the self magnetic field, the latter has a less trivial explanation . In an attempt to clarify these results, we performed a fine scan of the detector i v characteristic by measuring for every bias point the detector x - ray response and the noise . A very small variation (2%) of the bias current could result in an energy resolution degradation of more than a factor three . The results of this measurement are shown in fig . 3, where the baseline resolution is plotted as a function of the bias voltage and for several value of the perpendicular magnetic field . 3(color online) signal amplitude (i.e. I rms, tes tes current) and integrated energy resolution as a function of the bias voltage of the ac biased pixel . T bath=65 mk (color online) signal amplitude (i.e. I rms, tes tes current) and integrated energy resolution as a function of the bias voltage of the ac biased pixel . T bath=65 mk the energy resolution oscillates between values from 3.5 ev to 9 ev as a function of the bias point . The oscillating pattern is partially modulated by the magnetic field . As visible in the insert of fig . 3a, the sensor iv curve presents a staircase structure, modulated by the perpendicular magnetic field . The worst resolution is measured at the transition between two steps where the slope of the i v curve is the highest . The energy resolution deteriorates at the bias point corresponding to the higher slope in the iv curve steps . T bath=18 mk integrated energy resolution as a function of the bias voltage . The energy resolution deteriorates at the bias point corresponding to the higher slope in the iv curve steps . 5 we plot the nep, the responsivity and the noise spectra taken under ac and dc bias . For the ac bias case the spectra are taken respectively at the flat and at the rising part of the observed steps in fig . The detector response bandwidth is not identical under ac and dc bias due to the different load impedance of the two circuits [1, 2]. The nep is the lowest under dc bias . At low frequency (f<100 hz) the degradation in the nep observed in the ac bias case is probably due to a reduced responsivity . At high frequency (f>1 khz) the excess noise is worse for the measurement taken at the rising part of the steps and has the signature of excess johnson noise . Furthermore, the noise level at frequency f>1 khz in the spectra corresponding to the 3.5 ev integrated nep taken under ac bias, cannot be explained by simply including the squid and the lc resonator thermal noise . An excess white noise of about \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$50~\mathrm{pa}/\sqrt{\mathrm{hz}}$\end{document} is estimated from the model . Under ac bias 5(color online) responsivity (a), noise (b) and nep (c) measured under dc bias and ac bias . For the ac bias case the responsivity for two bias points is shown, taken respectively at the flat (red curve) and at the rising (black curve) part of the step (color online) responsivity (a), noise (b) and nep (c) measured under dc bias and ac bias . For the ac bias case the responsivity for two bias points is shown, taken respectively at the flat (red curve) and at the rising (black curve) part of the step in analogy with the analysis done for an rf - squid [611] we calculate the characteristic parameters of a tes in a superconducting loop weakly coupled via a superconducting transformer to an lc resonant circuit . The tes is treated as a weak - link in accordance with the rsj model where rshunt is assumed to be tes normal resistance . For the detector described above we find the cut - off and the characteristic frequency to be respectively cut = r / l400 khz, jj=2ric/0100 mhz, where a critical current of about ic5 a is assumed . Note that the tes critical current at a tbathtc is generally larger than 5 a (700 a at 55 mk). However in bias conditions the tes operating temperature is ttc and the critical current drops . The rfsquid - like ac biased tes operates then in an adiabatic and hysteretic regime, since lc <min(jj,cut) and rf1 . The steps in the tes iv curves have a non zero slope (fig . V characteristic and the rounding of the step edges reflect directly the width of the quantum transitions distribution due to thermal fluctuations . Kurkijrvi [7, 8] have shown that the ratio of the voltage rise along a step vs to the voltage difference v0 between steps is directly proportional to the squid s intrinsic flux noise . Their empirical formula gives \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\alpha=\frac{1}{0.7\phi_{0}}(\frac{\omega_{rf}}{2\pi})^{1/2}\sqrt{s_{\phi}}$\end{document}. In the same way we can estimate the flux noise in the tes superconducting ring . From the step observed in the iv curves we get an =vs/v0=0.36, which corresponds to a flux noise of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\sqrt{s_{\phi}}\sim 4\cdot 10^{-4} \frac{\phi_{0}}{\sqrt{\mathrm{hz}}}$\end{document}. For a 17 nh inductance ring this is equivalent to a current noise of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\sqrt{s_{i}}\sim 5\cdot 10^{-11}\frac{\mathrm{a}}{\sqrt{\mathrm{hz}}}$\end{document}. This noise level is comparable with the excess noise observed in the ac bias detector, which limits the best measured integrated nep to 3.5 ev . We observed excess noise and low reproducibility in the ac biased x - ray pixel . A strong dependency of the baseline noise on the bias voltage is at the origin of the non reproducible results obtained in the past . In the iv curve under ac bias a possible interpretation of this effect is given by comparing the detector and the ac read - out to an rf - squid . In this analogy the tes is seen as a weak - link in a superconducting ring weakly coupled to an lc resonator . Should this interpretation be valid, the excess noise observed in the ac bias experiment could be due to flux noise generated by the uncertainties in the quantum transition . To validate this hypothesis the following tests should be performed in the future: measurements with large l and high bias frequency (f>1 mhz) since in the rf - squid the flux noise decreases at higher rf tank frequencies and the detector operates in a non - adiabatic regime where rf - squid amplifiers show lower flux noise; measurements of excess noise (integrated nep) as function of temperature since a weak dependency to t is expected [7, 8]; experiments with tess with different weak - link parameters (ic and rn) to achieve a non - hysteretic regime.
Fortunately, these problems can now be overcome, to a large extent, by the use of fiber reinforced composite (frc). In fact, the bond strength between the prostheses and the abutment teeth obtained when using frc materials is 50100% higher than the bond strength achieved when using metal framworke.1 in addition, in frc restorations the glass fibers are translucent and covered with veneering composites, resulting in good aesthetic restorations, which do not increase plaque accumulation.2 metal - free prostheses continue to gain interest . Although the metal alloys contribute great strength to the prostheses, they do so at a considerable aesthetic liability . Two somewhat different metalfree approaches to fixed tooth replacement continue to be developed for a variety of clinical applications . Prostheses are the subject of this article and generally consist of a particulate composite veneer supported by a frc - substructure (framework). With frc prostheses, there are two approaches in using fibers: one is based on conventional tooth preparation and laboratorymade restorations while the other is based upon using fibers in minimally invasive restoration by direct or indirect fabrication . Frc - supported prostheses have undergone much testing recently in the laboratory and in the patient's mouth.37 the frc prostheses can be fabricated indirectly in the prosthetic laboratory by a dental technician, chairside in the dental clinic by the dentist, or directly in the patient's mouth . Veneer materials used for the chairside - fabricated prostheses are light cured hybrid or microfill composites typically found in the dental clinic . Laboratory - made prostheses, including the frc - framework, are also light cured but may have an additional heat polymerization stage with the optional use of vacuum or pressure to enhance polymerization . Deep polymerization improves mechanical properties, especially the flexural strength of the frc framework and wear resistance as well as color stability of the veneering composite.8 the frc material is a combination of fibers and a resinous matrix . Different types of frc materials exhibiting a wide variety of mechanical flexural properties are commercially available . The mechanical properties of frc materials are primarily dependent upon fiber type (glass, carbon, aramid, or polyethylene), quantity of fibers in the matrix resin (maximum is 15103 in a bundle), fiber architecture (unidirectional, woven, or braided), and quality of impregnation of fiber with resin . (a) woven polyethylene fibers; (b) braided glass fibers; (c) woven (bidirectional) glass fibers; (d) unidirectional glass fibers . (from fiber - reinforced composite in clinical dentistry, chicago: quintessence; 2000). Some manufacturers produce dry fibers that require hand impregnation by the technician or the dentist, e.g. Ribbond, glas span, and construct . Some of the commercially available frc materials are machine impregnated with resin by the manufacturer, e.g. Everstick, fiberkor, and vectris . The mechanical and handling properties of machine - impregnated frcs are better than those of the hand impregnated frcs . Rigidity of the frc framework is crucial for the integrity of the veneer, made from a brittle material, such as particulate filler composite . The ultimate flexural strength of manufacturer - impregnated (preimpregnated) unidirectional glass frc material ranges from 500 to 1200 mpa . This is greater than the flexural strength of noble alloys.9 for polyethylene fiber composites, flexural strength values are lower than glass or carbon fiber composites . Clinical tooth replacement applications of frc - reinforced prostheses are organized into two categories: laboratory - fabricated prostheses and chairside prostheses . Case selection for fiber - reinforced prostheses this article focuses on describing laboratory and chairside made prostheses that have conventional abutment tooth preparation rather than describing fibers in minimal invasive approach, which will be reported in the near future . Composite prostheses include a surface that does not wear opposing tooth enamel, and the frc framework does not require waxing, casting, or soldering procedures during fabrication . Supported by a strong metal - free framework, the aesthetic qualities of the frc prostheses can be outstanding . Potential concerns for these prostheses are water absorption, loss of surface shine, fatigue resistance over time, and the technique's sensitivity associated with cementation by using resin cement . For tooth - retained frc prostheses this also permits the use of conservative tooth replacement prosthesis, where intracoronal (inlay) preparation is made on minimally restored abutment teeth . Inlay bridge design has proven unsuccessful where a metal alloy framework is used and retainers have not been bonded to the abutment teeth . Tooth preparation designs of full and partial coverage frc prostheses are shown in figures 24 . Schematic drawing of anterior abutment tooth preparation for the extracoronal full coverage frc - prostheses . (from fiber - reinforced composite in clinical dentistry, chicago: quintessence; 2000). Schematic drawing of posterior abutment tooth preparation for the extracoronal full coverage frc - prostheses . (from fiber - reinforced composite in clinical dentistry, chicago: quintessence; 2000). Partial - coverage retainer (intracoronal) using unidirectional glass framework with high - volume design placed in the edentulous region . (from fiber - reinforced composite in clinical dentistry, chicago: quintessence; 2000). Data have shown that frc framework design is a key point for the clinical success of frc prostheses.7, 10 increased framework bulk added at the pontic region (high volume design) provides additional rigidity along with greater vertical support of the veneer material . Successful chemical bonding of the veneer composite to the frc framework is another critical element for clinical success . Clinical studies of frc prostheses made with pre - impregnated fibers have demonstrated greater than 90% survival of partial and full coverage prostheses for up to 5 years.7, 11 the properties of frcs that make them suitable for various chairside applications include high flexural strength, desirable aesthetic results, ease in use, adaptability to various shapes, and capability for direct bonding to tooth structure . Among the many direct intraoral applications of this technique are splinting of mobile teeth, replacement of missing teeth, and fabrication of endodontic posts . One of the most exciting and potentially useful applications of pre - impregnated frc technology is its use in replacing missing teeth in a timely and cost - effective manner . This ability to deliver a functional, aesthetic tooth replacement with or without minimal tooth preparation of the adjacent abutment teeth in a single visit is a realistic treatment option with current adhesive technologies and reinforced composites . The increased physical properties that fiber reinforcement provides to particulate composites resin allow for an improved approach over earlier methods in using denture teeth as pontics.12 this new approach eliminates the disadvantages caused by the incompatibility of the different chemistry between the particulate luting composite and the acrylic pontic and results in a much stronger connector between the pontic and the frc framework . This provides the potential for long - term clinical service.13 consequently, what was once thought of as a purely short - term or temporary solution can sometimes be considered as a more definite solution for those patients who cannot afford a conventional fixed - tooth replacement . Potential clinical applications for chairside - fabricated frc prostheses include situations where the abutment teeth may be of questionable stability or in place of a provisional removable prosthesis immediately after anterior implant placement but before loading . Additionally, this technology can be used for immediate fixed - tooth replacement after extraction, after traumatic loss of a tooth, or for space maintenance in pediatric or adolescent patients . In addition to prosthodontics, applications of frcs extend to periodontal, orthodontic, and surgical fields in the form of various splints . The recurrent fractures of removable dentures can be eliminated by the use of frc as reinforcement.14 the impact strength of maxillary complete denture can be increased by a factor greater than two times when reinforced with bidirectional - frc.15 however, as in the cases of any other application for fiber reinforcement, the positioning of fiber is of importance in order to achieve an efficient reinforcing effect.14 frcs can also be used as framework in overdenture or implant - supported prosthesis and in root canal posts as prefabricated posts or individually formed (custom - made) posts.16 problems associated with frc - prostheses can be grouped under the following categories: gray/ metal shadow due to metal posts and cores or amalgam cores on abutment teeth; loss of surface shining on the particulate veneering composite; excessive translucency in pontic areas; fracture or chipping of the particulate composite veneer and debonding of the retainer . The correct design of the frc framework and the use of high quality preimpregnated glass fibers in optimum quantity reduce the possibility of framework fractures . Veneering composite chipping can be avoided by using thicker layer (12 mm) of composite resin on the surface of frc framework.17 although there are some failures that have been associated to frc bridges made earlier, these failures are in the majority of cases repaired by composite technology in the patient's mouth . When a failure is observed, the dentist needs to analyze its reason and repair the device accordingly . The amount of plaque accumulation on the surface of frc materials depends on the type of fibers used . Polyethylene frc has the roughest material with promoted plaque accumulation significantly more than the other smoother materials . They are both composite materials composed of inorganic filler components and an organic polymer matrix.18 finally, it must be emphasized that the fiber reinforcement technology offers new prospects and approaches to the profession . Instead of discussing whether fiber fpds will replace metal - ceramic or full ceramic fpds, attention should be paid to the added new treatment options resulting from the use of fibers . Composite prostheses include a surface that does not wear opposing tooth enamel, and the frc framework does not require waxing, casting, or soldering procedures during fabrication . Supported by a strong metal - free framework, the aesthetic qualities of the frc prostheses can be outstanding . Potential concerns for these prostheses are water absorption, loss of surface shine, fatigue resistance over time, and the technique's sensitivity associated with cementation by using resin cement . For tooth - retained frc prostheses, this also permits the use of conservative tooth replacement prosthesis, where intracoronal (inlay) preparation is made on minimally restored abutment teeth . Inlay bridge design has proven unsuccessful where a metal alloy framework is used and retainers have not been bonded to the abutment teeth . Tooth preparation designs of full and partial coverage frc prostheses are shown in figures 24 . Schematic drawing of anterior abutment tooth preparation for the extracoronal full coverage frc - prostheses . (from fiber - reinforced composite in clinical dentistry, chicago: quintessence; 2000). Schematic drawing of posterior abutment tooth preparation for the extracoronal full coverage frc - prostheses . (from fiber - reinforced composite in clinical dentistry, chicago: quintessence; 2000). Partial - coverage retainer (intracoronal) using unidirectional glass framework with high - volume design placed in the edentulous region . (from fiber - reinforced composite in clinical dentistry, chicago: quintessence; 2000). Data have shown that frc framework design is a key point for the clinical success of frc prostheses.7, 10 increased framework bulk added at the pontic region (high volume design) provides additional rigidity along with greater vertical support of the veneer material . Successful chemical bonding of the veneer composite to the frc framework is another critical element for clinical success . Clinical studies of frc prostheses made with pre - impregnated fibers have demonstrated greater than 90% survival of partial and full coverage prostheses for up to 5 years.7, 11 the properties of frcs that make them suitable for various chairside applications include high flexural strength, desirable aesthetic results, ease in use, adaptability to various shapes, and capability for direct bonding to tooth structure . Among the many direct intraoral applications of this technique are splinting of mobile teeth, replacement of missing teeth, and fabrication of endodontic posts . One of the most exciting and potentially useful applications of pre - impregnated frc technology is its use in replacing missing teeth in a timely and cost - effective manner . This ability to deliver a functional, aesthetic tooth replacement with or without minimal tooth preparation of the adjacent abutment teeth in a single visit is a realistic treatment option with current adhesive technologies and reinforced composites . The increased physical properties that fiber reinforcement provides to particulate composites resin allow for an improved approach over earlier methods in using denture teeth as pontics.12 this new approach eliminates the disadvantages caused by the incompatibility of the different chemistry between the particulate luting composite and the acrylic pontic and results in a much stronger connector between the pontic and the frc framework . This provides the potential for long - term clinical service.13 consequently, what was once thought of as a purely short - term or temporary solution can sometimes be considered as a more definite solution for those patients who cannot afford a conventional fixed - tooth replacement . Potential clinical applications for chairside - fabricated frc prostheses include situations where the abutment teeth may be of questionable stability or in place of a provisional removable prosthesis immediately after anterior implant placement but before loading . Additionally, this technology can be used for immediate fixed - tooth replacement after extraction, after traumatic loss of a tooth, or for space maintenance in pediatric or adolescent patients . In addition to prosthodontics, applications of frcs extend to periodontal, orthodontic, and surgical fields in the form of various splints . The recurrent fractures of removable dentures can be eliminated by the use of frc as reinforcement.14 the impact strength of maxillary complete denture can be increased by a factor greater than two times when reinforced with bidirectional - frc.15 however, as in the cases of any other application for fiber reinforcement, the positioning of fiber is of importance in order to achieve an efficient reinforcing effect.14 frcs can also be used as framework in overdenture or implant - supported prosthesis and in root canal posts as prefabricated posts or individually formed (custom - made) posts.16 problems associated with frc - prostheses can be grouped under the following categories: gray/ metal shadow due to metal posts and cores or amalgam cores on abutment teeth; loss of surface shining on the particulate veneering composite; excessive translucency in pontic areas; fracture or chipping of the particulate composite veneer and debonding of the retainer . The correct design of the frc framework and the use of high quality preimpregnated glass fibers in optimum quantity reduce the possibility of framework fractures . Veneering composite chipping can be avoided by using thicker layer (12 mm) of composite resin on the surface of frc framework.17 although there are some failures that have been associated to frc bridges made earlier, these failures are in the majority of cases repaired by composite technology in the patient's mouth . When a failure is observed, the dentist needs to analyze its reason and repair the device accordingly . The amount of plaque accumulation on the surface of frc materials depends on the type of fibers used . Polyethylene frc has the roughest material with promoted plaque accumulation significantly more than the other smoother materials . They are both composite materials composed of inorganic filler components and an organic polymer matrix.18 finally, it must be emphasized that the fiber reinforcement technology offers new prospects and approaches to the profession . Instead of discussing whether fiber fpds will replace metal - ceramic or full ceramic fpds, attention should be paid to the added new treatment options resulting from the use of fibers.
Strains, cell lines and media - escherichia coli dh5 (invitrogen, usa) was used for the general propagation of plasmids and e. coli bl21 (de3) was used to express the e2 protein . Bacterial cells were grown under agitation at 37c in a low - salt luria - bertani medium containing zeocin at a final concentration of 25 g / ml . Yeast cultures were maintained in a yeast extract - peptone - dextrose (yepd) medium . The media for growth and induction were buffered complex glycerol medium (bmgy) and buffered complex methanol medium (bmmy), respectively, both at ph 4.0 huvecs (atcc crl-2873) were grown in rpmi-1640 medium (sigma aldrich, usa) containing 10% foetal bovine serum and a mix of antibiotics and antifungals (sigma aldrich). The cultures were kept at 37c and 5% co2 and disassociated from the culture dish using trypsin . Cloning, expression and purification of e2 protein in e. coli - hcv cdna was obtained from viral rna extracted with the qiamp viral rna mini kit (qiagen, usa), according to the manufacturer s protocol, using pooled sera from individuals with hcv genotype 1a provided by the laboratory of clinical immunology of the pharmaceutical science school of araraquara, so paulo, brazil . The hcv sequence was found by comparison using the blastn local alignment program and its orf was entirely sequenced . To express recombinant e2 protein, the soluble form of the protein without the transmembrane domain the mature orf was amplified with the forward primer 5-ggccatgggggaaacccacgtcaccgg-3 and reverse primer 5-gctcgaggctcggacctgtccctgtc-3 (the underlined bases indicate introduced restriction sites for ncoi and xhoi, respectively) (rodrguez - rodrguez et al . The pet42a plasmid was used to generate the mature e2 protein orf flanked by glutathione s - transferase (gst) at the n - terminus and a 6x his tag at the c - terminus . The transformed e. coli bl21 were induced for 3 h with isopropylthio--galactoside (final concentration 0.4 mm) at 37c and 250 rpm when the optical density (od) at 600 nm reached 0.5 . The cells were pelleted, suspended in lysis buffer (10 mm tris - hcl, 50 mm nah2po4 and 100 mm nacl, ph 8.0) and subjected to sonication (5 pulses of 1 min each). The soluble phase was purified using glutathione sepharose 4 fast flow (ge healthcare, usa). The binding buffer employed was 10 mm tris - base, 50 mm sodium phosphate and 100 mm sodium chloride at ph 8.0 . The gst - tagged protein was eluted with a two - fold resin volume of elution buffer (10 mm reduced glutathione and 50 mm tris - hcl, ph 8.0). The fractions containing the purified protein were dialysed against phosphate - buffered saline (pbs) (ph 8.0), quantified using the pierce bca protein assay kit (thermo scientific, usa) and stored at -20c . Cloning, expression and purification of recombinant protein in p. pastoris - the e2 protein orf was cloned into ppicza and the mature orf was amplified with the forward primer 5-aagaattcgaaacccacgtcaccgggggaa-3 and the reverse primer 5-aatctagattctcggacctgtccctgtcttcc-3 (the underlined bases indicate introduced ecori and xbai restriction sites, respectively). The cloning was performed to create a recombinant plasmid containing the e2 protein orf flanked by the secretion signal peptide (-factor) at the n - terminus and a 6x his tag at the c - terminus . Before p. pastoris transformation, the recombinant plasmid was linearised with pmei endonuclease and introduced into the yeast by electroporation (1.5 kv, 25 f, 200) (cregg 2007)). Transformants were cultivated in solid yepd with 1 m sorbitol and 100 g / ml zeocin . The yeast transformants were screened for protein induction in 24-well plates (boettner et al . (2012)), differing only in the use of bmgy and bmmy medium buffered with 100 mm mcilvaine s buffer, ph 4.0 . The supernatant was dialysed against pbs buffer (ph 8.0), concentrated using the labscale tff system (membrane pellicon xl50, millipore, usa) until 10-fold reduction and stored at -20c . Cell viability - for the determination of cell viability, huvecs were seeded at 5 x 10 cells / ml . The adherent cells were incubated for 24 h at 37c and 5% co2 with the recombinant proteins (e2b and e2y) at 250, 125, 62.5, 31.25, 15.63 and 7.81 g / ml or with 1.0 g / ml lipopolysaccharide (lps), 10 ng / ml tumour necrosis factor alpha (tnf-), 10% sodium dodecyl sulfate (sds) (positive controls) or rpmi medium and the culture supernatant of e. coli bl21 cells (negative controls). After incubation, the cells were incubated with 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (1 mg / ml) for 3 h. the resultant formazan salt was dissolved in acidic 2-propanol and the od was measured (540/620 nm filters). The od of the untreated cells was taken as 100% cell viability (mosmann 1983)). Cell death - huvecs were seeded at 5 x 10 cells / ml and incubated for 24 h at 37c and 5% co2 with recombinant e2b and e2y using the concentrations and controls as described in the cell viability section . The following controls were also added: cells without stimulation (negative) and annexin and propidium iodide (pi) controls . The evaluation of cell death was performed using the annexin v - fitc annexin v apoptosis detection kit (bd pharmingen, usa) according to the manufacturer s protocol . The cells were analysed by flow cytometry (using a facscanto flow cytometer, bd biosciences and facsdiva software v.6.1.3). In each run n - acetylcysteine (nac) treatment - the effect of nac on cells exposed to e2 recombinant proteins was studied with respect to apoptosis (parp cleavage) and no and hydrogen peroxide (h2o2) production . Huvecs were pre - incubated with 5 mm nac for 1 h and treated with e2y, e2b and controls as described above . Parp cleavage - huvecs at 5 x 10 cells / ml were pre - incubated in the presence or absence of nac (5 mm) for 1 h and incubated for 24 h at 37c and 5% co2 with recombinant e2 proteins (e2b and e2y) using the concentrations and control stimuli described in the cell viability section . Huvecs were lysed in 10 mm tris (ph 7.4), 1 mm edta, 0.5 mm egta, 150 mm nacl, 1% triton x-100, 50 mm naf, 10 mm na4p2o710h2o, 5 g / ml aprotinin, 5 g / ml leupeptin and 1 mm pmsf . To evaluate cell apoptosis, 20 g of lysate protein was electrophoresed in 8% sds - polyacrylamide gels and transferred onto nitrocellulose membranes (hybond ecl). The membranes were blocked with 5% skim milk in tris - buffered saline (tbs) containing 0.1% tween-20 (tbs - t) and subsequently incubated with rabbit parp antibody (1:2000 dilution, santa cruz biotechnology, inc, usa) overnight at 4c to detect full - length parp (116 kda) and cleaved parp (carboxyl - terminal catalytic fragment, 89 kda). After washing with tbs - t for 1 h at room temperature (rt), the membranes were further incubated with a horseradish peroxidase - conjugated rabbit polyclonal antibody (1:2000 dilution; santa cruz biotechnology, inc) for 2 h followed by 1 h washing (with 3 - 5 wash buffer changes). Actin levels were used to control for protein levels and were detected with an antibody against actin (yang et al . 2004)). No production - total no production was determined in the culture supernatant of huvecs seeded at 5 x 10 cells / ml incubated with e2b and e2y and controls as described in the cell viability section for 24 h at 37c and 5% co2 . The samples were measured in a no analyser (sievers nitric oxide analyzer overview, model noa 280i, ge analytical instruments, usa), in which the nitrites, nitrates and nitrosothiols present in the supernatant were converted into no by a saturated solution of vanadium trichloride in 0.8 m hcl at 90c . No was detected by a chemiluminescent reaction in the gas phase between no and ozone (archer 1993, jaiswal et al . This reaction is based on l - arginine hydrolysis by arginase in cell lysates (corraliza et al . Briefly, huvecs were cultured with recombinant proteins, lps, tnf- and culture medium or culture supernatant of e. coli bl21 cells using the concentrations and stimuli described in the cell viability section . The cells were lysed using 100 l of 0.1% triton x-100 for 30 min under agitation . Subsequently, 50 l of cell lysate was added to 50 l of 25 mm tris - hcl and 25 l of 100 mm mncl2 and the final solution was incubated for 10 min at 56c for enzyme activation . Next, 50 l of 0.5 m l - arginine (ph 9.7) was added and the test reaction was incubated at 37c for 60 min . The reaction was stopped by adding 400 l of stop solution (96% h2so4, 85% h3po4 and water, at a proportion of 1:3:7 v / v / v). Twenty - five microlitres of 9% -isonitrosopropiophenone in 100% ethanol was added and the reaction was incubated at 95c for 30 min . Finally, the cells were incubated at rt for 10 min and the absorbance was measured using a 540 nm filter . The urea concentration was calculated using a linear equation generated by known quantities of urea . One unit of enzyme activity was defined as the amount of enzyme capable of producing 1 mol of urea per minute . H 2 o 2 production - huvecs at 5 x 10cells / ml were incubated for 2 h at 37c and 5% co2 with recombinant e2b and e2y using the concentrations and stimuli described in the cell viability section . Approximately 600 ng / ml dihydrorhodamine 123 (dhr) (sigma - aldrich) was added and the cells were incubated at 37c for 10 min . The cells were washed with pbs (ph 7.2) and centrifuged for 5 min at 300 g. the supernatant was discarded and the cells were resuspended in 150 l of pbs (ph 7.2). The samples were read in the fl1 channel using a facscanto flow cytometer (bd biosciences) and facsdiva software v.6.1.3 . The experiment included a control for spontaneous fluorescence (cells only) and a control for spontaneous production of h2o2 (dhr and cells without stimuli) (walrand et al . Il-8, tnf- and vascular endothelial growth factor a (vegf - a) production - huvecs at 5 x 10 cells / ml were incubated for 24 h at 37c and 5% co2 with recombinant e2b and e2y using the concentrations and controls described in the cell viability section . An additional control using pma (0.50 m) was used in the tnf- detection assay . The negative control consisted of 300 l of culture medium and 300 l of pbs (ph 7.2; medium of the protein dilution). Il-8, tnf- and vegf - a production was measured by elisa using the kit human vegf - a platinum elisa (ebioscience inc, usa), according to the manufacturer s instructions . The results are expressed in pg / ml . Statistical analysis - the data were analysed by anova using a 5% level of significance followed by multiple comparisons with the tukey test and graphic representation of the data . The recombinant e2 proteins were expressed in two different expression systems, the e. coli rosetta strain (e2b) and the p. pastoris km71h strain (e2y) (fig . 1). The e2b protein exhibited a molecular weight of approximately 63.5 kda due to its expression as a fusion protein with gst (26 kda) and the 6x his tag (1 kda). The e2y protein exhibited a molecular weight of approximately 50.0 kda due to its expression as a fusion protein with the 6x his tag (1 kda). The n - glycosylation of the e2y protein was confirmed by protein treatment with a peptide - n - glycosidase, pngase f (new england biolabs, usa), according to the manufacturer s protocol . The proteins exhibited different molecular weights (e2b = 36.5 kda and e2y = 49 kda) due to the types of protein processing used in these two systems . Fig . 1: produced envelope glycoprotein 2 (e2) recombinant proteins (sodium dodecyl sulfate polyacrylamide gel electrophoresis 12%). Channel 1: molecular weight marker [benchmarktm protein ladder (10 - 220 kda), invitrogen]; 2: e2b (approximately 63.5 kda); 3: e2y (approximately 50 kda). We observed that some concentrations of the recombinant e2 proteins (e2y: 62.5 - 250 g / ml and e2b: 125 - 250 g / ml) were slightly cytotoxic to huvecs (fig . 2). At 250 g / ml, the decrease in viability was similar to that obtained when the cells were incubated with lps or tnf-. The cellular events provoked by the e2 proteins were evaluated using annexin v and pi assays, which indicated that early apoptosis was the main cause of cell death (fig . However, even at the highest concentration of e2 protein used in this study, the proportion of apoptotic cells was always lower than 30% . 2: effect of envelope glycoprotein 2 (e2) recombinant proteins on human umbilical vein endothelial cells viability [3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay]. C-: negative control; c+: culture medium rpmi; lps: lipopolysaccharide (1.0 g / ml); sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng / ml); *: p <0.05 compared to the negative control; * * *: p <0.001 compared to the negative control . 3: cytotoxicity of envelope glycoprotein 2 (e2) proteins on human umbilical vein endothelial cells . Results presented as mean and standard deviation of percentage obtained in the assay . In each run, 30,000 cells were analysed and all experiments were performed in triplicate . C-: negative control; early apoptosis: annexin v stained cells; late apoptosis: cells double - positive for annexin v and propidium iodide (pi); lps: lipopolysaccharide (1.0 g / ml); necrosis: cells stained with pi; sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng / ml); * * *: p <0.001 compared to the negative control . To further explore the mechanism of e2 protein - induced apoptosis, we investigated the degradation of parp, which is thought to be one of the targets of activated caspase-3 or 7 during apoptosis (yang et al . Immunoblot analysis revealed that the recombinant e2 proteins induced the degradation of endogenous 116 kda parp, as shown by the appearance of 89 kda fragments (fig . 4a, b), which were clearly detected in all samples treated with e2 protein or with the control stimuli, tnf- (fig . These results indicate that parp cleavage is associated with e2-induced apoptosis in huvecs . Moreover, the pre - treatment of the cells with the antioxidant nac protected against apoptosis by preventing parp cleavage (fig . 4: parp cleavage in recombinant envelope glycoprotein 2 (e2)-induced apoptosis in human umbilical vein endothelial cells . Cells were pre - treated (c, d) or no (a, b) with n - acetylcysteine (nac) for 1 h and incubated with recombinant e2 proteins, e2y (a, c) and e2b (b, d) in different concentrations . Line 2: 7.81 g / ml; 3: 15.63 g / ml; 4: 31.25 g / ml; 5: 62.5 g / ml; 6: 125 g / ml; 7: 250 g / ml; a - d1: lysate of untreated cells; e1: cells without pre - treatment with nac and treated with tumour necrosis factor alpha (tnf-); e2: cells pre - treated with nac and treated with tnf-; e3: cells without pre - treatment with nac and treated with lipopolysaccharide (lps); e4: cells pre - treated with nac and treated with lps; f1 - 4: actin . Statistical analysis of the results revealed that there was a statistically significant difference (p <0.01) when compared with the spontaneous control (negative control) or production stimulated by the bacterial supernatant . The e2 proteins were as effective as the classical stimuli, lps and tnf-. One exception was the treatment with 7.81 g / ml of e2 protein, in which only a slight, but significant elevation in no was observed relative to the more potent lps and tnf- stimuli . The higher production of no was not the result of increased or decreased arginase activity relative to the negative control (result not shown) because no significant differences were observed when compared with the negative control . Our data also demonstrated that pre - treatment with nac significantly decreased (p <0.01) the e2 protein - induced no production . Fig . 5: nitric oxide (no) production by envelope glycoprotein 2 (e2)-stimulated human umbilical vein endothelial cells . C-: no spontaneous production, cells and culture medium; lps: lipopolysaccharide (1.0 g / ml); nac: n - acetylcysteine; sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng / ml); * * *: p <0.001 compared to the negative control . The production of h2o2 was evaluated in huvecs after exposure to recombinant proteins at different concentrations and control stimuli . The relative production of h2o2, calculated as the mean fluorescence intensity, is presented in fig . The e2 proteins were able to stimulate the production of h2o2 at all of the tested concentrations . Again, the production was similar to that obtained by stimulation with lps and was inferior to that of tnf-. Of the two e2 proteins, e2y was more effective than e2b at concentrations of 7.81 g / ml (p <0.05). The results of pre - treatment with nac revealed a significant decrease (p <0.01) in the e2 protein - induced h2o2 production . Fig . 6: hydrogen peroxide production by envelope glycoprotein 2 (e2)-stimulated human umbilical vein endothelial cells . Results presented as mean and standard deviation of the mean fluorescence intensity (mfi). The experiments were performed in triplicate . (1.0 g / ml); nac: n - acetylcysteine; sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng / ml); * * *: p <0.001 in relation to negative control . The e2 proteins were capable of inducing the production of il-8 compared with non - stimulated cells . 7 . There was a statistically significant difference (p <0.05) between all of the stimuli tested compared with the negative control . Unlike the il-8 results, the e2 proteins were not able to induce the production of tnf- or lps by huvecs . However, 0.50 m pma induced huvecs to produce 173.05 pg / ml tnf-. Fig . 7: interleukin-8 (il-8) production by envelope glycoprotein 2 (e2)-stimulated human umbilical vein endothelial cells . C-: cells and medium and phosphate - buffered saline (ph 7.2). Lps: lipopolysaccharide (1.0 g / ml); sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng / ml); * * *: p <0.001 compared to negative control; *: p <0.05 compared to negative control . The detection of vegf - a production by huvecs in response to control stimuli and recombinant proteins is presented in fig . The e2 proteins significantly induced (p <0.01) the production of vegf - a by huvecs . Fig . 8: vascular endothelial growth factor a (vegf - a) production by envelope glycoprotein 2 (e2)-stimulated human umbilical vein endothelial cells . Results presented as mean and standard deviation . Lps: lipopolysaccharide (1.0 g / ml); tnf-: tumour necrosis factor alpha (10 ng / ml); sup: culture supernatant escherichia coli bl21; c-: cells and medium and phosphate - buffered saline (ph 7.2); * *: p <0.01 compared to the negative control; * * *: p <0.001 compared to the negative control . The e2 protein - induced production of no, h2o2, il-8 and vegf by huvecs strongly supports the cytotoxicity of these proteins . There is evidence that endothelial cells are directly susceptible to infection by hcv (fletcher et al . 2012)) and that the damage caused by the infection leads to late complications, such as fibrosis, cirrhosis and hepatocellular carcinoma . These late complications are believed to be caused by numerous inflammatory molecules in response to viral infection of the liver (ming - ju et al . Consistent with this hypothesis, we found that e2 proteins were able to induce apoptosis and several inflammatory responses in huvecs . The putative receptors for e2 proteins in this cellular type have been described previously, including low - density lipoprotein receptor (agnello et al . 1999)), tetraspanin cd81 (zhang et al . 2004)), scavenger receptor class b type 1 (scarselli et al . 2002)), claudin-1 (evans et al . 2007)), occludin (ocln) (ploss et al . 2009)) and transferrin receptor 1 (tfr1) (martin & uprichard 2013)). No is an inorganic free radical molecule (furchgott & zawadzki 1980)) that is highly diffusible and reactive (bredt & snyder 1992)) and is involved in various physiological functions and pathological conditions when produced in excess (kaufman 1999, benali - furet et al . 1997)), which may play an important role in the pathogenesis of cirrhosis associated with infection (hassan et al . 2002)). Here, we have demonstrated for the first time that no production by huvecs was induced by both recombinant e2 proteins . This no production may lead to later inflammation in the portal vein and subsequent fibrosis and cirrhosis . The increased no production could be the consequence of the increased expression of arginase in huvecs . Hcv infection is associated with the development of hepatocellular carcinoma (okuda 2007, tan et al . 2008)) and can alter the expression of arginase, thereby stimulating tumourigenesis and hepatocellular carcinoma (cao et al . . However, this pathway does not appear to be relevant to endothelial cells because arginase expression was not altered by the e2 proteins . The e2 proteins were also able to induce the production of h2o2 by huvecs . This is additional evidence of the role of e2 in the inflammatory response mediated by hcv . (2011)) and suggests the involvement of the e2 protein in h2o2 production and the development of inflammation in the hepatic portal vein, with the increased expression of factors related to hepatic fibrosis . (2003)) reported that the hcv e2 protein was able to stimulate intracellular signalling pathways, leading to the induction of secretion of pro - inflammatory cytokine il-8 . Il-8 is also observed in the serum of patients with chronic hepatitis c (polyak et al . 2001, akbar et al . 2011)), demonstrating a correlation between inflammation, il-8 serum levels and liver fibrosis (kaplanski et al . Consistent with this hypothesis, recombinant e2 proteins stimulated the production of il-8 in huvecs . (2005)). However, the e2 proteins were not able to induce the production of tnf- by huvecs . These results are also consistent with the work of balasubramanian et al . (2005)), who reported that hcv proteins can interact with the endothelium and that e2 protein did not induce the production of cytokines such as monocyte chemotactic protein-1, tnf- and gamma interferon . Analysis of peripheral blood mononuclear cells and liver biopsy samples of individuals chronically infected by the virus suggests that hcv infection may be able to induce apoptosis, causing damage to the liver while helping the virus to evade the immune system and facilitate viral dissemination (hiramatsu et al ., we found that the e2 proteins were also able to induce apoptosis (early and late) as well as necrosis (fewer cells) in huvecs . The glycosylated protein expressed in p. pastoris (e2y) was a more effective inducer of apoptosis as well as necrosis relative to the non - glycosylated protein (e2b), demonstrating the influence of glycosylation on apoptosis . Moreover, the apoptosis induced by recombinant e2 protein was effectively rescued in cells pre - treated with nac, suggesting that the generation of reactive oxygen species is involved in e2-induced apoptosis in huvecs . We also suggest that the production of no, h2o2, il-8 and vegf - a were not related to cell death induced by high concentrations of the recombinant protein, but are e2-specific effects . Vegf - a is a potent angiogenic factor that plays a key role in the development of angiogenesis in various tumour types (toi et al . 2000)), including hepatocellular carcinoma (ng et al . 2001, poon et al . 2004)). Vegf - a has a specific angiogenic effect on endothelial cells and can be stimulated by hcv infection (dvorak et al . Additionally, vegf - a plays a role in the regulation of several cellular functions, including growth (nasimuzzaman et al . 2007)) and apoptosis (hglinger et al . 2007)). Hepatic angiogenesis has been described in viral hepatitis, autoimmune liver cirrhosis, primary biliary cirrhosis and hepatocellular carcinoma (garca - monzn et al . Hcv stimulates the synthesis and secretion of vegf - a via virus - induced oxidative stress (nasimuzzaman et al . 2007)). In our study, the exposure of huvecs to both recombinant e2 proteins induced the production of vegf - a . We suggest that oxidative stress, as demonstrated by the production of no and h2o2 in huvecs in response to e2 proteins, may represent the stimulating factor of vegf - a production . The literature reports that the hcv core protein is able to stimulate the production of vegf - a, but there are no data regarding the e2 protein (hassan et al . Therefore, this is the first demonstration that the e2 protein is also able to induce the production of vegf - a and, consequently, angiogenesis . Hcv is a positive - stranded rna virus that is unable to integrate its genetic material into the host cell genome . The hcv genome does not contain oncogenes, suggesting that hcv induces hepatocellular carcinoma indirectly by causing chronic inflammation, cell death, proliferation and cirrhosis (hassan et al ., we provide evidence that endothelial cells, such as huvecs, are susceptible to e2 hcv envelope proteins . In conclusion, stimulation with e2 protein induced huvecs to produce inflammatory and angiogenic factors . Considering that endothelial inflammation is a determinant of fibrosis progression and cirrhosis, we propose that these cellular effects might be involved in the persistence and chronicity of hcv infection . These results may contribute to our understanding of the pathophysiology of hepatitis c and, consequently, to the development of new therapeutic strategies against the interaction of hcv structural proteins and the hepatic endothelium.
Data were collected through interviews of healthcare workers present during the attempted cardiopulmonary resuscitation where transmission of sars - cov was thought to have occurred . Hospital and provincial policies in place at the time of the resuscitation were reviewed . The hospital patient - care environment laboratory specimens, collected with nasopharyngeal swabs, were obtained from healthcare workers with symptoms that fulfilled the sars clinical case definition after exposure during the attempted cardiopulmonary resuscitation . Polymerase chain reaction (rt - pcr) with primers specific for sars - cov (7). After participants gave informed consent, convalescent - phase serum was collected from all consenting healthcare workers exposed to the attempted resuscitation event as part of a larger seroprevalence study of hospital staff . For this, samples were analyzed with a commercially available indirect immunofluorescent assay (euroimmune, lbeck, germany) according to the directions of the manufacturer . In addition, a limited evaluation of the stryker t4 personal protection system (stryker instruments, kalamazoo, mi), worn by some of the healthcare workers involved in the resuscitation attempt, was conducted to estimate the operating parameters, including particle removal efficiency and air - flow rate . A met one model 227b hand - held particle counter (met one, inc ., grants pass, or) was used to count ambient particles outside and inside the hood; five replicates were collected for each condition over a 1-minute sampling period . All information was obtained as part of an ongoing joint investigation into the cause of the second phase of the toronto sars outbreak conducted by toronto public health, health canada, and the centers for disease control and prevention (13). A 67-year - old woman with a history of asthma was admitted to hospital a on may 24, 2003, with a 5 day history of fever, cough, malaise, headache, and myalgias . The patient s mother had recently been admitted to the same hospital and died of a nosocomial pneumonia after orthopedic surgery for a fractured hip . On the basis of clinical findings and the identification of secondary infections in exposed persons, the mother s death was retrospectively determined to be due to sars . On admission, the patient was febrile and her chest radiograph showed left lower lobe and lingular infiltrates . Both acute - phase serologic tests and serum rt - pcr were positive for sars - cov (national microbiology laboratory, health canada, toronto). She was admitted to the hospital and placed in respiratory isolation on the sars unit . Progressive respiratory failure later developed in the patient, and within 72 hours of admission, she required 100% supplemental oxygen . On may 28, 2003, she was found to have no vital signs and cardiopulmonary resuscitation was attempted . Rn1 performed chest compressions while rn2 and rn3 prepared suction, oxygen, and intubation equipment . Three intensive care unit nurses (icu - rn13), two respiratory therapists (rt1 and 2), and a physician (md) also participated in the resuscitation . Icu - rn2 inserted a peripheral intravenous catheter (iv) in the left foot of the patient and administered medications via the iv during the resuscitation attempt . Icu - rn3 ventilated the patient with a bag - valve - mask, without a bacterial / viral filter . No suctioning was required during or after the intubation and no respiratory secretions or other bodily substances were observed in the environment . A bacterial / viral filter was placed on the bag - valve - mask after the intubation . Sars, severe acute respiratory syndrome; rn1, ward nurse 1; rn2, ward nurse 2; rn3, ward nurse 3; icu - rn1, intensive care unit nurse 1; icu - rn2, intensive care unit nurse 2; icu - rn3, intensive care unit nurse 3; rt1, respiratory therapist 1; rt2, respiratory therapist 2; md, physician; iv, intravenous catheter; tmax, maximum temperature; ekg, electrocardiogram; ett, endotracheal tube all nurses in the room during the resuscitation were wearing protection equipment that was considered standard for routine sars patient care at this hospital . This equipment consisted of two gowns, two sets of gloves, goggles, a full - face shield (with the exception of rn1 and rn2), shoe covers, hair cover, and niosh - approved n95 disposable respirators that were not fit - tested . In addition, all nurses involved in the resuscitation were experienced in working on sars units and thus familiar with the recommended infection control policies and procedures . In contrast to the nurses, both rts and the md were wearing t4 personal protection systems during the resuscitation . All nurses left the room immediately after the intubation and removed their protection equipment following the standard hospital protocol . Both icu - rn1 and icu - rn2 had a temperature> 38.0c, myalgia, and malaise . In addition, icu - rn1 complained of headache and nausea, and icu - rn2 reported dyspnea . Icu - rn1 had a normal chest radiograph results, but the radiograph of icu - rn2 showed a left lower lobe infiltrate that persisted for several days . Rn3 reported a headache and myalgia on june 1, 2003, but her maximum temperature reached only 37.8c . Results of rt - pcr performed on nasopharyngeal swabs from icu - rn1 and icu - rn2 were negative (7). At present, only one case (icu - rn2) meets the world health organization criteria for probable sars, one case (icu - rn1) is under investigation, and the third (rn3) does not meet the case definition as her temperature remained <38.0c (14). A review of the 48-hour period before the resuscitation did not show any other likely transmission episodes . In particular, icu - rn2 was the charge nurse in the icu and had little or no direct patient contact in the 48 hours before the resuscitation . Five of the nine healthcare workers involved in the resuscitation agreed to participate in serologic testing . All convalescent - phase samples were collected> 30 days after the event (table). Evaluation of the stryker t4 personal protection system indicated an average removal efficiency of 68% for particles> 0.5 m in diameter and 54% for particles> 5 m . This equates to a reduction factor (i.e., particles outside of the hood would be reduced in number by this factor) of 3.1 and 2.2, respectively . A 67-year - old woman with a history of asthma was admitted to hospital a on may 24, 2003, with a 5 day history of fever, cough, malaise, headache, and myalgias . The patient s mother had recently been admitted to the same hospital and died of a nosocomial pneumonia after orthopedic surgery for a fractured hip . On the basis of clinical findings and the identification of secondary infections in exposed persons, the mother s death was retrospectively determined to be due to sars . On admission, the patient was febrile and her chest radiograph showed left lower lobe and lingular infiltrates . Both acute - phase serologic tests and serum rt - pcr were positive for sars - cov (national microbiology laboratory, health canada, toronto). She was admitted to the hospital and placed in respiratory isolation on the sars unit . Progressive respiratory failure later developed in the patient, and within 72 hours of admission, she required 100% supplemental oxygen . On may 28, 2003, she was found to have no vital signs and cardiopulmonary resuscitation was attempted . Rn1 performed chest compressions while rn2 and rn3 prepared suction, oxygen, and intubation equipment . Three intensive care unit nurses (icu - rn13), two respiratory therapists (rt1 and 2), and a physician (md) also participated in the resuscitation . Icu - rn2 inserted a peripheral intravenous catheter (iv) in the left foot of the patient and administered medications via the iv during the resuscitation attempt . Icu - rn3 ventilated the patient with a bag - valve - mask, without a bacterial / viral filter . Rt1 performed the endotracheal intubation, which was completed in <30 seconds . No suctioning was required during or after the intubation and no respiratory secretions or other bodily substances were observed in the environment . A bacterial / viral filter was placed on the bag - valve - mask after the intubation . Sars, severe acute respiratory syndrome; rn1, ward nurse 1; rn2, ward nurse 2; rn3, ward nurse 3; icu - rn1, intensive care unit nurse 1; icu - rn2, intensive care unit nurse 2; icu - rn3, intensive care unit nurse 3; rt1, respiratory therapist 1; rt2, respiratory therapist 2; md, physician; iv, intravenous catheter; tmax, maximum temperature; ekg, electrocardiogram; ett, endotracheal tube all nurses in the room during the resuscitation were wearing protection equipment that was considered standard for routine sars patient care at this hospital . This equipment consisted of two gowns, two sets of gloves, goggles, a full - face shield (with the exception of rn1 and rn2), shoe covers, hair cover, and niosh - approved n95 disposable respirators that were not fit - tested . In addition, all nurses involved in the resuscitation were experienced in working on sars units and thus familiar with the recommended infection control policies and procedures . In contrast to the nurses, both rts and the md were wearing t4 personal protection systems during the resuscitation . All nurses left the room immediately after the intubation and removed their protection equipment following the standard hospital protocol . Both icu - rn1 and icu - rn2 had a temperature> 38.0c, myalgia, and malaise . In addition, icu - rn1 complained of headache and nausea, and icu - rn2 reported dyspnea . Icu - rn1 had a normal chest radiograph results, but the radiograph of icu - rn2 showed a left lower lobe infiltrate that persisted for several days . Rn3 reported a headache and myalgia on june 1, 2003, but her maximum temperature reached only 37.8c . Results of rt - pcr performed on nasopharyngeal swabs from icu - rn1 and icu - rn2 were negative (7). At present, only one case (icu - rn2) meets the world health organization criteria for probable sars, one case (icu - rn1) is under investigation, and the third (rn3) does not meet the case definition as her temperature remained <38.0c (14). A review of the 48-hour period before the resuscitation did not show any other likely transmission episodes . In particular, icu - rn2 was the charge nurse in the icu and had little or no direct patient contact in the 48 hours before the resuscitation . Five of the nine healthcare workers involved in the resuscitation agreed to participate in serologic testing . All convalescent - phase samples were collected> 30 days after the event (table). Evaluation of the stryker t4 personal protection system indicated an average removal efficiency of 68% for particles> 0.5 m in diameter and 54% for particles> 5 m . This equates to a reduction factor (i.e., particles outside of the hood would be reduced in number by this factor) of 3.1 and 2.2, respectively . This report describes the apparent transmission of sars - cov from a patient to healthcare workers during an attempted resuscitation . The similar symptom onset dates suggest a point source of exposure . In this case, sars - cov was transmitted despite healthcare workers wearing protection equipment designed to protect against contact and droplet transmission; no breaches in droplet protection equipment were identified, and exposure times were fairly brief . Although sars transmission that involved intubation and bipap (9) have been reported, this episode is unique in that the patient was neither conscious nor breathing at the time of the intubation, and the intubation procedure was performed quickly and without difficulty . These factors make it less likely that transmission occurred as a direct result of the intubation procedure . Instead, it is more likely that transmission was related to events leading up to the intubation . In this case, just as in previous cases, either contact, droplet, or airborne transmission might have occurred . Direct and indirect contact are the most common forms of transmission for most nosocomial pathogens; transmission between patients or from patient to healthcare worker usually follows contamination of the healthcare workers hands after touching either the patient or a fomite that came into direct contact with the patient . Large aerosol droplets (i.e.,> 10 m) can, in addition to contaminating both animate and inanimate surfaces in close range of the patient, travel short distances through the air and make direct contact with the exposed mucous membranes of healthcare workers or other patients . In contrast, airborne transmission is mediated by respiratory aerosols . These aerosols of infectious organisms contain droplet nuclei <10 m in size and, depending upon their size within this range as well as ambient environmental conditions, can float on air currents and remain airborne for many hours (1518). A large variety of viruses (16,1927) are transmissible through both contact and airborne modes . Often, investigation of the epidemiology of nosocomial viral infections, establishes the occurrence of airborne transmission (15). Two explanations may account for the transmission observed in this case: 1) an unrecognized breach in contact and droplet precautions occurred, or 2) an airborne viral load was great enough to overwhelm the protection offered by droplet precautions, including non fit - tested n95 disposable respirators . If the last form of transmission was responsible, airborne virus may have been generated by the coughing patient (16) before her cardiopulmonary arrest or due to a cough - like force produced by the airway pressures created during asynchronous chest compressions and ventilations using the bag - valve - mask (28). Regardless of the exact mode of transmission in this case, several lessons were learned through our investigation that may help reduce the risk of transmission to healthcare workers . A systematic approach to this problem is outlined considering the following framework: 1) administrative controls, 2) environmental engineering, 3) protection equipment, and 4) quality control . Policies and protocols for emergency resuscitation involving patients known to have or suspected of having sars should include 1) description of the roles and responsibilities of healthcare workers responding to the emergency, 2) mechanisms to alert responders that the emergency involves a potentially contagious patient (e.g., announcing the code as an isolation code blue), 3) steps to limit the number of healthcare workers involved to minimize potential exposures, 4) plans for having auxiliary staff staged in a safe area where they can be easily called on if needed but otherwise preventing unnecessary exposure, 5) plans for safe disposal and cleaning of equipment used during the emergency response, and 6) procedures for disposition of the patient after the emergency, either to the icu if resuscitation is successful or the morgue if unsuccessful . Policies must be developed that consider all high - risk exposures or emergency situations and not just individual procedures . Policies that are too focused are of little value in dealing with the hundreds of unforeseeable possible situations that may arise . Conversely, policies that educate healthcare workers to assess the risks of a task and empower them to take appropriate protective action will be more effective . These policies should be crafted at each healthcare facility by a team that involves key stakeholders, including persons involved in the clinical response along with infection control practitioners and infectious disease experts . It is also important to minimize the chance that a patient will suffer unwitnessed cardiopulmonary arrest or require emergency intubation on a sars unit . The first is to recognize that isolation wards cannot be staffed with the same nurse - to - patient ratio as a regular ward . Care of patients in isolation is more time intensive due to both the physical barriers (e.g., anterooms, doors kept closed at all times) and the required use of protection equipment . The nurse - to - patient ratio on the sars ward at the time of the arrest was between 1:4 and 1:5; a more ideal ratio might be 1:2 or 1:3 . It is also necessary to have a lower threshold for transferring patients to a higher acuity setting (i.e., icu or stepdown unit) when they first begin to show signs of a clinical deterioration . To enable this, all patients on a sars unit should have measurement of vital signs along with pulse oximetry at a minimum of every 4 hours . Should their oxygen saturation drop below 92% on room air one should administer oxygen through nasal prongs 14 l per minute to maintain saturation> 92%, and increase vital signs / pulse oximetry to every 2 hours . If the patient subsequently requires oxygen through nasal prongs at> 4 l per minute the responsible physician should be notified and increase vital signs or pulse oximetry to every 1 hour . Finally, if the patient requires supplemental oxygen of> 40% to maintain saturation> 92%, the patient should be transferred to the intensive care unit and undergo elective intubation in a controlled manner . This later policy has worked well in other sars units, as well as in hospital a after it was implemented by one of the authors (m.l .) After this cluster . Finally, policies should be developed to address the appropriateness and application of advanced cardiac life support for patients suffering cardiopulmonary arrest on a sars ward . Many considerations must enter into any such discussion, including the usefulness and outcome of resuscitation efforts, particularly in unwitnessed arrests (2931). Despite even the most well - planned and well - written policies, if healthcare workers are not trained in proper infection control practices, sars will continue to be transmitted . Staff must be trained in both the application of policies as well as the use of protection equipment . In addition to education, practice is also important; for example, consideration should be given to staging one or more mock sars code blue events . These consist of physical engineering elements such as negative pressure rooms, dilution ventilation, high - efficiency particulate air filtration, ultraviolet lights, and scavenging devices . The primary goal of environmental engineering processes is to contain the infectious agent in a limited area and to minimize or rapidly decrease the viral load in the environment so that in the event of a breach in infection control process or protection equipment, the chance of healthcare workers or other patients becoming infected is minimized . In this case, a breach occurred in source control; the initial bag - valve - mask used in the resuscitation did not have a viral / bacterial filter on the exhaust . Uncontrolled release of aerosolized virus into the environment . However, previous studies with coxsackie virus showed that little or no virus is detectable in expired air, only in respiratory aerosols and droplets from coughing or sneezing (16,21). The use of n95 respirators offers a level of protection against airborne transmission of sars . However, for any form of respiratory protection to perform at the level of its full potential, it must be properly fitted to provide an adequate seal . The n95 disposable respirators used by healthcare workers in this instance were not fit - tested to ensure an adequate seal . Thus the exact level of protection afforded by the n95 respirators for each person in this case is unknown . Nonetheless, a higher level of respiratory protection should be considered in environments with a potentially very high sars - cov load, such as that associated with aerosol - generating procedures as a result of the transmission of sars co - v during aerosol - generating procedures, some hospitals in ontario, canada, have adopted use of the t4 personal protective system (stryker instruments) (figure 1). This system was originally designed to maintain a highly sterile field during surgery to prevent operative site infections . Photos provided by randy wax and laurie mazrik, ontario provincial sars biohazard education team . As a form of protection equipment, this system has both advantages and disadvantages . The primary advantage is that the entire body of the healthcare worker is covered, providing a high level of droplet protection . The primary disadvantage of the t4 is the length of time required to put one on during an emergency . In the emergency resuscitation described in this report, the delay in certain rescuers responding was due to the time required to put on the t4 . This resulted in the need for a second code blue to be announced for the same patient, which drew additional personnel to the code and thus increased the number of healthcare workers exposed to sars . Moreover, the airborne reduction factors of 3.1, for particles> 0.5 m in diameter, and 2.2 for particles> 5 m were less than the protection factor of 10 that is assigned (i.e., minimum expected in practice) for a fit - tested, disposable n95 respirator . However, a disposable n95 is commonly worn under the t4 used in ontario hospitals, suggesting the respiratory protection afforded healthcare workers using the t4 would be greater . The powered air - purifying respirators (paprs) most commonly used in healthcare settings have a disposable full hood with face shield covering the healthcare worker s upper body (figure 2). This device provides a higher level of protection against airborne infectious agents (any papr equipped with a hood or helmet with any type of particulate air filter has an assigned protection factor of 25), and it may be faster and easier to apply in an emergency situation . Finally, ensuring that a hospital has adequate protection against airborne diseases, even if not absolutely required for sars, will ensure that staff are prepared to deal with future emerging infectious diseases or bioterrorism events that could involve airborne agents . Photos provided by randy wax and laurie mazrik, ontario provincial sars biohazard education team . Regardless of what device (t4 versus papr) is used in an institution for potentially aerosol generating procedures, it is essential that they are distributed throughout the hospital in areas where they are most likely to be required by primary responders in an emergency situation as opposed to a central area where teams must wait for them to be brought to the emergency . In addition, extra protection equipment should be included as part of any crash cart used by the responding code team . Although there is a tendency to focus only on high - tech forms of protection equipment, it is important not to forget the basics of infection control procedures such as glove changing and hand hygiene . Healthcare workers must remain vigilant about not only protecting themselves from sars transmission but also protecting against patient - to - patient transmission . As was found in the second phase of the sars outbreak in toronto (13), one of the best ways to prevent healthcare worker infections is to ensure that no sustained transmission of sars occurs within the patient population, which may act as a reservoir of infection . After developing good policies and training staff who are rehearsed for emergencies and provided with appropriate protection equipment, this adherence is achieved through quality control . Without an effective quality control program in place, lapses in infection control procedures will occur, particularly as healthcare workers become fatigued during a prolonged outbreak . A variety of quality control methods can be implemented, including administrative checks to ensure equipment is in good repair, policies are current, and training materials are up to date . Another quality control practice often used by emergency services personnel dealing with hazardous situations is the buddy system . In this system, healthcare workers always work in teams on sars units with each person being responsible for double checking to make sure that their partner is wearing appropriate equipment and following correct infection control practices before entering a patient s room . Finally, a process should be in place to review responses to emergencies after they have occurred to learn from the experience and facilitate continuous quality improvement . Policies and protocols for emergency resuscitation involving patients known to have or suspected of having sars should include 1) description of the roles and responsibilities of healthcare workers responding to the emergency, 2) mechanisms to alert responders that the emergency involves a potentially contagious patient (e.g., announcing the code as an isolation code blue), 3) steps to limit the number of healthcare workers involved to minimize potential exposures, 4) plans for having auxiliary staff staged in a safe area where they can be easily called on if needed but otherwise preventing unnecessary exposure, 5) plans for safe disposal and cleaning of equipment used during the emergency response, and 6) procedures for disposition of the patient after the emergency, either to the icu if resuscitation is successful or the morgue if unsuccessful . Policies must be developed that consider all high - risk exposures or emergency situations and not just individual procedures . Policies that are too focused are of little value in dealing with the hundreds of unforeseeable possible situations that may arise . Conversely, policies that educate healthcare workers to assess the risks of a task and empower them to take appropriate protective action will be more effective . These policies should be crafted at each healthcare facility by a team that involves key stakeholders, including persons involved in the clinical response along with infection control practitioners and infectious disease experts . It is also important to minimize the chance that a patient will suffer unwitnessed cardiopulmonary arrest or require emergency intubation on a sars unit . The first is to recognize that isolation wards cannot be staffed with the same nurse - to - patient ratio as a regular ward . Care of patients in isolation is more time intensive due to both the physical barriers (e.g., anterooms, doors kept closed at all times) and the required use of protection equipment . The nurse - to - patient ratio on the sars ward at the time of the arrest was between 1:4 and 1:5; a more ideal ratio might be 1:2 or 1:3 . It is also necessary to have a lower threshold for transferring patients to a higher acuity setting (i.e., icu or stepdown unit) when they first begin to show signs of a clinical deterioration . To enable this, all patients on a sars unit should have measurement of vital signs along with pulse oximetry at a minimum of every 4 hours . Should their oxygen saturation drop below 92% on room air one should administer oxygen through nasal prongs 14 l per minute to maintain saturation> 92%, and increase vital signs / pulse oximetry to every 2 hours . If the patient subsequently requires oxygen through nasal prongs at> 4 l per minute the responsible physician should be notified and increase vital signs or pulse oximetry to every 1 hour . Finally, if the patient requires supplemental oxygen of> 40% to maintain saturation> 92%, the patient should be transferred to the intensive care unit and undergo elective intubation in a controlled manner . This later policy has worked well in other sars units, as well as in hospital a after it was implemented by one of the authors (m.l .) After this cluster . Finally, policies should be developed to address the appropriateness and application of advanced cardiac life support for patients suffering cardiopulmonary arrest on a sars ward . Many considerations must enter into any such discussion, including the usefulness and outcome of resuscitation efforts, particularly in unwitnessed arrests (2931). Despite even the most well - planned and well - written policies, if healthcare workers are not trained in proper infection control practices, sars will continue to be transmitted . Staff must be trained in both the application of policies as well as the use of protection equipment . In addition to education, practice is also important; for example, consideration should be given to staging one or more mock sars code blue events . These consist of physical engineering elements such as negative pressure rooms, dilution ventilation, high - efficiency particulate air filtration, ultraviolet lights, and scavenging devices . The primary goal of environmental engineering processes is to contain the infectious agent in a limited area and to minimize or rapidly decrease the viral load in the environment so that in the event of a breach in infection control process or protection equipment, the chance of healthcare workers or other patients becoming infected is minimized . In this case, a breach occurred in source control; the initial bag - valve - mask used in the resuscitation did not have a viral / bacterial filter on the exhaust . This breach may have resulted in uncontrolled release of aerosolized virus into the environment . However, previous studies with coxsackie virus showed that little or no virus is detectable in expired air, only in respiratory aerosols and droplets from coughing or sneezing (16,21). The use of n95 respirators offers a level of protection against airborne transmission of sars . However, for any form of respiratory protection to perform at the level of its full potential, it must be properly fitted to provide an adequate seal . The n95 disposable respirators used by healthcare workers in this instance were not fit - tested to ensure an adequate seal . Thus the exact level of protection afforded by the n95 respirators for each person in this case is unknown . Nonetheless, a higher level of respiratory protection should be considered in environments with a potentially very high sars - cov load, such as that associated with aerosol - generating procedures as a result of the transmission of sars co - v during aerosol - generating procedures, some hospitals in ontario, canada, have adopted use of the t4 personal protective system (stryker instruments) (figure 1). This system was originally designed to maintain a highly sterile field during surgery to prevent operative site infections . Photos provided by randy wax and laurie mazrik, ontario provincial sars biohazard education team . As a form of protection equipment, this system has both advantages and disadvantages . The primary advantage is that the entire body of the healthcare worker is covered, providing a high level of droplet protection . The primary disadvantage of the t4 is the length of time required to put one on during an emergency . In the emergency resuscitation described in this report, the delay in certain rescuers responding was due to the time required to put on the t4 . This resulted in the need for a second code blue to be announced for the same patient, which drew additional personnel to the code and thus increased the number of healthcare workers exposed to sars . Moreover, the airborne reduction factors of 3.1, for particles> 0.5 m in diameter, and 2.2 for particles> 5 m were less than the protection factor of 10 that is assigned (i.e., minimum expected in practice) for a fit - tested, disposable n95 respirator . However, a disposable n95 is commonly worn under the t4 used in ontario hospitals, suggesting the respiratory protection afforded healthcare workers using the t4 would be greater . The powered air - purifying respirators (paprs) most commonly used in healthcare settings have a disposable full hood with face shield covering the healthcare worker s upper body (figure 2). This device provides a higher level of protection against airborne infectious agents (any papr equipped with a hood or helmet with any type of particulate air filter has an assigned protection factor of 25), and it may be faster and easier to apply in an emergency situation . Finally, ensuring that a hospital has adequate protection against airborne diseases, even if not absolutely required for sars, will ensure that staff are prepared to deal with future emerging infectious diseases or bioterrorism events that could involve airborne agents . Photos provided by randy wax and laurie mazrik, ontario provincial sars biohazard education team . Regardless of what device (t4 versus papr) is used in an institution for potentially aerosol generating procedures, it is essential that they are distributed throughout the hospital in areas where they are most likely to be required by primary responders in an emergency situation as opposed to a central area where teams must wait for them to be brought to the emergency . In addition, extra protection equipment should be included as part of any crash cart used by the responding code team . Although there is a tendency to focus only on high - tech forms of protection equipment, it is important not to forget the basics of infection control procedures such as glove changing and hand hygiene . Healthcare workers must remain vigilant about not only protecting themselves from sars transmission but also protecting against patient - to - patient transmission . As was found in the second phase of the sars outbreak in toronto (13), one of the best ways to prevent healthcare worker infections is to ensure that no sustained transmission of sars occurs within the patient population, which may act as a reservoir of infection . After developing good policies and training staff who are rehearsed for emergencies and provided with appropriate protection equipment, this adherence is achieved through quality control . Without an effective quality control program in place, lapses in infection control procedures will occur, particularly as healthcare workers become fatigued during a prolonged outbreak . A variety of quality control methods can be implemented, including administrative checks to ensure equipment is in good repair, policies are current, and training materials are up to date . Another quality control practice often used by emergency services personnel dealing with hazardous situations is the buddy system . In this system, healthcare workers always work in teams on sars units with each person being responsible for double checking to make sure that their partner is wearing appropriate equipment and following correct infection control practices before entering a patient s room . Finally, a process should be in place to review responses to emergencies after they have occurred to learn from the experience and facilitate continuous quality improvement . Sars has increased the medical community s awareness of issues related to occupational health and safety . A systematic approach, including administrative controls, environmental engineering, protection equipment, and quality control, is advocated to prevent future sars - cov transmission to healthcare workers.
Single - incision laparoscopic surgery (sils) is increasingly used in various surgical areas due to several advantages including better cosmesis, less incisional pain, and the ability to convert to standard multiport laparoscopic surgery if necessary . With the development of laparoscopic instruments, these laparoscopic instruments include sils port (covidien, norwalk, cn, usa), uni - x (pnavel systems inc ., morganville, nj, usa), x - cone (karl storz, tuttlingen, germany), and specialized customized dissector and graspers . However, using these instruments in sils might increase health - care costs . To reduce health - care costs,, we describe the use of homemade glove port in single - incision laparoscopic appendectomy (sila). A retrospective study was conducted for patients who underwent sila for acute appendicitis by a surgical team between february 2014 and june 2014 . Data pertaining to the patients demographics, operative time, length of hospital stay, and perioperative complications (if present) were retrospectively collected . The data collected from these patients were subsequently compared to those who underwent the conventional three - port conventional laparoscopic appendectomy (cla) from october 2013 to january 2014 . This study was approved by the institutional review board of the catholic university, bucheon st . All the patients were diagnosed with appendicitis, based on abdominal computed tomography with contrast enhancement . The patients with complicated appendicitis such as perforated appendicitis, local abscess, or diffuse peritonitis, and those contraindicated for general anesthesia were excluded from the study . We prepared the homemade glove port with a size 6 latex sterile surgical glove (ansell, melaka, malaysia), one flexible inner ring such as a sterilized plastic bangle (inner diameter = 4.0 cm), and three pieces of the silicon tube (sejong medical, paju, gyeonggi - do, korea) (5 cm in length) that was used as the suction tube during the operation (inner diameter = 6 mm, outer diameter = 10 mm, figures 1a and b). The flexible inner ring was placed within the wrist portion of the glove fold and rolled up to three or four times, and fixed with 2 - 0 dermalon (ethicone, nj, usa) sutures in three directions . Three silcon tubes of 5 cm length were placed into the third, fourth, and fifth fingers of the glove by 1 - 0 silk ties (ethicon, nj, usa). The thumb of the glove was connected with carbon dioxide gas insufflator by 1 - 0 silk ties . The index finger was used for specimen removal with lapbag (sejong medical, paju, gyeonggi - do, korea) or keeping a specimen when lapbag was not used . A surgical glove was attached to three pieces of silicon tube (a) silicone tube used as suction tube (b) standard 5-mm laparoscopic equipment such as 30-degree angle telescope (stryker, mi, usa) and straight rigid instrument identical to those used in conventional laparoscopy (including babcock clamp (covidien, cn, usa), grasper (covidien, cn, usa), scissors (covidien, cn, usa), and electrocautery (covidien, cn, usa)) were used to perform our sila [figure 2]. Each patient was placed in the supine position under general anesthesia . Using the open incision method, the homemade glove port with three silicon tube channels [figures 1a and b] was placed into the defect created in the abdominal wall . The telescope was introduced through a silicon tube channel that was placed in the fourth glove finger, and the peritoneal cavity was examined . Once the appendix was identified and isolated, the mesoappendix was dissected and cauterized using bipolar diathermy . The diameter of the rigid laparoscopic instruments was smaller than the silicon tube channel's inner diameter . We solved this by holding silicon tube channels with kelly clamps (aesculap, tuttlingen, germany) [figure 3]. The appendiceal base was ligated with one application of vicryl endo - loop (sejong medical, paju, gyeonggi - do, korea). The appendix was retrieved via the umbilical port site with or without lapbag (sejong medical, paju, gyeonggi - do, korea) [figure 4]. If there was any difficulty in some cases, additional port was placed in the right lower quadrant abdomen and then the drain was inserted at the end of sila . After removing the glove port, the umbilical fascia was closed with 2 - 0 vicryl suture (covidien, cn, usa). The subcutaneous layer was sutured with 4 - 0 monocryl suture (covidien, cn, usa). The umbilical skin was approximated with steri - strips (3 m, saint paul, mn, usa). An umbilical dressing was applied using a piece of gauze packed into the umbilicus covered with an occlusive dressing . Cla was performed using 3-trocar techniques with a 11-mm infraumbilical trocar (sejong medical, paju, gyeonggi - do, korea) placed by the hasson open technique, and two additional 5-mm torcars (sejong medical, paju, gyeonggi - do, korea) were placed in the suprapubic area and the right lower quadrant abdomen . Lapbag (sejong medical, paju, gyeonggi - do, korea) was used in all the cla cases . An appendix was in the index finger of glove; gas insufflators connected with thumb of glove, and kelly clamp used to prevent gas leakage appendix removed through glove port without lapbag continuous variables were compared using independent sample and two - tailed student t test . We prepared the homemade glove port with a size 6 latex sterile surgical glove (ansell, melaka, malaysia), one flexible inner ring such as a sterilized plastic bangle (inner diameter = 4.0 cm), and three pieces of the silicon tube (sejong medical, paju, gyeonggi - do, korea) (5 cm in length) that was used as the suction tube during the operation (inner diameter = 6 mm, outer diameter = 10 mm, figures 1a and b). The flexible inner ring was placed within the wrist portion of the glove fold and rolled up to three or four times, and fixed with 2 - 0 dermalon (ethicone, nj, usa) sutures in three directions . Three silcon tubes of 5 cm length were placed into the third, fourth, and fifth fingers of the glove by 1 - 0 silk ties (ethicon, nj, usa). The thumb of the glove was connected with carbon dioxide gas insufflator by 1 - 0 silk ties . The index finger was used for specimen removal with lapbag (sejong medical, paju, gyeonggi - do, korea) or keeping a specimen when lapbag was not used . A surgical glove was attached to three pieces of silicon tube (a) silicone tube used as suction tube (b) standard 5-mm laparoscopic equipment such as 30-degree angle telescope (stryker, mi, usa) and straight rigid instrument identical to those used in conventional laparoscopy (including babcock clamp (covidien, cn, usa), grasper (covidien, cn, usa), scissors (covidien, cn, usa), and electrocautery (covidien, cn, usa)) were used to perform our sila [figure 2]. Each patient was placed in the supine position under general anesthesia . Using the open incision method, a vertical incision through the center umbilicus measuring 2 - 2.5 cm was made . The homemade glove port with three silicon tube channels [figures 1a and b] was placed into the defect created in the abdominal wall . The telescope was introduced through a silicon tube channel that was placed in the fourth glove finger, and the peritoneal cavity was examined . Once the appendix was identified and isolated, the mesoappendix was dissected and cauterized using bipolar diathermy . The diameter of the rigid laparoscopic instruments was smaller than the silicon tube channel's inner diameter . We solved this by holding silicon tube channels with kelly clamps (aesculap, tuttlingen, germany) [figure 3]. The appendiceal base was ligated with one application of vicryl endo - loop (sejong medical, paju, gyeonggi - do, korea). The appendix was retrieved via the umbilical port site with or without lapbag (sejong medical, paju, gyeonggi - do, korea) [figure 4]. The abdominal cavity was washed with saline . If there was any difficulty in some cases, additional port was placed in the right lower quadrant abdomen and then the drain was inserted at the end of sila . After removing the glove port, the umbilical fascia was closed with 2 - 0 vicryl suture (covidien, cn, usa). The subcutaneous layer was sutured with 4 - 0 monocryl suture (covidien, cn, usa). The umbilical skin was approximated with steri - strips (3 m, saint paul, mn, usa). An umbilical dressing was applied using a piece of gauze packed into the umbilicus covered with an occlusive dressing . Cla was performed using 3-trocar techniques with a 11-mm infraumbilical trocar (sejong medical, paju, gyeonggi - do, korea) placed by the hasson open technique, and two additional 5-mm torcars (sejong medical, paju, gyeonggi - do, korea) were placed in the suprapubic area and the right lower quadrant abdomen . Lapbag (sejong medical, paju, gyeonggi - do, korea) was used in all the cla cases . An appendix was in the index finger of glove; gas insufflators connected with thumb of glove, and kelly clamp used to prevent gas leakage appendix removed through glove port without lapbag a total of 37 patients underwent sila from february 2014 to june 2014 . By the same surgical team there was no significant difference in the mean age (29.4 years vs 37.2 years, p = 0.235), weight (59.1 kg vs 61.4 kg, p = 0.489), or body mass index (bmi) (21.1 vs 22.5, p = 0.569) between the two groups . In the sila group, pathologic examinations revealed 29 (72.3%) cases with acute suppurative appendicitis and eight (27.7%) cases with acute gangrenous appendicitis . In the cla group, 47 (82.4%) patients had acute suppurative appendicitis and 10 (17.6%) patients had acute gangrenous appendicitis (p = 0.122). There was no significant difference in the mean operative time (43.68 min vs 51.08 min, p = 0.403). There were 10 (27.0%) cases who needed placement of additional port and drain in the sila group . Lapbag (sejong medical, paju, gyeonggi - do, korea) for retrieving the appendix was used in 12 (32.4%) cases in the sila group and in all (100%) cases in the cla group (p = 0.000). The mean hospital stay was significantly (p = 0.018) shorter in the sila group than in the cla group (3.46 days vs 4.16 days). In both groups, there was no intraoperative complication in the early or late periods . In the sila group, there was one (3.0%) postoperative complication with umbilical surgical site infection, which was treated at an outpatient setting as a superficial wound infection . The rate of complication was not significantly (p = 0.539) different between the two groups [table 1]. Laparoscopic appendectomy is a widely performed procedure due to its advantages in reducing postsurgical pain and decreasing operative trauma with quicker recovery, shorter hospital stay, and improved cosmesis . Single - incision laparoscopic surgery (sils) could potentially bring out more advantages of the laparoscopic surgery . Usually, many surgeons accepted that sils would take longer operative time and need specialized, flexible, and curved devices . There are several commercially available devices such as sils port (covidien, norwalk, cn, usa), uni - x (pnavel systems inc ., morganville, nj, usa), r - port (advanced surgical concepts, wicklow, united kingdom), and curved or articulating instruments . These instruments have contributed to the expansion of sils in various surgical areas . However, using them has increased the cost of surgery . To provide the benefits of sils with low health - care cost, some surgeons have tried sila using the conventional rigid instruments and noncommercial sils ports . Reflecting this trend, we made our homemade glove port that required a size 6 sterile surgical glove, 2 - 0 dermalon (ethicone, nj, usa), and three pieces of silicon tube . Our sila was performed with standard rigid laparoscopic instruments and a 30-degree 5-mm telescope . In this study, the demographics, operation time, pathologic diagnosis, and complication rate in the two groups were not significantly different . Patients in the sila group had a significantly shorter (p = 0.018) length of hospital stay than those in the cla group (3.46 days vs 4.16 days). The length of hospital stay of both the groups is longer than that observed in other countries as the health - care cost for hospitalization is very low in korea . We used the same postoperative treatments and same policy of discharge for both the groups . Therefore, the difference in the length of hospital stay might be associated with different rates of drain insertion in the spla and the cla groups (27.0% vs 57.8%, p = 0.003). Our policy for drain insertion comprise dirty fluid collection in the abdominopelvic cavity, phlegmonous appendicitis, and any case that is considered delayed bleeding because we used bipolar diathermy for dissection and cauterization instead of energy devices to decrease health - care costs . Those patients with complicated appendicitis were excluded from the study because they needed delicate tissue handling, precise dissection, detailed washing inside the abdominal cavity, and longer operation time . We also excluded such cases in the cla group for relatively accurate comparisons . During our sila, the appendix was retrieved via the umbilical incision site without using lapbag (sejong medical, paju, gyeonggi - do, korea). We did not observe any postoperative intra - abdominal complication in the early or late periods (at least 3 months follow - up). If any case in the sila group or if any part of specimen in the abdominal cavity was likely to be left due to its relatively big size than umbilical incision and friable appendix with severe inflammation, we used lapbag (sejong medical, paju, gyeonggi - do, korea) to retrieve the appendix in the sila group (32.4%). In the cla group, all the appendices were removed by using lapbag (sejong medical, paju, gyeonggi - do, korea). Performing sils by these technical modifications is associated with its own set of disadvantages such as leakage of carbon dioxide, sword fighting of instruments, chopstick effect, lack of triangulation, retrieval of specimen, and swiss cheese hernia . We used kelly forceps (aesculap, tuttlingen, germany) to occlude a small space between the silicon tube and the laparoscopic instruments to prevent gas leakage ., there was a very steep learning curve during the short time to successfully execute the critical steps of sila . This may be due to the fact that appendectomy itself is not a complex procedure, and that the authors already have a lot of experience in laparoscopic surgery . The biggest advantage of our homemade glove port and our procedure is that it is extremely cheaper than the other commercial devices . Our homemade port is easy to make and does not affect the patient's health - care cost like the other sils devices . We also helped decrease the patient's health - care cost by not using lapbag (sejong medical, paju, gyeonggi - do, korea) when the appendix was retrieved via the glove port without complications . However, recently reported meta - analysis revealed similar pain scores between the sila group and the conventionally treated groups . In conclusion, this study demonstrated that sila, using homemade glove port, is technically feasible and safe at a low cost . However, we do not want to force the use of our homemade glove port in sils because commercially available ports for sils have more advantages and safeties.
South east asia is home to one - third of the global burden of tuberculosis (tb), with an estimated 5 million prevalent cases and an annual incidence of 3 million tb cases . Five of the 11 countries in the region are among the 22 high - burden countries, with india accounting for over 20% of the global burden of tb disease [1, 2]. Using the current strategy of passive case finding, the case detection rate in the region has improved from around 40% in 2002 to 65% in 2008 . However, it has stagnated since 2006 and remains below the target of more than 70% . A lower than expected case detection rate indicates that tb cases in the community are not being adequately identified and treated, which means ongoing transmission of tb infection . The risk of transmission increases with the closeness of contact, overcrowded living conditions, and the degree of infectiousness of a tb case as determined by the positivity of sputum smear microscopy of acid - fast bacilli (afb) and degree of lung field involvement in the chest x - ray (cxr) [5, 6]. Close contacts to a tb case such as those living in the same household are at higher risk of infection than casual contacts . Among those that are infected, young children (<5 years) or those with immunodeficiency (e.g., hiv infected) are at increased risk of developing tb disease, usually within two years following infection . Therefore, the world health organization (who), the international union against tuberculosis and lung diseases (iuatld) and the national tb control programs (ntps) recommend screening of all children who are household contacts of sputum smear - positive tb case . Screening and management of child contacts has great potential to reduce tb - related morbidity and mortality in children [4, 9]. It also can identify contacts of any age with suspected tb disease at an earlier stage than they otherwise may have presented to health care services . It, therefore, has the potential to increase case finding and reduce transmission . Finally, though the contribution of young children to transmission may be small, they may form a pool of infection from which future adult cases arise [11, 12]. Despite the benefits, contact investigation for child contacts is rarely implemented and reported in resource - limited tb endemic settings, such as in the south east asia . This paper aims to collate published data reporting the prevalence of tb infection and tb disease among child household contacts of tb in the south east asia region . The search strategies were developed using a combination of subject headings and keywords, including tuberculosis, mycobacterium tuberculosis, contact tracing, contact investigation, contact screening, household contact, the primary studies were searched electronically using databases pubmed, embase, and web of science . Manual searching of the reference lists of the primary studies was performed to identify other eligible studies . Published studies were included if they included children and adolescents (015 years), reported the yield of household contact investigation in children or provided data to calculate the prevalence of tb infection or tb disease in children, and were conducted in countries in the south east asia region . The data extracted included the following information: study site, design, description of index cases, description of household contacts, definition of household contacts, investigations performed (tuberculin skin test (tst), cxr, sputum smear microscopy of afb, and culture of mycobacterium tuberculosis), outcomes among child contacts (healthy, tb infection, or tb disease), and the criteria used to determine the outcomes . There have been systematic reviews and a meta - analysis on contact investigation of tb, but none specifically assessed the yield from household contact investigation among children in the south east asia region [13, 14]. Eleven eligible studies were conducted in seven countries in south east asia: india (four studies) [1518], thailand (two studies) [19, 20], and one study each from cambodia, indonesia, lao people's democratic republic, pakistan, and philippines . Not all of the studies evaluated the prevalence of both tb infection and tb disease: five studies provided data on both; five studies evaluated the prevalence of tb infection only and one study of tb disease only . There was heterogeneity among studies with regards to epidemiology background, study design, the characteristics of the index case and child contact, and the criteria used for determining tb infection and tb disease (table 1). Most studies were cross - sectional in design, and only one study conducted in india in 1960s performed a prospective followup for a period of 5 years . The index case in most studies was a case of sputum smear - positive pulmonary tb (ptb). The study from indonesia evaluated household contacts of an index case with sputum smear - negative ptb, and two studies in india included sputum smear - positive and smear - negative cases with abnormal cxr [15, 16]. With regard to child contacts, three studies involved children under five only [15, 21, 22], the others included older children up to 1418 years of age [1620, 2325]. There was no uniform definition of a household contact across the studies, but the most common definition was a child living in the same house as the index case . Four studies specified a period of at least 3 months of living at the same house to define household contacts [19, 22, 24, 25]. A study in india defined close contact as living, cooking, and eating in the same house as the index case for the period of three months immediately preceding the start of treatment for the index case . All studies which provided data on tb infection defined it as a positive tst, evaluated 4872 after administration of tuberculin solution . Four studies used a cutoff of 10 mm, whereas the philippines study used 5 mm and the thailand study used 15 mm . The study from indonesia used the local scoring system, whereas most other studies used clinical and radiological features . The number of child contacts investigated in the studies ranged from 61 to 790 children of 50 to 342 index cases . In general, the prevalence of tb infection among child contacts under 15 years of age was higher (24.469.2%) than that of active tb disease (3.35.5%). Tb disease was more commonly found among children aged less than 5 years, whereas tb infection was more common in older children (table 2). The results of household contact investigation across the eligible studies cannot be compared directly due to the heterogeneity, particularly in outcome definitions (tb disease or tb infection). Figure 1 presents the yield of tb infection from studies which used a cutoff of 10 mm of tst result for tb infection among sputum smear - positive index cases . It is shown that tb infection is more common in children aged more than 5 years . The prevalence of infection in all children ranged from 24.4% to 38.8%, with a weighted yield of 31% . The prevalence of tb infection and disease among children living in the same house as a case of pulmonary tb in south east asia varies between settings . This variation may be due to the different epidemiology features amongst the countries or to the heterogeneity among studies with regards to the characteristics of the index case and the criteria used for determining tb infection and disease . Nonetheless, tb infection among child contacts was common and would support recommendations for routine screening and management of child household contacts . The finding that tb disease is more prevalent among young children (<5 years) is as expected given that young age is a well - established risk factor for disease following infection . Various approaches and criteria were used to assess the outcome of contact investigation, indicating that there has not been a universal method accepted or implemented in south east asia . For example, the study in the philippines used a cut - off point of 5 mm induration to define positive tst, which is lower than the recommended 10 mm in a bcg - vaccinated population . The use of the cutoff may explain why this group reported the highest prevalence (67.2%) of tb infection amongst the studies . For studies which defined a positive tst as 10 mm induration, the proportion of tb infection ranged from 24% to 48% [6, 15, 22, 24, 2731]. A meta - analysis of contact investigation in low- and middle - income countries by morrison and colleagues revealed a prevalence of tb infection of 40% in children aged under 15 years . Despite the evidence of high rates of infection and disease in child contacts in south east asia, screening a cross - sectional study in india reported that only 31 of 220 (14%) children younger than 14 years living in the same house as adults with pulmonary tb were screened for tb . A higher yield of 52% was reported by tornee and co - workers in a prospective study in thailand . . The potential of contact screening upon identification of an infectious case in the community is emphasised by a recent study from south africa which reported that most cases of young children with confirmed tb represented a missed prior opportunity for preventive therapy . Isoniazid preventive therapy (ipt) which has proven efficacy in preventing tb disease in infected and uninfected child contacts is recommended for child contacts <5 years of age who have no evidence of tb disease [8, 34, 35]. A study in india reported that, of 84 child contacts aged younger than 6 years, only 16 (19%) were initiated on ipt . In malawi, of 365 child household contacts under five, only 33 (9%) were actually screened for tb: 23 (6%) received ipt, 6 (2%) received anti - tb treatment, and, in 4 (1%), no action was taken . When ipt is prescribed, poor adherence is another problem that is likely to reduce the effectiveness of this intervention . Adherence rates of 15 to 28% have been reported from south africa [38, 39]. A reason for the poor implementation of contact investigation and ipt provision in resource - limited countries is likely to be the lack of human resources . Health workers in tb endemic areas are overburdened by the identification and management of sputum smear - positive cases, which are the priority for treatment in any national tb programs . In addition, the awareness and knowledge of families and healthcare workers of the rationale and potential of ipt are lacking [33, 40]. In malawi, only 21% of tb patients who had child contacts aged 5 years or below were informed about the need for screening their children . A more recent study in malawi in 2006 reported that only 8% of sputum smear - positive cases brought their children to the clinic for screening despite provision of clear information . Guidelines that are difficult to implement may also be a barrier for the implementation of contact investigation . As long as tst and cxr remain mandatory tests for screening, coverage in resource - limited settings cannot be expected to improve, and its impact on tb control is likely to be limited . Tst and cxr are not readily available in primary health clinics in the region, where index cases are commonly identified and treated . These tests are usually performed at main hospitals located in cities, which increases transport and time costs . The use and interpretation of tst are also problematic: unaffordable for most families in resource - limited setting; require skill to perform, and a second hospital visit is necessary . A more simple, cheap, feasible, efficient and patient - friendly method is required . The current who guideline of symptom - based screening recommends symptom evaluation alone to decide whether the contact requires further investigation for tb disease or can be prescribed ipt directly . Asymptomatic child contacts aged less than 5 years can be provided ipt without further investigation . If tb is suspected at initial assessment or at subsequent followup, further investigation should be performed to establish or exclude a diagnosis of tb disease . Referral to a district or tertiary hospital may be necessary when there are uncertainties about the diagnosis . A limitation of this systematic review is that it only includes published studies reported in english . More precise yields from contact investigation among child household contacts in the south east asia would have been gained if unpublished studies and the grey literature such as reports from ntps of each country were included . Contact investigation studies in south east asia indicate the potential of screening and ipt to reduce the risk of tb disease in child contacts, yet it is rarely implemented . Research is required to determine patient and health service barriers to screening to enable targeted effective intervention programs to be developed . One such research strategy could include a qualitative review of problems around the implementation of contact investigation and ipt provision for child contacts in the region . This will provide valuable information for the design of community - based interventions to improve the management of child contacts.
Tetralogy of fallot (tof) is a cyanotic congenital cardiac defect characterized by pulmonary outflow tract stenosis or obstruction, ventricular septal defect (vsd), overriding aortic root, and right ventricular hypertrophy.1 left without surgical correction, the overall survival was poor and over 90% of the patients die by 40 years of age.2,3 there are some subsets of tof patients with advanced chronic kidney disease (ckd); however, the association between tof and renal failure severe enough to require dialysis treatment has been rarely reported in the literature.4,5 in this report, we describe the case of an end - stage kidney disease patient with tof . We also discuss the complex processes of how and why peritoneal dialysis (pd) was selected as a mode of chronic renal replacement therapy in this case . A 33-year - old female with tof managed by palliative surgery was admitted to our hospital with complaints of general fatigue and appetite loss at the end of december 2013 . Taussig shunt at 2 years of age and palliative right ventricular outflow tract reconstruction, which is a procedure used to enlarge the ventricular outflow tract and main pulmonary artery, without inducing the closure of the concurrent vsd,6 at 4 years of age . There was no known family history of congenital cardiac disease . At 24 years of age, the patient s serum creatinine (scr) levels were increased at approximately 1.3 mg / dl, and her scr levels thereafter continued to increase gradually, but slowly . In 2012, at 32 years of age, she became hypertensive, and her scr levels were approximately 3.1 to 3.4 mg / dl with 3 + for urine protein when the additional surgical correction for closure of the vsd was planned . She was then referred to our hospital . According to the clinical pictures and renal sonographic findings, which showed decreases in the renal long axis dimensions (right: 80 mm, left: 85 mm) with grade ii renal cortex echogenicity, the patient was diagnosed with ckd7 and subjected to contemporary and comprehensive renal care . Despite the successful control of her blood pressure to the ranges of 130140/7080 mmhg with losartan potassium and azelnidipine, her renal function steadily worsened during the last year, and she finally became aware of the symptoms at the end of december 2013 when her scr and blood urea nitrogen (bun) levels elevated up to 8.25 and 99 mg / dl, respectively . As a result, she was admitted for further workup . A physical examination completed on the patient s blood pressure was 134/59 mmhg, her pulse was 78 beats / minute, and her temperature was 37.0 c . Although the patient s oxygen saturation was 85% while she breathed ambient air, a chest x - ray film demonstrated neither an accumulation of fluid nor a sign of pulmonary infiltrates . A laboratory evaluation revealed the following results: white blood cell count, 9,000/l; red blood cell count, 407 10/l; hemoglobin (hb), 12.1 g / dl; hematocrit, 36.4%; platelet count, 19.5 10/l; bun, 111 mg / dl; scr, 8.03 mg / dl; total protein, 7.7 g / dl; albumin, 4.7 g / dl; sodium, 139 mmol / l; potassium (k), 5.3 mmol / l; chloride, 108 mmol / l; calcium (ca), 10.5 mg / dl; phosphorus (pi), 7.2 mg / dl; aspartate aminotransferase, 13 u / l; alanine aminotransferase, 12 u / l; c - reactive protein, 0.02 mg / dl; and brain natriuretic peptide, 55.4 pg / ml . Her urine was 3 + for protein and + for occult blood and contained 1.3 g of protein in a 24-hour specimen, while the patient s creatinine clearance was 5.02 ml / minute . Transthoracic echocardiography disclosed a perimembranous vsd (maximum diameter of 21 mm), a bidirectional shunt with left - to - right shunting (2.55 m / second) predominance, and well contracting left ventricle (lv) with an lv ejection fraction of 63.8% (fig . 1a), while chest computed tomography (ct) scans demonstrated right pulmonary artery stenosis (fig . The patient was subjected to a transient session of hemodialysis (hd) treatment with repeated femoral vein puncture8 between hospital days 2 and 14, during which time she began to feel well along with the decline in her scr level . Finally, a tenckhoff pd catheter was placed on hospital day 17 through a classic transverse surgical incision with a favorable postoperative course . Pd using two daily exchanges (1.5 l of midperiq135 2, terumo co ..) with a total dwell of 12 hours was then initiated (fig ., the patient is still doing well with a daily urine output of approximately 1,100 to 1,300 ml . Considering the current therapeutic guidance for pd adequacy,9 her solute clearance status expressed in terms of kt / vurea, where k is the clearance of urea, t is the treatment duration, and v is the urea distribution volume,10 also appears to be favorable (a total kt / vurea: 1.9 [peritoneal kt / vurea: 0.8, residual renal kt / vurea: 1.1]). Along with the decline in the mortality of patients with congenital heart diseases, it has become clear that various types of disturbed physiologies occur beyond the cardiovascular system.5,11 chronic renal insufficiency is one such late complication, and it may also be common even in adult subjects after obtaining the palliation of previous tof.5,11 several morphological alterations, including glomerular enlargement, mesangial hypercellularity, glomerular capillary congestion, and segmental glomerular sclerosis, have been focused on as pathologic bases of the disease.5,12,13 in the current patient, the absence of any pathological information precluded us from precisely evaluating the cause of end - stage kidney disease . However, we believe that numerous conditions, including previous surgical palliation and long - standing cyanotic conditions, could play a role in the establishment of her renal manifestations.5,11 alternatively, or in addition, the long - term use of various analgesics for relieving menstrual pain and a tension headache, which was revealed by our thorough clinical interview, might have played a role in our patient through their nephrotoxic nature.14 thus, the combination of tof and ckd may not be surprising; however, the clinical significance of the current patient should be evaluated carefully in terms of the impact of the circulation disturbance due to cardiac anomaly on the therapeutic managements for end - stage kidney disease, including the choice of dialysis modality . For many patients with end - stage kidney disease, a renal transplant is the treatment of choice as it replicates the standard renal physiology much more closely than dialysis treatments and offers an improved quality of life as well as survival benefits.15,16 despite the high risk of cardiac death before and after renal transplantation,17 patients with cardiac disease or who are at high risk for cardiac disorders are still eligible for this procedure.18 moreover, it has been stated that patients with severe irreversible heart dysfunction should not be listed for kidney transplantation alone, while there may be select patients who are candidates for combined heart kidney transplants.18 the scarce information regarding renal transplantation among patients with unrepaired congenital heart disease precludes us from precisely evaluating the validity of such a strategy in the current case; however, the lack of readily available cadaveric or living renal transplantation in a timely manner, which leaves many subjects requiring dialysis,15,16 obliged us to start dialysis treatment . Considering the pathophysiologic characteristics of tof,1,19,20 we felt that avoiding the use of dialysis catheters as a means of either temporary or permanent vascular access for hd and the execution of periodic hd with peripheral vascular access should be mandatory in the current patient . Indeed, these devices may predispose patients with tof to the detrimental pathologies such as pulmonary embolism, septicemia, infectious endocarditis, and paradoxical embolism,2127 although the available literature has seldom discussed pulmonary embolism in patients with tof.28 we must also recognize that in patients with an intrinsic cardiac anomaly, the creation of peripheral vascular access may result in severe cardiac failure.29 otherwise, it should be noted that bacteremia is less frequent in pd patients than in chronic hd patients with endovascular catheter, and no reports on infectious endocarditis in pd patients were available, despite the fact that septicemia is not exceptional in pd subjects30,31; therefore, pd does not appear to be an additional risk of infectious endocarditis among patients with end - stage kidney disease.31 alternatively, or in addition, the therapeutic nature of pd, including minimal variation in the intravascular volume status, reduction in cardiovascular stress, avoidance of peaks and troughs in uremic toxins, arrhythmia prevention, and the better preservation of residual renal function,10,32,33 also encouraged us to promote the procedure as a good modality of renal replacement therapy for the current patient . One may argue against our concerns about the potential risks associated with a dialysis catheter and hd . Moreover, no one knows the impact of starting hd with repeated femoral vein puncturing for a transient vascular access on the risks of the concurrent development of thromboembolic and/or infectious events.8 nevertheless, it is necessary to take a proactive approach and not let lethal events become apparent . We believe that our policy regarding the application of tailored renal replacement therapy should be an appropriate therapeutic choice for the current patient . Apparently, we are always facing, as do most physicians at various times, different types of clinical challenges, as described herein . There may be substantial variation in the type and intensity of managements provided to end - stage kidney disease patients with congenital heart disease, stemming from the uncertainty of the advantages and disadvantages of renal care in this population . A lack of prospective data suggests that numerous therapeutic decisions among such subjects are potentially empirical . Indeed, only a few anecdotal reports describing patients with tof who began dialysis treatments during the observation periods for the disease are available.4,34,35 pd with reduced dialysate exchanges may be less advantageous than full - dose pd in terms of ultrafiltration and dialytic clearance, while such a pd protocol may permit early incremental dialysis and provide favorable clinical significance.33,36,37 at present, our patient appears to tolerate the pd program well with two daily dialysate exchanges; however, the validity of our strategy should be determined only when more experience with additional cases similar to ours has been accumulated . Thus, the establishment of an optimal management program for end - stage kidney disease patients with congenital heart disease should be a matter requiring continuous and careful attention.
A 45-year - old man with a lifelong history of atopic dermatitis had a year - long unremitting exacerbation for which he had started systemic therapy . After treatment with cyclosporine for several weeks, laboratory abnormalities and nonspecific neurologic signs prompted a switch to methotrexate . Within 4 weeks, he was hospitalized (in an overseas us military hospital) for generalized umbilicated papulopustules accompanied by profound hypothermia, hypotension, and mental status changes . He had large pustules on his trunk, inner thighs, and upper extremities (figure 1, panel a). He was transferred to our intensive care unit with widespread umbilicated pustules and normal mental status . The pustules were deep seated, monomorphic, dome shaped, and firm and were distributed densely on the patient s forearms and abdomen (figure 1, panels b and c). Clinical photographs of the patient . A) patient with generalized pustules, which were deep seated, monomorphic, dome shaped, and firm and were distributed densely on forearms and abdomen . C) umbilicated papulopustules in the same stage of evolution; no herpetiform clusters or red areolae are seen around the lesions . At our hospital, his oral temperature fluctuated dramatically, from 89.3f to 101.3f, with rectal confirmation <95f (<35c), indicating hypothermia (5). We performed a tzanck preparation, which showed multinucleated giant keratinocytes with nuclear molding and margination (appendix figure). A direct fluorescent antibody (dfa) test was positive for varicella zoster virus (vzv). A biopsy specimen showed epithelial necrosis with cellular ballooning and multinucleated giant cells, plus intranuclear inclusion bodies (figure 2, panels a and b). Subsequently, special immunohistochemical stains were positive for herpes simplex virus (hsv) (figure 2, panel c), and a viral culture grew hsv type 2 . His illness was diagnosed with disseminated hsv concurrent with underlying atopic dermatitis (i.e., eczema herpeticum). C) positive immunohistochemical stain for herpes simplex virus . Within minutes of the tzanck smear evaluation, our patient was given intravenous acyclovir . When cutaneous improvement was evident, he was switched to oral valacyclovir . Within days, his skin lesions largely resolved without conspicuous crusting or scarring, but he remained intermittently hypothermic for several weeks . This patient was markedly ill on admission and had a distinctive varioliform eruption with lesions in a uniform stage of evolution . Tzanck preparation promptly confirmed herpetic etiology, but we nevertheless used cdc s algorithm for evaluating agvpri, and our patient s illness stratified to high risk . Cdc has 3 major diagnostic criteria to designate a case as high risk for smallpox (table) (6). The first is febrile prodrome, which typically lasts 14 days before cutaneous lesions appear and must include> 1 of the following: prostration, headache, backache, chills, vomiting, or severe abdominal pain . Although our patient s illness eventually met the fever criterion, his 101f temperature occurred only after he began antiviral treatment . Prolonged hypothermia is associated with severe illness (7) and is equivalent to fever in determining critical illness (8), which we believe satisfies cdc s first major criterion . The second criterion requires classic cutaneous lesions that are deep seated, firm, round, well - circumscribed vesicles or pustules that may become umbilicated or confluent . The third criterion requires the same stage for most cutaneous lesions on an affected area . Our patient s illness met all 3 criteria; however, laboratory tests confirmed herpesvirus infection . Smallpox was declared eradicated by the world health organization in 1977; nevertheless, some health organizations consider this illness a bioterrorism threat . Clinical smallpox typically starts with a prodrome of high fever, headache, myalgia, backache, nausea, vomiting, and diarrhea . An oropharyngeal enanthem is followed by cutaneous eruption of erythematous macules that quickly become papules . The papules evolve over days into vesicles and then pustules, often developing central umbilication . Classic smallpox lesions occur in the same stage of evolution on a body segment, which differentiates it from varicella . Smallpox pustules have been called pearls of pus to help distinguish them from the more delicate histopathologically, cutaneous smallpox lesions may resemble herpetic lesions except that smallpox has intracytoplasmic inclusions (guarnieri bodies) instead of intranuclear inclusions (lipschutz bodies) of herpetic lesions . Also, multinucleated giant keratinocytes are uncharacteristic of smallpox (9). Eczema herpeticum, described by kaposi in 1887, is most common in patients with atopic dermatitis but can occur in other conditions that disrupt epidermal integrity . In eczema herpeticum, lesions are typically monomorphic vesicles that evolve into pustules (10). Fever, malaise, lymphadenopathy, and tender skin may accompany cutaneous eruption (11). Fever is a well - recognized sign of infection; however, hypothermia can also signal serious disease, including bacterial sepsis or viral encephalitis (12), and may be more dire than fever in severely ill hospitalized patients (13). We propose that our patient s hypothermic temperature dysregulation is equivalent to fever, thus serving as a major diagnostic criterion . When a patient with agvpri is evaluated for possible smallpox, rapid laboratory tests are necessary . Viral culture does not yield results quickly enough to avert infection control measures expected with a smallpox case . Indeed, cdc reports 7 incidents when patients with agvpri prompted emergency department diversions or hospital closures (1). Also, rapid confirmation of nonvariola etiology can help avert public panic, a potential problem in a suspected smallpox outbreak and a probable intended consequence of a terrorist attack . The tzanck smear must be performed by someone experienced in using the technique and interpreted by someone who can confidently and correctly distinguish herpesvivus nuclear inclusions from poxvirus cytoplasmic inclusions . Dfa for hsv and vzv is relatively rapid, but in our case, the dfa result was positive for vzv, although viral culture and immunohistochemical staining later showed that the patient s infection was due to hsv-2 . Had we been unable to confirm a nonvariola etiology, we would have proceeded to poxvirus testing . With no commercially available tests for smallpox, the algorithm advises close coordination among local, state, and federal public health authorities . Some state and federal reference laboratories can provide confirmatory tests, including pcr, for orthopoxviruses such as smallpox and monkeypox . Although not performed in this case, we recommend such testing if a simultaneous infection with an orthopoxvirus cannot be ruled out.
Cytokines are mediators of information transfer between cells, and in this way, they regulate physiological and pathological mechanisms in the body . They are potentially of use in diagnosis . As a result of its function during inflammatory processes and regeneration, interleukin-6 (il-6) it is produced by lymphoid cells and by a variety of non - lymphoid cells, including endothelial cells, epithelial cells and fibroblasts (kishimoto et al . For example, tumour necrosis factor-, interleukin-1 and catecholamines stimulate the synthesis of il-6, whereas glucocorticoids suppress it (papanicolaou et al . The target cells of il-6 are lymphoid cells and other cells such as hepatocytes and bone marrow cells (barton 1997; papanicolaou et al . 1998). Il-6 acts on its target cells via different transduction pathways, including those that involve protein kinase c, camp / protein kinase a and the calcium release pathway (kamimura et al . Release of il-6 occurs in cases of infection, trauma and neoplasia, and its functions range from induction of acute - phase proteins to cell growth and differentiation (jakab and kalabay 1998; barrientos et al . A role is described for il-6, for example, in different autoimmune and inflammatory diseases . In addition, il-6 appears to have a function in different diseases of bones and liver (linker - israeli et al . In hepatic diseases of humans, increased serum concentrations of il-6 have been found in cases of hepatitis, hepatic tumours and regeneration of the liver after different insults (lacour et al . Given its function in different disease mechanisms, il-6 could be an important parameter in clinical pathology to describe the aetiology, severity and course of diseases, and to determine the prognosis . In this study, the serum concentration of il-6 was measured in dogs with different diseases of the liver . The aim was to investigate the association of different liver diseases and the serum concentration of il-6 . Furthermore, the presence of a correlation between the degree of liver disease and the serum concentration of il-6 was investigated . Finally, the serum concentration of il-6 associated with hepatic disease was compared with that in cases of extra - hepatic inflammatory disease, tumours and metabolic diseases . The diagnosis of liver disease was based on the anamnesis, the clinical investigation, clinical pathological examination [alanine transferase (alt); aspartate transferase (ast); glutamate dehydrogenase (gldh); alkaline phosphatase (alp); fasting bile acids (ba); bilirubin (bili) and albumin (alb)], ultrasound investigation and histopathological diagnosis from a biopsy . The definitive diagnosis was based on the histological investigation, and the disease was classified according to the recommendations of the world small animal veterinary association (wsava liver standardization group 2006). The il-6 values of these dogs were compared with those of 18 clinically healthy dogs . These dogs were presented for vaccination and other routine examinations and had no abnormalities in anamnesis, clinical investigation, clinical biochemistry (alt, ast, gldh, alp, ba, alb, bili, creatinine, urea, phosphorus, calcium and glucose) and haematology (e.g. White blood cells, packed cell volume). Furthermore, no abnormalities were found in the liver during ultrasound investigation of these dogs . Both groups were compared with a group of 30 dogs with extra - hepatic diseases . Ten dogs of this group had diabetes mellitus, ten dogs had extra - hepatic inflammation and ten dogs had an extra - hepatic tumour . Blood samples were collected from the cephalic vein with a 22-g needle and were harvested in a plastic serum tube . The samples were kept at room temperature for 15 min to allow them to clot and were then centrifuged (10 min, 3,000g). Analysis of alt, ast, gldh, alp, fasting ba, bili and alb was performed according to standardised procedures using an analyser (konelab, thermo fisher scientific) and commercial kits . The serum samples were stored for no longer than 3 months before measurements were made . The concentration of il-6 was measured using the canine il-6 duoset elisa (catalogue number dy1609; r&d systems, inc . ). The analysis included plate preparation and assay procedure and was performed according to the manufacturer s elisa protocol . Finally, the microtitre plate was read using a microtitre reader (slt spectra, tecan) at 450 nm (correction wavelength 540 nm). The livers were examined for size, shape and structure . Using a biopsy needle (true - cut, surgivet) and guided by ultrasound, the dogs were investigated under general anaesthesia (levomethadone, l - polamivet, intervet; xylazine, rompun, bayer; isoflurane, isoflurane, abbott). The histopathological diagnosis corresponded to the recommendations of the wsava liver standardization group (2006). Group 1 comprised clinically healthy dogs; group 2, dogs with acute hepatitis; group 3, chronic hepatitis of mild degree; group 4, chronic hepatitis of moderate degree; group 5, liver tumours; group 5a, primary liver tumours; group 5b, secondary liver tumours; group 6, extra - hepatic inflammation; group 7, extra - hepatic tumours and group 8, diabetes mellitus . The statistical analysis was performed with the programme sas system, univariate procedure, version 8.1 (sas institute inc . ). The level of significance was p <0.05 . The precision of the il-6 elisa was determined using three serum samples on which ten consecutive runs were performed during a single day . The day - to - day precision was determined using three serum samples that were evaluated once daily for 5 days . The diagnosis of liver disease was based on the anamnesis, the clinical investigation, clinical pathological examination [alanine transferase (alt); aspartate transferase (ast); glutamate dehydrogenase (gldh); alkaline phosphatase (alp); fasting bile acids (ba); bilirubin (bili) and albumin (alb)], ultrasound investigation and histopathological diagnosis from a biopsy . The definitive diagnosis was based on the histological investigation, and the disease was classified according to the recommendations of the world small animal veterinary association (wsava liver standardization group 2006). The il-6 values of these dogs were compared with those of 18 clinically healthy dogs . These dogs were presented for vaccination and other routine examinations and had no abnormalities in anamnesis, clinical investigation, clinical biochemistry (alt, ast, gldh, alp, ba, alb, bili, creatinine, urea, phosphorus, calcium and glucose) and haematology (e.g. White blood cells, packed cell volume). Furthermore, no abnormalities were found in the liver during ultrasound investigation of these dogs . Both groups were compared with a group of 30 dogs with extra - hepatic diseases . Ten dogs of this group had diabetes mellitus, ten dogs had extra - hepatic inflammation and ten dogs had an extra - hepatic tumour . Blood samples were collected from the cephalic vein with a 22-g needle and were harvested in a plastic serum tube . The samples were kept at room temperature for 15 min to allow them to clot and were then centrifuged (10 min, 3,000g). Analysis of alt, ast, gldh, alp, fasting ba, bili and alb was performed according to standardised procedures using an analyser (konelab, thermo fisher scientific) and commercial kits . The serum samples were stored for no longer than 3 months before measurements were made . The concentration of il-6 was measured using the canine il-6 duoset elisa (catalogue number dy1609; r&d systems, inc . ). The analysis included plate preparation and assay procedure and was performed according to the manufacturer s elisa protocol . Finally, the microtitre plate was read using a microtitre reader (slt spectra, tecan) at 450 nm (correction wavelength 540 nm). The livers were examined for size, shape and structure . Using a biopsy needle (true - cut, surgivet) and guided by ultrasound, three to four tissue samples were taken from each structural lesion for further examination . The tissue core specimens were 0.51.0 cm long and 2 mm thick . In some cases the dogs were investigated under general anaesthesia (levomethadone, l - polamivet, intervet; xylazine, rompun, bayer; isoflurane, isoflurane, abbott). The histopathological diagnosis corresponded to the recommendations of the wsava liver standardization group (2006). Group 1 comprised clinically healthy dogs; group 2, dogs with acute hepatitis; group 3, chronic hepatitis of mild degree; group 4, chronic hepatitis of moderate degree; group 5, liver tumours; group 5a, primary liver tumours; group 5b, secondary liver tumours; group 6, extra - hepatic inflammation; group 7, extra - hepatic tumours and group 8, diabetes mellitus . The statistical analysis was performed with the programme sas system, univariate procedure, version 8.1 (sas institute inc . ). The level of significance was p <0.05 . The precision of the il-6 elisa was determined using three serum samples on which ten consecutive runs were performed during a single day . The day - to - day precision was determined using three serum samples that were evaluated once daily for 5 days . The dogs with liver disease were divided into five groups, depending on their histopathological diagnoses . Six dogs had acute hepatitis, 13 dogs had chronic hepatitis and 16 dogs had a liver tumour . The six dogs with acute hepatitis could be divided into three cases of acute purulent hepatitis, one case of hepatitis associated with adenovirus infection, one case associated with parvovirus infection and one case associated with leptospirosis . The serum concentrations of il-6 in this group varied between 1 and 202 pg / ml, with an average of 102 pg / ml (fig . 1). Median, maximum and first and third quartiles of il-6 serum concentrations in groups 1 to 8 (group 1 = healthy controls, group 2 = acute hepatitis, group 3 = mild chronic hepatitis, group 4 = moderate chronic hepatitis, group 5 = liver tumours [group 5a = primary liver tumours, group 5b = secondary liver tumours], group 6 = extra - hepatic inflammation, group 7 = extra - hepatic tumours and group 8 = diabetes mellitus) minimum, median, maximum and first and third quartiles of il-6 serum concentrations in groups 1 to 8 (group 1 = healthy controls, group 2 = acute hepatitis, group 3 = mild chronic hepatitis, group 4 = moderate chronic hepatitis, group 5 = liver tumours [group 5a = primary liver tumours, group 5b = secondary liver tumours], group 6 = extra - hepatic inflammation, group 7 = extra - hepatic tumours and group 8 = diabetes mellitus) the group with chronic hepatitis consisted of 13 dogs, of which eight had a mild degree of hepatitis and five had a moderate degree . Reactive hepatitis, as a reaction of an extra - hepatic disease, was excluded by histopathology; those dogs were not considered in this study . The average concentration in this group was 25 pg / ml (fig . 1). In addition, two cases of haemangiosarcoma, two cases of fibrosarcoma and three cases of lymphoma were also included in the study . The range of il-6 concentrations in this group was from 3 to180 pg / ml, with an average concentration of 58 pg / ml (fig . 2). The average concentration of il-6 in dogs with a primary liver tumour (hepatocellular carcinoma, cholangiocellular carcinoma) was 31 pg / ml and that of dogs with secondary liver tumours (lymphoma, haemangiosarcoma, fibrosarcoma) was 91 pg / ml (fig . 3). Median, maximum and first and third quartiles of il-6 serum concentrations in groups 2 to 5 . Median, maximum and first and third quartiles of il-6 serum concentrations in groups 5a and 5b . Significant differences are indicated by an asterisk minimum, median, maximum and first and third quartiles of il-6 serum concentrations in groups 2 to 5 . Significant differences are indicated by asterisks minimum, median, maximum and first and third quartiles of il-6 serum concentrations in groups 5a and 5b . Significant differences are indicated by an asterisk we compared these data between the liver disease groups and also compared them with data from healthy controls . The serum concentrations of il-6 in dogs with different liver diseases were highly significantly (p <0.001) increased compared with those of clinically healthy dogs . The difference between acute and chronic hepatitis was also significant (p <0.05). On the other hand, there was no significant difference between dogs with mild and moderate chronic hepatitis (fig . 2). The serum concentrations of il-6 in dogs with different liver tumours were highly significantly increased compared with those of healthy dogs (p <0.001; fig . 1). Dogs with secondary liver tumours had significantly higher serum concentrations of il-6 than dogs with primary liver tumours (p <0.01; fig . 3). There was no significant difference between dogs with acute hepatitis and dogs with primary and secondary liver tumours (p> 0.05; fig . 2); however, the difference between dogs with chronic hepatitis and those with secondary liver tumours was highly significant (p <0.001). To detect differences in the serum concentration of il-6 between dogs with intra- and extra - hepatic inflammatory diseases or tumours, we compared the dogs with liver disease in this study with dogs that had extra - hepatic diseases . This group of dogs included ten dogs with an extra - hepatic inflammatory process; two dogs in this group had prostatitis and eight had pyometra . A further ten dogs with an extra - hepatic tumour were included in this comparison, comprising five cases of mammary carcinoma, three cases of splenic haemangiosarcoma, one case of bronchial carcinoma and one case of carcinoma of the stomach . Finally, all data were compared with those from a group of ten dogs with diabetes mellitus that had no inflammatory or neoplastic disease . No significant difference could be found between dogs with acute hepatitis and those with extra - hepatic inflammation (p> 0.05); in contrast, the serum concentrations of il-6 in dogs with chronic hepatitis were significantly lower than those in dogs with extra - hepatic inflammation (p <0.01). The serum concentration of il-6 in dogs with intra- or extra - hepatic tumours showed no significant difference (p> 0.05). However, dogs with an extra - hepatic inflammation or tumour had highly significantly increased serum concentration of il-6 compared with dogs with diabetes mellitus (p <0.001; fig . 1). Finally the intra- and inter - assay precision of the il-6 assay was 2.9% and 5.9%, respectively . The measurement of cytokines in diseased dogs is a new field in clinical pathology . Given their function as mediators, cytokines can help to identify disease mechanisms, to describe the course of disease and to assess prognosis . This study focused on il-6 in dogs with liver disease because il-6 has been shown to be critical for the acute - phase response, for protection against hepatic injury and for liver regeneration (taub 2005; berasain et al . No healthy dog was found with a serum concentration above 1 pg / ml . Unfortunately, there is no study in which a reference interval for il-6 in dogs has been calculated . However, in human studies with healthy controls, comparable serum concentrations of about 1 pg / ml were reported (benoy et al . 2008; salamon et al . 2008). Given this very low reference range, the elevations of il-6 associated with different diseases can be recognised easily . The results of this study showed that liver diseases of different aetiologies were associated with elevated serum concentrations of il-6 . This is in agreement with the results of investigations in humans, which have involved measurement of il-6 in the serum of patients with different neoplastic diseases, including metastases, and those with non - neoplastic liver diseases . In both types of diseases, the serum concentrations of il-6 are increased compared with those of controls (matzaraki et al . 2007; the serum concentration of il-6 in cases of acute hepatitis is significantly higher than that in chronic hepatitis . The release of different cytokines, including il-6, indicates the early beginning of an inflammatory process (eklund 2009). Measurement of a significant difference in the level of il-6 between acute and chronic liver disease may help to differentiate between these processes . The results of this study show that il-6 could be helpful for identification of acute hepatitis in dogs; however, the number of dogs with acute hepatitis in this study was low, so further studies are recommended with a larger number of patients . Unfortunately, there was no significant difference in the level of il-6 between patients with mild and moderate chronic hepatitis . In human patients with chronic hepatitis, the serum concentration of il-6 correlates with the degree of fibrosis (migita et al . Given that all the dogs with chronic hepatitis in this study had a low degree of inflammation and no or only mild fibrosis, dogs with severe chronic hepatitis and fibrosis should be observed in further studies to investigate the correlation between the serum concentration of il-6 and the degree of hepatitis . All dogs with hepatitis in this study, both acute and chronic, had comparable serum concentrations of il-6 to dogs with inflammatory diseases outside the liver, such as prostatitis and pyometra . The concentration of il-6 in dogs with chronic hepatitis was lower than in the control group with extra - hepatic inflammatory processes . One reason for this could be a lower degree of inflammation in the group with chronic hepatitis . The dogs with liver tumours in this study also had elevated serum concentrations of il-6 . The levels were comparable to those in cases of acute hepatitis but higher than in cases of chronic hepatitis . An explanation for this could be the acute initiation of inflammation by mediators in hepatic tumours and the resulting destruction of the liver parenchyma . It could also be caused by attempts of the liver to regenerate its tissue during neoplastic alteration . Elevation of il-6 has also been reported in humans with liver tumours of different aetiologies (goydos et al . Studies of liver tumours and serum concentrations of il-6 in dogs have not been published previously . It is interesting that the concentrations of il-6 in dogs with secondary liver tumours were significantly higher than those in dogs with primary liver tumours . In cases of lymphoma, the release of il-6 from lymphoid tumour cells could explain this observation . In humans, serum concentrations of il-6 are increased in patients with lymphoma, and the levels fall during chemotherapy (serebriakov et al . 1998). To confirm that non - inflammatory and non - neoplastic diseases have little influence on the serum concentration of il-6, we measured il-6 in cases of diabetes mellitus and compared these results with those from all cases of inflammation or tumour . Like the healthy controls, the dogs with diabetes mellitus have very low concentrations of il-6 in the serum . It can be concluded that the absence of inflammatory processes is associated with a lack of il-6 activation . On the other hand, in humans, secondary inflammation associated with diabetes mellitus can induce elevations of il-6 (goldberg 2009). This observation requires investigation in further studies . In conclusion, the results of our study show that il-6 is measurable in dogs and that diseases of the liver are associated with elevations of this cytokine . Differentiation between acute and chronic hepatitis may be possible, but the assessment of the degree of hepatitis is not possible in milder cases . Dogs with liver tumours of different aetiologies have elevated serum concentrations of il-6, and those with secondary liver tumours showed significantly higher levels than those with primary tumours or inflammatory diseases . The reason for this is not clearly understood, but production of il-6 by the tumour cells could be one explanation . Further studies of il-6 and its involvement in liver disease in dogs are necessary to investigate the prognostic use of il-6 in patients with liver diseases.
E - cadherin is a calcium - regulated adhesion molecule expressed in most normal epithelial tissues . E - cadherin knockout mice are non - viable and have abnormal epithelial morphogenesis . Selective loss of e - cadherin can cause dedifferentiation and invasiveness in human carcinomas . In various cell lines, a reciprocal relationship has been shown between levels of e - cadherin expression and invasiveness . Reduced expression of e - cadherin has been observed in aggressive tumors of the esophagus, ovary, and stomach[68]. Mechanisms by which e - cadherin protein expression is lost include e - cadherin gene mutation and loss of the wild - type allele by loss of heterozygosity[911]. Ductal and lobular carcinomas of the breast represent the main infiltrating carcinomas, the latter being less frequent . Although the established histopathologic criteria distinguish invasive lobular from invasive ductal carcinoma, diagnostic difficulty occurs because of overlapping histopathologic features, particularly with invasive lobular carcinoma (ilc) variants and pleomorphic ilc[1317]. The majority of ilcs have shown a complete loss of e - cadherin expression[1722]. The loss of e - cadherin is from the outset, i.e., in the pre - invasive stage of lobular carcinoma in situ (lcis). E - cadherin loss explains the histopathologic appearance of lcis including a diffuse growth pattern of this non - gland - forming tumor with discohesive tumor cells . However, the practical application of e - cadherin expression in breast cancer as a prognostic and diagnostic cancer biomarker remains controversial . Reduced e - cadherin expression was an adverse prognostic biomarker in some studies[2427]. Although most studies show reduced expression of e - cadherin to be associated with high histopathologic grade, correlation with nodal metastasis and loss of estrogen receptor (er) and progesterone receptor (pgr) have been shown in only some studies . With the exception of histopathologic grade, the relationship between e - cadherin expression in regard to different prognostic markers and survival differs between studies . We evaluated e - cadherin expression as an aid to sub - classification of invasive breast cancer . In addition, we correlated the loss of expression of e - cadherin with various clinical and pathologic prognostic factors . While correlating the prognostic criteria with e - cadherin loss, we considered the inherent loss of e - cadherin in all lobular breast carcinomas, irrespective of their histopathologic grade, and the expression of other prognostic tumor variables that previous studies have not considered . We collected 276 breast cancer specimens from women undergoing modified radical mastectomy for operable primary breast cancer between may 2007 and july 2010 . All breast cancer tissues were collected from surgeries performed at grant medical college and sir j.j group of hospitals, mumbai, india . The pathology specimens were reviewed independently by histopathologists to grade and sub - classify the tumors based on established criteria without knowledge of immunohistochemical results . After final histopathologic review, 276 breast cancer cases were further studied, including 204 cases of invasive ductal carcinoma (idc) and ductal special types (tubular, mucinous); 59 cases of ilc and variants (49 conventional and 10 pleomorphic ilc); 4 cases of tubulolobular carcinoma (tlc); and 9 cases of invasive carcinoma (ic), with uncertain classification between lobular and ductal type . Data on patient demographics, tumor size, axillary lymph node status, stage of disease, er and pgr status, and her-2/neu overexpression were abstracted from the histopathology reports . Tissue samples were processed in an auto processer and embedded in paraffin wax on an embedding station . The tissue blocks were sectioned by microtome into 4 m sections that were dried overnight at 37c . Prior to antibody staining, the slides were pre - treated with microwave irradiation to unmask binding epitopes . After blocking endogenous peroxide activity with a 3% solution of hydrogen peroxide in methanol for 30 minutes, slides were immersed in 200 ml of 10 mm citric acid (ph 6.0) for 5 minutes at 100 watt power in a microwave oven, followed by 4 cycles of 5 minute each on 50 watt power . After topping up the buffer with distilled water, these steps were repeated . The slides were then left to stand for 10 minutes in buffer at room temperature before being washed thoroughly in tap water . After three washes in tris - buffered saline (tbs), the slides were incubated with a 1:50 dilution of mouse anti - e - cadherin monoclonal primary antibody (clone: nch-38; m3612; dakocytomation, denmark) in tbs for 1 hour at room temperature . After three more washes in tbs, the secondary antibody, biotinylated goat antibody (link) to mouse / rabbit immunoglobulin (k0355; dakocytomation, denmark) at a dilution of 1:100 in tbs was applied for 1 hour at room temperature . After an additional three washes, a streptavidin - biotin - horseradish peroxidase (hrp) complex (enzyme label) (k0355; dakocytomation, denmark) was formed . After an additional three washes, the staining was visualized by adding diaminobenzidine (dab) (k3467; dakocytomation, denmark) for 5 minutes at room temperature . The slides were washed well in tap water and counterstained with harris's hematoxylin for 10 seconds to 1 minute and then dehydrated, cleared, and mounted in distrene plasticiser xylene (dpx). Image collection and microphotographs were taken with an axioimager m1 microscope with axiovision software (carl zeiss microscopy, germany). The slides were first observed under a 10x objective to confirm that the cells were still attached to the slide . E - cadherin scoring used a 4-point scale adapted from: negative = 0; weak and heterogeneous = 1 +; mild or weak and homogeneous = 2 +; moderate or strong and heterogeneous = 3 +; intense or strong and homogeneous = 4 + . The intensity of staining was scored from 0 3, where 0 = complete absence or negative; 1 = <10% bright membrane expression; 2 => 10% but 50% membrane expression; and 3 => 50% membrane expression . Statistical analyses were performed using spss-16 procedures (spss-16 analytical software inc, chicago, il). Immunohistochemical staining scores were correlated with the histopathologic type, grade, nodal status, tumor size, hormone receptor status (er and pgr), and her-2/neu expression . The association between e - cadherin and tumor type was assessed with the test . Association with grade, nodal status, stage and her-2/neu overexpression were assessed with the spearman rank correlation coefficient . Associations with er and pgr were assessed with the cochran - armitage trend tests, kruskal - wallis test, wilcoxon rank sum test or the test, and confidence intervals . A 2-sided p value less than .05 was considered statistically significant . We collected 276 breast cancer specimens from women undergoing modified radical mastectomy for operable primary breast cancer between may 2007 and july 2010 . All breast cancer tissues were collected from surgeries performed at grant medical college and sir j.j group of hospitals, mumbai, india . The pathology specimens were reviewed independently by histopathologists to grade and sub - classify the tumors based on established criteria without knowledge of immunohistochemical results . After final histopathologic review, 276 breast cancer cases were further studied, including 204 cases of invasive ductal carcinoma (idc) and ductal special types (tubular, mucinous); 59 cases of ilc and variants (49 conventional and 10 pleomorphic ilc); 4 cases of tubulolobular carcinoma (tlc); and 9 cases of invasive carcinoma (ic), with uncertain classification between lobular and ductal type . Data on patient demographics, tumor size, axillary lymph node status, stage of disease, er and pgr status, and her-2/neu overexpression were abstracted from the histopathology reports . Tissue samples were processed in an auto processer and embedded in paraffin wax on an embedding station . The tissue blocks were sectioned by microtome into 4 m sections that were dried overnight at 37c . Prior to antibody staining, the slides were pre - treated with microwave irradiation to unmask binding epitopes . After blocking endogenous peroxide activity with a 3% solution of hydrogen peroxide in methanol for 30 minutes, slides were immersed in 200 ml of 10 mm citric acid (ph 6.0) for 5 minutes at 100 watt power in a microwave oven, followed by 4 cycles of 5 minute each on 50 watt power . After topping up the buffer with distilled water, these steps were repeated . The slides were then left to stand for 10 minutes in buffer at room temperature before being washed thoroughly in tap water . After three washes in tris - buffered saline (tbs), the slides were incubated with a 1:50 dilution of mouse anti - e - cadherin monoclonal primary antibody (clone: nch-38; m3612; dakocytomation, denmark) in tbs for 1 hour at room temperature . After three more washes in tbs, the secondary antibody, biotinylated goat antibody (link) to mouse / rabbit immunoglobulin (k0355; dakocytomation, denmark) at a dilution of 1:100 in tbs was applied for 1 hour at room temperature . After an additional three washes, a streptavidin - biotin - horseradish peroxidase (hrp) complex (enzyme label) (k0355; dakocytomation, denmark) was formed . After an additional three washes, the staining was visualized by adding diaminobenzidine (dab) (k3467; dakocytomation, denmark) for 5 minutes at room temperature . The slides were washed well in tap water and counterstained with harris's hematoxylin for 10 seconds to 1 minute and then dehydrated, cleared, and mounted in distrene plasticiser xylene (dpx). Image collection and microphotographs were taken with an axioimager m1 microscope with axiovision software (carl zeiss microscopy, germany). The slides were first observed under a 10x objective to confirm that the cells were still attached to the slide . E - cadherin scoring used a 4-point scale adapted from: negative = 0; weak and heterogeneous = 1 +; mild or weak and homogeneous = 2 +; moderate or strong and heterogeneous = 3 +; intense or strong and homogeneous = 4 + . The intensity of staining was scored from 0 3, where 0 = complete absence or negative; 1 = <10% bright membrane expression; 2 => 10% but 50% membrane expression; and 3 => 50% membrane expression . Statistical analyses were performed using spss-16 procedures (spss-16 analytical software inc, chicago, il). Immunohistochemical staining scores were correlated with the histopathologic type, grade, nodal status, tumor size, hormone receptor status (er and pgr), and her-2/neu expression . The association between e - cadherin and tumor type was assessed with the test . Association with grade, nodal status, stage and her-2/neu overexpression were assessed with the spearman rank correlation coefficient . Associations with er and pgr were assessed with the cochran - armitage trend tests, kruskal - wallis test, wilcoxon rank sum test or the test, and confidence intervals . A 2-sided p value less than .05 was considered statistically significant . We collected 276 breast cancer specimens from women undergoing modified radical mastectomy for operable primary breast cancer between may 2007 and july 2010 . All breast cancer tissues were collected from surgeries performed at grant medical college and sir j.j group of hospitals, mumbai, india . The pathology specimens were reviewed independently by histopathologists to grade and sub - classify the tumors based on established criteria without knowledge of immunohistochemical results . After final histopathologic review, 276 breast cancer cases were further studied, including 204 cases of invasive ductal carcinoma (idc) and ductal special types (tubular, mucinous); 59 cases of ilc and variants (49 conventional and 10 pleomorphic ilc); 4 cases of tubulolobular carcinoma (tlc); and 9 cases of invasive carcinoma (ic), with uncertain classification between lobular and ductal type . Data on patient demographics, tumor size, axillary lymph node status, stage of disease, er and pgr status, and her-2/neu overexpression were abstracted from the histopathology reports . Tissue samples were processed in an auto processer and embedded in paraffin wax on an embedding station . The tissue blocks were sectioned by microtome into 4 m sections that were dried overnight at 37c . Prior to antibody staining, the slides were pre - treated with microwave irradiation to unmask binding epitopes . After blocking endogenous peroxide activity with a 3% solution of hydrogen peroxide in methanol for 30 minutes, slides were immersed in 200 ml of 10 mm citric acid (ph 6.0) for 5 minutes at 100 watt power in a microwave oven, followed by 4 cycles of 5 minute each on 50 watt power . After topping up the buffer with distilled water, these steps were repeated . The slides were then left to stand for 10 minutes in buffer at room temperature before being washed thoroughly in tap water . After three washes in tris - buffered saline (tbs), the slides were incubated with a 1:50 dilution of mouse anti - e - cadherin monoclonal primary antibody (clone: nch-38; m3612; dakocytomation, denmark) in tbs for 1 hour at room temperature . After three more washes in tbs, the secondary antibody, biotinylated goat antibody (link) to mouse / rabbit immunoglobulin (k0355; dakocytomation, denmark) at a dilution of 1:100 in tbs was applied for 1 hour at room temperature . After an additional three washes, a streptavidin - biotin - horseradish peroxidase (hrp) complex (enzyme label) (k0355; dakocytomation, denmark) was formed . After an additional three washes, the staining was visualized by adding diaminobenzidine (dab) (k3467; dakocytomation, denmark) for 5 minutes at room temperature . The slides were washed well in tap water and counterstained with harris's hematoxylin for 10 seconds to 1 minute and then dehydrated, cleared, and mounted in distrene plasticiser xylene (dpx). Image collection and microphotographs were taken with an axioimager m1 microscope with axiovision software (carl zeiss microscopy, germany). The slides were first observed under a 10x objective to confirm that the cells were still attached to the slide . E - cadherin scoring used a 4-point scale adapted from: negative = 0; weak and heterogeneous = 1 +; mild or weak and homogeneous = 2 +; moderate or strong and heterogeneous = 3 +; intense or strong and homogeneous = 4 + . The intensity of staining was scored from 0 3, where 0 = complete absence or negative; 1 = <10% bright membrane expression; 2 => 10% but 50% membrane expression; and 3 => 50% membrane expression . Statistical analyses were performed using spss-16 procedures (spss-16 analytical software inc, chicago, il). Immunohistochemical staining scores were correlated with the histopathologic type, grade, nodal status, tumor size, hormone receptor status (er and pgr), and her-2/neu expression . The association between e - cadherin and tumor type was assessed with the test . Association with grade, nodal status, stage and her-2/neu overexpression were assessed with the spearman rank correlation coefficient . Associations with er and pgr were assessed with the cochran - armitage trend tests, kruskal - wallis test, wilcoxon rank sum test or the test, and confidence intervals . Patient demographics, histopathologic tumor subtypes, and tumor grade along with e - cadherin immunoreactivity are summarized in table 1 . Patient age, tumor histopathologic grade, and e - cadherin expression in breast cancer in 276 total cases e - cadherin expression was seen in all but 1 case of idc and special ductal types (203/204, 99.5%). As shown in figure 1, e - cadherin expression was present in 100% of tumor cells in all positive cases, and the staining was 3 + in the majority (199 specimens) and 2 + in only 4 cases . The special types included 1 case of adenosquamous carcinoma, 3 cases of mucinous carcinoma, and 3 cases of tubular carcinoma . Associated ductal carcinomas in situ (dcis) was positive in 89 cases with 3 + e - cadherin immunoreactivity . Invasive ductal carcinoma: (a) h & e, (b) e - cadherin positive immunoreactivity . Classic ilc was characterized by histopathology by strands of discohesive small to medium - sized tumor cells with mild to moderate cytologic atypia dispersed in a fibrous stroma . Of 49 ilc specimens with the classic histopathologic pattern, 44 (90%) showed complete loss of e - cadherin, as shown in figure 2; 5 (10%) of typical histopathological ilc specimens showed complete membrane staining in 100% of tumor cells . Three of these e - cadherin - positive cases were well - differentiated nuclear grade i and ii; 2 were moderately differentiated nuclear grade ii according to the nottingham grading system . Two cases of ilc had mixed alveolar and solid patterns, both of which were e - cadherin - negative . Twenty - five e - cadherin - negative conventional ilc cases also had e - cadherin - negative lcis in the same slide . Two cases of e - cadherin - positive ilc had associated e - cadherin - positive lcis, and 1 case had e - cadherin - positive dcis . Invasive lobular carcinoma: (a) h & e, (b) no e - cadherin immunoreactivity . Pleomorphic ilc was characterized by histopathology by a growth pattern similar to classic ilc with greater cytologic atypia, pleomorphism, and discohesion . Of 10 cases of pleomorphic ilc, 8 (80%) showed loss of e - cadherin membrane staining in invasive and corresponding in - situ components, as shown in figure 3 . Two cases (20%) showed 3 + positive staining in 100% of tumor cells . Invasive lobular carcinoma: (a) h & e, (b) e - cadherin positive immunoreactivity . The histopathology of tlc cases contained areas of classic ilc along with focal but distinct tubule formation . All cases of tlc exhibited a difference in e - cadherin expression between the tubules and the cords, with classic single - file pattern of ilc, as shown in table 1 . The tubules showed 2 + positive membranes staining, whereas the single - file invasive cords showed loss of e - cadherin, as shown in figure 4 . One case also had e - cadherin - positive dcis, whereas e - cadherin - negative lcis was present in 2 other cases . Tubulolobular carcinoma with lobular component: (a) h & e, (b) e - cadherin negative immunoreactivity, tubular component: (c) h & e, (d) e - cadherin positive immunoreactivity . Nine cases were designated as invasive carcinomas because of overlapping histopathologic features uncertain for idc or ilc . Of 9 cases, 5 (56%) showed positive e - cadherin staining in all tumor cells, as shown in figure 5, whereas the remaining 4 cases (44%) were negative for e - cadherin staining, as shown in figure 6 . Invasive carcinoma with lobular or ductal uncertainty: (a) h & e, (b) e - cadherin positive immunoreactivity . Magnification = 400x . Invasive carcinoma with lobular or ductal uncertainty: (a) h & e, (b) e - cadherin negative immunoreactivity . Comparison of e - cadherin staining in idc, ilc, and ilc variants revealed a highly significant difference between the groups (p<.001; kruskal - wallis test). Overall, negative staining of e - cadherin in ilc was specific for the diagnosis of ilc (specificity, 97.7%; negative predictive value, 96.8%; 95% confidence interval, 94.7 - 99.3). However, positive staining did not exclude the diagnosis of ilc (sensitivity, 88.1%; positive predictive value, 91.2%; 95% confidence interval, 77.1 - 95.1). All invasive carcinoma associations between e - cadherin expression and tumor characteristics were assessed with the wilcoxon rank sum test or the test . Various tumor variables (tumor size, nodal status, pgr status, and her-2/neu status) did not reveal significant associations with loss of e - cadherin expression, as shown in table 2 . Analysis of prognostic cancer biomarkers with loss of e - cadherin expression however, loss of e - cadherin was significantly associated with tumor grade and er status . The analysis was repeated after excluding all ilcs, on the basis that previous data have shown that ilcs are e - cadherin - negative irrespective of their grade, nodal status, size, or hormonal status . Complete loss of e - cadherin was seen in too few cases of idc and special types to be of prognostic or predictive value, as shown in table 2 . E - cadherin is a cell adhesion molecule that is expressed in normal breast tissue and is useful as a phenotypic marker in breast cancer, with absence of its expression frequently observed in lobular type tumors . Reduced or impaired e - cadherin expression is associated with a reduced disease - free interval and overall survival and with other indicators of poor prognosis including a larger tumor size, higher histological grade, and development of distant metastasis and er receptor negative tumors . E - cadherin immunostaining can be used in finding patients with favorable outcomes among node - positive patients . The loss of e - cadherin expression is a very early change in lobular breast carcinogenesis and the normal protein plays a tumor - suppressive and invasion - suppressive role . E - cadherin staining can help differentiate between lobular carcinoma in situ (lcis)/lobular carcinoma and ductal carcinoma in - situ (dcis)/infiltrating duct carcinoma denoting the presence of dcis or infiltrating duct carcinoma . Foote and stewart used the term lobular carcinoma in situ for a special type of non - invasive carcinoma of the breast associated with a monotonous intralobular proliferation of cells . The concurrent invasive carcinoma with absence of tubule formation and single - file growth pattern was established as ilc . The distinctive histopathologic features of this special type of breast cancer described by foote and stewart and wheeler and enterline paved the way for identification of this tumor by histopathologist when the classic features are present . Identification of solid, alveolar, tubulolobular, and pleomorphic variants[15173638] of ilc has added new dilemmas to the existing problem of distinguishing idc of no special type with cord - like or trabecular patterns from ilc and its variants . Selective e - cadherin loss, now well recognized, validates ilc as a distinct entity and explains its histopathologic appearance and distinctive growth patterns in metastases . Although e - cadherin is emerging as an excellent biomarker to type breast cancers, the conflicting reports of e - cadherin loss as predictor of increased invasiveness, metastatic potential, and poor survival raise questions about its reliability for typing . Loss of e - cadherin alone cannot be a predictor of metastatic potential and negative outcome as e - cadherin is lost even in the pre - invasive stages of lcis and atypical lobular hyperplasia . Furthermore, ilc is a slow - growing tumor that has been shown to have better survival than ductal carcinoma of no special type . As demonstrated in our study and in previous studies, e - cadherin can help in the diagnosis of ilc . As in our study, complete e - cadherin loss has been reported in 86% to 100% of ilcs, with most large studies reporting e - cadherin positivity in a small number of ilcs . All of these studies also show good membrane positivity for e - cadherin in all idcs, including special types, even at the advancing front . Almost all of our cases of invasive and in situ breast cancers were strongly e - cadherin - positive (3 +) or e - cadherin - negative (0). The exceptions were the few cases of tlc that showed 2 + staining in the tubules only and a very few high - grade cellular idcs with apparent reduced expression of e - cadherin . Acs et al also report similar all or none e - cadherin expression in the majority of their cases, including cases that were thought to have mixed or indeterminate patterns . Berx et al and acs et al observed variation in e - cadherin intensity in idcs and in some cases of ductolobular carcinomas . Tlc, first described by fisher et al as a rare variant of ilc, consists of a predominant ilc component with a diffuse infiltrative pattern and a component of variably defined small tubules . All 4 of our tlcs fit this profile and had distinctive biphasic e - cadherin expression in 3 cases with no immunoreactivity in the ilc component and moderately positive immunoreactivity in the tubules . Diagnostic difficulty occurs in some cases because idc may show a dispersed growth pattern, including infiltration around benign ducts in a targeted manner similar to ilc . Several authors have studied e - cadherin expression in ductolobular carcinomas or carcinoma of indeterminate type with similar results . Of our 9 cases initially regarded as ic of uncertain type, 5 e - cadherin - positive cases seemed to be idc with a dispersed growth pattern, whereas the 4 e - cadherin - negative tumors had morphologic features consistent with ilc . Thus, all of these cases could be classified further based on immunohistochemical expression of e - cadherin . A category of mixed ductal lobular lesions is absent in our study because we were able to classify most lesions as ductal or lobular based on cytoarchitectural features . Most studies have observed retained e - cadherin expression in almost all idcs but noted reduced expression, mainly associated with poor differentiation and high tumor grade . Various studies have observed a correlation between reduced e - cadherin expression and lymph node status and er and pgr status . Others have found no relationship to nodal or receptor status . To date, studies correlating e - cadherin expression with outcome are few . Some suggest that reduced e - cadherin expression may adversely affect overall and/or disease - free survival . Siitonen et al found reduced disease - free survival in association with reduced expression of e - cadherin . Charpin et al found shorter overall survival in node - negative patients but did not see correlation with metastases or recurrence - free survival . Acs et al and lipponen et al demonstrated no correlation of e - cadherin expression with tumor size, grade, tubule formation, nuclear pleomorphism, mitotic activity, er and pgr status, and her-2/neu overexpression in invasive carcinomas . Our findings were similar, with reduced expression being rare in non - lobular carcinomas, limited to a few high - grade idcs . Moreover, as e - cadherin is retained in nearly all non - lobular invasive carcinomas, reduced expression is difficult to quantitative in a reproducible manner . Each reported study differs in evaluating the intensity, distribution, and quantitation of positive e - cadherin staining . Reduced staining and coarsely granular membrane staining seen in some very poorly differentiated idcs in our study may represent a degenerative tumor effect . Contrary to the observation that e - cadherin has an invasion - suppression role in vitro, e - cadherin is retained in the majority of non - lobular invasive carcinomas, including poorly differentiated tumors, and is lost in the majority of lobular breast cancer irrespective of stage, grade, hormone receptor status, her- 2/neu expression, and nodal status . As previously pointed out, invasiveness and metastatic potential of a tumor probably is dependent on a variety of currently identified and unidentified factors, rather than e - cadherin . Loss of e - cadherin is a sensitive and relatively specific biomarker to confirm a diagnosis of ilc and its variants . A positive stain may not completely exclude the diagnosis ilc because e - cadherin expression may be retained in a minority of cases with characteristic ilc morphologic features . Partial loss of e - cadherin in a minority of poorly differentiated idcs is not of diagnostic significance . E - cadherin loss is rare in invasive non - lobular carcinomas and does not correlate with established prognostic variables when ilc is excluded.
Gene therapy is now a realistic prospect for the treatment of a variety of musculoskeletal disorders because of the emerging knowledge concerning proteins that govern the processes of growth and regeneration of tissues [1, 2]. Research has identified numerous growth factors and other gene products with the ability to promote regeneration . The most extensively studied are members of the transforming growth factor (tgf) superfamily, collectively known as bone morphogenetic proteins (bmps). Because gene therapy provides the gene rather than just a degradable protein, this technique may result in higher and more reproducible levels of protein production with the potential for long - term protein delivery . This would allow either local protein production for tissue healing and so forth or potentiate long - term systemic delivery . The most commonly used in the orthopaedic field have been viral vectors and ex vivo manipulation with considerable preclinical success [5, 6]. There are concerns regarding viral recombination / infectivity, immunogenicity, and possible carcinogenicity [79]. They are expensive to produce and as vectors have biophysical and genetic limitations . Also many gene therapy strategies prove ineffective, suffering from gene silencing . Non - viral therapy has not been extensively studied in orthopaedic research [11, 12]. In theory, non - viral therapy lacks some of the drawbacks associated with viral systems . In this study, the long - term viability of murine skeletal muscle plasmid gene expression in vivo was assessed using live whole body imaging of luciferase expression, along with the potential for expression control using an inducible model . Finally an ex vivo model was developed in murine musculoskeletal tissue and conditions replicated to examine plasmid gene expression in human ex vivo mesenchymal tissue . The commercially available plasmid pcmv - luc was purchased from promega (wisconsin, usa). David gould (bone & joint research unit, barts and the london, queen mary's school of medicine and dentistry, university of london, london, england). B - alb c mice were obtained from harlan laboratories (oxfordshire, england). They were kept at a constant room temperature (22c) with a natural day / night light cycle in a conventional animal colony . Female mice in good condition, without fungal or other infections, weighing 1622 g and of 68 weeks of age, were included in experiments . All in vivo and ex vivo animal experiments were approved by the ethics committee of university college cork . Administration of 200 g xylazine and 2 mg ketamine . For liver transfection, a 1 cm subcostal incision was made over the liver and the peritoneum opened . The right lobe of the exposed liver was administered plasmid by electroporation as described below . The wound was closed in two layers peritoneal and skin using 4/0 prolene sutures (promed). All ex vivo human tissue experiments were approved by the clinical research ethics committee of the cork teaching hospitals . Informed consent was obtained from patients scheduled for lower limb amputation and the surgeon's permission obtained . Upon removal of sample samples were cut to a size approximating the medial thigh muscle of balb - c mice (1.5 cm). For plasmid delivery by electroporation, a custom - designed applicator with 2 needles 4 mm apart was used, with both needles placed through the skin central to the tissue . Tissue was injected between electrode needles with plasmid dna in sterile injectable saline in an injection volume of 50 l . Plasmid concentration was determined using the nanodrop spectrophotometer (nd-1000 spectrophotometer, labtech int, east sussex, uk). The number of plasmid copies was determined using the following calculation: (1)mass of plasmid dna (g) = no . Of gene copies (bp) (plasmid size1.09610(21)). Plasmid sizes for pcmv luc and pgtrtl were 6.9 kbp and 7.5 kbp, corresponding to a mass of 6.05 10 g and 6.576 10 g, respectively . After 80 seconds, square - wave pulses (1200 v / cm 100 sec 1 and 120 v / cm 20 msec, 8 pulses) were administered in sequence using a custom - designed pulse generator (cythorlab, aditus, lund, sweden). In all cases, a drop in impedance measurement was taken as evidence for successful tissue cell poration . Replication incompetent recombinant adenovirus 5 particles encoding the luciferase gene under the transcriptional control of the cmv promoter were a kind gift from prof . Andrew baker, university of glasgow; they were generated and titrated as described previously . Viral vector particles were administered by direct intramuscular injection in a volume of 50 l . 1 10 vp of replication incompetent recombinant adenovirus 5 particles was used per administration . The entire medial thigh muscle tissue was harvested from sacrificed b - alb c mice (1.5 cm). Samples were stored as per the experimental protocol to assess survival in either rpmi (roswell park memorial institute medium) or dmem (dulbecco / vogt modified eagle's minimal essential medium) at 37c for 24 hours . The effect of electroporation on cell survival was assessed by administering the plasmid as described previously and assessing viability at 24 hours . Cell viability was assessed using the propidium - iodide - based nucleocounter kit as previously described . Samples were washed and processed through a fine mesh filter (bd biosciences, oxford, uk), using a pestle and pbs (phosphate buffered saline) until a suspension was obtained . The suspension was made up to a standard volume, and cell viability was assessed . Solutions were prepared by adding 200 g / ml of doxycycline (sigma) to distilled water containing 10% sucrose as previously described . All drinking bottles were wrapped in aluminium foil and were renewed every 2 - 3 days . A 20 g / ml solution was added to wells with pgtrtl ex vivo samples as the 200 g / ml resulted in excessive cell death (data not shown). In vivo luciferase activity from tissues was analysed at set time points after transfection as follows: 80 l of 30 mg / ml firefly luciferin was injected intraperitoneally . Ten minutes after luciferin injection, live anaesthetised mice were imaged for 3 min at high sensitivity using an intensified ccd camera (ivis imaging system, xenogen). The exposure conditions were maintained at identical levels so that all measurements would be comparable . All data analysis was carried out on the living image 2.5 software package (ivis imaging system, xenogen). Luminescence levels were calculated using standardised regions of interest (rois) for all 3 anatomical areas . Actual levels were obtained by subtracting the corresponding roi of an untransfected mouse to account for background luminescence . For comparison between plasmids, flux was calculated per gene copy number . At each time point, either one - way a two - sampled t - test was used to compare mean luminescence within each experimental group . Luciferase - coding plasmid dna featuring the cmv (pcmv - luc) promoter (figure 1) was delivered to liver or thigh muscle by electroporation . Ivis live whole body imaging was used at time points over 370 days to determine luciferase expression (figure 2). Expression driven by the cmv promoter in liver was initially high but reduced rapidly to background levels by day 14 . A different temporal pattern of expression was observed in muscle tissue, with no gross reduction in expression over time observed . Total luminescence for the period was 1.33 10 p / sec / cm / sr / plasmid copy . Unlike liver, muscle therefore has the potential to act as a long - term conduit for gene expression . Luciferase - coding plasmid dna featuring the cmv (pcmv - luc) promoter or adenovirus 5 particles encoding the luciferase gene under the transcriptional control of the cmv promoter was delivered to murine thigh muscle as described . Ivis live whole body imaging was used at time points over 18 days to compare luciferase expression between the two constructs . Maximum expression was significantly higher using adenoviral delivery when compared to that of plasmid delivery . Expression following adenoviral delivery, however, decreased over the study period to background levels at 18 days (figure 3(b)). Luciferase expression from an inducible tet - on promoter was examined in muscle tissue using the pgtrtl plasmid, both in the presence and absence of induction by doxycycline (figure 4). There was a low initial expression from reporter gene preinduction from the time of delivery . However, following induction with doxycycline at day 8, expression was increased by a factor of 11 (p = 0.0001) at day 11 . Following withdrawal of doxycycline at day 12, expression was reinduced at day 105 and had increased by a factor of 9.2 by day 108 (p = 0.001) and by a factor of 10.7 at day 116 . Expression remained constant at a maximal level between days 108 and 116 with no statistically significant change in magnitude observed (p = 0.77). Following withdrawal of doxycycline at day 117, there was no difference in maximal expression between the two induction periods (p = 0.28). It can also be reinduced on a temporal basis to give reproducible levels of expression . Cell viability following incubation in dmem at 37c for 1, 4, and 24 hours was 85%, 82%, and 38%, respectively (figure 5). This was significantly better than cell survival following incubation in rpmi (22%, p <0.05). There was no difference in cell survival following plasmid electroporation when compared to untreated samples (34% and 38%, resp ., p = 0.5). To assess translation of the murine findings to a clinical setting, samples of muscle, tendon, and bone with intact periosteal tissue were harvested from a human leg amputated for end - stage peripheral vascular disease . 4 samples were taken of each tissue type and transfected with pcmv - luc or pgtrtl as previously described . These were incubated overnight in conditions described above and luminescence assessed at 24 h (figure 6). Luciferase gene expression was observed in all tissues electroporated with plasmid, indicating successful plasmid delivery and subsequent gene expression in this setting . Localised gene expression offers certain advantages in the setting of tissue healing . It may provide a more accurate system of protein delivery to the desired tissue, whilst lessening systemic side effects . In addition, it has the potential for sustained protein delivery, both intracellularly and extracellularly without the need for repeated administration . However, inactivation of gene expression in specific cell types has important therapeutic implications, as does the prospect of uncontrolled protein production . Here, we have demonstrated that plasmid - based gene expression in murine muscle does not decrease with time . Long - term plasmid gene expression has been observed in muscle previously, although not using an in vivo luminescence system for a period greater than one year [15, 16]. In vivo luminescence it is also an ideal method of assessing an inducible agent as an on - off switch to control protein expression, by allowing repeated measurements in the same subjects over a long time period . Successful bone and tendon healing in animal models have been reported following adenoviral transfer of bmp 2 and bmp 14 [5, 6, 18]. Here, we have compared luciferase expression between a plasmid construct and viral particles . Although maximum expression was significantly greater with adenovirus, this was rapidly silenced to background levels by day 18 . The attraction of the plasmid system would therefore lie in its capacity for sustained levels of predictable expression over time . Electroporation - assisted intramuscular delivery of plasmid dna has been shown to efficiently transfect cells of myogenic origin with no evidence of transgene expression in infiltrating inflammatory cells . This is broadly in keeping with our observation of long - term expression, with transfection of a nontransient cell population in muscle and the absence of a significant immune response . Silencing has previously been observed with adenovirus, with the mechanism postulated as methylation of the cmv promoter . Why this does not occur when the promoter is delivered using a plasmid construct, however, is unclear . For instance, in the clinical use of recombinant bone morphogenetic protein (rhbmp) for augmentation of fracture healing and joint fusion, heterotopic ossification and other complications have been reported . In this instance, the protein is eventually cleared from the body . Following gene delivery, however, it would be difficult to arrest protein production in the event of unwanted side effects . It is, therefore, desirable to have a plasmid with an on - off switch . We have demonstrated that this can be achieved using pgtrtl, a tet - on inducible promoter . After plasmid delivery, gene expression initiated with the commencement of oral doxycycline administration and promptly ceased upon withdrawal . This strategy has also proven to be successful in a preclinical arthritis study . In the clinical setting, should side effects occur, gene expression could be turned off simply by omitting the oral agent . In addition, growth factors may not be clinically beneficial until days after intervention, while the delivery of rhbmp at the time of surgery has been shown to impair tissue healing by inducing antagonist factors [18, 22]. By using pgtrtl, we have demonstrated that the timing and duration of gene expression can be tightly controlled in vivo . This would decrease the chance of antagonist induction, whilst optimising the timescale of protein production . This would allow us to repeatedly treat tissue with a known quantity of protein in recalcitrant situations . As the system is orally administered, there would be no need for interference with the physical environment of tissue healing after the initial application . One issue with tetracycline compounds is that they do have an effect on the tissue healing environment and as such may not be the ideal tool for the investigation of therapeutic plasmid use . In terms of principle, however, it demonstrates the potential applicability of an inducible plasmid - based system in a clinical setting . Finally, we have demonstrated, for the first time, successful plasmid - based gene delivery to human ex vivo muscle tissue . Levels of luciferase expression in ex vivo tendon and muscle were similar when examined at 24 hours . Although the exact reasons for the similar levels of expression are unclear, it may be related to a threshold effect or differential tissue survival in the ex vivo environment . Expression may differ in the human in vivo setting, particularly with regard to increased metabolic activity in muscle tissue . Nonetheless, we believe this to be an important step in the demonstration of the applicability of this technique in the in vivo setting, as expression capability cannot be definitely extrapolated from the murine model to the human setting . The expression of plasmid - based delivery in human ex vivo musculoskeletal tissue is encouraging on two levels; firstly, it proves that the system can function in human tissue, and secondly, it raises the possibility of autograft or allograft transfection, which could lead to the acceleration of graft incorporation . The luminescence imaging strategy utilised here provided a rapid, robust and reliable method for ex vivo assessment of transgene expression in patient samples . The method of culturing tissue ex vivo has been demonstrated to provide high viability for up to 1 week post resection, while bioluminescence imaging provides a highly sensitive readout for real - time transgene expression in viable cells . Other reporter gene imaging techniques may also be applicable in this context (fluorescence, pet etc .) These results indicate, when administered using electroporation, that plasmid constructs result in long - term in vivo gene expression and that this expression can be reliably induced with oral agents . Finally, for the first time, successful plasmid gene transfection with electroporation in human ex vivo mesenchymal tissue has been demonstrated.
The role of laparoscopy is established for the removal of nonfunctioning kidneys and small - sized renal tumors . However, retroperitoneoscopic pyelolithotomy (rp) in the management of renal stones is yet to be evaluated, because very few centers throughout the world are performing this procedure . This study is an endeavor in this direction to evaluate the role of rp in the management of renal calculi . The study was conducted at the department of surgery, maulana azad medical college and associated lok nayak hospital, new delhi, india from january 2001 to february 2002 . The study included 56 cases of solitary or multiple renal calculi, with a male to female ratio 1:1.07 (male, 27; female, 29). There were 46 patients with a single stone in the renal pelvis, 4 patients with staghorn calculi, and 6 patients with caliceal calculi . The average size of stones was 2.75 cm (range, 1.5 to 4 cm). Two patients had a bifid renal pelvis, and another had renal vessels and the pelvis lying in the same plane . The mean age of the patients was 33.74 years (range, 18 to 60 years). Patients with recurrent and residual stones, bleeding diathesis, pregnancy, and congenital anomalies that precluded retroperitoneoscopy were excluded from our study . Preoperatively, a double j ureteral stent was inserted in all patients under local anesthesia . The first port was inserted through a 15-mm incision made just below the tip of the 12th rib . The muscles were divided under vision, and the dorsolumbar fascia was incised and the retroperitoneal space entered . Wherever possible, gerota's fascia was either incised under vision or breached with the fingertip . The balloon was inserted and inflated with air (approximately 500 ml) inside gerota's fascia . The balloon was kept inflated for 3 to 5 minutes to achieve homeostasis . In cases where it was not possible to gain entry inside gerota's fascia, the balloon was inflated posterior to the kidney; a 0 telescope was introduced through this port; and the peritoneum was further stripped off the transversalis fascia with counterpressure from the opposite side . A second 10-mm port was placed in the line of the first port above the iliac crest . A third 5-mm port was placed anteriorly mid way between the first 2 ports in such a manner that the 3 ports formed an equilateral triangle . A laparoscope was introduced through the first port after suitably tightening the incision around it . A 5-mm triflange retractor introduced through the third port we prefer to approach the pelvis directly; however, in cases where the pelvis is either not easily accessible or an aberrant vessel is present, the upper end of the ureter is exposed and traced upwards to the pelvis . The pelvis was dissected and a pyelotomy incision made with a hook dissector by using monopolar cautery . A longitudinal pyelotomy incision was made in patients with a single calculus in the renal pelvis; however, in cases of extended pyelolithotomy, a curvilinear pyelotomy incision was made with extension of the incision into the appropriate calyx . After extraction of the calculus, the pyelotomy incision was closed meticulously with 3 0 vicryl . Postoperatively, the kidneys, ureter, and bladder were x - rayed in all cases to confirm stone clearance . Preoperatively, a double j ureteral stent was inserted in all patients under local anesthesia . The first port was inserted through a 15-mm incision made just below the tip of the 12th rib . The muscles were divided under vision, and the dorsolumbar fascia was incised and the retroperitoneal space entered . Blunt finger dissection was carried out posterior to the kidney . Wherever possible, gerota's fascia was either incised under vision or breached with the fingertip . The balloon was inserted and inflated with air (approximately 500 ml) inside gerota's fascia . The balloon was kept inflated for 3 to 5 minutes to achieve homeostasis . In cases where it was not possible to gain entry inside gerota's fascia, the balloon was inflated posterior to the kidney; a 0 telescope was introduced through this port; and the peritoneum was further stripped off the transversalis fascia with counterpressure from the opposite side . A second 10-mm port was placed in the line of the first port above the iliac crest . A third 5-mm port was placed anteriorly mid way between the first 2 ports in such a manner that the 3 ports formed an equilateral triangle . A laparoscope was introduced through the first port after suitably tightening the incision around it . A 5-mm triflange retractor introduced through the third port was used to retract the kidney anteriorly . We prefer to approach the pelvis directly; however, in cases where the pelvis is either not easily accessible or an aberrant vessel is present, the upper end of the ureter is exposed and traced upwards to the pelvis . The pelvis was dissected and a pyelotomy incision made with a hook dissector by using monopolar cautery . A longitudinal pyelotomy incision was made in patients with a single calculus in the renal pelvis; however, in cases of extended pyelolithotomy, a curvilinear pyelotomy incision was made with extension of the incision into the appropriate calyx . After extraction of the calculus, the pyelotomy incision was closed meticulously with 3 0 vicryl . Postoperatively, the kidneys, ureter, and bladder were x - rayed in all cases to confirm stone clearance . In the first half of the patients, it was 94 minutes, and in the second half, it dropped to 69 minutes . Of the 56 patients who underwent rp, 47 had extrarenal pelvis while 7 patients had intrarenal pelvis, and 2 patients had total intrarenal pelvis . Blood loss varied from 15 ml to 60 ml with the average being 27 ml . No blood transfusion was required in any of the patients . The drain was removed in the first 48 hours in 34 (61%) patients . It was 100% in cases of pelvic renal calculi, and 2 of 6 failures occurred in caliceal calculi . The postoperative analgesic requirement was less, and on average, the patients required 2 tablets of diclofenac sodium (10075 mg of diclofenac). Time taken to resume normal activities was 10.3 days, and the number of person - days lost was 7.43.1 days . There were no vascular, visceral, or neural complications during the course of the study . Two conversions to open pyelolithotomy were necessary due to nonprogression of surgery for more than 45 minutes; both were cases of caliceal calculi . Three patients developed subcutaneous emphysema, and 2 patients developed superficial wound infection of the port sites . The development of retroperitoneoscopic surgery including rp has been slow compared with that of transperitoneal laparoscopic surgery due to the inability to establish adequate pneumoretroperitoneum with direct introduction of a needle into the retroperitoneum . However, the advent of the balloon dissection technique by gaur in 1992 has opened new horizons in the field of retroperitoneoscopic surgery . Gaur et al reported a small series of 8 cases of retroperitoneoscopic pyelolithotomy in 1994 with a success rate of 62% . Subsequently, micali et al in 1997 reported a series of 11 cases and hemal et al in 2001 reported a series of 7 cases with success rates of 90% and 71%, respectively . Of the 3 studies available for comparison, 2 adopted the retroperitoneal approach, and the third was done through the transperitoneal route (table 1). These studies had a small number of patients ranging from 7 to 11 with success rates varying from 62% to 90% . However, in the present study, the success rate is 96.4%, and the higher success rate could be because of the greater experience gained over time . In our study, success was 100% in pelvic calculi, and 2 failures occurred in caliceal calculi . Based on our experience so far, the procedure does not seem suitable for caliceal calculi unless the pelvicaliceal system is dilated . Moreover, at present, suitable instruments are also not available for extraction of caliceal calculi . Though we did not use any flexible endoscopes in this study, we believe that use of flexible endoscopes through the operating ports will help in localization and extraction of caliceal calculi . Average operating time in other series ranged from 108 minutes to 249 minutes, which is substantially higher than that in our series (81 minutes). Blood loss in our study was 27 ml, which is comparable to that of other series, where it ranged from 15 ml to 132.9 ml . The time taken to resume normal activities was 10.3 days, which was very encouraging, and the number of person - days lost was only 7.43.1 days . Comparative study of published series on retroperitoneoscopic pyelolithotomy in the present era, eswl is the preferred method of treating kidney stones smaller than 3 cm . Although the procedure is noninvasive, shock waves often induce acute and occasionally chronic lesion to kidneys and other organs, and sequelae may include hypertension and loss of renal function . In a study by eterovic et al, it was shown that while open pyelolithotomy from day one continuously improves renal function, eswl first decreases it and then over a period of months at best brings it back to the pretreatment level . These reports suggest that retroperitoneal laparoscopic pyelolithotomy, having procedural similarity to open pyelolithotomy, is not only nephronsparing but also nephron - reviving and, consequently, could eventually become accepted as the procedure of choice in select patients with renal calculus disease . Renal stones larger than 3 cm often require multiple eswl or pcnl sessions, or both, with adjuvant endoscopic procedures and exposure to ionizing radiation in pcnl . Even after this, some patients may not be completely stone free . Rp can make these patients completely stone free in a single sitting with the added advantage of not being invasive to kidneys . However, this difference between rp and other procedures is more pronounced when either the stone is large or multiple calculi are present . Retroperitoneoscopic pyelolithotomy can also be used in staghorn calculi, and the patient becomes stone free in a single sitting as compared with percutaneous nephrolithotomy, which requires multiple sittings, exposing the patient to ionizing radiation . Another advantage is that many auxiliary procedures like pyeloplasty and ureteric surgeries can be carried out in the same sitting . For patients with ectopic kidney, the results of eswl are only moderately successful and various authors have reported the laparoscopic approach for renal stones in patients with ectopically located kidney because the results of other minimally invasive techniques are only moderately successful . A history of previous open surgery on the kidneys is a relative contraindication, though we did not include any patient with previous surgery in our study . A large number of patients with renal calculus disease in the developing countries are still being treated by an open operative procedure, as either the modern minimally invasive modalities are not available or they are beyond their access due to economical reasons . Rp can be considered an economically viable minimally invasive technique for these patients in developing countries like india . Rp has a steep learning curve because of the relative absence of landmarks and the paucity of space, which makes this surgery difficult for beginners . The only constant landmark is the psoas muscle, but for surgeons experienced in open renal surgery, the learning curve is definitively shorter . Despite the learning curve, no significant complications occurred in this study . There is always a paucity of space in retroperitoneoscopic surgery, and gaur et al reported the however, in our study, we did not encounter such a problem due to judicious and strategic placement of ports . Contrary to this, gaur et al placed all the ports in a single line, which could have resulted in the aforementioned problem . In this study, gilvernet's plane was dissected in 10 cases . It is easier to dissect gilvernet's plane in rp compared to in open surgery because the laparoscope offers a direct view of the renal sinus with excellent anatomical display of all the structures, which is often not possible with the naked eye . In this series, the only significant complications were peritoneal rent, subcutaneous emphysema, and superficial wound infection . But the peritoneal rent did not create much difficulty in dissection and the progression of surgery . Therefore, the peritoneum was adherent firmly to the psoas sheath; and in the absence of a fat cushion, the peritoneum and the psoas sheath were not easily separable, thereby leading to peritoneal rent due to forced separation . In emaciated and small - sized patients, the balloon should not be inflated to full size, which often leads to peritoneal rent . It was observed that inflation of the balloon to 400 ml prevented peritoneal rent in such cases . Excess fat is a disadvantage in rp, as it occupies a major portion of otherwise confined space, leaving little room for dissection and retraction . Also, it leads to bleeding during dissection, but a moderate amount of fat was found suitable as peritoneum could be separated easily and dissection was relatively easier . It is advantageous to insert the balloon inside gerota's fascia and posterior to the kidney, so that only the posterior half of gerota's fascia and perinephric fat are striped off . The anterior half of fascia is kept adherent to the kidney, which helps in keeping the kidney in a relatively fixed position . Following creation of pneumoretroperitoneum, kidney hangs up with the posterior half exposed, thereby requiring a minimal retraction ., this complication was kept to a minimum with the use of the tristar port (ethicon endosurgery, inc ., cincinnati, oh), which has a conical sleeve with a flange around the port that tightly fits into the primary incision and thereby prevents leakage of carbon dioxide gas into parietes . Bleeding in the retroperitoneum can be of either generalized ooze from the dissected peritoneum and parietis or from a specific operative site like the renal pelvis . Keeping the balloon inflated for 3 to 5 minutes to achieve perfect homeostasis can easily control the first type of bleed . The second type of bleed, that is the bleed from a specific operative site, can be minimized by precise knowledge of retroperitoneal anatomy and meticulous dissection . It is necessary to place the double j ureteral stent preoperatively as it is very difficult to insert the stent from the ports intraoperatively due to the paucity of space and continuous leakage of gas . Also, the double j ureteral stent acts as a guide and helps the surgeon to localize the stone . To decrease the morbidity related to prolonged drainage, meticulous closure of the renal pelvis should be carried out . Therefore, it is recommended that surgeons, who are well versed with intracorporeal knotting techniques, should perform this procedure . The mean total analgesic requirement for rp is 10075 mg of diclofenac, which is equivalent to 2 tablets of diclofenac . However, in a parallel study conducted by us, the difference was significant when compared with that of eswl, where the mean total requirement of diclofenac was 1000600 mg . This difference is highly significant and can be explained by the fact that passage of stone fragments causes ureteric colic requiring round - the - clock analgesic cover for several days after eswl . This is significant, as the patients managed with eswl required multiple visits to the hospital (4.52.8) rp is a safe, simple, and effective minimally invasive procedure and is an exciting option for management of renal calculi . It has potential to replace pcnl / eswl as a procedure of choice in a subset of patients with staghorn, large, and multiple calculi . Although at present, it seems relatively unsuitable for caliceal calculi, with more experience and the availability of better hand instruments, even caliceal calculi may become equally amenable to this procedure.
Rickettsia are obligatory, intracellular, small gram - negative bacteria associated with eukaryotic hosts . They are traditionally divided into three groups: the spotted fever group, the typhus group and the scrub typhus group . The spotted fever results from a large group of tick-, mite- and flea - borne zoonotic infections that are caused by closely related rickettsiae . Rickettsia conorii has been identified as the agent causing mediterranean spotted fever (msf). A variety of geographically distinct types of r. conorii have been described that cause variable clinical presentations different from typical msf . A 27-year - old primigravida with a 16week history of amenorrhea and respiratory failure was transfered to a tertiary care center . She had high - grade fever for 8 days prior to the transfer and had developed an erythymatous maculopapular rash on day 4 of the illness, involving the trunk initially, later extending to the palms and soles [figure 1]. Erythematous maculopapular rash in a hand a persistant dry cough, not associated with hemoptysis, was noticed on day 5 . She developed a progressively worsening dyspnea with bilateral ankle edema not associated with oliguria or orthopnea . Her condition deteriorated rapidly, warranting intubation for respiratory failure and transfer to a tertiary care center . On admission to the tertiary care center icu, the patient also had tachycardia (128 beats / min) without any significant st segment changes on the ecg . The blood urea measured 8.7 mmol / dl with a serum sodium of 140 meq / l and a pottasium of 5.0 meq / l . Full blood count showed neutrophilia of 78% in a total of 14.4 10 l. hemoglobin was 7.4 g / dl with a mild thrombocytopenia of 160,000 l . The blood picture revealed normochromic normocytic anemia with no evidence of disseminated intravascular coagulation (dic). The international normalized ratio (inr) was 0.96 . The serum glutamate oxaloacetate transaminase (sgot) activity was 42 u / l and serum glutamate pyruvate transaminase (sgpt) activity was 28 the c - reactive protein (crp) level was 6 mg / dl and the antinuclear antibody (ana) was negative . Chest x - ray on day 1 at icu, showing diffuse bilateral opacities the patient was started on oral azithromycin, iv cefotaxime, iv hydrocortisone 50 mg 6 hourly . The patient's condition deteriorated rapidly on day 3 of icu stay and needed adrenaline, noradrenaline, dobutamine and vasopressin to maintain a blood pressure of 70/50 mmhg . The urine output dropped and the urine microscopic examination revealed granular casts and dysmorphic red blood cells . Blood urea rose to 12.9 mmol / dl and the electrolytes showed pottasium level of 5.6 meq / l . On the 4 day at the icu and 12 day of the disease, she devoloped anuria with further increase in blood urea and serum creatinine . She was hemodynamically unstable with a blood pressure of 60 mmhg even with total inotrope support . Endocardium of the heart showed vegitations on a narrowed mitral valve [figure 4]. The kidneys were of normal size, but the cortico - medullary demarcations were less clear . The grossly hemorrhagic lung the heart showing narrowing and vegetations at the mitral valve the histology of the lung showed gross hemorrhage and foci of pneumonia . The vegetations of the heart were reported as fibrinous with entrapped white cells, but with no bacteria or fungi . Histology of the liver revealed centrilobular necrosis with a tendency to confluence, and a mild fatty change . A final diagnosis of disseminated r. conorii infection with pulmonary hemorrhage, endocarditis and tubulointerstitial nephritis was made . R. conorii is an obligate, intracellular, slow - growing, gram - negative bacterium belonging to the spotted fever group of rickettsiae . Unusual rickettsial strains related to r. conorii have been described as belonging to an r. conorii complex which includes the indian tick typhus rickettsia (atcc vr-597) with r. conorii subsp . It is transmitted to humans through the bite of dog ticks (rhipicephalus sanguineus) widely prevalent among the old world . It is also known to be transmitted by haemaphysalis ticks, especially in pakistan and kenya . The infection is transmitted via larvae and nymphs, and the tick bite is usually not felt . The incubation period ranges from 3 to 15 days depending upon the route of rickettsial entry and the rickettsial load . After introduction into the skin at the site of the tick bite or through the conjunctiva contaminated by blood or excretions from an infective tick, the primary multiplication occurs . In the skin, the localized multiplication of the rickettsiae in the endothelial cells of the capillaries leads to the formation of a raised red papule . The inflammation and thrombosis of the affected capillaries lead to necrosis of the center of the papule and the formation of the typical red lesion with a black center, the tache noire . This is followed by the spread of infection through lympho - hematogenous routes throughout the body, causing disseminated vascular lesions in multiple organs . About 6% of the cases are severe, and fatal cases occur even in young, healthy adults, with a reported death rate of about 2.5% . Old age, alcoholism and glucose-6-phosphate dehydrogenase (g6pd) deficiency are known risk factors for severe disease . The patient described here is from kotagla, a tea estate village in central sri lanka . The patient reported a history of significant exposure to stray dogs, abundant in any sri lankan village, but not of any tick bites . The absence of the tachy noire is significant in this case as the clinical diagnosis of msf (caused by r. conorii subsp . However, the absence of tache noire has been noted in israeli spotted fever caused by r. conorii subsp . The fever starts after an incubation period of 7 days followed by a febrile period (up to 40c, usually continuous) associated with a maculopapular rash . The papules of the rash are first noticed on the 3 to 5 day of illness, and they come out in crops and are palpable as small nodules in the skin . In severe cases, characteristically, the rash involves the palms of the hands, the soles of the feet and, to a lesser extent, the face . In this patient, the rash involved the palms and soles, sparing the face, and was of dusky cyanotic appearence with prominant macules . The cough and the dyspnea reported in our patient were relatively rare in a case series of msf, with a representation of 10% and 21%, respectively . Renal insufficiency is a known complication in around 6% of the patients and is caused by tubulointerstitial nephritis . Myocarditis had been obseved in 11% of patients and might explain the severe tachycardia with poor response to inotropes in this patient . The diagnosis of r. conorii infection in this patient is justfied as there is a compatible clinical picture along with a single titer of> 1/512 . Endocarditis is not described as a complication of r. conorii infection . Identifying r. conorii as the causative organism of endocarditis in this patient is supported by the absence of previous heart disease and lack of clinical features to suggest subacute bacterial endocarditis on admission and during prenatal clinics . The vegetations isolated from this patient as well as the blood cultures did not reveal bacteria or fungi . This patient was correctly started on oral azithromicin and intravenous chlorampenicol at the tertiary hospital . A diagnostic scoring system with microbiological, epidemiologic, and clinical parameters has been proposed for msf and it had shown good sensitivity and specificity . This case highlights the need of clinical suspicion of uncommon diseases based on the geographic and socioeconomic background of a patient . Relatively benign diseases may have severe manifestations resulting in fatality; therefore, physicians should consider there factors for early diagnosis and intervention.
The waste arising from> 60 years of civil and military nuclear operations around the world contains long - lived radionuclides that must be contained and isolated from future populations . Deep geological disposal facilities (gdf) proposed by us and european waste management organisations employ an engineered multibarrier approach (figure 1) to retard the release of radioactive species from the waste in quantities that could be detrimental to life and the environment . The multibarrier design concept typically combines reducing conditions with high ph with the purpose of limiting the solubility and mobility of radionuclide species within gdf if (or when) primary containment fails . General design features of the multibarrier geological disposal facility (gdf) concept proposed for the long - term (10 year) storage of high - level nuclear wastes in the deep subsurface (bgl = below ground level). A significant obstacle to implementation of gdf is public and political concern around risks and consequences of failure against design criteria over the 10 to 10 year required lifespan of the facility, highlighted by several failures to site gdf repositories, e.g., in the uk and at yucca mountain in the usa . Should gdf performance be compromised, it is possible that long - lived, mobile radionuclides will be transported through the engineered backfill into groundwater and pose a long - term hazard to the biosphere and water resources . Thus, it is critical to the safety case for the gdf not only to be able to demonstrate that the design performance is well understood but to show that conditions arising from design failures are also accounted for and mitigated as far as possible . One potentially problematic radionuclide is technetium-99, a high - yield fission product of u, which has a long half - life (2.1 10 years) and high solubility in oxic conditions as the pertechnetate anion [tc(vii)o4]. While the conditions within the gdf are expected to be reducing, such that insoluble tc(iv) should be the dominant oxidation state, the uk nuclear authority estimates suggest that a significant proportion of the uk tc inventory is expected to be present as the tc(vii) pertechnetate species . Performance assessment analysis of tc mobility has shown that the potential risk to future populations from tc critically depends upon its oxidation state, such that tc(vii) presents a significantly greater risk than tc(iv) over the one million year lifetime of the gdf, even when reducing conditions are applied . Therefore, a robust design for the engineered barrier concept should be able to account for the risk arising from the presence and behavior of the mobile tc(vii), separately from the specific probability of oxic conditions occurring or persisting within any given gdf scenario . An improved understanding of the behavior of pertechnetate in proposed barrier materials is also necessary to evaluate the potential of different design specifications to mitigate or remove the potential hazard . Understanding the spatial and temporal dynamics of geochemistry within and surrounding a gdf is essential in this task . The importance of (bio)geochemical gradients on radionuclide mobility is the focus of substantial current research, e.g., refs (911). Such studies ideally require noninvasive, nondestructive measurement of the distribution, migration, and chemical transformation of radionuclides within a physical model of the barrier material . This should be considered over time as internal conditions respond to controlled changes in boundary conditions . Quantitative imaging techniques offer a means of achieving this information and have been developed to study reactive transport in porous media for a range of materials . Imaging techniques include visible light transmission and fluorescence imaging, nuclear magnetic resonance (nmr), and x - ray computed tomography (see ref (14) for a recent review). Gamma attenuation techniques with external americium-241 or cesium-137 sources have been used to determine fluid transported within a column . A key methodological step remains: the extraction of quantitative geochemical information from image data, particularly in three dimensions and opaque materials . Techniques have been developed to quantify, from image data, ph and oxygen gradients in two dimensions (2d) within porous media and to extract transport, deposition, and remobilization rate parameters from time - lapse image sequences of colloidal particles in translucent quartz sand . Recent work demonstrated that gamma - emitting radioisotopes can be used as an effective imaging tracer within opaque sediment and mineral systems, both in static batch experiments and in flow - through columns . These studies utilized ultratrace concentrations of a gamma - emitting technetium isotope, technetium-99 m (commonly used in medical and industrial imaging applications), to demonstrate qualitatively the immobilization of technetium on fe(ii)-bearing sediments and minerals, via an fe(ii)-mediated reduction of tc(vii) to tc(iv). In this study, we report the use of 2d gamma - imaging to quantify tc transport parameters in a simple granular porous media model . Uniform, saturated one - dimensional flow through ottawa quartz sand, as a model test material, is used to demonstrate the ability of gamma imaging to obtain reproducible data sets at the mesoscale (millimeters to decimeters), which can be used to yield transport parameters by fitting standard convection dispersion models . Furthermore, we apply this methodology, for the first time, to investigate the feasibility of direct noninvasive quantification of radionuclide migration within opaque cementitious gdf candidate material (crushed nirex reference vault backfill (nrvb)) under circum - neutral and alkaline ph . The technique represents a base for development of model systems for noninvasive study of radionuclide migration in complex physicochemical environments, critical to establishing the design specifications and safety case for future gdfs, and also for application to other contaminant transport in the subsurface . Replicated flow cells enabled aqueous solutions with and without a tc tracer to be pumped through saturated quartz sand at a steady flow rate with continuous monitoring using a gamma camera . Tc is a controlled radioactive substance; therefore, experiments were performed with appropriate risk assessment in specialist facilities at a hospital which routinely produces and handles the material for use in clinical nuclear medicine . All other chemicals used were obtained from fisher scientific (uk) unless otherwise indicated . Bench - scale flow cells were constructed of two perspex plates separated by viton seals and bolted tightly together (figure 2). The rear plate was solid, while the front plate had an indent creating a void space to hold the porous material . An upper port in the rear plate allowed for input of the aqueous phase to the cell, while a lower port in the same plate allowed for removal of the aqueous phase for control of flow rate and sampling . Flow was from top to bottom along a distance of 70 mm between the ports . Tc tracer was injected through a needle immediately below the inlet port (figure 2). Schematic of the experimental setup showing construction of the flow cells, the pumping system, and image acquisition geometry . The flow cells were filled with 70 g of ottawa sand (99.5% sio2, particle diameter 500700 m) or 45 g of crushed nirex reference vault backfill (nrvb), sieved to 24 mm particle size, ensuring maintenance of appropriate flow rates . Crushing and experimental setup were conducted in air several hours prior to experimentation, in which time some carbonation of the exposed surfaces may have taken place . The possible chemical changes that might be expected for degraded backfill are outside the scope of the current study and are thus not addressed in this model gdf system . The sand was washed and sonicated in ultrahigh quality water (18 m) five times to remove any existing impurities and oven - dried for 24 h prior to use . The nrvb material was prepared by mixing 130.1 g of ordinary portland cement, 49.12 g of ca(oh)2, 143.1 g of caco3, and 177.76 ml of water in a hobart mixer, giving a w / s ratio of 0.552 . It was cured at room temperature for 28 days and kept sealed prior to use . Duplicate flow cells containing sand were saturated with 16 ml of ph 5.7, deionized water (18 m) so that the material plus aqueous phase filled the cell above the inlet port . A 3 mm depth of solution was maintained above the top of the material to ensure a uniform pressure head across the flow field . Identical flow cells were prepared using a ph 10.7 buffer solution (0.05 m nahco3, 0.1 m naoh). A flow cell containing nrvb was saturated with 25 ml of deionized water at ph 5.7 (18 m). The porosity calculated from the ratio of solution volume to total saturated pack volume was 0.37 for sand and approximately 0.77 for the crushed nrvb, taking into account the internal porosity of the material itself (estimated as 0.55). Bulk densities of the porous materials as packed were 1.68 and 1.57 kg dm for sand and nrvb, respectively . Fully constructed, prefilled flow cells were transported to the nuclear medicine department of the royal hallamshire hospital (sheffield, uk) for imaging . Flow was maintained in the cells at 0.33 ml min using a multichannel peristaltic pump (watson marlow, uk), yielding a calculated pore velocity equal to 4.29 10 m s for the sand and 2.05 10 m s for the nrvb (due to the greater porosity). The darcy flux in both cases was 1.5 10 m s. flow cells were flushed with tc - free solution for 20 min to establish uniform flow conditions prior to injection with tc and subsequent imaging . Imaging was performed on a dual - headed ge medical systems infinia gamma camera (ge medical, milwaukee, wi, usa) fitted with a high resolution collimator . A dynamic acquisition with 30 s frame intervals was initiated a few seconds prior to injection of the tc into the flow cells . Images were acquired with a matrix size of 256 256 resulting in a pixel size of 2.2 mm . The spatial resolution of the imaging system was measured at the collimator face using standard nema testing techniques and was found to be 4.6 mm fwhm . This equates to a spatial resolution of 6 mm at the location of the flow cells . Due to the low spatial resolution tc as pertechnetate [tc(vii)] was produced on - site via saline - based elution of a ge medical systems drytec tc generator . This volume gave an activity of 1520 mbq at the time of the experiment . This corresponds to tc concentrations of <1 mm . The activity in each syringe was accurately measured in a capintec crc-15r radionuclide calibrator . Following injection of the tc into the flow cells as instantaneous pulses (<1 s injection), the residual activity in each syringe was measured and this reading was subtracted from the full reading to determine the exact activity injected into each cell . In all cases, tc activity readings were decay - corrected to the time the gamma camera acquisition was started (eq 1, 2):12where a0 is the corrected activity (mbq), at is the uncorrected activity (mbq), k is the decay constant (s), t is the time elapsed (s), and t1/2 is the half - life of tc (21 636 s). For each flow cell, a sensitivity value (counts per mbq) was determined so that image counts could be related directly to tc activity . This sensitivity value was calculated by using region of interest (roi) analysis to determine the image counts per frame within the region of the cell, averaged over the first 4 frames following injection of the radioisotope . During this early period, this averaged count value was then divided by the known activity injected into the cell to yield a sensitivity factor (eq 3):3where sf is the sensitivity factor, xci is the mean of the counts from the first four frames of image acquisition (counts pixel), and a0 is the initial activity (mbq). This sensitivity factor was applied to all decay - corrected gamma counts throughout the experiments to yield the concentration c (mbq pixel, normalized by the volume of pores in each pixel to give mbq ml) of tc at any location in each time step . Raw image data were calibrated using the sensitivity factor (eq 3) to give 2-d planar spatial arrays of tracer concentration data at 30 s intervals for up to 3 h during and after transit of the main mass of tc through the flow cell . Spatial moments in the direction of travel were calculated at the center of mass of the plume using imagej software . Calibrated concentration maps showing contours of tc mass within the flow cells were produced by interpolation of the 2-d data arrays using surfer 9.0 software (golden software, ca). The transport of the tc through the uniform saturated flow field was modeled using a one - dimensional (1-d) convection dispersion equation for reactive solute transport (eq 4):4where, subject to specified initial and boundary conditions, c is the aqueous concentration of a tracer at a given distance along the center of mass from inlet x (m) and elapsed time t (s), (s) is a first - order decay coefficient describing irreversible removal from the mobile aqueous phase, r is a retardation factor describing equilibrium interaction with the solid phase, and d is a dispersion coefficient equal to the product of the longitudinal dispersivity (m) and mean pore flow velocity, vp (m s). A numerical solution to eq 4 was implemented in inverse (parameter - fitting) mode in excel - cxtfit software to yield transferable parameters describing the transport of the radionuclide in the ottawa quartz sand and nrvb . Figure 3a d shows the calibrated concentration distribution data for tc transport through the ottawa sand at ph 5.7, at 8 (0.29), 16 (0.58), 24 (0.87), and 32 (1.16) minutes after injection . Values in parentheses and all time data thereafter are expressed in pore volumes (pv), where time is normalized by the transit time of a volume of solution equal to the volume of void spaces in the sand . Under the conditions of these experiments, 1 pv was equivalent to 1650 s (27.5 min) of travel time . The tc tracer passed through the saturated sand as well - defined plumes with peak concentrations in the center approximately 10 2 mbq ml . Figure 4 shows the total tc activity measured in the sand as a function of time for experiments at ph 5.7 and 10.7 . This behavior was highly reproducible for experimental runs at both ph 5.7 and 10.7 . Residual activities measured after 2 pv (not shown) were less than 1% of the total activity injected and were not significantly different from zero, taking into account the assumed measurement error quantified by the standard deviation (1%) for total activity measurements made between 0.25 and 0.5 pv . Calibrated concentration distribution from gamma camera images of tc activity in ottawa quartz sand in a ph 5.7 solution at (a) 0.29 pv (8 min), (b) 0.58 pv (16 min), (c) 0.87 pv (24 min), and (d) 1.16 pv (32 min) and in nirex reference vault backfill at (e) 0.3 pv (20 min), (f) 0.6pv (40 min), (g) 0.9 pv (60 min), and (h) 1.2 pv (80 min). Total measured activity of tc (normalized to input activity) as a function of time (expressed as pv, normalized to flow rate) during transport through ottawa quartz sand s1 and s2 at ph 5.7 and s3 at ph 10.7 and nrvb . Figure 3e h shows calibrated concentration distributions for tc transport in nrvb at 0.3, 0.6, 0.9, and 1.2 pv . Due to the lower pore velocities in nrvb than in sand, 1 pv was equivalent to 4300 s (71.5 min) of travel time . The peak concentration at 0.3 pv was 12 mbq ml, measured at 3 cm from the injection point . After 0.6, 0.9, and 1.2 pv, the peak concentrations were measured as 10, 9, and 8 mbq ml, respectively, at 4, 5.5, and 6 cm from the tracer injection point (figure 3). The total tc activity measured in the nrvb as a function of time is shown in figure 4 . As in sand, total activity decreased broadly symmetrically around 1 pv, indicating conservative transport with longitudinal dispersion . Residual activity at the end of the measurement period was less than 2% of the initial activity and not significantly different from zero, taking into account variability in the image data quantified as noted above . Tc activity was summed across horizontal pixel rows (normal to the vertical direction of transport through the cells) to yield concentration profiles which could be expressed as a function of distance from inlet or time since tracer injection . These data were fitted with the 1-d convection dispersion model (eq 4). In individual experiment runs s1s3 and n1n2 (table 1), the model was regressed to concentration profiles measured at five distances from the inlet simultaneously, using the linear least squared error method . The best fit model parameters for each experiment condition are shown in table 1; irreversible sorption parameter was never larger than zero and is therefore not tabulated . Figure 5a compares data from an individual experiment run in sand with the output from the model run in forward mode for the same distance intervals, using averages of the parameter values shown in table 1 . The correlation between the model and data is very strong (r = 0.98). Figure 5b shows equivalent data and model output (r = 0.99) for nrvb . Dispersion model (lines) to measured tc concentrations (data points) in (a) ottawa quartz sand and (b) nrvb material at several distances from the inlet during uniform saturated flow . The parameters obtained from numerical modeling of tc transport in sand (table 1) strongly indicate conservative transport (r = 1) of the tc through the ottawa quartz sand . This conclusion is supported by independent spatial moments analysis of the calibrated image data (figure 6), which yields a mean velocity for the center of mass of the tc plumes in sand of 4.32 10 m s. the transport velocity for the tc was therefore not significantly different from the pore velocity in the quartz sand (4.29 10 m s) calculated a priori . In contrast, both spatial moments and numerical modeling yielded the same mean transport velocity for tc transport through nrvb, 1.64 10 m s, which was slower than the calculated pore velocity based on the internal and boundary conditions of the experiment (2.05 10 m s). This may be due to errors in estimation of the internal pore structure of the nrvb which may be discontinuous, creating regions of low flow or immobile pore water . While r remained close to 1 indicating conservative transport, the longitudinal dispersivity,, for nrvb was 0.0033 m, more than three times that modeled in sand . Tracer plume center of mass (com, first spatial moment in the direction of flow) plotted as a function of calculated water movement for tc transport through ottawa quartz sand and nrvb . Data are averages of experimental replicates . The sorption of solutes to a solid phase is often described by an equilibrium linear sorption coefficient kd (m kg) estimated from batch experiments, which contain a known volume of solution, concentration of solute, and mass of solid phase, yielding (eq 5):5where c0 and cs are, respectively, the initial solute concentration in solution and final equivalent concentration on the solid phase, m (kg) is the mass of solid phase, and v (m) is the volume of the fluid . We approximated these parameters by normalizing the known input activity and the observed retained activity by the volume and mass of porous media in the flow chamber, to obtain an estimate for kd (we denote this method m1). For reactive transport through porous media and assuming that surface reactions occur sufficiently rapidly relative to transport that equilibrium can be achieved, kd can also be related both to the retardation factor r in the convection dispersion equation (denoted method m2) and to the ratio of mean transport velocities obtained from spatial moments analysis (method m3) by eq 6:6where is the porosity, b is the bulk density (kg m) of the porous media, and vtc is the mean velocity of mass flux (m s). Estimated sorption coefficients for both sand and nrvb were small, of the order 10 m kg, which is consistent with the transport parameters obtained from the convection dispersion modeling and the observed low retention of tc in the sand after 2 pv . Although the model - derived errors associated with nrvb were relatively large, kd as estimated by all three methods was consistently greater in nrvb (approximately an order of magnitude) than in sand (table 1). We reiterate that kd as calculated assumes equilibrium in the underlying sorption reactions; however, we cannot confirm this with the data reported here and, as such, our values may be biased toward underestimation . We do note, however, the empirical observation that after a relatively short period of flushing of the mobile tc plume from the flow chamber, less than 12% remained suggesting that the sorption that does occur within the transit time of the plume may be readily and rapidly reversible when solute concentrations return to zero, for both materials under these experimental conditions . We are also aware of the possibility that some irreversible sorption (12%) may occur as it is hard to rule out this condition without sorption capacity measurements . In the interpretations that follow, we recognize that several assumptions and simplifications have been made in the model gdf systems investigated . These have been made in order to demonstrate the applicability of the gamma imaging technique to radionuclide transport in a gdf and, as such, provide the basis for future detailed experimentation . The limited retardation (r 1) interpreted using the model, very low estimated kd obtained with the different methods, and the minimal retention of tc in the sand at the end of the experiments imply closely conservative transport of tc through ottawa sand . Although this is the first time that this has been confirmed directly, it is not an unexpected result . The point of zero charge (pzc) of ottawa sand is between ph 2 and 5, so at the ph of these experiments (> 5.7), the sand surface is negatively charged . Since the pertechnetate anion (tco4) is also negatively charged, chemical sorption is therefore impeded by repulsive electrostatic interactions between the tc and sand . This indicates that tc(vii) may be transported freely in environments where the substrate has only negatively charged surfaces . Such pure - phase interactions are a simplification of natural environments, especially where significant quantities of fe(ii) or other minerals capable of reducing tc(vii) to the less mobile and less soluble tc(iv) are present or in environments where microbially mediated reactions may take place to alter the oxidation state of technetium . Nevertheless, these results highlight the utility of quantitative measurements of transport parameters for tc(vii) in opaque porous media, that may be applied to substrate related to gdf concepts (e.g., clay, host rock). We have shown that it is possible to obtain quantitative transport data using the gamma imaging technique in opaque engineered backfill material . Pertechnetate transport in nrvb in our gdf - proxy experiments was closely conservative, i.e., our data pertaining to tc transport in this material showed no significant retardation and very low sorption coefficients . Previous studies have suggested low sorption coefficients for tc(vii) in batch experiments using aged, crushed nrvb, and our study indicates, for the first time using quantitative imaging, that such observations may translate into a significant potential for transport of tc(vii) through a backfill candidate material in a model flowing groundwater system . Despite the low spatial resolution of the gamma images, tc transported through nrvb exhibited a greater dispersivity and slower transport velocity than in sand . Discontinuities in the internal structure may create significant immobile (very low flow) zones within the pore space . Further work on nrvb will explore the use of a mobile - immobile (mim) transport model (e.g., tang et al . ), to better elucidate the dynamics of solute transport through this material . The quantitative gamma imaging technique described in this paper represents a rapid and convenient method for obtaining transport data for tc . The main advantage of this technique is that quantitative images can be obtained in opaque media; it is possible to see the retained mass as a function of time and space, allowing for a direct visual quantification of transport parameters . Furthermore, in experiments where the sorption can be controlled for, it may be possible to visualize and quantify sorption . This multitude of information is such that transport models, such as cxtfit used here to test and validate the methodology, may not be required to derive transport parameters . The spatial resolution presented in this methodology was relatively low (6 mm), largely as an artifact of the spatial constraints placed upon using a working hospital camera . However, higher spatial resolution, and thus accurate dispersivity measurements, should be possible, depending upon the quality of the instrument and proximity to the collimator . Quantitative gamma imaging has several potential applications to contaminant transport in opaque media . In the context of geological disposal of nuclear waste, the transport of i from the waste and through the engineered barrier is a key concern due to its long half - life (15.7 10 years), high solubility, and poor sorption . Gamma imaging coupled with the -emitting i radiotracer could be used to develop an understanding of iodine transport behavior and thus support engineered barrier material design . Because the gamma camera can detect ultratrace concentrations of radionuclides, several gamma - emitting isotopes could also be used to nondestructively quantify the transport of environmental contaminants in soil, such as chromium (cr) or mercury (hg). This highlights the potential versatility of the technique, applicable to a wide range of scenarios as a novel tool to understand the spatial and temporal dynamics of the geochemistry of a variety of radiotracers in opaque media.
Specific chimeric iga1 and iga1/igg1 domain swap mutants were expressed as previously described (16, 17). Antibodies were eluted with 200 mm arsanillic acid (sigma chemical co.) in 200 mm tris - hcl, ph 8.0, which was removed by extensive dialysis against pbs . Mono- and dimeric iga were detected by 4% nonreducing sds - page analysis . The hexahistidine - tagged human pigr extracellular domain was expressed in a similar manner and purified on a ni - nta agarose (qiagen) column (18). The c3 loop mutants l1, l2, and l3 were constructed by pcr soeing (splicing by overlap extension; reference 19) using the following complementary pairs of sense (s) and antisense (as) primers: l1s 5-gagcccagcgcgggcgccgccgccttcgctgtg-3, l1as 5-ctcgggtcgcgcccgcggcggc - ggaagcgacac-3; l2s 5-tacctgactgcggcagccgcgcaggagccc-3, l2as 5-atggactgacgccgtc - ggcgcgtcctcggg-3; and l3s 5-cggcaggaggccgccgcggccaccaccacc-3, l3as 5-gccgtcctccggcggcgccggtggtggtgg-3. The outer primers b1 - 2 (5-cctataaccatgggatggagcttcatc-3), specific for the 5 leader of the vh region of this chimeric iga heavy chain, and c3 - 3 (5-ccctctagattagtagcaggtgccgtccac-3), specific for the 3 tailpiece encoding sequence of the iga1 gene, were used with the above primer pairs l1l3 to generate pairs of 5 and 3 fragments with complementary overlaps . These fragments were gel purified then spliced in a further pcr reaction using the outer primers b1 - 2 and c3 - 3. modified iga1 genes were cloned into the baculovirus transfer vector using xbai and ncoi digestion and the insert sequences were verified . Madin - derby canine kidney (mdck) cells were placed in serum - free mem plus earle's salts (mediatech, inc .) Cells were harvested in 10 mm edta in pbs and washed in pbs 0.1% bsa . Pigr binding of human iga1 antibodies and mutants was assessed by incubation of 100 l antibody in pbs / bsa with 10 cells for 1 h. cells were washed three times in pbs / bsa and bound antibody was detected with 100 l of an anti human fitc conjugate (sigma chemical co.) diluted 1:100 . Data collection and analysis were performed with the lysysii (becton dickinson) and winmidi (http://facs.scripps.edu) or with the cellquest programs (becton dickinson). The random 40-mer peptide library was constructed in the pcantab5e vector and has an actual total diversity of 1.55 10 (20). The random 40-mer is flanked by two peptide tag sequences, preceded by a leader peptide and fused to the membrane - proximal domain of the m13 phage coat protein iii . 12 10 mdck cells were harvested in 5 ml pbs plus 10 mm edta at 37c, washed twice in 15 ml pbs, and resuspended in 1.8 ml pbs at 4c . 100 l phagemid library stock (4.5 10 cfu) was added and incubated for 1 h at 37 or 4c . Bound phage were eluted with 2 ml of 0.1 m glycine/ hcl, ph 2.2, containing 0.1% bsa for 10 min and neutralized immediately with 400 l of 2 m tris base . Phage rescue and amplification were carried out in escherichia coli strain tg1 (pharmacia) according to standard procedures (21). Dna sequencing was carried out on double - stranded plasmid or phagemid dna using an abi 377 prism (applied biosystems, inc .) Alignments of deduced peptide sequences and ig - constant regions were carried out using the map (22) and pima (23) software . Specific chimeric iga1 and iga1/igg1 domain swap mutants were expressed as previously described (16, 17). Antibodies were eluted with 200 mm arsanillic acid (sigma chemical co.) in 200 mm tris - hcl, ph 8.0, which was removed by extensive dialysis against pbs . Mono- and dimeric iga were detected by 4% nonreducing sds - page analysis . The hexahistidine - tagged human pigr extracellular domain was expressed in a similar manner and purified on a ni - nta agarose (qiagen) column (18). The c3 loop mutants l1, l2, and l3 were constructed by pcr soeing (splicing by overlap extension; reference 19) using the following complementary pairs of sense (s) and antisense (as) primers: l1s 5-gagcccagcgcgggcgccgccgccttcgctgtg-3, l1as 5-ctcgggtcgcgcccgcggcggc - ggaagcgacac-3; l2s 5-tacctgactgcggcagccgcgcaggagccc-3, l2as 5-atggactgacgccgtc - ggcgcgtcctcggg-3; and l3s 5-cggcaggaggccgccgcggccaccaccacc-3, l3as 5-gccgtcctccggcggcgccggtggtggtgg-3. The outer primers b1 - 2 (5-cctataaccatgggatggagcttcatc-3), specific for the 5 leader of the vh region of this chimeric iga heavy chain, and c3 - 3 (5-ccctctagattagtagcaggtgccgtccac-3), specific for the 3 tailpiece encoding sequence of the iga1 gene, were used with the above primer pairs l1l3 to generate pairs of 5 and 3 fragments with complementary overlaps . These fragments were gel purified then spliced in a further pcr reaction using the outer primers b1 - 2 and c3 - 3. modified iga1 genes were cloned into the baculovirus transfer vector using xbai and ncoi digestion and the insert sequences were verified . Madin - derby canine kidney (mdck) cells were placed in serum - free mem plus earle's salts (mediatech, inc .) Cells were harvested in 10 mm edta in pbs and washed in pbs 0.1% bsa . Pigr binding of human iga1 antibodies and mutants was assessed by incubation of 100 l antibody in pbs / bsa with 10 cells for 1 h. cells were washed three times in pbs / bsa and bound antibody was detected with 100 l of an anti human fitc conjugate (sigma chemical co.) diluted 1:100 . Data collection and analysis were performed with the lysysii (becton dickinson) and winmidi (http://facs.scripps.edu) or with the cellquest programs (becton dickinson). The random 40-mer peptide library was constructed in the pcantab5e vector and has an actual total diversity of 1.55 10 (20). The random 40-mer is flanked by two peptide tag sequences, preceded by a leader peptide and fused to the membrane - proximal domain of the m13 phage coat protein iii . 12 10 mdck cells were harvested in 5 ml pbs plus 10 mm edta at 37c, washed twice in 15 ml pbs, and resuspended in 1.8 ml pbs at 4c . 100 l phagemid library stock (4.5 10 cfu) was added and incubated for 1 h at 37 or 4c . Bound phage were eluted with 2 ml of 0.1 m glycine/ hcl, ph 2.2, containing 0.1% bsa for 10 min and neutralized immediately with 400 l of 2 m tris base . Phage rescue and amplification were carried out in escherichia coli strain tg1 (pharmacia) according to standard procedures (21). Dna sequencing was carried out on double - stranded plasmid or phagemid dna using an abi 377 prism (applied biosystems, inc .) Automated sequencer . Alignments of deduced peptide sequences and ig - constant regions were carried out using the map (22) and pima (23) software . Chimeric human iga1 (16) and a panel of iga1/igg1 constant region domain swap mutants (24) with murine - encoded arsonate specificity were expressed in baculovirus as both monomer and dimer, affinity purified, and used to define the pigr binding site . Diga was operationally defined as an iga preparation generated by coexpression of iga with j chain . Mdck cells, transfected with rabbit pigr (25), were used to measure binding of recombinant iga1 mutants to the receptor by facs analysis (fig . Mutant vgaa, in which the c1 domain was substituted with the c1 domain, bound to the pigr in a manner similar to wild - type iga1 (fig . . 1 c, heavy line) bound to the receptor, whereas the monomer (light line) did not . Similarly, the vgga mutant, in which both c1 and c2 including the hinge of iga were replaced with the analogous domains from igg, bound as a dimer but not as a monomer (fig . Thus, the c1 and c2 domains of diga are not necessary for pigr binding, suggesting that the presence of the c3 domain is required . Diga contains four c3 domains and the covalently bound j chain which, together with the iga tailpiece, are responsible for iga polymerization . To reduce the complexity of this problem, a library of random 40-mer peptides, expressed as a phage display library (20), was selected against pigr - expressing mdck cells . The goal was to identify putative pigr binding sites within iga by reducing them to a minimum peptide binding unit, a proven approach for several receptor ligand interactions (2628). Selection was carried out on live pigr - expressing mdck cells in suspension with negative selection on nonreceptor expressing cells . Recovery of both acid - eluted and cell - associated phage increased gradually from 6 10 to 5 10 cfu over 46 successive rounds, indicating enrichment for specific binding clones . Individual clones were randomly selected from the final panning from the acid - eluted and membrane - associated fractions and sequenced . Binding of the enriched phage populations to recombinant human pigr, as measured by elisa, increased with successive rounds of panning and was inhibited by polymeric igm (data not shown). Sequencing of phagemid dna showed that 20 out of 32 acid - eluted clones and 12 out of 32 cell - associated clones had open reading frames (fig . There is little clonality among these two groups of sequences, although the a22 peptide was recovered three times . These peptides were aligned for maximum homology with the human iga1 c3 region amino acid sequence (fig . Many of the peptides, particularly a12 (9 out of 30 identical amino acids) (fig . 3 a), show homology with human iga1 c3 domain, prompting a further examination of the amino acid sequence and structure in this area . The human c3 domain is 40% identical and 62% homologous to the corresponding region of human igg1 at the amino acid level . Accordingly, the human igg1 crystal structure (29) was used to predict the likely positions of the major structural motifs (-strands and loops) within the iga1 sequence, an approach used previously to map the fcr (cd89) binding site on iga1 (24). 3 a shows the alignment of the peptide a12 with the iga1 sequence and the corresponding igg1 sequence with its secondary structural features . The a12 peptide is homologous to a region that in the igg structure forms an exposed 6-amino acid loop between two -strands . However, in iga1, this area contains a 3-amino acid insertion to expand the loop to 9-amino acids . The flanking -strand sequences and part of the loop are conserved between iga and igg, which suggests that gross structural features are also conserved . 3 b shows alignment of this region in the ch3 domain of five mammalian iga molecules aligned with the four human igg subclasses . Despite sequence differences in the loop, all iga sequences have the three additional amino acids, whereas the igg sequences do not . Similar to iga, the sequence of igm contains a 2-amino acid insertion at this site (data not shown). On the basis of these observations, three mutant iga1 molecules were constructed and expressed in baculovirus to examine the effect of amino acid changes in this area on pigr binding (fig . Mutations were made in the loop itself (l1 and l3) and in the -strand nh2-terminal to the loop (l2) as a negative control . Binding was then measured to the physiologically relevant human receptor by elisa using the purified recombinant extracellular domain of human pigr expressed in baculovirus as previously described (18). 4 shows the binding of iga1 monomer, iga1 dimer, and igg compared with the monomeric and dimeric forms of the l1, l2, and l3 mutants to purified human pigr . Only dimeric wild - type iga1 and dimeric l2 mutant, in which the mutations are in the -strand nh2-terminal to the loop, mutations within the loop itself, namely l1 and l3, abrogate the binding of the dimeric iga1 mutant molecules to the pigr . Similar binding patterns were obtained with the loop mutants and rabbit pigr - expressing cells as measured by facs (data not shown). These results indicate that this c3 loop is the major binding motif for the pigr on diga . Iga is, in functional terms, closely related to igm, sharing its ability to polymerize and be secreted . The presence of amino acid sequence insertions in all the polymeric igs that are ligands for this receptor and the absence of insertions from non - pigr binding igs (fig . The variation in the insertion size and the actual iga and igm sequences may reflect differences in fine structure of these polymeric antibodies or in their affinity for pigr binding . The fact that monomeric iga is not secreted suggests that either a conformational change induced by polymerization is required for diga binding to the receptor or that the binding requires a polyvalent interaction of these c3 sites with the receptor . The presence of j chain is required for optimal iga (or igm) polymerization but its precise role in ig secretion remains to be elucidated . The increase in binding observed with dimeric l3 when compared with monomeric l3 (and to a lesser extent with the l1 mutants) suggests that j chain and/or polymerization may play a role in binding (fig . Although amino acids 402410 in the c3 domain of diga define a major pigr binding site, other diga structures may be involved . Deficient mice express lower levels of polymeric iga and have impaired hepatic transport of iga (which humans lack) but normal levels of iga at mucosal epithelial sites, compared with wild - type mice (30, 31). J chain thus may not be necessary for secretion of iga but still required for stable binding to the secretory component in the mucosal environment; however, alternative secretory mechanisms may also be involved . Further studies are underway with peptides and additional mutations to examine the nature of the interaction between iga and the pigr as well as the role of j chain . The ability of a peptide sequence to confer mucosal secretion upon a molecule may prove a powerful means of delivery of therapeutic molecules to mucosal areas where they may prevent the entry of pathogens . Binding of monomeric and dimeric iga / igg domain swap mutant antibodies to pigr expressed on mdck cells . (a) staining of mdck cells with sheep anti - pigr (heavy line) antiserum or normal sheep serum (broken line) followed by anti - sheep igg fitc conjugate . (b) binding of wild - type iga monomer (thin line) or dimer (heavy line) to pigr on mdck cells . (c) binding of vgaa mutant expressed as monomer (thin line) or dimer (heavy line) to pigr on mdck cells . (d) binding of vgga mutant expressed as monomer (thin line) or dimer (heavy line) to pigr on mdck cells . Alignment of deduced peptide sequences from selection of phage display peptide library against pigr receptor expressing cells with the human c3 domain amino acid sequence . Peptides designated a or m are from the acid - eluted and cell - associated fractions, respectively . Comparison of igg1 and iga1 ch3 sequences and igg1 structure in the area homologous to several phage - derived peptides . Iggstr indicates structural features of igg1 where <denotes a -strand running in a descending orientation (i.e., hinge to ch3 direction),> denotes a -strand running in an ascending direction (i.e., ch3 to hinge direction), and denotes a loop or open structure (29). (b) comparison of several mammalian iga sequences with the four human igg subclasses showing the additional iga - specific amino acids present in the loop at positions 402410 in the iga sequence . Hu, human; gr, gorilla; mur, murine; rab, rabbit . (c) iga1 c3 mutants l1, l2, and l3 aligned with the c3 and c3 wild - type sequences and c3 structure (iggstr). = denotes sequence identity in the mutants, denotes a space introduced in the igg sequence to maximize homology, and iggstr is labeled according to panel a. numbering of iga1 and igg1 is according to references 5 and 29, respectively . Binding of iga mutants l1, l2, and l3 to purified human pigr by elisa . The extracellular domain of human pigr was purified after expression in baculovirus and coated onto elisa plates at 10 g / ml . Chimeric iga1 and iga1 c3 mutants l1, l2, and l3 were expressed as both monomeric (m) and dimeric (d) forms along with chimeric igg1, purified and incubated on the pigr - coated plates to compare their abilities to bind to pigr.
Mauriac syndrome is a rare syndrome associated with type 1 diabetes (t1 dm) in children . The incidence of this syndrome had decreased significantly with introduction of long - acting insulin and better control of blood sugar . Recently, there has been re - emergence of this syndrome, especially with the use of premix insulin . A 15-year - old type 1 diabetic boy was referred to us for evaluation of short stature . He was diagnosed to have t1 dm, following an episode of diabetic ketoacidosis (dka) 8 years back, and was started on premix (30/70) insulin . Examination showed that he was significantly short for his age, height 131 cms (less than 3 percentile), weight 28 kg (less than 3 percentile) and body mass index of 16.31 . He had abdominal fat deposition [figures 1 and 2] and liver was palpable clinically 5 cms below costal margin [figure 3] with no splenomegaly or free - fluid . Short stature, abdominal obesity short stature, abdominal obesity investigations showed haemoglobin of 13.5 gm / dl . Ultrasound abdomen showed liver enlargement 15.5 cms with increased echotexture, with normal spleen and portal vein and no free - fluid . On evaluation for diabetic status, he had an hba1c of 10.3%, urine microalbumin 70 g / gm of creatinine, and fundus showing background diabetic retinopathy . He had a bone age of 10.2 years, (tanner whitehouse 2) thyroid - stimulating hormone (tsh) of 2.4 miu / ml and t4 of 8.8 microgm / dl . His growth hormone (gh) stimulation test and overnight dexa methasone suppression test were normal (after blood glucose control and testosterone priming). Based on the clinical history and investigations, the final diagnosis of mauriac syndrome was made and the patient was advised tight control of sugars . He was switched over to basal bolus regime, with glargine in the night and three doses of short - acting insulin before meals . Mauriac in 1930, described growth failure and maturational delay with hepatomegaly and abdominal distension in children with t1 dm, who were treated with short - acting insulin . Hepatomegaly was commonly observed in children in the earlier periods of diabetic treatment, when only short - acting insulin was available and aglycosuria was the objective of treatment . It was noticed that the hepatomegaly regressed when the children were given the newly introduced protamine zinc insulin, providing better sugar control . In the late 1930s joslin clinic reported a case series of 60 youngsters with hepatomegaly, growth failure, delayed sexual maturation, and severe uncontrollable diabetes . Equal incidence is reported in males and females, with most of the cases occurring during adolescence . With better control of sugar, the incidence of this syndrome has reduced rapidly and in the current era this is a very rare syndrome . Two different forms of mauriac syndrome have been described, based on the presence or absence of obesity . In first form, as classically described, treatment with regular insulin alone there is associated cushingoid obesity and documented - wide fluctuation between hyperglycemia and hypoglycemia, suggestive of a pattern of over - and under - insulinization, with secondary hyperadrenalism . Periods of over - insulinization appear to be essential for the development of obesity, and for the induction of hyperadrenalism . Recently, mauriac syndrome has been reported in patients who are not obese and are without a history of alternating hypoglycemia and ketoacidosis . This occurs in patients who have been given regular, under the dose insulin . Inadequate glucose to the tissues, decreased insulin - like growth factor-1 and gh levels, hypercortisolism, resistant or defective hormone receptor action contribute to stunted growth and delay in puberty . The cause of hepatomegaly is thought to be due to the deposition of glycogen in the liver, and similar subcutaneous deposition gives rise to the round moon like facies . Growth failure, delayed puberty and hepatomegaly in mauriac's syndrome improves with glycemic control . Aggressive glycemic control has been associated with worsening of retinopathy, which should be monitored . Mauriac syndrome is a rare manifestation of poorly treated t1 dm . With aggressive glycemic control,
Obstructive sleep apnea (osa) is characterized by frequent episodes of termination of respiratory airflow caused by upper airway collapse during sleep, followed by oxyhemoglobin desaturation, persistent inspiratory attempts against the obstructed airway and arousals from sleep . The inspiratory airflow can either decrease (hypopnea) or be completely absent (apnea), and an apnea that lasts 10 seconds or longer, associated with ongoing ventilatory effort, characterizes a patient with osa . The airflow limitation episodes are usually accompanied by decrease in hemoglobin level, which are usually terminated by quick micro - arousals as a result of excessive respiratory drive caused by the continuing hypoxemia [23]. To establish a definite diagnosis, the diagnosis of osa is confirmed when a person has an apnea / hypopnea index (ahi: number of apneas and hypopneas per hour of sleep) of more than five events per hour, associated with symptoms of excessive daytime sleepiness . Although known to be a benign disease, numerous studies have shown that osa is usually correlated with increased morbidity and mortality because of cvd such as systemic and/or pulmonary hypertension as its most common consequence, heart failure, myocardial infarction and stroke [69]. Oxyhemoglobin desaturation - resaturation, which is common in osa patients, results in free radical production, release of proinflammatory cytokines and prothrombotic mediators and endothelial dysfunction and leads to sympathetic nervous system activity and increased blood pressure, as well as impairment of cerebrovascular auto - regulation . Continuous positive airway pressure (cpap) has been shown to have cardio protective effects, decreasing mortality and morbidity among these patients [1214]. Numerous community - based studies have examined the relationship between osa and cvds [10, 1821]. Based on these studies, age, gender, smoking status, bmi, ahi, total sleep time and day sleepiness were some of the clinically important predictors of cvd outcomes in osa patients . We hypothesized that the ahi, currently used to determine the severity of osa, is not by itself enough to accurately predict cardiovascular outcomes in individuals with osa . We also hypothesized that several factors such as patients demographic and clinical characteristics would have greater accuracy for predicting cvds . Based on our electronic search, there is no published data about the prevalence of cvd among the iranian population with osa . Our study aimed to resolve conflicting evidence on the impact of severity of osa, gender, age, bmi, smoking status and socioeconomic status on the association between osa and development of cvds . Medical files of 385 patients (from 2009 to 2011) with definite osa, confirmed by overnight polysomnography were selected in noor sleep clinic, tehran, iran . Participants were eligible if they only had osa (not other types of sleep apnea such as central or mixed sleep apnea) with ahi of equal or more than five events / hour . Demographic data were collected from patient files and included gender, age (as reported by patients), smoking status and educational status (last academic degree reported by patients). Three modes for smoking status were considered: never - smoker, ever - smoker and ex - smoker . Bmi (weight in kilograms divided by the square of height in meters) and ahi (events per hour) were derived from the polysomnography reports . Several questions were designed in a questionnaire to detect cvds such as presence of cvd, type of cvd and medications used . If there was any controversy in the answers, the patients were questioned about their disease status to clarify their health / disease state . The data were analyzed using single regression analysis followed by multiple regression analysis (by backward method) to identify variables that were independently associated with cvd . The majority of patients were males (71.9%). Among the studied individuals, 26.5% showed at least one sign / symptom of cvd and hypertension was the most commonly reported sign (74.5%). Demographic characteristics and polysomnographic data of patients in cvd positive and cvd negative groups (values are presented as meansd) of patients, 17.9% had hypertension, 2.6% had coronary artery disease, 0.5% had arrhythmia and 0.3% had stroke; 2.3% of the patients had both hypertension and coronary artery disease, 0.3% had both hypertension and history of myocardial infarction and 0.3% had both hypertension and history of stroke; 0.8% of patients had myocardial infarction and one of them had hypertension as well . All variables had a significant association with cvd, except for smoking status (p=0.77). We only selected variables with p - values less than 0.20 in simple regression analysis and entered them into the multiple logistic regression model . Multiple logistic regression analysis showed that the odds ratios for one grade increase in bmi and one year increase in age were 1.13 and 1.12, respectively (p<0.001). In presence of these variables, severity of apnea, gender and level of education (as a socioeconomic index) had no significant correlation with cvd (p=0.36, p=0.83 and p=0.79, respectively). This study provided information on the association between osa and cvds . In our osa population, 26.5% showed at least one sign / symptom of cvd, with hypertension being the most common sign (74.5%). While ahi was found to predict cvd in simple regression analysis, no significant association was found in multiple model adjusted for potential confoundders . Multiple regression analysis showed that aging and obesity were significant predictors of the occurrence of cvd in osa patients . Lavie and lavie in a case - control study on seventy of osa showed that severity of osa affected biochemical markers associated with cvds only in severe stage and not mild or moderate stage of osa . Shahar et al, in a cross sectional study also showed modest to moderate effects of sleep disordered breathing on various manifestations of cvds within a range of ahi values that were considered normal or only mildly upraised . Kendzerska et al, in a decade - long cohort study showed that osa - related factors other than ahi were important predictors of composite cardiovascular outcome . Our findings were in agreement with the afore - mentioned studies indicating that osa - related factors other than ahi (bmi and aging) are important predictors of cvds . The mean of bmi in cvd+ group was calculated to be approximately 32 kg / m2, which put them in obese group of bmi classification . In parallel with our study, dacal quintas et al, found that the prevalence of osa in normal weight patients was lower than that in overweight and obese patients . Seetho et al, reported that patients with osa and severe obesity had increased arterial stiffness, which would possibly affect cardiovascular risk independently of metabolic abnormalities . Carlson et al, showed that age, sleep apnea and obesity represented both independent and additive risk factors for development of systemic hypertension . Similarly, lenfant described the correlation among obesity, hypertension and osa as a triangular relationship; osa and obesity have an interactive relation and both of them have increasing effect on incidence of hypertension . Our study showed that aging was another significant factor to explain the presence of cvd among osa patients . Pywaczewski et al, showed that the frequency of cardiovascular complications occurring in osa population increased with age . Evidence has been inconsistent on the effect of gender on the association between osa and cardiovascular events . In our study, women with osa were more susceptible to develop cvd than men . Drummond et al, and quintana - gallego et al, found that women with osa had hypertension more frequently than men . Faulx et al, found that ahi was inversely associated with flow - mediated dilation and peak blood flow in women . In contrast, no relationship between ahi and flow - mediated dilation was found in men . These results raise the possibility that women with sleep - disordered breathing are more vulnerable to related cvds than men . On the other hand, mohsenin et al, showed that markedly obese men with osa may have a nearly two - fold greater risk for hypertension than women . Gaines et al, showed that although women have naturally higher levels of inflammatory and metabolic markers than men, men with sleep apnea appear to have a more severe inflammatory profile compared to women . It is important to consider the role of bmi in this study and its conclusion: male sex is more susceptible for developing cvd only at the highest quartile of bmi . In a case - control study by lavie and lavie, a comparison was made between smoker and non - smoker patients with osa and they showed a significant interaction effect between smoking and severity of apnea on ceruloplasmin and high - density lipoprotein (hdl) levels . Smokers with severe sleep apnea had the highest level of ceruloplasmin and the lowest level of hdl . They concluded that smoking and sleep apnea had a synergistic effect on some of the biochemical cardiovascular risk markers . Patients with severe sleep apnea who smoked were at a greater risk for developing cvds than smokers with mild - moderate sleep apnea and patients who did not smoke . In our study, no significant correlation was observed between smoking and cvds (p=0.77). One probable reason may be that most ex - smokers stopped smoking before doing the sleep test according to the doctor s advice . Some studies categorized ex - smokers in the non - smoker group [3536]. Based on the electronic search, the current study is the first to provide comprehensive information about the role of severity of osa as a cause of cvd and its relationship with other important risk factors in an iranian population . We included patients with a wide range of osa severity and a relatively large number of females . Our findings are based on patients referred to a single center, which may reduce the generalizability of our findings . Our study showed that ahi was significantly associated with cvd in simple regression analysis; however, this association was not significant after controlling for other predictors . Other osa - related predictors, such as bmi and age were significantly and independently correlated with increased risk of cvds, respectively . In presence of these variables, other phenotypic and socioeconomic factors like severity of apnea, thus, health care providers should implement bmi control strategies and improve the quality of care for the elderly patients.
Molecular viscosity is an important factor for development and progression of heart disease [2, 3]. According to non - newtonian behavior, there is a need to apply capable non - newtonian models in order to capture the main flow characteristics at low strain rates . Furthermore, little research has focused on the exact role of molecular viscosity at low strain rates under oscillating flows . In cases where either the flow slow or it is disturbed, the atherosclerosis shows preference to low wall shear stress (wss) and/or its gradients . Complex geometry vessels promote flow disturbances with low time - averaged wss (awss) and high wss temporal oscillations . The oscillatory shear index (osi) and the relative residence time (rrt), indicating the residence time molecules are in contact with endothelium, are promising tools for identifying regions of possible atherosclerosis localization . Elevated low density lipoprotein (ldl) co - localized with atherosclerotic plaque development was reported . The human aortic arch is highly complex geometry exposing high curvatures and the flow behavior requires extensive analyses . Elucidating the ldl site concentration under physiological oscillating flow is a step of paramount importance [8, 9]. A highly bend arterial vessel was numerically analyzed to elucidate the localization of atherosclerotic lesions under steady flow conditions . Elevated ldl luminal surface did not co - locate to the sites of the lowest wss . Four non - newtonian models, namely power law, carreau, casson, non - newtonian power law plus the newtonian one are compared under oscillating flow conditions for the normal aorta . To the best of our knowledge, little research has been done concerning the biomechanical parameters of molecular viscosity models, awss, osi, and rrt in relation to the ldl distribution within the normal human aortic arch under oscillating flow . Furthermore, it is still unclear which of these factors best spot the prone to atheroma regions . The normal human aortic arch centreline was generated using appropriate computer - aided design (cad) software . The daughter vessels centerlines were generated and placed at the appropriate aortic arch centerline locations . Vessel cross - sections taken every 1.0 mm were set perpendicular to aorta and its daughter centerlines . The ascending aorta diameter at its entrance measured 3.477 cm, the descending aorta outlet was 3.076 cm, while the outlet diameters of the brachiocephalic artery, left common carotid artery and left subclavian artery segments were 1.435, 1.273, and 1.433 cm, respectively . The computational grid was created using tetrahedral for the main lumen volume and prismatic elements layers near endothelial wall in order to improve the accuracy and resolution of blood flow wall properties . Mesh independence study was performed using 0.9, 1.5 and 2.0 million computational cells grids . The 1.5 million cells grid gave mesh independent solution for the examined parameters . An extended time period of five cardiac cycles was simulated in order to avoid period dependencies . The computational model: ascending aorta, descending aorta, brachiocephalic artery, left common carotid artery and left subclavian artery . Five different blood viscosity models (the newtonian and four non - newtonian molecular viscosity models) were tested in the present study and are summarized in equations (a)-(e) of figure 2 . The numerical code fluent solved the governing navier - stokes equations [10, 16]. The assumptions made about the flow were that it was 3d, unsteady, laminar, isothermal, with no external forces applied on it while the aortic arch wall was comprised of non - elastic and impermeable material . For the ldl solution problem, the flow equations were coupled with mass transport equation (semi - permeable walls) and solved under steady flow conditions . The convection - diffusion equation is presented in equation (f) of figure 2, in which c mg / ml is the ldl concentration, and j is the ldl diffusion flux, calculated using equation (g) of figure 2 . In equation (f) and it was assumed the molecular diffusivity was 15.0 10 m / s [11, 17, 18]. The diffusivity was assumed isotropic throughout . Pulsatile inflow boundary condition was calculated using user - defined functions (udfs) subroutines, written in ansi c programming language . Convergence was achieved when all velocity component, mass and energy changes, from iteration to iteration, attained values less than 10 . Blood outflow discharges were calculated using a slightly modified version of the murray s law . The power index value for the murray s law was set to 2.4 . Applied blood waveform at the aortic arch inlet . A uniform flow velocity of 0.05 m / s and constant concentration co of ldl (1.3 mg / ml) were set at the ascending aorta orifice . At artery outlets, the gradient of ldl along the vessels was set equal to zero (newmann condition). The boundary conditions can be described using equation (h) of figure 2, where cw mg / ml is the endothelial surface (wall) concentration, vw is the infiltration velocity, and n is the direction normal to the wall . The condition described in equation (h) stated that the ldl (kcw) mass entering from endothelium to vessel walls was determined from the difference of mass carried to vessel by infiltration (cwvw) and the mass diffusing back to the main flow (d(c/n)). The awss (n / m) is defined in equation (i) of figure 2, where |wss| is the instantaneous wss magnitude (n / m) and t (s) is the pulse period . The averaged wall shear stress vector (awssv) (n / m) is defined in equation (j) of figure 2 . The osi values varied between 0.0 (for no cyclic variation of wss vector) to 0.5 (for 180.0 deflection) of wss direction . The osi needed modification for capturing the atheromatic flow regions of low wss and high osi at the same site of the arterial system . Blood outflow discharges were calculated using a slightly modified version of the murray s law . The power index value for the murray s law was set to 2.4 . Applied blood waveform at the aortic arch inlet . A uniform flow velocity of 0.05 m / s and constant concentration co of ldl (1.3 mg / ml) were set at the ascending aorta orifice . At artery outlets, the gradient of ldl along the vessels was set equal to zero (newmann condition). The boundary conditions can be described using equation (h) of figure 2, where cw mg / ml is the endothelial surface (wall) concentration, vw is the infiltration velocity, and n is the direction normal to the wall . The condition described in equation (h) stated that the ldl (kcw) mass entering from endothelium to vessel walls was determined from the difference of mass carried to vessel by infiltration (cwvw) and the mass diffusing back to the main flow (d(c/n)). The awss (n / m) is defined in equation (i) of figure 2, where |wss| is the instantaneous wss magnitude (n / m) and t (s) is the pulse period . The averaged wall shear stress vector (awssv) (n / m) is defined in equation (j) of figure 2 . The osi values varied between 0.0 (for no cyclic variation of wss vector) to 0.5 (for 180.0 deflection) of wss direction . The osi needed modification for capturing the atheromatic flow regions of low wss and high osi at the same site of the arterial system . All non - newtonian models qualitatively predict similar behavior . However, these patterns differ in quantitative terms . The power law yields low molecular viscosity at low strain rates, considerably smaller than 0.00345 kg / m / s, widely accepted newtonian molecular viscosity . In contrary, the carreau and casson law yield molecular viscosity higher to newtonian law at all strain rates . At very low strain rates, the carreau, casson and the non - newtonian power law models yield values approaching 0.010 kg / m / s . The carreau and casson law curves are very steep at the strain rate region less than 100.01/s . In the non - newtonian power law, low awss values develop at the concave parts of the curved flow regions, most noticeable at the downstream flow region of the left subclavian artery as well as at the first quarter of the concave descending aorta . Increased awss develops at the convex part of the ascending aorta (very end of it) as well as at the first quarter of the convex part of the descending aorta . In between these two locations, the awss lowers its value, although these values are still higher than those at the opposite site of the aorta (concave site). Time - averaged wall shear stress (awss) (n / m) magnitude with (a) power, (b) carreau, (c) casson, (d) non - newtonian power and (e) newtonian law models high osi and low awss develop at the concave part downstream to left subclavian artery . High osi endothelium regions> 0.2 tend to collocate (but not always) with low awss regions . However, there are exceptions of this rule . For example, high osi and awss values develop at the outer part of the ascending aorta (figs . 4 and 5). Oscillatory shear index (osi) with (a) power, (b) carreau, (c) casson, (d) non - newtonian power, and (e) newtonian law models . The rrt factor combines the effects of osi and awss (equation (l) of fig . 2). High rrt indicates regions of possible atheromatic localization, denoting that the blood molecules will spend relatively more time at specific endothelium regions . High rrt value indicates that awss is low and at the same time osi is high . High rrt values> 15.0 develop at the concave part of the aortic arch downstream to left subclavian artery . Two distinct rings of high rrt, similar to the osi rings of figure 5, appear at the middle descending aorta part . The rrt pattern distribution (fig . 6) is closer to awss than to osi . Additionally, rrt is by definition inversely proportional to the awssv (equations (j), (k) and (l) of fig . Relative residence time (rrt) with (a) power, (b) carreau, (c) casson, (d) non - newtonian power, and (e) newtonian law models . The awssv is inversely proportional to the rrt . Normalized ldl concentrations cw / co using non - newtonian power law model are shown in figure 7, revealing ldl topography . Derived results of the normalized peak ldl reach 35.0% higher than entrance for the concave site . Flow velocity 0.05 m / s and constant concentration ldl of 1.3 mg / ml are applied at the orifice of the ascending aorta . Typical luminal surface concentration cw / co of normalized ldl versus wss (n / m). Flow velocity 0.05 m / s and constant concentration ldl of 1.3 mg / ml are applied at the orifice of the ascending aorta . Direct comparison of the ldl with the rrt, awss and osi distribution using the non - newtonian power law is shown in figure 9 . The ldl pattern shown in figure 9a is similar to the rrt one (fig . High ldl endothelium regions, which are located at the concave aorta site, are well predicted with high rrt regions . Good comparison is also detected for the low ldl endothelium regions and low rrt at the convex site . The transitional region between high and low ldl distribution is also well predicted with the rrt factor . Low awss predicts the high ldl concentration at the concave aorta site as well as at the convex aorta site (fig . 9c). Furthermore, the transitional zone between high and low ldl is well predicted . However, the awss distribution shows that the affected concave site of the aorta exhibits uniform low awss (without patches of high awss). Contours using non - newtonian power law of (a) normalized luminal surface ldl concentration cw / co at 0.05 m / s and constant concentration of ldl of 1.3 mg / ml applied at the orifice of the ascending aorta), (b) rrt, (c) awss (n / m) and (d) osi . Relationships between time awssv and awss for the applied blood flow models are shown in figure 10 . Non - newtonian blood flow models show that high magnitude differences between these two biomechanical quantities appear at low awss values <0.8 n / m . Time - averaged wall shear stress vector (awssv) (n / m) versus averaged wall shear stress (awss) (n / m): (a) power, (b) carreau, (c) casson, (d) non - newtonian power, and (e) newtonian law models . The relationships between osi and awssv are shown in figure 11 . It is evident that as the awssv approaches zero, the osi increases and this is captured with all models . Awssv values of less than 0.5 n / m yield a steep increase to the osi values oscillatory shear index versus time - averaged wall shear stress vector (awssv) (n / m): (a) power, (b) carreau, (c) casson, (d) non - newtonian power, and (e) newtonian law models . The biomechanical flow parameters of awss, awssv, osi, and rrt elucidate the endothelial surfaces prone to atherosclerosis . The mass transport of the ldl is also solved in conjunction to the blood flow under steady flow . Henceforth, the comparison of the ldl distribution with the tested flow parameters during the cardiac cycle using non - newtonian blood behavior will possibly give a better understanding in spotting the prone to atherosclerosis aorta regions . Endothelial regions at the outer walls of the main ascending - descending aorta yield high molecular viscosity values . Molecular viscosity affects awss distribution and is considered (at low values) favorable for atherosclerosis genesis and development . Low awss develops at the concave parts, most noticeable at the downstream flow region of the left subclavian artery . Large osi values cause endothelial dysfunction because the instantaneous wss vector alters its direction during pulse wave . Analysis shows that low osi and high awss values develop at the convex part of the ascending aorta . The inverse correlation between awss and osi is further reinforced after performing statistical analysis between awss and osi results for all examined flow models . Person coefficients between osi and awss have negative values for all models: -0.221 (power law), -0.287 (carreau), -0.337 (casson), -0.272 (non - newtonian power law) and -0.358 (newtonian model) (table 1). This becomes apparent from figure 11 as well as from the osi - awssv pearson coefficient in table 1 . These coefficients are: -0.784 (power law), -0.721 (carreau), -0.721 (casson), -0.784 (non - newtonian power law) and -0.731 (newtonian). Pearson coefficients are higher between osi and awssv to osi and awss and are statistically significant for a p <0.01 . Their relatively low values arise because none of the examined biomechanical parameters have a clearly linear correlation with another one . Thus, the pearson coefficient is used as marker for macroscopic behavior estimation and not as a part of linear regression process . Low awss regions, <0.8 n / m, exhibit high awssv variation for all viscosity models (fig . 10). However, the positive pearson correlation factors, which vary from 0.735 for power law to 0.836 for casson and newtonian (table 1), indicate proportional relationship, when awss hurdles a limit high rrt, emerging from simultaneous low awss and high osi, denotes that the blood molecules spend relatively more time at specific endothelium regions and as a result give rise to atheroma genesis and progression . High rrt values <15.0 are present at the concave part of the aortic arch downstream to left subclavian artery . Rrt has negative correlation with awss and awssv, whereas its behavior is proportional to osi for all models (table 1). A question arises as to which of the physical parameters better describes the possible atherosclerotic aorta regions . Ground evidence is needed to support that high rrt value best describes the possible atherosclerotic aorta regions . The backing to the above question comes from the coupled solution of flow and mass transfer equation . According to prevailing theories, the rrt calculation requires relatively less central processing time since the mass flow transport is not incorporated . It is the contact time between ldl and endothelial surface and the subsequent interaction which really matters and this is exactly what the rrt does . Wherever and whenever the flow is disturbed the mass entering or exiting the arterial wall results show that the rrt is, relatively, a satisfactory biomechanical factor since its distribution is closer to the ldl distribution . For the concave aorta site, the peak ldl value is 35.0% higher than its entrance value . For the convex site, previous investigations indicate that the flow pattern is crucial for plaque formation . However, increased ldl values are developed wherever high curvature effects are encountered . The velocity streamlines using the non - newtonian power law model at time instants, 1) t = 0.075 s, 2) t = 0.150 s, 3) t = 0.250 s and 4) t = 0.60 s, are shown in figure 12 . The velocity streamline time and spatial variability, especially in regions where osi and rrt attain high values, give rise to elevated ldl (not shown). Centrifugal forces acting on the flow are forcing part of the bulk of fluid to move towards concave side, noticeable at the downstream flow region of the left subclavian artery (not shown). The wss vectors using the non - newtonian power law model are shown in figure 13 . Aorta streamline velocities m / s: (a) t = 0.075 s, (b) t = 0.150 s, (c) t = 0.250 s and (d) t = 0.60 s using the non - newtonian power law model . Instantaneous aorta wall shear stress vectors (wssv) (n / m) at (a) t = 0.075 s, (b) t = 0.150 s, (c) t = 0.250 s and (d) t = 0.60 s using the non - newtonian power law model . Further analysis is needed to capture the arterial wall deflection (elastic material) during the cardiac pulse . The incorporation of fluid - structure interaction with the mass transport within the human arterial wall will give a better inside into atherosclerosis genesis and development . All four non - newtonian molecular viscosity blood flow models yield a consistent aorta pattern for awssv, osi, and rrt . The abilities of non - newtonian blood flow models are mostly seen in satisfactorily capturing the molecular viscosity at low strain rate values . The non - newtonian power law blood flow model approximates the flow parameters in a more satisfactory way . High awss develops at the convex parts of the curved flow regions, most noticeable at the convex part of the ascending aorta . High osi and low awss develop at the concave parts of the curved flow regions, most noticeable at the downstream flow region of the left subclavian artery as well as at the concave ascending aorta . High rrt and molecular viscosity values appear in the downstream flow region of the left subclavian artery . The rrt is relatively a satisfactory biomechanical factor since its distribution is closer to the ldl . The ldl elevation of the luminal surface side determines the amount of its quantity transported to the arterial wall . Furthermore, the transitional region between high and low ldl distribution is also well predicted with rrt . For the concave aorta site, all four non - newtonian molecular viscosity blood flow models yield a consistent aorta pattern for awssv, osi, and rrt . The abilities of non - newtonian blood flow models are mostly seen in satisfactorily capturing the molecular viscosity at low strain rate values . The non - newtonian power law blood flow model approximates the flow parameters in a more satisfactory way . High awss develops at the convex parts of the curved flow regions, most noticeable at the convex part of the ascending aorta . High osi and low awss develop at the concave parts of the curved flow regions, most noticeable at the downstream flow region of the left subclavian artery as well as at the concave ascending aorta . High rrt and molecular viscosity values appear in the downstream flow region of the left subclavian artery . The rrt is relatively a satisfactory biomechanical factor since its distribution is closer to the ldl . The ldl elevation of the luminal surface side determines the amount of its quantity transported to the arterial wall . Furthermore, the transitional region between high and low ldl distribution is also well predicted with rrt . For the concave aorta site, the peak ldl value is 35.0% higher than its entrance value . For the convex site,
Clinical features are acute limbic encephalitis with personality and behavioral change, catatonia, memory loss, seizures, dyskinesia, and autonomic dysfunction [2, 3, 4, 5]. However, 40% of patients do not have a detectable tumor, and men are also affected . The clinical manifestation of nonparaneoplastic anti - nmdar encephalitis (without ovarian teratoma) is similar to that of paraneoplastic anti - nmdar encephalitis (with ovarian teratoma). In many cases, the medial temporal lobes and cerebral cortex are affected on mri . On the other hand, patients with anti - glutamate receptor (glur) 2 (nr2b) antibody have been reported to show an association with nonherpetic acute limbic encephalitis (nhale), rasmussen's encephalitis, and chronic forms of epilepsia partialis continua [7, 8]. Although anti - nmdar antibody and anti - glur 2 antibody could be simultaneously detected in nhale [6, 9], some patients had anti - nmdar antibody but did not have anti - glur antibody, and others vice versa . Little is known about the clinical difference between anti - nmdar antibody - only encephalitis and anti - glur antibody - only encephalitis . We herein report a man with anti - glur antibody but without anti - nmdar antibody, presenting with predominantly frontal lobar encephalitis, and discuss the clinical significance of this type of non - paraneoplastic anti - glur encephalitis . A left - handed, 33-year - old man, an office worker who had graduated from university, presented with progressive speech disturbance in february 2013 . He was noted to have difficulty finding words in the office and made grammatical errors on writing e - mails . He was referred to and admitted to our hospital 2 days after disease onset . On neurological examination, the patient exhibited fluctuating consciousness disturbance and difficulty saying words: he could only say yes. He did not obey some simple verbal commands such as eye closing or tongue protrusion . When asked to perform dictation, he repeatedly wrote down a character that was a part of our oral command . Once he had raised his arms, he kept them raised until we forced him to stop (catalepsy). Lumbar puncture showed cerebrospinal fluid (csf) lymphocytic pleocytosis (cells: 51/mm, protein: 35 mg / dl), and an elevated igg index (1.32, normal <0.7). Antibodies to n - terminals of nmda - type glur including glun2b (2, nr2b) and glun1 (1, nr1), and those to the n - terminal of glud2 (2) were all positive, and the antibody to the nmdar nr1/nr2 complex (dalmau's method) was negative in both the csf and serum . Magnetic resonance imaging (mri) performed 2 weeks after onset revealed hyperintensity in diffusion - weighted images in the bilateral frontal and left parietal cortices (fig . 1). Electroencephalography (eeg) showed diffuse semirhythmic 1- to 2-hz waves with a small amount of 10-hz waves superimposed on the waves in p - o, which was similar to the extreme delta brush in anti - nmdar encephalitis . On admission, however, oral intake decreased gradually, and he could not swallow purposely at 6 days after onset . Even if the patient put water in his mouth, the swallowing reflex did not occur, and water finally leaked out through the corners of his mouth . Although sialorrhea was not noted, he choked on his saliva at 10 days after onset, suggesting that voluntary oral transport of the trapped saliva was interrupted . As a result, he was dehydrated and required an intravenous drip . The patient exhibited bulging eyes, became mute and inattentive (he sometimes turned his eyes away while the doctor talked to him), with forced grasping that was more pronounced in the left hand . He was restless in the evening, and tried to leave the bed despite the infusion tube, and so required sedation with intravenous haloperidol . Suspecting herpetic encephalitis, we first administered intravenous acyclovir (1,500 mg / day) from 5 to 7 days after onset, which was ineffective and discontinued because of drug - induced acute renal injury . From 7 to 9 days after onset, he developed a transient partial seizure on the right side of his face and extremities . Taking the possibility of an autoimmune mechanism into account, we then administered a total of 3 courses of intravenous corticosteroid pulse therapy (methylprednisolone at 1,000 mg / day for 3 days) from 10 to 25 days after onset, and subsequently gave him oral prednisolone at 30 mg / day that was tapered and discontinued for 6 weeks . Immediately after the first pulse therapy, the patient was able to repeat a syllable following the doctor's example and responded properly to yes - no questions, such as are you mr . (patient's name)? He was able to take meals by himself 16 days after onset and spoke some sentences correctly 20 days after onset . Eeg performed 23 days after onset showed a moderate amount of 10-hz waves with occasional 6- to 7-hz waves . Spect with a tc - ethylcysteinate dimer (ecd - spect) performed 3 weeks after onset revealed, for the mean cerebral blood flow (cbf), a reduced blood flow in both hemispheres [early picture (ep) method, left 32.8, right 32.2 ml/100 g / min] with the patlak plot method and, for the regional cbf, significant hypoperfusion (uncorrected p <0.001, by statistical parametric mapping version 2) in the bilateral frontal convexity and mesial frontal gyri, and the left supramarginal gyrus (fig . The patient's cognitive function was evaluated for the first time 21 days after onset . The mini - mental state examination (mmse) score was 24.7/30: mental arithmetic (serial 7) and auditory comprehension (3-step command) were impaired . The western aphasia battery (japanese edition) conducted 27 days after onset revealed that spontaneous speech was dysfluent (5/10), with stuttering, halting, and occasional phonemic paraphasia and phonetic distortion (e.g., [handan] [hannan]), suggesting slight apraxia of speech . Auditory comprehension (9.35/10), repetition (9.2/10), naming (9.3/10), reading (9.2/10), and writing (9.85/10) were minimally impaired . Overall, his language profile was rated as slight boca's aphasia with apraxia of speech . The wechsler adult intelligence scale - iii conducted 4 weeks after onset revealed a nearly normal cognitive function: verbal iq 84, performance iq 80, and working memory 76 . The wechsler memory scale - revised conducted 33 days after onset revealed a normal memory function (verbal memory 110, visual memory 101) the mmse score at this time was 29/30, the fab score was 16/18 with word fluency of 7 words / min . Stuttering, halting speech, phonemic paraphasia, and phonetic distortion disappeared 3 months after onset . However, the working memory remained lower (digit span forward, 5) after 1 year . Mri performed 7 months after onset revealed a small area of hyperintensity in the left parietal cortex (fig . Performed 13 months after onset, the reduced blood flow recovered to the normal range (ep, left 46.9, right 46.9 ml/100 g / min) and the regional hypoperfusion was restricted to the diffuse areas of the frontal lobe (fig . The patient's cognitive function was evaluated for the first time 21 days after onset . The mini - mental state examination (mmse) score was 24.7/30: mental arithmetic (serial 7) and auditory comprehension (3-step command) were impaired . The western aphasia battery (japanese edition) conducted 27 days after onset revealed that spontaneous speech was dysfluent (5/10), with stuttering, halting, and occasional phonemic paraphasia and phonetic distortion (e.g., [handan] [hannan]), suggesting slight apraxia of speech . Auditory comprehension (9.35/10), repetition (9.2/10), naming (9.3/10), reading (9.2/10), and writing (9.85/10) were minimally impaired . Overall, his language profile was rated as slight boca's aphasia with apraxia of speech . The wechsler adult intelligence scale - iii conducted 4 weeks after onset revealed a nearly normal cognitive function: verbal iq 84, performance iq 80, and working memory 76 . The wechsler memory scale - revised conducted 33 days after onset revealed a normal memory function (verbal memory 110, visual memory 101) the mmse score at this time was 29/30, the fab score was 16/18 with word fluency of 7 words / min . Stuttering, halting speech, phonemic paraphasia, and phonetic distortion disappeared 3 months after onset . However, the working memory remained lower (digit span forward, 5) after 1 year . Mri performed 7 months after onset revealed a small area of hyperintensity in the left parietal cortex (fig . Performed 13 months after onset, the reduced blood flow recovered to the normal range (ep, left 46.9, right 46.9 ml/100 g / min) and the regional hypoperfusion was restricted to the diffuse areas of the frontal lobe (fig . The patient presented with global aphasia, swallowing disturbance, abnormal behavior [catalepsy (maintaining a forced posture) and nocturnal delirium], and partial seizure . Global aphasia was characterized by scanty speech and motor perseveration in writing, which resolved to apraxia of speech a few days after corticosteroid pulse therapy . The swallowing disturbance was voluntary in nature: he had difficulty transporting food to the pharyngeal cavity . In contrast, he swallowed saliva automatically; therefore, he did not exhibit sialorrhea . It was clear that the patient did not initiate bolus transfer with a lack of lingual movement during the oral stage . As described earlier, nonherpetic anti - nmdar encephalitis usually involves the limbic cortex and is associated with several psychiatric symptoms [2, 3, 4, 5]. On the other hand, the clinical features of anti - glur antibody - positive encephalitis (glur encephalitis) are similar to those of nmdar encephalitis with ovarian tumor, except that paraneoplastic nmdar encephalitis necessitates a longer hospitalization period . It is suggested that in these patients with glur encephalitis, anti - nmdar antibody was also positive . One problem is that in many reported cases of nonparaneoplastic anti - glur encephalitis, anti - nmdar antibody was not examined . Thus, the clinical difference between anti - nmdar encephalitis and anti - glur encephalitis remains unknown . It is suggested that our patient with lobar encephalitis without medial temporal involvement, marked cognitive impairment with a relatively preserved level of consciousness, and a favorable response to corticosteroid therapy, with nearly reversible cortical damage, characterizes anti - glur antibody - only encephalitis . It should also be noted that the lesion was difficult to detect on mri, whereas the extent of the lesion was easily identifiable on spect . This discrepancy suggests that neuronal damage was too mild to produce cytotoxic edema, and only a small area of the left supramarginal gyrus remained permanently injured . This reversible cortical damage may be another characteristic of anti - glur antibody - only encephalitis.
Cardiovascular diseases caused by the progression of atherosclerosis are the leading cause of death in the industrialized nations . Atherosclerosis is a focal, inflammatory fibro - proliferative response of the vascular wall to endothelial injury, resulting in the formation of an extended plaque into the lumen of the vessel, affecting the blood flow through coronary arteries . Over 75% of myocardial infarctions since this complication can be fatal, a percutaneous transluminal (coronary) angioplasty (ptca) with stent implantation became the first - choice therapy in the current medical practice . The method allows the dilatation of the narrowed coronary artery and thus the restoration of blood flow . However, the long - term effect of this therapy is limited by an excessive arterial remodeling and restenosis . By employment of stents, the ptca became more effective in the treatment of complicated lesions, allowing revascularization after an acute vessel closure . This method decreases the incidence of in - stent restenosis to less than 10% . Beside these benefits, this first - choice therapy for coronary revascularization bears also the life - threatening risks of in - stent thrombosis and restenosis . In - stent thrombosis is caused by a de - endothelialization of the vessel, followed by a massive adhesion of platelets and fibrin to the injured site . 26% of patients suffer from in - stent thrombosis and 63% die of myocardial infarction . Restenosis refers to the process of wound healing after mechanical injury to the vessel wall, involving neointimal hyperplasia (migration and proliferation of vascular smooth muscle cells (vsmc), deposition of extracellular matrix (ecm), and remodeling of the vessel . Often, an invasive re - intervention becomes necessary to dilatate severely narrowed atherosclerotic vessels due to in - stent thrombosis and restenosis . To prevent in - stent thrombosis, a long - term treatment with anti - thrombotic drugs is necessary . To prevent restenosis, new generation of drug - eluting stents elute anti - proliferative agents such as immunosuppressive drugs (e.g. Sirolimus, everolimus, zotarolimus) and anti - cancer drugs (e.g. Paclitaxel) from a polymer coating for several months . Although these drugs decrease the neointima formation and restenosis, they maintain a high risk of in - stent thrombosis by inhibiting the re - endothelialization . After arterial injury, the maintenance of the endothelial compartment is essential to prevent thrombotic complications . Under physiological conditions, the human endothelium shows a small turnover rate . Under pathological conditions, however, the endothelial integrity is impaired, so that a rapid recovery by surrounding mature endothelial cells and circulating endothelial progenitor cells (epcs) is required . The study of these complex molecular mechanisms in larger animals or in mouse aortic artery is a very difficult procedure, offering limited data . To test the efficiency of novel stent - coatings to reduce in - stent thrombosis and restenosis new models are imperative . Nitinol represents the ideal platform for stents because of its' high elasticity, shape - memory effect and good tolerance in patients, being successfully used as bare - metal stents in clinical use . This alloy made it possible to create a miniaturized stent with an external diameter of 500 m, which can be coated and implanted into the carotid artery of mice . The development of a miniaturized nitinol stent for mouse carotid artery, allows the study of precise molecular mechanisms induced by stent implantation and offers the possibility to test quickly and efficiently the effects of different drug - coatings to prevent restenosis . Moreover, the existence of different knock - out mice strains represents a huge advantage in clarifying the role of different molecules involved in neointima growth and in - stent thrombosis . The stent - struts (fort wayne metals, castlebar, ireland) were braided and then cut to the desired size at the institute for textile technology and mechanical engineering, rwth aachen university in germany (figure 1a). Before implantation, the stents must be transferred into a 2 cm silicon tube, using forceps, and placed 2 mm at one terminal end, referred front end (figure 1a). The front end should be cut obliquely, to ensure a sharp tip for implantation . Before implantation 10 - 12 weeks old male c57bl/6 wild type mice, 25 - 27 g are anesthetized using intraperitoneal injection of 100 mg / kg ketamine and 10 mg / kg xylazine . Proper anesthetization is confirmed prior to surgery by the lack of reflexes and beard movement . To prevent dryness while under anesthesia after shaving and proper disinfection of the ventral neck area, a small median incision of 1 cm is performed under a stereomicroscope, using scissors . After separating the 2 fatty bodies with sterile curved forceps, . 1 cm of the left common carotid artery and the bifurcation should be free prepared . 1 knot using a 5/0 silk thread will be bound around the left common carotid artery, 2 knots using 7/0 silk threads will be bound around the left external carotid artery, and 1 knot using a 7/0 silk thread will be bound around the internal carotid artery (figure 1b). The blood flow is then interrupted by binding the knots on the internal carotid artery and the proximal external carotid artery firmly, as well as by pulling the knot surrounding the common carotid artery . The vessel should be fixed in a way that the common and external carotid artery are in a straight line . A small incision at the external carotid artery is performed, near the proximal knot, using a vannas scissor . The silicon tube containing the stent is introduced into the external carotid artery, with the sharp end in front, using a guide - wire . After the stent reaches the desired position, the silicon tube is pulled back over the guide - wire and allows the shape - memory expansion of the stent (figure 1b). The distal knot on the external carotid artery is bind tightly to close the site of incision and the knots at the internal and common carotid artery are removed, thereby restoring the blood flow . The skin incision is closed using 3 - 4 michel suture clips and a michel forcep . To study the re - endothelialization, an earlier end - time point is necessary (3 - 4 days). We observed in our model of stent implantation that 4 weeks after this surgical intervention, especially by the use of specific coatings to biofunctionalize the miniaturized stents, neoangiogenesis occurs in approximately 30% of specimen . This is a hind for remodeling and regenerative processes, with different mechanisms and representing another pathological problem . To concentrate on neointima formation, in - stent stenosis and/or analysis of mechanisms underlying these side - effects after stent implantation an end - time point of 3 weeks would be beneficial not to mix up with the regenerative effects induced by the onset of neoangiogenesis . At the end - time point, the animals are anesthetized using intraperitoneal injection of 100 mg / kg ketamine and 10 mg / kg xylazine . Proper anesthetization is confirmed prior to surgery by the lack of reflexes and beard movement . After opening the thoracic cavity and pbs washing via intracardial punction, a body - perfusion with 4% paraformaldehyde (pfa) solution is performed for 5 min . The left carotid artery containing the stent is dissected, directly placed in a 4% pfa solution and at least 16 hr later embbeded in plastic . 50 m thick sections are performed from plastic - embedded samples using a diamond band saw . To measure the plaque size, giemsa staining is performed . To analyze the rate of re - endothelialization within the stented area of the vessel, immunohistochemistry for von willebrand factor (vwf) the stent - struts (fort wayne metals, castlebar, ireland) were braided and then cut to the desired size at the institute for textile technology and mechanical engineering, rwth aachen university in germany (figure 1a). Before implantation, the stents must be transferred into a 2 cm silicon tube, using forceps, and placed 2 mm at one terminal end, referred front end (figure 1a). The front end should be cut obliquely, to ensure a sharp tip for implantation . Before implantation 10 - 12 weeks old male c57bl/6 wild type mice, 25 - 27 g are anesthetized using intraperitoneal injection of 100 mg / kg ketamine and 10 mg / kg xylazine . Proper anesthetization is confirmed prior to surgery by the lack of reflexes and beard movement . To prevent dryness while under anesthesia after shaving and proper disinfection of the ventral neck area, a small median incision of 1 cm is performed under a stereomicroscope, using scissors . After separating the 2 fatty bodies with sterile curved forceps, the left common carotid artery can be seen pulsing along with the trachea . 1 cm of the left common carotid artery and the bifurcation should be free prepared . 1 knot using a 5/0 silk thread will be bound around the left common carotid artery, 2 knots using 7/0 silk threads will be bound around the left external carotid artery, and 1 knot using a 7/0 silk thread will be bound around the internal carotid artery (figure 1b). The blood flow is then interrupted by binding the knots on the internal carotid artery and the proximal external carotid artery firmly, as well as by pulling the knot surrounding the common carotid artery . The vessel should be fixed in a way that the common and external carotid artery are in a straight line . A small incision at the external carotid artery is performed, near the proximal knot, using a vannas scissor . The silicon tube containing the stent is introduced into the external carotid artery, with the sharp end in front, using a guide - wire . After the stent reaches the desired position, the silicon tube is pulled back over the guide - wire and allows the shape - memory expansion of the stent (figure 1b). The distal knot on the external carotid artery is bind tightly to close the site of incision and the knots at the internal and common carotid artery are removed, thereby restoring the blood flow . The skin incision is closed using 3 - 4 michel suture clips and a michel forcep . To study the re - endothelialization, an earlier end - time point is necessary (3 - 4 days). We observed in our model of stent implantation that 4 weeks after this surgical intervention, especially by the use of specific coatings to biofunctionalize the miniaturized stents, neoangiogenesis occurs in approximately 30% of specimen . This is a hind for remodeling and regenerative processes, with different mechanisms and representing another pathological problem . To concentrate on neointima formation, in - stent stenosis and/or analysis of mechanisms underlying these side - effects after stent implantation an end - time point of 3 weeks would be beneficial not to mix up with the regenerative effects induced by the onset of neoangiogenesis . At the end - time point, the animals are anesthetized using intraperitoneal injection of 100 mg / kg ketamine and 10 mg / kg xylazine . Proper anesthetization is confirmed prior to surgery by the lack of reflexes and beard movement . After opening the thoracic cavity and pbs washing via intracardial punction, a body - perfusion with 4% paraformaldehyde (pfa) solution is performed for 5 min . The left carotid artery containing the stent is dissected, directly placed in a 4% pfa solution and at least 16 hr later embbeded in plastic . 50 m thick sections are performed from plastic - embedded samples using a diamond band saw . To measure the plaque size, giemsa staining is performed . To analyze the rate of re - endothelialization within the stented area of the vessel, immunohistochemistry for von willebrand factor (vwf) the implantation of a miniaturized nitinol stent into the left carotid artery of mice takes 25 - 30 min and shows a mortality rate of 10% mostly due to the damage of the vessel during the intervention . A better survival rate is observed in mice having a weight more than 25 g at the time of stent implantation (mortality rate of 5%). Therefore, we chose for the implantation mice with a weight between 25 - 27 g. after surgery, the mice recover from anesthesia within 2 - 5 min and no physical impairments, like e.g. Paralysis, are observed . Micro - computer tomography (micro - ct) imaging performed one week after stent implantation showed that the stents are not dislocated by blood flow (figure 1c). Unfortunately, analysis of neointima formation in these images is not possible due to the metal - derived artifacts (figure 1d, 1e). We didn't observe any vessel or endothelial damages of unstented area of the vessel, immediately below the stent, as detectable by histological (figure 2a) and by specific staining for endothelium (figure 2b, anti - mouse cd31 antibody). For a better overview, the section was scanned using a two - photon laser scanning microscopy (figure 2b, 2c). In the stented vessel, a permanent dilatation of 15% is detected (ratio stent: artery, 1,15:1) by mice with a weight between 25 - 27 g. neointima formation and thrombus - formation can be analyzed by classical histological stainings (e.g. Hematoxilin - eosin, giemsa, movat, toluidin blue, masson - trichrom - goldner, figure 3a, 3b). Since the lamina externa and interna are not visible anymore, plaque size was calculated as the difference of the external and the luminal areas (mean plaque area: 234566 3315 m, mean luminal area: 12036 2662 m). External circumference was also measured (mean: 1799 14 m). For analysis of the cellular composition, the sections need to be deplastified and stained with specific markers . For the re - endothelialization, we used a cy3-conjugated anti - cd31 antibody and for smooth muscle cell proliferation a fitc - conjugated anti - sma antibody (figure 3c). Re - endothelialization was calculated as percentage of cd-31 positive stained to the total luminal surface (mean: 23.07 3.14%) one week after stent implantation . Of course, an unlimited number of specific staining is possible, depending on each laboratories' experience . Analysis of myosin heavy chain, for a better characterization of smcs, but also analysis of infiltrated cells (monocytes, lymphocytes), or stainings for different inflammatory cytokines can also be performed, depending on the aim of the study . The blood flow is interrupted by binding the knots on the internal carotid artery and the proximal external carotid artery firmly, as well as by pulling the knot surrounding the common carotid artery . The silicon tube containing the stent is introduced into the external carotid artery through a small incision at the external carotid artery . After the stent reaches the desired position, the silicon tube is pulled back over the guide - wire and allows the shape - memory expansion of the stent . Micro - ct images showing the stent position one week after surgical implantation (b). Due to the material - derived artifacts, unstented area of the vessel is not affected by the surgical procedure, as shown by toluidin blue (a) and endothelial - specific cd31 staining (b, c). Analysis of the plaque can be performed by classical histological stainings (e.g. Masson - trichrom - goldner) (a). The organized thrombus can be detected by black - stained fibrin depositions inside the neointima, in some cases a complete occlusion of the vessel is observed (b). Re - endothelialization (cy3, red) or smooth muscle cell proliferation (fitc, green) was detected by double immunofluorescence staining using specific markers . We noticed a completed re - endothelialization of the stent struts (left, double arrow) compared to an incompleted luminal re - endothelialization (right, single arrow). To reduce the risk of in - stent thrombosis and restenosis and to sustain the development of new coatings for drug - eluting stents, an easy, simple and accessible method of stent implantation in an animal model is needed . Mice deliver the ideal system to study the complex mechanisms of arterial remodeling after stent implantation and the efficiency of such drugs . Existing models for in - stent restenosis in mouse are difficult, require high surgical skills and imply high risks of complications as bleeding or paralysis . For example, in the model of the stent- implantation into thoracic aorta of a donor mouse after balloon - dilatation of the vessel and then transplantation of the stented segment into carotid artery of a recipient mouse, the study of the patho - mechanisms is not influenced only by recipient reaction to donor material, but also by the massive damaging of vasa vasorum and adventitia . Implantation of a stainless steel stent directly into abdominal aorta after balloon - dilatation is followed by a high mortality rate (35%) because of hind leg paralysis after thrombosis or bleeding from abdominal aorta on site of arteriotomy . Implantation of a spiral - shaped self - expanding nitinol - stent into abdominal aorta via femoral artery needs high surgical skills, mostly due to blindly directing the stent along the branching from femoral artery to aorta to place the stent at the right position . This procedure is followed by a high risk of damaging the femoral nerve, therefore paralysis of the hind leg . Compared with these procedures, our model of stent implantation in mouse does not need high surgical skills . Our model offers a simple, easy and efficient method to analyze the effects of different drug - coatings on arterial remodeling, the placing of the stent is made under sight, and there are no risks of damaging nerves or other structures . The complex molecular mechanisms can be investigated easier in our model of mouse carotid artery stenting, not only by direct accessibility of the vessel, but also due to the existence of different knock - out mice strains . As one limitation, comparing with the clinical procedure, our model uses healthy mice / arteries and doesn't perform stenting on pre - existing plaques (not in - stent restenosis, but in - stent stenosis). However, due to the massive damage of the vessel wall in both models, the reparatory processes are similar . Unfortunately, due to the metal - derived artifacts, an in vivo monitoring of the neointimal growth is not possible by existing imaging methods as ultrasound or computer - tomography . Another limiting factor is the thin sectioning of metal - based stents, which requires some expertise in the metal processing . Using this method, we were able to show, that neutrophil - instructing biofunctionalized miniaturized nitinol - stents coated with ll-37 reduce in - stent restenosis, providing a novel concept to promote vascular healing after interventional therapy . Despite these limitations, this model seems to be, until now, the most suitable system, thereby money- and time - saving, to investigate new drug - coatings for stents and their effects on the molecular events during arterial remodeling . Moreover, this model can be easily adapted to the hamster, which is more similar to the human, so that every therapeutical hypothesis can be verified before applying to larger animals or human to avoid unpleasant and unexpected effects.
Disability has been assigned as the umbrella term to include impairments, activity limitations or participation restrictions by the international classification of functioning (icf) disability and health . The older concept of disability along with the terms impairment and handicap, as described by icf, have been subsumed under the concept of activity and participation. Neuropsychiatric disorders continue to be leading contributors to the global burden of disease . As per the world health report, 2001 mental illnesses accounted for 25% of total disability and 16% of the total burden . Among women aged 15 - 44 years, mental disorders constitute three of the 10 leading causes of disease burden in low - and middle - income countries, and 4 of the leading 10 in high - income countries . As per the census of india, 2001 there are an estimated 2,263,821 (for a population of 1,028,610,328) people suffering from disability due to mental illness in the country . Mental disorders rank third among the five leading contributors to disability in india . However, a recent community - based study in india found mental disability to be the most common type of disability accounting for 36.7% of total disability . Schizophrenia has been identified as one of the most disabling condition known to mankind . As per the estimates for global burden of a disease study, it usually starts during young age and is frequently associated with deterioration from the previous level of functioning . This deterioration is reflected in various functional deficits leading to social isolation and poor occupational functioning . It is also being increasingly recognized that disability is one of the outcome indices for chronic illnesses such as schizophrenia . The indian literature on disability in schizophrenia has focused on patients seeking treatment in out - patient setting, in patient setting and community setting . However, till recently there was no published literature on disability certification seeking behavior of patients diagnosed with schizophrenia . A recent study from karnataka explored the utilization of disability benefits by those who have been issued disability certificates . The current study aimed at understanding the profile of patients diagnosed with schizophrenia seeking disability certification for a tertiary level multispecialty hospital in india . The findings of this study are expected to provide valuable information on various socio - demographic and illness related variables of these individuals . The current study aimed at assessing the profile of subjects diagnosed with schizophrenia seeking disability certification . Additionally it aimed at assessing the various socio - demographic and illness related variables among these individuals . The study was carried out at the psychiatry department for a tertiary care hospital in india . We here present the findings form review of cases seeking disability certification over a 5 year period . The evaluation of the subjects was carried out in the presence of a primary care giver . Detailed history taking and mental status examination was carried out as part of this evaluation process . The evaluation board comprised of three qualified psychiatrists with at least 3 years of post - senior residency experience in psychiatry . First, the diagnosis was established using icd-10 (international statistical classification of diseases and related health conditions). Subsequently, the disability was assessed using indian disability evaluation assessment scale (ideas). Socio - demographic information from all the subjects was collected using a pre - approved semi - structured proforma . Ideas are approved by the government of india for documenting the level of disability due to mental illness . It assesses disability under four domains: self - care, interpersonal activities (social relationships), communication and understanding, and work . Each item is scored between 0 and 4, i.e., from no to profound disability, adding scores on 4 items gives the total disability score. Global disability score is calculated by adding the total disability score and mi2y score (months ill in 2 years- a score ranging between 1 and 4, depending on the number of months in the last 2 years the patient exhibited symptoms). Global disability score of 0 corresponds to no disability, a score between 1 and 7 corresponds to mild disability, and a score of 8 - 13 corresponds to severe disability, and a score of 20 corresponds to profound disability. An ideas is a well - validated instrument and is being used across the country for disability evaluation in psychiatric disorders . The alpha value for the scale has been found to be 0.8682, indicating good internal consistency between the items . Criterion validity of the scale has been established by comparing ideas with schedule for the assessment of psychiatric disability which has been standardized in india . Data were analyzed using spss (statistical package for social sciences) software version 17 . Categorical variables were analyzed using chi - square test and continuous variables were analyzed using parametric tests . These included independent sample t - test for in - between group differences for male and female subjects; and family history positive / negative subjects . Further, correlation between different illness variables and ideas scores was carried out using pearson's correlation coefficient . Conditions of anonymity and confidentiality as recommended were strictly adhered to during the course of the study and data reporting . Socio - demographic information from all the subjects was collected using a pre - approved semi - structured proforma . Ideas are approved by the government of india for documenting the level of disability due to mental illness . It assesses disability under four domains: self - care, interpersonal activities (social relationships), communication and understanding, and work . Each item is scored between 0 and 4, i.e., from no to profound disability, adding scores on 4 items gives the total disability score. Global disability score is calculated by adding the total disability score and mi2y score (months ill in 2 years- a score ranging between 1 and 4, depending on the number of months in the last 2 years the patient exhibited symptoms). Global disability score of 0 corresponds to no disability, a score between 1 and 7 corresponds to mild disability, and a score of 8 - 13 corresponds to severe disability, and a score of 20 corresponds to profound disability. An ideas is a well - validated instrument and is being used across the country for disability evaluation in psychiatric disorders . The alpha value for the scale has been found to be 0.8682, indicating good internal consistency between the items . Criterion validity of the scale has been established by comparing ideas with schedule for the assessment of psychiatric disability which has been standardized in india . Data were analyzed using spss (statistical package for social sciences) software version 17 . Categorical variables were analyzed using chi - square test and continuous variables were analyzed using parametric tests . These included independent sample t - test for in - between group differences for male and female subjects; and family history positive / negative subjects . Further, correlation between different illness variables and ideas scores was carried out using pearson's correlation coefficient . Conditions of anonymity and confidentiality as recommended were strictly adhered to during the course of the study and data reporting . A total of 169 subjects seeking disability certification over the study period of 5 years were diagnosed with schizophrenia . Out of 169 subjects 132 (78.1%) were male and 37 (21.9%) were female . The mean age of male subjects and female subjects were 36.89 (standard deviation (sd) 9.67) years and 39.56 (sd11.79) years, respectively . Majority of the study subjects were literate [table 1]. Only around 5.3% of males and 10% of females were illiterate . Majority of the study subjects (93.9% males and 86.4% females) were from an urban setting . In - between group differences for male and female subjects for socio - demographic variables there was a statistically significant difference (chi - square=25.27, df=4, p<0.05) in the marital status of the male and female study subjects . While the majority of male subjects were unmarried (62.1%) and an equal proportion of female subjects were married and unmarried (35.1% each). Also, 18.9% of the female subjects were either separated or divorced . In comparison, there was a statistically significant difference in the employment status of the male and female subjects (chi - square=7.84, df=2, p=0.02). While 17.4% of male subjects were employed, none of the female subjects was currently employed . Around 56.7% of the female subjects were from a lower socio - economic background . The rest belonged to middle socio - economic status . In comparison, 15.9% of the male subjects belonged to lower socio - economic status, with the rest belonging to middle socio - economic status . This difference was not statistically significant (chi - square=3.23, df=1, p=0.07). A significantly higher (chi - square=8.99, df=2, p=0.01) percentage of male subjects (10.6%) were the primary earning member of the family as compared to female subjects (none). Family history of psychiatric illness was positive in 9.8% of male subjects and 10.8% of female subjects [table 2]. Of these, around 76.4% of the family members were suffering from schizophrenia . In - between group differences for male and female subjects for illness related variables there was no significant difference between male and female subjects for the duration of illness (t=1.20, p=23, 95% ci-4.62 - 1.12) and duration of being on treatment (t=0.86, p=38, 95% ci-4.03 - 1.57). The mean global score on ideas were 12.29 sd2.67 and 11.78 sd2.82 for male and female subjects, respectively [figure 1 and table 3]. * statistically significant difference at p<0.05 in - between group differences for male and female subjects for age, illness related and ideas variables male and female subjects did not differ significantly on the ideas global score (t=1.01, p=31, 95% ci-0.48 - 1.51), personal care (t=0.68, p=0.49, 95% ci-0.20 - 0.41), interpersonal interaction (t=0.35, p=0.72, 95% ci-0.33 - 0.22), and understanding and communication (t=0.16, p=0.87, 95% ci-0.33-.28) domains of ideas . The two groups differed significantly on the work domain (t=3.92, p<0.05, 95% ci-0.43 - 1.30). The disability on work domain was higher for male (mean=3.38 sd1.21) as compared to female (mean=2.51 sd1.09) subjects . Around 59.8% of male subjects and 56.7% of female subjects were suffering from moderate level of disability . Severe disability was found in 34.8% of male subjects and 35.1% of female subjects [table 2]. There was a significant positive correlation between total duration of illness and global ideas score (r=0.287, p=0.001) and duration for seeking treatment and global ideas score (r=0.242, p=0.005) for male subjects [table 4]. Correlation between socio - demographic, illness variables and ideas score for the male subjects however, no such correlation was observed for female subjects [table 5]. Correlation between socio - demographic, illness variables and ideas score for the female subjects additionally, the subjects with or without a family history of psychiatric illness did not differ on various domains of ideas scale as well as global ideas score [table 6]. In - between group differences for the study variables for subjects with and without a family history of psychiatric illness the current study aimed at assessing the profile of patients with schizophrenia seeking disability certification at a tertiary care multispecialty hospital in india . Additionally it aimed at assessing the various socio - demographic and illness related variables among these individuals . The existing indian literature on disability among patients diagnosed with schizophrenia has focused on patients seeking treatment in out - patient, in - patient and community settings . We analyzed a total of a total of 169 subjects seeking disability certification over the study period of 5 years was diagnosed with schizophrenia . Schizophrenia remains the most common diagnosis among previous indian studies on disability among treatment seeking psychiatric patients . Reported 65.3% of the subjects to be diagnosed with schizophrenia in their total sample of 285 over a 3 year period . However, affective disorders have been found to be the most common cause of disability among not treatment seeking individuals in community based studies . In spite of comparatively lower prevalence than other mental disorders schizophrenia continues to be over represented among treatment seekers in hospitals . In the current study, an overwhelming majority of study subjects were male . In a community based epidemiological survey for disability in rural karnataka, females constituted 68% of individuals with mental disability . In a recent study from karnataka, females constituted 49.1% of all disability certificate seeking individuals over a 3 year period . Similarly, in a study among long stay patients diagnosed with schizophrenia 67.86% were male . In another study from assam, 31.6% of the study subjects were female . While previous indian studies have reported relatively later help seeking for female patients suffering from schizophrenia, the same is not reflected in the findings of the current study . In the present study male and female subjects did not differ significantly with regards to age at presentation, total duration of illness and duration since seeing treatment . The study by kujur et al . Also observed a significant difference in marital status of male and female patients with schizophrenia with majority (57.7%) of women were separated from their husbands . A significantly higher proportion of female subjects were divorced or separated in the current study . Previous studies from the west have documented moderate disability in most of patients diagnosed with schizophrenia irrespective of the setting . In the current study indian studies have revealed the disability among patients with schizophrenia to moderate to severe as early as 2 - 5 years after illness onset . In a study from assam, 64% of patients suffering from schizophrenia and 30% of those suffering from bipolar affective disorder had severe disability as per the ideas . However, an indian study among non - treatment seeking individuals in a community setting found mild disability as the most common . In the present study, the highest disability for both male and female subjects was observed in the work domain of ideas . Previous indian studies have also reported occupational disability as the most disabling of all the categories . Additionally, the least disability observed for personal care (for both male and female subjects) was also in keeping with similar observations in previous studies . However, another indian study conducted in a mental hospital setting found the highest level of disability for understanding and communication domain of world health organisation disability assessment schedule ii (whodas ii). Disability in schizophrenia has been found to be affected by characteristics like age of onset and duration of illness among other factors . In a previous indian study from ranchi it was found that duration of illness has a significant correlation with personal areas of disability and age of onset has significant positive correlation with personal and occupational area of disability . However, in the current study a significant positive correlation between total duration of illness and global ideas score was observed only for the male subjects . A previous study by thara et al . Found a significantly higher global disability and occupational disability among male patients suffering from schizophrenia as compared to the female patients . However, the two did not differ for disability on other domains including self - care, social withdrawal and social contact . In the present also the male and female subjects differed significantly only on the work domain of ideas . No significant differences were observed for personal care, interpersonal interaction and understanding and communication domains . Also, there was no significant difference on the global ideas score for male and female subjects . Stigma, poor knowledge about the ideas, fear of misuse of certificates, discomfort to approach government hospitals, time constraints, rigid negative thinking about legal issues, denial of disability have been specified as some of reasons for underutilization of disability certification . Lack of education among disabled is an important barrier for effective delivery of services . According to national sample survey organization, 2002 gender has been found to be an important determinant of help seeking for mental disorders . Women with common mental disorders were more likely to have sought some form of help than men in studies from western setting . However, the situation is different in developing countries such as india . Due to socio - cultural factors women researchers has revealed that those closest to the individual play an influential role in whether or not an individual seeks mental health services when experiencing distressing symptoms . Multi - ethnic studies have reported that asian patients with psychiatric illness tend to show the longest delay in help seeking . More intensive, extended and persistent family involvement is a possible reason for the delay in seeking help by these individuals . The present study offers some interesting and important insights in to disability certification seeking behavior of patients diagnosed with schizophrenia . There is a relatively long gap between the onset of illness and disability certification . In spite of regulatory threshold of 2 years, also, all the female subjects in the present study were not gainfully employed and were financially dependent on the family . Also, a significant greater proportion of them were either divorced or separated . The findings also suggest a relatively early stabilisation of disability among females as the duration of illness was not found to be correlated with global ideas score . However, there was a significant correlation between these two variables for male subjects . Relatively later impact of disorder on employment status is a likely possible reason for this observation . Lack of impact of presence of psychiatric illness in another family member does not impact the disability seeking behavior of the study subjects . This is a worrisome finding and it reflects poor education of family with regard to the provisions of disability certification and disability benefits available . There is a need to disseminate information related to impact on disabled, community mobilization, opportunity for education, opportunity for work, transfer skills to community level, program activities, and involvement of disabled people . Also, research with respect to services, fund allocation, cost - effectiveness, manpower, training, and technical aid of disabled people should be strengthened . A special emphasis should be placed on providing rehabilitation services and disability benefits to the unreached persons with disabilities living in rural areas and small towns of the country . Positive impact of disability assessment camps on disability certification seeking behavior has been documented in india . Even those who have received disability certification do not utilize the disability benefits offered by the government . The underutilization is even more prominent in rural areas with disability pension being the most utilized benefit . We included all the subjects diagnosed with schizophrenia seeking disability certification over the study period . Assessment was carried out using a standardized indian instrument that has been used previously in indian settings . However, there are certain limitations as well . Also, the findings need to be replicated in multisite studies before they could be generalized . Also, it would be informative to review these subjects over time to assess the stability of disability level . Additionally, information on the utilization of disability benefits subsequent to certification should also be assessed in future studies . We included all the subjects diagnosed with schizophrenia seeking disability certification over the study period . Assessment was carried out using a standardized indian instrument that has been used previously in indian settings . Also, the findings need to be replicated in multisite studies before they could be generalized . Also, it would be informative to review these subjects over time to assess the stability of disability level . Additionally, information on the utilization of disability benefits subsequent to certification should also be assessed in future studies . Majority of patients with schizophrenia seeking disability certificate continue to be male . However, male and female subjects tend to differ very little on various socio - demographic and illness related variables . There are significant difference in the likely impact of schizophrenia on marital status of males and females . However, the work related disability is relatively higher among males and females continue to be financially dependent on the family members.
Ultrasound (eus)-guided celiac plexus neurolysis (cpn) has been reported to be effective in inducing pain relief . However, a 75-year - old man suffering from opioid refractory pain (recorded as 9 according to visual analog scale (vas)) due to an advanced stage iv histologically - proven pancreatic adenocarcinoma with liver metastases and celiac trunk infiltration not suitable for surgery, was referred to our center . Eus confirmed the nodular hypoechoic lesion of 40 38 33 mm in the pancreas [figure 1]. As the tumor stage was beyond any possibility of surgical radical care and in order to relieve patient's symptoms, after informed consent was obtained, eus - guided cpn combined to eus - guided tumor ablation was arranged . Under sedation with propofol, eus was conducted with a pentax fg-36ua ultrasound endoscope (pentax europe ltd, hamburg, germany) using a curved - array transducer . A 22 g needle (cook medical inc, bloomington, indiana, usa) was introduced though the endoscope's working channel to inject 10 ml 2.0% lidocaine and 20 ml of ethylic alcohol 95% into the base of the celiac trunk at its origin from the aorta [central approach, figure 2]. After performing cpn, 40 ml 75% of lesion volume of ethanol (concentration 95%) were directly injected into the tumor [figure 3]. Tumoral nodule in the body of the pancreas celiac plexus neurolysis performed via the central approach ethanol ablation of the pancreatic tumor no major complications were recorded during the procedure . In the days following the procedure, mild (grade 2) diarrhea and fever were the only minor complications experienced by the patient . Complete tumor devascularization was assessed by means of computed tomography (ct) 48 h after the procedure [figure 4]. Ca 19 - 9 dropped down to 56.84 u / ml at 2 weeks after eus . Tumor response assessed by means of computed tomography (ct) 48 h after the procedure complete pain relief, namely vas 0, was achieved 3 days after the endoscopic ablation . The patient remained pain - free without need of opioid, and was treated only with paracetamol for 20 weeks and afterwards experienced pain relief, (defined as pain within 30% of baseline) until death occurred 30 weeks after the procedure . Advanced pancreatic cancer commonly induces severe refractory pain . In such patients, where opioids result often ineffective, eus - guided cpn has been reported to induce pain relief in 70 - 80% of cases . However, most patients achieve only suboptimal and transient relief, probably due to technical failure or further nociceptive impulses which cannot be interrupted by the neurolysis . Furthermore, definitive data on its efficacy in improving survival is still lacking . Therefore, it was decided to try a combined approach directed both to the celiac plexus and the neoplastic mass, in order to delay tumor progression and lengthen pain - free survival as well as overall survival . The results were optimal in terms of pain relief and immediate tumor response (assessed by means of ct and tumor marker levels). The present case demonstrates that the combined approach (eus - guided ethanol ablation and cpn) may be a valuable option aimed at improving both prognosis and pain control in patients with pancreatic cancer . Randomized - controlled trials comparing eus - cpn alone to cpn associated to tumor ablation are needed to confirm this result.
In functional neuroimaging, and particularly in pet and fmri, study design and analysis have been dominated by the concept of functional segregation, which emphasizes the specialization of a brain structure for a specific part of a cognitive function . This has resulted in a large number of studies in which differences in cognitive states are linked to the differential activation of separate brain areas . The concept of functional integration, on the other hand, has long been recognized as an equally important principle of brain organization . Functional integration refers to the interaction between brain areas and has been studied with two categories of analyses: functional connectivity analyses and effective connectivity analyses . In functional connectivity analyses [24], the covariance structure of a measure of brain activity is studied, from which differences in cognitive states are linked to differences in correlations between regions . These analysis methods are thus limited in their capacity to make inferences about the directionality of these correlations, which makes it difficult to address, for instance, the functional hierarchy of the brain structures under investigation . In effective connectivity analyses, on the other hand, models are defined a priori, comprising the brain structures of interest and assumptions about the afferent / efferent connections between them [5, 6]. These models are then fitted to the activity of these brain areas to obtain the strength of these connections, which enables inferences on changes in connection strengths in relationship to cognitive states . Effective connectivity has been defined as the influence one neural system or region exerts over another . There are two ways by which this influence can be mediated: via a direct path between two regions, or via an indirect path in which a third region is involved . The analysis methods that have been applied to functional neuroimaging data, structural equation modeling (sem) and dynamic causal modeling (dcm), differentiate between these two possibilities, provided that the underlying model (regions and their paths) is completely specified . If two regions are connected via a third region and this third region has furthermore no other influence on the rest of the network, one can choose to incorporate only an indirect path between the two regions and to refrain from explicitly modeling the third region and its direct paths . We are working here, however, on the premise that most of the specified paths should reflect veridical direct paths, because we believe that too many indirect paths, involving these third party regions, which are not explicitly taken into account in the model, will seriously decrease the biological validity of the model . Sem has also extensively been applied in the social sciences, where these paths represent abstract causal connections between variables . When this method is applied to functional neuroimaging however, these paths should ultimately correspond to the white matter connectivity of the brain regions under investigation . Furthermore, mcintosh and gonzalez - lima have studied the effect of erroneous model specification on the estimation of the path coefficients and have found that it could seriously impinge on the estimation of these coefficients . Therefore, it would be highly valuable to incorporate all available knowledge regarding anatomical connections into effective connectivity models . It should be noted that we do not imply that each existing anatomical connection should result in an effective connection in each and every cognitive task . However, it is the role of the model estimation to indicate which anatomical connections have become effective for which task manipulation . Therefore, leaving an anatomical connection, which is known to exist, out of a model specification can only be justified when one has strong beliefs about the functioning of this path in the present context, possibly combined with a requirement for a decrease in model complexity . Unfortunately, our knowledge about human anatomical connectivity is relatively sparse, because a number of techniques that are used in other species (active tracers) are highly invasive . Therefore, only two classical anatomical methods can be used: dissection studies, which only provide information on a relatively coarse scale, and passive tracer studies, which are not very well suited to investigate long - range connectivity . Most effective connectivity studies thus can only validate their connections with information from nonhuman primates, which in turn raises problems with the homology of brain structures between different species . In the last decade, a technique known as diffusion tensor imaging (dti) [9, 10] has emerged as a good candidate to resolve this situation . In dti, the sensitivity of the (diffusion - weighted) mr signal to the self - diffusion of water on a microscopic scale is employed to characterize the anisotropic structure of white matter in vivo . It is assumed that the direction in which diffusion is largest is collinear to the direction of the axonal bundle in the voxel, because diffusion is assumed to be hindered in directions perpendicular to this direction . With this information, fiber tracking [11, 12] can be performed in which the main diffusion directions of voxels are followed throughout white matter . This method already has provided useful insights in, for instance, the anatomy of the thalamus and the striatum [13, 14]. First, dti provides no information about the afferent or efferent character of the axons, because the diffusion of water does not differentiate between these two situations . Second, the tensor model can only provide one main direction per voxel, which considerably increases the likelihood of erroneous tracking results through a region of crossing fibers . Finally, in cerebral gray matter there is generally no dominant fiber direction, making it difficult to track fibers to their cortical origin . The aim of the current study is to investigate to what extent dti - based tractography can provide support for the anatomical basis of the networks, proposed in effective connectivity studies . Furthermore, we have investigated whether dti - based tractography is able to reveal any connections that go beyond the ones proposed in the original analysis . To address these questions, we have chosen eight effective connectivity studies all using structural equation modeling . Sem was introduced at an early stage of the development of pet and fmri, with the consequence that a body of sem studies is to be found in the literature . Dcm, on the other hand, has only relatively recently been introduced, but is gaining a rapid popularity . It should be noted that any conclusions we are able to draw in this study within the context of sem models can be readily generalized to dcm studies as there is no difference in the role of the underlying anatomical model in both frameworks . We have chosen networks spanning a number of different cognitive domains, including learning [15, 16], cognitive control [17, 18], working memory, visual and auditory perception, major depression, and the thalamocortical network involved in general - anaesthetic - induced unconsciousness . We performed a standard dti experiment on 6 subjects and used the coordinates of the network nodes as seed regions for a fiber tracking analysis . In this analysis, we have established whether dti - based fiber tractography provides evidence about the direct nature of every possible connection, whether or not it was proposed in the original studies . We studied 6 healthy subjects (2 females, age range 2532 years) after informed consent was given according to institutional guidelines of the local ethics committee (cmo protocol region arnhem - nijmegen, the netherlands). Dti was performed using a twice refocused pulsed gradient spin echo epi sequence at 1.5 t(sonata system, siemens, erlangen, germany)with a standard head coil . Axial slices were obtained using the following imaging parameters: repetition time = 9900 milliseconds, echo time = 88 milliseconds, flip angle = 90, 128 128 matrix, 320 mm 320 mm field of view, and slice thickness = 2.5 mm with no gap (2.5 2.5 2.5 mm isotropic voxels). Diffusion weighting was obtained along sixty noncollinear directions using a b - value of 700 s / mm . Each subject the five reference images with no diffusion weighting were averaged and normalized to the mni t2 template in spm2 (statistical parametric mapping, http://www.fil.ion.ucl.ac.uk/spm). The matrix of normalization parameters was inverted to obtain the transformation matrix from standard space to world space . We have done this to avoid the extensive resampling and reorientation of the data that is involved in the normalization of dti data [25, 26], because we hypothesize that this would lead to a degradation of the finer details in the fiber tracts.only linear terms were used in the normalization to ensure that the transformation matrices could be inverted . Diffusion tensors and fractional anisotropy (fa) maps were calculated using the diffusion toolbox in spm2 . The fa maps were used for displaying the anatomical location of the roi coordinates . Fiber tracking was performed in the dti - studio package using the fact algorithm . Tracking was terminated when the angle of two consecutive eigenvectors was larger than 85, or when a voxel was reached with an fa value smaller than 0.20 . In most of the original studies [1519, 22], the rois that were used for effective connectivity analysis were all spheres of 8 mm radius . However, in two studies [20, 21] only the peak voxels of a partial least - squares analysis were used . Because these voxels represented larger clusters of voxels, we have used rois with roughly the same size (spheres of 8 mm radius) as a starting point for all networks . We have chosen not to transform the whole original roi into subject space, as this might lead to extensive seeding of the white matter adjacent to the seed coordinate, and thus to many false positives . Instead, we have drawn rois on the individual subject s fa maps, taking care that the borders of the roi were at the border of gray and white matters (as visible on the fa map) and that the roi would approximately be of the same size as the original roi . All possible combinations of regions were tracked, including the connections that were not proposed in the original effective connectivity studies . The results for all networks under investigation are visualized in figures 18, in which the thickness of the connecting lines indicates the number of subjects in which a particular connection was found . In the appendix, we have also listed these results in table 1 . The most striking class of paths which are not supported by our findings contains frontal interhemispheric paths . This can however convincingly be explained by methodological shortcomings in regions with crossing fibers in the frontal parts of the brain . We will discuss these issues further in section 4 . In half of the studies, we have also found connections indicating paths that were not included in the original studies . In the following this not only leads to the situation that this nomenclature is inconsistent between studies, but may also give the incorrect impression that similar connections are under investigation in different networks . It is therefore important to note that the regions of interest normally are spheres of approximately 8 mm in diameter, and thus two regions with the label the network of this study can be separated into a dorsal stream (v1, de, pp, and lp) and a ventral stream (v1, itp, and ita) of visual areas . The paths within these streams are supported in the majority of subjects by our dti results . However, the crucial path under investigation is the path between the two streams (pp - itp), which is hypothesized to mediate the learning effect under investigation . Interestingly, we have found no evidence for this path, but we have found support for a path (de - ita), which was not included in the proposed network and which could be a potential candidate to mediate this effect . Whereas we do not wish to suggest that the original path (pp - itp) should be dismissed, it would be interesting to investigate whether a part of the learning related effects, reported in the original study, is mediated by the new path we have reported . In this network, a series of regions (occ, par, and pfc) is proposed in both hemispheres with symmetrical paths within the hemispheres and extensive interhemispheric connections . The paths between occipital and parietal cortices are supported by our findings as are the interhemispheric connections between these regions . Furthermore, we have found evidence for paths that were not included in the original model, namely, interhemispheric connections between occipital and parietal cortices . This is quite remarkable, because interhemispheric connections between nonhomologous regions are rarely found in this kind of analyses . Also of interest are the cases in which the proposed paths are not supported by our results . The interhemispheric connections we did not find (lpfc - rpfc, lpfc - rpar, and rpfc - lpar) fall into the aforementioned problematic class of frontal interhemispheric connections . The most interesting negative result is the lack of connections between right parietal and right prefrontal cortices, in contrast to the presence of these connections in the left hemisphere . In this case, methodological shortcomings are not likely to affect the results, as this would indicate that these shortcomings would exist for the right hemisphere but not for the left hemisphere . The same argument makes the consideration of connections via an extra region, which has not been included in the network, also unattractive . Therefore, we tentatively interpret these findings as a support for an asymmetry in connectivity between these areas in parietal and prefrontal cortices . This network contains a set of motor and prefrontal regions in both hemispheres which are symmetrically connected within the hemispheres . This last set of paths falls again in the class of frontal interhemispheric connections and thus it is not surprising that we have found no support for these paths . Have proposed an alternative network in their study, which contained also paths directly from premotor cortex to rostral prefrontal cortex . This extra network did not result in significant changes in the original paths, which is in agreement with the lack of support for these paths in our results . Kondo et al . Have proposed four network nodes (pfc, acc, spl, and ifc). However, two of these nodes (spl and ifc) can be further split up in four anatomically distinct regions (spl1, spl2, ifc1, and ifc2). We have thus decided to treat each of these regions as a separate node and have studied the connections between these nodes . Our results show that the regions which constitute each original node (e.g., ifc1 and ifc2) are connected with each other, but they show differential connectivity patterns with the rest of the network, which suggest that they also have a different role within this network . The lack of support for paths from and to the acc was surprising, especially given the fact that the acc is known to connect extensively with the prefrontal cortex in the macaque . In this network, a set of regions is proposed ranging from occipital, temporal, premotor, and prefrontal regions . Given our results in the other studies, it was not surprising that there was hardly any support for the (nonhomologous) interhemispheric connections originating in frontal and prefrontal cortices . Support was found for paths between occipital cortex and frontal and superior temporal cortices . However, there are also two intrahemispheric paths for which no support was given (a6-a18r, a10-a6). Furthermore, there was no evidence found for paths which were not included in the original analysis . Therefore, within the context of this network, dti did not deliver any extra information . Rowe et al . Have proposed a network with bilateral parietal, prefrontal, and prestriate areas and a motor area in the left hemisphere only . We have found only scarce support for the paths to and from prestriate area, even after lowering the fa threshold . In the left hemisphere, we have found consistent evidence for all other proposed paths . However, as in the network of fletcher et al ., we have found support for parietal - frontal connections in the left but not in the right hemisphere . Based on the same arguments as in the network of rowe et al ., we again interpret this as an evidence for an asymmetry in these connections . This is even more remarkable, because the locations of parietal and especially prefrontal areas in both studies are quite widely separated . The network of seminowicz et al . Consists predominantly of prefrontal subcortical areas in the right hemisphere, with the lateral prefrontal cortex as the only region in the left hemisphere . This might directly explain why we have found only scarce evidence for paths from this region to the rest of the network, because of the aforementioned methodological problems with frontal interhemispheric connections . In contrast to the study of kondo et al ., we have found connections supporting the proposed paths from the anterior cingulate cortex . Furthermore, we have found many connections from the thalamus to the rest of the network which do not conform to proposed paths . This is however not surprising, as it is well known that the different nuclei in the thalamus extensively connect to different parts of the cortex . Connections are thus most probably the result of the fact that the seed region in this case was too large to specifically select the nucleus of the thalamus involved in this network . Further evidence for paths that were not proposed in the original network was found for connections from medial prefrontal cortex to the hippocampus and the subgenual cingulated cortex . The hippocampus is a region of low fa and thus in an initial analysis showed only very limited connectivity with the rest of the network . We have therefore repeated the analysis with a lowered fa threshold (0.15) which yielded support for the proposed paths from the hippocampus . White et al . Have proposed a model with the left motor cortex and supplementary motor area, the thalamus, and two areas from the right cerebellum . We have found support for the intrahemispheric paths but not for the interhemispheric ones . This last finding contradicts findings from the macaque literature in which there are connections found between the primary motor cortex and the contralateral cerebellum deep nucleus . Moreover, there is evidence that the pons, which is a region through which these fibers have to pass, contains crossing fibers . We, therefore, conclude that it is valid to include these connections in an effective connectivity analysis . In this study, we have for the first time used dti - based fiber tractography to investigate the anatomical basis of effective connectivity models . First, we wanted to establish that dti - based tractography is able to resolve the connectivity between rois of the size typically used in effective connectivity studies . We hypothesized that the majority of the proposed paths were indeed valid, and compared the results of our dti - based analysis with these paths . However, we believe that the greatest potential advantage of using dti - based tractography in the context of effective connectivity models lies in establishing paths that are not suggested by the available knowledge (e.g., macaque tracer literature). Our second aim was therefore to investigate the evidence for connections which were not proposed in the original studies . We have found evidence for such connections in half of the models . In the following, we will discuss these findings in the context of current methodological limitations and we will evaluate their implications for the proposed models . When there was no evidence found for a proposed path, there are two explanations possible: there is no direct anatomical connection; in this case, the proposed path can only be supported by an indirect connection with a third region;there is a direct connection, but it has not been found due to methodological limitations (false negative). The second explanation is especially relevant to a class of frontal interhemispheric connections . As mentioned in the introduction, dti - based tractography has profound difficulties when tracking through voxels with multiple fiber populations . The frontal interhemispheric connections pass through the corona radiata, which is well known to contain such voxels . Therefore, any negative findings about this class of connections have to be interpreted as being inconclusive . There is no direct anatomical connection; in this case, the proposed path can only be supported by an indirect connection with a third region; there is a direct connection, but it has not been found due to methodological limitations (false negative). There is another set of negative findings which merits further discussion: in both networks of fletcher et al . And of rowe et al ., we have found evidence for a connection between parietal and prefrontal cortices in the left hemisphere but not in the right hemisphere here, an explanation in terms of methodological limitations seems unattractive, because this would suggest that these limitations occur in the right hemisphere but not in the left hemisphere . Therefore, we tentatively conclude that these connections are indeed absent in the right hemisphere and that this is an evidence for an asymmetry in parietal - frontal connectivity . We should point out, however, that this asymmetry seems counterintuitive at first, since the right hemisphere is hypothesized to be dominant for visuospatial processing and one would expect that these connections would be especially strong for this hemisphere . However, as we are dealing with relatively small rois within the frontal and parietal lobes, this does not rule out the possibility of there being any connections between these lobes in the right hemisphere . There are a number of paths for which no evidence was found and which cannot be interpreted directly in terms of methodological limitations . As in many neuroimaging studies, these negative findings are difficult to classify and it would certainly be imprudent to conclude that these paths do not exist . Moreover, it is also possible that a path is mediated by connections from and to a third region, which was not included in the network . This situation can be relatively harmless if the function of the missing region is known to be restricted to message passing . However, we hypothesize that, if there is a substantial number of such indirect connections present in a network, the inclusion of these other regions, which mediate these connections, becomes necessary to ensure the biological validity of the network . Given the methodological issues discussed above, it is clear that the potential contribution of dti to connectivity studies lies not in disproving the existence of postulated connections, but in the unique potential for detecting hitherto unconsidered direct anatomical connections . This is because dti may be prone to type ii errors, but it is far less likely to consistently produce type i errors when connections are averaged across subjects . It is hence highly significant that we have also found evidence for a number of paths which have not been taken into account in the original studies . Incorporating these paths in a new analysis of these models can potentially have a significant impact on the interpretation of these models, since they point to improvements in the anatomical validity of the models, which in turn leads to more veridical path coefficients . At the current state of technology in effective connectivity, one has considerable freedom to choose the connections in a model and to evaluate different models with different connectivity profiles against each other . This model selection procedure can be augmented significantly with dti - based tractography, because models in which the connections to a large extent overlap with the connections found in a dti analysis should in turn be more likely . One could potentially formalize this in a bayesian framework by designing priors on the connections and by subsequently making the priors on the known connections high and sharp and the priors on the unknown connections relatively noninformative . If this would be a veridical variability, it would be a surprising and new finding, since the intersubject variability of anatomical connections is generally considered to be low and is furthermore difficult to assess with either dti or tracer methods . In dti, the normalization of findings still makes it difficult to compare findings across subjects, whereas tracer studies are normally performed in very few animals because of ethical considerations, which makes any discussion about differences between animals extremely difficult . Although we have not normalized the fiber tracks to a template, we do believe that normalization problems still play an important role in our studies because they might cause the erroneous placement of seed regions in some subjects, which in turn would lead to misleading tractography results and the above - mentioned intersubject variability . The smoothing strategy, employed in functional studies to reduce the effect of anatomical differences between subjects, cannot be applied in our framework because the directional information, used in the tracking procedure, would be smeared out over other voxels and potentially other tracks, with unpredictable implications for the veridicality of the tracks found . Currently, there is no convincing way of solving this problem, as the basic anatomical landmarks vary substantially over subjects . Recently, advances have been made towards the estimation of multiple fiber directions within one voxel and also in probabilistic tractography . We will now discuss each of these developments and their potential use for our framework . The estimation of multiple fiber compartments per voxel, in general, brings this technique closer to producing veridical anatomical connections, and a number of techniques have been proposed to achieve this [33, 3639]. There is, however, one problem which cannot be solved by this technique alone, and that is the kissing / crossing fiber problem: when a fiber has to track through a voxel with multiple compartments, it is uncertain which compartment has to be used to determine the direction in which the track is to be continued . In a number of studies, the direction that is most collinear with the incoming fiber was chosen, but this does not necessarily have to be the true direction . Whereas the single tensor model is probably too conservative in the connections it yields, multiple compartment models might thus yield a number of false positives . In probabilistic fiber tracking, a measure of uncertainty of the local fiber direction is estimated per voxel [4044]. Fiber tracking is now done in a monte carlo type experiment: the tracking is performed multiple times, each time with a different orientation drawn from the local fiber direction distributions . Subsequently, the number of times a target voxel was hit by this procedure is calculated, which then is converted to an informal measure of probability of connection . While this procedure by itself seems valid, in practice this leads to widespread patterns of connectivity and it is uncertain at which level of probability the map should be thresholded . Moreover, the probability of connection tends to decrease with increasing distance . In a sem network, both relatively local and long connections can be included, which makes the comparison of these connections difficult . Thus while both techniques (multiple direction estimation and probabilistic fiber tracking) can potentially alleviate some of the problems, we have encountered (e.g., interhemispheric connections), unresolved issues remain . In conclusion, we have shown that dti - based tractography can be used to explore the anatomical connections between regions, used in effective connectivity studies, notwithstanding the current limitations of this method . We have observed evidence for the proposed paths in a large number of cases and, more importantly, we have shown in several cases direct connections that were not included in the original models . We therefore conclude that dti - based tractography is a valuable tool for exploring the anatomical basis of functional networks.
Adp - ribosylation refers to the addition of one or more adp - ribose units onto proteins through the transfer of the adp - ribose group from nad to target proteins post - translationally . Adp - ribose groups can be attached singly as mono(adp - ribose) or in polymeric chains as poly(adp - ribose) (par) by the enzymatically active members of the family of 17 human adp - ribosyltransferases, commonly known as parps (13). In addition, mono(adp - ribosyl)ation can be facilitated by other enzymes including sirtuins, extracellular membrane - associated adp - ribosyltransferases and bacterial toxins (46). Of note, non - enzymatic addition of adp - ribose groups onto proteins was also reported in vitro (7,8). Adp - ribosylation can be added onto amino acids of diverse chemistry, including glutamate, aspartate, lysine, arginine and cysteine (9,10). Some of these adp - ribose conjugations have shown to be reversible and their removal is mediated by two broad classes of enzymes that cleave par or the bond between adp - ribose and its conjugated amino acid (11,12). Poly(adp - ribose) glycohydrolase (parg) and adp - ribosylhydrolase 3 (arh3) cleave the ribose ribose bonds between adp - ribose subunits (11,12). While adp - ribosylhydrolase arh1 removes single adp - ribose groups from conjugated arginine residues, adp - ribosylhydrolases macrod1, macrod2 and targ1 remove the last remaining adp - ribose groups from poly(adp - ribosyl)ated substrates or single adp - ribose groups from mono(adp - ribosyl)ated proteins conjugated at acidic residues (11,12). Targ1 is unique for its additional ability to remove the whole par chain specifically at glutamate several techniques have been developed to enrich and identify adp - ribosylated substrates (14). Some techniques use antibodies or protein domains that bind adp - ribose to pull out the modification from cell lysates and use mass spectrometry to identify adp - ribosylated substrates (1517). Other techniques utilize protein microarrays and recombinant parps to identify parp - specific substrates (18,19). Adp - ribosylation has numerous and diverse effects on protein functions and cellular pathways, including dna damage, transcription, chromatin organization, stress responses, circadian rhythms, cell cycle regulation and rna metabolism (2,2024). The addition of the modification can affect the substrate's stability and activity, as well as serve as a scaffold to recruit other proteins non - covalently (20,2527). Adp - ribosylation activity spans a diverse range of organisms across different kingdoms, from viruses to bacteria to mammals, highlighting the importance of this modification in living organisms (28,29). Because of the diverse roles they play in the cell, adp - ribosylation and adp - ribosyltransferase / parp activity have been implicated in a spectrum of disease pathogenesis, such as cancer, inflammatory diseases and neurological disorders (30,31). Notably, parp inhibitors have already shown clinical benefits in multiple cancers, including olaparib (lynparza) that has already been approved by the food and drug administration (fda) in the united states and european medicines agency (32,33). Thus, understanding substrate specificity of parps and how protein function is affected by adp - ribosylation are of timely importance and have the potential to improve our understanding of the biology of diseases . Though the modification was discovered over 50 years ago (34,35), it was only until recently that several proteomics techniques have been developed to identify the adp - ribosylation sites (9,36). Such site information will provide initial insights to generate hypotheses for testing the function of adp - ribosylation in modified substrates . To facilitate researchers in appreciating the depth and breadth of adp - ribosylation's role across the proteome, we have created adpribodb, a database of adp - ribosylated proteins curated from the literature between 1975 and july 2015 (adpribodb.leunglab.org). Adpribodb is freely accessible online and provides information for each entry on the protein name, gene symbol, uniprot i d, species / cell line of origin, experimental details and states the original figure / table from which the entry was curated . The database curation effort is ongoing and the website also allows single entries or bulk format upload for publication - associated data sets . It is our hope that adpribodb will offer insights into the adp - ribosylated proteome, and may reveal patterns of adp - ribosylation across substrate proteins, and highlight important interactions and networks, which will aid in our understanding of the myriad roles of adp - ribosylation played in cells . Adpribodb was compiled through a manual curation of the literature accessed from pubmed, using the following 16 search terms: parsylation or poly(adp - ribosyl)ation or poly - adp - ribosylation or poly(adp - ribosylation) or parylated or parsylated or poly(adp)ribosylation or marylation or marsylation or mono(adp - ribosyl)ation or mono - adp - ribosylation or mono(adp - ribosylation) or marylated or marsylated or this parameter was further limited for our search between january 1975 and july 2015 yielding 1456 articles . Each journal article was assessed for the inclusion in adpribodb by at least two independent curators . Diverse techniques have been applied to demonstrate that the entries are adp - ribosylated (method; see supplementary table s1), including immunoprecipitation with anti - par antibodies from cells and autoradiography of in vitro modification of recombinant proteins by adp - ribosyltransferases with p - labeled nad . Recent years have seen the application of mass spectrometry approaches for validation of protein modifications and site identification . For the sake of comprehensiveness, adpribodb includes all proteins identified from immunoprecipitation / affinity - based approaches as tentatively adp - ribosylated . The underlying caveat of these approaches using antibodies and adp - ribose binding domains is that it cannot distinguish whether these proteins are non - covalently bound with adp - ribose groups or covalently attached to them . However, such distinction can now be made possible with the ability to identify the adp - ribosylation sites (9,36). As a result, we include modification details based on mass spectrometry analyses in adpribodb whenever they are available . For example, cebpb was identified in an affinity - based proteomics study using the af1521 adp - ribose binding macrodomain (15), but the adp - ribosylation site was subsequently identified in a global site mapping study (37) (figure 1). Left: snapshots of adpribodb . Right: the number of publications identifying adp - ribosylated protein substrates each year from january 1975 through july 2015, totaling to 459 publications . Literature references. If a modified protein was identified, the protein name, gene symbol and corresponding uniprot i d were included in the no uniprot ids and gene symbols were associated in the publication, the curator(s) determined the best assignment of a uniprot i d based on all the information provided and noted that this entry as self - assigned, along with any other comments in the curator comments field . If multiple variants of the protein are available on uniprot, the first variant was chosen . Several key experimental details were collected under the experimental details section, including the origin of the cell line / tissue (origin) and the species they are derived from (species). Additionally, we noted whether the modification is induced / inhibited by certain drug treatment (drug sensitivity). Under the modification details section, we noted whether the modification is regulated by certain adp - ribosyltransferases (enzymes) and whether the modification is mono(adp - ribosyl)ation or poly(adp - ribosyl)ation (mono / poly). In addition, the adp - ribosylation sites and peptide sequences identified by mass spectrometry were included (sequencing information). Under the literature references section, the figure / table number displaying the data for modification and an excerpt of the text describing the data data description. The pubmed i d and year of these publications were included to allow users to easily review or cite the primary sources for the identification of specific adp - ribosylated proteins . All entries, given a unique adpribodb identification number, were organized in a flat text file database . A user search interface was then created using xataface, a web application framework for implementing the open - source relational database management system mysql . Adpribodb can be searched by protein name, gene symbol, uniprot i d, pubmed i d and enzymes (e.g. Parp1). The rest of the webpages to explain the functioning of the database were created through weebly . Manual curation of literature between january 1975 and july 2015 identified 12 428 entries, in which 8867 of them have protein sequencing data available . The current database entries are derived from 459 publications with experimental supports for parylated and/or marylated proteins . The database currently includes 2389 unique proteins and 573 of them are associated with sequencing information . Though 93% of entries are derived from human, over 860 entries are from diverse organisms, which include not only the common model systems, such as mouse, rat, fruitfly and arabidopsis, but also quail, cow, chicken, sea urchin, octopus, various bacteria and viruses (figure 2a). . The publications identifying the highest number of proteins are proteomics studies utilizing mass spectrometry . (c) only 79 proteins were overlapped between 10 large mass spectrometry proteomics analyses (blue) and the remaining 449 studies (purple) included in the database . The relative lack of overlap indicates that current proteomics approaches have yet to reach saturation in identifying adp - ribosylated substrates . (d) a representation of the number of times a specific protein is identified . However, 18 proteins were identified at least 10 times and are listed in table 1 . Amongst 459 publications, 58% of them (n = 264) identified single adp - ribosylated proteins, 5% (n = 25) identified at least 10 substrates and 2% (n = 10) from proteomics studies with more than 50 substrates identified (figure 2b). Among the 2389 unique proteins identified, 80% of adp - ribosylated substrates (1908) were uniquely identified in these 10 proteomics studies and 17% (402) from the rest of the 449 publications (figure 2c). Surprisingly, only 79 adp - ribosylated substrates were overlapped between these two sets, suggesting that we have yet to reach saturation in probing the adp - ribosylated proteome . Consistently,> 71% (1708 out of 2389 unique proteins) were identified only once (figure 2d). Adp - ribosylation of human parp1 (p09874) has been the most comprehensively analyzed protein with 111 publications, followed by histones, other parps and their homologs in mouse and rat (table 1). Other proteins identified in at least 10 publications, including tumor suppressor p53 and dna topoisomerase 1, are also included in table 1 . The availability of this aggregate data potentially allows researchers to gain insights into global functions of adp - ribosylation . Our previous informatics analyses indicated that adp - ribosylated substrates are significantly enriched with proteins that are enriched for low - complexity regions, which aid self - assembly of non - membraneous organelles (25). Using 457 human proteins that have sequencing information in adpribodb, we tested whether these substrates are enriched in particular subcellular compartments . Adp - ribosylated substrates are significantly enriched in the proteome of non - membraneous rna granules, including the nucleolus (38) and stress granules (39) (p - value = 1.85 10 and 5.00 10 respectively, fisher's exact test; figure 3a). These data are consistent with the identification of the adp - ribosyltransferases in these non - membraneous organelles parp1 and parp2 in the nucleolus (40) and parp5a, parp12, parp13, parp14 and parp15 in the stress granules (41). Consistent with a previous analysis (42), both the proteomes of the nucleolus and stress granules are enriched for low complexity domain - containing proteins (figure 3a). In contrast, similar analyses for n - glycosylated substrates are enriched in the endoplasmic reticulum, golgi, lysosome and membrane fractions and these substrates are not enriched for low complexity domain - containing proteins (figure 3a and b). Such a statistically significant association between adp - ribosylated substrates and non - membraneous organelles is in agreement with our informatics - led hypothesis (25) and recent experimental evidence (43,44) indicating that par can help seed low complexity domain - containing proteins to form non - membraneous structures . (a) adp - ribosylated proteins are significantly enriched in non - membranous compartments, such as the nucleolus (38) and stress granules (39), as determined by fisher's exact test, with significant p - values highlighted in red . A similar analysis was performed with proteins that have experimentally validated n - glyosylation sites (n - glyocsyldb) deposited in dbptm (46). As expected, n - glyocsylated proteins were found enriched in the golgi, endoplasmic reticulum, lysosomes and membrane fractions as defined by uniprotkb (51). No enrichment of experimentally validated adp - ribosylation sites or n - glycosylation sites was found in the mitochondrial proteome (52). (b) low complexity domain - containing proteins are significantly enriched in adpribodb in contrast to n - glycosyldb, suggesting a link between adp - ribosylation and low complexity domain - containing proteins . Adpribodb is built with the anticipation of several major developments in the adp - ribosylation field first, given the development of various site identification methods (9,14,36), we are expecting that a series of proteome - wide analyses will soon be available for a global survey of adp - ribosylated proteins in cells and tissues . The first generation of adpribodb will therefore help connect these newly acquired proteomics data with the existing literature between 1975 and 2015 . In addition, adp - ribosylation sites can be used to correlate with existing databases on other post - translational modifications, such as phosphorylation, acetylation and methylation (45,46). Second, 19% of adpribodb entries (2419) include the information regarding the enzyme responsible for the modification of specific substrates, where 69% (1659) are mediated by parp1 . However, we expect this trend will be changed soon with the coming - of - age technologies to investigate enzyme these include proteome arrays (18,19), the development of analog - sensitive adp - ribosyltransferases (4749) as well as the improvement in performing genetic knockdown by rna interference and knockout using crispr in mammalian cell culture . Finally, parp inhibition is actively used in clinical settings . Therefore, future development of these parp - specific inhibitors for clinical use should couple with our basic scientific knowledge in how the endogenous adp - ribosylated proteome is affected (9,50). As a result, drug sensitivity to report whether certain substrates / sites are sensitive to particular parp inhibitors (37). With adpribodb, we aim to provide a one - stop portal for the community to search adp - ribosylation substrates and site information, where basic scientists and clinicians can use this cumulative information to understand basic biology of adp - ribosylation, generate hypotheses in examining adp - ribosylation functions and explain clinical benefits and side effects observed in patients at the molecular level . Adpribodb was compiled through a manual curation of the literature accessed from pubmed, using the following 16 search terms: parsylation or poly(adp - ribosyl)ation or poly - adp - ribosylation or poly(adp - ribosylation) or parylated or parsylated or poly(adp)ribosylation or marylation or marsylation or mono(adp - ribosyl)ation or mono - adp - ribosylation or mono(adp - ribosylation) or marylated or marsylated or this parameter was further limited for our search between january 1975 and july 2015 yielding 1456 articles . Each journal article was assessed for the inclusion in adpribodb by at least two independent curators . Diverse techniques have been applied to demonstrate that the entries are adp - ribosylated (method; see supplementary table s1), including immunoprecipitation with anti - par antibodies from cells and autoradiography of in vitro modification of recombinant proteins by adp - ribosyltransferases with p - labeled nad . Recent years have seen the application of mass spectrometry approaches for validation of protein modifications and site identification . For the sake of comprehensiveness, adpribodb includes all proteins identified from immunoprecipitation / affinity - based approaches as tentatively adp - ribosylated . The underlying caveat of these approaches using antibodies and adp - ribose binding domains is that it cannot distinguish whether these proteins are non - covalently bound with adp - ribose groups or covalently attached to them . However, such distinction can now be made possible with the ability to identify the adp - ribosylation sites (9,36). As a result, we include modification details based on mass spectrometry analyses in adpribodb whenever they are available . For example, cebpb was identified in an affinity - based proteomics study using the af1521 adp - ribose binding macrodomain (15), but the adp - ribosylation site was subsequently identified in a global site mapping study (37) (figure 1). Left: snapshots of adpribodb . Right: the number of publications identifying adp - ribosylated protein substrates each year from january 1975 through july 2015, totaling to 459 publications . Literature references. If a modified protein was identified, the protein name, gene symbol and corresponding uniprot i d were included in the identifiers section . In the circumstance in which a protein was identified but no uniprot ids and gene symbols were associated in the publication, the curator(s) determined the best assignment of a uniprot i d based on all the information provided and noted that this entry as self - assigned, along with any other comments in the curator comments field . If multiple variants of the protein are available on uniprot, the first variant was chosen . Several key experimental details were collected under the experimental details section, including the origin of the cell line / tissue (origin) and the species they are derived from (species). Additionally, we noted whether the modification is induced / inhibited by certain drug treatment (drug sensitivity). Under the modification details section, we noted whether the modification is regulated by certain adp - ribosyltransferases (enzymes) and whether the modification is mono(adp - ribosyl)ation or poly(adp - ribosyl)ation (mono / poly). In addition, the adp - ribosylation sites and peptide sequences identified by mass spectrometry were included (sequencing information). Under the literature references section, the figure / table number displaying the data for modification and an excerpt of the text describing the data data description. The pubmed i d and year of these publications were included to allow users to easily review or cite the primary sources for the identification of specific adp - ribosylated proteins . All entries, given a unique adpribodb identification number, were organized in a flat text file database . A user search interface was then created using xataface, a web application framework for implementing the open - source relational database management system mysql . Adpribodb can be searched by protein name, gene symbol, uniprot i d, pubmed i d and enzymes (e.g. Parp1). The rest of the webpages to explain the functioning of the database were created through weebly . Manual curation of literature between january 1975 and july 2015 identified 12 428 entries, in which 8867 of them have protein sequencing data available . The current database entries are derived from 459 publications with experimental supports for parylated and/or marylated proteins . The database currently includes 2389 unique proteins and 573 of them are associated with sequencing information . Though 93% of entries are derived from human, over 860 entries are from diverse organisms, which include not only the common model systems, such as mouse, rat, fruitfly and arabidopsis, but also quail, cow, chicken, sea urchin, octopus, various bacteria and viruses (figure 2a). (b) a histogram displaying how many modified proteins were identified per publication . The publications identifying the highest number of proteins are proteomics studies utilizing mass spectrometry . (c) only 79 proteins were overlapped between 10 large mass spectrometry proteomics analyses (blue) and the remaining 449 studies (purple) included in the database . The relative lack of overlap indicates that current proteomics approaches have yet to reach saturation in identifying adp - ribosylated substrates . (d) a representation of the number of times a specific protein is identified . However, 18 proteins were identified at least 10 times and are listed in table 1 . Amongst 459 publications, 58% of them (n = 264) identified single adp - ribosylated proteins, 5% (n = 25) identified at least 10 substrates and 2% (n = 10) from proteomics studies with more than 50 substrates identified (figure 2b). Among the 2389 unique proteins identified, 80% of adp - ribosylated substrates (1908) were uniquely identified in these 10 proteomics studies and 17% (402) from the rest of the 449 publications (figure 2c). Surprisingly, only 79 adp - ribosylated substrates were overlapped between these two sets, suggesting that we have yet to reach saturation in probing the adp - ribosylated proteome . Consistently,> 71% (1708 out of 2389 unique proteins) were identified only once (figure 2d). Adp - ribosylation of human parp1 (p09874) has been the most comprehensively analyzed protein with 111 publications, followed by histones, other parps and their homologs in mouse and rat (table 1). Other proteins identified in at least 10 publications, including tumor suppressor p53 and dna topoisomerase 1, are also included in table 1 . The availability of this aggregate data potentially allows researchers to gain insights into global functions of adp - ribosylation . Our previous informatics analyses indicated that adp - ribosylated substrates are significantly enriched with proteins that are enriched for low - complexity regions, which aid self - assembly of non - membraneous organelles (25). Using 457 human proteins that have sequencing information in adpribodb, we tested whether these substrates are enriched in particular subcellular compartments . Adp - ribosylated substrates are significantly enriched in the proteome of non - membraneous rna granules, including the nucleolus (38) and stress granules (39) (p - value = 1.85 10 and 5.00 10 respectively, fisher's exact test; figure 3a). These data are consistent with the identification of the adp - ribosyltransferases in these non - membraneous organelles parp1 and parp2 in the nucleolus (40) and parp5a, parp12, parp13, parp14 and parp15 in the stress granules (41). Consistent with a previous analysis (42), both the proteomes of the nucleolus and stress granules are enriched for low complexity domain - containing proteins (figure 3a). In contrast, similar analyses for n - glycosylated substrates are enriched in the endoplasmic reticulum, golgi, lysosome and membrane fractions and these substrates are not enriched for low complexity domain - containing proteins (figure 3a and b). Such a statistically significant association between adp - ribosylated substrates and non - membraneous organelles is in agreement with our informatics - led hypothesis (25) and recent experimental evidence (43,44) indicating that par can help seed low complexity domain - containing proteins to form non - membraneous structures . (a) adp - ribosylated proteins are significantly enriched in non - membranous compartments, such as the nucleolus (38) and stress granules (39), as determined by fisher's exact test, with significant p - values highlighted in red . A similar analysis was performed with proteins that have experimentally validated n - glyosylation sites (n - glyocsyldb) deposited in dbptm (46). As expected, n - glyocsylated proteins were found enriched in the golgi, endoplasmic reticulum, lysosomes and membrane fractions as defined by uniprotkb (51). No enrichment of experimentally validated adp - ribosylation sites or n - glycosylation sites was found in the mitochondrial proteome (52). (b) low complexity domain - containing proteins are significantly enriched in adpribodb in contrast to n - glycosyldb, suggesting a link between adp - ribosylation and low complexity domain - containing proteins . Adpribodb is built with the anticipation of several major developments in the adp - ribosylation field site identification, enzyme substrate specificity and substrate / site sensitivity to parp inhibitors . First, given the development of various site identification methods (9,14,36), we are expecting that a series of proteome - wide analyses will soon be available for a global survey of adp - ribosylated proteins in cells and tissues . The first generation of adpribodb will therefore help connect these newly acquired proteomics data with the existing literature between 1975 and 2015 . In addition, adp - ribosylation sites can be used to correlate with existing databases on other post - translational modifications, such as phosphorylation, acetylation and methylation (45,46). Second, 19% of adpribodb entries (2419) include the information regarding the enzyme responsible for the modification of specific substrates, where 69% (1659) are mediated by parp1 . However, we expect this trend will be changed soon with the coming - of - age technologies to investigate enzyme these include proteome arrays (18,19), the development of analog - sensitive adp - ribosyltransferases (4749) as well as the improvement in performing genetic knockdown by rna interference and knockout using crispr in mammalian cell culture . Therefore, future development of these parp - specific inhibitors for clinical use should couple with our basic scientific knowledge in how the endogenous adp - ribosylated proteome is affected (9,50). As a result, adpribodb starts to collect information under the field drug sensitivity to report whether certain substrates / sites are sensitive to particular parp inhibitors (37). With adpribodb, we aim to provide a one - stop portal for the community to search adp - ribosylation substrates and site information, where basic scientists and clinicians can use this cumulative information to understand basic biology of adp - ribosylation, generate hypotheses in examining adp - ribosylation functions and explain clinical benefits and side effects observed in patients at the molecular level . Allegheny health network johns hopkins cancer research fund; johns hopkins catalyst award; american cancer society research scholar award [129539-rsg-16 - 062 - 01-rmc]; national institute of health [r01-gm104135]. The trainee was funded by an nci training grant [5t32ca009110 to c.a.v]; khorana program [to c.a]. Funding for open access charge: allegheny health network johns hopkins cancer research fund.
A 48-year - old female patient 158 cm in weight weighing 53 kg was admitted to receive functional endoscopic sinus surgery and septoplasty for a diagnosis of chronic sinusitis and nasal septal deviation . The patient was a non - smoker and her medical history stated that she had received an appendectomy one year prior to her visit and had a benign tumor removed from her bladder six months before her visit . There were no abnormalities other than light anemia with an hb of 9.7 g / dl and hct at 30.7% from the blood test . Glycopyrrolate 0.2 mg was i m injected as premedication, and preoxygenation was sufficiently achieved with 100% oxygen before induction of anesthesia . Propofol 100 mg and rocuronium 50 mg was slowly iv injected and after fully confirming loss of consciousness and muscle relaxation, oral endotracheal intubation was attempted with a curved laryngoscope (macintosh size3 blade). The patient was class 1 based on the cormack and lehane laryngeal endoscopic classification, and endotracheal intubation was performed smoothly in the first attempt with a preformed ring, adair, elwyn tube (rae, mallinckrodt) 7.0 mm in diameter . Proper placement of the tube was confirmed by chest auscultation and it was fixed at a tube length of 20 cm . A tidal volume of 450 ml and respiration rate of 12 times / min were maintained with mechanical ventilation (aestiva/5, datex - ohmeda, madison, usa); airway pressure was 14 - 16 cmh2o and positive end expiratory pressure was 1 cmh2o . Anesthesia was maintained with o2 2 l / min, n2o 2 l / min, and sevoflurane 2.0 - 2.5 vol% . During surgery, the blood pressure was 105 - 150/60 - 95 mmhg, heart rate 75 - 100 beats / min, and oxygen saturation 99 - 100%, and end - tidal carbon dioxide tension was maintained at 33 - 37 mmhg . The duration of the surgery was 2 hours and 30 minutes, and there were no abnormalities during surgery . After surgery, pyridostigmine 15.0 mg and glycopyrrolate 0.4 mg were iv injected to reverse the muscle relaxation . When spontaneous respiration was sufficiently recovered and extubation of the endotracheal tube was about to be performed, suddenly, the patient severely shook her head and started to struggle so the bandage fixing the tube was immediately removed; air was removed from the balloon, and extubation was performed . During extubation, the patient was severely bucking while raising her neck and upper body so surrounding staff were called for help in safely holding down the patient . After extubation, the patient was soon stabilized after a few coughs and was moved to the recovery room . A blood pressure of 120 - 140/70 - 80 mmhg, heart rate of 65 - 76 beats / min, and oxygen saturation of 99 - 100% were maintained in the recovery room, and other than weak pain in the operated area, there were no specific complaints of symptoms so she was moved to general ward without abnormalities . Three hours after surgery, the patient started to feel nauseous and five hours after surgery, she vomited severely several times thus metoclopramide 10 mg was iv injected . Seven hours after surgery, the patient's neck and face swelled up with complaints of pain, and physical examination showed crepitation . Vital signs at the time was blood pressure 100/60 mmhg, heart rate 80 beats / min, respiration rate 20 times / min, temperature 36.3, and oxygen saturation 98% . Arterial blood gas analysis was immediately performed as well as chest and neck x - ray, and neck ct . The patient was put in semi - fowler's position to provide oxygen 2 l / min through a nasal cannula, and was put on a fast . Results of arterial blood gas analysis showed ph 7.42, paco2 31.7 mmhg, pao2 80.2 mmhg, hco3 20.7 meq / l, and sao2 96.8% . In the chest x - ray pneumothorax, subcutaneous emphysema in the chest wall, pneumomediastinum, and pneumoperitoneum were observed (fig . The neck ct showed extensive subcutaneous emphysema in the neck and face area, and emphysema in the retropharyngeal space (fig . The patient was immediately transferred to icu and oxygen 5 l / min was provided through a mask in fowler's position . No abnormalities were discovered in the fiberoptic laryngoscope examination performed by the ent department when investigating the cause . 4 ml of air were extracted from the retropharyngeal space with an 18 g needle using the intraoral approach, and the thoracic surgery performed insertion of chest tube on the right chest and incision of the subcutaneous emphysema on the chest wall . The patient received esophago gastro duodenoscopy (egd) and bronchoscopy for differential diagnosis, and there were no abnormalities found in the egd . In the bronchoscopy, there were no abnormalities in the laryngopharynx, vocal cords, and carina, but mucosal damage and bloody secretion were observed in the right second carina (fig . The patient was positive for mycobacterium tuberculosis polymerase chain reaction, and was diagnosed with tuberculosis . The patient received conservative treatment and anti - tubercular treatment, and was discharged from the hospital 2 weeks later with improved symptoms (fig . Clinical symptoms of pneumomediastinum are usually chest pain with accompanying radiating pain from the neck or back, breathing difficulties, tachypnea, and throat discomfort . Physical findings include subcutaneous emphysema, the loss of cardiac dullness to percussion, and mediastinal crepitation (hamman's sign). Diagnosis can be achieved by the above mentioned clinical symptoms and radiological observations . In a simple chest x - ray, usually a line due to an air shadow can appear along the left heart disinsertion and between the heart and diaphragm (continuous diaphragm sign), while in the lateral view of chest x - ray, there can be subcutaneous emphysema of the chest and neck, air shadows that appear along the back of the sternum or aortic arches, and air shadow around the outer pericardium of the right pulmonary artery (ring around the artery sign). Fifty percent of pneumomediastinum cannot be found just with chest pa x - rays; therefore, a lateral chest x - ray must be taken together . Chest ct can clarify the diagnosis or help confirm lesions that did not appear in simple chest x - rays . Explain the occurrence of pneumomediastinum by the elements inside the thorax and by the elements outside the thorax, depending on the place where the air originated . Elements inside the thorax are rupturing the pulmonary alveoli from asthma, vomiting, giving birth, lifting heavy objects, and applying force with the glottis closed, as well as secondary rupture of pulmonary alveoli or damage to the trachea and bronchus from external physical impact . Elements outside the thorax are cases where anatomical boundaries surrounding the mediastinum is pierced and air is injected, such as in surgery or injury to the head and neck area, tooth extraction, infection or penetration in the abdominal or peritoneal cavity . From these various causes, those that are associated with surgery and anesthesia can be complications from the surgery itself, pressure damage from positive ventilation during anesthesia, airway damage from endotracheal intubation, and airway damage from movement of an endotracheal tube . One case of pneumomediastinum that occurred after functional endoscopic sinus surgery was reported by sohail et al ., where a few hours after receiving functional endoscopic sinus surgery under general anesthesia, pneumomediastinum occurred together with subcutaneous emphysema in the face, neck, and chest wall, and the patient recovered after conservative treatment . The authors inferred that the surgery itself could not be seen as the direct cause of pneumomediastinum, and that pulmonary alveoli rupture or airway damage from endotracheal intubation were possible causes . Also in our case, the fiberoptic laryngoscope examination performed by the ent department showed no abnormalities from the operated area to the glottis, so there is low possibility that the surgery itself was the direct cause for pneumomediastinum . The possibility of pressure damage from positive ventilation during anesthesia is also low since various indicators such as ecg, oxygen saturation, airway pressure, positive end expiratory pressure, and end - tidal carbon dioxide tension were all in the normal range . The possibility of mucosal damage due to endotracheal intubation while inducing anesthesia is also low since there were no difficulties in the intubation process and the 7.0 mm diameter rae tube forms a curve at a 20 cm length so it is difficult to have deeper intubation ., when mean height of korean females is 157.8 3.7 cm; the mean length from the front teeth to carina was 25.3 0.9 cm, and the height of the patient in our case was 158 cm so the possibility of deep intubation is low . Additionally, if the tube had been inserted into right second carina, there should have been a clear reduction in breath sound in the non - ventilated lung, increased airway pressure, and a decrease in oxygen saturation, but these situations did not occur up to the end of surgery . Therefore, the authors believe that there is low possibility of mucosal damage due to endotracheal intubation . In addition, since a stilet was not used, damage from a stilet can also be ruled out . Next, there is the possibility of mucosal damage due to the movement of the endotracheal tube . In a study regarding the movement of the endotracheal tube, conrardy et al . Reported that the tube moves 1.5 cm towards the carina when bending the neck, and moves 2.4 cm towards the vocal cords when the neck is extended . In our case, there were no excessive position changes to the neck area during surgery, but in the process of regaining consciousness and spontaneous respiration, there were several bouts of severe struggling and coughing before extubation . The tube could have moved during the neck bending and the position could have changed during this incident . Especially immediately before extubation, the air was removed from the balloon of the tube so the resistance between the tube and airway mucous membrane was largely reduced, and as the bandage was removed and the rae tube was about to be extracted, the patient suddenly lifted her upper body and coughed while bending her neck . Hence, it is conjectured that the tube was inserted much deeper than in the experiment where the neck was simply bent, and the end jabbed the mucous membrane of the airway . Macklin has shown the course of air which causes pneumomediastinum in an animal experiment, and also in our case, the air inflow through the damaged mucous membrane of the airway slowly expanded along the bronchovascular sheath to develop pneumomediastinum, and then expanded along the aorta and membrane surrounding the esophagus to develop pneumoperitoneum . In addition, it is considered that it detached the carotid perivascular sheath to develop subcutaneous emphysema in the head and neck, and ruptured into the pleural space causing the pneumothorax . According to the report by hood and sloan, in patients who suffered injury to the trachea or bronchial tubes, the time taken from damage to diagnosis was diverse, and a delay of 24 hours or more appeared in 66% . In our case, it took about 7 hours from the symptoms to appear from bronchial damage to be diagnosed, and such delay in time is because when there is partial damage to the tracheal wall, the air enters by detaching the adventitia and expanding to form an air sack . This expansion of air can take many hours, and there could be no symptoms until it ruptures into the mediastinum or pleura space . Mccoy et al . Reported that causes for endobronchial intubation were head and neck surgery and laparoscopy which can affect the location of the tube during surgery, incapacity of the anesthesiologist, the movements of the surgeons, and usage of the rae tube . The rae tube has a relatively large elasticity and structurally forms a sharp angle; thus, it is easy to damage the bronchial tubes when deep intubation occurs, hence there is need for more caution . It is conjectured that also in our case, these structural characteristics of the rae tube caused more damage to the bronchial tubes than the generally used single lumen endotracheal tube . In our case, the patient severely vomited several times 5 hours after surgery and the symptoms occurred 2 hours later, and for pneumomediastinum caused by vomiting, there are 2 reasons for esophagus rupture and pulmonary alveoli rupture . Differential diagnosis is performed with fiberoptic esophagoscopy or esophagography, and in our case, an egd was performed which confirmed that there were no abnormalities in the esophagus . Hence, it is considered that the pulmonary alveoli ruptured from the valsalva maneuver during vomiting, and the inflow of air expanded through the bronchovascular sheath to cause the pneumomediastinum . Treatment for pneumomediastinum caused by tracheal damage is conservative treatment consisting of bed rest, a supply of oxygen, and use of antibiotics when the symptoms are not severe and the vital signs are satisfactory . When there is severe damage, the vital signs are unstable, and there is a possibility of dyspnea or septicemia, it is better to perform surgical suturing in the early stages . In addition, to reduce pressure, extraction of air through subcutaneous dilacerations and insertion of a subcutaneous catheter are performed; chest tube insertion is performed for a pneumothorax larger than 15 - 20% of the thoracic volume, and endotracheal intubation or tracheostomy can be performed when there is severe circulatory disturbance or respiration difficulty . The patient in our case received conservative treatment consisting of bed rest, oxygen therapy, use of antibiotics, and administration of analgesics together with prompt investigation of the cause after presenting symptoms . The vital signs were not bad so the patient could be observed and monitored, but under the decision that the accompanying pneumothorax and subcutaneous emphysema were severe, chest tube insertion, dilacerations of the subcutaneous emphysema, and aspiration in the retropharyngeal space were performed . Although invasive, it is considered that these prompt decompression procedures prevent cardiac tamponade and an increase in pulmonary vascular pressure caused by air in the vascular sheath and hence, contribute to the faster recovery of the patient . As a method to prevent excessive excitement of the patient while waking up, continuous iv injection of a low concentration of remifentanil has the effect of hemodynamic stability, cough reflex suppression, and pain relief, which can lead to smooth awakening and reduce serious complications as in our case . The patient subsequently received conservative treatment and antitubercular treatment, and recovered enough to be discharged 2 weeks later . Before discharge, we wanted to check what happened to the lesions in the bronchial mucous membrane, but the patient refused so it is a pity that we were unable to follow - up . From the various cases and literature reviewed above, it is believed that in our case, the struggling and coughing of the patient during regaining consciousness pushed the endotracheal tube into the bronchial tubes, and the end of the tube damaged the bronchial mucous membrane to gradually develop emphysema . The valsalva maneuver during severe vomiting additionally increased the airway pressure, leaking a large amount of air through the damaged area in a short period of time, which accelerated the emphysema . Pneumomediastinum can be completely treated with conservative treatment, but according to the circumstances, it can proceed to mediastinitis or septicemia and lead to the death for the patient, so diagnosis, treatment, and methods of prevention must be well informed . In addition, the possibility of pneumomediastinum from anesthesia should also be considered and caution should be taken for positive ventilation and endotracheal intubation, and there should be close observation of the patient's state before and after surgery . Especially, there is need for meticulous care after regaining consciousness since the patient's struggling or coughing during extubation can push the endotracheal tube inside to damage the trachea or bronchial tubes, or cause unintended extubation and damage the glottis causing difficulties in maintaining respiration.
Recent evidence suggests that failure to recognize insular cortex seizures could be responsible for some cases of surgical failure in patients with temporal lobe epilepsy (tle) [15]. Insular seizures may mimic tle or may coexist with temporal seizures, an entity referred to as temporal plus epilepsy [68]. Clinical observation of patients with insular seizures proven by depth recordings and after cortical stimulation using insular contacts has revealed a high prevalence of somatosensory and pharyngolaryngeal auras (ssa and pla, resp . ), including a characteristic sensation of laryngeal constriction (lc) [13, 915]. In this study, we sought to determine the prevalence and prognostic significance of ssa and pla in tle patients undergoing epilepsy surgery . We performed a retrospective chart review of all patients who underwent surgery for refractory tle at our institution between january 1980 and july 2007 . All patients underwent a comprehensive epilepsy surgical workup, including complete anamnesis and neurological examination, neuropsychological evaluation, and video - electroencephalographic (veeg) monitoring with scalp electrodes . Magnetic resonance imaging (mri) single photon emission computed tomography (spect) and f fluorodeoxyglucose positron emission tomography (pet) was performed in more recent cases . Invasive veeg recordings were obtained in the majority of patients before the availability of mri . Since then, electrode implantation has been performed only in well - selected cases following evaluation by our epilepsy multidisciplinary team . Collected data included patient demographics, cause of epilepsy and risk factors, seizure type and clinical features, presence and characteristics of ssa and/or pla, number of antiepileptic drugs tried, type of resective surgery, histopathological findings, and final outcome in seizure control . Ssas were defined as a perceptual experience of tingling, numbness, electric - shock sensation or pain, occurring in isolation as a simple partial seizure or as an early manifestation (i.e., aura) of a complex partial seizure [1618]. Plas were defined as ictal pharyngolaryngeal symptoms of paresthesia (tingling or burning), discomfort, or sensation of throat constriction of varying intensity [13, 1922]. Other early ictal symptoms suggestive of operculoinsular involvement were also documented, including motor, epigastric viscerosensory, cephalic, auditory, and dysphasic symptoms . We compared subgroups of patients with ssa / pla to those without ssa / pla . Categorical (binomial) variables were compared using boschloo exact unconditional test and continuous variables using the wilcoxon rank sum test . Statistical analysis was performed using r [24, 25] and pasw statistics 18 (spss inc ., chicago, il, usa). During the study period, a total of 158 patients underwent surgery for pharmacoresistant tle in our institution . This patient population consisted of 74 women (47%) and 84 men (53%) with an average age of 33.9 years (range 1362) and an average duration of epilepsy of 21 years (range 146). Risk factors for epilepsy included cns infection in 20 (12.7%), head trauma in 12 (5%), positive family history for epilepsy in 33 (21%), febrile seizures in 34 (22%), perinatal complications in 10 (6%), and developmental delay in 10 (6%). Mri was obtained in 114 (72%) of these patients, revealing abnormalities in most cases (87%), hippocampal atrophy (ha) without sclerosis in 22 (19%), hippocampal sclerosis (hs) in 54 (47%) and other temporal lobe abnormalities in 51 patients (32%). Sixty - five (67%) ictal spect scans localized the seizure focus to one temporal lobe . Fdg pet was only obtained in 15 patients, and it localized the seizure focus to the temporal lobe in 13 of these patients (87%). Twenty - seven underwent selective amygdalo - hippocampectomy (sah) (17%), 75% underwent anterior medial temporal lobectomy (amtl) (n = 118), 4% amtl and lesionectomy (n = 6), and 4% lesionectomy (n = 7). Amtl involved resection of 3.57 cm t2, t3, most (two - thirds) of the amygdala, and a radical hippocampectomy . Pathology confirmed hs in 69 (44%), hs and another pathology in 9 (5.7%), ganglioglioma in 6 (3.8%), glioma in 5 (3.2%), cavernoma in 4 (3%), focal cortical dysplasia in 4 (3%), gliosis in 3 (2%), dysembryoplastic neuroepithelial tumor in 2 (1%), was normal in 24 (15%), and was inconclusive in 16 (10%). Only 11 (7%) experienced symptoms of ssa and/or pla as part of their seizures: ssa (n = 8, 5%), pla (n = 2, 1.2%), or both (n = 1, 0.6%) (table 1). This group of patients was composed of 3 men and 8 women with mean epilepsy duration of 27 years (range 246) and mean age at surgery of 40 years (range 2155). Risk factors for epilepsy included central nervous system (cns) infections in 4 patients, perinatal anoxia in 1, febrile seizures in 1, and family history of epilepsy in 1 (table 2). Mri was obtained in 10 patients, revealing hs in 6, ha in 2, a posterior temporal cavernous malformation in 1, and a fusiform gyrus pilocytic astrocytoma in 1 . Scalp eeg recordings localized the seizure focus to the temporal lobe in 7 patients (64%), lateralized the focus to the hemisphere ipsilateral to the resection side in 3 (27%), and were non - localizing in 1 (9%) patient . Seven patients underwent preoperative ictal spect, which localized the seizure focus to the temporal lobe in 2 and was nonlocalizing in 5 cases . Intracranial electrodes were implanted in 6 patients, enabling localization of seizure focus to the mesial temporal lobe in all of them . Surgical procedures included amtl in 7 patients, sah in 2, lesionectomy and temporal corticectomy in 1, and simple lesionectomy in 1 . Three patients underwent a second operation during the study period (before outcome assessment). One patient with previous cavernoma lesionectomy and corticectomy underwent second operation with electrocorticography (ecog) guided further perilesional corticectomy . Two patients with initial sah underwent a second resective surgery consisting of radical temporal lobectomy, including the superior temporal gyrus . Pathology demonstrated hs either alone (n = 7) or with another pathology (n = 1) in 8 patients, a cavernous malformation in 1, a pilocytic astrocytoma in 1, and was inconclusive in 1 . Compared to patients without ssa or pla, those with ssa and/or pla were older at surgery (p = 0.049), had a higher prevalence of early ictal motor symptoms (p = 0.022), had a higher rate of cns infections (p = 0.022), and were less likely to have a localizing spect study (p = 0.025) (table 3). Eight patients had only ssa, 2 had only pla, and 1 had both ssa and pla . Of the 9 ssa patients, 7 (77.8%) had strictly unilateral symptoms involving the contralateral hemiface in 2, the contralateral hand in 2, the contralateral hemibody in 1, the ipsilateral leg in 1, and the ipsilateral hemibody in 1 . In 1 patient with contralateral hemiface ssa, symptoms progressed in a somatotopic jacksonian march to the ipsilateral hemitongue, arm, and leg . In 2 patients (22.2%), ssas were strictly bilateral, involving the legs in 1 and the forearms in the other . In the 3 patients with pla, symptoms were described as a sensation of pharyngo - laryngeal constriction (n = 3), with occasional pharyngeal pain in 1 patient . Outcomes were assessed in all but 1 patient who was lost to followup in the no ssa / pla group (n = 157). A favorable outcome (engel i or ii) was achieved in 81.8% (9/11) of patients with ssa and/or pla and 90.4% (132/146) of those without ssa or pla (p> 0.05) (table 4). A complete seizure - free outcome (engel ia) was observed in 36.4% (4/11) of patients with ssa and/or pla and 32.2% (47/146) of those without ssa or pva (p> 0.05). Since the study period, two patients of the ssa / pla cohort have undergone invasive reinvestigation for persistent disabling seizures (table 2). Both have obtained seizure - freedom following a third resection of the temporal lobe and anterior insular cortex, respectively . Insular epilepsy should be suspected whenever tle - like seizures are accompanied by early - occurring lc and/or somatosensory symptoms (sss), especially those described as unpleasant paresthesias or warmth affecting the perioral region or extending to a large somatic territory, either bilateral or ipsilateral to the seizure focus [13, 5]. Although some studies have suggested that patients with pharmacoresistant tle who exhibit ssa and pla have a favorable prognosis following temporal lobe surgery [8, 21, 26, 27], others have reported a poor outcome in this patient population [2830]. The purpose of this study was to determine the prevalence and prognostic significance of ssa / pla as a potential marker of insular epilepsy and thus a predictor of poor response to surgery in tle patients . The 5% rate of ssa among surgical tle patients in the present series is comparable to the 1.7%14% rates reported in the literature [26, 29, 3135]. Unlike prospective studies that have reported an 11% incidence of ssa in tle surgery patients, retrospective series may actually underestimate the real prevalence of ssa, mainly as a result of recall bias . Although viscerosensory auras are frequent (45%) in patients with pharmacoresistant tle, the prevalence of pla is less well known . Pharyngeal auras have been reported to occur in up to 16.9% of pharmacoresistant tle and 13% of temporal plus epilepsy cases . The higher prevalence in the series of barba et al . Compared to ours may either reflect a difference in the definition of pla or a selection bias since all patients in their study had undergone intracranial electrode implantation . In this study, ssa and/or pla were not found to be negative prognostic factors in tle patients undergoing surgery . Our findings are in line with previous reports suggesting that ssa [8, 26, 27] and pla [21, 22] do not necessarily indicate an extratemporal seizure onset or an independent extratemporal seizure focus in patients with pharmacoresistant temporal lobe - like epilepsy . Our findings would suggest that for the majority of our patients, ssa or pla was the result of rapid spread of epileptic activity to perisylvian somatosensory structures such as the insular cortex and second somatosensory cortex (sii) [1, 2, 5, 6, 22, 26, 3537] rather than from an extratemporal seizure focus . Because almost all of the patients in the ssa / pla cohort had lesional tle, it is not possible to draw any conclusion about the prognosis of ssa / pla in nonlesional tle surgery patients . For the latter, it would remain prudent to perform an intracranial study to rule out an extratemporal focus . For the former, however, temporal lobe surgery without preoperative invasive investigation would appear to result in a good outcome for most . Although independent insular seizures have been known to coexist with temporal lobe seizures and ha / hs (i.e., the hippocampal mri abnormality may represent only the tip of the iceberg of a larger pathological substrate), it may be that this is a rare occurrence which does not necessarily warrant systematic invasive investigation in the presence of ssa / pla . In our series sampled the insula in 50 consecutive patients with tle on the basis of ictal symptoms or scalp veeg data suggesting an early spread of seizures either to the suprasylvian opercular cortex (e.g., lip and face paresthesiae, tonic - clonic movements of the face, dysarthria, motor aphasia, gustatory illusions, hypersalivation, and postictal facial paresis) or the infrasylvian opercular cortex (e.g., auditory hallucinations, early sensory aphasia). Only five patients (10%) had seizures originating from the insular cortex while in 43 patients (86%), they propagated to the insula after a temporal onset . Hopefully, further clinical observations and imaging techniques (e.g., magnetoencephalography) will allow us to better identify the small subset of patients who will most benefit from an implantation prior to surgery [38, 39]. The retrospective nature of this study may be associated with a recall bias for the incidence and characteristics of ssa / pla . These auras are very subjective and are very much dependent on the history taking skills and detailed attention of the examiner . Furthermore, because they were not assessed in a standardized way, the timing of these auras during a seizure may not always be clear with regards to other subjective symptoms patients may have felt at seizure onset . Whether ssa / pla occurs as the initial or only aura may be important [28, 29]. Many of the patients in this report had multiple auras, some more typical of mesial temporal lobe epilepsy (dj vu, epigastric). Finally, as mentioned previously, our data does not allow drawing conclusions about the prognosis of ssa / pla in non - lesional temporal lobe - like epilepsy as numbers are too small . It is possible that these patients have been selected out already by careful presurgical evaluation and found to have extratemporal or temporal plus epilepsy . Most patients with pharmacoresistant lesional tle appear to have a favorable outcome following temporal lobectomy, even in the presence of ssa and pla.
The long - term storage of information in the form of memory is one of the principal functions of the developed nervous system . The ability to utilize this information provides evolutionary advantages in adapting and responding to situations in a given environment . The method for the formation of memories and the process of functional specialization in the brain during development has been found to be mediated by both structural and functional plasticity, including long - term potentiation between neurons . While much attention has been given to these processes on a neuronal level, less attention has been given to what role glial cells, particularly astrocytes, may have in the underlying mechanisms . While astrocytes were formerly thought to serve mostly as housekeeping cells, they have recently gained attention as an integral part of the chemical synapse . In addition to their structural and metabolic roles, astrocytes are now thought to be heavily involved in synaptogenesis and in regulating the communication between already formed connections . Several studies have demonstrated that astrocytes utilize both ionotropic and metabotropic systems in order to regulate neuron to neuron communication [35], and that they may have specific mechanisms for regulating the formation of memories . Here, we review recent evidence for the importance of astrocytes in both structural and functional synaptic plasticity, specifically long - term potentiation, the key chemical transmitters that are involved (table 1), as well as the underlying mechanisms by which astrocytes may regulate these processes . Glial cells are nonneuronal cells that are now believed to constitute 50% of the cells in the whole brain in humans and other primates [69], although other reports have suggested that glia may outnumber neurons 10: 1 [1012]. Astrocytes, as their name suggests, appear to be star - shaped when golgi stained or immunostained for glial fibrillary acidic protein . However, the morphology and physiology of astrocytes differ depending on the type . Typically, astrocytes have a complex structure that is highly branched with many small protrusions that contact the synaptic cleft [14, 15]. With their unique morphology, astrocytes form the blood brain barrier, have a role in ion homeostasis, and form the tripartite synapse . The blood brain barrier is made up of capillary endothelial cells, vascular pericytes, and the perivascular endfeet of astrocytes . Together, they create a highly selective barrier that allows oxygen and hormones to permeate into the brain while preventing the passage of other molecules due to possible harmful effects . Astrocytes also maintain homeostasis of various ions such as sodium, potassium, chloride, and hydrogen . When the extracellular concentration of k is high, astrocytes uptake the ion using transporters or channels and transfer it to adjacent astrocytes via gap junctions by a process called spatial buffering [1821]. Due to this process, astrocytes prevent extracellular concentrations of k from reaching toxic levels . In the tripartite conceptualization of the synapse, perisynaptic astrocytes are present along with the standard presynaptic and postsynaptic neurons [15, 2224]. Contact made by perisynaptic astrocytes with the synaptic cleft depends on the type and location of synapses [13, 15, 25]. In the hippocampus for instance, the intricate arborization and ramifications of astrocytes allow them to tightly enwrap the synaptic terminal in order to modulate synaptic processes [14, 15, 25]. Previous studies suggest that astrocytes respond to neurotransmitter release by increasing their intracellular calcium levels and controlling neuronal excitability through the release of gliotransmitters . Based on findings that explain the functioning of the tripartite synapse, more attention has been given to the potential role of how astrocytes aid memory . In areas known for synaptic plasticity, such as the hippocampus, astroglial membranes appear to surround the majority of larger axo - dendritic synapses, and around 60% of all synapses in the hippocampus [27, 28]. In astrocytes that are part of a tripartite synapse, calcium peaks, which correspond to calcium oscillations tuned to neuronal activity, excess glutamate is taken up by astrocytes and further regulated through a shunting cycle by which it is broken down into glutamine, repackaged, sent to the presynaptic - neuron, and finally converted back into glutamate . Astroglial glutamatergic regulation is so widespread that it is estimated that only 20% of synaptic glutamate is taken up by transporters on the postsynaptic neuron, while the other 80% is processed by transporters such as the glutamate aspartate transporter (glast) on the membrane of the associated astrocyte . Additionally, astrocytes have the ability to swell and shrink in size through the use of aquaporin channels, and this may allow them to reduce the leakage of neurotransmitters, increasing the active concentration in the synapse, and preventing spillover in the case of damage [30, 31]. However, transmitters can also be released through these channels when exposed to a hypotonic bath solution, ischemia, or a traumatic brain injury [3234]. Besides their role in signaling, astrocytes have also been implicated in controlling the development of the nervous system through factors such as axon guidance and synaptogenesis, as discussed below . It is now well known that the hippocampus, located in the inferior temporal lobe, is responsible for the formation and storage of memory [35, 36]. The hippocampal structure has distinct functional areas implicated in memory formation, that is, the ca1, ca3, and the dentate gyrus . Various parts of the brain display some form of synaptic plasticity, but the hippocampus is one of the structures that has received much attention due to its overall functional importance . Synaptic plasticity refers to experience mediated structural and functional changes to the connections between neurons that results in changes to neural circuits [3739]. These neural circuits are often developed (synaptogenesis) and strengthened through the reinforcement of some connections and the removal of others (synaptic stripping), which can occur in response to environmental experience . During early development, plasticity can occur through large scale dendritic and axonal conformational changes, and while these processes are observed in the adult mammalian brain, the scale on which they take place and the efficacy of regulatory processes involved are inhibited . While less overall change is observed in the adult brain, early developmental plasticity in children, as well as memory formation and learning in adults, are both likely dependent on structural changes in the functioning of the synapse itself [4143]. Recent evidence shows that even small structural changes to the dendritic spines can drastically alter the overall output / input of synaptic protein receptors, which in adults is likely more important in determining neuronal activity than dendritic spine density [4143]. Due to a high concentration of synapses in the brain, tuning of activity could be accomplished through regulating synaptic function with relatively little conformational change, which is important in being able to learn and store large quantities of information without negatively impacting other signaling pathways . The tuning of synaptic activity associated with functional plasticity, or changes in synaptic strength, has been demonstrated through the modulation of membrane receptors by enzymatic activity such as phosphorylation [39, 4547]. However, changes to the chemical environment within the synapse are likely more influential in the associated changes to neuronal firing and receptor concentrations . The changes in dendritic spines and synaptic activity in relation to plasticity have been found to be most closely linked to synaptic glutamate receptors and changes in both internal and external calcium in neurons . It is consistently demonstrated that neuron - glia interactions are essential to this type of environmental regulation, with astrocytes being paramount in regulating signaling molecules such as glutamate which are particularly important in the plasticity and learning processes [49, 50]. As astrocytes are in part often responsible for regulating synapse formation and synaptic activity, there is a strong possibility that their activity plays an integral role in plasticity and learning . Among the various forms of functional synaptic plasticity, long - term potentiation (ltp) has received much attention in the hippocampus due to its role in memory . This was first observed in electrophysiological studies, using high - frequency stimulation (100 hz) of neurons in the perforant pathway and recording the activity at the dentate gyrus . Electrode recordings followed by tetanic stimulation exhibited a longer lasting excitatory postsynaptic potential (epsp) of the postsynaptic neuron in the dentate gyrus . N - methyl d - aspartate (nmda) receptor dependent ltp occurs at the schaffer collateral region while nmda receptor independent ltp is observed at the mossy fibers of the ca3 region [5357]. Despite various forms of ltp that occur in the hippocampus, nmda receptor dependent ltp several studies blocking nmda receptor activity showed impairment in different types of memory in mice, implicating nmda receptors in memory formation [5861]. However, these studies do not indicate that ltp causes memory, as ltp may be an underlying process that helps form memory but does not directly cause it . For nmda receptor dependent ltp to occur, activation of nmda receptors allows calcium to stimulate cyclic adenosine monophosphate (camp) release, causing a cascade of signaling mechanisms involving protein kinase a, camp response element binding protein (creb), camp response element (cre), mitogen activated protein kinase, and calcium calmodulin dependent protein kinase ii [6264]. Therefore, synthesis of new proteins underlies the mechanism for long - term memory . While much attention has been given to the regulation of hippocampal neurons by these factors, there is a growing body of evidence that astrocytic support is more critical in the regulation and function of many ltp related compounds and mechanisms than previously thought . Astrocytes release and regulate several neuroactive molecules that can affect neuronal activity and modulate plasticity and ltp . These compounds (summarized in table 1) include glutamate, atp, cytokines, and several other key signaling molecules like d - serine, adenosine, and lactate . Glutamate plays a key role in the regulation of synaptic activity and causes a response in astrocytes [66, 67]. Importantly, astrocytes actively sequester up to 90% of glutamate that is released into the extracellular space between neurons [68, 69]. Glutamate causes a wide range of effects in astrocytes via metabotropic glutamate receptors (mglur), nmda receptors, and -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (ampa) receptors . Although cortical astrocytes generally express functional nmda receptors, this does not appear to be the case for hippocampal astrocytes [7072]. Do not exhibit activation upon standard nmda receptor agonists [70, 72]. Functional ampa receptors, on the other hand, are expressed by hippocampal astrocytes [73, 74]. Additionally, hippocampal astrocytes change the properties of their ampa receptors during postnatal development . At the beginning stages of postnatal development, low levels of ampa receptor currents immature astrocytes also had a prolonged activation of the ampa receptor, which induced an influx of na and ca . Astrocytes are likely able to synchronize with neuronal activity and subsequently regulate glutamate transmission between neurons [7679]. For example, astrocytic glutamate release activates presynaptic nmda receptors and promotes increased excitatory communication between neurons . These nmda receptors are also subjected to further regulation by endogenous concentrations of d - serine, which serves as a coagonist, specifically in the hippocampal region, suggesting its potential importance in new memory formation [8184]. In addition to the ionotropic glutamate receptors, astrocytes also use mglurs . In the hippocampus, mglur1 [85, 86], mglur5 [87, 88], and mglur3 [89, 90] however, astrocytes of 1-week - old mice, but not older mice, express high levels of mglur5 . Furthermore, astrocytes of adult mice did not exhibit an increase in ca when stimulated with an mglur5 agonist . Contradictory to the observations by, there has been research demonstrating mglur5's role in ca elevation in adults . Astrocytes express a neurotransmitter receptor called g - protein coupled metabotropic receptor (gpcr). Specifically, the g - protein gq, coupled to phospholipase c (plc), is involved in elevating intracellular ca levels in astrocytes [91, 92]. When gq is stimulated, plc is activated to break down phosphatidylinositol 4,5-bisphosphate (pip2) into inositol 1,4,5-triphosphate (ip3) and diacylglycerol (dag) [91, 92]. By breaking down pip2, the endoplasmic reticulum can release stored ca to stimulate gliotransmitter release . In gliotransmission, astrocytes release vesicles that are packed with gliotransmitters via the process of exocytosis . Astrocytes express proteins that are known to be involved in vesicle fusion such as soluble nsf attachment protein receptor (snare), synaptotagmin, complexin2, and munc18a, which are critical for gliotransmitter release [5, 92]. For example, altering the snare complex resulted in a failure of glutamate release from astrocytes . Glutamate release also requires vacuolar type of proton atpase to exchange the proton gradient from the vesicular lumen with glutamate [94, 95]. In addition, in hippocampal astrocytes, synaptic - like microvesicles (slmv) were found with the r - type snap receptor (r - snare), which is known to govern exocytosis . Atp released from astrocytes also interacts directly with pre- and postsynaptic neurons, serving to regulate their own glutamatergic transmission and to also enhance the concentration of ampa receptors, which facilitates the release of neuropeptides including oxytocin and vasopressin . Additionally, some of the atp released by astrocytes is converted directly to adenosine, which can act as both an agonist and antagonist for specific k and ca channels . Cytokines and chemokine receptors are also implicated in the regulation of ca stores, glutamatergic transmission, and synaptic plasticity as a whole . In astrocytes, the cxcr4-cxcl12 signaling axis has been implicated in both modulating glutamate exocytosis, and in causing the release of the cytokine tnf- . Tnf- is also linked to regulating both glutamate release and the insertion of ampa receptors into neighboring neurons [99, 100]. Finally, cytokine signaling in astrocytes, as well as microglia, plays a role in the response to physically sensing pain and responding to damage, with chemokine (c - c motif) ligand 2 (ccl2) released from astrocytes having a strong regulatory effect on the activity of nmda receptors . Despite the evidence indicating the significance of ca in the release of gliotransmitters, some studies have observed that blocking ca in hippocampal astrocytes located at the ca1 region in situ does not change ca levels in neurons, change spontaneous excitatory postsynaptic current, result in astrocytic glutamate release, or nmda receptor mediated slow inward currents in pyramidal neurons [102104]. These findings may suggest that a mechanism not dependent on ca release may lead to gliotransmitter release in astrocytes . Although the gliotransmitters discussed above are important in regulating ltp, another crucial gliotransmitter to postsynaptic neurons is lactate . Memory formation is the result of a cascade of cellular and molecular processes and thus, to ensure the proper functionality of a neuron, astrocytes provide neurons with lactate, a usable form of energy [105107]. Through glycogenolysis, astrocytes convert stored glycogen into lactate and release it into the synapse through the mct1 or mct4 transporter . The neuron is then able to take up lactate via an mct2 transporter, which has been confirmed through blocking mct2 with either 4-cin or mct2-oligodeoxynucleotides [106, 107]. Rats showed memory impairment in inhibitory avoidance and spatial memory tasks when glycogenolysis, mct1, mct4, or mct2 were inhibited [106, 107]. Thus, it is clear that the metabolism of astrocytes is critical in hippocampal dependent memory . Ephrin signaling, consisting of ephrin - as and ephrin - bs, is known for its involvement in neural development by inhibiting axonal and dendritic growth via actin rearrangement [108114]. The interaction between ephrin - a3 and epha4, which are expressed by astrocytes and dendritic spines of neurons, respectively, is involved in decreasing levels of glast and glutamate transporter 1 (glt-1) for proper synapsing to occur [115118]. Astrocytes express both ephb receptors and ephrin - b ligands, ephrinb3 being the most active during ltp . Ephrinb3 enhances d - serine release by regulating serine racemase (sr), an enzyme responsible for the conversion of l - serine to d - serine, and an sr - interacting protein, protein kinase c (pkc). Specifically, ephrinb3 downregulates pkc in order to increase the interaction between sr and protein interacting with c - kinase (pick1), causing d - serine release . Moreover, ephrinb3 is able to bind to both ephb3 and epha4 receptors . By measuring d - serine levels in ephb3 and epha4 knockouts in cultured astrocytes, thus, while ephrin - a signaling regulates levels of glt-1, ephrin - b signaling regulates levels of d - serine release for activation of nmda receptors . Nicotine influences memory by inducing synaptic transmission at acetylcholinergic synapses [121123]. In alzheimer's disease, astrocytes express nicotinic acetylcholine receptors (nachr), implicating nicotine's role in cholinergic dependent memory . This effect on memory is dependent on glutamatergic nmda receptors, which requires binding of d - serine released by astrocytes [8183, 125]. As described previously, d - serine binds to nmda receptors, therefore, nicotine binding to the nachr on astrocytes stimulates the release of d - serine by increasing internal calcium concentrations, allowing nmda receptors on the postsynaptic neuron to induce ltp [123125]. Similar to nachr, activation of muscarinic achr (machr) also increases internal calcium concentrations [126128]. The adenosine a1 receptor is expressed on presynaptic neurons, and activation of the receptor activates the inhibitory metabotropic g - protein (gi) pathway . Memory deficits in mice that underwent 6 hours of sleep deprivation were prevented by pharmacologically blocking the a1 receptor . Furthermore, astrocytes modulate levels of adenosine during 12 hours of sleep deprivation in mice . Interestingly, a1 receptor activation in astrocytes can also modulate sleep in a rodent model of inflammation . The cytokine interleukin-1 (il-1) also plays a key role in hippocampal dependent memory . Blocking activity of il-1 receptors resulted in the poor performance of learning with the morris water maze and fear conditioning, as well as reduced ltp [132135]. Although il-1 receptors can be expressed by many cells, it is prominently expressed on astrocytes [136140]. Il-1 receptor knockout mice that did not express il-1 receptors on astrocytes exhibit memory deficits that can be rescued with transplantation of neural precursor cells from wild - type mice that express il-1 receptors . The underlying mechanism of il-1 has yet to be determined in the context of memory . Research on synaptic plasticity and memory has traditionally been neuron - centric, yet it is crucial to not ignore the astrocytic role in these processes since they are now known to modulate neuronal activity . Not only do astrocytes regulate the extracellular concentration of neurotransmitters, they also regulate the activity and expression of receptors on the postsynaptic neuron through gliotransmitter activity, and play a role in dampening activity and promoting the removal of nonadvantageous connections . The evidence reviewed here shows that astrocytes have an ongoing role in the regulation of neuronal activity through the release of gliotransmitters and the expression of transporters / receptors on their extracellular surface . Based on these findings, we propose a mechanism of astrocyte - to - postsynaptic neuron interaction that supports the induction of ltp (see figure 1). Here, the influx of intracellular ca caused by the activation of cholinergic receptors and mglurs allows multiple gliotransmitters (e.g, glutamate, d - serine, tnf-, and atp) to be released . These gliotransmitters then bind to their respective receptor to regulate the influx of ions on the postsynaptic neuron, which causes a cascade of molecular mechanisms that initiate transcription . Moreover, for the cellular and molecular changes of the postsynaptic neuron, lactate must be provided by astrocytes for energy to protect neurons from cytotoxic death, and glt-1 regulates the extracellular glutamate concentration during the late phase of ltp . The purpose of the proposed mechanism is to represent how astrocytes may regulate the postsynaptic neuron during ltp . Behavioral studies used to determine that the role of astrocytes are known to be hippocampal dependent tasks . However, this by no means allows us to determine which part of the hippocampus the mechanism takes place in, nor the type of ltp . More importantly, there are various kinds of memory such as episodic memory, procedural memory, associative memory, and fear conditioned memory . Moreover, it is important to note that this model only examines astrocyte to postsynaptic terminal communication: it is well known that astrocytes are also able to modulate presynaptic terminal [142, 143]. Although we have explained detailed evidence of how astrocytes regulate the postsynaptic neuron, we must also consider how astrocytes affect activity of the presynaptic neuron as well . Hippocampal astrocytes are able to detect synaptic activity at distinct locations via mglur5 and increase intracellular ca levels for a prolonged time span, which results in alteration of basal synaptic transmission [144, 145]. The mechanism also involves astrocytic release of purines to activate a2a receptors expressed by the presynaptic neuron . Calcium activity was also observed to not only be involved in gliotransmission, but neurotransmission as well . Synaptic transmission in neighboring synapses was reduced when blocking ca in astrocytes, suggesting the ability of astrocytes to modulate the activity of presynaptic neurons . The engraftment of human astrocytes in mice enhances ltp and significantly increases the release of the cytokine tnf- . Since a xenograft of human astrocytes can functionally modulate the activity of mice neurons, it may be possible that a xenograft from another species would facilitate ltp if placed into a human patient . There is still much to research in glial neurobiology in order to fully understand the underlying mechanisms of neural networks that are involved in plasticity and memory . For instance, since astrocytes are physically connected with other astrocytes through gap junctions to form a glial syncytium, it is crucial to further examine how astrocytic signaling may regulate neuronal activity and therefore, underlie ltp . It is now clear that astrocytes play an important part in learning and memory, and continuing to elucidate astrocytic processes that are involved in learning and memory will help advance our understanding of the dynamic role of these glial cells in modulating ltp.
Systemic sclerosis (ssc) is characterized by early and persistent microvascular impairment leading to functional raynaud's phenomenon (rp) and clinical manifestations (i.e., digital ulcers, pulmonary arterial hypertension, etc .) (figure 1) [1, 2]. Digital ulcers in ssc are considered to be related to tissue ischemia following several processes, including at the beginning persistent vasospasm (rp), but in the progression of the disease also to intimal fibroproliferation, tissue fibrosis, and thrombosis of digital arteries . Progressive deficiency in vasodilatory capacity of the vessels and tissue fibrosis is proposed as a mechanism of the persistent vascular spasm; however, the mechanism of endothelial injury is still unclear . The assessment of vascular involvement is still a matter of study, and several noninvasive techniques have been proposed . Peripheral microvascular impairment in ssc may be easily and safely detected by nailfold videocapillaroscopy (nvc). The morphological capillary abnormalities in ssc have been classified in 3 validated patterns (early, active, and late) of microangiopathy by nvc and scored (figure 2) [57]. Nvc may partially observe the column of red blood cells moving inside the capillary, but the technique does not allow measurement of the blood flow . Laser doppler flowmetry (ldf) is the best non invasive and safe technique to assess and to measure the blood perfusion at peripheral sites [8, 9]. Blood flow has been found to be reduced in patients with ssc, compared with healthy subjects and patients with primary rp . Patients with ssc showing the late nvc pattern of microangiopathy have a significantly lower finger blood perfusion (fbp) than patients with the active and early nvc patterns (p <.05). The question today is if capillaroscopy (and eventually ldf) may represent an outcome measure for clinical trials on the peripheral vasculopathy in ssc . We will analyze clinical conditions related to ssc in which nvc may represent an outcome measure by considering their already assessed relationship with the nvc patterns and/or eventually scores . The 3 important biological / clinical conditions are: the ssc - specific serum autoantibodies, the ssc skin digital ulcers (dus), and the pulmonary arterial hypertension (pah) associated to ssc . Ssc is characterized by serum autoantibodies, including anticentromere (anti - cenp - b), anti - th / to, antitopoisomerase i (anti - topo i), and anti - rna polymerase i / iii (anti rnap iii). Together, these markers account for almost 85% of autoantibodies specific for ssc and show a predictive value for clinical evaluation and prognosis [11, 12]. Anti - cenp - b and anti - topo i are known predictors of progression from isolated rp to ssc . However, until recently, many of the studies on the significance of expression of these antibodies in ssc have been limited by small sample sizes, incorrect classification of patients with manifestations of connective tissue disorders as having primary rp, use of varying definitions of subsets of patients, lack of standardised methods for determining antinuclear antibodies, omission of tests for anti - th / to and anti - rnap iii antibodies, and absence of multivariable analyses . Antiendothelial cell antibodies (aecas) are a heterogeneous class of antibodies whose role in the pathogenesis of autoimmune diseases with vascular involvement has been extensively studied and are present in the serum samples of many patients with ssc (2286%) but are not ssc specific . Even if, among the demonstrated clinical associations, lung and peripheral vascular involvement is the most common, further research on this topic, including longitudinal studies in patients with ssc, is mandatory for a better understanding of the clinical value of aeca . However, for long time it has not been determined prospectively whether ssc autoantibodies are related to the course and type of microvascular damage detectable by nailfold capillaroscopy . Leroy and medsger proposed that patients with rp who had abnormal findings on nvc and ssc - specific autoantibody should be classified as having early ssc . This set of criteria had not been validated and considered for long time, until recently . Finally, koenig et al . Prospectively studied a large cohort of raynaud's patients who were referred to a single centre for evaluation of rp over a period of 20 years . The objectives were to identify the strongest independent predictors of progression to definite ssc, to determine the type and time course of microvascular damage by nailfold capillaroscopy and its relationship to major ssc autoantibodies, and to validate the criteria for early ssc . Of the 586 patients who were followed up for 3,197 person - years, 74 (12.6%) developed definite ssc . In fact, this study validated the criteria of leroy by demonstrating that almost all patients who were to futurely develop ssc had early ssc (raynaud's phenomenon plus a scleroderma pattern on capillaroscopy and/or ssc - specific antibodies) at the baseline visit . Concerning the scleroderma pattern they reported a characteristic sequence of microvascular damage, starting with enlarged capillaries (giant capillaries) that identify the early ssc pattern, followed by capillary loss that indicates the active ssc pattern and then by capillary telangiectasias (neoangiogenesis) that might better characterize the late ssc pattern (figure 2), from the stadium of early ssc until development of definite ssc . Enlarged capillaries (giant capillaries), capillary loss, and ssc - specific autoantibodies independently predicted definite ssc . Interestingly, anti - cenp - b and anti - th / to antibodies predicted for the development of giant capillaries; these autoantibodies and anti rnap iii also predicted for capillary loss . Each autoantibody was associated with a distinct time course of microvascular damage . At followup, 79.5% of patients with one of these autoantibodies and abnormal findings at the baseline nailfold capillaroscopy examination had developed definite ssc . Patients with both baseline predictors were 60 times more likely to develop definite ssc . These data validated the proposed criteria for early ssc . In conclusion, in the presence of a secondary rp evolving to definite ssc, microvascular damage (as assessed by nailfold capillaroscopy) is dynamic and progressive, and ssc - specific autoantibodies are associated with the course and type of capillary abnormalities . It was confirmed that the microvascular damage in secondary rp evolving to definite ssc is characteristically sequential, starting with enlarged capillaries (giant capillaries, early ssc pattern) followed by capillary loss (active ssc pattern), and then by capillary telangiectasias (neoangiogenesis, late ssc pattern). Since new therapeutic agents are being evaluated in patients with ssc, awareness of this sequence of microvascular damage has potential implications for future trials . Of note, recently, it was established the evolution of microangiopathy in established ssc disease, by pointing out the progression of capillary loss and augmentation of ramifications in a microangiopathy score . The final message is that abnormal findings on nailfold capillaroscopy at baseline together with a systemic sclerosis - specific autoantibody indicate a very high probability of developing definite systemic sclerosis whereas their absence excludes this outcome . In ssc patients awareness of this sequence of microvascular damage and ss - associated autoantibodies has potential implications for future therapeutical trials . For example, in trials of novel angiogenic, vasculogenic, or fibrosis - modulating agents, it would appear realistic to select ssc patients at a uniform stage of microvascular damage and with similar ssc - specific autoantibodies and eventually to evaluate such damage longitudinally by nvc to assess response to treatment . Skin dus represent one of the most frequent clinical manifestations of microangiopathy in patients with ssc (figure 3). On the other hand, a decreased number of capillary loops should be considered highly specific for advanced rp, and it has been estimated that the number of normal capillaries may be reduced to just 20% in patients with active ssc . Recently, using a semiquantitative score that highlights the importance of the number of capillaries, an association was reported between advanced stages of capillary loss (mean score class 2 and 3) and digital trophic lesions in 49% of patients with ssc . Also, loss of capillaries may be relevant in determining tissue hypoxia, and, in patients with recent onset of rp, the appearance of rapidly progressive capillary loss may represent the first capillaroscopic evidence of severe ssc with destruction of microvessels . The extensive disappearance of capillaries may generate large avascular areas giving a desert - like appearance to the nailfold bed, and progressive loss of capillaries has been associated with more extensive skin involvement (as well as diffuse ssc) and a poor prognosis . As a consequence, the early detection of ssc patients who are at high risk of developing du could allow preventive treatment of these complications with reduction of morbidity and social costs . Very recently, it was found, in 130 ssc patients examined at entry and after 20 months of follow - up, that the diffuse cutaneous form of ssc with avascular areas on capillaroscopy represented, among other factors (e.g., increased interleukin- 6) the major risk factor for du development . A previous study showed that, patients with late ssc pattern at nvc showed an increased risk to have an active disease (odds ratio (or) 3.50; 95% confidence interval (ci) 1.319.39) and to present skin du (or 5.74; 95% ci 2.0815.89). Another recent investigation showed that a quantitative capillaroscopic score was suggested highly predictive of the development of new skin du within 3 months after nvc . The predictive value of this index still needs to be confirmed in a validation study . A clinical history of multiple skin du is the most helpful predictor and indicator for preventive therapy, and the loss of capillary as assessed at nvc has been found the best possible nvc predictive marker to be considered . However, the routine use of nvc now seems a possible predictive tool to enable the early detection of patients at a high risk of developing skin du . In this regard, at present, the cost / effectiveness ratio for the therapy of ssc skin du is very unfavourable, and strategies for their treatment or prevention are under debate . Ssc is the main connective tissue disease associated with pah and pah is estimated to affect 12% of ssc patients, being the leading cause of death in this disease . Structural changes in the systemic microcirculation, consisting of a reduction of capillary density and widening of the capillaries, are considered an hallmark of ssc . It is now clear that the severity of this microvascular damage as assessed by nvc differs between patients with ssc and pah (ssc - pah) and those with ssc without pah (ssc - non - pah) and correlates with pulmonary haemodynamic parameters . Interestingly, when compared to healthy controls, the same is true for patients with idiopathic pah, a condition not known to be characterized by systemic microvascular changes . A recent study suggests that capillary density reduction is a marker of the presence and severity of pah . A few studies have investigated nailfold capillary patterns in patients with ssc - pah, with only one study including patients with idiopathic pah . Two studies used echocardiography and/or right heart catheterisation to confirm the diagnosis of pah ., found a significant reduction of capillary density in eight patients with ssc - pah in comparison with 12 patients with ssc - non - pah . The other study, by greidinger et al . Using capillary density and qualitative scoring of nailfold patterns, found no differences in capillary patterns between eight patients with ssc - non - pah and seven with ssc - pah, but capillary density in these groups was not reported . A third study, by ohtsuka et al . Using only right heart catheterisation to diagnose and exclude the diagnosis of pah, showed a significant difference in semiquantitative scoring of nailfold patterns between ssc - non - pah and ssc pah patients, but, again, capillary density was not assessed in this study . Practically, only one of these studies included patients with idiopathic pah and reported no differences in capillary density and capillary patterns between 13 healthy controls and 37 patients with idiopathic pah . There is, however, more recent evidence of a reduction of capillary density in both ssc - pah and, albeit to a milder extent, in idiopathic pah . The explanation for a reduction in capillary density may not be the same for the two disorders . In ssc it is generally presumed that structural changes in the systemic (micro)circulation precede changes in the pulmonary circulation, as systemic microvascular changes may precede the development of ssc by many years . Therefore, nvc abnormalities might also reflect what is going on in the pulmonary circulation . This may not be true for all capillary abnormalities, because most patients with ssc demonstrate nailfold capillary abnormalities whereas only a minority develop pah . Recent data confirm that only capillary density is associated with the presence of pah and is a marker of disease severity in ssc . A further suggested explanation for the more pronounced capillary reduction in ssc - pah could be that pah itself amplifies the reduction of capillary density already present in ssc . However, houben et al . Recently observed an increase rather than a decrease of nailfold capillary density in patients with heart failure . The observation that circulating plasma levels of endothelin1 (et-1) are raised in patients with pah and that et-1 production is increased in the pulmonary tissue of affected individuals makes this vasoconstrictor a particularly interesting target for therapeutic intervention in pah . Clinical trials with et receptor antagonists have clearly shown that such antagonists provide symptomatic benefit in patients with pah, thereby proving the clinical relevance of the endothelin system as a therapeutic target with optimised use of selective eta or nonselective eta / etb blockade . As matter of fact the highest serum et-1 levels are found in ssc with late nvc pattern and visceral involvement . Recent therapeutical examples of clinical trials with nvc as measure of outcome and conclusions are presented . Very recent studies represent examples of clinical trials in which nvc has been successfully included as a measure of treatment outcome . The objective of one study was to evaluate nvc pattern changes in ssc patients treated regularly on cyclic basis with iloprost and to find associations with clinical, serologic, and pharmacological variables . Forty - nine patients affected by ssc underwent two ncv analyses at 3 years apart from each other . Six patients showed an amelioration of nvc abnormalities who changed from active to early pattern; five of these cases (83.3%) had been given cyclophosphamide therapy and the remaining case methotrexate plus azathioprine . Cyclophosphamide administration was significantly associated with regression of the nvc pattern (p <.001). Interestingly, none of the ssc patients who received cyclophosphamide demonstrated worsening of the microvascular lesions; the progression of nvc pattern was inversely correlated to cyclophosphamide treatment (p = .02). Therefore, cyclophosphamide treatment demonstrated to be effective in modulating the ssc microvascular damage as directly observed and monitorized by nvc . In another study cyclophosphamide treatment showed to be effective for ssc microvascular damage as directly observed by rapid improvement of the nvc pattern . Confirmation of the trend was obtained by a further study on autologous stem cell transplantation that confirmed a significant regression of the nvc pattern together with the improvement of the clinical conditions . In conclusion, to the question if capillaroscopy (nvc) may represent in ssc an outcome measure for clinical trials on the peripheral vasculopathy, based on the growing evidences and our detailed studies, the answer is positive . Early recent therapeutic trials in ssc are confirming this role, and the experience is growing rapidly . To definitely establish its role as an outcome measure two requirements still need to be fulfilled . First, large multicentric and longitudinal and randomized controlled trials (certainly in establishing its role as an outcome measure in therapeutical trials) are needed . Recently, a first step in assessing reliability has been taken through demonstration of reliability both in qualitative and semiquantitative assessment of nailfold images of ssc patients in a bicentre setting.
Autophagy is a catabolic process that degrades cytoplasmic components and organelles and is conserved in almost all eukaryotes . Autophagy is initiated in response to cellular stresses such as nutrient starvation, oxidative stress, infection, or inflammatory stimuli . Upon its induction, a cup - shaped double - membrane structure, called an isolation membrane (or phagophore), emerges in the cytoplasm, then the isolation membrane elongates with curvature and finally becomes enclosed, forming an autophagosome containing cytoplasmic components . Subsequently, autophagosomes fuse with lysosomes / vacuoles, and lysosomal hydrolases degrade the sequestered material [15]. This process facilitates physiological processes such as survival during starvation, clearance of dysfunctional or aggregated proteins and organelles, development, differentiation, and aging [68]. In addition to the nonselective degradation of cytoplasmic components, autophagy can selectively degrade specific organelles or proteins . These include peroxisomes, endoplasmic reticulum, ribosomes, the nucleus, intracellular pathogens, protein aggregates, lipid droplets, and secretory granules . These catabolic processes are termed pexophagy, reticulophagy (erphagy), ribophagy, nucleophagy, xenophagy, aggrephagy, lipophagy, and zymophagy, respectively . Similarly, the yeast cvt complex (a protein complex comprising aminopeptidase i (ape1) and alpha - mannosidase (ams1)) is delivered to vacuoles via an autophagy - like process; ape1 and ams1 are processed and activated in the vacuoles, and this autophagic process is called the cvt pathway . It has been known for some time that mitochondria are also degraded by autophagy in mammalian cells (first described by clark in 1957) and in yeast (first described by takeshige and colleagues in 1992), but this selective autophagic process has recently been described in more detail . Daughter mitochondria with reduced membrane potential after a fission event are preferentially removed by autophagy in mammalian cells . Photoirradiation - damaged mitochondria are selectively degraded by autophagy in hepatocytes [12, 13]. During the maturation of erythroid cells, mitochondria are preferentially degraded by autophagy in a manner dependent on the mitochondrial outer membrane protein nix [14, 15]. Recently, it has been reported that there are two types of autophagy in mammalian cells: autophagy related protein 5 (atg5) and atg7-dependent (conventional) autophagy and atg5/atg7-independent (alternative) autophagy . Both conventional and alternative autophagic processes are implicated in the autophagic degradation of mitochondria during erythroid cell maturation [16, 17]. Similarly, during white adipose tissue differentiation, mitochondria are preferentially degraded by autophagy . When yeast cells were cultured in lactate - containing medium as the sole carbon source and the identification of the yeast mitophagy - specific protein atg32, which plays a key role in the recognition of mitochondria by the autophagic machineries, confirmed the existence of selective degradation of mitochondria by autophagy [20, 21]. Atg11 is a cytosolic adaptor protein that is required for selective cargo recognition by autophagy . For example, during the cvt pathway, the cargo proteins ape1 and ams1 generate a complex with the receptor protein atg19 that is recognized and bound by atg11 . Similarly, during pexophagy, pichia pastoris atg30 (ppatg30) binds peroxisomal proteins pppex3 and pppex14 and is recognized and bound by atg11 . Finally, in both cases, atg11 transports the cargo to the pre - autophagosomal structure / phagophore assembly site (pas), where the isolation membrane emerges, and the cargo is surrounded by the autophagosome [22, 23]. Atg11 is also essential for mitophagy, suggesting the presence of a receptor protein for mitophagy that corresponds to atg19 or ppatg30 in the cvt pathway and pexophagy, respectively, . A genetic screen for yeast mutants defective in mitophagy identified such a receptor protein, which is now known as atg32 [20, 21, 25]. Atg32 is a mitophagy - specific protein that is not required for nonselective autophagy or other types of selective autophagy [20, 21]. Atg32 consists of 529 amino acids and localizes in the mitochondrial outer membrane with its n - terminal domain towards the cytoplasm . Similarly to the cvt pathway and pexophagy, when mitophagy is induced, atg32 is bound by atg11 and the atg11atg32 complex recruits mitochondria to the pas [20, 21]. During this recruitment step, this atg32atg8 interaction is thought to increase the efficiency of mitochondrial sequestration by the isolation membrane . Although the molecular processes by which the autophagic machinery selects and degrades mitochondria have been revealed, little is known about the upstream signaling pathways . Recently, it was reported that the related signaling pathways of two mitogen - activated protein kinases (mapks), slt2 and hog1, are involved in the induction of mitophagy [26, 27]. In the slt2 signaling pathway, all of protein kinase c (pkc1), mapkkk (bck1), mapkk (mkk1/mkk2), slt2, and the upstream cell surface stress sensor wsc1 are required for mitophagy . In the hog1 signaling pathway, pbs2-hog1 and the upstream stress sensor sln1 the role of slt2 is, however, controversial: in the above - mentioned study, nitrogen starvation - induced mitophagy was deficient in slt2-deleted cells, whereas another study reported normal mitophagy in slt2-deleted cells cultured to the post - log phase . Recently, we found that, when mitophagy is induced, ser114 and ser119 on atg32 are phosphorylated and that the phosphorylation of atg32, especially on ser114, mediates the atg32atg11 interaction and mitophagy . Similarly it has been noted that phosphorylation of ser112 on ppatg30 is required for ppatg30ppatg11 interaction and pexophagy in pichia pastoris . These findings suggest that both mitophagy and pexophagy are regulated by kinase activity and/or the localization of the kinases that phosphorylate atg32 and/or ppatg30 . Although the mapk hog1 is required for atg32 phosphorylation, the direct phosphorylation of atg32 by hog1 was not observed in an in vitro phosphorylation assay . Presumably, the unidentified kinase that phosphorylates atg32 is downstream of hog1 and slt2 . Atg33 is a mitophagy - related protein that was identified by a genetic screen for yeast mutants defective in mitophagy . Atg33 is located in the mitochondrial outer membrane and functions in mitophagy but not in nonselective autophagy, the cvt pathway, or pexophagy . Interestingly, in an atg33-knockout strain, although mitophagy was partially inhibited when induced by starvation, it was blocked almost completely when induced during the stationary phase . Although the function of atg33 in mitophagy is unknown, it might be a factor for the selection or detection of damaged or aged mitochondria when cells have reached the stationary phase [25, 29]. In addition to atg33, whi2, uth1, and aup1 have also been reported as related to mitophagy [3032]. Whi2 is a stress response protein that predominantly influences mitophagy and, to a lesser extent, autophagy . Mller and reichert speculated that whi2 and the ras / pka (protein kinase a) signaling pathway are linked to the regulation of mitophagy . Uth1 is a mitochondrial outer membrane protein and is reported to be required for mitophagy induced by rapamycin or nitrogen starvation . Aup1 was identified by a screen for protein phosphatase homologs that interact with the serine / threonine kinase atg1 that is required for autophagy and is suggested to be needed for efficient mitophagy to survive in prolonged stationary phase culture in a medium containing lactate as the carbon source . Interestingly, it was shown that deletion of rtg3, a transcription factor that mediates the retrograde signaling pathway, causes a defect in stationary phase mitophagy and that deletion of aup1 leads to alterations in the patterns of rtg3 phosphorylation under these conditions, implying that the function of aup1 in mitophagy may be regulation of rtg3-dependent transcription . Inconsistently, both uth1 and aup1 have also been reported to be not required for mitophagy and were not identified in genome - wide mitophagy screens [20, 29]. Further studies are required to clarify these discrepancies, which could be due to differences in the condition used to assess autophagy . Reported that n - acetylcysteine, which increases cellular levels of reduced glutathione, prevents mitophagy . Reported that the expression of atg32 is suppressed by n - acetylcysteine treatment, and, as a result, mitophagy is inhibited . Because mitophagy is thought to preferentially eliminate damaged mitochondria, it is reasonable that cellular oxidative status, which is compromised by reactive oxygen species (ros) generated by damaged mitochondria, is related to the induction of mitophagy . We have summarized the above - described molecular processes and regulatory mechanisms in figure 1 . It has been suggested that mitophagy eliminates damaged or aged mitochondria, thereby maintaining mitochondrial quality . There are several lines of evidence demonstrating that damaged mitochondria are eliminated by mitophagy in yeast . Suggested that conditional knockout of fmc1, a gene encoding the fmc1 protein that is concerned with the folding of the f1fo - atpase, induces mitophagy under anaerobic conditions . Suggested that interference with the mitochondrial k / h exchanger mdm38 causes the swelling of mitochondria and the degradation of those mitochondria by mitophagy . Zhang et al . Blocked mitochondrial dna (mtdna) replication using ethidium bromide or a mtdna polymerase temperature - sensitive mutant and observed rapid degradation of mitochondria via autophagy . These results indicate that mitochondrial damage is related to the induction of mitophagy, but are not direct evidence that autophagy selectively eliminates damaged mitochondria . Accordingly, it is still unknown whether mitophagy contributes to mitochondrial quality control in yeast . In fact, it has been difficult to identify the physiological role of mitophagy in yeast, because mitophagy - deficient atg32-deleted cells do not show any phenotype, including phenotypes of mitochondrial dysfunction . When mitophagy - deficient atg32-deleted cells were precultured in nonfermentable medium (for instance, lactate - containing medium as the sole carbon source) and were then shifted to nitrogen starvation for long - term culture (~5 days), the atg32-deleted cells grown on nutrient - rich plates generated small colonies, while wild - type cells did not . Further analysis revealed that, when wild - type cells encounter nitrogen starvation, they induce mitophagy and quickly eliminate mitochondria that have proliferated during respiratory growth . As a result, cellular ros production, which occurs mainly in mitochondria, is suppressed . On the other hand, in mitophagy - deficient atg32-deleted cells, ros damage mitochondria, and damaged mitochondria produce further ros, finally leading to mtdna deletion . Ultimately, cells with mtdna deletion generate small colonies even in fermentable medium; this phenotype is called petite . This suggests that mitophagy is required to regulate the number of mitochondria to minimize ros production and, as a result, maintains the quality of mitochondria . Bulk autophagy - deficient yeast strains exhibited reduced mitochondrial membrane potential, reduced activities of the electron transport chain, and higher levels of ros and oxidative stress, resulting in the loss of mtdna [38, 40]. In bulk autophagy - deficient cells, cellular ros accumulate during nitrogen starvation because the cellular amino acid pool is reduced and the expression of the ros scavenger proteins is suppressed . This finding suggests that autophagy, including mitophagy, contributes to the quality control of mitochondria . In a contrasting situation, graef and nunnari demonstrated that healthy mitochondria are required for efficient induction of autophagy under amino acid starvation . Autophagic flux is regulated by atg1, target of rapamycin (tor) kinase complex i, and camp - dependent protein kinase a (pka), whereas atg8 induction is solely dependent on pka . Defects in mitochondrial respiration induce pka activity, resulting in the suppression of both atg8 induction and autophagic flux . The data presented by graef and nunnari indicate that defects in mitochondrial respiration inhibit autophagy including mitophagy during amino acid starvation . They suggest that the effect of mitochondrial dysfunction on the regulation of autophagy varies according to the severity of the defect . Furthermore, these authors also suggest that inordinate accumulation of mitochondria that are defective in respiration beyond a certain level decreases the capacity for autophagy and mitophagy in these cells and evokes a negative feedback that results in cellular aging or death . As described above, the molecular processes and regulatory mechanisms of mitophagy in yeast have been slowly but surely identified . Since the 2008 report that a defect in mitophagy might be involved in the pathogenesis of parkinson's disease, there has been much interest in mitophagy in higher eukaryotes and, in particular, mammalian cells . Most mitophagy studies in mammalian cells have focused on pten - induced putative kinase protein 1 (pink1)/parkin - dependent mitochondrial degradation by autophagy . Parkin and pink1 are encoded by the park2 and park6 genes, respectively; both are responsible for familial parkinson's disease and have been reported to be associated with mitophagy [4244]. Pink1 is expressed in the cytoplasm and constitutively translocates into the mitochondrial inner membrane where it is promptly degraded by the mitochondrial inner membrane rhomboid protease presenilin - associated rhomboid - like protein (parl) [43, 4547]. When mitochondria lose their membrane potential, pink1 can target to the mitochondria, but cannot translocate across the mitochondrial outer membrane; therefore, it accumulates there . Parkin translocates to mitochondria in a pink1-dependent manner [4244, 48, 49]. Parkin triggers the ubiquitination of many mitochondrial proteins such as mitochondrial assembly regulatory factor (marf) in flies or mitofusin 1, mitofusin 2, and voltage - dependent anion channel 1 (vdac1) in mammalian cells [4954]. The ubiquitinated proteins on mitochondria are bound by the autophagy substrate p62/sqstm1, which contains a ubiquitin - associated domain, and the p62-associated mitochondria aggregate near the nucleus [49, 54, 55]. Because p62 is a substrate of autophagy, it is thought that p62-associated mitochondria are eventually degraded by autophagy [49, 54, 55]. Although it is accepted that p62 associates with mitochondrial proteins ubiquitinated by parkin and mediates the aggregation of mitochondria, there have been conflicting reports showing that p62 is not indispensable for mitophagy [56, 57]. The histone deacetylase hdac6, which can bind ubiquitinated proteins and facilitates the clearance of protein aggregates, is also reported to accumulate on mitochondria after parkin translocation from the cytosol and mediate mitophagy . Further studies are required to clarify the precise roles of p62 and hdac6 in mitophagy . However, other studies have focused on parkin / pink1-independent mechanisms of mitophagy in higher eukaryotes . In mammalian cells, ulk1, a homolog of yeast atg1, is known to be associated with the control of autophagy by the tor signaling network . Ulk1 activity is suppressed under nutrient - rich conditions by tor complex 1 (torc1). Recently, it has been suggested that phosphorylation of ulk1 by adenosine monophosphate - activated protein kinase (ampk) is concerned with autophagy . Loss of ampk or ulk1 resulted in deficient mitophagy and aggrephagy during starvation in mouse embryonic fibroblasts and hepatocytes, resulting in increases in the overall mitochondrial number and aberrant morphology . This finding suggests that ampk - mediated phosphorylation of ulk1 is required for mitochondrial homeostasis in nutrient - poor conditions . Tectonin domain - containing protein 1 (tecpr1) has been identified as an atg5-binding protein . This protein forms a complex with atg12-atg5-atg16l1 and binds to wipi-2, which is capable of association with phosphatidylinositol 3-phosphate at an isolation membrane . Interestingly, tecpr1 is required for xenophagy, which selectively recognizes and eliminates bacterial pathogens such as shigella, salmonella, and group a streptococcus . Tecpr1 is also required for the autophagic degradation of misfolded protein aggregates and depolarized mitochondria but not for nonselective autophagy . These findings suggest that tecpr1 is an essential factor for specific cargo recognition in selective autophagy . It has been reported that mitophagy is induced under several conditions such as mitochondrial permeability transition, during cellular development or during hypoxia . First, nutrient starvation and photodamage, which both lead to mitophagy, cause mitochondrial permeability transition (mpt), in which the opening of the mpt pores causes mitochondria to become permeable to all solutes up to a molecular mass of approximately 1500 da, leading to mitochondrial depolarization and outer membrane rupture [62, 63]. Cyclosporin a, an inhibitor of mpt through interaction with cyclophilin d, blocks mitophagy during mpt [12, 64]. These findings suggest that mpt is a trigger for mitophagy that arises from mitochondria themselves . Second, recent studies have revealed that mitophagy plays an important role in cellular differentiation . During reticulocyte maturation (as with erythroid cell maturation mentioned in section 1), mitochondria are eliminated via autophagy in a nix - dependent manner [14, 17, 65]. Nix, in both in vivo and in vitro assays, interacts with lc3/gabarap, which anchors to the isolation membrane and is involved in isolation membrane extension, and this nix - lc3/gabarap interaction is thought to mediate efficient targeting of mitochondria to autophagosomes [66, 67]. Similarly, when autophagy was inactivated by targeted deletion of the autophagy - essential gene atg7, post - differentiated white adipocytes exhibited large numbers of mitochondria compared with the relatively few mitochondria observed in wild - type white adipocytes . This suggests that mitochondria are preferentially eliminated by autophagy during adipogenesis [18, 6871]. Third, mitophagy is induced by hypoxia in a bcl-2/adenovirus e1b 19 kda interacting protein 3-(bnip3-) dependent manner; the expression of bnip3 is regulated by hypoxia - inducible factor [7274]. This indicates that mitophagy might be a survival mechanism to regulate the production of ros from mitochondria during hypoxia . As shown here, mitophagy plays a role in several aspects of cellular physiology, not just eliminating depolarized mitochondria in a parkin / pink1-dependent manner . Although there are at present more than 50 publications regarding parkin / pink1-dependent mitophagy, the precise mechanisms are still unknown . Recently, it was reported that parkin induces rupture of the outer membrane of depolarized mitochondria, depending on proteasomal activity, and then the ruptured mitochondria are eliminated by mitophagy . This finding implies that parkin and pink1 are not the primary factors required for mitophagy but rather that they present depolarized mitochondria to the autophagic machineries by disrupting the mitochondrial outer membrane . Most of the autophagy - related genes identified in yeast are also present in mammals, suggesting that the molecular processes of autophagy are conserved throughout evolution . It is surprising then that the molecular processes of mitophagy and the essential factors identified to date are completely different between yeast and mammals . For example, in mammals, the mitochondrial receptor protein corresponding to atg32 in yeast has not been identified . In recent years, there has been significant progress in studies of mitophagy in both yeast and mammals . In particular, the molecular processes and regulatory mechanisms of mitophagy in yeast have been well described, such as the specific atg32atg11 interaction and the requirement for signaling by the two mapks slt2 and hog1 . Meanwhile, the physiological role of mitophagy in mammalian cells has been well understood . Because mitophagy is evolutionarily conserved, it is reasonable to speculate that there will be similar molecular processes, regulatory mechanisms, and physiological roles in both yeast and mammals . The interplay of yeast and mammalian mitophagy studies will consolidate our understanding of this cellular process.
The elimination of bacteria present in the root canal system is the fundamental objective of endodontic treatment as they play an important role in the development and maintenance of periapical lesions11,21 . The high percentages of failure after endodontic treatment of teeth with periapical lesions9,11,12,17,21,23have been related to implications of microbial origin . Among the phases of endodontic treatment, the biomechanical preparation aims at removal of organic and inorganic debris and modeling of the root canal7 . During the biomechanical preparation sodium hypochlorite solution has been largely used in endodontic treatment of teeth with necrotic pulp and periapical lesions18 . The antimicrobial activity, capacity to dissolve organic tissue, low surface tension and detergent action5are important properties attributed to sodium hypochlorite solution . The residual effect of chlorhexidine solution after usage as an endodontic irrigating solution10,15plays an important role in the disinfection of the root canal system . The aim of this study was to evaluate, in vivo, the microbiological conditions of root canals of teeth with chronic periapical lesions after biomechanical preparation using different endodontic irrigants . The research project was approved by the ethics committee in animal experimentation of araraquara dental school . The teeth selected for the study were the second, third and fourth mandibular premolars and the second and third maxillary premolars, adding up to seventy - eight root canals . After the premolar coronal cavities were opened, the exploration of the root canals was done with #25 k - file (dentsply maillefer, swiss) at 1.5 to 2 mm from the radiographic apex . With the k - file positioned at this point, radiographs were taken for determination of the total root canal length . The working length was established approximately 2 mm short of this measurement . Following this, the apical foramen was perforated by using #20 to #30 k - files at the total root length . The root canals remained exposed to the oral environment for seven days, with the objective of permitting their contamination . After this period, the irrigation / aspiration of the pulp chamber was carried out with saline solution, and crown opening was sealed with zinc oxide / eugenol cement (pulposan s.s.white artigos dentrios ltda . After sixty days, radiographic controls were taken to verify the radiolucent images indicating the presence of chronic periapical lesion, according to the method proposed by leonardo, et al.8(1994). After experimental induction of periapical lesions, the root canals were prepared using the following solutions for irrigation: group 1) 2.5% sodium hypochlorite (naocl); group 2) 2% chlorhexidine (chx); group 3) saline solution and group 4) control group with no biomechanical preparation (table 1). After radiographic detection of the periapical lesions, isolation of teeth in one quadrant was carried out using rubber dam and antisepsis of operating field was done using 2% chlorhexidine digluconate solution . Following this, after removal of coronal sealing, material was collected from the root canals for microbiological evaluation before biomechanical preparation . The root canal was filled with saline solution and the material was collected with two absorbent paper points, placed in sequence and maintained in the root canal for one minute . Then the absorbent paper points were placed into test tubes containing reduced transport fluid (rtf). The biomechanical preparation was carried out using k - files up to #60 or 70 at the working length . During the whole time of biomechanical preparation, then, the root canals were dried and filled with edta solution (edta, biodinmica qumica e farmacutica ltda ., pr, brazil), followed by irrigation with saline solution and drying with absorbent paper points (tanariman ind ., rio de janeiro, brazil), which was condensed on a glass ionomer base (vitremer, 3 m, st paul, mn, usa) made at the pulp chamber . Once the 30-day experimental period had elapsed, after isolating each quadrant using rubber dam, the coronal seal was removed and material was collected within the root canals using the method already described, to once again evaluate the microbiological conditions . The contaminated paper points were placed in test tubes with rtf and sent for microbiological processing . At the microbiology laboratory, 4 - 6 glass beads and a sterile metal wing were added to the test tubes containing the samples . The tubes were agitated for 2 min in a mixtron mixer (toptronix, so paulo, brazil) at maximum speed . Subsequently, the samples were serially diluted up to 5 - 10 times in sorensen phosphate buffer (spb) under laminar airflow . A volume of 0.05 ml of the pure samples and of each dilution was plated, with a sterile calibrated pipette, onto plates containing blood agar (as), mitis salivarius agar (ms; difco, detroit, mi, usa) and blood agar supplemented with 5.0 g / ml haemin and 1.0 g / ml menadione (ask; sigma chemical co., st . The ms and sb20 plates were incubated in microareophilic environment using the candle jar system for 23 days, and the ask plates aerobically for 2448 h, at 37c . After incubation, colonies were counted using a stereomicroscope (nikon, yokohama, japan) under reflected light and the cfu / ml was determined . To evaluate the microbiological results, the colony forming units were counted, in cfus, for the different culture mediums . The number of colony forming units was converted into decimal logarithms and statistical comparison was done by analyzing the variance of three factors: 1) group, 2) microorganisms: aerobic, anaerobic and microareophilic, and 3) time, being either before or after biomechanical preparation . This analysis was complemented by the tukey test and by the student test at a 5% significance level . The contaminated paper points were placed in test tubes with rtf and sent for microbiological processing . At the microbiology laboratory, 4 - 6 glass beads and a sterile metal wing were added to the test tubes containing the samples . The tubes were agitated for 2 min in a mixtron mixer (toptronix, so paulo, brazil) at maximum speed . Subsequently, the samples were serially diluted up to 5 - 10 times in sorensen phosphate buffer (spb) under laminar airflow . A volume of 0.05 ml of the pure samples and of each dilution was plated, with a sterile calibrated pipette, onto plates containing blood agar (as), mitis salivarius agar (ms; difco, detroit, mi, usa) and blood agar supplemented with 5.0 g / ml haemin and 1.0 g / ml menadione (ask; sigma chemical co., st . The ms and sb20 plates were incubated in microareophilic environment using the candle jar system for 23 days, and the ask plates aerobically for 2448 h, at 37c . After incubation, colonies were counted using a stereomicroscope (nikon, yokohama, japan) under reflected light and the cfu / ml was determined . To evaluate the microbiological results, the colony forming units were counted, in cfus, for the different culture mediums . The number of colony forming units was converted into decimal logarithms and statistical comparison was done by analyzing the variance of three factors: 1) group, 2) microorganisms: aerobic, anaerobic and microareophilic, and 3) time, being either before or after biomechanical preparation . This analysis was complemented by the tukey test and by the student test at a 5% significance level . Figures 1to 4represent the values of the cfu counts relative to the four experimental groups by means of a dispersion graph . In each experimental group, the cfus are divided into groups representing the aerobic, anaerobic and microaerophilic environments . In groups 1 and 2, there was a reduction in microorganisms in relation to groups 3 and 4, where there was an increase in the number of microorganisms . The analysis of variance indicated that the only significant interaction was between group and time . The results indicated that " before " biomechanical preparation the groups were homogeneous as to the number of microorganisms . And " after ", there were significant differences between the means (table 2). Groups 1 (naocl) and 2 (chx) presented significant cfu reduction, less than the mean of groups 3 (saline solution) and 4 (no mechanical preparation). In relation to the microorganisms, the anaerobes presented a greater mean of reduction (p<0.05) and the other two, aerobic and microaerophilic, presented lower means, but were not significantly different to each other (p<0.05). During the biomechanical preparation of teeth with periapical lesions, the antimicrobial action of endodontic irrigants played an important role in disinfecting the root canals . A significant reduction in the number of microorganisms after biomechanical preparation with bactericidal solutions, such as sodium hypochlorite2,4,16,18, has been demonstrated . The sodium hypochlorite solution, in different concentrations, is the most widely used irrigating solution5 . The bactericidal action of sodium hypochlorite solution is proportional to its concentration . On the other hand, tissue irritation is higher when a concentrated solution is used20 . Besides the antimicrobial activity, sodium hypochlorite solution has the capacity to dissolve organic material and detergent action, which results in good cleaning capacity when associated with edta26 . Chlorhexidine solution has demonstrated antimicrobial effectiveness, along with its continuing action for long periods of time10,13,24 . In this study, microbiological evaluation of the root canals this period was important to evaluate the possibility of reinfection of the root canal by microorganisms remaining within the root canal system2,4 . Since the endodontic microbiota is complex and diverse, being predominantly anaerobic1,11,21, it was necessary to use diverse culture mediums containing different nutrients and incubated under different ambient conditions (aerobic, anaerobic and microaerophilic) to isolate the various different microorganisms from the root canal4,19 . For the canals in which saline solution was used, a similar result was observed in the control group, where no mechanical preparation was undertaken . The reduction of cfus was only observed when biomechanical preparation was undertaken using antimicrobial irrigating solutions (naocl and chx). In these groups, the microorganisms were detected, but in lower numbers than the canals prepared with saline solution or in the control group . The best results obtained with the chlorhexidine solution may be associated to its residual action . Rosenthal et al.15(2004) evaluated the residual effect or substantivity of chlorhexidine solution in root canal systems . Root canals of bovine teeth were obturated either with or without previous immersion in 2% chlorhexidine solution . The evaluation of dentin samples demonstrated that chlorhexidine provided antimicrobial effect up to twelve weeks after root canal obturation . The minor antimicrobial effect observed for sodium hypochlorite solution chlorhexidine solution presents the lowest capacity to clean the root canal walls, as demonstrated by yamashita, et al.26, 2003, using an scanning electron microscope . In this way, an alternative option could be to do the final irrigation with chlorhexidine solution and use sodium hypochlorite solution during biomechanical preparation . Ercan, et al.3(2004) studied the antimicrobial action of 5.25% sodium hypochlorite solution and 2% chlorhexidine in human teeth having necrotic pulp and periapical lesion, using the culture technique, and reported a significant reduction in the microbiota for both irrigation solutions tested . The partial action of biomechanical preparation to disinfect the root canal, even with the use of bactericidal solutions, suggests that the role of intracanal dressing is fundamental in the endodontic treatment of teeth with periapical lesions . Holland, et al.6(1992) studied the influence of irrigation and intracanal dressing on the healing process of dogs' teeth with apical periodontitis and observed that the intracanal dressing was more important for success than the type of irrigating solution used (saline solution or 0.5% naocl at 0.5%). The employment of hydroxide - based intracanal dressing in the endodontic treatment of teeth with periapical lesions is important to deactivate the effects of endotoxins released by gram - negative microorganisms, since the irrigating solutions do not have this capacity22 . Tanomaru filho, et al.23(2002) studied the influence of naocl and chx irrigating solutions and the use of calcium hydroxide - based intracanal dressing for periapical repair after endodontic treatment of teeth with periapical lesions in dogs . The root canals irrigated with sodium hypochlorite or chlorhexidine solution were obturated in a single visit or after the use of an intracanal dressing with a calcium hydroxide paste . The results demonstrated that utilization of the intracanal dressing was more important for periapical repair than the irrigating solution used . It can be concluded that the use of antimicrobial irrigating solutions during biomechanical preparation promotes the reduction of endodontic microbiota.
Congenital ptosis is an abnormally low position of the upper eyelid in relation to the globe, which occurs either at birth or soon after . There are several methods of ptosis surgery, including levator muscle resection, frontalis suspension procedure, fasanella - servat procedure, and mller muscle conjunctival resection.1,2 one of the most popular methods of ptosis surgery is the frontalis suspension procedure . There are various materials available to secure the lids to the frontalis muscles in the frontalis suspension procedure, including polypropylene suture, nylon suture, silicone, mersilene mesh, and gore - tex material.3 we are reporting a rare case of infected gore - tex material that was used in modified frontalis sling surgery for congenital ptosis . A 7-year - old chinese boy with no known medical history, presented with history of right eye ptosis since he was 10 months old . He had a marginal reflex distance of 1 mm, with levator function of 3 mm in the right eye . The marginal reflex distance of the left eye was 2 mm, with 7 mm levator function . He underwent ptosis surgery on the right eye as he developed mild amblyopia in the right eye, with the best - corrected vision of 6/12 . A right eye frontalis sling procedure with modified fox s pentagon method4 chloramphenicol ointment was applied 8-hourly to the surgical wound site on the right upper eyelid . The patient was discharged on day 1 postoperation, with plan to review after 1 week . However, he defaulted his follow - up and only came back 1 month after surgery . He had used his medication for only 1 week and had stopped thereafter . At this presentation, he complained of painful swelling (of 7 days duration) of the right upper eyelid . The right upper eyelid swelling was associated with pus discharge from the surgical wound site . His best - corrected visual acuity was 6/12 in the right eye and 6/9 in the left eye . There was presence of crusted pus at the surgical wound site (figure 1). A diagnosis of right eye preseptal abscess secondary to the infected surgical wound was made . The patient was admitted and treated with intravenous co - amoxiclav 800 mg (25 mg / kg) 8-hourly for a duration of 1 week . Chloramphenicol ointment was applied 8-hourly to the infected surgical wounds, together with instillation of topical chloramphenicol eye drops 6-hourly to the right eye . An emergency incision and drainage of the right upper eyelid was performed, and about 5 ml of pus was drained out . Post - incision and drainage, the right upper eyelid was still inflamed and swollen with partial mechanical ptosis (figure 2). In view of no improvement in the healing process, the antibiotic was changed to intravenous cefotaxime 750 mg (25 mg / kg) 8-hourly for a duration of 1 week . The topical antibiotic eye drop was also changed to topical moxifloxacin 6-hourly for the right eye . However, there was still no improvement; hence an antibiotic combination of intravenous ceftazidime 750 mg (25 mg / kg) 8-hourly for 5 days and intravenous amikacin 210 mg (15 mg / kg) 12-hourly for 3 days was commenced . A third incision and drainage was performed together with removal of the gore - tex material . A culture from the final pus sample isolated multidrug - resistant acinetobacter species, which was resistant to all penicillins, cephalosporins, carbapenems, fluoroquinolones, and aminoglycosides there was resolution of the right upper eyelid swelling, with no more pus discharge . The patient was discharged, with chloramphenicol ointment to apply to the surgical wound 8-hourly for 2 weeks . After 6 months follow - up (about 3 months post - removal of gore - tex material), the patient s right upper eyelid was healed with scarring, but without ptosis (figure 3). Frontalis suspension surgery is a commonly used surgery in cases of congenital ptosis with poor levator function, chronic progressive ophthalmoplegia (cpeo), muscular dystrophy, third nerve palsy, myasthenia gravis, and aponeurotic ptosis in elderly patients.1,3 there are several suspension materials that can be used in frontalis suspension surgery . Synthetic materials such as polypropylene suture, nylon suture, silicone, mersilene mesh, and gore - tex can also be used.5 gore - tex material or expanded polytetrafluoroethylene (eptfe) is suitable for suspension surgery because it is less bulky and less stretchable.5 it is a nontoxic polymer used in various other implantable medical products, including vascular grafts and hernia repair patches . Unlike other implantable materials, eptfe is biocompatible . Micropores within the material are too small to allow infiltration of fibrovascular tissues hence allowing for easier removal or manipulation to adjust the eyelid height.6,7 however, its porous nature may allow proliferation of bacterial contaminants and cause abscess formation, resulting in a high risk of soft tissue complications . In our patient, constant scratching may have led to infection of the wound . With tracking of the long, porous eptfe material through an open wound the periorbital abscess was chronic and persistent even after treatment with multiple antibiotics and repeated incision and drainage, indicating the highly virulent nature of the causative organism . This could be due to the formation of biofilm by the causative bacteria, especially on biomedical implants, causing antimicrobial resistance.8 complete resolution in our case occurred only after removal of the gore - tex material, which might have harbored the virulent microorganism . There were a few other reports of complications of ptosis surgery such as granuloma and infection.2,3,9 in a retrospective study of 59 frontalis suspension procedures, infection with preseptal cellulitis appeared in one case (1.7%) and required removal of the material, and in two cases (3.4%) there were foreign body granulomas that were resolved by excision.10 there were other reports of post - ptosis surgery complicated by long - standing postoperative infection which were mostly associated with mycobacterium or candida infection.11,12 however, to our knowledge, there was no reported case of long - standing post - ptosis surgery infection involving multidrug - resistant acinetobacter species . Acinetobacter rarely colonizes implant materials;13 it commonly causes nosocomial infections such as pneumonia, urinary tract infection, and skin infections.14,15 in a delayed and long - standing post - frontalis surgery infection, multidrug - resistant organisms may be responsible for delayed healing and poor response to treatment . Surgical removal of infected slings and a prolonged course of antibiotics may be required for complete resolution.
Adult soft - shelled turtles (2 males and 4 females) were purchased from a local supplier tobun (kamikita, japan). All procedures were done in accordance with the guideline for care and use of animal experiments and approved by the animal care and use committee at iwate university . The animals were anesthetized by intraperitoneal injection of sodium pentobarbital (64.8 mg / kg). Two animals (1 male and 1 female) were perfused transcardially with ringer s solution followed by bouin s solution without acetic acid . The upper jaw was dissected, immersed in the same fixative solution overnight at 4c and decalcified in 10% ethylenediamine tetra - acetic acid (edta) in 0.1 m phosphate buffer at 4c for two weeks . The specimens were routinely embedded in paraffin and cut at 57 m thick . Sections were stained with pas or ab (ph 1.0 or ph 2.5), or processed for lectin histochemistry as described previously . For transmission electron microscopy, samples were collected from four animals (1 male and 3 females) and processed as described previously . The nasal cavity of soft - shelled turtles was divided into the upper and lower chambers (fig . 1a and 1bfig . 1.the olfactory organs in soft - shelled turtle . Uc, upper chamber; lc, lower chamber; on, olfactory nerve; ob, olfactory bulb . Coronary section at line b is shown in b. (b) the right nasal cavity . (c) he stained sections showing upper chamber epithelium (upper left), the bowman s glands (lower left, bg) and the lower chamber epithelium (right) in the nasal cavity of soft - shelled turtles . The nuclei of supporting cells (sp), receptor cells (rc) and basal cells (bc) were situated in the apical, intermediate and basal layers of the upper and lower chamber epithelia . (d) pas, alcian blue (ab) ph 1.0 and ab ph 2.5 stainings in the upper chamber epithelium (top panels), lower chamber epithelium (middle panels) and the bowman s glands (bottom panels). The apical portion of the upper chamber epithelium was stained with pas, ab ph 1.0 and ab ph 2.5 (bidirectional arrows). In the lower chamber epithelium, cytoplasm near the free border (arrowheads) was more intensely stained than the supranuclear region of the supporting cells (bidirectional arrows) with pas and ab ph 2.5 . The bowman s glands were positive for pas, but negative for ab ph 1.0 and ab ph 2.5 . The nuclei were counterstained with nuclear fast red in the sections stained with ab ph 1.0 . Scale bars: 50 m . ). Both of the upper and lower chamber epithelia consist of three types of cells, the supporting cells, receptor cells and basal cells (fig . Nuclei of the supporting, receptor and basal cells were situated in the apical, middle and basal layers of the epithelium, respectively . The associated glands (the bowman s glands) were observed in the upper chamber epithelium, but not in the lower chamber epithelium (fig . In addition, staining patterns for pas and ab ph 2.5 differed between the two epithelia (fig . Pas and ab ph 2.5 intensely stained the apical one - third of the upper chamber epithelium . In contrast, they stained the apical portion near the free border intensely and the supranuclear region of supporting cells less intensely in the lower chamber epithelium . Moreover, the upper chamber epithelium and the lower chamber epithelium were differently stained by ab ph 1.0: the upper chamber epithelium was positive for ab ph 1.0, but the lower chamber epithelium was negative . The bowman s glands were positive for pas, but negative for ab ph 1.0 and ab ph 2.5 . Uc, upper chamber; lc, lower chamber; on, olfactory nerve; ob, olfactory bulb . Coronary section at line b is shown in b. (b) the right nasal cavity . (c) he stained sections showing upper chamber epithelium (upper left), the bowman s glands (lower left, bg) and the lower chamber epithelium (right) in the nasal cavity of soft - shelled turtles . The nuclei of supporting cells (sp), receptor cells (rc) and basal cells (bc) were situated in the apical, intermediate and basal layers of the upper and lower chamber epithelia . (d) pas, alcian blue (ab) ph 1.0 and ab ph 2.5 stainings in the upper chamber epithelium (top panels), lower chamber epithelium (middle panels) and the bowman s glands (bottom panels). The apical portion of the upper chamber epithelium was stained with pas, ab ph 1.0 and ab ph 2.5 (bidirectional arrows). In the lower chamber epithelium, cytoplasm near the free border (arrowheads) was more intensely stained than the supranuclear region of the supporting cells (bidirectional arrows) with pas and ab ph 2.5 . The bowman s glands were positive for pas, but negative for ab ph 1.0 and ab ph 2.5 . The nuclei were counterstained with nuclear fast red in the sections stained with ab ph 1.0 . Scale bars: 50 m . In the apical part of the upper chamber epithelium, the dendrites of the receptor cells bearing cilia on the tip (fig . (a) secretory granules filled the supranuclear region of the supporting cells (sp) in the upper chamber epithelium . (b) most secretory granules were distributed near the free border of supporting cells in the lower chamber epithelium . Arrows in a and b indicate receptor cells bearing cilia on the tip of the dendrites . (c) secretory granules of the supporting cells in the upper chamber epithelium, 12 m in diameter, consisted of the marginal part of moderate density and central part of low density . Some of the secretory granules contained a core of high density (arrowheads). (d) secretory granules of the supporting cells in the lower chamber epithelium, 0.51 m in diameter, consisted of two parts of moderate and high density . (e) the glandular cells in the bowman s glands contained secretory granules of high density . Scale bars: 2 m in a and b, 0.5 m in c e ., arrows) alternated with the cytoplasm of supporting cells bearing microvilli on the free border (fig . The secretory granules of supporting cells in the upper chamber epithelium, measuring 12 m in diameter, showed a bipartite structure with the marginal part displaying moderate density and central part displaying low density (fig . 2c). In addition, a core of high density was observed in some secretory granules (fig . 2c, arrowheads). In the apical part of lower chamber epithelium, the dendrites of receptor cells bearing cilia alternated with the cytoplasm of supporting cells bearing microvilli (fig . Most secretory granules were distributed near the free border of supporting cells in the lower chamber epithelium (fig . The secretory granules of supporting cells, 0.51 m in diameter, showed a bipartite structure of moderate and high densities (fig . Secretory granules of high density, approximately 1 m in diameter, were abundant in the glandular cells of the bowman s gland (fig . (a) secretory granules filled the supranuclear region of the supporting cells (sp) in the upper chamber epithelium . (b) most secretory granules were distributed near the free border of supporting cells in the lower chamber epithelium . Arrows in a and b indicate receptor cells bearing cilia on the tip of the dendrites . (c) secretory granules of the supporting cells in the upper chamber epithelium, 12 m in diameter, consisted of the marginal part of moderate density and central part of low density . Some of the secretory granules contained a core of high density (arrowheads). (d) secretory granules of the supporting cells in the lower chamber epithelium, 0.51 m in diameter, consisted of two parts of moderate and high density . (e) the glandular cells in the bowman s glands contained secretory granules of high density . Scale bars: 2 m in a and b, 0.5 m in c e . Cellular expression of carbohydrate chains staining patterns for lectins were evaluated in each region where the secretory granules were observed by transmission electron microscopy: the apical one - third of the upper chamber epithelium (fig . 3afig . (a) the apical portions of the upper chamber epithelium (top panels) and lower chamber epithelium (bottom panels). Bidirectional arrows indicate the supranuclear region, and arrowheads indicate the cytoplasmic region near the free border of the supporting cells . (left panels) uea - i stained the supporting cells in the lower chamber epithelium more intensely than those in the upper chamber epithelium . (middle panels) rca120 equally stained the supporting cells in the upper chamber epithelium and those in the lower chamber epithelium . (right panels) lel stained the supporting cells in the upper chamber epithelium more intensely than those in the lower chamber epithelium . (b) bowman s glands were stained intensely by swga, moderately by vva and weakly by pna . Scale bars: 25 m ., top panels), the superficial portion (fig . 3a, bottom panels, bidirectional arrows) of the lower chamber epithelium, and the glandular cells of the bowman s gland (fig . Eighteen lectins stained the secretory granules of supporting cells in the upper and/or lower chamber epithelium (table 1table 1.lectin binding patterns in the supporting cells of the upper and lower chamber epithelia and the bowman s glandslectin (abbreviation)upper chamber epitheliumlower chamber epitheliumbowman s glandswheat germ agglutinin (wga)+++++succinylated wheat germ agglutinin (s - wga)+/+/++lycopersicon esculentum lectin (lel)++++solanum tuberosum lectin (stl)++/+datura stramonium lectin (dsl)++++bandeiraea simplicifolia lectin - ii (bsl - ii)++dolichos biflous agglutinin (dba)+++soybean agglutinin (sba)+/++bandeiraea simplicifolia lectin - i (bsl - i)+/+/vicia villosa agglutinin (vva)++++sophora japonica agglutinin (sja)ricinus communis agglutinin - i (rca120)+++++jacalin++/peanut agglutinin (pna)+++/erythrina cristagalli lectin (ecl)+++ulex europaeus agglutinin - i (uea - i)+/+++concanavalin a (con a)++++++pisum satibum agglutinin (psa)++lens culinaris agglutinin (lca)++phaseolus vulgaris agglutinin - e (pha - e)+++phaseolus vulgaris agglutinin - l (pha - l)+/, negative staining; + /, faint staining; +, moderate staining; + +, intense staining . ). Among them, 14 lectins stained the supporting cells in the upper chamber epithelium and those in the lower chamber epithelium differently . Eleven lectins, including dsl, dba, sba, bsl - i, vva, jacalin, pna, uea - i, psa, lca and pha - e, stained the supporting cells in the lower chamber epithelium more intensely than those in the upper chamber epithelium (fig . Four lectins, including swga, rca120, ecl and cona, stained the supporting cells in the upper chamber epithelium and those in the lower chamber epithelium equally (fig . Three lectins, including wga, lel and stl, stained the supporting cells in the upper chamber epithelium more intensely than those in the lower chamber epithelium (fig . Twenty lectins, excluding sja, stained the secretory granules in the glandular cells of the bowman s glands (table 1). Five lectins, including wga, swga, bsl - ii, dba and cona, stained the bowman s glands intensely . Eleven lectins, including lel, stl, dsl, sba, vva, rca120, ecl, uea - i, psa, lca and pha - e, stained moderately, and 4 lectins, including bsl - i, jacalin, pna and pha - l, stained weakly (fig . Fourteen lectins stained the supporting cells of upper chamber epithelium and the bowman s glands differently (table 1). (a) the apical portions of the upper chamber epithelium (top panels) and lower chamber epithelium (bottom panels). Bidirectional arrows indicate the supranuclear region, and arrowheads indicate the cytoplasmic region near the free border of the supporting cells . (left panels) uea - i stained the supporting cells in the lower chamber epithelium more intensely than those in the upper chamber epithelium . (middle panels) rca120 equally stained the supporting cells in the upper chamber epithelium and those in the lower chamber epithelium . (right panels) lel stained the supporting cells in the upper chamber epithelium more intensely than those in the lower chamber epithelium . (b) bowman s glands were stained intensely by swga, moderately by vva and weakly by pna ., negative staining; + /, faint staining; +, moderate staining; + +, intense staining . As we demonstrated in this study, the supporting cells contained secretory granules both in the upper chamber epithelium and lower chamber epithelium in the nasal cavity of soft - shelled turtles . Supporting cells of the upper chamber epithelium contained secretory granules more abundantly than those of the lower chamber epithelium: the secretory granules filled the supranuclear region of the supporting cells in the upper chamber epithelium: whereas, most of the secretory granules were localized near the free border and were scarcely distributed in the supranuclear region of the supporting cells in the lower chamber epithelium . In addition, the upper chamber epithelium possessed the associated glands, but the lower chamber epithelium did not . These evidences suggest variable lubrication ability between the upper and lower chamber epithelia: secretory activity is higher in the upper chamber epithelium than in the lower chamber epithelium . In squamates, the presence or absence of associated glands and the amount of the secretory granules are different between the oe and the vne [21, 27]. For example, the oes of snakes, gekkos and scincomorpha associate with glands and contain abundant secretory granules in the supporting cells: whereas, their vnes lack the associated glands and contain few secretory granules in the supporting cells [25, 26]. The lumen of squamate vno is always filled with fluids, which have both an intrinsic source and, at least partially, an extrinsic source (most likely the harderian glands). In the case of soft - shelled turtles, the surface of the lower chamber epithelium is always in contact with extrinsic water, possibly leading to the lower secretory activity in the lower chamber epithelium as compared with the upper chamber epithelium . In general, the secretory products of exocrine cells are classified into 3 types: serous type containing neutral mucopolysaccharides, mucous type containing acid mucopolysaccharides and seromucous type containing both neutral and acid mucopolysaccarides . The secretory granules in the bowman s glands of soft - shelled turtles have been suggested to be serous, because they were pas - positive and ab - negative and showed high electron - density . The bowman s glands, which present in all vertebrate species except fish and some amphibians, are generally serous in amphibians, reptiles and birds . Also, in the soft - shelled turtles, the bowman s glands contain serous secretory granules, suggesting that their secretory products play a significant role shared among non - mammalian bowman s glands . On the other hand, the supporting cells of both upper chamber epithelium and lower chamber epithelium were positive for pas and ab ph 2.5, suggesting that they contain mucous or seromucous secretory granules . By the electron microscopic observation, the supporting cells of both chamber epithelia have been demonstrated to contain secretory granules of heterogeneous electron - density, suggesting that they are seromucous . Furthermore, supporting cells of upper chamber epithelium and lower chamber epithelium were suggested to contain secretory granules of different compositions, because they exhibited inconsistent staining for ab ph 1.0 . In order to make further confirmation for the differences in the properties of secretory granules, we analyzed the expression of carbohydrate chains by lectin histochemistry in the area where secretory granules were distributed, and compared them between supporting cells of upper chamber epithelium and those of the lower chamber epithelium . Although 4 lectins stained the supporting cells of both chamber epithelia equally, 14 lectins stained the supporting cells of either upper or lower chamber epithelium more intensely . Among them, 3 lectins stained the supporting cells of upper chamber epithelium more intensely than those of the lower chamber epithelium, and 11 lectins stained the supporting cells of lower chamber epithelium more intensely than those of the upper chamber epithelium . Although electron - microscopic data indicated that the amount of the secretory granules in the supporting cells of lower chamber epithelium is apparently smaller than those of the upper chamber epithelium, most lectins stained the supporting cells of lower chamber epithelium more intensely than those of the upper chamber epithelium . Thus, it seemed that the differences in the lectin staining between them are not due to the differences in the amount of secretory granules but instead due to the differences in their carbohydrate expressions, i.e. The differences in the properties of secretory products . In addition to the differences in staining patterns for pas and ab or in the electron - density, the secretory granules in the bowman s glands showed different binding patterns to lectins from the patterns of the supporting cells in the upper and lower chamber epithelia . For example, supporting cells of both epithelia were negative for bsl - ii and pha - l, whereas the bowman s glands were positive . The supporting cells of both epithelia were weakly positive for s - wga, whereas the bowman s glands were intensely positive . These evidences suggest that the properties of secretory granules are different among them . In this study, we revealed that the associated glands are present only in the upper chamber epithelium, that the supporting cells of upper chamber epithelium contain secretory granules more abundantly than those of the lower chamber epithelium and that the properties of secretory granules in the supporting cells are different between the upper and lower chamber epithelia in the nasal cavity of soft - shelled turtles . The fluid layer covering the surface of olfactory sensory epithelium plays important roles in olfaction as mentioned above, and the properties of fluid layer differ among functionally distinct epithelia . Considering the lubricating ability as one of the indices for olfactory functions, differences in the olfactory function are suggested by the differences in the amount and properties of secretory granules between the upper and lower chamber epithelia in the olfactory organ of soft - shelled turtles . In general, semi - aquatic turtles show sniffing behavior under water as well as on land . Even when turtles are under water and the lower chamber is filled with water, the upper chamber could be filled with air owing to the structure of nasal cavity . Thus, in the nasal cavity of semi - aquatic turtles, the upper and lower chamber epithelia could be considered as the olfactory organs that function in the air and under water, respectively [5, 28]. Also, in some amphibians, the olfactory organ that functions in the air is different from the olfactory organ that functions under water in the amount and properties of secretory granules . Two distinct sensory epithelia present in the main olfactory system of adult xenopus laevis, the oe (functioning in the air) and the middle chamber epithelium (functioning under water), are such examples [9, 10]: the bowman s glands are present, and the supporting cells contain abundant secretory granules in the oe; whereas, associated glands are not present, and the supporting cells contain few secretory granules in the middle chamber epithelium [14, 24]. The xenopus oe functions under water in the larval stage and functions in the air during adulthood . During metamorphosis, the bowman s glands are formed, the amount and size of the secretory granules increase, and their electron - density and lectin - binding patterns change in the supporting cells of the oe [6, 14, 33]. Also, in the olfactory organs of soft - shelled turtles, the upper and lower chamber epithelia seem to be the olfactory organs that function in the air and under water, respectively.
Most of the children with cerebral venous thrombosis have an underlying chronic disease and those who are previously well have an acute infectious illness . Obstructive hydrocephalus as a complication of cerebral venous thrombosis is rare and few cases are described . A previously healthy 4-year - old boy presented with 5 days of headache and vomiting . Magnetic resonance imaging of the patient revealed obstructive hydrocephalus and magnetic resonance venography revealed thrombosis of the right transverse sinus [figure 1]. Low molecular weight heparin was started at a dosage of 1 mg / kg twice a day . Control magnetic resonance imaging and magnetic resonance venography 1 month after the first event revealed partial resolution of hydrocephalus along with recanalization of the affected sinus [figure 2]. Hydrocephalus and absent flow in the right transverse sinus showing acute thrombosis improvement of hydrocephalus and recanalization of the affected sinus after a month of heparin therapy with folic acid and vitamin b6 and b12 replacement, the follow - up of the patient was given up by the family and he did not receive any treatment for 5 months . Six months after the first event, the patient was again admitted to hospital with a similar clinical picture along with new thrombosis at the sagittal sinus . The patient is still followed up with low molecular weight heparin treatment after the second thrombosis attack . Cerebral venous system thrombosis is an unusual event in childhood and clinical presentations, complications, diagnostic procedures, etiological investigations, and treatment modalities were not well established . Clinical findings of cerebral venous system thrombosis include seizures, headache, vomiting, drowsiness, lethargy, and confusion . The patient may show acute or subacute picture related to progression of the disease . The present case presented with acute symptoms secondary to increased intracranial pressure . Increased intracranial pressure is a well - known complication of cerebral venous thrombosis, but accompanying hydrocephalus is rarely described . The mechanism of hydrocephalus is considered to be secondary to an increase in venous pressure resulting in the blockade of cerebrospinal fluid flow into the sinuses by arachnoid villi . Most of the patients with cerebral venous thrombosis have an increased intracranial pressure without an increase in ventricular size . Why some patients develop hydrocephalus is not clearly understood and only a few adult cases were described . The etiologies regarding cerebral venous thrombosis are diverse and include head and neck infections and chronic disorders such as collagen tissue disorders, cardiac disease, and hematological abnormalities . Half of the patients have prothrombotic states which include anticardiolipin antibodies, deficiencies of protein c and s, antithrombin iii and prothrombotic gene mutations such as prothrombin 20210, factor v leiden, and mthfr mutations . The most frequent two common mthfr polymorphisms are c677 t (alanin to valin transition) and a1298c (glutamine to alanine transition). Evaluation of nine case control studies with total 382 patients having cerebral venous thrombosis revealed that carrying mthfr was not a risk factor for cerebral venous thrombosis . On the contrary a canadian study revealed that 29% of patients with cerebral venous thrombosis had mthfr polymorphisms . Our case had a prothrombotic state with mthfr 1298 homozygous polymorphism without any risk factors . Occurrence of clinical findings after cessation of heparin treatment suggests that mthfr polymorphism may be an important risk factor for cerebral venous thrombosis . Anticoagulation is not recommended for asymptomatic and hemorrhagic cases . When used, low molecular weight heparin is the standard anticoagulant treatment in children . Treatment may last for 36 months or it may be continued until recanalization if risk factors are eliminated . Our patient responded well to low molecular weight heparin with recanalization of sinuses and recovery of hydrocephalus in both the attacks . In conclusion mthfr 1298 polymorphism may be an important risk factor and low molecular weight heparin should be the choice of treatment in cases without hemorrhage.
Participation in the afatinib cup was available to patients with advanced nsclc who were ineligible to participate in another actively accruing afatinib trial and who had failed at least one line of platinum - based chemotherapy and progressed following at least 24 weeks on erlotinib or gefitinib . Additional inclusion criteria were age 18 years or older, absence of an established treatment option, and written informed consent . The intention of this cup was to provide controlled preregistration access to afatinib for patients with life - threatening diseases and no other treatment option . Afatinib was given as a continuous oral treatment at a starting dose of 50 mg / day . Lower starting doses of 40 or 30 mg were allowed at the discretion of the treating physician . Dose modifications (10-mg steps, maximum dose: 50 mg / day, minimum dose: 30 mg / day) were allowed . The protocol was approved by the responsible ethics committee (medical board of the state rhineland - palatine, 837.105.10), and the required regulatory authorities (bfarm and regional authorities) were informed . As required by regulations, the cup was stopped with the availability of afatinib (giotrif) on the market . Within the cup participating physicians were asked to provide a pseudonymized clinical data set for each patient including gender, age, comorbidities, disease stage, prior therapies, and egfr mutation status . Physicians with patients known to have cns involvement were approached to collect further data on bm, ld, radiation, and outcome . One patient consented to pharmacokinetic analyses of blood and cerebral spinal fluid (csf) samples . Blood samples were collected in ethylenediaminetetraacetic acid drawing tubes . Validated bioanalytical assays for the determination of afatinib in human ethylenediaminetetraacetic acid plasma and in human csf (with 1% citric acid added to prevent adsorption loss) were used for sample analysis . Afatinib was analyzed by high - performance liquid chromatography coupled to tandem mass spectrometry (hplc - ms / ms) using isotope - labeled afatinib as internal standard . Solid - phase extraction was performed on plasma samples before the extract was injected onto the hplc - ms / ms instrument . Samples were subjected to chromatography on a reversed - phase analytical hplc column with gradient elution . Afatinib and internal standard were detected by ms / ms using electrospray ionization in the positive mode . Calibration ranges were linear from 0.500 to 250 ng / ml for plasma and from 0.100 to 20.0 ng / ml for csf, respectively . Each patient with cns metastasis was matched with one patient from the cup without cns metastasis for age, gender, histology, mutational subgroup, median treatment duration with reversible egfr - tki, and treatment line . Time to treatment failure (ttf) was defined from start of afatinib treatment (if not reported it was calculated as 7 days after shipment) to end of treatment stop (if not reported the date of the last order was used). Systemic response was defined as a response of both the primary tumor and metastasis outside the cns . General response was defined as a response of the primary tumor and of all metastases including those in the cns . The database was locked on december 31, 2013 and patients on treatment were censored . Survival curves were estimated using the kaplan meier method for ttf and overall survival . A cox model was applied to estimate hrs and 95% confidence intervals with significance set at p value less than 0.05 . Analyses were undertaken using medcalc for windows, version 12.1.4.0 (medcalc software, ostend, belgium). Patients who received less than 2 months of afatinib due to progressive disease (pd) or death were classified pd as best response, whereas patients receiving treatment for a period of more than 4 months were classified stable disease (sd) as best response if not reported differently . Participation in the afatinib cup was available to patients with advanced nsclc who were ineligible to participate in another actively accruing afatinib trial and who had failed at least one line of platinum - based chemotherapy and progressed following at least 24 weeks on erlotinib or gefitinib . Additional inclusion criteria were age 18 years or older, absence of an established treatment option, and written informed consent . The intention of this cup was to provide controlled preregistration access to afatinib for patients with life - threatening diseases and no other treatment option . Afatinib was given as a continuous oral treatment at a starting dose of 50 mg / day . Lower starting doses of 40 or 30 mg were allowed at the discretion of the treating physician . Dose modifications (10-mg steps, maximum dose: 50 mg / day, minimum dose: 30 mg / day) were allowed . The protocol was approved by the responsible ethics committee (medical board of the state rhineland - palatine, 837.105.10), and the required regulatory authorities (bfarm and regional authorities) were informed . As required by regulations, the cup was stopped with the availability of afatinib (giotrif) on the market . Within the cup participating physicians were asked to provide a pseudonymized clinical data set for each patient including gender, age, comorbidities, disease stage, prior therapies, and egfr mutation status . Physicians with patients known to have cns involvement were approached to collect further data on bm, ld, radiation, and outcome . One patient consented to pharmacokinetic analyses of blood and cerebral spinal fluid (csf) samples . Blood samples were collected in ethylenediaminetetraacetic acid drawing tubes . Validated bioanalytical assays for the determination of afatinib in human ethylenediaminetetraacetic acid plasma and in human csf (with 1% citric acid added to prevent adsorption loss) afatinib was analyzed by high - performance liquid chromatography coupled to tandem mass spectrometry (hplc - ms / ms) using isotope - labeled afatinib as internal standard . Solid - phase extraction was performed on plasma samples before the extract was injected onto the hplc - ms / ms instrument . Samples were subjected to chromatography on a reversed - phase analytical hplc column with gradient elution . Afatinib and internal standard were detected by ms / ms using electrospray ionization in the positive mode . Calibration ranges were linear from 0.500 to 250 ng / ml for plasma and from 0.100 to 20.0 ng / ml for csf, respectively . Each patient with cns metastasis was matched with one patient from the cup without cns metastasis for age, gender, histology, mutational subgroup, median treatment duration with reversible egfr - tki, and treatment line . Time to treatment failure (ttf) was defined from start of afatinib treatment (if not reported it was calculated as 7 days after shipment) to end of treatment stop (if not reported the date of the last order was used). Systemic response was defined as a response of both the primary tumor and metastasis outside the cns . General response was defined as a response of the primary tumor and of all metastases including those in the cns . The database was locked on december 31, 2013 and patients on treatment were censored . Survival curves were estimated using the kaplan meier method for ttf and overall survival . A cox model was applied to estimate hrs and 95% confidence intervals with significance set at p value less than 0.05 . Analyses were undertaken using medcalc for windows, version 12.1.4.0 (medcalc software, ostend, belgium). Patients who received less than 2 months of afatinib due to progressive disease (pd) or death were classified pd as best response, whereas patients receiving treatment for a period of more than 4 months were classified stable disease (sd) as best response if not reported differently . Between may 2010 and december 2013, 573 patients were included in the cup and 541 were treated with afatinib . One hundred patients (66% female; median age, 60 years; range, 3178 years) were reported to have either bm or ld (table 1). Of those 97% had adenocarcinoma, 74% were reported to have an egfr mutation confirmed by molecular pathology, and 77% of the reported egfr mutations were exon 19 deletions or exon 21 l858r mutations . Characteristics of the patients with and without cns metastasis and of the matched group without cns metastasis all patients in the cup were pretreated with chemotherapy and erlotinib / gefitinib; first - line therapy was a platinum doublet in the majority (64%), and erlotinib (13%) and gefitinib (22%) in a subset (table 2). The most common second - line treatments were erlotinib (38%) and gefitinib (22%), and 38% of patients received erlotinib in third - line . The majority of patients were enrolled in the cup for third - line or fourth - line treatment, but individual patients with up to 12 prior treatment lines were also registered . Pretreatment of the patient group with cns metastasis the cup protocol suggested a starting dose of 50 mg afatinib daily; however, this dose could be modified by the treating physician depending on side effects during prior egfr - tki treatment and the patient s general performance status . Accordingly, starting doses were 50 mg (n = 71), 40 mg (n = 25), and 30 mg (n = 4). Dose reductions from 50 to 40 mg were carried out in 51% of patients, and from 40 to 30 mg in 80% . The main reasons for dose reductions were diarrhea (70% of dose reductions) and skin rash (24%). We analyzed patients previous response to treatment with erlotinib or gefitinib before their inclusion in the cup . Patients with cns metastases had been treated with erlotinib or gefitinib for a median of 9 months (range, 136 months). Data on general best response were available for 68 of these patients: 18% (12 of 68) had experienced a partial remission (pr), 53% (36 of 68) had sd, and 29% (20 of 68) had pd . Detailed information about the first diagnosis of cns metastases was available for a subset of patients . Twenty - four percent (11 of 46) were reported to have developed cns metastases after treatment with reversible tkis . Cns metastases were first detected by computed tomography (ct) in 29%, by positron emission tomography - ct in 4%, and by magnetic resonance imaging in 67% . One patient had ld without further brain metastasis, 28% (10 of 36) had a solitary brain metastasis, 22% (8 of 36) had 2 to 5 brain metastases, and 47% (17 of 36) patients had more than five metastases in the cns . Sixty - nine percent of patients were symptomatic from their cns metastases, and 88% were treated with cranial radiation prior to afatinib therapy (36 of 41, median dose 30 gy). Ttf under afatinib in patients with cns metastases was 3.6 months and did not differ from the ttf in matched patients without cns metastases (hr, 1.16; 95% confidence interval, 0.831.62; p = 0.52; fig . Ttf for patients with known egfr mutations (n = 72) was 4.0 months, for patients with unknown mutational status (n = 20) 3.6 months, and for wild - type patients (n = 8) 1.3 months . Forty - two percent (13 of 31) of the evaluable patients experienced a pr on afatinib, 39% (12 of 31) had sd, and only 19% (6 of 31) had pd (fig . Nineteen percent (6 of 31) had a general response (defined as systemic and cns response), 16% (5 of 31) had a cerebral response only, and 13% (4 of 31) had a systemic response only . Sixty - six percent (21 of 32) of patients had cns disease control on afatinib, whereas 23% (8 of 35) had an isolated cerebral progression during treatment (fig . 3; please note that data on recurrence pattern were not always fully reported). Afatinib was discontinued in 39% of patients due to progression, in 17% due to death, in 7% due to side effects, and in 3% due to patient request . Twelve percent of patients were lost to follow - up, and 22% of the patients remained on treatment with afatinib at the end of the cup . Typical adverse events, including diarrhea, skin / mucosal toxicity, nausea / vomiting, and fatigue, were observed as expected based on previous experiences with afatinib . Two cases of patients with cns metastasis are of great interest and shall be described here in detail . In june 2011, a 59-year - old never - smoking woman was diagnosed with stage iv adenocarcinoma of the lung (ct2b pn2 m1a, ple) and proof of an l858r exon 21 mutation of the egfr gene . First - line gefitinib treatment led to a partial remission for a duration of 9 months and was followed by second - line therapy with two cycles of pemetrexed 500 mg / m . In june 2012, the patient developed symptomatic peritoneal carcinomatosis, an ovarian mass, pulmonary, and bone metastases . A rebiopsy from the peritoneum showed 10 to 20% l858r / t790m - positive tumor cells . Subsequent therapy with four cycles of cisplatin (40 mg / m, d1 + 8) and gemcitabine (1000 mg / m, d1 + 8, q d22) resulted in a minor response for a further 6 months . She then developed leptomeningeosis carcinomatosa (cytological confirmation in the spinal fluid) and was hospitalized with an eastern cooperative oncology group performance status of 3/4 . The patient subsequently received a fourth - line therapy with afatinib 50 mg / day . After a few days the neurological symptoms regressed, the vomiting stopped, and the eastern cooperative oncology group performance status dramatically improved to 1/2 when the patient was discharged . Furthermore, the lung metastases were regressive with extension of a partial response according to response evaluation criteria in solid tumors 1.1 . One month after beginning afatinib therapy, there was no evidence of tumor cells in the spinal fluid . The plasma concentration of afatinib 3 hours after administration was 66.7 ng / ml bibw 2992 base (bs; the free base of afatinib). The concentration of csf 3 hours after administration was 0.464 ng / ml bibw 2992 bs, which is equivalent to a concentration of approximately 1 nmol afatinib in the csf (fig . Then the patient developed diarrhea and elevated liver transaminases (25 times upper limit of normal). The course of disease was complicated by acute renal failure after contrast media (for ct) in conjunction with moderate diarrhea . The dosage was reduced to 40 mg afatinib . In may 2013 (5 months after starting afatinib), the patient died of sepsis following an infection of the port - catheter without evidence of progression of the leptomeningeosis carcinomatosa . In february 2007, a 61-year - old male smoker was first diagnosed with stage iv adenocarcinoma of the lung and two cerebral metastases (pt4 pn1 m1b). After a bilobectomy and a cerebral metastasectomy, he received four cycles of cisplatin (40 mg / m d1 + 8)/vinorelbine (25 mg / m d1 + 8)/bevacizumab (15 mg / kg d1, q d29) and bevacizumab was continued up to june 2008 . In january 2009, a bone metastasis was resected and irradiated (30 gy) and a radiation of the brain was performed (30 gy) followed by a second - line therapy with erlotinib . In march 2012, a metastasectomy of the right adrenal gland was performed with confirmation of an egfr - wildtype in the resection specimen . One month later, the patient developed new cerebral and pulmonal metastases and third - line therapy with afatinib (50 mg / day) was initiated . The trough plasma concentration 7 weeks after the start of afatinib was 35.6 ng / ml; 3 hours after administration, it was 59.07 ng / ml bibw 2992 bs . The patient experienced a partial response with little side effects (grade 1: diarrhea and rash). In january 2013, the dosage of afatinib was increased to 60 mg / day and in april 2013 to 70 mg / day at the discretion of the treating physician . In october 2013, after 16 months of treatment with afatinib, the patient died due to rapid tumor progression . We analyzed patients previous response to treatment with erlotinib or gefitinib before their inclusion in the cup . Patients with cns metastases had been treated with erlotinib or gefitinib for a median of 9 months (range, 136 months). Data on general best response were available for 68 of these patients: 18% (12 of 68) had experienced a partial remission (pr), 53% (36 of 68) had sd, and 29% (20 of 68) had pd . Detailed information about the first diagnosis of cns metastases was available for a subset of patients . Twenty - four percent (11 of 46) were reported to have developed cns metastases after treatment with reversible tkis . Cns metastases were first detected by computed tomography (ct) in 29%, by positron emission tomography - ct in 4%, and by magnetic resonance imaging in 67% . One patient had ld without further brain metastasis, 28% (10 of 36) had a solitary brain metastasis, 22% (8 of 36) had 2 to 5 brain metastases, and 47% (17 of 36) patients had more than five metastases in the cns . Sixty - nine percent of patients were symptomatic from their cns metastases, and 88% were treated with cranial radiation prior to afatinib therapy (36 of 41, median dose 30 gy). Ttf under afatinib in patients with cns metastases was 3.6 months and did not differ from the ttf in matched patients without cns metastases (hr, 1.16; 95% confidence interval, 0.831.62; p = 0.52; fig . Ttf for patients with known egfr mutations (n = 72) was 4.0 months, for patients with unknown mutational status (n = 20) 3.6 months, and for wild - type patients (n = 8) 1.3 months . Forty - two percent (13 of 31) of the evaluable patients experienced a pr on afatinib, 39% (12 of 31) had sd, and only 19% (6 of 31) had pd (fig . Nineteen percent (6 of 31) had a general response (defined as systemic and cns response), 16% (5 of 31) had a cerebral response only, and 13% (4 of 31) had a systemic response only . Sixty - six percent (21 of 32) of patients had cns disease control on afatinib, whereas 23% (8 of 35) had an isolated cerebral progression during treatment (fig . 3; please note that data on recurrence pattern were not always fully reported). Afatinib was discontinued in 39% of patients due to progression, in 17% due to death, in 7% due to side effects, and in 3% due to patient request . Twelve percent of patients were lost to follow - up, and 22% of the patients remained on treatment with afatinib at the end of the cup . Typical adverse events, including diarrhea, skin / mucosal toxicity, nausea / vomiting, and fatigue, were observed as expected based on previous experiences with afatinib . Two cases of patients with cns metastasis are of great interest and shall be described here in detail . In june 2011, a 59-year - old never - smoking woman was diagnosed with stage iv adenocarcinoma of the lung (ct2b pn2 m1a, ple) and proof of an l858r exon 21 mutation of the egfr gene . First - line gefitinib treatment led to a partial remission for a duration of 9 months and was followed by second - line therapy with two cycles of pemetrexed 500 mg / m . In june 2012, the patient developed symptomatic peritoneal carcinomatosis, an ovarian mass, pulmonary, and bone metastases . A rebiopsy from the peritoneum showed 10 to 20% l858r / t790m - positive tumor cells . Subsequent therapy with four cycles of cisplatin (40 mg / m, d1 + 8) and gemcitabine (1000 mg / m, d1 + 8, q d22) resulted in a minor response for a further 6 months . She then developed leptomeningeosis carcinomatosa (cytological confirmation in the spinal fluid) and was hospitalized with an eastern cooperative oncology group performance status of 3/4 . The patient subsequently received a fourth - line therapy with afatinib 50 mg / day . After a few days the neurological symptoms regressed, the vomiting stopped, and the eastern cooperative oncology group performance status dramatically improved to 1/2 when the patient was discharged . Furthermore, the lung metastases were regressive with extension of a partial response according to response evaluation criteria in solid tumors 1.1 . One month after beginning afatinib therapy, there was no evidence of tumor cells in the spinal fluid . The plasma concentration of afatinib 3 hours after administration was 66.7 ng / ml bibw 2992 base (bs; the free base of afatinib). The concentration of csf 3 hours after administration was 0.464 ng / ml bibw 2992 bs, which is equivalent to a concentration of approximately 1 nmol afatinib in the csf (fig . Then the patient developed diarrhea and elevated liver transaminases (25 times upper limit of normal). The course of disease was complicated by acute renal failure after contrast media (for ct) in conjunction with moderate diarrhea . The dosage was reduced to 40 mg afatinib . In may 2013 (5 months after starting afatinib), the patient died of sepsis following an infection of the port - catheter without evidence of progression of the leptomeningeosis carcinomatosa . In february 2007, a 61-year - old male smoker was first diagnosed with stage iv adenocarcinoma of the lung and two cerebral metastases (pt4 pn1 m1b). After a bilobectomy and a cerebral metastasectomy, he received four cycles of cisplatin (40 mg / m d1 + 8)/vinorelbine (25 mg / m d1 + 8)/bevacizumab (15 mg / kg d1, q d29) and bevacizumab was continued up to june 2008 . In january 2009, a bone metastasis was resected and irradiated (30 gy) and a radiation of the brain was performed (30 gy) followed by a second - line therapy with erlotinib . In march 2012, a metastasectomy of the right adrenal gland was performed with confirmation of an egfr - wildtype in the resection specimen . One month later, the patient developed new cerebral and pulmonal metastases and third - line therapy with afatinib (50 mg / day) was initiated . The trough plasma concentration 7 weeks after the start of afatinib was 35.6 ng / ml; 3 hours after administration, it was 59.07 ng / ml bibw 2992 bs . The patient experienced a partial response with little side effects (grade 1: diarrhea and rash). In january 2013, the dosage of afatinib was increased to 60 mg / day and in april 2013 to 70 mg / day at the discretion of the treating physician . In october 2013, after 16 months of treatment with afatinib, the patient died due to rapid tumor progression . Heavily pretreated nsclc patients with cns metastases who progressed on erlotinib or gefitinib seemed to respond well to treatment with afatinib during a cup . These results are encouraging, as cns metastases negatively impact the quality of life and os of many patients with nsclc and continue to present a therapeutic challenge . In addition to the therapeutic effect of afatinib, the relatively long os of patients with cns metastases in the cup may also reflect the prognostic relevance of egfr mutations and a degree of preselection for patient motivation and general state of health . Systemic chemotherapy is often ineffective in patients with cns metastases, perhaps due to poor permeability of the blood the cerebral efficacy of tkis seems to be somewhat higher, and response rates of 75 to 89% in egfr - mutated nsclc patients with cns metastases treated with egfr - tkis have been reported . A sequential approach to treatment in which patients with egfr - mutated nsclc and cns metastases are offered a trial of tki treatment, and brain irradiation is delayed until clinical or radiological progression occurs, may be reasonable, and could delay or prevent patient exposure to the side effects of cranial irradiation . However, in addition to evidence that tkis are effective in patients with brain metastases, there is evidence that patients treated with egfr - tkis or anaplastic lymphoma kinase - tkis over a period of many months may have an increased risk of developing cns metastases . It may be that the concentration of tki in the csf is sufficient to inhibit treatment - naive, non tki - resistant cells, but that over time the lower drug concentrations select for resistant clones . Due to its potency at relatively low concentrations, afatinib may remain effective in the csf after resistance to other tkis has developed . In preclinical studies, afatinib demonstrated high potency of kinase inhibition against egfr, her2, and erbb4 kinases with 50% inhibitory concentration (ic50) of 0.5, 14, and 1 nm, respectively . The median inhibitory concentration of afatinib (in vitro) is lower than that of currently available egfr - tkis (table 3). This suggests that afatinib has the potential to treat cns metastases effectively, despite incomplete penetration of the blood the regression of cns metastases observed during the afatinib cup provides clinical evidence that afatinib concentration in the csf is sufficient to inhibit tumor growth . Subgroup analyses of the lux - lung trials have also documented the effectiveness of first - line afatinib in the treatment of cns metastases in egfr - mutated nsclc, and support the observations within the afatinib cup . Over 70% of the patients with cns metastases had either pr or sd and 76% of the patients developed no new metastases . Ic50 values of reversible egfr - tkis and afatinib therapy with erlotinib results in penetration into the csf previously reported to range from 2.5% to 13%; and gefitinib concentration in the csf has been reported to reach approximately 1% of serum levels . The plasma and csf concentrations of afatinib were measured in one patient in the cup (see case report 1) and gave a csf to plasma ratio of below 1% . Calculating the molar concentration would lead to a value of 0.95 nm, which is around the ic50 value for egfr / erbb1 (0.5 nm) and for her4/erbb4 (1 nm) but below the value for her2 (14 nm). Nevertheless, the correlation with dramatic clinical improvement and disappearance of tumor cells in the csf suggests that the dose reached was sufficient to inhibit tumor growth . One could speculate that there are distribution processes in the cns which could lead to higher concentrations at the target tissue . Afatinib has a high affinity to egfr, which should be overexpressed in the tumor tissue and, thus, could be enriched there . It should also be considered that the protein content of csf is much lower than that of blood, so ratios of the free (effective) concentrations would probably be higher . By comparison, erlotinib levels in the csf at approximately 5% of the plasma levels have been reported to be sufficient to inhibit the receptor, whereas gefitinib levels in the csf (approximately 1% of plasma levels) have been reported to be insufficient for inhibition . Clearly some afatinib penetrates into the cns, and achieves concentrations high enough to have a clinical effect . Dose modifications of afatinib based on individual tolerability reduced excessive afatinib plasma levels (as in case report 1), whereas experimental escalation up to 70 mg from an initial dose of 50 mg in case report 2 prolonged response . Case report 2 involved a trial of high - dose afatinib to treat progressing brain metastases . The patient remained on high - dose (70 mg / day) afatinib for 6 months . Cases involving the use of high - dose or pulsed egfr - tkis for the treatment of progressive brain metastases have been reported in the literature . Hata et al . Gave erlotinib at a dose of 300 mg on alternating days and dhruva and socinski . A case series involving 10 patients treated with pulsed erlotinib 1000 to 1500 mg once weekly was presented at the 2013 american society of clinical oncology meeting but has to our knowledge not yet been published . The responses seen in these patients suggest that the efficacy of these tkis in the brain may be limited by insufficient penetration of the drugs into the csf and may be increased by increasing the dose . However, as clinical trial data supporting the use of these strategies is not yet available, the use of high - dose or pulsed tkis should be considered experimental at this time . In summary, heavily pretreated patients with egfr - resistant nsclc and cns metastases benefited from treatment with afatinib in this cup . In light of the lack of established treatment options in this setting, editorial assistance was provided by katie mcclendon of geomed, part of knowledgepoint360, an ashfield company, prior to submission of this article . Supported financially by boehringer ingelheim.
Oral glucose administration leads to greater insulin release from pancreatic islets than intravenous glucose loading that yields equivalent glucose levels . Gut hormonal substances released in response to glucose include the incretins, gastric inhibitory polypeptide (gip) and glucagonlike peptide1 (glp1), which are responsible for 5060% of postprandial insulin secretion . Gip is secreted on meal ingestion from kcells in the proximal small intestine, whereas glp1 is secreted from lcells in the distal small intestine and colon, and binds to their respective receptors (gip receptor [gipr] and glp1 receptor) on the surface of pancreatic cells to stimulate insulin secretion by increasing the intracellular adenosine 3,5monophosphate (camp) concentration . The incretin effect has been shown to be reduced in type 2 diabetic subjects compared with those with normal glucose tolerance (ngt) in previous studies, suggesting that a reduced incretin effect might be associated with hyperglycemia after food intake and glucose loading in type 2 diabetes . When intravenous infusion of gip or glp1 was carried out in type 2 diabetic subjects, glp1 potentiated insulin secretion from pancreatic cells, but gip did not, showing that the gipr signal is downregulated in cells in type 2 diabetes . In studies using rodent models, it was reported that gipr mrna and protein expression levels in islets are decreased in the diabetic state . In contrast, in the nondiabetic obese state the gip signal might be enhanced as a result of increased gipr sensitivity of cells to gip or increased gip secretion from kcells in the nondiabetic obese state . Indeed, gip concentrations are reported to be increased in obese rodent models and human subjects compared with those in lean rodents and human subjects, respectively . Furthermore, we have previously shown the hypersensitivity of gipr to gip in cells of high fatinduced obese mice . Plasma glp1 concentrations in type 2 diabetic patients are reported to be reduced after meal ingestion and glucose loading . However, in other studies it was reported that glp1 concentrations did not differ in ngt and type 2 diabetic subjects . Thus, the measurement of gip and glp1 concentrations in various metabolic states is important to evaluate the effects of incretin on insulin secretion . Insulin sensitivity in asian subjects has been shown to be higher than in mexican americans and caucasians in previous reports, which is partly as a result of the fact that asians, including japanese, are generally less obese . Furthermore, insulin secretion rather than insulin sensitivity is the more important factor in progression from ngt to diabetes in japanese subjects . We have reported that earlyphase insulin secretion is considerably decreased, even in japanese ngt subjects with 1h plasma glucose (pg) levels during oral glucose tolerance test (ogtt) of more than 180 mg / dl . Thus, it is especially important to evaluate incretin secretion and determine the factors associated with incretin secretion in japanese ngt subjects, because gip and incretin is responsible for more than 50% of postprandial insulin secretion after glucose ingestion . The factors responsible for incretin secretion have been reported in caucasian subjects, but have not been thoroughly elucidated in japanese subjects . In the present study, we evaluated gip and glp1 levels during ogtt and determined the factors involved in gip and glp1 secretion (area under the curve [auc] of gip and glp1 during ogtt) in japanese ngt subjects . The subjects had no history of hypertension, hyperlipidemia or kidney and liver diseases, and did not take any drugs 2 weeks before the study . The study was designed in compliance with the ethics regulations of the helsinki declaration and kyoto university . Blood samples for the measurement of liver and kidney function, hba1c, serum triglyceride (tg), total cholesterol and highdensity lipoprotein (hdl)cholesterol levels were drawn after an overnight fast . All subjects received ogtt . After the subjects fasted overnight for 1016 h, standard ogtt with 75 g glucose was given according to the national diabetes data group recommendations . Blood samples were collected at 15, 0, 10, 20, 30, 60, 90, 120, 150 and 180 min after glucose loading and were centrifuged at 1800 g at 4c for 10 min . After collecting supernatant of the samples, plasma and serum plasma gip, glp1 levels and the various parameters (pg, serum immunoreactive insulin [iri], serum cpeptide reactivity [cpr], tg, serum free fatty acid [ffa] and plasma glucagon) were measured at the indicated times (plasma gip and glp1 levels were measured at 15, 0, 10, 30, 60, 90, 120 and 180 min after glucose loading, and plasma glucagon levels were measured at 15, 0, 30, 60, 90, 120 and 180 min after glucose loading). The pg levels were measured by glucose oxidase method . Total gip and total glp1 levels were measured using human gip elisa kit (linco research, st charles, mo, usa; range of detection from 8.2 pg / ml to 2000 pg / dl) and human glp1 elisa kit (meso scale discovery, gaithersburg, md, usa; range of detection from 2.4 pg / ml to 1,000,000 pg / dl), respectively, as previously described . The auc of pg, iri, cpr, tg, ffa, glucagon, total gip (aucgip) and total glp1 (aucglp1) were calculated . We then analyzed the relationship between the auc of gip (gip secretion) and glp1 (glp1 secretion) and age, body mass index (bmi) and the parameters during ogtt . Basal insulin secretion and sensitivity were evaluated by homeostasis model assessment (homa) cell function and homeostasis model assessment of insulin resistance (homair), respectively . Earlyphase insulin secretion and systemic insulin sensitivity during ogtt were evaluated by insulinogenic index and insulin sensitivity index (isi) composite . The calculations of the four indices were as follows: equation equation equation equation all analyses were carried out using statistical analysis software (spss version 17.0, ibm, somers, ny, usa) system . Statistical analysis was carried out by anova with fisher s plsd test for changing levels of gip, glp1, and the parameters during ogtt and differences between the two groups were assessed by unpaired ttest . We used simple regression analysis to determine the relationship between aucgip or aucglp1 and the age, bmi and the parameters during ogtt, and we carried out multiple regression analysis to determine the factors most strongly associated with aucgip and aucglp1, and the indices of insulin secretion and sensitivity . The subjects had no history of hypertension, hyperlipidemia or kidney and liver diseases, and did not take any drugs 2 weeks before the study . The study was designed in compliance with the ethics regulations of the helsinki declaration and kyoto university . Blood samples for the measurement of liver and kidney function, hba1c, serum triglyceride (tg), total cholesterol and highdensity lipoprotein (hdl)cholesterol levels were drawn after an overnight fast . All subjects received ogtt . After the subjects fasted overnight for 1016 h, standard ogtt with 75 g glucose was given according to the national diabetes data group recommendations . Blood samples were collected at 15, 0, 10, 20, 30, 60, 90, 120, 150 and 180 min after glucose loading and were centrifuged at 1800 g at 4c for 10 min . After collecting supernatant of the samples, plasma and serum plasma gip, glp1 levels and the various parameters (pg, serum immunoreactive insulin [iri], serum cpeptide reactivity [cpr], tg, serum free fatty acid [ffa] and plasma glucagon) were measured at the indicated times (plasma gip and glp1 levels were measured at 15, 0, 10, 30, 60, 90, 120 and 180 min after glucose loading, and plasma glucagon levels were measured at 15, 0, 30, 60, 90, 120 and 180 min after glucose loading). Total gip and total glp1 levels were measured using human gip elisa kit (linco research, st charles, mo, usa; range of detection from 8.2 pg / ml to 2000 pg / dl) and human glp1 elisa kit (meso scale discovery, gaithersburg, md, usa; range of detection from 2.4 pg / ml to 1,000,000 the auc of pg, iri, cpr, tg, ffa, glucagon, total gip (aucgip) and total glp1 (aucglp1) were calculated . We then analyzed the relationship between the auc of gip (gip secretion) and glp1 (glp1 secretion) and age, body mass index (bmi) and the parameters during ogtt . Basal insulin secretion and sensitivity were evaluated by homeostasis model assessment (homa) cell function and homeostasis model assessment of insulin resistance (homair), respectively . Earlyphase insulin secretion and systemic insulin sensitivity during ogtt were evaluated by insulinogenic index and insulin sensitivity index (isi) composite . The calculations of the four indices were as follows: equation equation equation equation all analyses were carried out using statistical analysis software (spss version 17.0, ibm, somers, ny, usa) system . Statistical analysis was carried out by anova with fisher s plsd test for changing levels of gip, glp1, and the parameters during ogtt and differences between the two groups were assessed by unpaired ttest . We used simple regression analysis to determine the relationship between aucgip or aucglp1 and the age, bmi and the parameters during ogtt, and we carried out multiple regression analysis to determine the factors most strongly associated with aucgip and aucglp1, and the indices of insulin secretion and sensitivity . Mean age was 31.7 1.3 years and mean bmi was 23.1 0.9 kg / m . Hdl, highdensity lipoprotein; homa, homeostasis model assessment; homair, homeostasis model assessment of insulin resistance; isi, insulin sensitivity index . The levels of gip, glp1, pg, iri, cpr, tg, ffa and glucagon after glucose loading were measured (figure 1). The subjects were diagnosed ngt according to who criteria with fasting plasma glucose and 2h glucose levels below 6.1 and 7.8 mmol / l, respectively . Levels of pg, iri and cpr were significantly increased from 10 min after glucose loading compared with fasting level (figure 1a c). Ffa levels were significantly decreased from 10 min after glucose loading (figure 1d). Glucagon levels were significantly decreased from 30 min after glucose loading (figure 1f). Total gip levels were significantly increased from 10 min during ogtt (figure 1 g). Total glp1 levels were significantly increased from 10 min during ogtt with peaks at 30 and 120 min (figure 1h). Concentrations of (a) plasma glucose, (b) serum immunoreactive insulin, (c) serum cpeptide reactivity (cpr), (d) serum free fatty acid (ffa), (e) serum triglyceride (tg), (f) glucagon, (g) total gastric inhibitory polypeptide (gip) and (h) total glucagonlike peptide1 (glp1) during oral glucose tolerance test in 17 japanese subjects . Mean se, * p <0.05, * * p <0.01, * * we analyzed the relationship between aucgip or aucglp1 and age, bmi and the several parameters (auc of pg, iri, cpr, tg, ffa and glucagon). Aucgip were positively related to bmi and auc of cpr, iri and glucagon, but aucglp1 was not related to these factors (figure 2a c; auc data of iri during ogtt are not shown; p <0.05). In contrast, aucglp1 was inversely related to auc of pg (figure 2d), but aucgip was not . Simple regression analysis of gastric inhibitory polypeptide secretion (aucgip) and (a) body mass index (bmi), (b) auc of serum cpeptide reactivity (cpr) and (c) glucagon . (d) simple regression analysis of glucagonlike peptide1 secretion (aucglp1) and auc of plasma glucose (pg). We then analyzed the relationship between aucgip or aucglp1 and indices of insulin secretion and insulin sensitivity . Aucgip was positively related to insulinogenic index and homair, whereas aucglp1 was positively related to homa cell function (figure 3a c). Isi composite was not related to either aucgip or aucglp1 (figure 3d). In addition, multiple regression analysis was carried out to determine the factors strongly associated with aucgip and aucglp . The insulinogenic index was the most strongly associated factor in aucgip (correlation coefficients 0.56, standardized 0.56, p <0.05) of the four indices; homa cell function was the strongest factor in aucglp1 (homa cell function: correlation coefficients 0.524, standardized 0.870, p <0.01, isi composite: correlation coefficients 0.063, standardized 0.581, p <0.05). Relationship between gastric inhibitory polypeptide secretion (aucgip) and glucagonlike peptide1 secretion (aucglp1) and the indices of insulin secretion and insulin sensitivity . (a) insulinogenic index, (b) homeostasis model assessment (homa) cell function, (c) homeostasis model assessment of insulin resistance (homair) and (d) insulin sensitivity index (isi) composite . In the present study, we estimated the incretin level after glucose loading in japanese ngt subjects and found that plasma gip and glp1 levels during ogtt are related to different factors . Incretin action of gip is reduced in the diabetic state as a result of decreased gip receptor expression on pancreatic cells, whereas gip signaling is enhanced and maintains glucose homeostasis by compensatory increased insulin secretion in the obese state . In some human studies in caucasians, plasma gip levels are increased in obese subjects and there is a positive relationship between aucgip and auc of ffa during ogtt . In the present study, aucgip after glucose loading was not associated with auc of ffa, but was positively associated with bmi, homair, and auc of iri and cpr after glucose loading . In fact, obese subjects are known to have hyperinsulinemia and insulin resistance, and bmi was strongly associated with auc of iri and cpr . Thus, gip secretion from kcells may well be associated with insulin resistance to maintain postprandial hyperinsulinemia in japanese ngt subjects . It might be explained by the fact that gip secretion is associated with the amount of glucose loading, whereas blood glucose levels are maintained within normal levels by gipinduced compensatory insulin secretion in ngt subjects . Glp1 secretions of type 2 diabetes subjects after glucose or meal ingestion are diverse in human studies . Recently, it is reported that glp1 levels after ingestion of glucose and mix meal in japanese type 2 diabetic subjects were not decreased compared with those in ngt subjects, suggesting that glp1 secretion is not decreased in japanese type 2 diabetes . Two studies of caucasian subjects found that aucglp1 during ogtt is positively associated with age and auc of glucagon, whereas auc of glp1 is negatively associated with bmi or bodyweight and auc of ffa . In the present study, aucglp1 was negatively related to auc of pg during ogtt, showing that the increase in glp1 secretion after glucose loading is associated with a decrease in postprandial glucose levels in japanese ngt subjects . It has been reported that glp1 levels after glucose loading are positively related to gastric empting in caucasian subjects . Although we did not measure gastric empting of the subjects in the present study, increasing glp1 secretion after glucose loading might decrease postprandial glucose levels through gastric emptying . In the present study, however, because japanese subjects are less obese than caucasian subjects, the difference observed in the relationship between aucgip and glp1, and auc of ffa might reflect this ethnic difference in caucasians and japanese . Insulin secretion, rather than insulin sensitivity, is the more important factor in the progression from ngt to type 2 diabetes in japanese patients . Because incretin is an intestinal hormone that induces postprandial insulin secretion, we hypothesize that gip and glp1 secretion is more crucial in japanese subjects than in caucasian subjects . Indeed, glp1 mimetics and dpp4 inhibitors improve glycemic control better in japanese type 2 diabetic patients than in caucasian type 2 diabetic patients in clinical trials . We therefore evaluated the correlation between gip secretion (aucgip) and glp1 secretion (aucglp1), and the indices of insulin secretion and insulin sensitivity in japanese ngt subjects during ogtt . The values of homa cell, insulinogenic index, homair and isi composite were similar to those in previous studies of japanese subjects . Aucgip was positively associated with the insulinogenic index and homair, and the insulinogenic index was strongly associated with aucgip, whereas aucglp1 was associated only with homa cell among the four indices . It has been reported that earlyphase insulin secretion is an important factor in the progression from ngt through impaired glucose tolerance (igt) to type 2 diabetes, and that basal insulin secretion (homa cell) and insulin resistance are important factors in the progression from ngt through impaired fasting glucose (ifg) to type 2 diabetes in japanese patients . Thus, enhancing the gip and glp1 signals might be particularly useful in inhibiting the progression of type 2 diabetes in japanese patients . Recently, variants at the gip receptor gene locus associated with 2h glucose levels during ogtt were identified by metaanalysis of genomewide association studies . In subjects who carry this gip receptor risk allele, these data seem to support our results that gip secretion is associated with insulinogenic index in japanese ngt subjects . In conclusion, we evaluated plasma gip and glp1 levels during ogtt in japanese ngt subjects . Glp1 secretion was associated with pg during ogtt, and basal insulin secretion (homa cell) and gip secretion was associated with bmi and earlyphase insulin secretion (insulinogenic index). Thus, there might be different factors associated with gip and glp1 secretion during ogtt in japanese subjects.
The gamma - aminobutyric acid (gaba), the major inhibitory neurotransmitter in the mammalian central nervous system, causes changes in a polarization of cell membrane acting through the activation of gaba receptors . The most prevalent, gaba type a (gaba a), receptors tend to exist as pentameric structures consisting of various combinations of six major subunits:,,,,, and . Recent data indicate that gabaergic activity is not restricted to the central nervous system, but also involves cells of different origin that, like hepatocytes, possess the peripheral type of gaba a receptors . As was shown in several studies, an activation of gaba a receptors (especially the 3 subunit) leads to the hyperpolarization of cell membrane, which, in turn, causes a rapid decrease in cell proliferation [3, 4]. This feature seems to be interesting with regard to the study that demonstrated the impact of cell polarization on the efficiency of hepatitis c virus (hcv) entry . An elevated gabaergic activity was found to be responsible for the impaired hepatocyte proliferation in regenerating livers after partial hepatectomy [6, 7]. On the other hand, it has been known since the early 1980s that the serum level of gaba may be elevated in case of acute or chronic hepatocellular failure, and the gaba neurotransmitter system is involved in the pathogenesis of hepatic encephalopathy (he) in humans . Recently, it has been suggested that he - dependent ammonia may be developed due to the modification of the gaba a receptor affinity . Other findings suggest that increased inhibition through gaba a receptors may represent an important pathophysiological mechanism of fatigue in chronic hcv infection . This multifunctionality of gabaergic action in numerous liver failures has drawn our attention to the possible role of the modulation of gaba a receptors expression in the course of hcv infection and in the response to the antiviral treatment . Although the liver is the main place of hcv replication, gathered data, including our own [12, 13], indicate that hcv can persist and replicate efficiently in extrahepatic tissue, including peripheral blood mononuclear cells (pbmcs). Hcv rna can persist in pbmcs long after spontaneous or treatment - induced viral elimination from sera, but the relevance of this phenomenon is still unknown . It has been documented recently that pbmcs originated from the healthy human population express functional 1 and 3 subunits of the gaba a receptor . The aim of the current study was to investigate whether the comparable expression of gaba a subunits can be observed in pbmcs from chronic hepatitis c (chc) patients that have undergone anti - hcv treatment . Consequently, not only did we succeed to show 1 and 3 expression in pbmcs from hcv - infected patients, but our results also demonstrated the substantial differences in 3 and, less manifested, in 1 subunits expression in pbmcs between healthy donors and post - treatment hcv patients . We then speculate on how the alterations in the expression of gaba a subunits may be of special importance for hcv rna persistence . Blood samples were collected, after the informed consent had been obtained, from ten healthy donors (6 males, 4 females: age 1826 years) and from 22 chronically infected with hcv patients (12 males, 10 females: age 1622 years) within 2 weeks after the cessation of antiviral treatment (ifn alfa2b + ribavirin). Neither patients nor healthy controls were taking medication known to alter gaba a receptor expression or activity . Pbmcs and sera were isolated by blood centrifugation in density gradient (histopaque 1077, sigma). Total rna was extracted from pbmcs by a modified guanidinium thiocyanate / phenol / chloroform technique . Hcv rna presence in sera was determined by reverse transcription polymerase chain reaction (rt - pcr) (cobas, amplicor hcv 2.0 monitor, roche). Briefly, 6 g of total rna were reverse - transcribed and amplified by masteramp tth dna polymerases (epicentre biotechnologies) with external hcv - specific primers (table 1) in a reaction as follows: 20 min of rt at 70c and 3 min at 94c, followed by 35 cycles of 94c for 20s, 50c for 20s, 72c for 20s, and 72c for 7 min . The resultant amplicon was used in the second - round pcr (2 min at 94c, 30 cycles of 94c for 40s, 55c for 40s, 72c for 40s, and 72c for 10 min). After pa gel electrophoresis, an hcv - specific product of 278 bp was visualized with ethidium bromide staining.table 1list and sequences of primers used in the reverse transcription polymerase chain reaction (rt - pcr) analysis and size of pcr productsspecificity of primerspcr product (bp)sequence of forward and reverse primershcv rna (external)321f: ccaccatgaatcactcccctgtr: gctcatggtgcacggtctacgagaccthcv rna (internal)278f: gtcttcacgcagaaagcgtctagccr: cactcgcaagcaccctatcaggcaggaba a 1(external)241f: cggtcaattttgctgacactr: ggttatgcatgggatggcgaba a 1(internal)95f: gacctctttaaggttctatggr: gctccaacagcaaccagcgaba a 3 (external)319f: cacatcggttagatcaggr: caaggcaaagaatgaccggaba a 3 (internal)110f: cgctggaagttcacaatgr: cgaggcatgctctgtttc-actin434f: caaagacctgtacgccaacacar: aaccgactgctgtcaccttcac list and sequences of primers used in the reverse transcription polymerase chain reaction (rt - pcr) analysis and size of pcr products for the detection of mrnas specific for gaba a receptor subunits 1 and 3, random cdna was synthesized according to the manufacturer s instructions by using the transcription high fidelity cdna synthesis kit (roche diagnostics, mannheim, germany) and then amplified in nested pcr assays (each of 35 cycles) were performed as follows: 5 min of preliminary heating at 94c, 94c for 40s, 50c (for gaba a 1/3)/55c (for actin) for 40s, 72c for 40s, and 72c for 10 min . Pcr 1- and 3-specific products of 95 bp and 110 bp, respectively, were analyzed as described above . Protein lysates (20 g / lane) were separated on 10% sds - pa gel . Resolved proteins were electroblotted into nitrocellulose and incubated with gaba a 1, 52 kda (gtx 30204, dilution 1:12,000) and 3, 55 kda (gtx 261302, dilution 1:2,000) specific antibodies purchased from gene tex, inc . The reactions with the goat antibodies against -actin, 43 kda (sc-1615, santa cruz biotechnology) were carried out at the dilution of 1 to 300 . The bound antibodies were visualized using the enhanced chemiluminescence (ecl) western blotting reagent (sc-2048, santa cruz biotechnology) with signals captured on film . In order to quantify the density of signals, the bio - rad quantity one system was used . To estimate the comparative levels of gaba a 1 and 3 subunits expression, all immunoreactivities were normalized to -actin expression before statistical analysis . Cells were collected from healthy donors and chc patients who had undergone antiviral treatment . According to the hcv rna status in sera and in pbmcs, three subgroups of patients were distinguished: 0/0 with sera and pbmcs free from hcv rna (n = 10); 0/1 with sera negative for hcv rna, but with hcv rna - positive pbmcs (n = 6); and the 1/1 group, where sera and pbmc samples contained hcv rna (n = 6). To analyze the gene expression of gaba a receptor subunits 1 and 3, pcr amplification produced single 1- and 3-specific pcr products, of 95 and 110 bp, respectively . Our results showed that all pbmc samples contained mrna specific for the 1 and 3 subunits of gaba a receptor . The expression of -actin was used as the endogenous control of gene expression . As shown in fig . 1, the gene expression of gaba a receptor subunits differs among pbmc samples, even among the same group . No significant differences were found in gene expression level for either 1 or 3 between groups . We could only observe that 3 gene expression showed a margin tendency to be elevated in pbmcs from healthy donors in comparison to the hcv - infected patients . In contrast, the gene expression of 1 subunit in pbmcs tends to be slightly higher in the group of chc patients compared to the healthy controls.fig . 1gamma - aminobutyric acid type a (gaba a) receptor, 1 and 3 genes expression in peripheral blood mononuclear cells (pbmcs). The figure shows several examples of the results obtained by reverse transcription polymerase chain reaction (rt - pcr) analysis performed in the groups as follows: a healthy donors (hd) and (b d) anti - hepatitis c virus (hcv)-treated chronic hepatitis c (chc) patients, who: b eliminated hcv rna from both sera and pbmcs (0/0), c only from sera (0/1), or d neither from sera nor from pbmcs (1/1). As a control of gene expression, the analysis of -actin was performed gamma - aminobutyric acid type a (gaba a) receptor, 1 and 3 genes expression in peripheral blood mononuclear cells (pbmcs). The figure shows several examples of the results obtained by reverse transcription polymerase chain reaction (rt - pcr) analysis performed in the groups as follows: a healthy donors (hd) and (b d) anti - hepatitis c virus (hcv)-treated chronic hepatitis c (chc) patients, who: b eliminated hcv rna from both sera and pbmcs (0/0), c only from sera (0/1), or d neither from sera nor from pbmcs (1/1). As a control of gene expression, the analysis of -actin was performed the presence of the protein expression of gaba a 1 and 3 subunits was confirmed using western blot in all of the tested pbmc samples . Figure 2 shows several examples of western blot analysis performed on lysates obtained from the pbmcs of healthy donors and chc patients . The quantitative immunoblotting based on a density analysis, described in the materials and methods section, was utilized in order to determine the possible differences in the gaba a 1 and 3 subunits expression between pbmc samples . As indicated in fig . 3a, the gaba a 1 protein expression was somewhat higher (p = 0.047) in the group of anti - hcv - treated chc patients than in the group of healthy controls . However, no statistical differences were found between individual subgroups of patients.fig . 2expression of 1 and 3 subunits of the gaba a receptor in pbmcs as revealed by western blot analysis . Representative images of western blot analysis come from groups as follows: a healthy donors (hd) and (b d) anti - hcv - treated chc patients, who: b eliminated hcv rna from both sera and pbmcs (0/0), c only from sera (0/1), or d neither from sera nor from pbmcs (1/1). 3differences in gaba a 1 and 3 subunits expression in pbmcs evaluated by western blot analysis . The results are shown after normalization to the -actin expression . A relative expression level of gaba a 1 protein in pbmcs from healthy donors and from post - treatment chc patients . B relative expression level of gaba a 3 protein expression in pbmcs from healthy donors and three groups of anti - hcv - treated chc patients (0/0, 0/1, 1/1) expression of 1 and 3 subunits of the gaba a receptor in pbmcs as revealed by western blot analysis . Representative images of western blot analysis come from groups as follows: a healthy donors (hd) and (b d) anti - hcv - treated chc patients, who: b eliminated hcv rna from both sera and pbmcs (0/0), c only from sera (0/1), or d neither from sera nor from pbmcs (1/1). The analysis of -actin was performed as a control of gene expression differences in gaba a 1 and 3 subunits expression in pbmcs evaluated by western blot analysis . The results are shown after normalization to the -actin expression . A relative expression level of gaba a 1 protein in pbmcs from healthy donors and from post - treatment chc patients . B relative expression level of gaba a 3 protein expression in pbmcs from healthy donors and three groups of anti - hcv - treated chc patients (0/0, 0/1, 1/1) an opposite relation was found for the expression of 3 subunit . In pbmcs from anti - hcv - treated chc patients, the 3 protein showed decreased levels in comparison to the group of healthy donors . As presented in fig.3b, significant differences (p = 0.0038) in the 3 expression among healthy donors and the three subgroups of chc patients were observed as a result of the 3 expression analysis . The lowest expression level of 3 protein, compared to the healthy donors, was observed in pbmcs from patients, who, despite the antiviral treatment, have retained hcv rna in both sera and pbmcs (p = 0.00047). Cells were collected from healthy donors and chc patients who had undergone antiviral treatment . According to the hcv rna status in sera and in pbmcs, three subgroups of patients were distinguished: 0/0 with sera and pbmcs free from hcv rna (n = 10); 0/1 with sera negative for hcv rna, but with hcv rna - positive pbmcs (n = 6); and the 1/1 group, where sera and pbmc samples contained hcv rna (n = 6). To analyze the gene expression of gaba a receptor subunits 1 and 3, pcr amplification produced single 1- and 3-specific pcr products, of 95 and 110 bp, respectively . Our results showed that all pbmc samples contained mrna specific for the 1 and 3 subunits of gaba a receptor . The expression of -actin was used as the endogenous control of gene expression . As shown in fig . 1, the gene expression of gaba a receptor subunits differs among pbmc samples, even among the same group . No significant differences were found in gene expression level for either 1 or 3 between groups . We could only observe that 3 gene expression showed a margin tendency to be elevated in pbmcs from healthy donors in comparison to the hcv - infected patients . In contrast, the gene expression of 1 subunit in pbmcs tends to be slightly higher in the group of chc patients compared to the healthy controls.fig . 1gamma - aminobutyric acid type a (gaba a) receptor, 1 and 3 genes expression in peripheral blood mononuclear cells (pbmcs). The figure shows several examples of the results obtained by reverse transcription polymerase chain reaction (rt - pcr) analysis performed in the groups as follows: a healthy donors (hd) and (b d) anti - hepatitis c virus (hcv)-treated chronic hepatitis c (chc) patients, who: b eliminated hcv rna from both sera and pbmcs (0/0), c only from sera (0/1), or d neither from sera nor from pbmcs (1/1). As a control of gene expression, the analysis of -actin was performed gamma - aminobutyric acid type a (gaba a) receptor, 1 and 3 genes expression in peripheral blood mononuclear cells (pbmcs). The figure shows several examples of the results obtained by reverse transcription polymerase chain reaction (rt - pcr) analysis performed in the groups as follows: a healthy donors (hd) and (b d) anti - hepatitis c virus (hcv)-treated chronic hepatitis c (chc) patients, who: b eliminated hcv rna from both sera and pbmcs (0/0), c only from sera (0/1), or d neither from sera nor from pbmcs (1/1). As a control of gene expression, the presence of the protein expression of gaba a 1 and 3 subunits was confirmed using western blot in all of the tested pbmc samples . Figure 2 shows several examples of western blot analysis performed on lysates obtained from the pbmcs of healthy donors and chc patients . The quantitative immunoblotting based on a density analysis, described in the materials and methods section, was utilized in order to determine the possible differences in the gaba a 1 and 3 subunits expression between pbmc samples . As indicated in fig . 3a, the gaba a 1 protein expression was somewhat higher (p = 0.047) in the group of anti - hcv - treated chc patients than in the group of healthy controls . 2expression of 1 and 3 subunits of the gaba a receptor in pbmcs as revealed by western blot analysis . Representative images of western blot analysis come from groups as follows: a healthy donors (hd) and (b d) anti - hcv - treated chc patients, who: b eliminated hcv rna from both sera and pbmcs (0/0), c only from sera (0/1), or d neither from sera nor from pbmcs (1/1). 3differences in gaba a 1 and 3 subunits expression in pbmcs evaluated by western blot analysis . The results are shown after normalization to the -actin expression . A relative expression level of gaba a 1 protein in pbmcs from healthy donors and from post - treatment chc patients . B relative expression level of gaba a 3 protein expression in pbmcs from healthy donors and three groups of anti - hcv - treated chc patients (0/0, 0/1, 1/1) expression of 1 and 3 subunits of the gaba a receptor in pbmcs as revealed by western blot analysis . Representative images of western blot analysis come from groups as follows: a healthy donors (hd) and (b d) anti - hcv - treated chc patients, who: b eliminated hcv rna from both sera and pbmcs (0/0), c only from sera (0/1), or d neither from sera nor from pbmcs (1/1). The analysis of -actin was performed as a control of gene expression differences in gaba a 1 and 3 subunits expression in pbmcs evaluated by western blot analysis . The results are shown after normalization to the -actin expression . A relative expression level of gaba a 1 protein in pbmcs from healthy donors and from post - treatment chc patients . B relative expression level of gaba a 3 protein expression in pbmcs from healthy donors and three groups of anti - hcv - treated chc patients (0/0, 0/1, 1/1) an opposite relation was found for the expression of 3 subunit . In pbmcs from anti - hcv - treated chc patients, the 3 protein showed decreased levels in comparison to the group of healthy donors . As presented in fig.3b, significant differences (p = 0.0038) in the 3 expression among healthy donors and the three subgroups of chc patients were observed as a result of the 3 expression analysis . The lowest expression level of 3 protein, compared to the healthy donors, was observed in pbmcs from patients, who, despite the antiviral treatment, have retained hcv rna in both sera and pbmcs (p = 0.00047). Several studies have revealed the contribution of a variety of host factors to the development of hcv rna persistence in chronically infected patients, despite having used antiviral treatment [13, 16, 17]. Our study was designed to evaluate whether the expression of chosen subunits of gaba a receptors in pbmcs bears any relation to hcv infection and/or the path of hcv rna elimination after anti - viral treatment . Studies that were carried out on other viruses like herpes simplex virus (hsv) and human immunodeficiency virus (hiv) indicated that the expression of gaba a receptor on the target cells could be modulated upon the viral infection [18, 19]. Although gaba a receptors tend to exist as a pentameric structure consisting of six major gaba a receptor subunits, we decided to screen the expression of two of them: 1 and 3 . This choice was grounded on alam et al.s study that confirmed the significant content of the 1 subunit in pbmcs and fractionated t - cell populations . The evaluation of 3 expression, despite the lower abundance of this subunit in pbmcs, seemed interesting due to the confirmed impact on a proliferative activity of other cells [20, 21]. If governing the hcv infection indeed plays any role in the gaba a receptor activity, the modulation of their expression would be an expected phenomenon . To address this issue, we analyzed the 1 and 3 gaba a expression in pbmcs using nested pcr and quantitative immunoblotting . Our results showed, for the first time, that the expression of the 1 and 3 subunits of the gaba a receptor is common not only for healthy donors (15), but also for anti - hcv - treated patients . Moreover, the expression of these subunits at the protein level displayed differences between healthy donors and chc patients . A marginally significant elevation of 1 gaba a in pbmcs was demonstrated for anti - hcv - treated patients when compared with healthy donors . It seems interesting that the expression of 1 gaba a receptor subunit is detectable in the majority of pbmcs subtypes, such as: t - cells, b - cells, and monocytes, in other words, in cells that are also able to maintain hcv during chronic infection . Taking into account that the increased expression of these receptors in t - cells downregulates the effector t - cell response [23, 24] and that the defective function of hcv - specific t - cells contribute to the chronicity of infection [2527], we can hypothesize that gaba a activation may contribute to the impaired response to the hcv infection . In contrast, the majority of pbmcs from the anti - hcv - treated patients represented significantly lower expression of the 3 subunit of the gaba a receptor than the healthy donors pbmcs . Thus, also in case of the 3 subunit, expression measured at the protein level does not reflect precisely the gene expression level . This type of discrepancy, probably connected with the post - transcriptional regulation, was observed for gaba a receptor expression previously . The lowest level of gaba a 3 receptor expression was observed in these pbmcs, where hcv rna presence in cells was accompanied by the hcv rna positivity of sera . As was demonstrated, the transfection of hepatoma cells with 3-specific cdna resulted in a significant decrease of cell proliferation . Similarly, an increased gaba a 3 receptor expression was found to act as an inhibitory signal for hepatic cell proliferation, whereas the downregulation of the gaba a 3 receptor expression was observed in malignant hepatocyte cell lines . Although less is known about the role of 3 subunit expression of the gaba a receptor in pbmcs, we can hypothesize that, like in the case of hepatic cells, the decreased expression of gaba a 3 receptor in pbmcs may alter the proliferative activity of these cells . Since hcv - infected cells present enhanced proliferation in comparison to non - infected cells [30, 31], this process appears to play an important role in hcv rna replication . On the other hand, it was previously demonstrated that the drug - dependent inhibition of gaba a receptors expression does not alter hcv load, which may suggest that, rather, hcv infection is responsible for inducing such changes in gaba a expression that favor hcv propagation in target cells . In conclusion, the current study provides evidence for the 1 and 3 expression in pbmcs from hcv - infected patients . Decreased gaba a 3 expression, which is observed in hcv rna - positive pbmcs, future studies should elucidate whether the alteration of gaba a expression, which is observed during chc infection, has an impact on the development of hepatocellular carcinoma.
Onchocerciasis is the second leading infectious cause of blindness in the world, after trachoma . For centuries black fly, the disease is prevalent in 19 african countries, and endemic in now just six american foci . In total, 37 million people are thought to have active disease, with nearly all such cases in africa where over 100 million people live at risk of new infection . This old world disease originated in africa and spread to new world via the slave trade, where it formerly existed in 13 discrete geographic foci within latin america . Over 500,000 individuals live with a significant visual impairment from the disease, with an additional 270,000 individuals who have suffered from complete vision loss . The simulian vector is infected when biting infected humans, and after maturation of larva within the fly, can then re - infect others during subsequent blood - meals . These flies breed within and live around fast - flowing rivers (hence the name river - blindness), and generally only persons living in and around these areas are at risk for infection after repeated biting . Transmission efficiency of most simulian species is quite low relative to other diseases (e.g., anopheles mosquito with malaria), although variable between regions, such that travelers are generally not at risk for this infection unless living long - term in endemic areas . Once deposited within the skin, infective stage larvas maturate and trigger the development of fibrous subcutaneous nodule in which they will mate and reproduce . Annually, female adult worms can release hundreds of thousands of microfilariae (mf) that migrate freely through skin with the potential for reaching and invading the eye . In the skin, mf cause pruritis and dermatitis, and eventually can lead to skin atrophy and discoloration (leopard skin). In the eye the ocular pathology of this disease occurs in both anterior and posterior segments of the eye . Anteriorly, mf travel through scleral and subconjunctival tissues to reach the cornea whereby they attempt to penetrate and migrate through the cornea . Within the corneal stroma, bacteria, an intracellular, rickettsia - like bacteria that lives symbiotically with mf and adult onchocerca worms . Interestingly, these organisms are extremely important to the lifecycle and reproduction of onchocerca, and without them, female adult worms cannot reproduce . Within the cornea, as with other tissues, release of wolbachia elicits an immune response and inflammation . This process clinically appears in the cornea as a punctate keratitis (pk), lesions that gradually resolve over 23 months as the mf are degraded by immune cells . The prevalence of pk has served as the cornerstone for evaluating the progress of mass ivermectin therapy during recent elimination campaigns in the americas . Repeated mf - associated corneal insults eventually lead to sclerosing keratitis (opacification and scarring of the cornea), a major cause of onchocercal - related visual loss . A large proportion of visual morbidity and blindness caused by this disease, however, is due to posterior pole lesions that persist even after ivermectin therapy. [1416] in the posterior segment of the eye, mf invade retinal tissues causing chronic chorioretinitis, inflammation, scarring, and in some cases optic atrophy and glaucoma . It is likely that dying mf in these tissues trigger an inflammatory response there, one that is potentially promoted by cross reactivity between o. volvulus antigen (ov39) and human retinal pathogen (hr44) found in the optic nerve and neural epithelial layers of the retina. [1719] interestingly, onchocercal chorioretinitis continues despite ivermectin therapy and extermination of the parasite from the eye, potentially as a result of an autoimmune response provoked by the parasite . Diagnosing onchocerciasis relies on demonstration of characteristic eye pathology (visible mf in the cornea or anterior chamber) or demonstration of mf within the skin . On the individual level, visible mf in the anterior segment are specific to onchocerciasis; however, it is often difficult to observe mf in the anterior chamber, and punctuate keratitis lesions are fleeting and can be nonspecific for onchocerciasis if the degraded mf is not visible within the lesion . At lower levels of microfiladermia, skin - snips, a superficial (dermal) biopsy of 13 mg, examined microscopically for mf are invasive and suffer from poor sensitivity in patients with low levels of microfiladermia . Pcr examination of skin snips improves this situation, although sensitivity is still low in such persons, making this tool less useful in endemic areas where ivermectin has been used to treat this disease for years . Skin patch testing with diethylcarbamazine (dec) has been shown as a good alternative to skin snip evaluations in africa . This test relies upon dec killing of mf within the dermis and subsequent provocation of a hypersensitivity reaction (i.e., localized mazzoti reaction). Advantages over skin snip evaluation (noninvasive, better patient acceptance), although can be operationally difficult (patches can fall off, patients must return in 24 h for test reading). The sensitivity and specificity of the dec patch test is not yet clear, although recent studies using newer formulations suggest its utility in monitoring for infection within mass onchocerciasis treatment programs in africa . Serologic antibody tests using recombinant antigens, such as the ov-16, can be useful, but cannot distinguish between past and active infection. [2629] in addition, the sensitivity of this assay is questionable, with at least one study showing that a large percentage of those with active eye disease living in endemic areas have negative ov-16 results . A highly specific antigen detection test capable of diagnosing active infection has been reported in the literature, but to date, has received little evaluation . The development of a highly specific and sensitive test capable of determining active onchocercal infection remains an imperative for public health campaigns seeking to control and eliminate this parasite . The development of a safe and effective macrofilaricidal drug has been long sought for this disease . For years, ivermectin, a macrocyclic lactone, has been the mainstay of therapy; however, ivermectin kills only the mf . In effect, ivermectin serves as a birth control device for adult worms, in that female worms are temporarily sterilized for an average of 6 months, preventing the release of mf during that time . Consequently, periodic single dose oral treatment prevents the onset of new ocular and dermal lesions and reduces transmission as the vector is less exposed to mf during its feeding on human skin . Ocular barrier, thus avoiding intraocular killing of mf and subsequent intraocular damage due to inflammation . However, new therapies targeting the endosymbiotic wolbachia within the adult worms have now been proven to be effective in causing long - term (and potentially permanent) sterilization of adult worms and early worm death . Doxycycline treatment (100mg / day) for 6 weeks with a single dose of ivermectin has become the treatment of choice for individuals based on recent clinical trial data, although 4 week courses of doxycycline or rifampin are also effective [table 1]. From a public health perspective, however, the mass treatment of affected populations with doxycycline is difficult given the length of necessary therapy and the potential for re - infection in endemic areas . However, these therapies may be of particular use in areas of co - endemicity with loiasis where mass distribution of ivermectin is complicated by potential adverse events in patients co - infected with loiasis . Studies evaluating the efficacy of antibiotic therapy directed at onchocercal endosymbiotic wolbachia bacteria the development of a safe and effective macrofilaricidal drug has been long sought for this disease . For years, ivermectin, a macrocyclic lactone, has been the mainstay of therapy; however, ivermectin kills only the mf . In effect, ivermectin serves as a birth control device for adult worms, in that female worms are temporarily sterilized for an average of 6 months, preventing the release of mf during that time . Consequently, periodic single dose oral treatment prevents the onset of new ocular and dermal lesions and reduces transmission as the vector is less exposed to mf during its feeding on human skin . Ocular barrier, thus avoiding intraocular killing of mf and subsequent intraocular damage due to inflammation . However, new therapies targeting the endosymbiotic wolbachia within the adult worms have now been proven to be effective in causing long - term (and potentially permanent) sterilization of adult worms and early worm death . Doxycycline treatment (100mg / day) for 6 weeks with a single dose of ivermectin has become the treatment of choice for individuals based on recent clinical trial data, although 4 week courses of doxycycline or rifampin are also effective [table 1]. From a public health perspective, however, the mass treatment of affected populations with doxycycline is difficult given the length of necessary therapy and the potential for re - infection in endemic areas . However, these therapies may be of particular use in areas of co - endemicity with loiasis where mass distribution of ivermectin is complicated by potential adverse events in patients co - infected with loiasis . Two large public health campaigns currently operate worldwide with goals of either elimination or control of this parasite . The cornerstone of these campaigns is the mass distribution of ivermectin, delivered semi - annually or annually, and donated in perpetuity for this cause by merck . When ivermectin is delivered as such in the long - term, sustained fashion to large percentages of at risk populations (e.g.,> 85% is the goal in latin america), dermal mf levels fall such that new eye lesions and transmission are prevented . The african programme for onchocerciasis control (apoc) currently strives to eliminate onchocerciasis as a public health concern by delivering ivermectin to populations where dermal mf prevalence of 40% . Recent studies in mali and senegal indicate a tremendous reduction in microfilaridermia and a profound reduction in the prevalence of black fly infection indicating that elimination is feasible in at least some african foci . In the americas, the onchocerciasis elimination program for the americas (oepa) strives to completely eliminate the disease by treating 85% of at risk persons with ivermectin every 6 months . As of 2010, 7 of the 13 endemic foci have been declared free of onchocerciasis, treatment with ivermectin therapy has stopped, and surveillance for disease recrudescence will continue for 3 years prior to a declaration of disease elimination in these foci . Currently, active eye disease only exists within several foci within venezuela and brazil, where treatment coverage has been more recently increased and it is anticipated that elimination of eye disease in these areas will follow in subsequent years . As anti - wolbachia therapy has been shown to be effective in clinical trials, its optimal use within these public health campaigns is not yet clear . Within latin america, conceivably, anti - wolbachia therapy could be used in limited circumstances either to mop - up or catch - up in regions that continue to have active disease or where ivermectin coverage has been less than complete . As elimination with ivermectin looms near in latin america, however, it is not clear that such alternative therapies will ever be needed . Within africa, at least one large scale community directed treatment program using doxycycline has been reported . As with latin america, a role for mass doxycycline therapy there has not yet been clearly defined, and might differ by region based on vector competence, parasite pathogenicity, public health capacity, and the ability to deliver 46 weeks of such therapy in mass fashion . Lastly, anti - wolbachia would theoretically become very important in either region should the parasite develop resistance to ivermectin . Although ivermectin resistance has not definitively been reported, it remains a concern and anti - wolbachia therapy offers an alternative should such an event occur . In latin america, oepa has declared the year 2015 as a goal for the final year of mass treatment with ivermectin for onchocerciasis, and in africa great reductions in disease have been documented with mass ivermectin therapy . Although current progress with these mass ivermectin drug campaigns is encouraging, improved diagnostics and further development and evaluation of anti - wolbachia and other drug therapies will improve the chances that these large regional public health initiatives will achieve long - term success.
Knowledge of the anatomy of root canal systems is an essential prerequisite for endodontic treatment . Many of the problems encountered during and after root canal treatment occur because of inadequate understanding of the pulp space anatomy . Studies on the internal and external anatomy of teeth have shown that anatomic variations can occur in all groups of teeth and can be extremely complex . This applies to mandibular incisor teeth as well, as many dentists fail to recognize the presence of a second canal . Current knowledge of pulp space anatomy is based on research findings and individual case reports . There is a lack of consistency in the reported prevalence of second canals in mandibular incisors. [15] the differences may be related to study design (in vivo versus ex vivo), technique of canal identification (radiographic examination, sectioning and clearing) or to racial divergence . It is important to be familiar with variations in tooth anatomy and characteristic features in various racial groups, since such knowledge can aid location and negotiation of canals, as well as their subsequent management . Additionally, a number of studies have shown different trends in shape and number of roots and canals amongst the different races. [1368] these variations appear to be genetically determined and are important in tracing the racial origins of populations . Descriptions of the frequently occurring root canal systems of permanent teeth are based largely on studies conducted in europe and north america, and relate to teeth of mainly caucasian origin . These descriptions may not be fully applicable to teeth of non- caucasian origin . There are no published reports on the root canal anatomy of mandibular incisors in north east indian population . However, some studies have examined an indian population . The north - eastern population in india is mostly comprised of indo - aryans (caucasoid) mongoloids (tibeto - burman and paleo - mangoloid sub race) and dravidian sub populations . The population of north - east india is nearly 38 million, out of which tribal mongoloid population accounts for almost 42 - 45% of the total population . A total of five hundred and thirty six extracted mandibular incisors were randomly collected from general dental clinics within north - eastern india.out of the collected teeth, fifty six teeth were excluded because of immature or resorbed apices and four hundred and eighty teeth were selected for the present study . The gender and age of patients was not known, and no attempt was made to differentiate between central and lateral incisors . The samples were stored in 5.25% sodium hypochlorite (organo bio tech laboratories pvt ltd new delhi, india) for 30 minutes for the removal of organic debris, and then in 10% formaldehyde until use . The teeth were cleaned under running water, access cavities were prepared and the coronal pulp tissue extirpated in the canal orifices . The samples were stored in 5% nitric acid solution (aries laboratories, india) for 5 days . Demineralization was assessed by the insertion of a paper pin in the crown and with the help of radiographs . The samples were then rinsed under running water for 4 hours and placed in 70, 80 and 95% ethyl alcohol successively, for 1 day . At the end of this period, the clearing procedure was completed by placing the samples in methyl salicylate (regent chemicals, mumbai)). At the end of the third day, complete transparency was achieved . India ink (united ink and varnishes pvt ltd, mumbai, india) was injected into the root canals of the transparent teeth using syringes with 27 gauge needle (shree uniya surgical, india). After the ink had dried, root canal morphology was examined by a magnifying glass of 5x magnification [figure 1], and the following observations were made: transparent specimen showing canal bifurcation number and type of root canals, presence and location of lateral canals and intercanal communications, location of apical foramina, andbifurcation of canals.canals were categorized into the first five types of vertucci's classification as follows: type i: a single canal is present from the pulp chamber to the apex.type ii: two separate canals leave the pulp chamber, but join to form one canal to the site of exiting.type iii: one canal leaves the pulp chamber, divides into two within the root, and then merges to exit in one canal.type iv: two separate and distinct canals are present from the pulp chamber to the apex.type v: single canal leaving the pulp chamber but dividing into two separate canals with two separate apical foramina . Number and type of root canals, presence and location of lateral canals and intercanal communications, location of apical foramina, and bifurcation of canals . Canals were categorized into the first five types of vertucci's classification as follows: type i: a single canal is present from the pulp chamber to the apex.type ii: two separate canals leave the pulp chamber, but join to form one canal to the site of exiting.type iii: one canal leaves the pulp chamber, divides into two within the root, and then merges to exit in one canal.type iv: two separate and distinct canals are present from the pulp chamber to the apex.type v: single canal leaving the pulp chamber but dividing into two separate canals with two separate apical foramina . Type i: a single canal is present from the pulp chamber to the apex . Type ii: two separate canals leave the pulp chamber, but join to form one canal to the site of exiting . Type iii: one canal leaves the pulp chamber, divides into two within the root, and then merges to exit in one canal . Type iv: two separate and distinct canals are present from the pulp chamber to the apex . Type v: single canal leaving the pulp chamber but dividing into two separate canals with two separate apical foramina . Results of this investigation indicate that one third of the teeth exhibit two canal system (36%). Of the teeth with two canals, type iii configuration was most common followed by type ii and type v [figure 2]. Although two canals were found in 36% of teeth, only 6.25% of canals exited in two separate foramina (type v) [table 1]. Out of all the canals showing two canal configuration, around 83% joined and exited in single foramen (type ii and iii) and remaining 17% exited in two separate foramina (type v) [table 1].the apical foramen was found to coincide with the apical root tip in 47.2% of teeth [table 2]. In the present study, lateral canals were observed in around 13% of the cases [figure 3] [table 3]. Anastomosis were found only in type iii canals which accounts for 2.5% of all the teeth [table 4]. Apical ramifications were seen in around 7.42% of the teeth, out of which 75.7% were with two rami, 24.3%with three rami, and none with four rami [table 4] [figure 4]. In teeth with two canals, bifurcations were seen maximum in middle third (64%) followed by in cervical third 23.3% and in apical third 1.25% [table 5]. Intercanal communications were observed in 28.4% of all teeth and in 70.2% of teeth with two canals [table 6]. Canal configuration (from left to right) types i, ii, iii and v number and percentage of canal system types in mandibular incisors (n=480) in the study distribution of apical foramen in mandibular incisors (n=480) in the study curvatures in type i canal configurations- straight, s shaped and j shaped distribution of lateral canals in mandibular incisors in the study distribution of apical ramification in mandibular incisors in the study type i variations- apical ramification, reticular structure and lateral canals distribution of position of canal bifurcation in mandibular incisors in the study distribution of intercanal communications in mandibular incisors in the study various methods have been used to study root canal morphology including radiographic examination, root sectioning, staining and clearing techniques, direct observation with microscope, sectioning and macroscopic observation, stereo microscope, spiral computed tomography, and cone beam computed tomography . Vertucci used the clearing technique to study the root canal morphology of extracted mandibular anterior teeth . It has been reported that fine details of the root canal system can be visualized by staining and clearing[figure 1]. This technique also makes canal negotiation with instruments unnecessary, thereby maintaining the original form and relation of canals, and provides a three - dimensional view of root canal . The process of changing the tooth into a transparent object involves many physical and chemical changes . The inorganic constituents of the tooth are first dissolved by decalcification, and further water, air, and lipid components are removed by dehydration and by subsequent immersion in the clearing agents, th and this method was used in the present study as well . The literature on mandibular incisors reveals that 1168% of mandibular incisors possess two canals, although in many of these cases, the canals merge into one in the apical 13 mm of the root . Vertucci examined the root canal morphology of 300 mandibular anterior teeth and reported a second canal in 27.5% of mandibular incisors . Miyashita et al ., reported that 12.4% of mandibular incisors contained two canals; however, only 3% had two foramina . Sert et al ., noted that two canals were present in 68% of mandibular central incisors . Mauger et al ., evaluated the canal morphology at different root levels in one hundred mandibular incisors, and reported that 98100% of the teeth had one canal in the area 13 mm from the apex . The differences between these morphology studies may be related to variations of examination methods, classification systems, sample sizes and ethnic background of tooth sources . In a study in jordanian population, it was found that 73.8% of the mandibular incisors possessed a single root canal, and 26.2% of teeth were with two canals . The results of the present study indicate that one third of the teeth exhibit two canal system (36%) [table 2] [figure 2]. It was found that 63.75% of mandibular incisors possessed a single root canal (type i) with straight, j and s shaped curvatures [figure 3] as well as frequent apical ramifications, lateral canals and reticular structures [figure 4]. Only 6.25% of canals exited in two separate foramina (type v). Of the teeth with two canals, type iii configuration was most common followed by type ii and type v. therefore, the frequency of two canals in the present study was within the range of previous reports . This is due to failure of the dentist to recognize the presence of the second canal, and the need for access cavities to have appropriate inciso - gingival extension to facilitate the location of lingual canals . None of the teeth were seen with type iv canal system, which may be due to smaller number of samples examined in the present study and any conclusion drawn needs to be based on study of a larger population . The apical foramen was found to coincide with the apical root tip in 47.2% of teeth [table 2]. This is higher than reported in previous studies that demonstrated that the apical foramen coincided with the anatomical apex in 1746% of cases . In the present study, total apical foramen count stands at 510 (n=480), which is because of type v canal configuration and apical ramifications this finding may be of significance in working length determination which often depends on the average position of the apical constriction relative to root apex . In the present study, lateral canals were observed in around 13% of teeth and were found most frequently in the middle of the canal [table 3] [figure 4]. Lateral canals in the apical third account for 2.94%.this is consistent with the findings of miyashita et al . ; however, much lower than that reported by vertucci . Anastomoses were found only in type iii canals which accounts for 2.5% of all the teeth . Apical ramifications were seen in around 7.42% of the teeth out of which 75.7% were with two rami, and 24.3% with three rami, and none with four rami [table 4]. In teeth with two canals, bifurcations were seen maximum in middle third (64%) followed by the cervical third 23.3%; and, the apical third 1.25% [table 5].this requires an individualized procedure for preparation and filling in each of these conditions to obtain the most desirable results . Pulp space anatomy of mandibular incisors in an indian population show high incidence of complexity which includes variations in canal configuration, number of canals and presence of isthmus . Intercanal communications were observed in 28.4% of all teeth, and in 70.2% of teeth with two canals [table 6]. The high percentage of intercanal communications in teeth with two canals may be of clinical significance, because it may be difficult to debride and fill these communications adequately . Within the limitations of the present study, it can be concluded that overall, 36% of mandibular incisors in this north - east indian population had two canals . In the teeth with two canals, the type iii canal system was the most prevalent followed by type ii.type v was the least prevalent.
According to the new report from world health organization (who) published in september 2011, cardiovascular diseases (cvds) remain the leading cause of death and disability in the world . Noncommunicable diseases accounted for more than 36 million deaths in 2008 with cvds responsible for 48% of these deaths, cancers 21%, chronic respiratory diseases 12%, and diabetes mellitus 3% . Over 80% of cvd deaths occur in low- and middle - income countries . Although, a large proportion of cvds is preventable, they continue to rise mainly because preventive measures are inadequate and it has been projected that by year 2030, almost 23.6 million people will die from cvds . Similarly, majority of cvd deaths in low income countries occur in individuals less than 60 years of age [1, 2]. Interestingly, while actions to reduce blood pressure and cholesterol are having an impact on overall cvd mortality in high - income countries, there is worsening of cvd risk profiles in most developing regions of the world . In sub - saharan africa, the prevalence of cvds has reached near epidemic proportions with sh being the main driver of cardiovascular complications . Whereas sh was said to be rare in africans in the first half of the twentieth century, it is the commonest cause of heart failure, stroke, and kidney disease from many studies in africa . This upsurge in the incidence of sh and its complications in sub - saharan africa with high burden of infectious diseases and poverty had greatly reduced the life expectancy in this part of the world . Although there are indications that sh plays a major role in cardiovascular outcomes, there is paucity of data particularly in the northeast nigeria on mortality profile of hypertension - related admissions into the medical wards, hence this study . This is a retrospective study which reviewed the frequency and outcome of hypertension - related admissions at the atbuth, bauchi north east nigeria . The hospital is a 650-bedded tertiary health care facility established in 2009 with 130 beds dedicated to medical admissions . The health facility serves as a referral centre for the residents of bauchi state with estimated population of 4.7 million (2006 nigerian population census) and neighbouring states of gombe, yobe, and adamawa . Diagnoses and management of all patients admitted into the emergency unit are usually discussed the next day at the morning review with all consultants in attendance . This is to ensure accurate diagnosis of cases and to provide quality care to the patients . Blood pressure was measured in the emergency department using a standard mercury sphygmomanometer (accoson) every 30 minutes until it was stable . Hypertension was defined as admission blood pressure of 140/90 mmhg or antihypertension medication usage . Records of all patients admitted between 1st november 2010 and 31st october 2011 were studied . Although we independently reassessed patients' diagnoses from their medical records, the final diagnosis used in this study was that of the managing consultants . This was because there was high correlation between reviewed diagnoses and the initial one by the managing team . Case files of those admitted for various complications of sh were retrieved using both nurses and medical records admission books . Necessary information was extracted from the case files and entered into a proforma designed for the study . Patients who were admitted for hypertensive heart failure, stroke, or transient ischemic attack (tia) due to sh, hypertensive nephrosclerosis and hypertensive emergencies or urgencies were included . Excluded from the study were cases with blood pressure less than 140/90 mmhg at presentation and who were not on antihypertensive medication and no documented stigmata of long standing sh . Information obtained from the case notes was patient's age and gender, complications of sh, awareness of hypertension, duration of hypertension, drug compliance, alcohol use, and cigarettes smoking . Others included patient's weight, height, body mass index, sbp, dbp, duration on admission and outcome . Total number of admissions and hypertension - related admissions were noted, and the percentage of latter was calculated . A simple frequency distribution of sh complications was generated . Student t - test was used to compare means of continuous variables while chi - square test was used to compare means of proportions . Three thousand one hundred and eight patients consisting of 1603 (51.6%) males and 1505 (48.4%) females were admitted at the medical wards of atbuth during the period of the study . Three hundred and fifty - two deaths occurred in males and 236 in females with percentage mortality being higher (p = 0.0001) in males (21%) than in females (15.7%). Of the total 3108 admissions, 735 (23.7%) were due to hypertension - related complications, with mean age of 51.9 17.5 years . Diabetes complications with sh as comorbidity were seen in 96 (3.1%) patients, peripartal cardiomyopathy in 51 (1.64%), and stroke in the young not related to sh was diagnosed in 25 (0.8%) patients . Others included dilated cardiomyopathy in 18 (0.6%) patients and coronary artery in 2 (0.06%) patients . A total of 1220 (39.3%) patients were admitted for cholera which ravaged bauchi state during the period of the study . When cholera patients were excluded from analysis three main occupations among the patients admitted included housewife (33.5%), trading (22.2%), and farming 21.4%). Although hypertension - related admissions were 23.7% of total admissions, there was an excess of mortality from sh complications (42.9%). Stroke / tia was the commonest complication of sh in the patients, and it accounted for 44.4% of cases . This was followed by hypertensive heart failure (27.8%), hypertensive emergencies (16.7%), and chronic kidney disease (11.2%). Mean sbp and dbp were 167.4 18.2 and 98.6 13.5 at presentation . Although 498 (67.8%) patients were aware of their sh status at presentation, only 269 (36.4%) were compliant with their antihypertensive medications . Comparison of baseline characteristics of survivors and nonsurvivors of sh admissions is presented in table 2 . Nonsurvivors were older (p = 0.001) and had longer duration of hypertension (p = 0.041) and higher body mass index than survivors . Similarly, pulse rate, sbp, and dbp were significantly higher in nonsurvivors than survivors (p = 0.001, 0.001 and 0.001, resp . ). The mean duration of hospital stay was significantly shorter in nonsurvivors (6.6 7.8 days) in comparison to survivors (11.7 13.6 days), p = 0.001 . The percentages for awareness of sh, compliance with antihypertensive medications, alcohol use, and cigarette smoking were similar between survivors and non - survivors . Stroke had the highest mortality (39.3%), followed by chronic kidney disease (36.6%) hypertensive emergencies (30.9%) and hypertensive heart failure had the lowest intrahospital mortality (27.5%). While duration of sh and pulse rate at presentation was higher in males than in females, the mean body mass index was higher in females . On the other hand, mean age, duration on admission, sbp, and dbp were similar between the two groups . Although mortality profile due to stroke, hypertensive heart failure, and chronic kidney disease as well as hypertensive emergencies was higher in males than females, the differences did not reach statistical significance . The probability of death increased with age (odds ratio = 1.024, p = 0.02), pulse rate at admission (odds ratio = 1.02, p = 0.001), and duration on admission (odds ratio = 0.957, p = 0.002). The findings from this study showed that hypertension - related admissions accounted for sizeable proportion (23.7%) of medical admissions among adult patients from a tertiary health institution in northeastern nigeria . This result is comparable to 20.2% from another tertiary hospital in southsouth and 18.4% from southeastern nigeria . Similarly ndjeka et al . Reported 19% from a rural hospital in south africa . Interestingly, when cases of acute cholera admissions were excluded from the data because cholera was epidemic during the study period, the proportion of hypertension - related admissions rose to 38.9% . The three commonest complications of sh were stroke (44.4%), hypertensive heart failure (27.8%), and hypertensive emergencies (16.7%), respectively . Although hypertension - related complications accounted for 23.7% of medical admissions, mortality related to this condition was 42.9% . This mortality profile is high and may be a reflection of severity of sh complications in the patients . Casefatality of hypertensive - related admissions was 34.3%, and this was significantly influenced by age, duration of sh, body mass index, and admission pulse rate . Factors that were predictive of mortality in this study were patients' age, admission pulse rate, and duration of admission . Some of these factors have also been identified in a study among congolese . The overall mean length of hospital stay was 10.1 12.7 days (median 7 days). Non - survivors had a median duration of 4 days at death compared to survivors with median stay of 8 days, and most deaths occurred within the first week of admission . Mean duration of hospital stay has been documented in some studies to be associated with mortality . One important finding of this study is the fact that two - thirds of the patients had been diagnosed as being sh prior to admission . Among those who were aware of their sh status, drug compliance rate was 54% this proportion is similar to what had been reported in other studies in africa [11, 13] and may be one of the reasons for high mortality in the region . High level of illiteracy along with poverty and side effects of medications was among several reasons given for poor compliance . Unlike the study from congo where death was associated with younger age, report of this study showed that hypertension - related death was more in older people . The tendency of older people having more cardiovascular comorbid conditions could partly explain this observation . High pulse rate was another factor that predicted risk of death from complication of sh in this study . Several published data have demonstrated a positive association between pulse rate and all - cause mortality in hypertensive individuals [14, 15]. This has an important implication for choice of medication especially in the presence of complications . Although smoking and alcohol abuse had been associated with poor outcomes in hypertensive patients, findings from this study did not show any significant difference amongst survivors and non - survivor in this regard . In europe and america, hypertensive cardiovascular complications are commonly seen in older age group [16, 17]; however, relatively younger individuals were affected in our study . Majority of our patients were not covered by the national health insurance scheme which has just started in nigeria and thus had to pay for drugs and services at the point of care which increase out - of - pocket expenses . In addition, a sizeable number of our patients were housewives and students with little or no sources of income . These reduce their financial capability to purchase antihypertensive medications and compliance with their treatment . Stroke was the commonest complication of sh amongst this group of nigerians, and this agrees with previous studies from other regions in nigeria [8, 9, 17]. Recent community and hospital - based data have shown increasing cases of stroke in africa [18, 19]. On the other hand reports from high income countries seem to suggest a decline in hypertension - related complications . Part of the reasons for this is availability of potent antihypertensive medications with minimal side effects which are associated with greater compliance . Mortality among males (21%) was significantly higher than in females (15.7%). Gender - related difference in mortality among medical admissions had been reported from a hospital - based study in nigeria . Although females tend to use hospital more frequently, male patients often present with complications . Part of the limitations of this study includes the fact that it was a retrospective study and being hospital based . It might be difficult to generalize our result to the entire community since study was from a tertiary hospital which serves as a referral centre to the neighbouring states . Low postmortem rate to confirm or refute diagnoses was another limitation of the study . In conclusion, sh complications are common among medical admissions in bauchi nigeria and occur at a relatively young age . Hypertension - related admissions are associated with excess mortality, and stroke is the commonest . Community intervention to health - educate the populace on the need for early detection, dangers of sh, and other cardiovascular risk factors is urgently needed . Women empowerment programs and provision of gainful employment by the government will reduce poverty and improve medication compliance among hypertensive individuals.
The prevalence of child obesity is increasing rapidly worldwide . Based on the data of the world health organization (who), over 30% of the people in the middle east are overweight . A review of some studies from iran reveals that the prevalence of obesity among iranian children has been doubled between 1993 and 1999, which could be attributed to the changes in lifestyle.1, 3, 4 obesity in adults is not easy to treat and is often correlated with obesity during childhood . In the last decade, consumption of soft drinks and fast foods together with less activity and exercise contributed to the increasing number of overweight people worldwide . Along with increasing caries risk, increased consumption of sugar - sweetened beverages and snack foods also has been linked to obesity . Health risks associated with childhood overweight and obesity are strong indicators for predisposition to adult morbidity and mortality and include type 2 diabetes, cardiovascular disease, fatty liver disease, early maturation, endometrial, colon, breast and other cancers, psychological stress, as well as orthopedic problems, general poor health, and hepatic problems.7 - 10 an iranian study detected a high prevalence of cardiovascular risk factors in overweight and obese children aged 7 - 12 years . Obesity is also related to several aspects of oral health, such as caries, periodontitis and xerostomia . Fruit drinks and other sweetened beverages represent high sugar sources, which may contribute to cariogenic potential . Oral health is strongly influenced by the daily intake of food and can also play a significant role in nutritional intake and general status of health, particularly in the elderly . Who recommends limiting added sugars to 10% of total calories on the grounds that added sugars contributed to overall caloric density of the diet . A study in scotland showed that among 165 children aged 3 - 11 years, whom with the worst decay were significantly thinner also severe dental decay was associated with underweight . One brazilian study concluded that there was no statistically significant association between dental caries and obesity in adolescents aged 12 to 15 years . Among children and teenagers aged 2 - 20 years, body fat amount changes as the body grows and is different for boys and girls . Unlike body mass index (bmi) assessments for adults, assessments for children and teenagers take these growth and gender specific differences into account . These child - specific bmi values are referred to as bmi - for - age . Categories describing amount of body fat for children and teenagers is also different from the categories describing amount of body fat in adults . Among adults, bmi categories include underweight, normal, overweight, and obese . Among children and teenagers, bmi - for - age categories include underweight, since the frequent consumption of high caloric and cariogenic substances are two of the many factors associated with caries and obesity, and to the best of our knowledge there are no studies that have investigated the association between bmi - for - age and dental caries in iran to date, the purpose of this study was to determine whether bmi - for - age, might be associated with dental caries in children in isfahan, iran . This cross - sectional study was conducted from june to august 2007 in isfahan, iran . Using a random cluster sampling, a total of 1003 pupils aged 6 - 11 years from six private and state elementary schools with different social backgrounds the children thoroughly chewed one disclosing tablet (svenska dentorama ab, stockholm, sweden) and rinsed their mouth with water, according to the manufacturer s instructions . The children who had 70% or fewer teeth surfaces with plaque were invited for further evaluations . The sample size was estimated allowing for caries prevalence of 60%, and significance level of 0.05 . All of the children participated in the clinical examination were iranians and permanent residents of the city . Body weight was recorded to the nearest 100-gram using a standard beam balance scale with the subject barefoot and wearing light dresses . The balance was calibrated at the beginning of each working day and at frequent intervals throughout the day . Body height was recorded to the nearest 0.5 cm according to the following protocol: no shoes, heels together and head touching the ruler with line of sight aligned horizontally . To avoid subjective errors, bmi - for - age percentiles, representing eating habits in children and teenagers, were used . Bmi - for - age [(weight in kilograms) / (height in meters)] percentiles are dependent on gender and age - specific weight for height curves for those aged 2 - 20 years . According to these curves, underweight is defined as bmi - for - age <5th percentile, normal is defined as 5th percentile <bmi - for age <85th percentile, at risk of overweight is defined as 85th percentile <bmi - for - age <95th percentile, and overweight is defined as bmi - for - age> 95th percentile . Since the number of samples in underweight group was insufficient (three samples), this group was excluded from the study . The remaining 633 children (317 boys and 316 girls) enrolled in the study . All selected children were clinically examined for dental caries by a specialist utilizing the who criteria for diagnosis of dental caries . The examination was carried out using a cycle and cow horn two - headed dental explorer (aesculap ag, tuttlingen, germany), a plane mouth mirror (aesculap ag) and cotton rolls to remove any plaque or debris where necessary, and recorded on special charts . Teeth were considered as decayed when in addition to showing clinical signs such as a color change, wedging and catching of an explorer tip during the examination of occlusal surface encountered some degree of resistance ., a surface is diagnosed as decayed if the explorer is retained . Dressed and restored teeth that had recurrent caries teeth filled with temporary materials were considered as filled, and not as decayed; no radiographs were taken . Missing teeth were not marked correspondingly, since no definite statement could be made without a proper anamnesis whether the tooth really existed, or if an early extraction had taken place . To assess the caries frequency the dft index for the permanent dentition and the dft index for primary dentition were used, since it gives a good insight into the state of decay in the patient . If both the deciduous and permanent teeth were present, only the permanent teeth were evaluated . T - test was used to analyze the mean decayed and filled permanent / primary teeth (dft / dft) and the difference between groups, chi square test for evaluation of association between bmi - for - age and gender, and multiple linear regression for evaluation of association between bmi - for - age and dft / dft indices . The authors certify that all applicable institutional and governmental regulations concerning the ethical use of human volunteers were followed during this research . The findings showed that 16% of the children were within normal weight range, 16.9% at risk of overweight, and 67.1% overweight . There was no statistically significant association between bmi - for - age and gender (p = 0.2) (table 1). The mean se of dft in the normal weight, at risk of overweight and overweight groups were 0.34 0.08, 1.23 0.13 and 0.73 0.05, respectively; and mean se of dft were 2.01 0.19, 2.76 0.18 and 2.59 0.13, respectively . Multiple linear regression showed that there was no statistically significant association between bmi - for - age and dft (r = 0.06; ci: 0.01 to 0.09), and bmi - for - age and dft (r=0.07; ci: 0.003 to 0.046). By taking the bmi - for - age into account, 27.7% of the children with normal weight were caries free, whereas only 14% of children at risk of overweight and 37.2% of the overweight children were caries free . There was statistically significant association between bmi - for - age and being caries free (p = 0.0001). Given the causative relation between refined carbohydrates and dental caries, it is appropriate to hypothesize that overweight might also be a marker for dental caries in children and teenagers . Although bmi is widely used to screen adults for obesity, its use in adolescents is controversial . Bmi is a commonly used measure of adiposity, because it is easy to calculate, quick to measure, and noninvasive . Unfortunately, it is a fairly poor index in children unless age and gender are taken into consideration . Therefore, bmi - for - age categories were used in this study which might produce controversial results compared to the other studies . Results of the present study showed the high prevalence of overweight and at risk of overweight in the 6 - 11-year - old children in isfahan . A study showed that prevalence of overweight was 20.8% in 3 - 9 year - old children according to bmi . Palmer implicated that the relationship between obesity and caries in children needs further exploration; it is clear that there are common denominators that both diseases share . Negative changes in eating and activity patterns, increased frequency of snacking and increased consumption of fermentable carbohydrates are common in both obesity and caries in children . The mean dft / dft indices in the normal weight children were less than children at risk of overweight and the overweight . Although it was hypothesized that bmi - for - age would be associated with increased dental caries prevalence, there was no association between bmi - for - age and dft / dft indices (r 0.07). The relationship between nutrition and dental caries is complex because it is a multifactorial disease; oral hygiene, available nutrients, saliva, and oral flora influence dental caries . Chen et al investigated bmi index and dft score in three - year - old children . They concluded that there were no significant differences in the dft score of carious children among different bmi groups and there is no relationship between carious deciduous teeth and weight status . Kantovitz et al in a systematic review on the relationship between obesity in childhood found that only one study with high level of evidence showed direct association between obesity and dental caries . Macek & mitola concluded that there is no statistically significant association between bmi - for - age and dental caries prevalence for children in either dentition and overweight children with a positive history of dental caries in the permanent dentition exhibit fewer dmft than do their normal weight peers . The authors found that overweight children aged 6 - 17 years had a significantly lower dental caries severity than did children of normal bmi - for - age . Hilgers et al found that the mean caries average for permanent molars significantly increased with increased bmi, even after adjusting for age and gender . They concluded that elevated bmi is associated with an increased incidence of permanent molar interproximal caries . Burt & pai reported that children of low birth weight subsequently developed more caries in the primary dentition than did children with normal to high birth weight . They concluded that this may be related to social deprivation factors during the development of the primary dentition . Willerhausen et al indicated a strong association of obesity and caries in 1290 children of elementary schools in a city in germany . Another study found that there was a significant correlation between the bmi and caries frequency even after adjustment for the age of the children . One finnish study followed 516 children from birth to age 12 and used weight to predict caries experience (dmft / dmft). The investigators reported that obesity alone was not a very good predictor of dental decay . The present study demonstrated a significant association between bmi - for - age and being caries free (p = 0.0001). This is in line with the results of the study of willerhausen et al that showed number of healthy teeth decreased with age and bmi.a swedish study examined the relationship between dental caries and risk factors for atherosclerosis and reported that children with a dmft score greater than 9 had significantly higher bmi - for - age values than caries - free children . Glick noted that, while the consequences of obesity will have an indirect effect on oral conditions, this alone is not justification to get involved . Rather, there needs to be a stronger desire to have an impact on the patients general health . These findings might also show that further investigation should be conducted to determine if an association exists between dental caries and bmi - for - age and to address what factors specific to overweight in children might be protective against dental caries especially in permanent dentition . The future preventive programs must include strategies for nutrition control to avoid obesity as well as dental caries . There is a high prevalence of at risk of overweight and overweight in 6 - 11-year - old children in isfahan . At risk of overweight and overweight children had higher dft / dft score than did normal children, but there was no association between bmi - for - age and dft / dft indices.
The canadian integrated program for antimicrobial resistance surveillance (cipars), established in 2003, monitors antimicrobial drug use and resistance in selected species of enteric bacteria from humans, animals, and animal - derived food sources across canada (www.phac-aspc.gc.ca/ cipars - picra / surv - eng.php). Human salmonella isolates were submitted by all provincial public health laboratories in canada to the national microbiology laboratory for further characterization . Antimicrobial drug susceptibility testing was performed by using broth microdilution (sensititer automated microbiology system; trek diagnostic systems ltd ., westlake, oh, usa) and breakpoints established by the clinical laboratory standards institute (4). A total of 76 s. enterica serovar kentucky isolates were submitted to the cipars program during 20032009, and 23 (30%) isolates showed ciprofloxacin resistance (mic 4 ciprofloxacin - resistant isolates were identified from human case - patients in british columbia (n = 2), alberta (n = 2), saskatchewan (n = 1), ontario (n = 12), quebec (n = 5), and prince edward island (n = 1). Age information was available for 54 of 76 case - patients infected with s. enterica serovar kentucky during the study period . Black bars indicate ciprofloxacin - resistant isolates, and white bars indicate non ciprofloxacin - resistant isolates . Of these isolates, ciprofloxacin resistance was observed among case - patients 1869 years of age, and 5 of 11 were 1829 years of age . Case - patients 1829 years of age were 8 times more likely to have a ciprofloxacin - resistant strain than case - patients 5069 years of age (odds ratio [or] 8.3, 95% ci 1.03467.198, p = 0.046). Of 21 ciprofloxacin - resistant isolates from case - patients who reported site of isolation, 20 were identified from feces and 1 from urine . There were no differences in site of isolation between ciprofloxacin - resistant and ciprofloxacin - susceptible s. enterica serovar kentucky isolates . Although the total number of isolates associated with human infections was rare, of the 21,426 nontyphoidal salmonella spp . Submitted for susceptibility testing as part of the human component of the cipars program since 2003, s. enterica serovar kentucky had a significantly higher rate of ciprofloxacin resistance than all other nontyphoidal salmonella isolates and comprised 66% (23/35; p<0.0001) of all ciprofloxacin - resistant isolates identified during that period . In canada, ciprofloxacin - resistant s. enterica serovar kentucky was first identified in 2005, when 22% (2/9) of isolates submitted for drug susceptibility testing were resistant to this drug . A significant increase (or 10.5, 95% ci 1.1159.913, p = 0.04) in the number of isolates resistant to ciprofloxacin the largest number occurred during 20082009, when ciprofloxacin - resistant isolates comprised 57% (17/30) of all s. enterica serovar kentucky isolates identified (figure 1). The number of cases reported in canada is comparable with that reported in denmark over a similar period (3). We typed all isolates by using pulsed - field gel electrophoresis as described and restriction enzyme xbai (5). A dendrogram depicting the results was generated with bionumerics version 3.5 (applied maths, sint - martens - latem, belgium) and is shown in figure 2 . All ciprofloxacin - resistant isolates clustered with a percentage similarity> 80%; only 1 ciprofloxacin - susceptible isolate was found in this cluster (figure 2, panel a). Dendrograms of macrorestriction fragments of all (a) and ciprofloxacin - resistant (b) salmonella enterica serovar kentucky isolates identified in canada, 20032009 . The dotted vertical line in panel a indicates a cutoff value of 80% similarity, and the box indicates ciprofloxacin - resistant isolates . Left end and right end in panel b indicate pcr results for presence (pos) or absence (neg) of left and right junctions of salmonella genomic island 1 . Pfge, pulsed - field gel electrophoresis; mlst, multilocus sequence typing; ac, amoxicillin clavulanate; am, ampicillin; ch, chloramphenicol; ci, ciprofloxacin; ge, gentamicin; na, nalidixic acid; st, streptomycin; su, sulfisoxazole; te, tetracycline; st, sequence type; tm, trimethoprim; pei, prince edward island . Multilocus sequence typing (mlst) was performed on a subset of 8 isolates on the basis of differences in pulsed - field gel electrophoresis patterns and variations in antimicrobial drug resistance . Data were submitted to the mlst database website (http://mlst.ucc.ie/mlst/dbs/senterica) to determine mlst types (6). All isolates tested were sequence type (st) 198 (figure 2, panel b). This sequence type and similar antimicrobial drug resistance patterns have been recently reported in france, england and wales, denmark, belgium, and africa (3,7,8). Many st198 multidrug - resistant isolates observed in europe and africa contained salmonella genomic island 1 (sgi1) variants, particularly, sgi1-k, sgi1-q, and sgi1-p . To determine whether ciprofloxacin - resistant isolates from canada harbored similar sgi1 variants, we used pcr to detect the chromosomal left and right junctions of sgi1 as described (9,10). The right junction was found in 22 of 23 isolates, and the left junction was found in 18 of 23 isolates (figure 2, panel b). Analysis of s. enterica serovar kentucky isolates obtained during 20032009 from animal and retail meat samples as part of cipars did not identify any ciprofloxacin - resistant isolates (www.phac-aspc.gc.ca/cipars-picra/index-eng.php). This finding suggests that human infections in canada were not acquired from domestically produced food . Many ciprofloxacin - resistant s. enterica serovar kentucky human infections identified in europe have been linked to travel to countries in africa (3). Of 23 case - patients in canada travel history was defined as previous travel out of canada within the past 7 days . Four case - patients had traveled to morocco (1 also had traveled to spain and portugal), 3 had traveled to egypt, 1 had traveled to libya, and 3 had traveled to africa (no country reported). Resistance to ciprofloxacin in salmonella spp . Is a growing concern because it limits the ability to treat invasive disease . In this study, we described the characteristics of ciprofloxacin - resistant s. enterica serovar kentucky isolates in canada . Similar drug - resistance patterns and genetic backgrounds of s. enterica serovar kentucky have been observed in europe and linked to travel to countries in africa (3). That most isolates had multidrug resistance phenotypes is of particular concern . Further studies are required to determine risk factors for acquisition of these infections in canada.
Because more immature neonates are surviving, the incidence of bronchopulmonary dysplasia (bpd) has not decreased . Bpd impairs early growth, and prematurity is associated with altered eating habits in later life . Inflammation, a key pathogenic factor of bpd, affects metabolism, nutritional requirements, and growth in the neonatal period, but its association with later growth is less clear . Preterm infants have lower adiponectin levels compared with term children at term - equivalent age . Growth and nutrition may affect adipokine levels . Whether the growth and nutrition of the school - aged survivors of very low birth weight (vlbw; birth weight <1500 g) and bpd affect their adipokine status is not known . Our aim was to study nutritional intake and growth, with respect to plasma levels of adipokines and neonatal factors, in vlbw school children with and without severe radiographic bpd and term controls . Our hypotheses were that (1) bpd children and vlbw controls would present with similar growth parameters, but term children would demonstrate better growth than vlbw cases; (2) nutritional differences would exist between bpd children and controls; and (3) plasma adipokine concentrations would be associated with growth parameters in vlbw children at school age . Tampere university hospital records were searched to find vlbw children born between january 1, 1995, and april 13, 2003, with severe, northway grade iii to iv cystic radiographic bpd and age - matched controls without radiographic bpd . We examined 59 children 6 to 14 years of age, comprising 21 vlbw children with radiographic bpd, 19 vlbw children without radiographic bpd, and 19 children born at term . The median age of the study cohort was 11.3 years (range = 6.3 - 14.2), and 64% were boys . The age and sex profile of the 3 groups was similar, with the exception of a lower - than - average percentage of boys in the vlbw control group (58%). Parents were considered to be overweight if their body mass index (bmi) was more than 25 kg / m . The children were examined by a pediatrician (tk) who measured their height, weight, and head circumference, and their bmi standard deviation score (bmi - sds) was determined according to finnish age - specific and sex - specific references . Microcephaly was defined as a head circumference of less than 2sd and macrocephaly as a head circumference of more than + 2sd . Overweight and underweight were defined as bmi - sds of more than 1.16 and less than 1.65 in girls and more than 0.78 and less than 1.83 in boys . Long - term illnesses, such as asthma, cerebral palsy, epilepsy, and short bowel syndrome, were recorded . Thigh, hip, waist, and middle upper - arm circumferences were measured with a tape measure, and the mean of 2 measurements was recorded . Biceps, triceps, subscapular, and suprailiacal skinfold thicknesses were measured with a harpenden skinfold caliper according to the guidelines of the manufacturer (baty international, west sussex, uk), and the mean of 3 measurements was recorded . The adiponectin, adipsin, resistin, and leptin levels in plasma were determined as previously described; adipokine concentrations did not differ between the groups, as reported earlier . The parents completed a food record of everything the participants ate and drank over 3 consecutive days, and a trained nutritionist interviewed the families and calculated nutrient intakes with the diet32 dietary analysis program (aivo ab sverige, solna, sweden). The nutritional intakes were compared with national age - specific recommendations and the upper level of tolerable intake for adults . An energy intake that was up to 200 kcal above or below the age- and sex - adjusted estimated energy requirement was considered normal to cover different levels of physical activity . The ethics committee of the hospital district approved the study protocol, and written, informed consent was obtained from the parents . Spss statistics for windows, version 18.0 (spss inc, chicago, il), was used for the statistical analyses . Independent - sample t - tests or 1-way analysis of variance were used for normally distributed variables, the mann - whitney u test or kruskal - wallis test for non - gaussian variables, and the test or fisher s exact test for categorical variables . Values of p <.05 were considered statistically significant . In vlbw children, the correlations between adipokine concentrations, anthropometric parameters, and nutrient intake were studied using pearson s r correlation test for normally distributed variables and spearman s rank correlation coefficient () test for nonnormally distributed variables . Logistic regression analysis was carried out among vlbw children to examine predictors for the lowest and highest quartiles of bmi - sds and the lowest quartile of length for age and microcephaly . The first variables were birth weight, neonatal sepsis, radiographic bpd, severe intraventricular hemorrhage (ivh) of grade iii or more, or periventricular leukomalacia and bell stage 2 or 3 necrotizing enterocolitis (nec). The second variables were the intake of energy, fat, protein, and carbohydrates . Spss statistics for windows, version 18.0 (spss inc, chicago, il), was used for the statistical analyses . Independent - sample t - tests or 1-way analysis of variance were used for normally distributed variables, the mann - whitney u test or kruskal - wallis test for non - gaussian variables, and the test or fisher s exact test for categorical variables . Values of p <.05 were considered statistically significant . In vlbw children, the correlations between adipokine concentrations, anthropometric parameters, and nutrient intake were studied using pearson s r correlation test for normally distributed variables and spearman s rank correlation coefficient () test for nonnormally distributed variables . Logistic regression analysis was carried out among vlbw children to examine predictors for the lowest and highest quartiles of bmi - sds and the lowest quartile of length for age and microcephaly . The first variables were birth weight, neonatal sepsis, radiographic bpd, severe intraventricular hemorrhage (ivh) of grade iii or more, or periventricular leukomalacia and bell stage 2 or 3 necrotizing enterocolitis (nec). The second variables were the intake of energy, fat, protein, and carbohydrates . One child with radiographic bpd with a birth weight of less than 2sd was considered small for gestational age . Children with radiographic bpd had poorer initial weight gain and higher rates of ivh, sepsis, and nec than the vlbw controls (table 1). Three children with radiographic bpd with nec had undergone bowel resection, and 1 had short bowel syndrome . Abbreviations: vlbw, very low birth weight; bpd, bronchopulmonary dysplasia; ivh, intraventricular hemorrhage . N = 18 in the bpd group and n = 12 in the control group . At school age, the only anthropometric difference between the groups was in head circumference (table 2). Children with radiographic bpd had a smaller age - adjusted head circumference and were more likely to have microcephaly than the controls (table 2). In all, 8 vlbw children with microcephaly at school age had smaller age - adjusted head circumferences at birth, with a mean and sd of 0.5 (0.86) versus 0.39 (0.62), and their weight gain during initial hospitalization was poorer, with a median (range) of 14.8 g / d (14.3 to 20.4) versus 22.8 g / d (7.0 to 28.5), compared with vlbw children without microcephaly . The bmi - sds and the height for age were similar in vlbw children with and without microcephaly . Growth statistics of the school - aged children . Abbreviations: bpd, bronchopulmonary dysplasia; vlbw, very low birth weight; bmi - sds, body mass index standard deviation score; hc, head circumference; muac, middle - upper - arm circumference; sft, skinfold thickness . Nec survivors had a smaller head circumference at school age than children without nec, with a mean (sd) of 1.6 (2.8) versus 0.4 (1.3), but the other anthropometric parameters did not differ . One of the 5 children with severe ivh or periventricular leukomalacia and 2 of the 4 children with cerebral palsy had microcephaly at school age . In addition, 9 of the radiographic bpd and 4 of the vlbw control children with long - term illnesses had smaller waist - to - hip ratios compared with children without those conditions . Plasma adipokine concentrations were similar in prepubertal and pubertal children, with girls having higher adipsin levels than boys, with a median (range) of 916 ng / ml (598 - 1264) versus 787 ng / ml (483 - 1409). The girls leptin levels were also higher, at 7.1 ng / ml (2.1 - 37.6) versus 1.8 ng / ml (0.5 - 50.0), than those of the boys, but the adiponectin and resistin levels were similar between the sexes . Food records were not returned by the parents of 1 child with radiological bpd, 3 vlbw controls, and 1 term child . There were no differences between the groups in regard to nutritional intake (table 3), but daily nutritional intake recommendations were poorly met (table 4), with the exception of vitamin b12 and phosphate, which were adequate in all children . Abbreviations: bpd, bronchopulmonary dysplasia; vlbw, very low birth weight; sfa, saturated fatty acids; e%, percentage of total energy intake; mufa, monounsaturated fatty acids; pufa, polyunsaturated fatty acids; -te, -tocopherol equivalent, equals 1 mg -tocopherol; vitamin a retinol equivalent, 1 g retinol, equals 12 g -carotene; niacin equivalent, 1 mg niacin, equals 60 mg tryptophan . Abbreviations: rdi, recommended daily intake; bpd, bronchopulmonary dysplasia; vlbw, very low birth weight; sfa, saturated fatty acids; mufa, monounsaturated fatty acids; pufa, polyunsaturated fatty acids; cho, carbohydrates . Plasma leptin concentrations correlated positively with bmi - sds (= 0.57) and negatively with fat intake (= 0.36). Adiponectin (= 0.36), adipsin (r = 0.33), and leptin (= 0.55) levels correlated negatively with energy intake, as did resistin levels with carbohydrate intake (= 0.36). Birth length for gestational age correlated negatively with resistin levels (= 0.32) and birth head circumference for gestational age with adiponectin levels at school age (= 0.47). In the univariate logistic regression analysis, radiographic bpd was associated with an increased risk of microcephaly, with an or of 9.69 (95% ci = 1.06 - 88.65), and so was neonatal sepsis (or = 11.25; 95% ci = 1.91 - 66.39). In addition, neonatal sepsis seemed to predict short stature at school age in the multivariate analysis (or = 11.57; 95% ci = 1.01 - 132.40). When gestational age was entered into the multivariate model instead of birth weight, the association between neonatal sepsis and short stature was no longer significant . Neonatal dexamethasone treatment was associated with microcephaly at school age in the univariate analysis (or = 8.63; 95% ci = 1.44 - 51.72) but not when entered into the multivariate analysis . Short stature was found to be negatively associated with the intake of protein (or = 0.35; 95% ci = 0.14 - 0.85), fat (or = 0.12; 95% ci = 0.02 - 0.79), and carbohydrates (or = 0.37; 95% ci = 0.15 - 0.37) and positively associated with energy intake (or = 1.38; 95% ci = 1.03 - 1.58). School - aged vlbw survivors with radiographic bpd had smaller head circumferences and were more likely to have microcephaly than vlbw and term controls, but no other differences were found in growth parameters or nutritional intake . Bmi - sds correlated with leptin levels, but no other associations between plasma adipokine concentrations and anthropometric parameters at school age were found . There were negative correlations between leptin concentrations and fat intake, resistin levels and carbohydrate intake, and adiponectin, adipsin, and leptin concentrations and energy intake . School - aged vlbw children have been reported to have smaller head circumferences and higher levels of microcephaly than term controls . Bpd has been associated with small head circumference at school age, but not in all studies . Because bpd mainly affects the most immature infants, neonatal comorbidity is high, and the independent effect of bpd on growth is difficult to establish . In contrast, our children with microcephaly had poorer neonatal weight gain compared with the other vlbw children . Children with microcephaly at school age were the sickest infants and had nec, sepsis, and pulmonary problems requiring steroid treatment . The head circumference measurements between the birth and the study date were not available in our study, which is a weakness . Although children with microcephaly at school age had smaller age - adjusted birth head circumference than vlbw children without microcephaly, none had microcephaly at birth . A previous study estimates that the critical period of brain growth extends to late infancy, and after the first year of life, the small head circumference tends to persist . Parental head circumference was not measured, which is a major limitation, because the hereditability of head circumference has been reported to be up to 88% in childhood . Although most of the children reported a lower - than - recommended daily energy intake, only 4 were underweight . However, the amount of physical exercise was not recorded, and this may explain the adequate weight gain . All children reported an excessive intake of saturated fatty acids, whereas low intakes of fiber and micronutrients were common . Similar unfavorable dietary habits have been reported in young vlbw adults, and because this increases the risk of later chronic diseases, counseling about healthier eating from childhood could be an important tool for preventing disease . Recommended micronutrient intakes are set to the average requirement of + 2sd, and therefore, a lower - than - recommended intake does not mean that there was an inadequate food supply . Our food diaries can be regarded as reliable because they were checked with the nutritionist, but the food diaries only provide an estimate of short - term intake, with variability depending on the season and different food - related occasions . The only correlation between plasma adipokine levels and growth parameters in school - aged vlbw survivors was between bmi - sds and leptin levels . Greater weight has previously been associated with higher leptin and lower adiponectin levels in children . It seems that the association between inflammatory marker levels and growth is not more marked in vlbw survivors than in other school children . Lower leptin levels were correlated with a greater intake of energy and fats . In a previous study of obese adults, weight correlated positively with leptin and negatively with leptin receptor concentrations, and both leptin and leptin receptor levels correlated negatively with total energy intake . That study highlighted the role of the leptin / leptin receptor levels in satiety control and total energy intake and the importance of the synergistic interrelationships between the adipokines . Adiponectin has been linked to insulin sensitization, and adipsin to triglyceride storage, and a decrease in energy intake has been associated with an increase in adiponectin levels in adults . Levels of resistin, which have a controversial effect on glucose metabolism, have been shown to correlate negatively with carbohydrate intake . In addition, a high - fiber diet has been shown to decrease resistin levels in children . It seems that adipokine concentrations, and thus the risk of metabolic diseases, can be modified by a diet . Nec survivors had a smaller head circumference than children who had not had nec, and neonatal sepsis was associated with microcephaly and shorter stature at school age . Neonatal sepsis and nec have been shown to increase the risk of growth impairment in toddlers, and the resulting systemic inflammatory response has been shown to activate a local inflammatory response in the brain, leading to impaired neurodevelopment and head growth . Our results suggest that the impact of neonatal inflammation on growth, together with neurocognitive development as a result of microcephaly, may persist up to school age . Head circumference at birth correlated negatively with adiponectin levels in vlbw children, as did birth length with resistin levels . Previous studies have found an association between low birth weight and low adiponectin levels at school age and high leptin levels in adults . Weight gain during infancy has been positively associated with leptin concentrations at school age and negatively associated with adiponectin levels at 17 years of age . Previous data on the growth of modern age bpd survivors at school age have been relatively limited . Our study is a single - center study that minimized the effect of different neonatal treatment protocols on the results but was also limited by the number of patients that were available . The number of cases was not based on power analysis; instead, all available patients with severe radiographic bpd treated in our hospital during an 8-year period were studied . Based on small groups and wide 95% cis, underpowering may be one reason for negative results . In the case of positive results, such as the statistically significant trend of more instances of microcephaly in bpd children, the power is sufficient, although the number of cases is small . Children with radiographic bpd presented with poorer head growth and a greater incidence of microcephaly at school age than vlbw and term controls . Bmi - sds correlated with leptin levels, but otherwise, adipokine levels at school age seemed to have no association with growth parameters in vlbw children . Plasma adipokine levels correlated with nutritional intake, and as a result, dietary counseling would be beneficial . Ps: contributed to acquisition, analysis, and interpretation; drafted the manuscript; agrees to be accountable for all aspects of work ensuring integrity and accuracy . Pk: contributed to conception, design, analysis, and interpretation; drafted the manuscript; gave final approval . Tl: contributed to conception, design and analysis; gave final approval . Ot: contributed to conception, design, analysis, and interpretation; drafted the manuscript; gave final approval.
Bourgelatia diducta ralliet, henry and bauche, 1919 is a small - sized, milky white - colored nematode parasite with a well - developed mouth and bursa . This nematode is a member of the subfamily oesophagostominae, family chabertiidae, and order strongylida . The genus bourgelatia comprises a single species, b. diducta, which was first found in the cecum and colon of pigs in 1919 . The species was formerly classified as phacochoerostrongylus schwartz, but later was reclassified into the genus bourgelatia by differences in the morphology of buccal capsule, ovejecter, vagina length, and dorsal ray . Thus far, little is known about the pathogenesis and clinical symptoms of this parasite to its host, sus scrofa . Previous studies indicated that the infection of this worm is common among domestic pigs in india (21.6%), papua new guinea and the solomon islands (13%). Although the parasite was found in a relatively high prevalence among wild boars in japan (95%), the parasite so far has not been reported in the republic of korea (south korea). It has been reported that korean domestic pigs are infected with oesophagostomum detatum only without b. diducta in some surveys performed by fecal examination [9 - 12]. Recently, the population of wild boars in south korea has gradually increased due to the absence of predators such as panthera tigris . Therefore, the growing number of wild boars has been creating serious problems for human residential life and local agriculture industry . However, there has been little systematic approach to investigate the disease status among wild boars in south korea . The purpose of this study, therefore, was to investigate parasitic diseases of wild boars in south korea . In this study, we examined the gastrointestinal tract of 87 wild boars over a 4-year period in the southwestern part of south korea and found that b. diducta was quite prevalent among wild boars . Together with light and scanning electron microscopic evidences, we provided the identification key and measurements of various parts of the worm . Gastrointestinal tracts of 87 korean wild boars (sus scrofa coreanus) hunted in mountains of suncheon - si, gwangyang - si, and boseong - gun between 2009 and 2012 by members of local hunting associations were collected and examined for visceral helminths . The gastrointestinal tract of each wild boar was removed from the body and brought to the laboratory to examine the presence of parasites . The cecum and colon were slit open lengthwise and the mucosa and contents were examined carefully in a separate container . Worms were preserved in 70% ethanol, and were mounted on a slide glass using polyvinyl alcohol mounting medium . Measurements were made under a light microscope (axioscop, zeiss, city, country) on body dimensions, lengths of corona radiata, eosophagus, spicules, and gubernaculum, width of pharynx and other body parts of adult male and female worms . Species identification of the worm was based on the description by yamaguti and lichtenfels . Scanning electron microscopy was used to identify b. diducta as previously described by yadav and tandon . Briefly, worms were washed 3 times with 0.85% pbs for 20 min, fixed in 2.5% glutaraldehyde in 0.1 m phosphate buffer (ph 7.2) for 24 hr in a refrigerator at 4 and were post - fixed in 1% oso4 for 2 hr in a refrigerator at 4. after serial dehydration steps in 30, 50, 70, 80, 90, and 100% ethanol for 20 min each, critical - point drying in a hitachi hcp-2 (hitachi ltd, tokyo, japan) and sputter - coating with gold - palladium in an emitech k550 (emitech ltd, ashford, kent, england), digital photography of worms was taken using a hitachi s-2400 scanning electron microscope (hitachi ltd, tokyo, japan). Gastrointestinal tracts of 87 korean wild boars (sus scrofa coreanus) hunted in mountains of suncheon - si, gwangyang - si, and boseong - gun between 2009 and 2012 by members of local hunting associations were collected and examined for visceral helminths . The gastrointestinal tract of each wild boar was removed from the body and brought to the laboratory to examine the presence of parasites . The cecum and colon were slit open lengthwise and the mucosa and contents were examined carefully in a separate container . Worms were preserved in 70% ethanol, and were mounted on a slide glass using polyvinyl alcohol mounting medium . Measurements were made under a light microscope (axioscop, zeiss, city, country) on body dimensions, lengths of corona radiata, eosophagus, spicules, and gubernaculum, width of pharynx and other body parts of adult male and female worms . Species identification of the worm was based on the description by yamaguti and lichtenfels . Scanning electron microscopy was used to identify b. diducta as previously described by yadav and tandon . Briefly, worms were washed 3 times with 0.85% pbs for 20 min, fixed in 2.5% glutaraldehyde in 0.1 m phosphate buffer (ph 7.2) for 24 hr in a refrigerator at 4 and were post - fixed in 1% oso4 for 2 hr in a refrigerator at 4. after serial dehydration steps in 30, 50, 70, 80, 90, and 100% ethanol for 20 min each, critical - point drying in a hitachi hcp-2 (hitachi ltd, tokyo, japan) and sputter - coating with gold - palladium in an emitech k550 (emitech ltd, ashford, kent, england), digital photography of worms was taken using a hitachi s-2400 scanning electron microscope (hitachi ltd, tokyo, japan). The average length of adult females was 11.30.87 mm, and the thickest part of the body measured 0.540.04 mm in maximum width, while those of males were 9.80.72 and 0.450.03 mm, respectively . . 1 g, h), and males had the type ii dorsal ray with 2 rami (fig . The buccal capsule was small, relatively thin - walled, cylindrical, very short, and ring - shaped (fig . 2c), the cervical groove that can be recognized in the genus oesophagostomum was absent (fig . The ovijector in the inside of the posterior extremity of females consisted of 3 parts as a thick - walled vestibule that connected to the vagina, a paired thick - walled sphincters and a thinner - walled infundibula which was connected to the uteri (fig . The anterior extremity was equipped with 20 - 22 external corona radiata, a well - developed leaf - crown structure surrounding the mouth, 4 cephalic papillae and 2 lateral amphids around the mouth (fig . There was an oral collar which was much deeper than transverse ridges of the body cuticle, and an excretory pore and a pair of cervical papillae were also present (fig . The vulva was shown as a prominent circular protrusion with a semicircular opening while the anus was shown as a rather flat semicircular hole (fig . The tapering tail bore a pair of minute caudal papillae and a spike (fig . The posterior extremity of males had a well - developed bursa that consist of a long dorsal and 2 slightly shorter lateral lobes (fig . There were 2 conspicuous protrusions at the end of externodorsal and anterolateral rays on its surface (fig . The genital cone was observed at the point of the spicules flowing in and out (fig . 3f). From 87 korean wild boars captured in the southwestern area of south korea, 47 (54.0%) were found to harbour b. diducta in the large intestine, mainly in the cecum . The worm was found in 5 of 13 wild boars (38.5%) from suncheon - si, 38 of 70 (54.3) from gwangyang - si, and all 4 (100%) from boseong - gun . No differences between the gender were recognized on the rate of infection (table 1). A total of 938 worms (551 males and 387 females) of b. diducta was collected from the cecum and colon with an average number of 20.0 per animal and the infection intensity being the highest in animals from boseong - gun . The number of female worms present was 1.3 times more prevalent than the number of male worms (table 2). From 87 korean wild boars captured from mountains of the suncheon - si, gwangyang - si and boseong - gun, south korea spanning 2009 to 2012, the infection of b. diducta, with an average number of 20 worms per animal was confirmed in 47 (54%) wild boars . Although this is the first report in south korea, for instance, the prevalence of b. diducta in wild boars or domestic pigs reported from japan, india, and the solomon islands was 95%, 21.6%, and 13.0%, respectively . These reports suggest that the parasite may be distributed over a rather wide area ranging from asia and oceania . Up to now, however, there have been few reports on the intensity and pathogenesis of the infection with the parasite among pigs in the rest of the world . Although we carefully observed the large intestine, pathologic changes in the mucosa was hardly recognized . In the infection with oesophagostomum detatum which belongs to the same subfamily oesophagostominae as bourgelatia, infective larvae exsheath in the small intestine and enter the mucosa of the large intestine causing small nodules . Although the parasite is normally regarded as being only mildly pathogenic to pigs, the intestinal walls become edematous and strongly hyperemic in heavy burdens to develop into necrotic enteritis . As observed during the autopsy in this study, the infection of b. diducta did not elicit pathologic lesions in pigs at the population density of 20 worms per animal . There is a possibility that pathologic changes in the mucosa were not recognized due to the relatively low worm burden . Also, it is possible that the worm is relatively non - pathogenic in wild boars . The infection of domestic pigs with the genus oesophagostomum spp . Has been frequently reported in south korea and the prevalences of o. dentatum among domestic pigs based on fecal examination of eggs were 10.5%, 14.8%, 6.4%, and 2.5% . However, eggs of the genus oesophagostomum and bourgelatia are indistinguishable by size and appearance, and therefore it is possible that previous surveys based on fecal examination might have made mistakes stemming from correct identification of the genus . Similarly, the prevalence of b. diducta (17%) previously reported in pigs from nigeria by fecal examination might not be based on correct identification . Therefore, the infection status of o. dentatum among domestic pigs in korea requires identification of adult worms for a correct faunistic record in korea . Previous studies on the morphological features of b. diducta are remarkably consistent with those of our present study . The measurements of the worm body in this study were practically identical with the report by yamaguti (table 4). Studies on sem structures by yadav on external corona radiata, oral collar, cephalic papilla, lateral amphid, bursa, genital cone, externodorsal and anterolateral rays, vulva, anus, and caudal papillae match structurally up with our findings . In other members of the subfamily oesophagostominae in pigs, morphological structures are varied in shape and size . The cervical groove is present in daubneyia leroux, 1940 and oesophagostomum molin, 1861 while the buccal capsule of phacochoerostrongylus schwartz, 1928 is twice as wide as deep . The bourgelatioides traguli differs from b. diducta in lacking the anterior leaf - crown and in other details of the mouth capsule, in the presence of a groove and overlying flaps in the cervical region, and in the presence of terminal convoluted filaments on the spicules . We provided some identification key aspects regarding the morphological features of the superfamily strongyloidea and the genus bourgelatia (fig . The identification keys in this article are adapted from lichtenfels . Conclusively, in the present study, b. diducta (nematoda: chabertiidae) is recorded for the first time in south korea . In addition, morphological characteristics and differential keys provided in the present study will be helpful in the faunistic and taxonomic studies of strongylid nematodes related.
Rheumatoid arthritis (ra) is an obstinate, systemic inflammatory disease which has a negative impact on the quality of life.1 anti - tumor necrosis factor (tnf) therapy has proved to be beneficial to ra patients because it can suppress inflammation and joint damage;2 therefore, the percentage of ra patients treated with ant - tnf agents is steadily increasing . Adalimumab (ada), a fully human anti - tnf monoclonal antibody, exhibits excellent effectiveness in ra; however, its use has been reported to cause many adverse events in ra patients . Tnf is an important cytokine involved in initiating a protective immune response; therefore, patients receiving this therapy may be at a high risk of infection . Legionella pneumophila is a fastidious intracellular gram - negative bacillus that requires special microbiological culture media ., however, it seems that the risk of l. pneumophila pneumonia may be increasing in ra patients receiving tnf antagonist therapy.3 we report a rare case of pneumonia caused by l. pneumophila in an ra patient after only two ada injections . This report suggests a possible association between the use of ada and the incidence of pneumonia, which is a severe and often fatal infection . A seventy - eight - year - old japanese woman with seropositive ra, diagnosed in 1998 based on the acr 1987 criteria, underwent sulphasalazine (sasp) therapy before she visited our institute . In 2008 she was started on methotrexate (mtx) and low - dose prednisolone (psl) therapies . Despite administration of low - dose therapies of mtx (6 mg / week), sasp (500 mg / day), and psl (2.5 mg / day), because of her age and history of drug intolerance, her ra disease activity remained high [tender joint count, 4/28, and swollen joint count, 11/28; patient global assessment score, 72 mm/100 mm; c - reactive protein (crp), 2.55 mg / dl; erythrocyte sedimentation rate (esr), 52 mm / hour; matrix metalloproteinase- 3, 71.7 ng / ml; and disease activity score 28-esr, 5.82]. Furthermore, she had pulmonary emphysema and slight fibrosis in her bilateral lower lungs, and her sister had previously suffered from tuberculosis . However, the patient had no other lung diseases, including tuberculosis (negative result on the tuberculin test quanti - feron), no medical history of any viral infection, was not a hepatitis b virus carrier, and showed normal serum kl-6 and beta - d - glucan levels (410 u / ml and <2.84 pg / ml, respectively). Therefore, we decided to include anti - tnf therapy along with her current therapy after giving isoniazid (inh) 300 mg / day for three months . Ada at a dose of 40 mg was introduced in addition to mtx (6 mg / week), sasp (500 mg / day), psl (2.5 mg / day), and folic acid (5 mg / week) in june 2011 . She experienced excellent pain relief in her joints after her first subcutaneous ada injection, with no immediate adverse effects; her second injection was therefore safely administered two weeks after her first injection . Eight days after her second ada injection, she had fever (38.6 c), fatigue, and bloody sputum for two consecutive days; thereafter, she was admitted to our hospital . At that time, we first heard that she regularly visited a public bath and had continued to do so after ada treatment . On admission (day 0, 8 days after her second ada injection), her body temperature was 38.6 c and she was slightly tachycardic (96 beats / minute) with a blood pressure of 142/68 mmhg . Her heart sounds were normal, and she had neither chest pain nor visible rash . However, coarse crackles were audible in her right lower lung, and oxygen monitoring showed hypoxemia (spo2, 92%). Her joints were not swollen, painful, or warm, so we did not consider this state as a flare of ra . On the other hand, laboratory data showed marked acute inflammation (crp, 27.05 mg / dl; white blood cell count, 20,600/mm) and a positive urine l. pneumophila antigen test (binax, portland, or, usa). However, her serum beta - d - glucan levels were normal (<3.30 pg / ml). In addition, her expectoration culture, collected two days later, was weakly positive for haemophilus influenzae (blnar). Chest x - ray showed a permeation shadow in her right lower lung, and chest computed tomography (ct) showed pleural thickening, light ground glass opacities (ggos) right under the pleura, and consolidation with an air bronchogram in the right s6, s9, and s10 segments without fibrotic change from her baseline lung (fig . The patient was clinically diagnosed with pneumonia caused by l. pneumophila affecting her originally fibrotic ra lungs . She was then admitted and given intravenous pazufloxacin (pzfx) 1000 mg / day (after an initial administration of 2 g twice daily at days 0 and 1) for 10 consecutive days . She showed remarkable recovery after being injected with pzfx and was discharged on day 10 . After discharge from our hospital, we confirmed her seroconversion of l. pneumophila and complete healing of pneumonia on chest ct . Mtx (6 mg / week) and psl (5 mg / day) therapies were then restarted without ada because of an increase in her ra disease activity at day 20 . However, pneumonia relapsed at day 55 along with loss of appetite, fatigue, and coughing . Laboratory data showed acute inflammation (crp, 13.09 mg / dl; white blood cell count, 10,500/mm), and her urine l. pneumophila antigen test (binax) was again positive . In addition, both her serum kl-6 and beta - d - glucan levels were high (815 u / ml and 29.56 pg / ml, respectively) unlike before . Blood gas data showed severe hypoxemia (po2, 47.5 mmhg; pco2, 29.5 mmhg). Chest ct findings showed multifocal consolidation with ggo extending to the bilateral lower aggravated fibrotic lungs (fig . 2a and b) unlike pneumocystis pneumonia (pcp), which mostly showed diffuse ggo of the bilateral lungs . Furthermore, neither dna of pneumocystis jiroveci from bronchoalveolar lavage fluid (balf) nor serum cryptococcus and aspergillus antigens were positive . We could not detect any bacteria from her balf culture . On the other hand, serum candida antigen and culture of candida albicans were positive . On the basis of these findings, we diagnosed a relapse of l. pneumophila pneumonia with deep mycosis (eg, candida infection) and interstitial pneumonia (ip). The patient s lungs were previously affected by ra, but not pcp . Unfortunately, although we tried every possible treatment, the patient eventually died of aggravated ip on day 79 (kl-6, 5030 u / ml; beta - d - glucan, 8.05 pg / ml at day 72). Ada, a fully human anti - tnf monoclonal antibody, has been used in japan since june 2008 for the treatment of ra and is administered at 40 mg once every 2 weeks or at 80 mg for cases of high disease activity which do not respond to 40 mg use . It is known to be very effective in decreasing inflammation, such as that in ra . However, it is also known that anti - tnf therapy may be a risk factor for a number of infections; in particular, ada treatment is considered a risk factor for reactivation of latent tuberculosis.46 anti - tnf agents including ada are said to be risk factors for bacterial pneumonia.7,8 in addition, ra disease severity in itself is known to be one of the strongest risk predictors of infection.9 as mentioned above, patients treated with anti - tnf agents are generally believed to be at an increased risk of bacterial infections.10 conversely, another study found that the severity of serious infections was not increased in anti - tnf - treated patients compared with a disease - modifying antirheumatic drugs (dmard)-treated cohort.11 considering the risks associated with the use of anti - tnf agents, we restrict their administration and occasionally exclude immunocompromised patients with co - morbidities, such as those with diabetes mellitus, heart disease, viral hepatitis, and lung disease, or elderly patients from these treatments . Our patient was a 78-year - old woman with ra, who had a long - term smoking habit and had bilateral fibrotic lungs; these were possibly be risk factors for legionella infection in patient as well as other infections such as pcp . Legionellosis presents as two types of diseases; one is legionnaires disease, the more severe form, and the other is pontiac fever, the milder form, which shows minimal heat and muscular pain, and has a rapid complete recovery.12 legionellos is also often presents as pneumonia and is mainly caused by the l. pneumophila serogroup 1 (sg1), a ubiquitous, opportunistic, gram - negative intracellular pathogen.3 tnf induces differentiation of monocytes into macrophages, which are essential in the induction of granuloma, and is important for maintaining the integrity of granuloma.13 in addition, tnf plays an important role in host resistance against infectious agents, especially those multiplying intracellularly.14 thus, treatment with tnf antagonists is associated with an increased risk of infection, particularly infections caused by intracellular microorganisms such as l. pneumophila . In contrast, in japanese post - marketing surveillance with tnf antagonists for ra, both fatal and surviving cases of legionella pneumonia were reported to be very rare (infliximab, 1 and 0 in 7522 cases; etanercept, 0 and 0 in 13894 cases; ada, 3 and 2 in 3084 cases, respectively). Legionella pneumonia tends to be a severe and fatal form of community - acquired pneumonia very similar to pneumococcal pneumonia . Nowadays, however, l. pneumophila pneumonia is considered to be a curable disease if appropriate antimicrobial therapy is administered at an early stage . Usually, legionellosis is considered to be caused by inhalation of aerosols containing l. pneumophila and bathing in hot springs and circulation - type bathtubs available in public bathing facilities that are infected with l. pneumophila . But further investigations showed that her case was an isolated infection and was not part of a mass outbreak, suggesting that l. pneumophila infection in our patient was more likely caused after ada treatment . Nowadays in japan, both the introduction of the urinary legionella antigen test and improvements in the infectious disease law have led to an increase in the number of reports of l. pneumophila . Accordingly, milder cases of legionella pneumonia have been reported . In the past, many cases of legionellosis might have been overlooked, including milder cases of legionella pneumonia or minor pontiac fever . Winthrop - university hospital criteria are said to be very useful for discriminating fairly well between l. pneumophila pneumonia and bacteremic pneumococcal pneumonia, at the time of hospitalization, for community - acquired pneumonia.15 chest ct findings of legionella pneumonia are said to be bilateral or unilateral with single and multifocal consolidation and ggo,16 while those of mild legionella pneumonia are said to be bilateral, with multiple affected segments and peripheral lung consolidation with ggo.17l . Pneumophila includes 16 types of serogroups, and only sg1 can be detected by the urine l. pneumophila antigen test (binax). The percentage of l. pneumophila sg1 may be high in japan, as it is in a lot of countries, but we are unable to detect all l. pneumophila by this antigen test . Urine l. pneumophila antigen test may be positive for a few weeks after treatment of legionella pneumonia as seen in this case; however, we diagnosed this case as a recurrence of l. pneumophila pneumonia with deep mycosis (eg, candida infection) and ip on the basis of data from serum, culture, balf analysis, and ct scans, which showed multifocal consolidation with ggo extending to the lower parts of her fibrotic lungs bilaterally at recurrence (fig . The risk of l. pneumophila pneumonia is reported to increase in patients receiving tnf antagonists, with a relative risk of 16.521, compared with that in the overall population in france.3 the use of corticosteroids and mtx might also have played a role in the emergence of this infection, but the patient had been treated with these medications for a long time . Legionella tends to colonize the respiratory tract of immune - compromised patients and causes severe health problems once their immune system is further affected.18 in our case, because the patient did not visit any public bath after discharge from our hospital, it is possible that although she initially recovered from l. pneumophila pneumonia and was discharged from the hospital, the organism was still present in her respiratory tract, causing pneumonia to recur and ultimately prove fatal . In such cases, it is important to prevent tuberculosis by inh, pcp by trimethoprim sulfamethoxazole, and pneumococcal pneumonia by vaccination, in all immune - compromised ra patients before the first treatment with anti - tnf agents; additionally, it is important to carefully monitor ra patients who have been given anti - tnf agents in the past, not only in the early phase when they are first given tnf inhibitors, but also afterwards, especially after they have recovered from infections such as that described in our case . To our knowledge, this is the first reported fatality triggered by relapsing pneumonia caused by l. pneumophila with deep mycosis and ip in an ra patient treated with ada . The patient eventually died of aggravated ip following a relapse of pneumonia caused by l. pneumophila . To avoid exacerbation of a patient s illness and to prevent fatality due to severe infection, it is important for us to be aware of the fact that the use of tnf - inhibitors can lead to infections such as that described here . Because a delay in controlling some infections worsens the patient s ra disease activity during that period, it is important to control any infection rapidly and completely . Recently, ra treatment has been rapidly and aggressively adopted based on the concept of treat - to - target; therefore, we need both to accumulate evidence from case studies to promote safe and effective treatments for ra, and to avoid therapeutic errors, which will result in the maximum possible survival of patients.
A specimen of b. bassiana efcc 13188, growing on adult mantis, was collected from yang - yang of gangwon province, korea in october 2006 and preserved in the entomopathogenic fungal culture collection (efcc), kangwon national university, korea (fig ., the conidia were transferred from the fresh specimen to 2% water agar (wa) plates in two parallel lines with the help of a sterile insect pin and incubated at 25 under continuous light . After two days of incubation, fine, regular hyphal growths could be observed by the naked eye on the sides of the parallel lines . Small agar blocks containing hyphal growths were cut with the help of a zeiss dissecting microscope stemi sv11 (zeiss, oberkochen, germany) and then transferred to of half strength sabouraud's dextrose agar yeast extract (sday) agar plates (dextrose 20 g, peptone 5 g, yeast extract 5 g and agar 15 g per 1,000 ml; ph 5.6). Mycelial discs (4 mm) from the peripheral region of the two - week old agar cultures were inoculated in flasks of sday broths (sday without agar) and incubated in stationary condition under light for three days . The culture suspension was diluted in 1.8 ml eppendorf tubes in different grades and then plated in wa plates . After two days of incubation, single conidial colonies were isolated from the wa plates through a zeiss dissecting microscope stemi sv11 (zeiss) and transferred to half - strength sday agar plates . All of the eight single conidial isolates, efcc 13188 - 1 to efcc 13188 - 8 incubated for the induction of fruiting bodies, following the method of shrestha et al . . After regular observations until fifty - five days of incubations, very surprisingly only few combinations, including two single inoculations, produced perithecial stromata (table 1, fig . Perithecial stromata produced from b. bassiana isolates were compared with those of c. bassiana [5, 7]. Similarly, conidial structures of b. bassiana efcc 13188 were compared with those of c. bassiana 12511 (fig . 4). All of the eight single conidial isolates of b. bassiana efcc 13188 and four single ascospore isolates of c. bassiana efcc 12511a b were inoculated in brown rice medium in all possible combinations of two isolates at a time to observe the nature of fruiting bodies (table 2). A specimen of b. bassiana efcc 13188, growing on adult mantis, was collected from yang - yang of gangwon province, korea in october 2006 and preserved in the entomopathogenic fungal culture collection (efcc), kangwon national university, korea (fig ., the conidia were transferred from the fresh specimen to 2% water agar (wa) plates in two parallel lines with the help of a sterile insect pin and incubated at 25 under continuous light . After two days of incubation, fine, regular hyphal growths could be observed by the naked eye on the sides of the parallel lines . Small agar blocks containing hyphal growths were cut with the help of a zeiss dissecting microscope stemi sv11 (zeiss, oberkochen, germany) and then transferred to of half strength sabouraud's dextrose agar yeast extract (sday) agar plates (dextrose 20 g, peptone 5 g, yeast extract 5 g and agar 15 g per 1,000 ml; ph 5.6). Mycelial discs (4 mm) from the peripheral region of the two - week old agar cultures were inoculated in flasks of sday broths (sday without agar) and incubated in stationary condition under light for three days . The culture suspension was diluted in 1.8 ml eppendorf tubes in different grades and then plated in wa plates . After two days of incubation, single conidial colonies were isolated from the wa plates through a zeiss dissecting microscope stemi sv11 (zeiss) and transferred to half - strength sday agar plates . All of the eight single conidial isolates, efcc 13188 - 1 to efcc 13188 - 8 incubated for the induction of fruiting bodies, following the method of shrestha et al . . After regular observations until fifty - five days of incubations, very surprisingly only few combinations, including two single inoculations, produced perithecial stromata (table 1, fig . Perithecial stromata produced from b. bassiana isolates were compared with those of c. bassiana [5, 7]. Similarly, conidial structures of b. bassiana efcc 13188 were compared with those of c. bassiana 12511 (fig . All of the eight single conidial isolates of b. bassiana efcc 13188 and four single ascospore isolates of c. bassiana efcc 12511a b were inoculated in brown rice medium in all possible combinations of two isolates at a time to observe the nature of fruiting bodies (table 2). Single conidial isolates of b. bassiana efcc 13188 were similar to c. bassiana efcc 12511 isolates with regard to colony pigmentation and texture . Three combinations of isolates of b. bassiana efcc 13188 - 1 5, 3 8, and 5 8 produced perithecial stromata (table 1, fig . 2). Isolate efcc 13188 - 4 produced perithecial stromata when inoculated in single as well as in combinations with isolates efcc 13188 - 1, 5, 6, and 7, but not with isolates efcc 13188 - 2, 3, and 8 (table 1). However, isolate efcc 13188 - 2 produced perithecial stromata in single, but produced no perithecial stromata with any other isolates of b. bassiana (table 1). It could not be understood if co - inoculations of two isolates suppressed fruiting body formation or not . Mating type was found to be very variable among the isolates, which is in contrast with c. militaris that shows more stable mating types . Thus, despite the formation of perithecial stromata, b. bassiana isolates could not be separated into distinct mating types . This may be due to the dominance of an asexual life cycle in b. bassiana . Morphological characteristics of perithecial fruiting bodies produced from b. bassiana efcc 13188 isolates were compared with those of c. bassiana . The stromatal characteristics and size of perithecia and ascospores were within the range of c. bassiana, as reported by li et al . And sung et al . Conidial structures of b. bassiana efcc 13188 were also similar to those of c. bassiana efcc 12511 (fig . Four out - crossings between b. bassiana and c. bassiana, efcc 13188 - 1 efcc 12511a b 3, efcc 13188 - 2 12511a b 3, efcc 13188 - 6 12511a b 4 and efcc 13188 - 7 12511a b 2, produced perithecial stromata (table 2, fig . Interestingly, b. bassiana isolate efcc 13188 - 2 produced no perithecial stromata with any other sister isolates of b. bassiana 13188 (table 1), but it produced perithecial stromata with c. bassiana efcc 12511a b 3 (table 2, fig . Out - crossing between efcc 13188 - 7 efcc 12511a b 2 showed excellent fertile fruiting body production (fig . 5d). Mating types of both b. bassiana efcc 13188 and c. bassiana efcc 12511a b isolates could not be verified from out - crossings . It is quite difficult to study also mating system of rare cordyceps species, such as c. bassiana . From the present study, it has been shown that hyphomycetous entomopathogenic fungi can induce the production of teleomorphic states of cordyceps under the suitable nutritional and environmental conditions . Single conidial isolates of b. bassiana efcc 13188 were similar to c. bassiana efcc 12511 isolates with regard to colony pigmentation and texture . Three combinations of isolates of b. bassiana efcc 13188 - 1 5, 3 8, and 5 8 produced perithecial stromata (table 1, fig . 2). Isolate efcc 13188 - 4 produced perithecial stromata when inoculated in single as well as in combinations with isolates efcc 13188 - 1, 5, 6, and 7, but not with isolates efcc 13188 - 2, 3, and 8 (table 1). However, isolate efcc 13188 - 2 produced perithecial stromata in single, but produced no perithecial stromata with any other isolates of b. bassiana (table 1). It could not be understood if co - inoculations of two isolates suppressed fruiting body formation or not . Mating type was found to be very variable among the isolates, which is in contrast with c. militaris that shows more stable mating types . Thus, despite the formation of perithecial stromata, b. bassiana isolates could not be separated into distinct mating types . This may be due to the dominance of an asexual life cycle in b. bassiana . Morphological characteristics of perithecial fruiting bodies produced from b. bassiana efcc 13188 isolates were compared with those of c. bassiana . The stromatal characteristics and size of perithecia and ascospores were within the range of c. bassiana, as reported by li et al . And sung et al . Conidial structures of b. bassiana efcc 13188 were also similar to those of c. bassiana efcc 12511 (fig . Four out - crossings between b. bassiana and c. bassiana, efcc 13188 - 1 efcc 12511a b 3, efcc 13188 - 2 12511a b 3, efcc 13188 - 6 interestingly, b. bassiana isolate efcc 13188 - 2 produced no perithecial stromata with any other sister isolates of b. bassiana 13188 (table 1), but it produced perithecial stromata with c. bassiana efcc 12511a b 3 (table 2, fig . Out - crossing between efcc 13188 - 7 efcc 12511a b 2 showed excellent fertile fruiting body production (fig . Mating types of both b. bassiana efcc 13188 and c. bassiana efcc 12511a b isolates could not be verified from out - crossings . It is quite difficult to study also mating system of rare cordyceps species, such as c. bassiana . From the present study, it has been shown that hyphomycetous entomopathogenic fungi can induce the production of teleomorphic states of cordyceps under the suitable nutritional and environmental conditions.
Conserved, highly pheromone - induced genes were identified by comparing previously published expression data from s. cerevisiae and c. albicans . We combined results from three independent ortholog maps to find pheromone response genes that were present in most hemiascomycete yeast species . General pheromone - activated genes were defined as genes that were among the top ten most highly pheromone - activated genes in s. cerevisiae or c. albicans, present in the genomes of most hemiascomycete species, and are not an asg in s. cerevisiae, k. lactis, or c. albicans . The asgs were defined as showing differential expression between a and cells in s. cerevisiae, k. lactis, or c. albicans . The protein sequences of these genes were used as a psi - blast query to identify orthologs in species whose genomes were not included in any of the ortholog maps . Mfa1 genes, which encode for the a - factor pheromone, are too short to be annotated by automated bioinformatics techniques, so they were identified manually in most species using tblastn . Ste12 motifs were generated from general pheromone response gene intergenic regions pooled from all the species in a given clade . Each intergenic region was considered up to 600bp upstream of the start codon, a distance that is likely to capture functional ste12 cis - regulatory sites . The program meme was used to find overrepresented sequences in these sets of intergenic regions, under conditions assuming zero to one binding site per intergenic region . Because the motifs generated for ste12 from the kluyveromyces, saccharomyces, and candida clades were highly similar, we pooled intergenic regions from all three clades and generated a 7bp motif to score individual gene regulatory regions across the hemiascomycetes . The upstream 600bp of intergenic regions were scored as described for the number of ste12 motifs above a given cutoff . For consensus sites, the cutoff only accepted a single sequence: tgaaaca . For mismatched sites, the cutoff allowed deviation from the consensus sequence of a single nucleotide in any position in the motif . For genes that were duplicated in a species (i.e. Contained more than one copy) the copy with the largest number of ste12 sites was taken, because this was the most stringent criterion to test our hypothesis that the a - specific genes lacked ste12 sites in the kluyveromyces and candida clades . Mfa1 genes often are found in multiple copies in each species (i.e. Mfa1 and mfa2) so two copies were included when present . Ste12 motifs were also enumerated in the rest of the intergenic regions in each species . Enrichment of the ste12 motif in either the a - specific genes or the general pheromone response genes with respect to the rest of the genome was calculated using the hypergeometric distribution at all possible cutoffs of number of ste12 motifs . The cutoff giving the most significant p - value was chosen, because this represented the most stringent test of our hypothesis that the a - specific genes lacked ste12 sites in the kluyveromyces and candida clades . Sequence data were obtained from the yeast gene order browser (ygob) and the joint genomes institute (jgi) websites (http://ygob.ucd.ie and http://genome.jgi.doe.gov, respectively). Constructs for gene disruption, epitope tagging, and promoter replacement were generated by fusion pcr . Three to five individual pcr components were amplified using extaq (takara), and 50 ng of each were combined into a single 50 l reaction along wth 0.5 l extaq, 0.4 l 25 mm dntps, 0.1 l of each 100 m primer . The reactions were incubated in a thermocycler: 95c 3:00, [95 0:30, 55 0:30, 72 1:00/kb] x 4, [95 0:30, 5872 0:30 (depending on the annealing temperature of the primers), 72 1:00/kb] x 30, 72 10:00 . The gfp reporters for k. lactis, l. kluyveri, and s. cerevisiae were constructed from the original vector that was made for use in k. lactis . Pts12 was made from a 5-piece fusion pcr, digested with kasi and hindiii (new england biolabs) and ligated into puc19 using fast - link ligase (epicentre biotechnologies). Vectors were treated with antarctic phosphatase (new england biolabs) for 30 minutes prior to ligation . The reporter consisted of the upstream flanking region of the k. lactis trp1 gene, the s. cerevisiae trp1 gene, the entire s. cerevisiae cyc1 upstream intergenic region, the cagfp and act1 terminator, and the downstream flanking region of k. lactis trp1 . The s. cerevisiae trp1 gene was replaced with the hygromycin resistance marker from pfa6-htb - hphmx4 by digestion with bsiwi and pmli and ligated to make pts16 . Dna oligos with sites for noti and bamhi sites were annealed in fast - link ligase buffer (epicentre biotechnologies) and ligated in a 50:1 insert to vector ratio to make pts26 . This vector was used to make the other reporters for use in k. lactis by ligating annealed oligos or digested pcr products into the noti and xhoi sites . Vectors incorporating an entire intergenic region of a gene were constructed by ligating digested pcr products the sites saci and agei . The l. kluyveri reporter was made by cloning upstream and downstream homology to the trp1 locus into the ngomiv / bsteii and blpi / hindiii sites, respectively . These homology regions were then swapped out for homology to the ura3 locus to improve the efficiency of integration of the reporter by selection with 5-foa . The altered regions of the l. kluyveri ste2 promoter were cloned as with the k. lactis reporter . The s. cerevisiae reporter was made by cloning the ste2 promoter fused to gfp into a centromeric reporter, prs412, using the kpni and saci sites . To measure the pheromone response in a strain that lacks mata2, we replaced the promoter of ste2 with that of a general pheromone response gene that is not dependent on a2 . Strain yts43 in which the ste2 promoter was replaced by the sst2 promoter was made in the mata2 background . This replacement construct consisted of a 4-piece fusion pcr that contained 5 homology, the ura3 marker, the sst2-promoter, and 3 homology . K. lactis and l. kluyveri were transformed with 1 g dna according to published protocols, and s. cerevisiae was transformed using a standard lithium acetate protocol . K. lactis cells were grown overnight for ~14h, then starved in sd medium lacking phosphate as previously described . Cells were induced after 6h with 6.25 m -factor pheromone (wswitlrpgqpif> 95% purity, 100mg / ml in 100% dmso; genemed synthesis) or an equivalent amount of dmso . Cells were removed at several time points and were pelleted, washed, and frozen in liquid nitrogen . Rna was extracted using the ribopure rna purification kit (ambion). The rna was reverse transcribed into cdna using superscript ii as described previously . Transcript levels were measured using sybr green on a steponeplus rt pcr machine (applied biosystems). Transcripts were normalized to that of vps4, a gene that was found to be highly consistent across conditions in previous expression experiments . Strains yts314 and yts315 were grown using a phosphate starvation protocol modified from our previously published protocol . Yeast were grown overnight for ~14h, then pelleted, resuspended in phosphate starvation media, then diluted in 100200ml phosphate starvation media to od600 = 0.25 0.3 . These cultures were grown for 2h, then 13-mer -factor pheromone was added to 6.25 m, and the cultures were grown for an additional 2h . Cells were crosslinked with 1% formaldehyde for 15 minutes, quenched with glycine, pelleted, washed, and frozen in liquid nitrogen . Cells were lysed in 300700l lysis buffer (50 mm hepes / koh ph 7.5, 140 mm nacl, 1 mm edta, 1% triton x-100, 0.1% na - deoxycholate) with added edta - free protease inhibitor tablet (roche). Cells were transferred to a fresh tube with 500l 0.4 mm glass beads, and were lysed for ~45min on a vortex genie with tube adaptor (labrepco). Lysate was recovered by centrifugation, and sonicated 34x on a diagenode bioruptor (level 5, 30s on, 1min off). Lysate was cleared by centrifugation at max speed in a table - top centrifuge at 4 c . Immunoprecipitation was carried out overnight with 300l cleared lysate, 200l fresh lysis buffer, and 10l 200g / ml anti - c - myc antibody (invitrogen). 50l of washed protein g sepharose beads 50% slurry was added and incubated for 2h . Crosslinking was reversed by incubating 16h at 65 c, and immunoprecipitated dna was recovered using the minelute kit (qiagen). Chip - seq libraries were prepared using the nebnext chip - seq library prep kit for illumina (new england biolabs) and ampure xp magnetic beads (beckman coulter, inc). Libraries were pooled and sequenced on a hiseq 2500 (illumina) through the ucsf center for advanced technology (cat.ucsf.edu). The chip experiment was performed with a total of three replicates on two separate days, and a single replicate was performed of the untagged control . K. lactis reporter strains were grown as 1ml cultures in sd medium overnight for ~14h in a 96 well plate . Cells were pelleted, resuspended in phosphate starvation medium, and diluted to od600 = 0.25 . Cells were grown 6h, then induced with 6.25m -factor (or dmso for control cells) for 4h . Cells were diluted 10-fold into the same media before measuring gfp fluorescence on a bd lsr ii flow cytometer . Cells were gated to exclude debris and the mean of the cell population was used for further analysis . The autofluorescence level of a cell containing no reporter was subtracted from each reporter strain, and the standard deviation of each reporter strain was added to the standard deviation of the autofluorescence strain . Values were divided by the mean autofluorescence to give an indication of the signal relative to noise . Multiple independent isolates were tested for each reporter strain, and each experiment was performed separately two or more times . In rare cases where one isolate displayed a drastic difference in expression from the others, it was tested to see whether it was a statistical outlier, and if so, was removed for subsequent experimental repetitions . Statistics for the reporter assays were conducted using an anova followed by tukey s hsd test . The intergenic sequences for the a - specific genes were obtained from ygob for the species s. cerevisiae, s. paradoxus, s. mikatae, s. uvarum, and s. kudriavzevii . 19 k. lactis strains were obtained from the phaff yeast culture collection (davis, california). From these and 3 additional k. lactis strains, a - specific gene intergenic sequences were amplified from both directions using extaq (takara) and sanger sequenced . The intergenic regions from the saccharomyces sensu stricto and k. lactis species complex were then analyzed separately as follows . For each species or isolate, the a - specific gene intergenic regions were scored for the presence of strong and weak ste12 cis - regulatory regions . The appropriate nucleotide evolution model was selected as previously described; the hky+g model was selected for the sensu stricto species, and the gtr+g model was selected for k. lactis . These models output the estimated evolutionary rate for each site in the alignment and each site was categorized as being part of a consensus or mismatched ste12 cis - regulatory site in at least one species, or no site at all . Then, the trees generated by this method were used as input to test for different evolutionary rates among the different categories using the rphast package . The null model was generated using phylofit on the intergenic regions lacking mismatched and consensus ste12 sites using the model for the sensu stricto species and the rev model for k. lactis . Then, the mismatched and consensus ste12 sites were tested for increased conservation in comparison the null model using phylop . Conserved, highly pheromone - induced genes were identified by comparing previously published expression data from s. cerevisiae and c. albicans . We combined results from three independent ortholog maps to find pheromone response genes that were present in most hemiascomycete yeast species . General pheromone - activated genes were defined as genes that were among the top ten most highly pheromone - activated genes in s. cerevisiae or c. albicans, present in the genomes of most hemiascomycete species, and are not an asg in s. cerevisiae, k. lactis, or c. albicans . The asgs were defined as showing differential expression between a and cells in s. cerevisiae, k. lactis, or c. albicans . The protein sequences of these genes were used as a psi - blast query to identify orthologs in species whose genomes were not included in any of the ortholog maps . Mfa1 genes, which encode for the a - factor pheromone, are too short to be annotated by automated bioinformatics techniques, so they were identified manually in most species using tblastn . Ste12 motifs were generated from general pheromone response gene intergenic regions pooled from all the species in a given clade . Each intergenic region was considered up to 600bp upstream of the start codon, a distance that is likely to capture functional ste12 cis - regulatory sites . The program meme was used to find overrepresented sequences in these sets of intergenic regions, under conditions assuming zero to one binding site per intergenic region . Because the motifs generated for ste12 from the kluyveromyces, saccharomyces, and candida clades were highly similar, we pooled intergenic regions from all three clades and generated a 7bp motif to score individual gene regulatory regions across the hemiascomycetes . The upstream 600bp of intergenic regions were scored as described for the number of ste12 motifs above a given cutoff . For consensus sites, the cutoff only accepted a single sequence: tgaaaca . For mismatched sites, the cutoff allowed deviation from the consensus sequence of a single nucleotide in any position in the motif . For genes that were duplicated in a species (i.e. Contained more than one copy) the copy with the largest number of ste12 sites was taken, because this was the most stringent criterion to test our hypothesis that the a - specific genes lacked ste12 sites in the kluyveromyces and candida clades . Mfa1 genes often are found in multiple copies in each species (i.e. Mfa1 and mfa2) so two copies were included when present . Ste12 motifs were also enumerated in the rest of the intergenic regions in each species . Enrichment of the ste12 motif in either the a - specific genes or the general pheromone response genes with respect to the rest of the genome was calculated using the hypergeometric distribution at all possible cutoffs of number of ste12 motifs . The cutoff giving the most significant p - value was chosen, because this represented the most stringent test of our hypothesis that the a - specific genes lacked ste12 sites in the kluyveromyces and candida clades . Sequence data were obtained from the yeast gene order browser (ygob) and the joint genomes institute (jgi) websites (http://ygob.ucd.ie and http://genome.jgi.doe.gov, respectively). Constructs for gene disruption, epitope tagging, and promoter replacement were generated by fusion pcr . Three to five individual pcr components were amplified using extaq (takara), and 50 ng of each were combined into a single 50 l reaction along wth 0.5 l extaq, 0.4 l 25 mm dntps, 0.1 l of each 100 m primer . The reactions were incubated in a thermocycler: 95c 3:00, [95 0:30, 55 0:30, 72 1:00/kb] x 4, [95 0:30, 5872 0:30 (depending on the annealing temperature of the primers), 72 1:00/kb] x 30, 72 10:00 . The gfp reporters for k. lactis, l. kluyveri, and s. cerevisiae were constructed from the original vector that was made for use in k. lactis . Pts12 was made from a 5-piece fusion pcr, digested with kasi and hindiii (new england biolabs) and ligated into puc19 using fast - link ligase (epicentre biotechnologies). Vectors were treated with antarctic phosphatase (new england biolabs) for 30 minutes prior to ligation . The reporter consisted of the upstream flanking region of the k. lactis trp1 gene, the s. cerevisiae trp1 gene, the entire s. cerevisiae cyc1 upstream intergenic region, the cagfp and act1 terminator, and the downstream flanking region of k. lactis trp1 . The s. cerevisiae trp1 gene was replaced with the hygromycin resistance marker from pfa6-htb - hphmx4 by digestion with bsiwi and pmli and ligated to make pts16 . Dna oligos with sites for noti and bamhi sites were annealed in fast - link ligase buffer (epicentre biotechnologies) and ligated in a 50:1 insert to vector ratio to make pts26 . This vector was used to make the other reporters for use in k. lactis by ligating annealed oligos or digested pcr products into the noti and xhoi sites . Vectors incorporating an entire intergenic region of a gene were constructed by ligating digested pcr products the sites saci and agei . The l. kluyveri reporter was made by cloning upstream and downstream homology to the trp1 locus into the ngomiv / bsteii and blpi / hindiii sites, respectively . These homology regions were then swapped out for homology to the ura3 locus to improve the efficiency of integration of the reporter by selection with 5-foa . The altered regions of the l. kluyveri ste2 promoter were cloned as with the k. lactis reporter . The s. cerevisiae reporter was made by cloning the ste2 promoter fused to gfp into a centromeric reporter, prs412, using the kpni and saci sites . To measure the pheromone response in a strain that lacks mata2, we replaced the promoter of ste2 with that of a general pheromone response gene that is not dependent on a2 . Strain yts43 in which the ste2 promoter was replaced by the sst2 promoter was made in the mata2 background . This replacement construct consisted of a 4-piece fusion pcr that contained 5 homology, the ura3 marker, the sst2-promoter, and 3 homology . K. lactis and l. kluyveri were transformed with 1 g dna according to published protocols, and s. cerevisiae was transformed using a standard lithium acetate protocol . K. lactis cells were grown overnight for ~14h, then starved in sd medium lacking phosphate as previously described . Cells were induced after 6h with 6.25 m -factor pheromone (wswitlrpgqpif> 95% purity, 100mg / ml in 100% dmso; genemed synthesis) or an equivalent amount of dmso . Cells were removed at several time points and were pelleted, washed, and frozen in liquid nitrogen . Rna was extracted using the ribopure rna purification kit (ambion). The rna was reverse transcribed into cdna using superscript ii as described previously . Transcript levels were measured using sybr green on a steponeplus rt pcr machine (applied biosystems). Transcripts were normalized to that of vps4, a gene that was found to be highly consistent across conditions in previous expression experiments . Strains yts314 and yts315 were grown using a phosphate starvation protocol modified from our previously published protocol . Yeast were grown overnight for ~14h, then pelleted, resuspended in phosphate starvation media, then diluted in 100200ml phosphate starvation media to od600 = 0.25 0.3 . These cultures were grown for 2h, then 13-mer -factor pheromone was added to 6.25 m, and the cultures were grown for an additional 2h . Cells were crosslinked with 1% formaldehyde for 15 minutes, quenched with glycine, pelleted, washed, and frozen in liquid nitrogen . Cells were lysed in 300700l lysis buffer (50 mm hepes / koh ph 7.5, 140 mm nacl, 1 mm edta, 1% triton x-100, 0.1% na - deoxycholate) with added edta - free protease inhibitor tablet (roche). Cells were transferred to a fresh tube with 500l 0.4 mm glass beads, and were lysed for ~45min on a vortex genie with tube adaptor (labrepco). Lysate was recovered by centrifugation, and sonicated 34x on a diagenode bioruptor (level 5, 30s on, 1min off). Lysate was cleared by centrifugation at max speed in a table - top centrifuge at 4 c . Immunoprecipitation was carried out overnight with 300l cleared lysate, 200l fresh lysis buffer, and 10l 200g / ml anti - c - myc antibody (invitrogen). 50l of washed protein g sepharose beads 50% slurry was added and incubated for 2h . Crosslinking was reversed by incubating 16h at 65 c, and immunoprecipitated dna was recovered using the minelute kit (qiagen). Chip - seq libraries were prepared using the nebnext chip - seq library prep kit for illumina (new england biolabs) and ampure xp magnetic beads (beckman coulter, inc). Libraries were pooled and sequenced on a hiseq 2500 (illumina) through the ucsf center for advanced technology (cat.ucsf.edu). File types were manipulated using samtools, and peaks were called using macs . Coverage and peak the chip experiment was performed with a total of three replicates on two separate days, and a single replicate was performed of the untagged control . K. lactis reporter strains were grown as 1ml cultures in sd medium overnight for ~14h in a 96 well plate . Cells were pelleted, resuspended in phosphate starvation medium, and diluted to od600 = 0.25 . Cells were grown 6h, then induced with 6.25m -factor (or dmso for control cells) for 4h . Cells were diluted 10-fold into the same media before measuring gfp fluorescence on a bd lsr ii flow cytometer . Cells were gated to exclude debris and the mean of the cell population was used for further analysis . The autofluorescence level of a cell containing no reporter was subtracted from each reporter strain, and the standard deviation of each reporter strain was added to the standard deviation of the autofluorescence strain . Values were divided by the mean autofluorescence to give an indication of the signal relative to noise . Multiple independent isolates were tested for each reporter strain, and each experiment was performed separately two or more times . In rare cases where one isolate displayed a drastic difference in expression from the others, it was tested to see whether it was a statistical outlier, and if so, was removed for subsequent experimental repetitions . Statistics for the reporter assays were conducted using an anova followed by tukey s hsd test . The intergenic sequences for the a - specific genes were obtained from ygob for the species s. cerevisiae, s. paradoxus, s. mikatae, s. uvarum, and s. kudriavzevii . 19 k. lactis strains were obtained from the phaff yeast culture collection (davis, california). From these and 3 additional k. lactis strains, a - specific gene intergenic sequences were amplified from both directions using extaq (takara) and sanger sequenced . The intergenic regions from the saccharomyces sensu stricto and k. lactis species complex were then analyzed separately as follows . For each species or isolate, the a - specific gene intergenic regions were scored for the presence of strong and weak ste12 cis - regulatory regions . The appropriate nucleotide evolution model was selected as previously described; the hky+g model was selected for the sensu stricto species, and the gtr+g model was selected for k. lactis . These models output the estimated evolutionary rate for each site in the alignment and each site was categorized as being part of a consensus or mismatched ste12 cis - regulatory site in at least one species, or no site at all . Then, the trees generated by this method were used as input to test for different evolutionary rates among the different categories using the rphast package . The null model was generated using phylofit on the intergenic regions lacking mismatched and consensus ste12 sites using the model for the sensu stricto species and the rev model for k. lactis . Then, the mismatched and consensus ste12 sites were tested for increased conservation in comparison the null model using phylop . Expression of the asg ste2 and the general pheromone - activated gene fus3 in the presence of k. lactis ste12, in the absence of ste12, and in the presence of s. cerevsiae ste12 . Expression under uninduced and pheromone - induced conditions are shown as mean fluorescence of three independent genetic isolates + / s.d . Individual a - specific genes and general pheromone - activated genes were scored for the presence of ste12 cis - regulatory motifs in their upstream regulatory regions . Shown is the number of consensus ste12 sites within 600bp of the translation start site . The enrichment for the ste12 motif in each set of genes in each species is shown in figure 1c . Asgs were scored for the presence of weak ste12 binding sites in their upstream regulatory regions . The enrichment of the ste12 site in the asgs in each species is shown in the bottom row . The s. cerevisiae ste2 promoter was fused to gfp and the role of ste12 cis - regulatory sites in expression . Expression under uninduced and pheromone - induced conditions are shown as mean fluorescence of three independent genetic isolates + / s.d . The k. lactis ste2 gfp reporter and heterologous reporter containing the a2-mcm1 binding site were transformed into wild type and ste12 cells . The k. lactis ste2 gfp reporter was tested with a mutated mcm1 cis - regulatory site . Shown is mean fluorescence of three independent genetic isolates + / s.d . A, the presence of the mcm1 binding site is unchanged across the candida, kluyveromyces, and saccharomyces clades . Asgs were scored for the strength of the mcm1 binding site in their upstream regulatory regions . The enrichment of the strength of the mcm1 site in the asgs in each species is shown in the bottom row . B, a construct with increased mcm1 binding site strength was tested for its ability to compensate for the deletion of a2 . The yeast phylogeny along with the number of ste12 binding sites in extant species was used to estimate the gain and loss rate of the sites over evolutionary time . The saccharomyces clade was allowed to have different rates (orange) (x = 49.33, df = 2, p = 1.94e-11). The gain and loss rate units are cis - regulatory sites per amino acid substitution in the species phylogeny . The evolutionary rate of nucleotides in ste12 binding sites was compared to rates in the rest of the upstream regulatory regions of the a - specific genes, shown as violin plots . Promoters between closely related species were aligned and the evolutionary rate of each basepair in the alignment was determined after model selection.
Although global gene content and detailed sequence similarity comparisons with the previously described megaviridae members clearly classify pgv within the family (including the partially sequenced organic lake phycodnaviruses (olpv), chrysochromulina erecina virus, and phaoecystis pouchetti virus), the finding of a pgv - associated virophage came as a surprise . Complete virophage genomes have now been described, but only 3 correspond to identified and isolated the pgv virophage (pgvv) is the third, and presumably not the last, of a rapidly growing series . Except for their genome size in the 20 kb range, these new types of satellites viruses have little in common in terms of gene content, although they all code for a major capsid protein and one dna primase . Consistent with the fact that it was never observed in pgv - infected cultures, pgvv is the first example of a virophage lacking the information to make a capsid protein, the essential building block of a virus particle . Once multiplied in the pgv virus factory, the pgvv genome is thus packaged (in multiple copies) alongside the pgv genome, and propagated through the pgv virion, either as an integrated or free viral plasmid . The precise molecular structure(s) the finding of a virophage associated to pgv is already teaching us the important lesson that virophages are not solely associated to dna viruses with micron - sized particles and 1 mb genome sizes, but can be found with large dna viruses of more reasonable (poxvirus - like?) Proportion . It is thus likely that many of such associations have been overlooked in the past, and that virophages might have played a fundamental role in the evolution of many more viruses than just the megaviridae . If this is true, they could be (and have been) the main vehicle of gene transfers between eukaryotic viruses, and indirectly between these viruses and their hosts . They may also be responsible for the sporadic occurrences of mobiles elements such as self - splicing introns, inteins, and transpovirons . Another lesson is that, like all parasites, the virophages are submitted to the irreversible phenomenon of reductive evolution, condemning them to disappear as individual biological entities, eventually saving some of their genes by integrating them into the genome of their companion virus, themselves undergoing a similar process vis - - vis their cellular host . The first published phylogenetic tree including mimivirus 2 and using a concatenation of 7 universally conserved protein sequences, already pointed out that: we could now build a tentative tree of life, within which mimivirus appears to define a new branch distinct from the three other domains . Elsewhere in the same article, mimivirus was also shown to be part of the broad family of the nucleocytoplasmic large dna viruses (ncldv), branching near the middle of the previously defined iridovirus, phycodnaviruses, poxviruses, and asfarviruses lineages . Put together, these 2 results suggested in a subliminal way that all the large dna viruses were in fact defining a domain distinct from the 3 established cellular domains . As additional genomes of megaviridae became available, molecular phylogenies computed with an increasing number of universal proteins associated to basic functions (dna clamp loaders, ribonucleotide reductases, aminoacyl - trna synthetases, dna polymerases) kept clustering the megaviruses in their own clade, clearly separate from the cellular domains, thus contributing an additional domain rooted in between archaea and eukarya in the tree of life . Despite receiving increasing support from various authors, others remain strongly opposed to this view . In agreement with the notion of a fourth domain of life anchored by the largest dna viruses, the dna polymerase of pgv nicely clusters with the other megaviridae homologs, exhibiting no affinity with any of the main cellular lineages (fig . 1). Based on the presence of a vestigial protein translation system, i previously argued that the genome of today's giant viruses derived from an ancestral cellular organism through the irreversible process of reductive evolution experienced by all parasites . Dna viruses exhibiting a whole range of genomic complexity could have been generated through this continuous process: viruses would have lost translation first (the ribosome), then transcription (the rna polymerase), then dna replication (the dna polymerase), following an evolutionary scenario whereby they become increasingly dependent from their host . The vast range of size and complexity among today's dna viruses might thus be the results of differences in their evolution rates (the largest ones experiencing the least evolutionary pressure). In this context, the lack of affinity of the giant viruses with any of today's cellular domains, as well as the huge proportion of the viral genes without cellular homolog, would suggest that the lineage of the ancestral cellular organism that gave rise to giant viruses became extinct as a cellular life form, and only managed to survive as a parasitic fourth domain . The recently described giant pandoravirus might represent an independent instance of the same scenario . The tree was produced using the default option on the mafft server (url: mafft.cbrc.jp) from the multiple alignment of 25 dna polymerase b sequences (510 ungapped positions, excluding the inteins). Branches with bootstrap values <80 are collapsed . Despite infecting eukaryotic hosts from vastly divergent phyla, the viruses do not show any phylogenetic affinity with a specific eukaryotic group, and cluster (in red) separately from the 3 cellular domains: eukarya (green), archaea (purple), and eubacteria (blue). This strongly supported topology suggests that the common ancestor of the megaviridaelargely predated the radiation of the eukaryotes.
The aryl hydrocarbon receptor (ahr) is a transcription factor activated by numerous environmental ligands such as dioxins and polycyclic aromatic hydrocarbons (pahs). Its endogenous ligand has not yet been described, but some endogenous compounds, notably oxidative derivatives of tryptophan, are already described as efficient activators . Following ligand binding, ahr translocates to the nucleus, dimerizes with its partner the aryl hydrocarbon receptor nuclear translocator (arnt), and binds to xenobiotic responsive elements (xre) in target genes . Ahr is known to be a key regulator of some xenobiotic degradation enzymes, notably cytochromes p450 belonging to the cyp1 family, which are involved in the bioactivation of various environmental procarcinogens including pah and arylamines . The ahr - mediated pathway is commonly viewed as an adaptive response toward these xenobiotic agents . Recent data demonstrated that ahr mediates diverse endogenous functions in our close vertebrate relatives as well as our distant invertebrate ancestors, including cell proliferation, adhesion and migration, and inflammation [2, 3]. Accidental exposure to dioxins, which are prototypes of environmental ahr ligands, leads to a broad spectrum of pathologies, ranging from cancers to cardiovascular diseases and type 2 diabetes [46], all of which involve an inflammatory process . Using a triple - null mouse model that lacks the two receptors for tnf and tnf and the receptor for the il-1 and il-1 cytokines, it was demonstrated that il1-like cytokines play a central role in dioxin - induced inflammatory effects . We have shown in intestine that pah - induced ahr activation upregulates the expression of some inflammation target proteins, including proinflammatory cytokines such as il-1 and tnf [8, 9]. Similar data have been observed in other cells and tissues, ranging from macrophages and breast cells to skin and lung [1013]. Moreover, hollingshead et al . Showed that 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd) treatment in combination with il-1 or phorbol 12-myristate 13-acetate (pma) results in a marked synergistic induction of il-6 levels over what is seen without ahr activation . Since tcdd induces il-6 expression through the ahr pathway, this synergistic effect could be partly explained by an inflammation - induced increase in ahr expression . The aim of this study on caco-2 cells was to investigate the effect of signals known to be proinflammatory on ahr expression and to describe the molecular mechanisms involved . Phorbol 12-myristate 13-acetate (pma) was sourced from sigma (france), il-1 from peprotech (france), anti - il1 antibody (ab2105) from abcam (france), and proteasome inhibitor set i from calbiochem (france). Caco-2 human colonic adenocarcinoma cells and thp1 human monocytic cells were cultured as previously described [8, 14]. At confluence, cells were starved for 12 h without fbs (replaced by 0.2% bsa) and treated for 1 h to 24 h with either 100 nm pma or 200 nm il-1. In some experiments, caco-2 or thp-1 cells were treated with conditioned media . To obtain the conditioned media, cells were treated for 2 h with 100 nm pma, washed 3 times with pbs, and further cultured in 0.2% bsa medium . Media samples were collected after 224 h incubation, and a new caco-2 batch was treated for 8 h with these conditioned media . Total rna was isolated using a nucleospin rnaii kit (macherey - nagel, france) and reverse - transcribed at 42c for 1 h using gibcobrl m - mlv reverse - transcriptase (life technologies, france) and random primers . Expression levels of target genes (ahr, il1-, il-8, tnf, and tgf) were determined using a lightcycler 480 system (roche, france). Pcr was performed with 0.5 m of each primer using the lightcycler with mastermix plus for sybr green i no rox . Cycling conditions were 10 min denaturation at 95c, followed by 40 cycles of 30 s denaturation at 95c, 30 s primer annealing at 60c, and 30 s fragment elongation at 72c . Ahr, il-1, il-8, tnf, and tgf mrna expressions were normalized to 2-actin expression, and data were quantified by the 2 method . The 2.7 kb of the human ahr gene 5-flanking region (the 2103/+637 region of the ahr gene) was subcloned into the pgl3-enhancer luciferase vector (promega, france) as previously described to obtain the p3.48 construct . Transient transfections were performed by lipofection (lipofectin, life technologies) in a serum - free and antibiotic - free medium containing 2% l - glutamine, with 0.5 g of p3.48 . After 48 h treatment with 100 nm pma, luciferase activity was evaluated using the luciferase assay system from promega . Ahr promoter analysis with mathinspector software (genomatix software, germany) revealed the presence of 3 ap1 and 3 nfb putative binding sites . These sites were mutated using the quickchange site - directed mutagenesis kit (stratagene, france). Cells were transfected with 0.5 g of the mutated vectors, and after a 48 h treatment with 100 nm pma, luciferase activity was evaluated as described above . Statistical analysis was performed using a mann - whitney test on graphpad prism (graphpad software). In order to evaluate the effect of proinflammatory conditions on ahr mrna levels, caco-2 cells were treated with pma or with il-1. The maximal (4.9-fold) induction of ahr mrna was observed after 8 h of treatment with pma (figure 1(a)). We also evaluated the expression of various cytokines after exposure to pma (figure 2). Peak tnf, il-1, and tgf upregulation (10-, 53-, and 286-fold, resp .) Occurred after 8 h of exposure . Treatment of caco-2 cells with the proinflammatory cytokine il-1 was also associated with an increase in ahr mrna that was maximal (6.5-fold) after 8 h of treatment (figure 1(b)). Taken together, these results showed that enhancement of ahr expression was associated with signals involved in proinflammatory processes . To see whether ahr induction (mrna) in response to pma was associated with an increase in ahr transcription, reporter gene expression was analyzed using the p3.48 construct in which luciferase expression was driven by the ahr promoter . Treating wt p3.48-transfected caco-2 cells with 100 nm pma led to a 2.3-fold increase in luciferase expression (figure 3), showing that increased ahr expression in response to pma was mainly of transcriptional origin . Pma is well known to potentialize inflammation - related processes through ap-1 and nfb pathways . Ahr promoter analysis using matinspector software revealed the putative presence of 3 ap-1 and 3 nfb binding sites . The mutation of ap-1 sites did not modify ahr induction by pma (data not shown), suggesting that only the nfb pathway was involved . The effects of mutations of the three nfb binding sites found in the ahr promoter are summarized in figure 3 . The mutation of one of the three sites did not significantly modify luciferase induction, whereas mutation of the first site proved most efficient . Double mutation of sites 2 and 3 reduced the induction of luciferase expression by 45%, while mutation of all three sites totally abrogated this induction . Taken together, these data strongly suggest that ahr induction involves the nfb pathway . In order to gain stronger confirmation of the role of nfb in ahr expression, we reduced nfb activation by inhibiting ib degradation using a supplier - specified proteasome inhibitors cocktail that includes proteasome inhibitor i, lactacystin, and mg-132 . As shown in figure 4, using the proteasome inhibitor cocktail led to a 65% reduction in ahr induction by 100 nm pma, along with an 86% decrease in il-1 enhancement, demonstrating that the proteasome inhibitor cocktail was able to prevent the il-1 induction triggered by the nfb transduction pathway . Caco-2 cells are able to produce cytokines, notably tnf and il-1, in response to proinflammatory signals . Therefore, treating caco-2 cells with conditioned media from pma - treated caco-2 cells should result in ahr induction . Media collected from 6 to 24 h after treating caco-2 cells with pma significantly upregulated ahr mrna . Maximal activity (4.2-fold increase) was obtained with the 24 h conditioned medium (figure 5(a)). Pretreating the cells with an il-1 neutralizing antibody (dilution 1/100) 4 h before exposure to 24 h pma - conditioned medium inhibited the induction of ahr expression, while pretreatment with rabbit isotype igg had no effect (figure 5(b)). In another experiment, caco-2 cells were treated with conditioned media from pma - treated thp-1 cells, and similarly we observed an induction of ahr mrna (4.4-fold increase) (figure 5(c)). Our data therefore point to the involvement of a signalization loop which could lead to an enhancement of inflammatory processes . This study suggested the induction of an inflammation loop resulting from an initial ahr activation in the colon . Indeed, this tissue through diet is effectively chronically exposed to various ahr ligands such as pah or food residues like dioxins or polychlorobiphenyls . Our results obtained in caco-2 cells clearly demonstrated that both pma- and il1- enhance ahr transcript expression . This phenomenon was associated with an increase of ahr promoter activity . As inflammation - related processes mainly involve nfb and ap-1 transduction pathways, we carried out site - directed mutagenesis of ap-1 or nfb binding sites . Mutagenesis of ap-1 was unable to decrease the induction of ahr promoter activity, whereas mutation of the 3 putative nfb binding sites abrogated the increase in ahr promoter activity . We also pretreated cells with a proteasome inhibitor cocktail in order to prevent degradation of the ib subunit and therefore inhibit nfb activation . This pretreatment inhibited both the induction of ahr expression after pma exposure and the increase of il-1 expression, which is known to be mainly regulated by nfb . Taken together, these results demonstrated that proinflammatory conditions induce ahr expression at least partly through the nfb pathway . Caco-2 cells express a number of cytokine receptors on their cellular membrane and are also able to secrete proinflammatory cytokines in response to initial inflammatory signals . Our results demonstrated that treating caco-2 cells with a conditioned media derived from pma - treated cells also leads to an increase of ahr expression, and that this induction involved il-1 signaling . These results are consistent with our results from site - directed mutagenesis experiments and the treatments of cells with proteasome inhibitors . Moreover, these data suggested that an autocrine loop could occur and probably generate and amplify a proinflammatory signal . Indeed, environmental exposure to ahr agonists like pahs has been demonstrated to induce the expression of proinflammatory cytokines such as il-1 [8, 9] and to activate nfb . Our data demonstrated that proinflammatory conditions induced and sustained through ahr expression could, therefore, increase cell susceptibility to pah - induced inflammation . Pahs are potent ahr ligands that are present in tobacco smoke as well as diet, notably grilled meats . Cigarette smoking is emerging as a strong risk factor in the otherwise unknown etiology of chronic inflammatory diseases . There are reports of a dose - response relationship between exposure to tobacco smoke and inflammatory bowel disease (ibd). The exact mechanisms by which smoking influences the development of ibd are poorly understood, but nicotine does not appear to play a critical role . Interestingly, a recent study in dextran sulfate sodium - induced colitis mice reported that the attenuation of ahr expression resulted in a protective effect . Moreover, ahr and its downstream targets, such as il-8, were significantly upregulated in ibd patients versus controls . The authors concluded that abnormal ahr pathway activation in the intestinal mucosa of ibd patients may promote chronic inflammation, and our results support this hypothesis . Figure 6 proposes a possible explanation of the link between the ahr pathway and ibd . Pahs such as benzo(a)pyrene, are bioactivated by cyp1 family enzymes into diolepoxides, such as benzo(a)pyrene diol epoxide, which activate nfb . The activation of nfb promotes an inflammatory loop via il-1 expression and induces ahr expression . The upregulation of ahr would, in response to pah exposure, enhance both cyp1 inducibility and pah - inflammatory properties . Nfb - controlled pathways were classically divided into two branches: the classical pathway involving rela subunit and ikk and the alternative pathway involving relb subunit and ikk. Physical interactions between ahr and each one of the nfb subunits were reported to induce distinct effects via specific sequences . Interaction of ahr with rela induced a downregulation of gene expression controlled by rela as in the case of cyp1a1 or il-6 gene . In opposite, interaction of ahr with relb enhances dre - reporter gene activity of cyp1a1 and transcription of some nfb target genes such as il-8 and other chemokines through binding on specific relb / ahre sequences [23, 24]. Furthermore, nfb - binding sites that are preferentially recognized by relb / p52 are spontaneous targets for relb / ahr complexes (i.e., independently of addition of any exogenous ligand). Relb / ahr complexes are also found to bind on xre, as well as nfb consensus elements, and relb drastically increases the tcdd - induced xre - luc reporter activity . Vogel and matsumura propose that ahr assists the function of relb not only to mediate chronic inflammation but also to promote relb's function in resolution of inflammation via negative feedback mechanisms, whereas ahr antagonizes the action of rela to moderate acute cellular inflammation and/or protect cells from unwanted side effects of full activation of inflammatory effects of rela . Our data showed that in vitro, proinflammatory conditions enhance ahr expression through nfb pathway, therefore, it would be of interest to evaluate if the enhanced expression of ahr was also associated with an increase of relb / ahr complex formation and if such an interaction promotes in vivo either inflammation or its resolution . In conclusion, we demonstrated for the first time that compounds inducing proinflammatory cytokine expression enhance ahr expression in intestinal epithelial caco-2 cells through the nfb transduction pathway . Several pieces of evidence point to ahr as a potential new target in the management of ibd and suggest that the modulation of ahr signaling pathway via diet, smoking cessation, or the consumption of ahr antagonists such as resveratrol could be a viable new strategy for the prevention and treatment of ibd.
Pseudomonas aeruginosa is one of the major causes of nosocomial diseases; it can secrete a diversity of virulence factors and in parallel forms biofilms to ensure the infection success . The production of key virulence factors in p. aeruginosa and other important pathogenic bacteria is regulated by a cell - to - cell communication mechanism known as quorum sensing (qs). This mechanism enables bacteria to detect their population density through the production, release, and perception of small diffusible molecules called autoinducers and to coordinate gene expression accordingly . In p. aeruginosa, two qs systems (las and rhl) drive the production (by the synthetases lasi and rhli) and the perception (by the transcription factors lasr and rhlr) of the acyl - homoserine lactones (ahls) n-(3-oxododecanoyl)-l - homoserinelactone (3-oxo - c12-hsl) and n - butanoyl - l - homoserine lactone (c4-hsl), respectively . Once lasr interacts with 3-oxo - c12-hsl, it induces the las system (by increasing lasi expression) and triggers the production of lasb elastase, lasa protease, apr alkaline protease, and exotoxin a . Rhlr interacts with c4-hsl, resulting in an enhancement of the production of rhamnolipids, pyocyanin, lasb elastase, hydrogen cyanide, and cytotoxic lectins [3 - 5]. In addition, biofilm formation and maturation is also regulated by las system and indirectly by rhl system under nutritional condition . Indeed, some studies demonstrated the role of rhamnolipids in biofilm architecture and maintenance [10 - 12]. The las and the rhl systems are organized in a hierarchical manner where the las system regulates the rhl system at the transcriptional and posttranscriptional levels . In addition, p. aeruginosa releases a third intercellular signal, 2-heptyl - hydroxy-4-quinolone (designated the pseudomonas quinolone signal), which interacts with the ahl systems in an intricate way and acts as a link between the las and rhl quorum - sensing systems . Since fundamental virulence processes in many pathogenic bacteria are regulated by qs systems, an interesting strategy to overcome the emergence of antibiotic - resistant microorganisms is to interfere with this cell - to - cell communication mechanism in order to attenuate their virulence . Thus, medicinal plants traditionally used to treat infectious diseases should be screened, not only for their antimicrobial properties, but also for their capacity to inhibit qs mechanisms in bacteria . In this study, we investigated the qs inhibitory (qsi) effects of extracts from a congolese medicinal plant, cordia gilletii de wild . The root barks extracts from this plant species are used for the treatment of malaria and diarrhea (decoction), for wounds and skin diseases (topical application), whereas leaves decoction is used against malaria . Root barks and leaves of c. gilletii were collected in kisantu area the (democratic republic of congo) in january 2005, and voucher specimen has been deposited under the number br - sp.627986 at the national botanical garden of meise, belgium . Powders of the two - plant parts were exhaustively and successively extracted with solvents of increasing polarity (n - hexane, dicholoromethane, ethyl acetate and methanol). The evaporation of solvents in buchi rotavapor yielded crude extracts, which were dissolved in dimethyl sulfoxide (dmso) at a final concentration of 10 mg / ml . P. aeruginosa pao1 wild - type and reporter strains were grown in liquid lb cultures (5 ml) supplemented with 50 mm 3-(n - morpholino) propanesulfonic acid (mops; ph 7.0) at 37c supplemented with carbenicillin (300 g / ml) when appropriate as described previously . For the detection of anti - qs activity, we used reporter strains including six pao1-derived strains harboring qs - related promoter - lacz fusions (lasb - lacz; rhla - lacz; rhli - lacz, rhlr - lacz; lasi - lacz and lasr - lacz), and pao1-derived strains harboring qs - independent acea gene (acea - lacz), described previously . Inhibition of pyocyanin and elastase production in p. aeruginosa pao1 wild type was assessed according to previously described procedures . Briefly, p. aeruginosa pao1 were grown overnight polystyrene tube containing 5 ml of lb - mops medium (37c and agitation at 175 r.p.m). The cells were washed twice in fresh lb - mops medium, and the pellets were suspended in lb - mops medium . Then, 50 l portions of the cell suspension were added to 940 ml of lb - mops, spectrometrically evaluated at 600 nm (in order to obtain a a600 ranging between 0.020 and 0.025, corresponding to ~10 cfu / ml) using a spectramax m2 device (molecular devices, california, usa) and supplemented with 10 l of dmso (1% [vol / vol], final concentration) or 10 l of plant extract dissolved in dmso (100 g / ml, final concentration). After 18 h of growth, samples were taken to assess the growth (a600). After centrifugation (16,000 g, 5 min), 900 l of supernatant were mixed with 500 l of chloroform in eppendorf tube . The organic phase was transferred in a new eppendorf tube and pyocyanin was extracted with 300 l of hcl 0.2 n and quantified spectrometrically at 380 nm . Lasb elastase production was assessed through the measurement of elastase activity using elastin - congo red (a495 nm). The statistical significance of each test (n = 6) was evaluated by conducting student s t - tests using the graphpad prism software (graphpad software inc . Pao1 reporter strains were prepared as described for pyocyanin quantification (see previous section). Pao1 strains (50 l) were grown in 940 l of lb medium at 37c under agitation (175 r.p.m), supplemented with 10 l of plant extract or naringenin (4 mm, final concentration) or dmso (1% [vol / vol], final concentration) and incubated for 18 h. after incubation, the cell growth was assessed as previously and the absorbance of the medium after centrifugation of the bacteria (16,000 g, 5 min) was used as a blank . The sample used for cell growth assessment was used to perform the b - galactosidase assay with o - nitrophenyl - b - d - galactopyranoside as previously described . Quantification of biofilm formation by p. aeruginosa pao1 was assessed according to previously described procedures . Pao1 cells were incubated statically for 24 h at 37c in 24-well polystyrene plates containing biofilm broth medium (na2hpo4 1.25 g / l, feso4.7h2o 0.0005 g / l, glucose 0.05 g / l, (nh4)2so4 0.1 g / l, mgso4.2h2o 0.2 g / l, kh2po4 0.5 g / l) supplemented with plant extract (100 g / ml) or dmso 1% or naringenin (4 mm). After 24 h of incubation, biofilm biomass was quantified via crystal violet staining . Root barks and leaves of c. gilletii were collected in kisantu area the (democratic republic of congo) in january 2005, and voucher specimen has been deposited under the number br - sp.627986 at the national botanical garden of meise, belgium . Powders of the two - plant parts were exhaustively and successively extracted with solvents of increasing polarity (n - hexane, dicholoromethane, ethyl acetate and methanol). The evaporation of solvents in buchi rotavapor yielded crude extracts, which were dissolved in dimethyl sulfoxide (dmso) at a final concentration of 10 mg / ml . Aeruginosa pao1 wild - type and reporter strains were grown in liquid lb cultures (5 ml) supplemented with 50 mm 3-(n - morpholino) propanesulfonic acid (mops; ph 7.0) at 37c supplemented with carbenicillin (300 g / ml) when appropriate as described previously . For the detection of anti - qs activity, we used reporter strains including six pao1-derived strains harboring qs - related promoter - lacz fusions (lasb - lacz; rhla - lacz; rhli - lacz, rhlr - lacz; lasi - lacz and lasr - lacz), and pao1-derived strains harboring qs - independent acea gene (acea - lacz), described previously . Inhibition of pyocyanin and elastase production in p. aeruginosa pao1 wild type was assessed according to previously described procedures . Briefly, p. aeruginosa pao1 were grown overnight polystyrene tube containing 5 ml of lb - mops medium (37c and agitation at 175 r.p.m). The cells were washed twice in fresh lb - mops medium, and the pellets were suspended in lb - mops medium . Then, 50 l portions of the cell suspension were added to 940 ml of lb - mops, spectrometrically evaluated at 600 nm (in order to obtain a a600 ranging between 0.020 and 0.025, corresponding to ~10 cfu / ml) using a spectramax m2 device (molecular devices, california, usa) and supplemented with 10 l of dmso (1% [vol / vol], final concentration) or 10 l of plant extract dissolved in dmso (100 g / ml, final concentration). After 18 h of growth, samples were taken to assess the growth (a600). After centrifugation (16,000 g, 5 min), 900 l of supernatant were mixed with 500 l of chloroform in eppendorf tube . The organic phase was transferred in a new eppendorf tube and pyocyanin was extracted with 300 l of hcl 0.2 n and quantified spectrometrically at 380 nm . Lasb elastase production was assessed through the measurement of elastase activity using elastin - congo red (a495 nm). The statistical significance of each test (n = 6) was evaluated by conducting student s t - tests using the graphpad prism software (graphpad software inc ., ca, usa), and a p 0.01 was considered significant . Pao1 reporter strains were prepared as described for pyocyanin quantification (see previous section). Pao1 strains (50 l) were grown in 940 l of lb medium at 37c under agitation (175 r.p.m), supplemented with 10 l of plant extract or naringenin (4 mm, final concentration) or dmso (1% [vol / vol], final concentration) and incubated for 18 h. after incubation, the cell growth was assessed as previously and the absorbance of the medium after centrifugation of the bacteria (16,000 g, 5 min) was used as a blank . The sample used for cell growth assessment was used to perform the b - galactosidase assay with o - nitrophenyl - b - d - galactopyranoside as previously described . Quantification of biofilm formation by p. aeruginosa pao1 was assessed according to previously described procedures . Pao1 cells were incubated statically for 24 h at 37c in 24-well polystyrene plates containing biofilm broth medium (na2hpo4 1.25 g / l, glucose 0.05 g / l, (nh4)2so4 0.1 g / l, mgso4.2h2o 0.2 g / l, kh2po4 0.5 g / l) supplemented with plant extract (100 g / ml) or dmso 1% or naringenin (4 mm). After 24 h of incubation, biofilm biomass was quantified via crystal violet staining . C. gilletii root barks and leaves extracts were investigated for their effect on pyocyanin production . As shown in figure 1a, all tested extracts decreased drastically pyocyanin production with no significant effect on p. aeruginosa pao1 growth when compared to the dmso control . Besides, all extracts (except root barks methanol and leaves dichloromethane extracts) decrease significantly elastase production in pao1 although less spectacular compared to pyocyanin reduction [figure 1b]. In addition, no elastase - like activities (which could interfere with the tests) were observed when the extracts were used in bacteria - free control tests (data not shown). Effect of cordia gilletii root barks and leaves extracts on pyocyanin and elastase production in pseudomonas aeruginosa pao1 . (a) effect of c. gilletii root barks and leaves extracts on pyocyanin production in p. aeruginosa pao1 . (b) effect of c. gilletii root barks and leaves extracts on elastase production in p. aeruginosa pao1 (hexane: n - hexane, dcm: dichloromethane, etoac: ethyl acetate, meoh: methanol). All experiments were performed in six replicates in the case of the decrease of pyocyanin and elastase production was due to the interference of c. gilletii extracts with qs mechanisms, we assessed the impact of c. gilletii extracts on qs - regulated genes lasb and rhla genes (coding for lasb elastase and rhamnolipid, respectively) expression . Therefore, the effect of c. gilletii extracts on lasb and rhla genes expression was monitored by using two pao1 reporter strains harboring qs - related (lasb and rhla) promoter - lacz fusions . Pao1 reporter strain harboring qs - independent acea gene (coding for isocitrate lyase) was used to verify that the drop in b - galactosidase activity was indeed associated with a reduction in qs - related gene expression rather to a general effect on transcription / translation mechanisms . Naringenin, a flavanone, which is known to affect qs signaling in p. aeruginosa pao1 without affecting bacterial growth, was used as a positive control . As shown in figure 2, the results highlight that rbdcm extract and leaves methanol extract, at final concentration of 100 g / ml reduce qs - regulated lasb and rhla genes expression without affecting pao1 cells growth . Indeed, colony - forming unit of p. aeruginosa pao1 wild - type and reporter strains grown in the presence of extracts for 18 h were similar to those of dmso - treated cells (data not shown). More interesting, rbdcm extract does not affect the expression of the control gene acea [figure 2c], contrarily to the leaves methanol extract . However, effects of leaves methanol extract on qs - independent acea gene and qs - regulated (lasb and rhla) genes may be the results of two or more different active compounds . Indeed, some compounds could do affect specifically the expression of qs - related genes and others the expression of qs - independent acea gene and/or the transcription machinery without affecting pao1 cells growth . Effect of cordia gilletii extracts on quorum sensing (qs)-regulated genes (a: lasb; b: rhla) expressions, and qs - independent acea gene (c) in pseudomonas aeruginosa pao1 . Gene expression was measured as the b - galactosidase activity of the lacz gene fusions expressed in miller units . Root barks and leaves extracts were tested at 100 g / ml (hexane: n - hexane, dcm: dichloromethane, etoac: ethyl acetate, meoh: methanol). Dimethyl sulfoxide (dmso) (1% [vol / vol], final concentration) was used as solvent control and naringenin (nar: 4 mm, final concentration) as qs inhibitory control . * significance at p <0.05 . All experiments were performed in six replicates since qs - regulated (lasb and rhla) genes expression is impaired by rbdcm extract of c. gillettii, we were interested in its effect on qs systems (lasri and rhlri) in p. aeruginosa pao1 . Therefore, the effect of root barks extract was further characterized by evaluating the expression of the ahl synthetase genes lasi and rhli and the qs regulator genes lasr and rhlr . The results highlight that the rbdcm affects both qs systems (lasri and rhlri) [figure 3]. Indeed, rbdcm inhibits significantly the expression of ahl synthetase genes lasi (24% 5% of inhibition) and rhli (52% 5% of inhibition), and of the qs regulator genes lasr (25% 3% of inhibition) and rhlr (23% 4% of inhibition). Effect of root barks dichloromethane (rbdcm) extract in pseudomonas aeruginosa quorum sensing (qs) regulator genes (a: lasi; b: lasr; c: rhli; d: rhlr). Dimethyl sulfoxide (1% [vol / vol], final concentration) was used as solvent control and naringenin (nar: 4 mm, final concentration) as qs inhibitory control . * significance at p <0.05 . All experiments were performed in six replicates since biofilm formation is partially controlled by qs mechanisms, the effect of rbdcm extract on p. aeruginosa pao1 biofilm formation was assessed after 24 h. noticeably, there were a significant decrease (21% 5% of inhibition) in biofilm formation when strain pao1 was grown in the presence of rbdcm extract (100 g / ml) compared with that of the negative control (dmso) [figure 4]. Effect of root barks dichloromethane (rbdcm) extract in biofilm formation by pseudomonas aeruginosa pao1 . After 24 h of static incubation, biofilm biomass was quantified by using crystal violet staining . Dimethyl sulfoxide (1% [vol / vol], fi nal concentration) was used as solvent control and naringenin (nar: 4 mm, final concentration) as quorum sensing inhibitory control . * c. gilletii root barks and leaves extracts were investigated for their effect on pyocyanin production . As shown in figure 1a, all tested extracts decreased drastically pyocyanin production with no significant effect on p. aeruginosa pao1 growth when compared to the dmso control . Besides, all extracts (except root barks methanol and leaves dichloromethane extracts) decrease significantly elastase production in pao1 although less spectacular compared to pyocyanin reduction [figure 1b]. In addition, no elastase - like activities (which could interfere with the tests) were observed when the extracts were used in bacteria - free control tests (data not shown). Effect of cordia gilletii root barks and leaves extracts on pyocyanin and elastase production in pseudomonas aeruginosa pao1 . (a) effect of c. gilletii root barks and leaves extracts on pyocyanin production in p. aeruginosa pao1 . (b) effect of c. gilletii root barks and leaves extracts on elastase production in p. aeruginosa pao1 (hexane: n - hexane, dcm: dichloromethane, etoac: ethyl acetate, meoh: methanol). In the case of the decrease of pyocyanin and elastase production was due to the interference of c. gilletii extracts with qs mechanisms, we assessed the impact of c. gilletii extracts on qs - regulated genes lasb and rhla genes (coding for lasb elastase and rhamnolipid, respectively) expression . Therefore, the effect of c. gilletii extracts on lasb and rhla genes expression was monitored by using two pao1 reporter strains harboring qs - related (lasb and rhla) promoter - lacz fusions . Pao1 reporter strain harboring qs - independent acea gene (coding for isocitrate lyase) was used to verify that the drop in b - galactosidase activity was indeed associated with a reduction in qs - related gene expression rather to a general effect on transcription / translation mechanisms . Naringenin, a flavanone, which is known to affect qs signaling in p. aeruginosa pao1 without affecting bacterial growth, was used as a positive control . As shown in figure 2, the results highlight that rbdcm extract and leaves methanol extract, at final concentration of 100 g / ml reduce qs - regulated lasb and rhla genes expression without affecting pao1 cells growth . Indeed, colony - forming unit of p. aeruginosa pao1 wild - type and reporter strains grown in the presence of extracts for 18 h were similar to those of dmso - treated cells (data not shown). More interesting, rbdcm extract does not affect the expression of the control gene acea [figure 2c], contrarily to the leaves methanol extract . However, effects of leaves methanol extract on qs - independent acea gene and qs - regulated (lasb and rhla) genes may be the results of two or more different active compounds . Indeed, some compounds could do affect specifically the expression of qs - related genes and others the expression of qs - independent acea gene and/or the transcription machinery without affecting pao1 cells growth . Effect of cordia gilletii extracts on quorum sensing (qs)-regulated genes (a: lasb; b: rhla) expressions, and qs - independent acea gene (c) in pseudomonas aeruginosa pao1 . Gene expression was measured as the b - galactosidase activity of the lacz gene fusions expressed in miller units . Root barks and leaves extracts were tested at 100 g / ml (hexane: n - hexane, dcm: dichloromethane, etoac: ethyl acetate, meoh: methanol). Dimethyl sulfoxide (dmso) (1% [vol / vol], final concentration) was used as solvent control and naringenin (nar: 4 mm, final concentration) as qs inhibitory control . * since qs - regulated (lasb and rhla) genes expression is impaired by rbdcm extract of c. gillettii, we were interested in its effect on qs systems (lasri and rhlri) in p. aeruginosa pao1 . Therefore, the effect of root barks extract was further characterized by evaluating the expression of the ahl synthetase genes lasi and rhli and the qs regulator genes lasr and rhlr . The results highlight that the rbdcm affects both qs systems (lasri and rhlri) [figure 3]. Indeed, rbdcm inhibits significantly the expression of ahl synthetase genes lasi (24% 5% of inhibition) and rhli (52% 5% of inhibition), and of the qs regulator genes lasr (25% 3% of inhibition) and rhlr (23% 4% of inhibition). Effect of root barks dichloromethane (rbdcm) extract in pseudomonas aeruginosa quorum sensing (qs) regulator genes (a: lasi; b: lasr; c: rhli; d: rhlr). Dimethyl sulfoxide (1% [vol / vol], final concentration) was used as solvent control and naringenin (nar: 4 mm, final concentration) as qs inhibitory control . * significance at p <0.05 . Since biofilm formation is partially controlled by qs mechanisms, the effect of rbdcm extract on p. aeruginosa pao1 biofilm formation was assessed after 24 h. noticeably, there were a significant decrease (21% 5% of inhibition) in biofilm formation when strain pao1 was grown in the presence of rbdcm extract (100 g / ml) compared with that of the negative control (dmso) [figure 4]. Effect of root barks dichloromethane (rbdcm) extract in biofilm formation by pseudomonas aeruginosa pao1 . After 24 h of static incubation, biofilm biomass was quantified by using crystal violet staining . Rbdcm extract was tested at 100 g / ml . Dimethyl sulfoxide (1% [vol / vol], fi nal concentration) was used as solvent control and naringenin (nar: 4 mm, final concentration) as quorum sensing inhibitory control . * signifi cance at p <0.05 . Few studies have already been reported the anti - qs effects of plants traditionally used in the treatment of infectious diseases [23 - 26]. C. gilletii belongs to the family of boraginaceae and it is used in congolese traditional medicine . Previously we have shown direct and indirect antimicrobial activities against pathogenic microorganisms . To the best of our knowledge, none of the members of this plant family has been screened so far for inhibitory effects on qs, except for an interfering effect in the vibrio fischerii bioluminescence . In the present investigation, we have shown that p. aeruginosa pao1 growth is not affected by any of the tested c. gilletii root barks or leaves extracts (at 100 g / ml final concentration). Besides, by using a reporter strain coupled to acea gene to evaluate the effect of the c. gilletii extracts on gene transcription machinery, we have discarded all leaves extracts as well as hexane, ethyl - acetate and methanol root barks extracts . Accordingly, only dichloromethane root barks extract was found to specifically reduce in the same time qs - dependent virulence factors (pyocyanin and elastase) production, qs - regulated genes (lasb and rhla) expression as well as qs - regulatory genes, suggesting the occurrence of a tissue specific compound(s) in c. gilletii that affect qs machinery in p. aeruginosa pao1 . However, we cannot exclude that other tested extract contain qsi compounds, particularly for leaves methanol extract which inhibits transcription of the qs - regulated lasb and rhla genes and qs - independent acea gene . Moreover, inhibition kinetic analysis should be led in order to detect time points in which the highest inhibition level of the qs phenotype and the qs genes could be recorded . Biofilm formation in p. aeruginosa represents a protective mode of growth which may enhance bacterial survival under conditions of environmental stress . Interestingly, rbdcm extract was found to specifically reduce biofilm formation by p. aeruginosa pao1, which could be attributed to its qsi propriety . . Demonstrated that the qs dependence of biofilm formation is nutritionally conditional (i.e., qs systems are needed for biofilm formation in growth media with succinate as the sole carbon source but not glucose). Accordingly, as we used glucose as the sole carbon source, we cannot amputate biofilm reduction in the presence of rbdcm extract to the sole qs systems disruption . Since root barks of c. gilletii are known to contain phenolic compounds, this class of molecules could represent one of the putative active compounds as some of them, catechin, naringenin and perbergin have already demonstrated anti - qs effect . However, qsi compounds from c. gilletii can be a new class of chemical structure compared with those flavonoids reported elsewhere and may show a different mechanism of inhibition . Besides, at this stage we do not have sufficient data to speculate the quorum inhibitory mechanism and the transcriptional and/or post - transcriptional level of interference of root barks of c. gilletii . This study highlights anti - virulence propriety of c. gilletii, which could contribute to explain its efficacy in the traditional treatment of infectious diseases caused by p. aeruginosa . Further investigations are needed in order to identify the chemical nature of compound(s) responsible for these observed effects . Isolated compounds will have a greater advantage for human use and search for such compounds may contribute to the prevention of bacterial diseases without the concern of antibiotic resistance . Finally, we must point out that c. gilletii, although belonging to the family of boraginaceae, one of the most important botanical families of plants producing pyrrolizidine alkaloids (pas), does not harbor these alkaloids in investigated root barks and leaves samples (detection limit, 2 g of pas per gram of plant material), excluding thus toxicological risk due to pas and ensuring a probable safe use of this plant.
Compared to many other clinical settings, pain and distress are common complaints in dental clinical practice . Closely linked is that, such complaint of pain or distress among dental patients can be indicative of either a physical or psychological pathology . Although, psychological distress is a non - specific term for negative mood states that encompasses sadness, frustration and anxiety among others; however, it is a valuable indicator of emotional ill - health . This is because psychological distress often refers to both the symptoms of psychiatric disorders and emotional responses to adversity and it is sometimes used as a screening for measure of probable psychiatric morbidity . Despite being contiguous with psychological distress, emotional pain (psychological pain or psychache) is more indicative of a sustained state of inner turmoil, a perception of negative changes in the self and its functions that are accompanied by negative feelings . This pain is deeper and more vicious than depression, although depression may be present as well . For instance, it is known that patients who experience emotional pain or bodily ache without identifiable and adequate physical causes may be symbolically experiencing an intra - psychic conflict or psychological disorder . Dental patients may suffer from both physical diseases and mental disorders presenting with psychological symptoms like mild anxiety and depression . The diagnosis and treatment of mental disorders, therefore, should be especially relevant to dental practitioners . As it is, dental specialists often come across patients, who present with complaints of pain, abnormal sensation and movement around the orofacial region, and hypersalivation, which are manifestations of underlying emotional disturbance and not due to a clearly identifiable physical cause . For instance, existing literature suggest that recognizable psychopathology is seen in about 30% of patients attending dental clinics with complaints of distress or pain, and this often goes undetected and untreated . Early and appropriate recognition of such psychological distress would benefit both the individual patient and health care providers . Moreover, unattended emotional ill - health often delays presentations, compromises treatment adherence and impairs quality of life among dental patients . Importantly, the knowledge of psychological distress and emotional pain among dental patients would directly provide a framework for collaboration between dental practitioners and psychiatrists, and indirectly lead to a better understanding of psychiatric disorders by dental specialists . Unfortunately, there are no controlled study on the prevalence of psychological distress and emotional pain in adult nigerian dental patients to the best of our knowledge following an extensive literature search . Therefore, the aim of this study was to compare, with a matched control, the prevalence of psychological distress and emotional pain among patients attending an outpatient dental clinic in nigeria . We hypothesized that compared to the controls, dental patients would experience significant burden of emotional pain with psychological distress; and some demographic factors would constitute identifiable correlates . A total of 201 participants were recruited over a period of six months into the study . Of these, 101 were dental participants who were attendees of oral and maxillofacial unit of the study hospital . They presented with jaw pain and were to have oral surgery (test group) and were matched with 100 controls (non - patients; normal relatives of dental patients). Specifically, the test subjects consisted of consecutive patients attending the maxillofacial surgical outpatient / exodontia clinic of lagos university teaching hospital . The control participants were selected from non - patients of relatives of dental patients and matched for age and sex with the test group . Selection criteria included: being a patient registered at the dental outpatient clinic, informed consent, aged between 18 and 60 years and no current or past history of psychiatric illness . The study protocol was sent to the health and research ethics committee of lagos university teaching hospital and approval was obtained before commencement of the research . Written informed consent was obtained from each of the participants to take part in the study and assurance was given to participants that they could decline participation at any point without any negative consequences . All data were treated with confidentiality and those with significant distress were counseled and referred for the indicated care . All participants completed a pre - designed socio - demographic questionnaire to elicit variables like age, sex, employment status, and educational status among others . Psychological distress was measured with the general health questionnaire version 12 (ghq-12), which has been widely used in nigeria . Lastly, the psyche ache assessment schedule (pas) was used to measure emotional pain . Examples of question items include: i feel psychological pain, my psychological pain seems worse than any physical pain, i hurt because i feel empty, i ca nt take my pain any more, my pain is making me fall apart, and my pain is making me fall apart among others . The pas has been used locally in the study of emotional pain and a score of 28 and above is indicative of emotional pain . All questionnaires were filled in private with the help of the researchers before the dental procedures were carried out . Data analyses were done with the statistical package of social sciences for windows version 16 (spss-16). Normally distributed data were summarized using mean (sd), while categorical data were represented as proportions . The mean age of study group and control group was 33 (12) years and 36 (13) years respectively (p=0.180). Most of them were above 20 years of age for both the test and control groups . Most of them were males with 60.4% and 66.0% in the study and control groups respectively (p=0.41). They were mostly employed 70.3% and 61.6%, with about one third being unemployed (students) in both groups (p=0.17). Majority had at least primary school education (study group=100%) and (control=95.9%). Table 2 shows the comparison of psychological distress and emotional pain between dental patients and the controls . On the ghq-12, the mean score for the test and control group was 0.721.2 and 0.370.6 respectively (p=0.011). In the test group, 21.8% (n=22) of the subject had ghq-12 scores of 3 and above (suggestive of psychological distress) while only 7% of the control group had ghq suggestive of psychological distress . The mean score among the test groups was 19.37.1 and 17.87.8 among the control (p=0.0146). Figure 1 shows the proportion of subjects with positive scores for ghq and pas in both groups . A positive score suggestive of emotional pain (psych ache) was found in over a third of the dental patients (37.6%, n=38), while on the other hand, only 13% of the controls experienced psych ache (p<0.001). (table 2). Of the dental patients with positive pas scores, 50% had scores suggestive of psychological distress on the ghq-12 . However, more than half (86.4%) of those with ghq positive scores did experience psych ache (p<0.001). The experience of psychological distress was almost the same in both gender groups, with 16.5% in males and 14% in females (p<0.05). While for psych ache a similar 25.2% for males and 25.6% of females (p<0.05) (table 2). There was no difference in the number of subjects who currently live with a partner in both groups . However, more than one - sixth of those that experienced psyche ache (60.4%) were not currently living with a partner . The complaint of pain is common in dental practice setting, and may often largely assume to be solely due to physical causes . However, recent evidence has implicated other causes including psychological problems . In this respect, while dental anxiety as a psychological experience faced by dental patients has been extensively examined, particularly by western researchers, other common psychological experiences among dental patients like emotional pain, dental fear or depression have been scantily researched, especially in resource - restricted countries like nigeria . Therefore, findings in this study constitute an important contribution to knowledge on the emotional concerns of dental patients in order to improve the quality of care in dental setting . In this study, the burden of psychological distress among dental patients (21.8%) was about three folds higher than what is found in the control group (7%). This high prevalence of distress among dental patients, as observed in this study, is not only in keep with what has been fielded in earlier works, but can be attributed to the experience of varieties of psychopathologies by dental patients . For example, the presence of dental anxiety has been implicated, especially because anxiety is a form of psychological distress and may be detectable by the ghq-12 . However, studies have shown a world - wide variation in the prevalence of dental anxiety with estimates as high as 11% prevalence among people with dental fear . The disparity in the burden of emotional distress in the cited studies and our study can be adjudged to several factors like methodological issues, study population and setting, clinical factors, personality traits and the extent of comorbidity of mental health disorders among others . To further buttress the importance of the roles of psychosocial factors on emotional well - being among dental patients, improved understanding of dental procedures and expectations have been associated with reduction in dental fear, while a female gender, low engagement in treatment and depressed mood tend to increase the occurrence of dental fear . As expected, the experience of emotional pain as reflected by the burden of psyche ache is high among these study participants . That said, it is interesting to note that psych ache, which is often a feature of depressive illness, was found to exist among more than one - third of the test subjects, out of which only a half had scores suggestive of psychological distress on ghq-12 . This is postulated to suggest that while ghq may be useful in screening for all forms of psychological distress, the pas is more specific to chronic pain . A further explanation is that most patients in this environment tend to show up at the dental clinics late, and more often these patients have not experienced chronic dental pain, but they only show up when the pain has become unbearable . As it is, the diagnosis and treatment of mental health illnesses including depression should be relevant to dental practitioners because they are the primary care providers who treat a large cross - section of the community . Although mental problems are common in the community, they are particularly evident in treatment settings . For instance, more than 20% of patients seen in primary care clinics report had clinically significant depressive symptoms . By identifying the symptoms of depressed people, that can include complaint of distress, and referring them for treatment, dentists can provide another important contribution to the health care of their patients . Some researchers have proposed the collaboration between dentists and psychotherapeutic specialists in provision of modern dental treatment . A four stepped approach for addressing dental anxiety has been proposed by pawlicki, which includes assessment, categorization, relaxation training and referral when necessary . In spite of the potential benefits of this study in the expansion of scanty data on the emotional experience of dental patients in resource - limiting setting like nigeria, it is limited in certain respect . For instance, this study did not explore in details the past dental experiences, which may have proven useful in understanding the finding of psychological distress . Also a randomization was done as a result of the small population in the clinic, as well as physical pain was not measured using specific instruments . Additional, it is a clinic - based study, thus extrapolation of its findings to the general population should be cautiously done . The findings in this study confirm the experience of many - fold of psychological distress and emotional pain by dental patients in comparison to normal population . Thus, dentists should be empowered to go the extra - mile to carry out broad evaluation of pain symptoms, while deploring useful holistic distress - relieving techniques as well . Such broad evaluation of pain symptoms that include psychological evaluation along with psychosocial support should be integrated into standard dental care protocol . Again, the exigency to develop collaboration framework between dental and mental health services is buttressed in this study.
Early life stressors that shape the stress response in offspring have profound effects on mood and cognition in adulthood (davidson & mcewen, 2012). Chronic exposure to glucocorticoids contribute to the dysfunction of the inhibitory network and impairment of rhythmic oscillations, which are critical for the regulation of brain activity and complex cognitive processes (hu & et al, 2010). A dysfunctional gabaergic system is associated with the pathogenesis of neuropsychiatric diseases such as schizophrenia, anxiety and depression (hines & et al, 2012). During brain development, gabaergic synapses are formed prior to the formation of glutamatergic synapses and the activation of the gabaa receptor depolarizes immature neurons (ben - ari and et al, 2012, ben - ari, 2002, ben - ari and et al, 2007). Excitatory gaba transmission plays important roles in various neurodevelopmental processes including; neuronal migration, cell proliferation, neurite outgrowth and generating synchronized network activity (cherubini & et al, 2011). Cation chloride cotransporter (ccc) is the key controlling factor in controlling the switch of the gabaa receptor function . Cccs control the reversal potential of the gabaa receptor - mediated current (egaba), which is important for the modulation of the gabaa receptor function . There are two main types of cccs; the outwardly directed potassium - chloride cotransporter 2 (kcc2), and the inwardly directed sodium potassium - chloride cotransporter 1 (nkcc1). In immature neurons, kcc2, on the other hand, reduces the chloride reversal potential thus it extrudes cl out of the cell and shifts the actions of the gaba from excitation to inhibition . Although the other chloride regulators channels and transporters also take part in this sequence (blaesse and et al, 2009, medina and chudotvorova, 2006), the expression of kcc2 is thought to initiate the developmental switch of the gabaa receptor function from excitatory to inhibitory transmission (ben - ari, 2002). In addition to the expression of cation - chloride cotransporters, the gabaa receptor undergoes postnatal changes in its structure and function by the differential expression of different subunits' composition (jacob et al ., 2008). The presence of gabaa receptor 1 subunits mediates phasic inhibition by inducing a more rapid decay rate in gabaa - mediated synaptic currents (dunning & et al, 1999). In contrast, the gabaa receptor 5 subunits mediate tonic inhibition, which can be characterized by a slow decay rate of the synaptic current (jacob et al ., 2008). The 1 subunits are located at the synaptic sites and mostly found in mature neurons, while the 5 subunits are located at the extrasynaptic sites and found mostly in immature neurons prior to the formation of the inhibitory synapse (jacob et al ., 2008, thus, the maturation of the gabaergic function requires the precise expression of specific subunits of the gabaa receptor during postnatal brain development . The early expression of the gabaa receptor 5 subunit is required for the tonic inhibitory function of gaba, while the late expression of the 1 subunit is required for the phasic inhibition that indicates the maturation of the gabaa receptor function . It is well documented that stress increases glucocorticoid hormones and thereby potentiates excitotoxic damage in hippocampal gabaergic neurons (elliott and sapolsky, 1992, stein - behrens and sapolsky, 1992). Early life stress exerts an effect on the hippocampal neurons and predisposes individuals to psychosis (stumpf and et al, 1989, tornello and et al, 1982, zhang and et al, 1990, scheller - gilkey and et al, 2003). The hippocampus exhibits subtle alterations subsequent to neuropsychiatric diseases such as schizophrenia and mania depressive disorder (benes, 1999). Previous studies in postmortem brains from schizophrenia patients have shown a decrease in hippocampal gabaergic activity that could potentiate excitotoxic damage to hippocampal interneurons, consistent with abnormal oscillatory rhythms and increased basal metabolic activity (benes, 1999). It is still unclear how prenatal stress affects the development of gabaergic synapses in the hippocampus of the offspring . In this study we hypothesized that prenatal stress may affect the structural and functional maturation of the gabaa receptor in the hippocampus of rat pups . Therefore, the purpose of this study was to examine the effect of maternal restraint stress on the levels of nkcc1 and kcc2, as well as gabaa receptors 1 and 5 subunits in the hippocampus of the offspring to provide insights about the involved mechanisms of maternal stress as a cause of dysregulation of gabaergic synapses that are known to be associated with the pathogenesis of psychiatric diseases at adulthood . Pregnant rats were obtained from the national laboratory animal centre, mahidol university, salaya, thailand . They were housed in a single housing condition with a temperature and humidity controlled environment and maintained on a 12 h light / dark cycle with free access to food and water . Each pregnant female rat was weighed on gestation day (gd) 721 . In the morning of gd 21, each pregnant rat received nesting material, and thereafter, the cage was checked twice daily for the appearance of a litter . The day a litter gets discovered becomes designated as postnatal day 0 (p0), and the length of gestation was noted . All experiments were conducted according to the guidelines for care and use of the laboratory animals and approved by the experimental animal ethics committee of the institute of molecular biosciences, mahidol university, thailand (coa.mb-acuc 2015/003). Pregnant rats were divided into two groups; 1) control group, 2) maternal restraint stress group (n = 4/group). For the restraint stress, each pregnant rat was put into a small plexiglas cylindrical cage in which the length can be adjusted to accommodate the size of each animal . The restraint stress was performed during gd14 - 20, at four hours daily intervals during the light phase of the cycle as previously described (surakul et al ., 2011, gestation days 1420 were selected because they represent the most sensitive period for the behavioral teratogenic effect of prenatal stress (fride & weinstock, 1984). Whole hippocampal tissues were collected from rat pups at different postnatal days (p) from p7, p14, p21, p28 and p40, with n = 4/group . Brain tissues were then suspended in a lysis buffer composed of 50 mm tris ph 7.4, 150 mm nacl, 1 mm edta, 0.5% sodium deoxycholate, 1% sds, 1 mm pmsf, 1% triton - x-100 and supplemented with a complete protease and phosphatase inhibitor cocktail set (calbiochem, germany), then homogenized twice with a sonicator for 10 s each . The homogenized samples were centrifuged at 14,000 rpm, 4 c for 15 min . Cell lysates were mixed with a sodium dodecyl sulfate (sds) sample buffer and boiled . Equal amounts (20 g) of extracted protein samples were resolved in 10% sds - page and electrophoresis at 100 v for 150 min . The protein bands were then transferred to the pvdf membrane (amersham, usa) at 100v for 135 min . The membranes were then incubated in a blocking solution containing 3% skimmed milk for nkcc1, kcc2 and gabaa receptor 1 and 5 subunits, and 5% skimmed milk for actin at room temperature for 60 min . Then the membranes were incubated with the following specific primary antibodies purchased from the available commercial sources . Polyclonal goat anti - nkcc1 (sc-21545; 1:500), polyclonal goat anti - kcc2 (sc-19420; 1:500), polyclonal goat anti - gabaa receptor 1 subunit (sc-7348; 1:500), polyclonal goat anti - gabaa receptor 5 subunit (sc-7357; 1:500), and monoclonal mouse anti - actin (sc-69879; 1:5000), all antibodies were purchased from santa cruz biotechnology, usa . The membranes were then thoroughly washed 3 times using 0.1% tween - tbs (ttbs) for 5 min each, and then incubated with an appropriate hrp - conjugated secondary antibody . After that, the membranes were washed 3 times using 0.1% ttbs for 5 min each, and then the signals were detected by an enhanced chemiluminescence system (ecl prime, amersham biosciences, usa) and film exposure . The intensities of the band were quantified using densitometry software (image j, national institutes of health, usa). The immunoblot data were corrected for corresponding product of the -actin extracted from the same tissue which serve as an internal control . Quantitative results were expressed as mean sem, calculated from the duplicate experiments . The statistical significance of difference between means was evaluated using student's t - test (unpaired, unless otherwise stated). Changes produced by prenatal stress were analyzed at different postnatal ages using a two way anova with the prenatal stress and postnatal ages as independent variables and the protein levels as dependent variables; followed by a tukey's post hoc multiple comparison test . The probability level of p 0.05 was considered to have a statistically significant difference between the two sets of data . We examined the effects of maternal restraint stress, during the gestation day (gd) 1420, on the levels of nkcc1 and kcc2 in the hippocampus of rat pups and compared between the groups at different postnatal ages . The results showed that maternal restraint stress caused a transient but significant increase in the level of nkcc1 in the hippocampus at p14 (p <0.05) but no significant difference when observed at the other periods (fig . 1). For kcc2, the results show that maternal restraint stress caused a transient but significant increase in the kcc2 level in the hippocampus of rat pups during the weaning period (p21) (p <0.01) and this was followed by a transient but significant decrease during the preadolescence period (p28) (p <0.05) (fig . 2). However, there was no difference in the level of kcc2 when compare between groups during the adolescence period (p40). We found that maternal restraint stress significantly increases the nkcc1/kcc2 ratio in the pup's hippocampus at p14 and p28 (p <0.01). During this period, the nkcc1/kcc2 ratios in the hippocampus of prenatally stress pups exhibited more fluctuations than those observed in the control group (fig . The developmental expressions of gabaa receptor 5 and 1 subunits in the hippocampus appear in the opposite way . The 5 subunit was highly expressed during p7p14, and then declined during p21p40 (fig . 4, white bar) while the 1 subunit was expressed at a very low level during p7p14, then continually increased during p21p28 (fig . Maternal restraint stress caused a transient but significant decrease in the level of the gabaa receptor 5 subunit at p14 (p <0.05) and followed by a long term increase at p21 (p <0.01), p28 (p <0.05) and p40 (p <0.05) as compared to the control (fig . 4). In contrast, maternal restraint stress caused a transient but significant increase in the level of the gabaa 1 subunit at p14 (p <0.05) followed by a significant decrease at p21 (p <0.01) and p28 (p <0.01) (fig . We found no significant difference in the level of the 1 subunit when comparing between the groups at p40 . When the ratios of the 5/1 subunit of the gabaa receptor were calculated and compared across the different postnatal ages, we found that maternal restraint stress causes a significant decrease in the ratio of the 5/1 subunits during p7p14 (p <0.01), but a significant increase in the ratios of the 5/1 subunits during p21p28 (p <0.05) (fig . 6). In fact, we found small increase in the 5/1 ratios at p40; however, there was no statistically significant difference when compared with the control group . Gabaa receptor depolarization maintained by nkcc1 is important for proper brain development since it is a key factor in the control of several ca2-dependent developmental phenomena, including neuronal proliferation, migration and targeting (rivera & et al, 1999). Kcc2, in contrast, shifts the gabaa receptor activity from depolarization to hyperpolarization in mature neurons . In a developing hippocampus, the level of nkcc1 continuously increases starting from p21 to adulthood (yan et al ., 2001) while the hyperpolarizing gaba is completed by the second postnatal week due to the progressive reduction of nkcc1 activity in parallel with the enhanced activity of kcc2 (rivera and et al, 1999, emri and et al, 2001, gulyas and et al, 2001, stein and et al, 2004). Previous studies reported that kcc2 expression significantly increases during the second postnatal week, which is the co - incidence time point when the developmental switch of gabaa receptor activity is observed (rivera and et al, 1999, clayton and et al, 1998) and continually increased until p28 (lu et al ., 1999). In the hippocampus, nkcc1 and kcc2 expressions show relatively similar developmental patterns indicating that both are required for the reciprocal regulation of cl homeostasis, which is important for the functional maturation of the gabaa receptor . In this study, maternal restraint stress induced a transient increase in the level of nkcc1 in the hippocampus of rat pups only at p14, while there was a kcc2 increase at p21 and then a decrease at p28 . Previous studies reported that the alteration in nkcc1 under a stress response has no effect on the gabaa receptor function . In contrast, the stress - altered kcc2 level has a profound effect on the modulation of intracellular cl concentrations (hewitt & et al, 2009). Our finding, that maternal restraint stress increases the kcc2 level in the pup's hippocampus at p21, indicates the protective mechanism that counteracts the higher level of nkcc1 at p14 . Maternal restraint stress, which increases kcc2 level at p21 and then decreases it at p28, indicates the dysregulation of intracellular cl concentrations and the gabaa receptor mediated current during the preadolescence period . In the mature pyramidal neurons, kcc2 inhibition positively shifts the gabaa receptor reversal potential, thus, gabaa receptor activation causes depolarization (rivera & et al, 1999). Our results indicate that maternal restraint stress may induce prolonged depolarizing of gaba in the hippocampus of rat pups until the pre - adolescence period, while in the control pups, hyperpolarizing gaba was completed by the early postnatal week . Different brain regions may exhibit differential vulnerability to the effects of stress on the level of kcc2 and its activity . For examples, in the rat hypothalamic paraventricular nuclei, acute restraint stress has no effect on the level of kcc2, but attenuates the kcc2 activity (hewitt & et al, 2009). Maternal restraint stress has no effect on the level of kcc2 in the amygdala of male pups at p14 and p22 (laloux & et al, 2012). In contrast, prenatal stress causes a significant decrease in the kcc2 level and its activity in the hippocampus, as measured by phosphorylation of kcc2 on ser 940 residue (sarkar & et al, 2011). These findings, together with our results, indicate that maternal restraint stress might alter gabaa transmission in the hippocampus of prenatal stress pups during the post - weaning (p21) to pre - adolescence period (p28) and this mechanism might be due to the alteration in the levels of kcc2 . The underlying mechanism by which prenatal stress alters kcc2 levels remains unclear . Studies have shown that brain a derived neurotrophic factor (bdnf) regulates the expression of kcc2 in both the young and adult brains (aguado and et al, 2003, rivera and et al, 2002). Bdnf is seen to down - regulate kcc2 expression in the adult hippocampal slices via the activation of tyrosine receptor kinase b (trkb) (rivera & et al, 2002). In addition, bdnf promotes kcc2 expression in the developing mice forebrain (aguado & et al, 2003). Therefore, bdnf regulation of kcc2 expression varies depending on the developmental stages and brain regions . Prenatal stress has been reported to decrease bdnf levels in the rat hippocampus at p21 (van den hove & et al, 2006). Taken together, the results suggest that an alteration in bdnf levels caused by prenatal stress might affect the kcc2 level in the pup's hippocampus . Although it has been noted that bdnf - induced alteration in kcc2 expression was not caused by neuronal excitability and network activity (aguado & et al, 2003), the endogenous action that is regulating the changes is still elusive . It is assumed that maternal restraint stress altering kcc2 level in the rat pups hippocampus at preadolescence period could affect the excitatory glutamatergic synapses as well . It has been reported that kcc2 has an important roles in the modulation of the dendritic spines and ampa receptor diffusion by interacting with sub - membranous actin cytoskeleton (gauvain & et al, 2011), therefore indicating kcc2 is also require for the production of long - term potentiation (ltp) in the hippocampus of young animals . Prenatal stress has been linked to an increased risk of psychiatric disorders such as schizophrenia and depression (charil & et al, 2010). Recent studies show that the kcc2 level is significantly decreased in the hippocampus of schizophrenia patients, while there was no change in the nkcc1 level (hyde & et al, 2011). Thus, an increase in the nkcc1/kcc2 ratio indicates the delayed maturation of cation - chloride cotransporters in the patient's brain, which may underlie the pathology of neuropsychiatric diseases . Recently, it was demonstrated the significant increase in the level of oxsr1 (oxidative stress response kinase1) and wnk3 (with no k [lysine] protein kinase3) in the post - mortem brain of schizophrenia patients (arion & lewis, 2011). Consequently, changes in the level of oxsr1 and wnk3 can shift the balance of chloride transport and leading to an abnormal gabaergic transmission in the prefrontal cortex, thereby contributing to the impaired neural network synchrony and cognitive dysfunction in affected individuals (arion & lewis, 2011). For the development of gabaa receptor subunits, our results are consistent with those that have been previously reported (ramos and et al, 2004, laurie et al ., 1992). We found the 5 subunit is highly expressed during the early postnatal period and declined to the adult level around the 3rd postnatal week, while the 1 subunit was initially expressed at a small level during the 1st and the 2nd postnatal week and gradually increased until reaching its peak around the 3rd postnatal week . Prenatal stress delays the developmental shift of the gabaa receptor 1 and 5 subunits that normally occur around p21 in the control pups . This was clearly observed in the control pups that were seen to have manifested developmental increments in the 1 subunit at p21, but not in the prenatal stress pups, at least until p40 . On the contrary, the control pups show a developmental decrease in the 5 subunit at p21, but not in the prenatal stress pups that were seen to maintain the expression of the 5 subunit at least until p40 . As a result, the ratio of the 5/1 subunits in the prenatal stress pups exhibits a significant increase during p7 and p14, but shows a significant decrease when observed at p21 and p28, as compared to the control group . The underlying mechanism of prenatal stress that induces a prolonged increase of 5 subunits in the rat pup's hippocampus at preadolescence is still elusive . A prolonged increase in the 5 subunit in the pup's brain may create an unpredictable effect on gaba inhibitory transmission; especially during puberty (shen & et al, 2007). In the hippocampal ca1 and neocortical pyramidal neurons, the extrasynaptic 5 subunit of the gabaa receptor mediates tonic inhibition and plays an important role in memory and learning (rudolph & mohler, 2014). An increased expression of the gabaa receptors' 5 subunit is associated with memory loss (wang & et al, 2012) while the antagonist of the receptor can enhance learning and memory processes (rudolph and mohler, 2014, ling and et al, 2015). Thus, our results suggest that prenatal stress induces an increase in the gabaa receptor's 5 subunit expression and the 5/1 ratios in the hippocampus at the preadolescence period may underlie the long term effects of prenatal stress on learning and memory impairment in the offspring at adulthood . For the gabaa receptors 1 subunit, our findings are consistent with previous report that reveal exposure to stress in juvenile rats can induce biphasic changes in their behavior, including hyperactivity at juveniles which in adulthood becomes hypoactivity accompanied by behavioral anxiety that are associated with the decrease of 1 subunits in the hippocampus and amygdala (jacobson - pick & richter - levin, 2012). Taken together the results are in agreement, the juvenile period is a sensitive time and is more vulnerable to stress than other periods and this supports the hypothesis that prenatal stress is a predisposing factor for various neuropsychiatric diseases and memory impairment at later life . In this study, we added further information that the developmental expression of the gabaa receptor 1 subunit is similar to the developmental pattern of the kcc2 . Both the gabaa 1 subunit and kcc2 reach their peak around p21p28 and this indicates that the gabaa 1 subunit and kcc2 might coordinate in enhancing the gabaa receptor mediated synaptic inhibition that occurs around this period . Interestingly, we found that prenatal stress induces changes in the levels of the gabaa 1 subunit and the kcc2 in a similar way . Our results correspond to what has been previously documented in that kcc2 could modulate the expression level of the gabaa receptor 1 subunit via an alteration in intracellular [cl] and the decay rate of gaba - mediated inhibitory transmission (houston & et al, 2009). Indeed, lower intracellular [cl] resulted in a faster decay rate of the gaba transmission (moroni & et al, 2011). It has been shown that kcc2 can manipulate the expression of gabaa receptor subunits, i.e., overexpression of kcc2 results in the reduction of intracellular [cl] and leads to an increase in the level of 1 and subunits (succol & et al, 2012). Taken together, these results are in accordance with the hypothesis that prenatal stress reduces the kcc2 levels, which might lower the intracellular [cl], that acts as the intracellular signal and induces a faster decay rate of the gabaa receptor gating and, thus, decreases the expression of the 1 subunit of the gabaa receptor (succol & et al, 2012). These changes indicate a delayed maturation of the gabaergic function in the hippocampus of prenatal stress pups, especially during the preadolescence period . Additionally, it was reported that stress disrupts the gabaergic function in the brain in many ways . Stress induces dysfunction of the inhibitory network and impairs rhythmic oscillations leading to cognitive deficits commonly found in psychiatric disorders (hu & et al, 2010). Prenatal stress disturbs the distribution of gabaergic interneurons in the cortical plate, reflecting the changes occurring in tangential migration and radial integration in the developing cortex (stevens & et al, 2013). Prenatal stress causes a significant decrease in the frequency of spontaneous ipscs in the immature hippocampal neurons (grigoryan & segal, 2013) and increasing the vulnerability to stressful situations in the offspring during adulthood accompanied by a reduction of benzodiazepine binding in the hippocampus (fride & et al, 1985). In summary, this study has shown that maternal restraint stress has the ability to differentially alter the levels of nkcc1, kcc2, and gabaa receptor 1 and 5 subunits in the hippocampus of rat pups . Consequently, these changes can lead to an imbalance of inhibitory transmission that may delineate the linkage between prenatal stress and neuropsychiatric disorders in later life . Our findings reveal that there is a strong connection between early life stress exposures with an increased risk of developing psychiatric disorders at adulthood . Furthermore, a reduction of kcc2 levels has been linked to the cause of epilepsy, which is considered as a risk factor for schizophrenia and autism . Moreover, a prolonged increase in the 5 subunits in the hippocampus of rat pups during adolescence indicates a prolongation of the slow decay rate of inhibitory transmission in the pup's hippocampus and predisposes it for neuropsychiatric diseases and memory impairment in adulthood . Experiencing adverse events during pregnancy has a negative impact on brain development and may increase vulnerability to developing neurological and psychiatric disorders later in life . As we demonstrated, fetal exposure to maternal stress hormones delays structural and functional development of gaba transmission in the rat pup's hippocampus during the preadolescence period . These changes may lead to the dis - regulation of gaba inhibitory transmission in the developing hippocampus . Similar patterns of changes in the kcc2 and gabaa receptor 1 subunits were observed in response to early life stress, accompanied by supporting evidence that indicates changes in kcc2 levels may underlie the effect of maternal stress on the alterations in the 1 subunit of the gabaa receptors . Moreover, prenatal stress also increases gabaa receptor 5 subunit expression throughout the preadolescence period, which may underlie the learning and memory impairments in the offspring at adulthood . In summary, we have provided an explanation of certain prenatal factors mediating structural and functional development of the gabaergic synapse that may be the link between prenatal stress and the emergence of neuro - psychiatric disorders at adulthood.
With further research, refinement and contributions made by survivors, health researchers and health care professionals, the survivorship care plan is proposed to be a useful and practical tool aimed at supporting the survivorship continuum of care . The proportion of people surviving cancer is increasing in many parts of the world due, in part, to early diagnosis, increased rates of detection and significant improvements in treatment [13]. However, many cancer survivors experience a range of ongoing difficulties related to the disease itself and the treatments used . These difficulties continue to impact upon survivors during, immediately after and, for some individuals, many years after completion of their treatment [46]. Well - recognised physical problems include chronic pain, weight gain, osteoporosis, premature menopause and memory and sleep disturbances . Additional consequences of cancer and cancer treatments can contribute to further difficulties including a range of chronic health conditions including heart disease and diabetes . Psychological difficulties including depression and anxiety may also be experienced, and these may be associated with ongoing symptoms of fatigue, sexual dysfunction, fear of recurrence and changes to relationships [8, 9]. A recent australian study identified that long - term survivors of cancer reported increased levels of vulnerability, loneliness and anxiety about their health and the possibility of the cancer returning . It is evident that many cancer survivors experience significant ongoing problems with resuming their usual roles and relationships as well as returning to their previous routines and habits . There are many less - recognised and sparsely publicised issues for survivors following cessation of treatment including social difficulties, maladjustment to work responsibilities, intimacy problems, organisational difficulties and cognitive processing issues [1113]. The literature also identifies a range of existential problems affecting cancer survivors including challenges pertaining to self - identity and personal expectations . Globally, survivors are increasingly seeking a wider range of supports and services during the post - treatment period to assist them with the breadth of physical and psychological difficulties experienced in the longer term [13, 15, 16]. In most developed countries, a range of strategies are currently available to assist cancer survivors with these ongoing difficulties, including access to health services, support groups, online forums and educational tools . However, it appears that there is a lack of recognition of this period with referral and coordination for follow - up care needed during cancer survivorship . The survivorship care plan (scp) is postulated as a potential resource to improve survivorship care . The scp is recognised as an important tool that may be used during the survivorship period and one which is attracting further research in the international context because of its potential to assist survivors to direct and navigate their own ongoing care [8, 10, 13, 1719]. Researchers in the united states of america (usa), canada and the united kingdom (uk) have made significant contributions to the study of the survivorship phenomenon . In 2005, the institute of medicine (iom) (usa) published its report from cancer patient to cancer survivor: lost in transition . This report outlined key recommendations to assist cancer survivors in the longer term including the use of scps . The scp usually includes a summary of diagnosis and treatment, methods of surveillance for the potential development of malignancies, maintenance of healthy lifestyle, legal and financial rights and identification of support services . These recommendations have been widely accepted in many countries as critical to the care of survivors yet have not been fully evaluated . In a randomised control trial conducted by grundfeld, it was found that there was little evidence to support the use of the scp in practice . However, this study was limited to survivors of breast cancer and its generalisability to other types of cancer, as well as the context of care, has not been investigated . Canada has had a national cancer strategy since 2007 which identifies key priorities for survivorship: the development and implementation of national standards and models of care; promotion of survivorship research, knowledge and communication plans and advocacy groups; and an emerging interest in the use of scps . In the uk, the national cancer survivorship initiative (ncsi) articulates the care of survivors using a recovery - focussed, personalised approach with explicit outcome measures to determine the effectiveness of the services provided . It recommends that all survivors are offered a treatment summary and care plan as well as appropriate education and information . Australia does not have a national cancer plan or consistent model of care for cancer survivors . Models of care across the states of australia vary and include the disease - specific model, general survivorship model, consultative clinic, multidisciplinary clinic, integrated care model and transition to primary care model . This has resulted in each state providing a different framework of care, a variety of practice guidelines and a range of state - based services . According to one australian author, jefford et al . Traditional medical follow - up currently offered may not meet survivors needs due to its focus on cancer recurrence and not on other important, but less obvious, concerns . The scp which offers a summary of treatment, surveillance and recommendations for follow - up care is a key resource used in many other countries, however, to date, not used consistently in australia and other countries . There is a range of published literature that explores the use of scps in many different countries and contexts of care with sources of input from oncologists, primary care physicians / general practitioners and oncology nurses . More recently, systematic reviews of the quantitative literature have been conducted that consider a range of issues including survivorship models of care and the effectiveness of the scp . While these studies contribute to the range and breadth of the literature, there has been very little consideration of survivors own perspectives regarding their experiences and views about the use of the scp [20, 26, 27]. As scps are used by a range of health professionals, it is essential that the preferences of survivors, as key stakeholders in the continuum of care, are explored and articulated to ensure services and supports are directed appropriately . The aim of this systematic review is to document and review the available published qualitative literature that describes cancer survivors experiences of using survivorship care plans . An examination of existing published systematic reviews and protocols was undertaken to determine whether the research question was appropriate due to previously published literature on the subject . The following sources were initially reviewed: cochrane collaboration, joanna briggs institute, database of abstracts of reviews of effects (dare), prospero and trip . It was established that no existing systematic reviews of the research question had been registered or published to date . Priori inclusion criteria were determined as follows: adults only (18 years and above), date range from 2000 to 2014 and published in english . Publications were excluded if they reported on the experience of cancer treatment or the palliative phase of care and were conference presentations or abstracts only . Searches of electronic databases completed were cinahl, amed, embase, medline, informit, proquest, psycinfo, sciencedirect, wiley online library, scopus and web of science . The journal of cancer survivorship was also reviewed for publications that met the inclusion criteria . Permutations of the following search terms were truncated and exploded: cancer, neoplasm or malignancy survivor, experiences, opinions, ideas, views or preferences, survivorship care plan, post - treatment care, forward care, survivorship program, individualised care plan and comprehensive care plan . The title and abstracts of the remaining 405 records were reviewed by the first author and 46 of these met the prior inclusion criteria for full review . The full - text articles were then reviewed independently by the first and second authors using the eligibility criteria of any of the following: qualitative studies including systematic reviews, interviews, focus groups, case studies, descriptive studies, observational and narrative studies; action research as well as the qualitative components of mixed methods studies . Additional eligibility criteria included survivors experiences of using a scp and analysis and discussion about the findings of the study (refer to fig . 1 for details of data screening). In total, 11 papers were determined as eligible for critical appraisal of methodological quality.fig . Critical appraisal of methodological quality was completed using the standard quality assessment criteria for evaluating primary research papers from a variety of fields by kmet, lee and cook . This tool uses a numeric score (02) to rate the quality of ten categories considered essential to the research credibility . The categories assessed are as follows: research question or objective stated clearly, explanation of the study design, context clearly defined, connection to a theoretical framework, justification of the sampling strategy, description of data collection, clearly defined analysis of results, use of verification procedures discussed, conclusions drawn and reflexivity of authors considered . The first two listed authors independently assessed each paper using these criteria to determine a total score out of a possible 20 . Where there was a difference in scores of greater than 1/20, discussion and consensus agreement was reached . The calculated scores were defined according to quality as strong (score of> 80%), good (7080%), adequate (5070%) or limited (<50%). Studies were included if they received a quality score of 70% and above . All of the 11 studies reviewed met the minimum requirement of 70% on the assessment criteria . A list of each study s scores using the appraisal tool can be found in table 1 . The total number of participants included across all reviewed studies was 336 with one study not stating the number of participants.table 1demographic data of all studiesauthor and yearpopulation and genderno . Of participantslocationage range (years)time since diagnosistime since completion of treatmentcancer typetype of studyscp usedexperiences of survivorship?methodological quality using kmet/20ashing - giwa et al . 2012 american / not stated7 survivors7 oncology providersusa5484not statedaverage 18 monthscolorectalinterviewsyesyes15hewitt et al . 2007 american / men and women36usa2570not statedless than 5 yearsall except skin cancerfocus groupsyesyes14kantsiper et al . 2009 2011 american men and women40usanot statednot statednot statedrangefocus groupsyesyes14parry et al . 2011 american men and women51usa2082not stated348 monthsmostly lymphoma and leukaemiainterviewsyesyes18singh- carlson et al . The 11 studies included the use of interviews (four studies), focus groups (six studies) and action research (one study). Table 1 provides a comprehensive summary of each study including sample location, population, number of participants, gender, age range, cancer type, time since diagnosis, time since completion of treatment and marital / partnership status . A content analysis was undertaken to review and understand the breadth and depth of the themes discussed for each of the studies by each of the researchers . Four significant themes were identified following content analysis of the 11 articles: (1) stakeholders agree that scps should be used as a key strategy for cancer survivors; (2) lack of consensus on what the scp should contain and who should develop it; (3) cancer survivors do not consistently receive a scp and (4) there was a lack of evidence to support the use of scp in practice . The scps were identified as a key strategy during the post - treatment period for cancer survivors [2939] by the authors of all studies . Significant points raised by researchers include the use of scps to reduce duplication of materials improved coordination of care and increased communication between health professionals and cancer survivors . Specific areas for improvement were that the scp needed to be accessible and nontechnical and directed to address the cultural issues specific to particular groups of people . A significant finding from the majority of authors [28, 30, 31, 3437] was the recommendation that scps should be targeted to provide coordinated, individualised and patient - centred care . There appeared to be many barriers preventing this occurring in practice due to the limitations of the time needed to complete them, the need for resources and a lack of training on how to complete them [3032, 35, 36, 40]. The use of scps assisted cancer survivors to translate information from specialist providers to their primary care providers and gave direction for the future [31, 32, 34, 35, 39]. It was also noted that scps reduced duplication of information and helped to synthesise treatment information to provide patients with peace of mind, a written synopsis of treatment and a targeted surveillance strategy during follow - up [34, 38, 39]. Furthermore, a range of unique survivorship issues relating to cultural background were identified, and many authors stated the importance of considering these broader issues as part of the development of the scp [29, 32, 35]. Ashing - giwa et al . And burg et al . Noted the explicit concerns of african - american women survivors of breast cancer and discussed the importance of including resources to address questions regarding treatment - related skin pigment changes and the availability of genetic testing for family members . Noted concerns raised in their study regarding south asian women living in canada, including the significance of family relationships and importance of faith during and after the treatment period . The use of patient - centred scps was thought to assist in the transition from treatment to survivorship but also needed to be used in conjunction with suitable models of care [31, 34, 37]. Many different models are used by cancer survivors including shared care, consultative care, the chronic illness model and transitional care which resulted in the use of a range of tools and strategies as well as the involvement of many health professionals . At times, the complexities of these models resulted in a breakdown in communication and coordination of care . Several authors commented that scps could be used as a resource to facilitate well - timed support and case coordination [32, 34, 36, 39]. The studies provided a range of findings regarding three important issues: what to include in the scp, the format of the scp and who should be responsible for developing it . Four studies indicated the essential components of the scp should be diagnostic and treatment summaries, side effects of treatment and signs and symptoms of recurrence [30, 32, 38, 39]. Two studies [34, 38] concluded that scps must not only consist of a generic template of key considerations but also include sections for personalised items relating specifically to the individual . These additional items included educational resources regarding lifestyle changes, nutrition, exercise and details of support organisations ., stipulated the need for scps to include a designated key provider to assist with the transition between care environments and services . This was supported by brennan et al ., who reported that the scp could be used to improve care and coordination of key stakeholders during the survivorship period . . Indicated that an overview of late and long - term effects also needed to be included as well as referrals for health professional services . A significant finding from ten of the 11 reviewed studies was that currently, scps do not identify or address the significant psychosocial needs reported by cancer survivors [2932, 3439]. Reported that the breast cancer survivors in their studies had specific concerns regarding the need for assistance regarding an altered body image, breast reconstruction issues and weight gain [32, 35]. Depression, fear of recurrence and difficulties with relationships, intimacy and sexual function were described by singh - carlson et al . . Sense of abandonment as survivors transitioned from the treatment phase to survivorship was also discussed by parry et al . And burg et al . Who explained this period as being pivotal for the adjustment between these two periods . This period of transition was also commented on by singh - carlson et al . Who identified many uncertainties regarding returning to work as well as concerns about the future to be included and examined as key elements of the scp . What was common to all these authors was the potential for the scp to identify particular psychosocial concerns as well as provide resources and supports that could be used by survivors and health professionals in the longer term . Interestingly, baravelli et al . Reported that the use of the scp may also cause some distress to some survivors particularly when information regarding the recurrence of cancer was highlighted . This is a key point of interest for all people involved in the development of the scp and one which warrants further exploration . Stressed the need for the scp to be written in a language suitable for the population group and presented as a written, portable document so that survivors could use it as a key resource when negotiating new services or engaging other health professionals . Living document available in electronic format [33, 35] which could be modified and readily available to all stakeholders . The primary care physician (pcp) or general practitioner (gp) was identified as suitable [29, 32, 34, 39], as were the oncology or specialist provider and oncology nurse . Other studies did not reach a clear consensus about who should take primary responsibility for this [30, 31, 38]. Only three studies stressed the need for survivors themselves to be included in the development of their own scp [29, 36, 37]. Many studies identified a range of barriers associated with incorporating the scp into their current model of practice including a lack of training available to assist health professionals to prepare these [31, 32, 34, 35] and the time required to develop and prepare scps [29, 3234, 38]. Also noted by faul et al . And hewitt et al . Was the uncertainty regarding responsibility for the cost of developing scps with many models of care not providing financial assistance for these additional resources . There was a wide range of findings regarding availability and access to scps . Reported that only one of the 25 participants in their study had received a scp . Only one of all the reviewed studies indicated a consistent provision of the scp as part of the cancer survivorship period . Indicated that only one quarter of cancer survivors in their study received a written statement of any type regarding diagnosis . Ten percent had received a treatment summary and 15% had received copies of diagnostic tests . While this information was recognised as important components of scps, it was also acknowledged that there was very little information provided regarding what to expect in the future such as long - term effects of treatment, potential psychosocial concerns and resources for ongoing problems . Four studies [31, 32, 37, 38] reported that this issue may be related to the varying models of practice, inconsistencies around the coordination of survivorship care and a lack of consensus regarding the most appropriate time to provide the scp to survivors . Adding to the potential reasons for why scps are not used routinely is the lack of clear evidence to support the use of the scp in clinical practice . Recommendations were made by all authors regarding the need to conduct both qualitative and quantitative studies regarding the efficacy and application of scps in the future . Of considerable interest was the essential research needed to determine the opinions and preferences of cancer survivors themselves contributing to the research dialogue concerning scps [30, 34]. Two studies [33, 37] indicated a dearth of research regarding whether scps resulted in improved care and outcomes for cancer survivors . Additional statements by two authors [29, 32] stated that prospective longitudinal studies were vital for determining the long - term benefits and any added value of using scps as part of the overall care of cancer survivors . Further recommendations were made to suggest that both qualitative and quantitative studies were needed to support if and how the scp could be integrated into standard oncology care and the health professionals best suited to provide them [31, 35, 38]. Parry et al . Argued that research was needed to evaluate each component of the scp to substantiate their use across the various contexts of use . The scps were identified as a key strategy during the post - treatment period for cancer survivors [2939] by the authors of all studies . Significant points raised by researchers include the use of scps to reduce duplication of materials improved coordination of care and increased communication between health professionals and cancer survivors . Specific areas for improvement were that the scp needed to be accessible and nontechnical and directed to address the cultural issues specific to particular groups of people . A significant finding from the majority of authors [28, 30, 31, 3437] was the recommendation that scps should be targeted to provide coordinated, individualised and patient - centred care . There appeared to be many barriers preventing this occurring in practice due to the limitations of the time needed to complete them, the need for resources and a lack of training on how to complete them [3032, 35, 36, 40]. The use of scps assisted cancer survivors to translate information from specialist providers to their primary care providers and gave direction for the future [31, 32, 34, 35, 39]. It was also noted that scps reduced duplication of information and helped to synthesise treatment information to provide patients with peace of mind, a written synopsis of treatment and a targeted surveillance strategy during follow - up [34, 38, 39]. Furthermore, a range of unique survivorship issues relating to cultural background were identified, and many authors stated the importance of considering these broader issues as part of the development of the scp [29, 32, 35]. Ashing - giwa et al . And burg et al . Noted the explicit concerns of african - american women survivors of breast cancer and discussed the importance of including resources to address questions regarding treatment - related skin pigment changes and the availability of genetic testing for family members . Noted concerns raised in their study regarding south asian women living in canada, including the significance of family relationships and importance of faith during and after the treatment period . The use of patient - centred scps was thought to assist in the transition from treatment to survivorship but also needed to be used in conjunction with suitable models of care [31, 34, 37]. Many different models are used by cancer survivors including shared care, consultative care, the chronic illness model and transitional care which resulted in the use of a range of tools and strategies as well as the involvement of many health professionals . At times, the complexities of these models resulted in a breakdown in communication and coordination of care . Several authors commented that scps could be used as a resource to facilitate well - timed support and case coordination [32, 34, 36, 39]. The studies provided a range of findings regarding three important issues: what to include in the scp, the format of the scp and who should be responsible for developing it . Four studies indicated the essential components of the scp should be diagnostic and treatment summaries, side effects of treatment and signs and symptoms of recurrence [30, 32, 38, 39]. Two studies [34, 38] concluded that scps must not only consist of a generic template of key considerations but also include sections for personalised items relating specifically to the individual . These additional items included educational resources regarding lifestyle changes, nutrition, exercise and details of support organisations . One author, faul et al ., stipulated the need for scps to include a designated key provider to assist with the transition between care environments and services . This was supported by brennan et al ., who reported that the scp could be used to improve care and coordination of key stakeholders during the survivorship period . . Indicated that an overview of late and long - term effects also needed to be included as well as referrals for health professional services . A significant finding from ten of the 11 reviewed studies was that currently, scps do not identify or address the significant psychosocial needs reported by cancer survivors [2932, 3439]. Reported that the breast cancer survivors in their studies had specific concerns regarding the need for assistance regarding an altered body image, breast reconstruction issues and weight gain [32, 35]. Depression, fear of recurrence and difficulties with relationships, intimacy and sexual function were described by singh - carlson et al . . Sense of abandonment as survivors transitioned from the treatment phase to survivorship was also discussed by parry et al . And burg et al . Who explained this period as being pivotal for the adjustment between these two periods . This period of transition was also commented on by singh - carlson et al . Who identified many uncertainties regarding returning to work as well as concerns about the future to be included and examined as key elements of the scp . What was common to all these authors was the potential for the scp to identify particular psychosocial concerns as well as provide resources and supports that could be used by survivors and health professionals in the longer term . Interestingly, baravelli et al . Reported that the use of the scp may also cause some distress to some survivors particularly when information regarding the recurrence of cancer was highlighted . This is a key point of interest for all people involved in the development of the scp and one which warrants further exploration . Stressed the need for the scp to be written in a language suitable for the population group and presented as a written, portable document so that survivors could use it as a key resource when negotiating new services or engaging other health professionals . Living document available in electronic format [33, 35] which could be modified and readily available to all stakeholders . The primary care physician (pcp) or general practitioner (gp) was identified as suitable [29, 32, 34, 39], as were the oncology or specialist provider and oncology nurse . Other studies did not reach a clear consensus about who should take primary responsibility for this [30, 31, 38]. Only three studies stressed the need for survivors themselves to be included in the development of their own scp [29, 36, 37]. Many studies identified a range of barriers associated with incorporating the scp into their current model of practice including a lack of training available to assist health professionals to prepare these [31, 32, 34, 35] and the time required to develop and prepare scps [29, 3234, 38]. Also noted by faul et al . And hewitt et al . Was the uncertainty regarding responsibility for the cost of developing scps with many models of care not providing financial assistance for these additional resources . Reported that only one of the 25 participants in their study had received a scp . Only one of all the reviewed studies indicated a consistent provision of the scp as part of the cancer survivorship period . Indicated that only one quarter of cancer survivors in their study received a written statement of any type regarding diagnosis . Ten percent had received a treatment summary and 15% had received copies of diagnostic tests . While this information was recognised as important components of scps, it was also acknowledged that there was very little information provided regarding what to expect in the future such as long - term effects of treatment, potential psychosocial concerns and resources for ongoing problems . Four studies [31, 32, 37, 38] reported that this issue may be related to the varying models of practice, inconsistencies around the coordination of survivorship care and a lack of consensus regarding the most appropriate time to provide the scp to survivors . Adding to the potential reasons for why scps are not used routinely is the lack of clear evidence to support the use of the scp in clinical practice . Recommendations were made by all authors regarding the need to conduct both qualitative and quantitative studies regarding the efficacy and application of scps in the future . Of considerable interest was the essential research needed to determine the opinions and preferences of cancer survivors themselves contributing to the research dialogue concerning scps [30, 34]. Two studies [33, 37] indicated a dearth of research regarding whether scps resulted in improved care and outcomes for cancer survivors . Additional statements by two authors [29, 32] stated that prospective longitudinal studies were vital for determining the long - term benefits and any added value of using scps as part of the overall care of cancer survivors . Further recommendations were made to suggest that both qualitative and quantitative studies were needed to support if and how the scp could be integrated into standard oncology care and the health professionals best suited to provide them [31, 35, 38]. Parry et al . Argued that research was needed to evaluate each component of the scp to substantiate their use across the various contexts of use . This systematic review considered the range of data collected by the authors of 11 studies, all contributing to the qualitative evidence regarding the research question . According to the institute of medicine, the purpose of a scp is to include a summary of cancer diagnosis and treatment, information regarding likely consequences of treatment and follow - up health information . While the use of scps has varied amongst countries including the usa, canada, uk and australia, the availability and consistency of use is also not constant across the various contexts of care . According to the studies reviewed, there are a number of barriers and enablers influencing their acceptability and integration into the various models of care . A key concern is that the survivorship period requires improved recognition as an integral period of the cancer journey . The reviewed studies support other literature regarding an emerging awareness and recognition of survivorship as a distinct part of the cancer journey [13, 41, 42]. It is apparent that health policies and the models of care that support cancer survivors also require attention so as to consider the many variables impacting this group of consumers [16, 24]. A consistent approach to the delivery of supportive services to cancer survivors, including the use of scps, is essential and must be prioritised for the future [6, 26, 32, 37]. According to the iom, scps have the potential to empower and inform survivors about diagnosis and treatment, monitoring required and follow - up care available as well as act as a communication tool between stakeholders in order to maximise health . However, greater consultation is needed between patients and the health professionals involved to ensure that the scp is individualised and reflects the key concerns and issues for the cancer survivor . Cancer survivors are frequently not included in the development of the scp, and therefore not targeted to the specific needs of individuals . This is of particular concern as the need for consumers to be involved and in charge of their health care requirements is regarded as an essential component of contemporary health practice [13, 16]. Further considerations for the development of scps might require adoption of a generic template with options for people with specific types of cancer and particular population groups . As noted by several authors, a much greater consideration of the psychosocial concerns experienced by cancer survivors is needed and included for discussion [9, 41, 43]. Some specific concerns include sexuality, intimacy, mood and adjustment to previous roles and relationships [6, 44, 45]. Additional educational information for financial, social, health and spiritual supports may also be required [8, 18, 46]. Agreement on many of the practical issues regarding use of the scp is yet to be reached . Who is responsible for developing the scp, what it should include and how it should be developed are still unclear . Some potential reasons for this may include time constraints, the cost of preparing the scp and a lack of rigid evaluation regarding the efficacy of these [16, 18, 47, 48]. Also noted is the requirement to meet the needs of specific population groups, e.g. African - american, southeast asian and others with unique needs to address issues relevant to these cancer survivors . Finally, there has been a growing effort by researchers to explore the effectiveness of scps for cancer survivors . In a recent systematic review conducted by martin et al ., it concluded that while limited evidence existed regarding the effectiveness of scp for a group of breast cancer survivors, the scp did assist with the assessment and symptom management of survivors in the longer term . In contrast, other researchers concluded that the use of scps could assist health professionals to determine strategies for surveillance, increase communication amongst stakeholders and transition care from a medical model to a wellness model [17, 18, 20]. This systematic review examined the experiences of cancer survivors using survivorship care plans and explored many of the current issues relating to their use across a range of different contexts . While the period of cancer survivorship is gaining interest amongst clinicians and researchers, it is clear that further studies are needed to explore the range of scps available, the practicalities related to their use and how to best ensure they meet the needs of cancer survivors in the future . It is recognised that there are many published studies using quantitative methodologies in the subject area of scps and that these may offer additional data and discussion regarding the topic . This review also targeted the use of scps from the perspective of survivors and therefore the experiences of other key stakeholders (treating medical professionals and providers of support services) are not articulated . Author keesing, author mcnamara and author rosenwax declare that they have no conflict of interest.
One of the most important helminthic diseases is hydatidosis or cystic echinococcosis, established via ingesting parasite s egg through soil, air, vegetable, contacting with dog etc . Unilocoular cyst (produced by echinococcus granulosus) and multilocular cyst (produced by e. multilocularis, respectively) are among the most important human diseases in terms of imposed dalys and economic damages (2, 3). Has estimated the number of asymptomatic individuals living in iran as 635,232, in addition to overall annual cost of cystic echinococcosis as us$93.39 million (4). As for livestock, iran has been considered as a country of endemic situation by who and various researches attested this claim (57). So far, many studies have been conducted in different parts of iran to show the seroprevalence of human hydatidosis . Accordingly, the rate of prevalence has been reported from 1.2% to 13.7% in different provinces (6, 812). Iran has ideal situation in terms of the risk of infecting with hydatidosis such as the high rate of dogs infected with e. granulosus, food habit of eating row vegetable, presence of nomads in southern provinces, dusts etc . Hence, it is of great importance to monitor the situation of human hydatidosis regularly throughout the country . Although many diagnostic tests have been evaluated and established to diagnose hydatidosis, (1, 1517), but in iran mostly elisa test using agb has been reported as an authentic and valuable test for this issue (6). Elisa has the potential to be served as a vehicle to detect the seroprevalence of some diseases, so it was utilized in this study to detect the hydatidosis in isfahan province, central iran . The aim of this study was to determine the prevalence of human hydatidosis using elisa test in isfahan province, central iran . 1). Location of isfahan province in iran overall, 635 serum samples were collected from 20 health centers of isfahan city, and 10 centers from suburb areas . According to the statistician consultant, because population of the city is higher than in rural areas, 468 samples were collected from the city and 167 from rural areas . Based on a random sampling all participants filled out an informed consent . Besides, a questionnaire including information on food diet, vegetable consumption, clinical symptoms etc . Was filled out for each case . In case of inability of the participant to fill out the questioner or informed consent form for any reason, the study was approved by the ethics committee of tehran university of medical sciences, tehran, iran ., hydatid cyst fluid (hcf ag) was aspirated from hydatid cysts obtained from livers and lungs of sheep slaughtered at the local abattoirs of tehran . Antigen b was purified and extracted as described earlier (18) and was applied in elisa test . Elisa test was performed in 96 well micro plates (nunc, denmark) as previously described (18), with some modifications . Micro plate wells were coated overnight at 4 c with 100 l agb (10 g / ml) in 0.05 m bicarbonate buffer, ph 9.6 . Wells were washed 3 times in pbs plus 0.05% tween 20 (pbs - t) and blocked with pbs - t containing 1% bsa for 30 min at 37 c . Sera were added at 1:500 dilutions in pbst, incubated at 37 c for 1 h then washed as before . Antihuman igg -hrp (sigma chemical co., poole, dorset, united kingdom) conjugates were added at 1: 10000 dilutions in pbs - t and the micro plate incubated and washed as before . This was then developed by opd substrate (5 mg 1, 2-phenylenediamine, 12.5 ml of 0.2 m citrate phosphate buffer ph 5, 10 l 30% h2o2). The absorbance was read at 492 nm after 10 min using an automatic micro plate reader (state fax 2100, awareness, usa). Altogether 30 samples of sera from healthy volunteers had been collected during the previous studies were examined to set the cut - off . 1). Location of isfahan province in iran overall, 635 serum samples were collected from 20 health centers of isfahan city, and 10 centers from suburb areas . According to the statistician consultant, because population of the city is higher than in rural areas, 468 samples were collected from the city and 167 from rural areas . Based on a random sampling all participants filled out an informed consent . Besides, a questionnaire including information on food diet, vegetable consumption, clinical symptoms etc . Was filled out for each case . In case of inability of the participant to fill out the questioner or informed consent form for any reason, the study was approved by the ethics committee of tehran university of medical sciences, tehran, iran . At first, hydatid cyst fluid (hcf ag) was aspirated from hydatid cysts obtained from livers and lungs of sheep slaughtered at the local abattoirs of tehran . Antigen b was purified and extracted as described earlier (18) and was applied in elisa test . Elisa test was performed in 96 well micro plates (nunc, denmark) as previously described (18), with some modifications . Micro plate wells were coated overnight at 4 c with 100 l agb (10 g / ml) in 0.05 m bicarbonate buffer, ph 9.6 . Wells were washed 3 times in pbs plus 0.05% tween 20 (pbs - t) and blocked with pbs - t containing 1% bsa for 30 min at 37 c . Sera were added at 1:500 dilutions in pbst, incubated at 37 c for 1 h then washed as before . Antihuman igg -hrp (sigma chemical co., poole, dorset, united kingdom) conjugates were added at 1: 10000 dilutions in pbs - t and the micro plate incubated and washed as before . This was then developed by opd substrate (5 mg 1, 2-phenylenediamine, 12.5 ml of 0.2 m citrate phosphate buffer ph 5, 10 l 30% h2o2). The absorbance was read at 492 nm after 10 min using an automatic micro plate reader (state fax 2100, awareness, usa). Altogether 30 samples of sera from healthy volunteers had been collected during the previous studies were examined to set the cut - off . The result of seroprevalence study of human hydatidosis was detected as 1.1% (7 cases) by elisa test in isfahan province (fig . Cut - off was calculated as 0.19, so each od absorbance higher than this rate was considered positive . Analysis of sera from subjects and normal controls from isfahan city and suburb areas, isfahan province, central iran by igg - elisa using antigen b. serum samples obtained from subjects (635, lanes 1), and normal controls (30, lanes 2) the sero - prevalence of hydatidosis was 0.27% among females and 2.24% among males (p=0.019). Age group of 6069 years old, with 2.59% as prevalence had the highest rate of positivity . There was no significant difference as regards age groups, job, residency, contact by dog and literacy . According to job, as regards residency, urban life (1.49%) showed no significant difference with rural life . Table 1 shows the distribution of age group among cases examined by elisa text in isfahan city and suburb areas for hydatidosis . Distribution of positive cases of hydatidosis using elisa according to age group (yr) in isfahan city and suburb areas, isfahan province, central iran in this study, we detected a seroprevalence for human hydatidosis using elisa test in isfahan city and suburb area, accordingly total prevalence of human hydatidosis was 1.1% (7 cases). Due to long time of prepatent period of human hydatidosis, and the risk of death after consecutive surgeries, it is regarded as one the most important parasitic disease throughout the world . Iran for a long time has been considered as an endemic area for this disease and before considering a watch and wait method to monitor the disease, altogether 1% of all surgeries in iran belonged to hydatidosis (6, 7, 19). The annual incidence in iran from various cities are as follows: hamadan 1.33/100000 (20), kashan (isfahan) 3/100000 (8), babol 1.18/100000 (21) and entire of iran 0.61/100000 (22). Many studies have been conducted so far to detect the rate of human hydatidosis in various parts of iran . Accordingly the rate of infection has been reported as zanjan 3% (23), nomads tribes from south of iran 13.7% (24), ilam 1.2% (25), kashan 2.04% (8), sanandaj 7.3% (26), golestan 2.34% (9), meshkinshahr 1.79% (10), tehran 1.63% (27) and qom 1.6% (28). The rate of infection in our study was 1.1%, which shows more or less a similar rate with other parts of iran . In this study, the highest rate of infection was in the age group of 6069 yr old (2.59%). It is obvious that hydatidosis is a disease of long prepatent period and nearly most cases are diagnosed after a long time, so finding the most cases in higher ages is expectable (29). Previous studies reported the highest rate of infection in 6090 yr old in meshkinshahr (10), 3060 yr in qomand and golestan (9, 28), 2030 yr in shahryar (12), 4049 in arak (11), and> 60 yr in mongolia (30). In our study previous studies in iran shows nearly contradict findings in this regard, which originates from the culture and habit of people in different areas . Some studies have reported more seropositivity in females than males (9, 10, 28, 31), but some studies reported invers results (10, 32), and one study has reported the same findings, i.e., equivalence in males and females (33). Sources of infection with hydatidosis are varies such as soil, contact with dog, eating vegetable, etc ., so depending the culture and geographical situation the risk for infection would vary between males and females . For example, in villages where females have more contact with soil and intend to geophagy because of pregnancy, so they encompass more chance to get the disease (5, 6). Considering occupation, we noticed no obvious difference between seropositive cases, which might be due to low sample, but many studies conducted in iran and abroad have reported mare seropositivity in housewives and farmers than other jobs (57). In this study, illiterates showed the highest rate of infection (4 cases), which is attested by other studies as well (9, 28, 34). As for residency in the city and rural areas, more all seropositive cases belonged to city . One of the most important limitations of this study might be mentioned as the low rate of sero - positive cases, which is a hinder in statistical analysis, but it would undoubtedly assist for conducting a systematic review and meta - analysis article . This study would help to complete the puzzle of determining the situation of human hydatidosis in different parts of iran . Although the rate of infection was not high in isfahan city in this study, but it should be considered as a challenge in establishing the backbone of healthy measurements . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
Plasma cell leukemia (pcl) was originally defined by the presence of both> 20% circulating plasma cells (pcs) and an absolute count> 2 10/l pcs, although in many studies the presence of only 1 of the above criteria was required . Pcl may be classified as primary when it presents de novo in patients without previous evidence of multiple myeloma (mm) or secondary when it is presented as a leukemic transformation of a previously recognized mm . Primary pcl is a rare entity with an incidence of 2 to 4% of mm and is associated with a worse prognosis than mm . However, with the use of novel drugs upfront, median survival ranging from 18 to 36 months has been reported . The presence of circulating pcs, identified by cytology, multiparameter flow cytometry or slide - based immunofluorescence, is also associated with a worse prognosis in myeloma patients not fulfilling the criteria of pcl . The presence of circulating pcs is also a risk factor of progression to active disease in patients with monoclonal gammopathy of undetermined significance and smoldering mm . It has been suggested that mm patients with circulating pcs, even below 20%, could have the same bad prognosis as patients with pcl . Indeed, a lower cutoff of 5% or 0.5 10/l of nucleated peripheral blood cells to redefine pcl has been proposed . In the present study, the impact of the presence of circulating pcs assessed by cytology on the survival of patients with mm was analyzed . Requirements to enter the study were a diagnosis of symptomatic mm or primary pcl according to the international myeloma working group (imwg) criteria between january 2008 and december 2013 in 5 university hospitals from catalonia, and to have peripheral blood smears at diagnosis available for review . The study was approved by the ethic committee of the hospital de la santa creu i sant pau and was conducted according to the declaration of helsinki . Clinical data including age, sex, myeloma isotype, percentage of bone marrow plasma cells, lactate dehydrogenase (ldh), durie - salmon and iss stages, as well as initial treatment and follow up, were collected from medical records . Cytogenetic analysis was performed according to local policies and patients were treated according to regional protocols . Wright - giemsa stained peripheral blood smears were reviewed by 5 experienced hematologists on peripheral blood cytology . Each sample was analyzed by a single morphologist, with each following the same common criteria . The primary endpoint was overall survival (os) measured from the date of diagnosis to the date of death or last follow up . Differences in demographics and baseline characteristics were compared using the two - sided fisher s exact test for categorical variables and the mann - whitney u test for continuous variables . Survival analysis was performed using the kaplan - meier method and differences were tested for statistical significance using the log - rank test . The study cohort included 482 patients diagnosed with mm between january 2008 and december 2013 . The median age at diagnosis was 69 years (range 28 to 92 years). The median follow up was 28 months for the whole cohort and 38 months for the patients alive . First - line therapy was based on bortezomib combinations in 230 (47.7%) patients, alkylating agents with glucocorticoids in 114 (23.7%) patients, vincristine, doxorubicin (adriamycin), and dexamethasone (vad) or vad - like chemotherapy in 60 (12.4%), immunomodulatory - based combinations in 26 (5.4%), high - dose dexamethasone in 4 (0.8%), and only palliative care in 48 (9.9%) patients . One hundred and fifty - six (32.4%) patients received autologous stem cell transplantation as part of their first - line treatment . Twelve (2.5%) patients received allogeneic stem cell transplantation during the course of the disease . Clinical characteristics at diagnosis according to the circulating pcs group are summarized in table 1 . Differences in age, sex, myeloma isotope, ldh, durie - salmon and iss stages between the 4 groups were not statistically significant . However, patients within the 5 to 20% circulating pcs group had lower platelet counts (median 8610/l vs. 21410/l, p<0.0001) and a higher proportion of bone marrow pcs (median 53% vs. 36%, p=0.004). The 5 patients with> 20% circulating pcs were initially treated with bortezomib and dexamethasone (2 patients); bortezomib, cyclophosphamide and dexamethasone (1 patient); melphalan and prednisone (1 patient); and bortezomib, melphalan and prednisone (1 patient). Of the 12 patients with 520% circulating pcs, 1 died the day after diagnosis and only received supportive care, the remaining 11 patients were initially treated as follows: bortezomib and dexamethasone (6 patients); bortezomib, thalidomide and dexamethasone (2 patients); vad (1 patient); bortezomib, melphalan and prednisone (1 patient); and cyclophosphamide and steroids (1 patient). One patient with> 20% circulating pcs and 3 patients with 520% circulating pcs received an autologous stem cell transplantation as consolidation . According to the percentage of circulating pcs, 4 groups were considered for the analysis of survival: no circulating plasma cells, 382 (79.2%) patients; 1 to 4% circulating plasma cells, 83 (17.2%) patients; 5 to 20% circulating plasma cells, 12 (2.5%) patients; and classical pcl group (> 20% or> 210/l plasma cells), 5 (1%) patients . A patient with 15% circulating pcs but an absolute circulating pc count of 2.710/l the median os of patients with no circulating pcs, 1 to 4%, 5 to 20% and> 20% were 47 (95%ci 38.655.4) months, 50 (95%ci 31.068.9) months, 6 (95%ci 0.911.1) months and 14 (95%ci 9.718.3) months, respectively (figure 1) (p<0.001). Overall survival according to the circulating plasma cells (pcs) group in patients with multiple myeloma (p<0.001). In the univariate analysis, the other factors associated with a worse survival together with circulating pcs were age older than 65 years at diagnosis, creatinine> 2 mg / dl, treatment with new drugs upfront (proteasome inhibitors or immunodulatory drugs), and durie - salmon and iss advanced stages . Cytogenetic data was not included in the survival analysis due to the lack of such data in most patients . The finding of 5 to 20% circulating plasma cells, age older than 65 years, durie - salmon iii, creatinine> 2 mg / dl, and iss 3 retained their significance in the multivariate analysis (table 2). Two hundred and sixty five of the 482 (54.9%) patients were treated upfront with proteasome inhibitors and/or inmunomodulatory drugs . Of these, 192 (72.5%) patients had 0% circulating pcs, 61 (23.0%) patients had 1 to 4% circulating pcs, 9 (3.4%) patients had 5 to 20% circulating pcs and 3 (1.1%) patients had a diagnosis of classical pcl . One hundred and ten (41.5%) patients treated with novel agents upfront died during follow up and their median os was 50 (95% ci 3861) months . In patients treated with novel agents upfront, the median os in cases with 0%, 1 to 4%, 5 to 20% and pcl were 58 (95% ci nr) months, 60 (95% ci 3386) months, 22 (95% ci 065) months and 14 (95% ci 126) months, respectively . When only 2 groups were considered, <5% and 5% circulating pcs, median os were 58 (95% ci 46 69) months and 14 (95% ci 0.4 27) months (figure 2). Overall survival according to the circulating plasma cells (pcs) in patients with multiple myeloma and plasma cell leukemia (pcl) treated with novel drugs upfront (p<0.001). Together with the percentage of circulating pcs, the other factors associated with a worse os in univariate analysis were creatinine> 2mg / dl and iss stage ii or iii . A trend was observed in patients> 65 years old and durie - salmon stage iii . Taking into account the aforementioned variables, having 5% circulating pcs alone was the only fact which maintained statistical significance in the multivariate analysis (table 3). Ldh was not included in the multivariate analysis due to the lack of statistical significance or even a trend in univariate analysis (rr 1.1, 95% ci 0.71.9, p=0.467). The study cohort included 482 patients diagnosed with mm between january 2008 and december 2013 . The median age at diagnosis was 69 years (range 28 to 92 years). The median follow up was 28 months for the whole cohort and 38 months for the patients alive . First - line therapy was based on bortezomib combinations in 230 (47.7%) patients, alkylating agents with glucocorticoids in 114 (23.7%) patients, vincristine, doxorubicin (adriamycin), and dexamethasone (vad) or vad - like chemotherapy in 60 (12.4%), immunomodulatory - based combinations in 26 (5.4%), high - dose dexamethasone in 4 (0.8%), and only palliative care in 48 (9.9%) patients . One hundred and fifty - six (32.4%) patients received autologous stem cell transplantation as part of their first - line treatment . Twelve (2.5%) patients received allogeneic stem cell transplantation during the course of the disease . Clinical characteristics at diagnosis according to the circulating pcs group are summarized in table 1 . Differences in age, sex, myeloma isotope, ldh, durie - salmon and iss stages between the 4 groups were not statistically significant . However, patients within the 5 to 20% circulating pcs group had lower platelet counts (median 8610/l vs. 21410/l, p<0.0001) and a higher proportion of bone marrow pcs (median 53% vs. 36%, p=0.004). The 5 patients with> 20% circulating pcs were initially treated with bortezomib and dexamethasone (2 patients); bortezomib, cyclophosphamide and dexamethasone (1 patient); melphalan and prednisone (1 patient); and bortezomib, melphalan and prednisone (1 patient). Of the 12 patients with 520% circulating pcs, 1 died the day after diagnosis and only received supportive care, the remaining 11 patients were initially treated as follows: bortezomib and dexamethasone (6 patients); bortezomib, thalidomide and dexamethasone (2 patients); vad (1 patient); bortezomib, melphalan and prednisone (1 patient); and cyclophosphamide and steroids (1 patient). One patient with> 20% circulating pcs and 3 patients with 520% circulating pcs received an autologous stem cell transplantation as consolidation . According to the percentage of circulating pcs, 4 groups were considered for the analysis of survival: no circulating plasma cells, 382 (79.2%) patients; 1 to 4% circulating plasma cells, 83 (17.2%) patients; 5 to 20% circulating plasma cells, 12 (2.5%) patients; and classical pcl group (> 20% or> 210/l plasma cells), 5 (1%) patients . A patient with 15% circulating pcs but the median os of patients with no circulating pcs, 1 to 4%, 5 to 20% and> 20% were 47 (95%ci 38.655.4) months, 50 (95%ci 31.068.9) months, 6 (95%ci 0.911.1) months and 14 (95%ci 9.718.3) months, respectively (figure 1) (p<0.001). Overall survival according to the circulating plasma cells (pcs) group in patients with multiple myeloma (p<0.001). In the univariate analysis, the other factors associated with a worse survival together with circulating pcs were age older than 65 years at diagnosis, creatinine> 2 mg / dl, treatment with new drugs upfront (proteasome inhibitors or immunodulatory drugs), and durie - salmon and iss advanced stages . Cytogenetic data was not included in the survival analysis due to the lack of such data in most patients . The finding of 5 to 20% circulating plasma cells, age older than 65 years, durie - salmon iii, creatinine> 2 mg / dl, and iss 3 retained their significance in the multivariate analysis (table 2). Two hundred and sixty five of the 482 (54.9%) patients were treated upfront with proteasome inhibitors and/or inmunomodulatory drugs . Of these, 192 (72.5%) patients had 0% circulating pcs, 61 (23.0%) patients had 1 to 4% circulating pcs, 9 (3.4%) patients had 5 to 20% circulating pcs and 3 (1.1%) patients had a diagnosis of classical pcl . One hundred and ten (41.5%) patients treated with novel agents upfront died during follow up and their median os was 50 (95% ci 3861) months . In patients treated with novel agents upfront, the median os in cases with 0%, 1 to 4%, 5 to 20% and pcl were 58 (95% ci nr) months, 60 (95% ci 3386) months, 22 (95% ci 065) months and 14 (95% ci 126) months, respectively . When only 2 groups were considered, <5% and 5% circulating pcs, median os were 58 (95% ci 46 69) months and 14 (95% ci 0.4 27) months (figure 2). Overall survival according to the circulating plasma cells (pcs) in patients with multiple myeloma and plasma cell leukemia (pcl) treated with novel drugs upfront (p<0.001). Together with the percentage of circulating pcs, the other factors associated with a worse os in univariate analysis were creatinine> 2mg / dl and iss stage ii or iii . A trend was observed in patients> 65 years old and durie - salmon stage iii . Taking into account the aforementioned variables, having 5% circulating pcs alone was the only fact which maintained statistical significance in the multivariate analysis (table 3). Ldh was not included in the multivariate analysis due to the lack of statistical significance or even a trend in univariate analysis (rr 1.1, 95% ci 0.71.9, p=0.467). This study aimed to address the impact of circulating pcs on the survival of patients with mm . Seventeen per cent of patients had between 1 and 4% circulating plasma cells . That finding was not associated with other clinical characteristics and had no impact on survival . There was a completely different picture for the 2.5% of patients with 5 to 20% circulating pcs . Such patients had lower platelet counts, higher bone marrow infiltration and, importantly, a shorter survival independent of other known clinical prognostic factors . In fact, the median os of 6 months observed in these patients is closer to that of patients with the classical definition of pcl . When the analysis was restricted to patients treated with novel agents upfront, the impact of circulating pcs was consistent with the whole cohort . The differences in os observed between patients with 520% circulating pcs and> 20% circulating pcs (6 vs. 14 months) may be explained by the low number of cases in both groups . Although the presence of circulating pcs has been previously associated with survival, conventional cytology has been used for their assessment in only one study . In that case, patients with circulating plasma cells constituted 14.1% of the overall series and had a median survival of 25 months . The results of the present study are consistent with the ominous prognostic impact of peripheral blood plasmacytosis; however, the definition of a high - risk group found was different; 2% circulating pcs in the study by an et al . And 5% circulating pcs in the study herein . Using multiparameter flow cytometry, the presence of circulating pcs has also been associated with survival . In the study from the mayo clinic, such patients had a median os of 32 months versus not reached in patients with 400 or less circulating pcs . In another study from the same institution, which in this case used slide - based immunofluorescence microscopy for plasma cell quantification, 54% of patients with> 4% pcs were identified . These patients had a median survival of 2.4 years compared to 4.4 years in patients with fewer circulating pcs . The aforementioned studies used much more sensitive techniques than those used in the present; this may explain the different percentages of patients with circulating pcs identified in those studies in comparison with the present one . Despite these findings, the definition of pcl has been based on standard morphological examination of peripheral blood . In comparison with flow cytometry and immunofluorescence additionally, conventional cytology has the advantage of being a simple and inexpensive technique that can be applied in any clinical laboratory worldwide . However, it has a limitation; conventional cytology is not able to identify the clonality of pcs, as can be achieved by flow cytometry and immunofluorescence . This may hamper the specificity of conventional cytology since polyclonal reactive pcs may be rarely detected in some patients with mm . The presence of t(4;14), del(17p), amp(1q21) and del(1p21) in malignant pcs are adverse prognostic factors in mm . Indeed, adverse cytogenetics together with iss 3 and/or high ldh identifies a group of patients with an ultra - high risk of mm . Several of these genetic abnormalities, particularly del(17p)9 and chromosome 1 alterations are more frequent in pcl than in mm . In the series presented herein, del(17p) by fluorescence in situ hybridization (fish) was observed in 1 of 7 patients with 5 to 20% circulating pcs and 1 of 2 patients with> 20% circulating pcs . A limitation of the present study is that, due to the lack of cytogenetic data in most patients, the prognostic impact of unfavorable cytogenetic abnormalities and the revised iss could not be analyzed . As highlighted in the last consensus by imwg, the diagnosis of pcl has been classically done on the basis of the presence of> 20% circulating pcs and/or an absolute count> 2 10/l pcs . However, lower peripheral blood pc counts, as showed in our study (that is, 5% peripheral blood plasma cells), should be considered as a diagnostic criteria of pcl (pcl - like myeloma or early pcl), due to the independent and strong prognostic impact . Prospective multicenter analysis with translational and correlative studies into the biology of these patients is encouraged as well as risk - oriented therapeutic strategies . Careful examination of peripheral blood by conventional microscopy should be done for all patients with mm in daily clinical practice . In conclusion, the presence of 5% circulating pcs by conventional cytology easily identifies a group of patients with myeloma with a prognosis as poor as that of pcl, suggesting that the diagnosis of pcl should be revisited . If confirmed in other series, especially in prospective studies of uniformly treated patients, such patients may benefit from a distinct and more intensified therapeutic approach.
A 70-year - old man was admitted to the emergency department with a 1-month history of coughing and dyspnea . He developed a productive cough with purulent sputum, left chest wall pain, and 3 days prior to arrival ecchymosis developed on the left upper quadrant of the abdomen . He did not have a recent history of thoracic or abdominal trauma, and it was unknown if he had a history of thoracic surgery . The initial chest x - ray showed a hyperdensity in the left lower lung, an obliterated diaphragmatic border with an atelectasis, and a decreased lung volume . The scan film showed a protrusion of the lung through the left 7th intercostal space (fig . Therefore, he was diagnosed with a lung herniation, and a medical conservative treatment was performed . On hospital day 10, after experiencing uncontrolled coughing, the patient complained of aggravated dyspnea and left chest wall pain . The subsequent chest x - ray showed increased hyperdensity with a gas - filled area above the left dome of the diaphragm . He also showed dullness to percussion and chest wall tenderness . On hospital day 12, a ct scan with contrast of the chest revealed herniation of the bowl and omental fat in the anterior portion of the left hemithorax (fig ., the patient was transferred to the department of thoracic surgery and underwent an emergency operation due to the incarceration of the bowl and a parapneumonic effusion due to passive atelectasis . The operation revealed a partial agenesis of intercostal muscle, costal cartilage around the 7th anterolateral intercostal space due to the lack of developed intercostal muscle (fig . 2a), an 8 cm defect of the diaphragm, and a herniation of the small bowel located in the anterior portion of the left thoracic cavity (fig . The primary repair of the diaphragm was performed and the direct approximation of the 7th intercostal space was determined . A lung herniation is defined as a protrusion of the lung beyond the normal confines of the thoracic cavity through an abnormal opening in the chest wall . A condition associated with increased intra - thoracic pressure or that weakens the thoracic wall may cause a lung herniation . According to a report by goverde et al ., lung herniation is such a rare disease, that only about 300 patients have been reported with the disease in the world literature, and most were single case reports . Congenital lung hernias are especially rare and consist of approximately 18% of all reported lung hernias . Most congenital lung hernias are found in the supraclavicular area, whereas a lung herniation in the intercostal area is rare . A morgagni's hernia is caused by a failure of fusion between the fibrotendinous portions of the sternal and the costal parts of the diaphragm . A morgagni's hernia is also a rare disease . In a report by berman et al ., only 15 infants and children with morgagni's hernia were admitted over a 20 year period at the hospital for sick children in toronto . The majority of patients present with a morgagni's hernia in the neonatal period, but the hernia may remain undiscovered until later in life . Morgagni's hernia is secondary to an incomplete development of the diaphragm in contributing to the increase of abdominal pressure; other contributing factors include trauma, severe exertion, and obesity . We located the agenesis of the intercostal muscle and the costal cartilage, and the congenital morgagni's hernia was located near the intercostal herniation . The discoveries serve as evidence that this case involved a congenital disorder . In conclusion, we believe that the cause of the intercostal hernia combined with the morgagni's hernia might have been due to incomplete development of the chest wall and diaphragm . The increased abdominal pressure due to recurrent cough is what aggravated the symptoms.
In order to collect a set of images useful to test the algorithm, we run 10 plasma samples using 2d - ge . 2d - ge was performed according to maresca et al ., with each sample run in duplicate . For the first - dimension of electrophoresis, 200 g of plasma protein samples (approximately 3 l) were applied to 18-cm linear ipg strips 47 (ge healthcare, uppsala, sweden) and focused until 72,000 v / h were reached . Prior to sds page, the ipg strips were equilibrated twice for 15min in equilibration buffer (50 mm tris hcl ph 8.8, 6 m urea, 30% glycerol (v / v), 2% sds (w / v) and traces of bromophenol blue) containing 1% dtt (w / v)for the first equilibration step and 2.5% iodoacetamide (w / v) for the second step, respectively . Page was performed on 12.5% polyacrylamide gels at 60 ma / gel at 16 c and terminated when the dye front reached the lower end of the gel . After sds page, the gels were stained overnight with rubps in fixing solution (30% ethanol and 10% acetic acid) according to the manufacturer s instructions . The gel images were acquired by gel - doc - it 310 imaging system (uvp, upland, ca), with the following setting exposure 7 s, gain 3 and three different apertures: 6, 7 and 8 . Aperture is expressed as f - stop (e.g., f2.8 or f/2.8): the smaller is the f - stop number (or f / value), the larger is the aperture . Using a larger exposure yields a larger number of spots and, at the same time, more saturated areas . In our case, only the image acquired at the lower exposure (figure 1c) could be properly analysed by commercial and academic software currently available, while the saturation in some areas in the other two images (figure 1a and b) prevented accurate evaluation of protein expression . Using the algorithm described in this work, we have been able to approximate the intensity values of the non - saturated spots within the saturated area . After image scanning, the 2d - ge images are noisy and usually affected by several artefacts such as scratches, air bubbles and spikes . Scratches and air bubbles are unintentionally introduced by the operator, while spikes are caused by the presence of precipitated staining particles or imperfect polyacrylamide gel matrix . In particular, spikes are a sort of impulsive noise because of the small area of high intensity . The aim of reducing speckles in a 2d - ge image (despeckling) is to remove the noise without introducing any significant distortion in quantitative spot volume data . Noise suppression methods employed in commercial software packages for 2d - ge image analysis are based on spatial filtering, particularly the most widely used techniques are based on local median filter . Although several other methods have been developed, the advantage of using the median filter is the easy application, since it normally requires the setting of only one main parameter, the filter kernel, which is generally related to the noise size . At the same time, the size of the filter matrix also accounts for the major impact exerted on the resulting image . We evaluated the performance of filter size on a set of test images from 3 3 to 7 7 and observed remarkable deterioration for larger filter size, due to the decreased the contrast of the image . Therefore, a 3 3 filter was chosen, which was capable of removing most of the spikes, while preserving the shape of the spots . The result of a 3 3 median filter on a sample image is shown in figure 5 . A portion of gel with spikes in 2d and 3d view was shown in figure 5a and c, respectively . The results of a 3 3 median filter are shown in figure 5b and d accordingly . Saturation effects in 2d gel images could occur for several reasons: (i) intense staining, causing complete absorption of light passing through the spot, (ii) long exposure time during the acquisition step, (iii) too high protein concentration, or (iv) accumulation of pigment on top of high intensity spots, leading to the loss of dynamic linear range . Saturation effects might also result from manipulation of image data with image processing software that is not designed for quantitative image analysis (e.g., photoshop). For instance, visually - enhanced images often show plateau areas in the high and low intensity regions . The commercial software is able to detect a saturated area when the intensity reaches the maximum value of grey - scale . However, in most cases saturated areas are very similar to plateau zones, i.e., where the pixels have similar intensity without reaching the maximum value of grey - scale . In these cases, the software might also fail to detect the plateau regions, causing the operator to underestimate the problem . In order to identify the plateau regions, we implemented a morphological filter, inspired by the rolling - ball algorithm described by sternberg, which allows segmentation of the plateau zones . This method is based on a structural element (se) defined by a circle of given radius (rd) and a grey - scale value tolerance (gvt). In particular, for each pixel (x, y) of the image i, the se is defined as a circular neighbourhood of rd:(1a)se=(s, t)ini/(s - x)2+(t - y)2<rdwhere(1b)i=(0,image width)[0,image height]denotes the spatial domain of the image . The gvt represents the rate of grey values of the pixel in the centre of the ses (figure 6b). For instance, setting the parameter to 10, the rd is 10 pixels and the gvt in the 10% of grey values of the pixel at position (x, y). The centre of se is moved along each pixel of the image and the maximum and minimum grey values of the pixels for each point (x, y) within the given rd are calculated . When the difference between maximum and minimum is less than gvt, the area defined by the local operator is considered as a plateau area . It is worth noting that, when the value of the parameter is low, the rd of the ball is small and only few pixels are included in se . We examined the performance with rd values from 10 to 25 and for this analysis we selected a value of 15 . After localizing the plateau regions, we segmented the image to identify the isolated protein spots containing plateau areas on each gel image . The segmentation procedure yields a set of image segments, consisting of connected neighbouring pixels enclosed by a spot boundary . The image is considered as a landscape, and the segmentation is to identify all the local minima in the landscape and then find the catchment basins associated with each local minima . The boundary between several catchment basins is called a watershed . For 2d - ge each separated catchment basin is considered as an isolated protein spot . Unlike the usual watershed segmentation, only the plateau areas in our method have been assigned to a catchment basin . Finally, the grey values of the pixels inside the spot, excluding the region identified as a plateau area, were used in the gaussian extrapolation step to recover the distribution of the unsaturated spot . The final step consists of reconstructing the saturated spots resulting from high exposure images and approximating the unknown grey values in the plateau region . This has been done considering the unsaturated spot to be described by an analytical function, depending on a restricted set of parameters . In particular, we assumed each cross section of the spot intensity along both vertical and horizontal axes to be approximated by a generalized gaussian distribution . Namely, for each value of the y - coordinates we considered a function of the form:(2)f(x, m(y),(y),x0,b)=m(y)(y)exp-|x - x0(y)|bb(y)b for b = 2, eq . (1b) defines the kernel of a standard gaussian distribution centred in x0(y), where (y) and m(y) is the standard deviation and the maximum of intensity values, respectively . Note that, unlike the other parameters, b does not depend on y, assuming that the approximating gaussian can have different maximum, center and variance in different sections .,nyand the corresponding intensities {iij}, we determine the set of parameters (m,, x0, b) for which the function defined in (2) fits at best the values of the intensity in the unsaturated region . In practice, we have to minimize an error function that defines how good a particular parameter set is . For example, a standard least - squared criterion can be used(4)em(yj),(yj),x0(yj),b=i=1nxfxi, m(yj),(yj),x0(yj),b - iij2 however, the error measure can be defined in different ways, e.g., according to different norms or including different weighs for the different parameters and/or the different pixels . In particular, we modified (4) in order to control the variation of the parameters for different sections . In our case the error function (5) can be formulated as follows(5)em(yj),(yj),x0(yj),b = em(yj),(yj),x0(yj),b+m(yj)-m(yj-1)2+(yj)-(yj-1)2+x0x0(yi)-x0(yj-1)2 for positive values of the parameters (m,, x0), the problem is then reduced to finding the parameters yielding the minimum of the selected error function . One possibility is to perform an exhaustive search on all the values of a pre - defined parameters space . However, if the size of the parameter space is large, a more effective newton after image scanning, the 2d - ge images are noisy and usually affected by several artefacts such as scratches, air bubbles and spikes . Scratches and air bubbles are unintentionally introduced by the operator, while spikes are caused by the presence of precipitated staining particles or imperfect polyacrylamide gel matrix . In particular, spikes are a sort of impulsive noise because of the small area of high intensity . The aim of reducing speckles in a 2d - ge image (despeckling) is to remove the noise without introducing any significant distortion in quantitative spot volume data . Noise suppression methods employed in commercial software packages for 2d - ge image analysis are based on spatial filtering, particularly the most widely used techniques are based on local median filter . Although several other methods have been developed, the advantage of using the median filter is the easy application, since it normally requires the setting of only one main parameter, the filter kernel, which is generally related to the noise size . At the same time, the size of the filter matrix also accounts for the major impact exerted on the resulting image . We evaluated the performance of filter size on a set of test images from 3 3 to 7 7 and observed remarkable deterioration for larger filter size, due to the decreased the contrast of the image . Therefore, a 3 3 filter was chosen, which was capable of removing most of the spikes, while preserving the shape of the spots . The result of a 3 3 median filter on a sample image is shown in figure 5 . A portion of gel with spikes in 2d and 3d view was shown in figure 5a and c, respectively . The results of a 3 3 median filter are shown in figure 5b and d accordingly . Saturation effects in 2d gel images could occur for several reasons: (i) intense staining, causing complete absorption of light passing through the spot, (ii) long exposure time during the acquisition step, (iii) too high protein concentration, or (iv) accumulation of pigment on top of high intensity spots, leading to the loss of dynamic linear range . Saturation effects might also result from manipulation of image data with image processing software that is not designed for quantitative image analysis (e.g., photoshop). For instance, visually - enhanced images often show plateau areas in the high and low intensity regions . The commercial software is able to detect a saturated area when the intensity reaches the maximum value of grey - scale . However, in most cases saturated areas are very similar to plateau zones, i.e., where the pixels have similar intensity without reaching the maximum value of grey - scale . In these cases, the software might also fail to detect the plateau regions, causing the operator to underestimate the problem . In order to identify the plateau regions, we implemented a morphological filter, inspired by the rolling - ball algorithm described by sternberg, which allows segmentation of the plateau zones . This method is based on a structural element (se) defined by a circle of given radius (rd) and a grey - scale value tolerance (gvt). In particular, for each pixel (x, y) of the image i, the se is defined as a circular neighbourhood of rd:(1a)se=(s, t)ini/(s - x)2+(t - y)2<rdwhere(1b)i=(0,image width)[0,image height]denotes the spatial domain of the image . The se is depicted in figure 6a . The gvt represents the rate of grey values of the pixel in the centre of the ses (figure 6b). For instance, setting the parameter to 10, the rd is 10 pixels and the gvt in the 10% of grey values of the pixel at position (x, y). The centre of se is moved along each pixel of the image and the maximum and minimum grey values of the pixels for each point (x, y) within the given rd are calculated . When the difference between maximum and minimum is less than gvt, the area defined by the local operator is considered as a plateau area . It is worth noting that, when the value of the parameter is low, the rd of the ball is small and only few pixels are included in se . We examined the performance with rd values from 10 to 25 and for this analysis we selected a value of 15 . After localizing the plateau regions, we segmented the image to identify the isolated protein spots containing plateau areas on each gel image . The segmentation procedure yields a set of image segments, consisting of connected neighbouring pixels enclosed by a spot boundary . The image is considered as a landscape, and the segmentation is to identify all the local minima in the landscape and then find the catchment basins associated with each local minima . The boundary between several catchment basins is called a watershed . For 2d - ge each separated catchment basin is considered as an isolated protein spot . Unlike the usual watershed segmentation, only the plateau areas in our method have been assigned to a catchment basin . Finally, the grey values of the pixels inside the spot, excluding the region identified as a plateau area, were used in the gaussian extrapolation step to recover the distribution of the unsaturated spot . The final step consists of reconstructing the saturated spots resulting from high exposure images and approximating the unknown grey values in the plateau region . This has been done considering the unsaturated spot to be described by an analytical function, depending on a restricted set of parameters . In particular, we assumed each cross section of the spot intensity along both vertical and horizontal axes to be approximated by a generalized gaussian distribution . Namely, for each value of the y - coordinates we considered a function of the form:(2)f(x, m(y),(y),x0,b)=m(y)(y)exp-|x - x0(y)|bb(y)b for b = 2, eq . (1b) defines the kernel of a standard gaussian distribution centred in x0(y), where (y) and m(y) is the standard deviation and the maximum of intensity values, respectively . Note that, unlike the other parameters, b does not depend on y, assuming that the approximating gaussian can have different maximum, center and variance in different sections . The reconstruction problem can be formulated as follows .,nyand the corresponding intensities {iij}, we determine the set of parameters (m,, x0, b) for which the function defined in (2) fits at best the values of the intensity in the unsaturated region . In practice, we have to minimize an error function that defines how good a particular parameter set is . For example, a standard least - squared criterion can be used(4)em(yj),(yj),x0(yj),b=i=1nxfxi, m(yj),(yj),x0(yj),b - iij2 however, the error measure can be defined in different ways, e.g., according to different norms or including different weighs for the different parameters and/or the different pixels . In particular, we modified (4) in order to control the variation of the parameters for different sections . In our case the error function (5) can be formulated as follows(5)em(yj),(yj),x0(yj),b = em(yj),(yj),x0(yj),b+m(yj)-m(yj-1)2+(yj)-(yj-1)2+x0x0(yi)-x0(yj-1)2 for positive values of the parameters (m,, x0), the problem is then reduced to finding the parameters yielding the minimum of the selected error function . One possibility is to perform an exhaustive search on all the values of a pre - defined parameters space . However, if the size of the parameter space is large, a more effective newton mn conceived the study, developed the algorithm for the detection of overexposed areas and plateau regions . Mn and ac drafted the manuscript with the help of ef . All authors read and approved the final manuscript.
Obesity is associated with numerous chronic diseases and, currently, its prevalence is 34% in us adults . Excess fat storage is the result of greater energy intake than expenditure for a period of time; thus, increasing energy expenditure is an important strategy to treat obesity . Physical activity energy expenditure (paee) can be further divided into energy expended during structured exercise and during activities of daily living other than structured exercise . There has been extensive research investigating the effects of various exercise and/or caloric restriction interventions for inducing weight loss . In general, these programs are successful at inducing weight loss; however, there is some evidence showing that increases in total daily energy expenditure during prescribed exercise interventions are less than expected given the amount of energy expended during the prescribed exercise sessions [38]. In support of this, one study showed that accelerometer counts from physical activities outside of structured exercise decreased by 8% after a 12-week training period . This suggests that paee outside of the structured exercise may decrease as a result of the exercise treatment . All of these prior studies examined the chronic or longer - term effects of exercise interventions on paee . However, it is also important to determine whether there are potential changes in paee acutely on days in which the exercise is performed . Yet, to date, only one small study examined this acute effect of exercise on daily paee . It reported that accelerometer counts from nonexercise activities were lower on days with, than without, structured exercise during a 12-week exercise program . Thus, the purpose of the present study was to determine whether performing a single exercise bout impacts daily paee in postmenopausal women and to determine whether the intensity of the exercise bout plays a role in any potential changes in daily paee . Women in this study are a subset of those enrolled in a randomized clinical trial that was designed to determine whether intensity of aerobic exercise affects the loss of abdominal adipose tissue and improvement in cardiovascular disease risk factors in postmenopausal women with abdominal obesity (clinicaltrials.gov: nct00664729). Briefly, they were: (1) older postmenopausal (age: 5070 yr), (2) overweight or obese (bmi: 2540 kgm and waist circumference> 88 cm), (3) nonsmoking, (4) not on hormone therapy, and (5) sedentary (<15 minutes of exercise, two times per wk) in the past 6 months before enrollment . The study was approved by the wake forest university institutional review board, and all women signed an informed consent form to participate in the study according to the guidelines for human research . Data used for the current analyses are from women who were randomized to caloric restriction plus moderate - intensity aerobic exercise (moderate - intensity) or caloric restriction plus vigorous - intensity aerobic exercise (vigorous - intensity) and completed the study interventions . There were 18 women in the moderate - intensity and 18 women in the vigorous - intensity groups who had paee data available from before the intervention and from days with and without center - based exercise in the last month of intervention . Both the moderate - intensity and vigorous - intensity interventions were 5 months, and the energy deficit was designed to be approximately 2100 kcalwk from caloric restriction and 700 kcalwk from center - based exercise . Individual energy needs for weight maintenance were calculated from each woman's resting metabolic rate (indirect calorimetry after an overnight fast by using a medgraphics ccm / d cart and breeze 6.2 software, medgraphics, st . Paul, mn) and an activity factor based on self - reported daily activity (1.2 - 1.3 for sedentary lifestyle). Individual diets were developed by a registered dietitian according to each woman's choices from a menu designed by a registered dietitian . Throughout the course of the 5-month intervention, all women were provided with daily lunch, dinner, and snacks prepared by the general clinical research center (gcrc) metabolic kitchen . They were asked to eat only the food that was given to them or that was approved from the breakfast menu . Energy make - up of the diet was approximately 25% from fat, 15% from protein, and 60% from carbohydrate . Women were allowed to consume as many noncaloric, noncaffeinated beverages as they liked . They were also allowed 2 free days per month during which they were not provided food but were given guidelines for diet intake at their prescribed energy level . All women were provided with daily calcium supplements (500 mg, 2 timesd). They were asked to keep a log of all foods consumed, and the records were monitored by the dietitian to verify compliance . The exercise interventions were center - based walking on treadmills (lifefitness 9500hr, life fitness co., il) on 3 dwk under the supervision of an exercise physiologist . Exercise progressed from 2025 min the first week to 55 minutes by the end of the sixth week for the moderate - intensity (4550% of maximum oxygen consumption, vo2max) group and it progressed from 1015 minutes the first week to 30 min by the end of the sixth week for the vigorous - intensity (7075% of vo2max) group . The target exercise intensity was determined based on each woman's target heart rate calculated from the karvonen equation [(hrr intensity) + resting heart rate], where hrr is the maximal heart rate, obtained from each woman's maximum exercise test, minus resting heart rate . Treadmill speed and grade were adjusted on an individual basis to ensure women exercised at their prescribed exercise intensity . Heart rate readings (by polar heart rate monitors; polar electro inc, lake success, ny) were taken before, at least 2 times during (to monitor compliance to the prescribed exercise intensity), and after the exercise . It is about the size of a pager and is worn by clipping onto the waist . It collects 3-dimensional data at one minute intervals and stores such data for 7 days . Activity energy expenditure was computed using the manufacturer's software from the integrated acceleration and body mass with formula developed by the manufacturer . Daily paee was calculated using the average calories expended per minute times 1440 minutes a day . Women were asked to wear the accelerometer before and each month during the intervention, for 57 days including week days and weekend days . Women were instructed not to change their activities while wearing the accelerometer at all times, except while sleeping and bathing . Data collected from rt3 monitors were included only when there were valid data from both before the intervention and during the last month of intervention . During the last month of intervention, rt3 data were considered valid when data were collected from at least 2 days with center - based exercise and at least 2 days without center - based exercise . The average paee from days with and without center - based exercise were used for the current analyses . Of note, the average daily paee from days with center - based exercise included the energy expended during the exercise sessions, and none of the women performed structured exercise at baseline . Treadmill readings during the exercise sessions were recorded for each woman as a measure of energy expended during center - based exercise . Height and weight were measured before and after the 5-month intervention with shoes and jackets or outer garments removed . All analyses were performed using sas software, version 9.1 (sas institute, cary, nc). Paired t - tests were used to compare values within the same group at different measurement points . As shown in table 1, there were no differences in baseline characteristics such as age, racial distribution, body weight, and body mass index between the moderate - intensity and vigorous - intensity groups . The total amount of weight loss during intervention was similar between the moderate - intensity and vigorous - intensity groups (12.9 4.2 kg or 14.6 4.8% and 12.6 5.1 kg or 13.5 4.6%, resp . ). During the last month of intervention, paee on days with center - based exercise was significantly higher in women performing moderate - intensity exercise than in women performing vigorous - intensity exercise (p = .052). In contrast, paee on days without exercise was not statistically different between the two groups (p = .135). In the moderate - intensity group, 13 of the 18 women had higher paee on days with than without center - based exercise (figure 1), and the average paee on days with exercise (577.7 219.7 kcald) was higher than on days without exercise (450.7 140.5 kcald, p = .011) (table 1). Yet, the difference (127.0 188.1 kcald) was much smaller than the energy expended during exercise (325.0 79.6 kcald) (figure 2), suggesting that, during the 5th month of exercise training, women expended less energy on activities outside of the structured exercise when they exercised during the day . In support of this, paee on days with center - based exercise was not different from baseline paee (520.8 206.5 kcald; p>.05 for both) in women performing moderate - intensity exercise even though energy expended during exercise was included in the daily paee on days with exercise . On the other hand, in the vigorous - intensity group, 12 of the 18 women had lower paee on days with than without center - based exercise during the last month of the intervention (figure 1). The average daily paee on days with exercise (450.6 153.6 kcald) was lower than on days without exercise (519.2 127.4 kcald) (difference = 68.6 136.1 kcald, p = .047) again even though energy expended during exercise (296.8 93.0 kcald) was included in daily paee on days with exercise (figure 2). This indicates that, during the 5th month of exercise training, women performing vigorous - intensity exercise were expending more total calories on nonexercise days than on exercise days . In addition, paee on days without exercise was not different from baseline daily paee (543.2 164.0 kcald; p>.05); however, paee on days with exercise (which included energy expended during center - based exercise) was significantly lower than baseline paee (p = .020). This study adds information to the literature regarding how acute exercise sessions affect daily paee and whether the intensity of exercise influences the effects . We found that, during the last month of a 5-month moderate - intensity exercise training intervention, the daily paee during days with center - based exercise was higher than days without exercise by an amount much smaller than the exercise energy expenditure . During the 5th month of a vigorous - intensity exercise training intervention, daily paee during days with center - based exercise was lower than days without center - based exercise sessions, even with energy expended during the exercise sessions included in paee . Therefore, there was a reduction in paee outside of the center - based exercise sessions in both intervention groups, and this reduction appeared to differ based on the intensity level of the center - based exercise because it was greater in women performing vigorous - intensity, compared to moderate - intensity, exercise . Our findings are in line with those of meijer et al ., who found that accelerometer counts of total physical activity were similar between days with and without training, and that after energy expenditure during the training session was subtracted out, accelerometer counts were significantly lower on training days . In their study, the training program included one aerobic exercise of 60 minutes and one cardio- and weight - stack machine exercise of 90 minutes each week for 12 weeks in men and women of 55 years and older . We cannot directly compare the magnitude of the paee responses in our study to their study because the intensity of the exercises was not specified and only accelerometer counts were reported in their study . We also showed that exercise at vigorous intensity induced greater compensation in paee than moderate - intensity exercise . Of note, both exercise programs in our study are consistent with the current physical activity guidelines for adults [11, 12]. The frequency of the exercise sessions was the same for the moderate - intensity and vigorous - intensity exercise groups, and the volume of exercise was also similar . However, this does not exclude the possibility that volume or frequency of exercise of an exercise program may affect the chronic response in paee to the program . Further studies are needed to address these questions because these are important factors to consider when designing exercise programs to better meet an individual's goal for participating exercise . In this study, thus, women were relatively trained so that paee responses to acute exercise may be somewhat different from those if women were untrained . However, we suspect that the compensation in paee is likely lower in the trained state . In other words, for a person who does not participate in regular exercise, an acute session of exercise may induce greater compensation in paee . On the other hand, the information found in this study may be more important because with the epidemic of obesity, many individuals participating in exercise programs may think that would satisfy the goal of weight control . Thus, we should educate and encourage them to maintain higher daily activities while participating in exercise programs at the same time . The results of this study should be interpreted in light of a few considerations . The daily paee during days with and without center - based exercises was the average of at least two days . Although this provides a good measure of activity energy expenditure, it would be better if data from more days were available . Second, all exercise sessions were during the week . For paee during days without exercise, we did not have enough data to determine whether there was a difference in paee between those weekdays and weekend days . These are not accurate measures of energy expenditure; however, we believe this will not affect our conclusion given the big difference shown between exercise energy expenditure and the difference between paee during days with and without exercise sessions (figure 2). In summary, the main finding of this study is that women expended more energy during physical activities outside of prescribed exercise sessions on days they did not perform center - based exercise, especially if the prescribed exercise was of a higher intensity . More research is needed to determine what exercise prescription can minimize this compensation . This phenomenon may have biological and behavioral reasons, and future research investigating the underlying mechanisms is warranted . Thus, health professionals should encourage individuals who are participating in exercise programs to maintain levels of activity in addition to the program, so that greater weight loss can be achieved.
The occurrence of screw loosening is reported to be 12.7% in single tooth restoration and 6.7% in partial fixed prostheses . 23 jemt et al.4 observed that most of the screw loosening occurred within a year and the frequency of screw loosening was reduced over time . Henry et al.5 and khraisat et al.6 stated that screw loosening is more frequent in external type implants . In internal type connections, the stability of the prosthesis is obtained from the clamping force of the screw joint and the frictional force created by contact between the conical mating parts of the implant - abutment assembly . Because of this connection, internal type implants have more favourable stress distribution, better stability, and superior resistance to lateral load.7 however, tsuge and hagiwara8 presented no significant difference between internal and external implant - abutment connections concerning their effect on the abutment screw loosening . Theoharidou et al.9 also reported that the frequency of screw loosening in single tooth restoration was 2.7% in external type implants and 2.4% in internal type implants; this difference was not statistically significant . The frequency of screw loosening is reduced over time, but still occurs in spite of recent advances in the design and screw materials . Screw loosening produces discomfort for patients; therefore, methods to prevent screw loosening are needed . One method for preventing screw loosening that is easily applicable to clinical practice is retightening . Gradual functional loading causes sliding of the screw thread and relief of screw extension induced by preload . Gradual reduction of preload below a critical point causes screw turning . Applying a greater preload on the screw in the first phase of screw loosening siamos et al.11 reported that in order to minimize the loss of preload, it is necessary to retighten the screw 10 minutes after the first screw tightening . However, the retightening procedure may change the shape of the abutment screw and the inner screw thread of the implant; hence, stability during function may be affected.12 in addition, conflicting results on the effect of retightening have been reported . According to tzenakis et al.,13 if the abutment screw is repeatedly retightened, a higher preload can be obtained because of surface wear that can lower the coefficient of friction . However, weiss et al.14 reported that repeated tightening / removal procedures decreased the reverse torque value (rtv) of screws . Riccardi - copped et al.15 reported that repeated tightening and removal of titanium screws caused the rtv to decrease gradually . The effect of screw retightening remains controversial and on the timing and frequency of retightening are lacking . The aim of this study was to assess the effect of dynamic loading and screw retightening on rtv in external and internal connection type implants . Twenty external type implants (diameter, 4 mm; length, 10 mm; sola, shinhung, seoul, korea) and 20 internal type implants (diameter, 4 mm; length, 10 mm; luna, shinhung, seoul, korea) were used (fig . 1). Abutments for cementretained prostheses (diameter, 5 mm; gingival height, 5.5 mm; esthetic abutment for external implant and duo abutment for internal implant, shinhung, seoul, korea) were connected to each implant (fig . Each implant and abutment assembly was held in a customized jig in all testing procedures . Using a digital torque controller (mgt 12, mark-10 co., new york, ny, usa) after 10 minutes, the assemblies were retightened with 30 ncm torque to compensate for embedment relaxation.11 after tightening the screws twice, an initial measurement of rtv was made . The implant / abutment assemblies were divided into 4 groups (10 assemblies per group) in order to evaluate the effect of intermittent retightening: 1) ext - n, external type implant with no retightening; 2) ext - rt, external type implant with retightening; 3) int - n, internal type implant with no retightening; 4) int - rt, internal type implant with retightening . The implant / abutment assemblies were fitted to the mounting base of a universal testing machine (electroplus e 3000, instron, washington dc, wa, usa) with the long axis of the implant fixed at 30 degrees relative to the vertical axis (fig . The testing device delivered sine curved cyclic loading between 20 and 250 n at 14 hz for 100,000 cycles . In the groups with no retightening (ext - n and int - n), the rtv was measured after 100,000 cycles of loading, while rtv was measured after 3, 10, and 100 cycles as well as every 20,000 cycles in the retightening groups (fig . 3). For all statistical evaluations, spss version 20.0, spss inc ., one - way analysis of variance (anova) was used for comparing rtv depending on the implant system and retightening . When the rtv was measured repeatedly after various loading cycles, tukey's test was used for post hoc comparisons, and the significance level was set at =0.05 . The initial rtvs were 27.8 1.3 ncm in external implants and 25.1 1.9 ncm in internal implants . Both implant systems showed decreased rtvs when compared with the tightening torque value of 30 ncm . The initial rtv of external implants was significantly higher than that of internal implants (p<.05). The rtvs of all implant / abutment assemblies were significantly reduced after cyclic loading (p<.05, table 1, table 2). The rtvs of the groups without retightening were 25.4 1.2 ncm in the ext - n group and 15.8 1.8 ncm in the int - n group . The ext - n group showed a significantly higher rtv when compared with the int - n group (p<.05). The rtvs of the groups with retightening were 23.8 1.8 ncm in the ext - rt group and 19.9 3.3 ncm in the int - rt group . The ext - rn group showed a significantly higher rtv than the int - rn group (p<.05). In external implants on the other hand, retightened internal implant / abutment assemblies showed superior rtvs when compared to internal implants with no retightening (table 1, table 2). Screw loosening is the most frequently occurring mechanical complication of implant restorations.516 abutment screw loosening has been reported in a large number of studies with an incidence ranging from 2% to 15% of abutments . 2359 screw loosening is caused by inadequate tightening torque, settling of implant components, inappropriate implant position, inadequate occlusal scheme or crown anatomy, poorly fitting frameworks, improper screw design / material, and heavy occlusal forces.171819 to overcome screw loosening and joint instability, many technical solutions have been suggested . For example, new abutment screw designs and materials for maximizing preload,120 mechanical torque - applying instruments for optimizing tightening torque,21 precise implant components for antirotation, and internal conical connection implants with no micromotion or microgaps have been proposed . In the current study, the initial rtv was always smaller than the tightening torque (30 ncm) in external and internal type implants . Haack et al.22 reported that most of the tightening torque is used to overcome the friction of the surface and only 10% of the tightening torque is used to generate preload . They suggested that 75 - 80% of tightening torque remained in titanium or gold screws.22 kim et al.23 reported that the amount of remaining torque was affected by the screw material (77% remained in titanium alloy and 66% remained in gold alloy). For standardization of the results, the same titanium alloy was used for both internal and external abutment screws in the present study . The results showed that the remaining torque was 90.9% in external implants and 83.3% in internal implants . These relatively high remaining initial rtvs might have been caused by advanced milling technique and/or the screw design / material . In the current experiments, initial rtvs and post - cyclic loading rtvs were higher in external implants than in internal implants . This is a result of the difference in connection type between the implants . In external implants, joint stability is obtained by the tension of the screw, while it is achieved mainly by friction between the abutment and the implant in internal type implants.24 most of the tightening torque is used to produce preload in external implants,25 while in internal implants, tightening torque is distributed between friction with the abutment and preload on the screw . Moreover, internal implants are susceptible to the wedge effect, which arises when tightening torque and mechanical load are applied, leading to axial displacement of the abutment, so that the tensile force of the screw is lost and preload is decreased.232425 according to lee et al.24 and kim et al.,25 axial displacement of the abutment is greater in internal implants, while rtv is greater in external implants . Although screws from the same manufacturer were used for standardisation, the screws for external implants have longer threads than those of the screws used for internal implants (fig . 1). The thread - engaging surface may affect the preload in screw - tightening procedures . To our knowledge, no internal / external implant system manufactured by the same manufacturer offers either similar or identical screw shapes owing to the different inner structures of internal / external implants . Although the 2 implant systems had different screw sizes and dimensions, the lengths of the engaging or the mating threads were similar in both.24 the upper part of the thread in the screw of the external implant was not in contact and just passed through the inner surface of the implant . Comparison of the groups with and without retightening after cyclic loading revealed no significant differences in rtvs in external implants . However, in internal implants, retightening resulted in higher rtvs than those found in implants without retightening . These results can be explained by the difference in connection type between the implants and the number of times the implants were retightened . In internal type implants, less settling effect occurs during tightening and loosening procedures, because tightening torque generates less preload due to dissipation of force via friction between the abutment and the implant . Therefore, a greater number of retightening procedures allows more settling effect and making an adequate surface of the screw . Cardoso et al.26 found that rtvs decreased as the number of insertion / removal cycles increased in external type implants . In contrast, tzenakis et al.13 reported an increase of preload in internal type implants . Therefore, retightening of screws is strongly recommended for joint stability, especially in internal type implants . The appropriate number of retightening procedures is not clear from the results of previous studies . Tzenakis et al.13 reported a gradual increase in gold screw preload from tightening for the first time to retightening 5 and 10 times in internal type implants . In the current study it should be noted that retightening more than 5 times is not recommended for the maintenance of preload . In the present study, this phenomenon was observed in both external and internal type implants . According to delben et al.,27 rtvs were maintained constantly by retightening after every 100,000 cycles of loading in external type implants . According to binon and mchugh,28 the average daily number of mastication is about 2,700 and so 100,000 cycles corresponds to around one month . In the current study, the load cycle was decreased to 20,000 cycles (corresponding to one week) in order to infer the timing of retightening, because previous studies found no significant differences with 100,000 load cycles . In the current experiments, rtvs decreased only 10 rounds of cyclic loading in external and internal type implants . In our previous study,24 thus, axial displacement of the abutment screw can affect joint stability, especially in internal implants . To increase preload and secure joint stability, it is recommended that retightening be performed after 10 loading cycles for both external and internal implants . Moreover, retightening after 1 week is also profitable for internal type implants . This study evaluated rtv according to retightening and cyclic loading in external and internal type implants . Initial rtv and postcyclic loading rtv were higher in external implants than in internal implants . In external type implants, retightening did not produce a significant difference in rtv when compared with the non - retightening group after 100,000 rounds of cyclic loading . In internal type implants, the retightening group showed significantly increased rtvs when compared with the non - retightening group after cyclic loading . A decrease in rtv occurred after only 10 rounds of cyclic loading, which represents the early stage of cyclic loading . After 20,000 cycles of loading, rtvs were maintained constantly in both external and internal type implants.
Dravet syndrome, or severe myoclonic epilepsy in infancy, is a rare form of epilepsy which is characterized by impaired psychomotor and neurologic development, occurring in the first year of life in an apparently normal infant . The actual frequency is not known, but an incidence of <1 per 40 000 live births and 1/20 000 or 30 000 was reported from the united states and france, respectively . The disease starts with generalized, unilateral, or alternating unilateral febrile and afebrile clonic seizures in the first year of life . Later on, multiple seizure types, electroencephalography is normal at onset, but generalized spikes, spike and waves, polyspikes and focal abnormalities appear on follow up . A family history of febrile seizure and epilepsy is present in2054% of patients with dravet syndrome . Dravet syndrome has a genetic etiology and 7080% of patients carry sodium channel 1 subunit gene abnormalities . Most of the mutations are de novo and they are randomly distributed across the sodium channel 1 subunit protein . Truncating mutations account for about 40% and are associated with an earlier age of seizure onset . Missense mutations also account for about 40%, and the remaining are the splice - site mutations . The clinical and electroencephalography criteria for diagnosing dravet syndrome include (1) high frequency of familial seizures; (2) normal developmental skills before onset; (3) generalized, unilateral, or alternating unilateral febrile and afebrile clonic seizures beginning in the first year of life, with subsequent myoclonic and partial seizures; (4) normal electroencephalography at onset, with later generalized spike - wave and polyspike wave discharges, focal abnormalities and photosensitivity; (5) delayed developmental skills from the second year of life onward; (6) refractoriness of seizures to antiepileptic drugs . Some patients do not have myoclonic and atypical absences and they are accepted as borderline dravet patients . Here, we report two patients with dravet syndrome in whom different mutations were identified in the sodium channel 1 subunit gene . We also review the mutations of the sodium channel 1 subunit gene that were identified in the turkish population . The first patient was a 7-year - old boy whose parents were healthy and non - consanguineous . He was initially given phenobarbital at 6 months of age, but valproate was added at 12 months due to recurrent febrile seizures . Brain mri was normal, but electroencephalography revealed generalized spikes and polyspikes (figure 1). The electroencephalographic and clinical findings suggested dravet syndrome and mutation analyses of the sodium channel 1 subunit gene revealed a heterozygous nucleotid substitution in exon 4 (c.602 + 1g> a; n.19003). Interictal sleep electroencephalography of a 7-year - old boy with dravet syndrome (case 1) showing frequent generalized spikes . The second patient was a 6-year - old boy who was the first child of healthy and non - consanguineous parents . Generalized and focal febrile convulsions that were refractory to phenobarbital and valproate treatments continued until 2 years of age . After this age, generalized tonic, clonic, myoclonic and atypical absence seizures started . Electroencephalography of the patient revealed generalized spikes and polyspikes and waves with photosensitivity . Despite appropriate combinations of antiepileptic drugs, atypical absences and myoclonic seizures continued with a frequency of 1015 times per day . Mutation analysis of the sodium channel 1 subunit gene revealed heterozygous deletion of five nucleotides in exon 24 (e24 n.77532 - 535, c.4486 - 4490delcaaga, p.gln1496argfsx14). The first patient was a 7-year - old boy whose parents were healthy and non - consanguineous . He was initially given phenobarbital at 6 months of age, but valproate was added at 12 months due to recurrent febrile seizures . Brain mri was normal, but electroencephalography revealed generalized spikes and polyspikes (figure 1). The electroencephalographic and clinical findings suggested dravet syndrome and mutation analyses of the sodium channel 1 subunit gene revealed a heterozygous nucleotid substitution in exon 4 (c.602 + 1g> a; n.19003). Interictal sleep electroencephalography of a 7-year - old boy with dravet syndrome (case 1) showing frequent generalized spikes . The second patient was a 6-year - old boy who was the first child of healthy and non - consanguineous parents . Generalized and focal febrile convulsions that were refractory to phenobarbital and valproate treatments continued until 2 years of age . After this age, generalized tonic, clonic, myoclonic and atypical absence seizures started . Despite appropriate combinations of antiepileptic drugs, atypical absences and myoclonic seizures continued with a frequency of 1015 times per day . Mutation analysis of the sodium channel 1 subunit gene revealed heterozygous deletion of five nucleotides in exon 24 (e24 n.77532 - 535, c.4486 - 4490delcaaga, p.gln1496argfsx14). Dravet syndrome is a distinct epileptic syndrome characterized by frequent seizures and impaired neurologic and psychomotor development beginning in the first year of life . Our cases had all the diagnostic criteria of the disease except history of familial seizures . To the best of our knowledge, all of these patients had classical findings of the disease and none of them was reported as borderline dravet syndrome . Mutations of the sodium channel 1 subunit gene are responsible for 7080% cases of dravet syndrome . In children with suspected dravet syndrome, the three criteria that best predicted a mutation in sodium channel 1 subunit were reported as seizure exacerbation with hyperthermia, normal development before seizure onset, and the appearance of ataxia, pyramidal signs or interictal myoclonus . Mutations in the sodium channel 1 subunit gene result in either the reduction or complete loss of sodium current or in noninactivating sodium channels with abnormal kinetics . Sodium channel 1 subunit mutations have also been found in generalized epilepsy with febrile seizures plus, infantile spasms and severe epilepsy of infancy . More than 500 mutations have been reported in dravet syndrome and most of them are de novo . Sequencing mutations are found in about 70% of cases and comprise truncating (40%) and missense mutations (40%) with the remaining being splice - site changes . Phenotype - genotype correlation studies have failed to show a clear relationship between the type of mutation and phenotypic expression . In the study of arlier et al, a total of 13 patients from istanbul university cerrahpaa school of medicine with the diagnosis of dravet syndrome were studied and authors reported heterozygous point mutations in six patients (46%). Two missense mutations (g2585a, g2860a); one frameshift mutation (t1033del); two nonsense mutations (c1738 t, c3733 t); and one splice site mutation (int14 [+] g1a) were identified . Of the six patients, four of the mutations were novel (66%), while the other two (c1738 t, c3733 t) had been previously reported . Five of the six identified mutations corresponded to coding segments of the sodium channel 1 subunit gene, while one was at a splice site . Two novel missense mutations resulted in theoretical intolerable amino acid changes . A novel deletion in exon 8, t1033, is also expected to cause a premature stop codon secondary to frameshift . A splice site mutation is thought to theoretically compromise the mrna sequence and result in an aberrant protein product . In the case of gkben et al, mutation analysis in the proband revealed a heterozygous silent nucleotide substitution in exon 9 (c.1245a> g; p.v415v; rs7580482) and a nonsense amino acid mutation in exon 26 (c.4933 c> t; p.r1645x). The r1645x mutation is located in the d4 / s4 domain that is implicated in voltage sensing of fast inactivation . The same nucleotide substitutions in exon 9 and exon 26 were also found in the father . Although the patient and father shared the same nonsense mutation, their clinical phenotypes were completely different . The father had only a few febrile seizures during childhood, but his daughter had dravet syndrome . The mutation in our first patient was a splice donor mutation which impaired the splicing of mrna . The mutation identified in the second patient was a novel frame shift mutation that resulted from the deletion of five nucleotides in exon 24 . Taken together, the diagnosis of dravet syndrome is easier in patients presenting with typical clinical findings, but the diagnosis is difficult in patients whose seizures are atypical and/or the psychomotor development is normal . Sodium channel 1 subunit gene mutations are not found in all patients and genotype - phenotype correlations are not elucidated . Defining the clinical and genetic features of more cases with dravet syndrome should provide new insights for the disease.
Unilateral neglect (un) refers to the neuropsychological condition in which patients experience reduced orientation and concentration and response to stimuli on the contralesional side owing to behavioral problems that occur after brain injury, although these patients having sensorimotor abilities1 . Un is caused by various forms of brain damage and has an especially high incidence in patients with stroke in the right inferior parietal lobe2 . It is negatively associated with the rehabilitation period because patients with un show relatively poor functional recovery compared with those without un3 . In addition, these patients experience difficulties in activities of daily living (adl), including maintaining personal hygiene, eating, and dressing, and also are at increased risk of falling because of gait disturbance4 . Therefore, having an appropriate treatment and strategy are important while treating this condition because it is essential to reduce un to achieve effective rehabilitation in these patients . We proposed a new treatment method for un by modifying current treatment methods and combining them with mental practice and electromyogram - triggered electrical stimulation (mp - emg es). Mp - emg es is a new, state - of - the - art rehabilitation treatment technology based on neurologic theories . Mp - emg es involves only repetitive mental practice (for example, imagination of intense movement of the upper limbs on the neglected side), not voluntary muscular contraction . When the generated electric potential reaches a preset threshold, an electric stimulus is generated, resulting in actual muscular contraction and cortical activation5 . In other words, mp - emg es can produce a synergistic effect by combining two treatments (mental practice plus electrical stimulation) with proven efficacy in the alleviation of neglect . The purpose of this study was to identify the effects of this novel training method mp combined with emg es over a 6-week period of daily training in patients showing right brain damage with un . The participants for this study were recruited from the rehabilitation center of a local university hospital . The inclusion criteria for participation were: (1) onset duration of> 6 months, (2) right hemisphere stroke with un, (3) mini - mental status examination score> 24, (4) ability to imagine (average score on the vividness of movement imagery questionnaire <3), and (5) active wrist muscle strength> 2 on the medical research council (mrc) scale . Exclusion criteria were: (1) an implanted cardiac pacemaker, (2) skin lesion on the affected side or hypersensitivity at the electrode site, (3) a history of seizure or epilepsy, and (4) unstable medical conditions . In total, thirty - three stroke patients with neglect were eligible for this study . All participants provided written informed consent, and this study was approved by the inje university institution review board . This study was designed as a single - blind randomized control study and was scheduled to last for a total 6 weeks . Eligible participants were randomly allocated to the two groups by block randomization using opaque envelopes containing a code specifying the group . The experimental group (n=16) received mp - emg es in addition to conventional rehabilitation therapy (crt: physical therapy and occupational therapy), whereas the control group (n=17) received cyclic es in addition to the same crt . Mentamove (mentamove deutschland gmbh, munich, germany) was used to apply mp - emg es in the experimental group . Surface electrodes were attached to the wrist extensor muscle and a reference electrode was attached at the lateral side of the forearm . The site of electrode placement was marked using a permanent marker throughout the intervention . During motor imagery training, when the potentials reached a preset threshold, the induced electrical stimulation would contract the targeted muscle . The mentamove process consisted of three stages: (1) motor imagery (approximately 12 s), (2) electrical stimulation (approximately 6 s), and (3) relaxation (approximately 12 s). The motor imagery used in this study was a vigorous waving of the affected whole arm . This imagery was selected because the emg was not able to detect electrical stimulation induced by motor imagery of simple extension of the wrist or elbow . The emg pick - up threshold was set afresh for each subject in every session . If the subject repeatedly reached the threshold during the mp - emges, the threshold was automatically increased slightly . Imagine that your left arm moves rapidly and intensely when you see motor imagery in the tool window . If your performance is successful, you will experience an electrical stimulation in your forearm . Cyclic es (mendel gmbh, germany) without the emg function was used to apply electrical stimulation in the control group . Electrodes also were attached to the wrist extensor muscle . In either instrument, biphasic pulses with a frequency of 35 hz and pulse width of 200 s were applied for 12 s. stimulation intensity led to a clear extension of the wrist (average 2030 ma). Over a period of 6 weeks, both groups were treated 30 times in two 30-min sessions . The line bisection test (lbt), star cancellation test (sct), and catherine bergego scale (cbs) were used to quantify the severity of un . Twenty lines were drawn on an a4 sheet parallel to the long axis, and 18 of these lines were organized into 3 set of 6: 1 set lay primarily on the left, 1 at the center, and 1 on the right side of the sheet . The evaluator initially demonstrated the procedure by marking the 2,150-mm lines at the top and bottom of the sheet . Patients were asked to mark the center points of each of the 18 lines in order . Distances from the left of each line to patient s marks and to true line centers were measured . Deviations were measured using the formula: percent deviation (%) = [(marked left side distance - true half length)/true half length] 100 . In sct, the left and right halves of the sheet each contained 27 stars, and patients were asked to mark all of the stars . The scores range from 0 to 27, with lower scores indicating more severe un . Assessment using cbs involved evaluating the performance of patients by directly observing them perform activities (e.g., dressing, grooming) in real - life situations, and consisted of 10 items . Each item was scored on a four - point scale as follows: 0: no neglect 110: mild neglect, 1120: moderate neglect, and 2130: severe neglect7 . Participant characteristics were analyzed using a statistical software program (spss statistics 20) and descriptive statistics were presented as mean sd . The shapiro - wilk test was used to check normality of the outcome variables . To evaluate the intervention effects, measures before and after the intervention in each group an independent t - test was used to compare changes in outcome measures between the two groups . All demographic and clinical characteristics of the participants were comparable and are summarized in table 1table 1.baseline characteristics of the subjects included in the studyexperimental group (n=16)control group (n=17)gendermale10 8 female69age (years)67.510.362.210.2time post stroke (months)3.31.33.51.6stroke typehemorrhage45infarction1212 . The experimental group showed a significant improvement in the lbt (p<0.01), cbs, and sct (p<0.05) scores after the intervention compared with the values obtained before the intervention (table 2table 2.clinical parameters before and after the treatment (n=33)experimental group control groupbeforeafterbeforeaftercbs12.14.210.14.612.63.811.24.1lbt30.58.924.110.332.69.127.710.6sct10.65.213.05.5 9.25.211.04.6the values are mean standard deviation . Cbs: catherine bergego scale, lbt: line bisection test, sct: star cancellation test . * p<0.05 by paired t test between the initial and final scores in the group . On the other hand, no significant difference was observed in the control group, except in the lbt score (p<0.05). No significant differences were observed in the lbt, cbs, and sct scores between the two groups after treatment . Cbs: catherine bergego scale, lbt: line bisection test, sct: star cancellation test . * p<0.05 by paired t test between the initial and final scores in the group . Mp - emg es is a recently developed method that produces tiny electrical signals in the brain through mental practice, rather than through actual physical movements, and this method is used to induce muscle contraction in the upper extremity (u / e) on the neglected side . In other words, the aim of mp - emg es is to form sensorimotor circuits for movement through a repeated cycle of brain signal transmission muscle movement, which can be used to produce functional changes in the central nervous system and the body . The continual activation of these circuits helps reorganize the damaged areas of the cerebral cortex8 . It is thought that mp - emg es works by inducing neural and peripheral changes through activation of the cerebral cortex via mental practice and afferent stimulation of the neglected u / e via electrical stimulation . Hong et al.5 reported mp - emg es is more effective than cyclic es for improving motor function on the affected side and improves cerebral glucose metabolism in supplementary motor, precentral and postcentral gyri on the contralesional side . However, there is little evidence about the effects of this treatment in cases of un . In this study, we investigated the effects of mp - emg es on neglect in comparison with those of cyclic es . Cbs, lbt and sct scores significantly improved after treatment in the experimental group . The control group received various crt interventions that were the same as the experimental group . This control treatment was important because cyclic es has been proven to alleviate neglect to some extent by applying afferent stimulation to the neglected side . Therefore, while the control group only showed a significant improvement in lbt, they also showed a slight improvement in scores for cbs and sct, and as a result, no significant differences were demonstrated between the two groups in any assessments . Some studies reported that mental practice is effective for rehabilitation in patients with contralesional neglect, but it is difficult to verify whether patients imagine the specific movement well9 . Mp - emg es seems to remedy the deficiencies of mental practice alone . In this study, patients were instructed to imagine a large and powerful movement of the neglected u / e during the mental practice stage of mp - emg es treatment . When imagining the movement of the neglected u / e, the muscles in the u / e show dynamic regulation and changes5 . In this regard, when a participant imagined a complex and powerful movement instead of a simple movement, the motor - evoked potential and the excitation in the corticospinal tract increased10 . This study showed that mp - emg es is an effective method for reducing unilateral neglect in stroke patients . However, several factors need to be considered when applying this method . Because mp - emg es requires the patient to be capable of imaging movement of the body on the neglect side
Sox9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation . It is considered to be the direct target gene of the protein encoded by sry and its overexpression in an xx murine gonad can lead to male development in the absence of sry . Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of sox9 in which 46,xy duplicated persons were completely normal and fertile whereas the 46,xx ones were males who came to clinical attention because of infertility . We report a family with two azoospermic brothers, both 46,xx, sry negative, having a 96 kb triplication 500 kb upstream of sox9 . Both subjects have been analyzed trough oligonucleotide array - cgh and the triplication was confirmed and characterised through qpcr, defining the minimal region of amplification upstream of sox9 associated with 46,xx infertile males, sry negative . Our results confirm that even in absence of sry, complete male differentiation may occur, possibly driven by overexpression of sox9 in the gonadal ridge, as a consequence of the amplification of a gene desert region . We hypothesize that this region contains gonadal specific long - range regulation elements whose alteration may impair the normal sex development . Our data show that normal xx males, with alteration in copy number or, possibly, in the critical sequence upstream to sox9 are a new category of infertility inherited in a dominant way with expression limited to the xx background.
Osteoporosis most commonly affects postmenopausal women, placing them at a significant risk of fractures . In particular, hip fractures are an important cause of mortality and morbidity among postmenopausal women . Approximately 20% of patients with hip fractures die within a year, most of the deaths occurring within the first 6 months after a fracture (cumming et al 1997). Among the survivors, recent reports have shown that the rate of hip fractures is falling in ontario and finland (jaglal et al 2005; kannus et al 2006), probably because of recent indications that clinical attention to osteoporosis management is increasing and that specific programs of selective screening and aggressive treatment to prevent bone loss may really be able to reduce the fracture rate among the population most at risk (melton et al 2005). However, there is no indication that the use of effective osteoporosis interventions is increasing dramatically in regions including asia where the growth in the elderly population is most rapid . Because elevated bone turnover markers and low bone mineral density (bmd) are independent predictors of hip fracture risk, and the risk is multiplied when both are present (garnero et al 1996), bone turnover and bmd are important factors in decreasing the risk of hip fractures . Both reduction in bone turnover and increase in hip bmd may be necessary to decrease the fracture risk of the hip, which is primarily composed of cortical bone and may require greater proportionate changes than trabecular bone (epstein 2007). In fact, drugs with a smaller effect on bone turnover reduce the risk of only vertebral fractures, whereas those with a greater effect reduce the risk of both vertebral and nonvertebral fractures including hip fractures (delmas 2002). Furthermore, only those drugs associated with relatively large bmd increases together with greater reductions in bone turnover were effective for reducing the risk of nonvertebral fractures including hip fractures (hochberg et al 2002). Treatment with potent anti - resorptive drugs is a strategy for preventing hip fractures in postmenopausal women . Several therapeutic agents are currently available to treat or prevent postmenopausal osteoporosis (iwamoto et al 2006, 2007). Among commercially available drugs, however, only alendronate, risedronate, intravenous zoledronate, strontium ranelate, and hormone replacement therapy (hrt) have shown anti - fracture efficacy against hip fractures in post - menopausal women (black et al 1996, 2007; mcclung et al 2001; rossouw et al 2002; reginster et al 2005). Alendronate and risedronate, which are the second- and third - generation bisphosphonates, respectively, have been used as first - line drugs in the treatment of osteoporosis for many years . In particular, evidence to explain the efficacy of alendronate against hip fractures has been accumulated for postmenopausal osteoporosis . Thus, this paper discusses, based on a review of the literature, the efficacy of alendronate against hip fractures and the mechanism for this anti - fracture efficacy in postmenopausal women with osteoporosis . Treatment of osteoporosis is conducted in accordance with the principles of evidence - based medicine (ebm). Ebm takes into account information derived from the highest - quality investigations with clinical judgment and patient values, to allow optimal clinical management . All available clinical evidence is classified hierarchically into various levels; strictly conducted systematic reviews with homogeneity represent the highest level, followed by strictly conducted randomized controlled trials (rcts) with narrow confidence interval or meta - analyses with homogeneity of rcts, which have long been considered as the gold standard in the context of clinical investigations (centre for evidence based medicine). The important points that must be considered in the choice of drugs for the treatment of osteoporosis are the effects of the drugs in reducing the incidence of fractures, the consistency of the results of rcts of the drugs, and the long - term efficacy and safety of the drugs . A meta - analysis conducted by papapoulos et al (2005) demonstrated the efficacy of alendronate against hip fractures in postmenopausal women with osteoporosis . In total, 6,804 women with bmd t - score of 2.5 or less (age range: 3991 years) from 6 rcts were analyzed . The rates of hip fractures were 29 per 10,000 person - years at risk (pyr) in the alendronate group and 62 pyr in the control group . The overall risk reduction rate was 55% with the consistent results of rcts (figure 1). The efficacy of alendronate against hip fractures in postmenopausal women with osteoporosis is supported by a report of the world health organization (who) scientific group (who scientific group 2003). Rcts have also demonstrated a similar incidence of gastrointestinal tract adverse events in patients treated with alendronate and a placebo, with no severe adverse events seen in the alendronate group (liberman et al 1995; black et al 1996; cummings et al 1998). The long - term (10-year) safety of alendronate has been confirmed (bone et al 2004; black et al 2006); reductions in bone turnover remain stable throughout 10 years of alendronate treatment and are associated with continued gains in lumbar spine and hip bmd . Thus, alendronate could be a candidate for postmenopausal women with osteoporosis who are at a higher risk of hip fractures . Vitamin d and calcium supplementation would also be needed in patients with vitamin d insufficiency / deficiency and low calcium intake . According to the analyses of the fracture intervention trial, postmenopausal women treated with alendronate with the greatest percentage reduction in bone - specific alkaline phosphatase (bsap) have the lowest risk of hip fractures, while those with the smallest reduction in bsap have the highest risk of hip fractures (figure 2) (bauer et al 2004). Each 1 standard deviation reduction in a 1-year change in bsap is associated with 39% fewer hip fractures in alendronate - treated postmenopausal women (bauer et al 2004). Alendronate - treated postmenopausal women with at least 30% reduction in bsap (56% of alendronate - treated subjects) have a 74% lower risk of hip fractures relative to those with less than 30% (bauer et al 2004). Alendronate is effective in reducing the risk of hip fractures across a spectrum of ages (figure 3) (hochberg et al 2005). The effectiveness appears to be greater in patients with a femoral neck bmd t score 2.5 than in patients with a femoral neck bmd t score 2.0 (hochberg et al 2005). A retrospective analysis of a large population of new users of alendronate with diagnosed osteoporosis has confirmed that both compliance and persistence, in actual practice, is low and inadequate (rabenda et al 2008). Siris et al (2006) analyzed the fracture probability across the full range of possible compliance values expressed as a medication possession ratio (mpr) (full mpr range: 0.01.0 or 0%100%), which is defined as the number of days supply of a medication with bisphosphonates during a certain period (sclar et al 1991). At an mpr from 0% to 50%, the probability of fracture during a period of 24 months remains consistent at about 11% and declines progressively once a threshold value of 50% is achieved (siris et al 2006). Less than half the women were found to be compliant with bisphosphonate therapy (mpr 0.8) and approximately 40% of women persisted with treatment for 12 months without a substantial gap in therapy (rabenda et al 2008). Poor adherence to alendronate treatment is associated with an increased risk of hip fractures (rabenda et al 2008). Thus, adherence (compliance and persistence) with treatment has represented a major challenge in patients receiving alendronate . Once - weekly alendronate, which is the preferred dosing regimen, has been reported to be theoretically equivalent to daily dosing, providing postmenopausal osteoporotic women with a more convenient dosing option that enhances their adherence to treatment (kendler et al 2004; rossini et al 2006). Once - weekly alendronate has safety and tolerance profiles similar to daily alendronate in postmenopausal women with osteoporosis (schnitzer et al 2000; rizzoli et al 2002; simon et al 2002). Rabenda et al (2008) have reported that the mpr is a significant predictor of the occurrence of hip fractures in postmenopausal women treated with alendronate . The logistic regression model has estimated that for each decrease in the mpr of 1%, the adjusted risk of hip fractures increases by 0.4% . As shown in figure 4 (rabenda et al 2008), there is a negative estimated linear relationship between the probability of hip fractures and the value of the mpr . The treatment regimen is also an important determinant of hip fracture occurrence: postmenopausal women who receive weekly alendronate are 16.4% less likely to suffer from hip fractures than those on the daily regimen (rabenda et al 2008). Rabenda et al (2008) have also shown that persistence to alendronate treatment is a significant predictor of incurring hip fractures . The relative risk reduction for hip fractures is 60% for persistent patients compared with nonpersistent patients (hazard ratio: 0.404; 95% ci: 0.357, 0.457; p <0.0001). Thus, both high compliance and persistence with prescribed osteoporosis medication are significantly associated with reduced hip fracture risk . The once - weekly alendronate regimen provides benefit in terms of better adherence (compliance and persistence) of the patients to the treatment regimen than the once - daily dosing regimen, leading to greater efficacy against hip fractures . Osteoporosis is defined as a skeletal disorder characterized by compromised bone strength, predisposing a person to an increased risk of fracture (nih consensus development 2001). Properties related to bone strength include rate of bone turnover, bmd, geometry, microarchitecture, and mean degree of mineralization (epstein 2005). Theoretically, microdamage might weaken bone, but no relationship to bone strength or fracture risk has been established (epstein 2005). The proximal femur of the hip is primarily composed of cortical bone . In cortical bone, high bone turnover, as observed after the menopause, is associated with decreased bmd, increased cortical porosity due to increased bone remodeling in the haversian canal, decreased cortical thickness due to increased endocortical bone remodeling, and decreased mean degree of mineralization (hedlund et al 1989; bousson et al 2000; boivin et al 2000; szulc et al 2006). Increased cortical thinning, increased porosity, and decreased mean degree of mineralization of bone (mdmb) are observed in the cortex in cases of hip fractures (loveridge et al 2004; bell et al 1999a; bell et al 1999b; bell 1999c), which might be associated with increased indices of haversian remodeling . These changes caused by high bone remodeling in terms of high bone turnover translate to alterations in bone strength and risk of fractures . Alendronate inhibits osteoclastic bone resorption, strongly reduces bone turnover, increases hip bmd, decreases cortical porosity, and produces more uniform mineralization (ie, increases the mdmb) in cortical bone, possibly contributing to a reduction in the risk of hip fractures (liberman et al 1996; black et al 1996; cummings et al 1998; boivin et al 2000; roschger et al 2001). In alendronate - treated postmenopausal women, the distribution of the degree of mineralization in cortical bone shows a clear shift toward the highest mineralization values and a decrease in the number of bone structure units having low values of mineralization (boivin et al 2000). The mdmb augmentation probably accounts for most of the increase in bmd seen with alendronate (boivin et al 2000). According to the hypothesis proposed by boivin et al (2000), the reduction in the activation frequency caused by the anti - resorptive effect of alendronate is followed by a prolonged secondary mineralization that increases the percentage of bone structure units having reached a maximum degree of secondary mineralization and, though this mechanism, augmentation of the mdmb (table 1). Recently, it has been possible to extract cross - sectional geometry from dual - energy x - ray absorptiometry (dxa) scan imaging . Hip structure analysis (has) is a computer program designed to perform this function with dxa scans of the hip . Greenspan et al (2005) have demonstrated that alendronate improves parameters of hip structure geometry as evaluated by the has, such as cortical thickness, cross - sectional area, section modulus, and buckling ratio in the narrow neck, intertrochanteric region, and femoral shaft (figure 5) (greenspan et al 2005). These data provide additional information on a potential mechanism for hip fracture reduction with alendronate . In addition, improvements in the above parameters in the narrow neck and intertrochanteric region are greater in combination therapy with hrt (figure 5) (greenspan et al 2005). This result supports the concept that anti - resorptive therapies that produce larger decreases in bone turnover markers together with larger increases in bmd are associated with greater reductions in hip fracture risk, especially at sites primarily composed of cortical bone (hochberg et al 2002). Osteocyte viability has been observed to be an indicator of bone strength, with viability as the result of maintaining physiological levels of loading and osteocyte apoptosis as the result of a decrease in loading (epstein 2007). Osteocyte apoptosis and decrease are major factors in the bone loss and fractures associated with aging (epstein 2007). A recent animal study demonstrated that low doses of risedronate or alendronate suppressed osteocyte apoptosis induced by fatigue loading of the ulna in rats (follet 2007). However, the effect of alendronate on osteocyte apoptosis remains to be established in clinical studies . Evidence derived from the literature, stratified and based on strict ebm guidelines, suggests the efficacy of alendronate against hip fractures in postmenopausal women with osteoporosis with an overall risk reduction rate of 55% . According to the analyses of the fracture intervention trial, each 1 standard deviation reduction in a 1-year change in bsap is associated with 39% fewer hip fractures in alendronate - treated postmenopausal women, and those with at least a 30% reduction in bsap have a 74% lower risk of hip fractures relative to those with less than 30% . Alendronate is effective in reducing the risk of hip fractures across a spectrum of ages . The mechanism for this anti - fracture efficacy has been clarified; alendronate suppresses bone turnover and subsequently increases hip bmd, decreases cortical porosity, improves parameters of hip structure geometry (cortical thickness, cross - sectional area, section modulus, and buckling ratio), and produces more uniform mineralization (increases the mdmb) in cortical bone . A once - weekly alendronate regimen provides better adherence (compliance and persistence) of the patients to the treatment than the once - daily dosing regimen, leading to greater efficacy against hip fractures . Thus, the efficacy of alendronate against hip fractures has been confirmed in postmenopausal women with osteoporosis, especially with once - weekly dosing regimen.
The principal functions of an intact knee meniscus include transmitting load, increasing tibiofemoral congruency and stabilizing the joint.1234 partial or complete meniscal resection may obtain good results in the short term after surgery; however, many researchers have reported the occurrence of degenerative arthritis during mid or long term followup . Jrgensen et al.5 reported that 89% of patients undergoing complete meniscectomy had demonstrable degenerative changes on radiographs after a followup period of 14.5 years . Other studies obtained similar results.678910 if a meniscus is resected, it is likely that articular degeneration will eventually occur, so it is preferable to retain and repair the meniscus rather than resect it . Many meniscal repair techniques and devices have been developed to facilitate meniscal repair.111213 fast - fix (smith and nephew endoscopy, andover, ma, usa) is one of the most popular meniscal repair devices . The aim of this study was to evaluate the clinical results of arthroscopic repair of various types of meniscal tears using the fast - fix ultra system, applying standard all - inside or outside - in suturing techniques . Ninety - six patients meeting our inclusion criteria underwent repair of their meniscal tears using the fast - fix meniscal repair suture system and were successfully followed for a mean of 3.7 years between july 2007 and june 2011 . The inclusion criteria were patients with acute or degenerative longitudinal, horizontal or radial meniscal tears in the red - red zone (<3 mm from the meniscocapsular junction) or red - white zone (between 3 and 5 mm from the meniscocapsular junction). The exclusion criteria were patients with complex meniscal tears, serious defects, multiple longitudinal tears, longitudinal tears in the white zone> 2 cm long, dissociated or fragmented menisci and fragile tears in which previous attempted repairs were unsuccessful . Patients with anterior cruciate ligament deficient knees were also excluded . Of the 96 patients (58 males and 38 females), the mean age at the time of surgery was 24.3 years (range 1256 years). Surgery was performed at an average of 44 days (range 3 days 1 year) after the knee injury . Forty right and 56 left knees were included, involving injuries to 44 lateral menisci and 52 medial menisci . Of these, 12, 46 and 38 meniscal tears were located in the anterior horn, body and posterior horn of the menisci, respectively [table 1]. In addition, 38, 45, and 13 menisci were injured in the red, red - white and white regions, respectively . All - inside and outside - in suturing techniques were used in 84 and 12 cases respectively . A mean of 2 (range 14) fast - fix devices (sutures) were used for each patient, spaced at an interval of approximately 58 mm . Types of meniscal tears preoperatively, the meniscal tear was diagnosed by physical examination findings . Mcmurray and appley tests were routinely used to assess positive signs of a meniscal tear, such as locking, pain on palpation of the joint line, joint snapping and presence of an effusion . The lysholm rating system, tegner activity score and international knee documentation committee (ikdc) activity score were recorded to evaluate knee function . All patients underwent preoperative magnetic resonance imaging (mri) for evaluation and to provide a surgical reference, but the results of this imaging alone were not used to provide a definite diagnosis because of the possibility of false positives and false negatives . The criteria used to define clinical success were the presence of barrett criteria and/or arthroscopically verified meniscal healing . The barrett criteria14 included no joint locking or swelling, no pain on palpation in the joint space, free motion, and a negative mcmurray test . If any of these conditions were noted, the result was classified as a failure . The all - inside technique was the most commonly used approach . In the red or red - white region, bucket handle tears parallel to the meniscocapsular junction, radial tears, horizontal tears and even transection injuries or defects were commonly sutured using the all - inside technique [figure 1]. Diagrammatic representation of all - inside technique the tear position and type was first identified arthroscopically . If the tear was dislocated, as with a bucket handle tear, then reduction was performed . If the tear could be sutured, we used a meniscal rasp and shaver to freshen the tear edges because this stimulates vascular growth and wound healing . After determining the desired penetration with a meniscal depth probe, we trimmed the depth limiter of the fast - fix system accordingly . The fast - fix delivery needle (fast - fix ultra) the needle pierced the surface of the inner meniscal fragment perpendicularly and was then advanced into the peripheral meniscal fragment to the end of the depth penetration limiter . A probe hook confirmed the stability of the suture and we observed the meniscal dynamic status when the knee joint was extended and flexed . Meniscal body transection was sometimes deemed a contraindication for the all - inside suture technique . We attempted to suture the tear using two fast - fix devices during arthroscopy and were able to recover the crescent - shape of the meniscus [figure 2a - c]. Arthroscopic view (a) the lateral meniscus was transected approximately 10 mm; the chondral damage had occurred in the tibial plateau . (b) we made an auxiliary incision through the patellar tendon to allow grasper tongs to grab the far end of the meniscus . (c) both stumps were sutured together and then smoothened along the meniscal rim we generally use the outside - in technique to repair certain kinds of anterior horn and posterior horn longitudinal tears, especially the former, because the all - inside suture technique is difficult to perform on these injuries . In our study, there were 12 cases with anterior horn injury, which were all longitudinal tears parallel to the capsule in the red . For other types of anterior horn injuries, other methods should be used . For the outside - in approach, we first punctured the knee joint with a 2-mm syringe needle in the position corresponding to the anterior horn tear and then directed the needle to the tear fragment . We subsequently made an 8-mm skin incision near the syringe puncture point, leaving the capsule intact . The light source of the arthroscope radiated inside - out, and the capsule was semitransparent, so we were able to observe the neurovascular bundles and avoid injuring them . The fast - fix needle punctured the capsule, entered the joint space, and released the first anchor by puncturing the anterior horn tear segment with a gentle rotation motion . The needle was then withdrawn and reinserted into the joint cavity 5-mm lateral to the first puncture, placing the second needle perpendicular to the tear . After the second anchor was in place, the delivery needle was removed from the joint, leaving the free suture ends, and the self - sliding knot outside of the capsule [figure 3a - c]. Finally, the pretied self - sliding knot was tightened with the aid of the knot pusher / suture cutter . The knots were tightened outside the capsule and the excess suture was cut with the knot pusher / suture cutter or arthroscopic scissors . The same suture technique was also used for posterior horn tears [figure 3a - c]. In this group, the injury area of the anterior horn was located in the red - red zone (<3 mm from the meniscocapsular junction) and all injuries were longitudinal tears parallel to the capsule in the red - red region . After freshening the tear edges, the tear segments were located 13 mm from the capsule if our two puncture points were 12 mm from the tear edge . We fastened the pretied self - sliding knot outside the capsule, and the anchors adhered firmly to the inferior surface of the meniscus . As observed through the arthroscope at the end of surgery, the anchors were depressed in the soft meniscus . Diagrammatic representation of outside - in technique (a) a 2-mm syringe needle was used to determine the puncture point and direction for making an incision . (b) after releasing the first anchor, we withdrew and reinserted the needle into the joint cavity to puncture the meniscus segment 5-mm lateral to the first insertion point . (c) when the second anchor was in place, the delivery needle was removed from the knee joint, leaving the free end of the sutures and the self - sliding knot outside the capsule . The knot was tightened with a knot pusher / suture cutter postoperatively, all patients underwent routine rest, ice, compression, elevation (rice) therapy and used a hinged brace . Active motion was restricted between 0 and 60 for the first 3 weeks after surgery and between 0 and 90 in the fourth week; this was followed by an increase in the range of motion (rom) between 0 and 120 for another 2 weeks . Continuous passive movement (cpm) was begun earlier, starting shortly after the acute response to the operation regressed (at 34 days postoperatively). Rom of passive knee joint flexion was applied according to this program: 90 in the first week, 100 in the second week, 110 in the third week, and 120 in the fourth week . All patients with a meniscal body injury were restricted from weight - bearing until 2 weeks after surgery . In the third week, 25% weight - bearing was allowed, followed by 50% and 75% weight - bearing in the fourth and fifth weeks . The patients progressed to full - weight - bearing by 68 weeks postoperatively . With anterior horn injuries, the full - weight straight - knee movement was permitted shortly after the operation . Jogging was permitted after the 10 postoperative week, and full activity was allowed at 6 months for all patients . Statistical analyses were performed using spss version 13.0 (spss inc, chicago, il) for windows . Data are shown as mean standard error of the mean, except where indicated otherwise . The chi - square test was used to evaluate the differences in clinical outcomes between potential associated factors . The all - inside technique was the most commonly used approach . In the red or red - white region, bucket handle tears parallel to the meniscocapsular junction, radial tears, horizontal tears and even transection injuries or defects were commonly sutured using the all - inside technique [figure 1]. Diagrammatic representation of all - inside technique the tear position and type was first identified arthroscopically . If the tear was dislocated, as with a bucket handle tear, then reduction was performed . If the tear could be sutured, we used a meniscal rasp and shaver to freshen the tear edges because this stimulates vascular growth and wound healing . After determining the desired penetration with a meniscal depth probe, we trimmed the depth limiter of the fast - fix system accordingly . The fast - fix delivery needle (fast - fix ultra) the needle pierced the surface of the inner meniscal fragment perpendicularly and was then advanced into the peripheral meniscal fragment to the end of the depth penetration limiter . A probe hook confirmed the stability of the suture and we observed the meniscal dynamic status when the knee joint was extended and flexed . Meniscal body transection was sometimes deemed a contraindication for the all - inside suture technique . We attempted to suture the tear using two fast - fix devices during arthroscopy and were able to recover the crescent - shape of the meniscus [figure 2a - c]. Arthroscopic view (a) the lateral meniscus was transected approximately 10 mm; the chondral damage had occurred in the tibial plateau . (b) we made an auxiliary incision through the patellar tendon to allow grasper tongs to grab the far end of the meniscus . We generally use the outside - in technique to repair certain kinds of anterior horn and posterior horn longitudinal tears, especially the former, because the all - inside suture technique is difficult to perform on these injuries . In our study, there were 12 cases with anterior horn injury, which were all longitudinal tears parallel to the capsule in the red . For other types of anterior horn injuries, other methods should be used . For the outside - in approach, we first punctured the knee joint with a 2-mm syringe needle in the position corresponding to the anterior horn tear and then directed the needle to the tear fragment . We subsequently made an 8-mm skin incision near the syringe puncture point, leaving the capsule intact . The light source of the arthroscope radiated inside - out, and the capsule was semitransparent, so we were able to observe the neurovascular bundles and avoid injuring them . The fast - fix needle punctured the capsule, entered the joint space, and released the first anchor by puncturing the anterior horn tear segment with a gentle rotation motion . The needle was then withdrawn and reinserted into the joint cavity 5-mm lateral to the first puncture, placing the second needle perpendicular to the tear . After the second anchor was in place, the delivery needle was removed from the joint, leaving the free suture ends, and the self - sliding knot outside of the capsule [figure 3a - c]. Finally, the pretied self - sliding knot was tightened with the aid of the knot pusher / suture cutter . The knots were tightened outside the capsule and the excess suture was cut with the knot pusher / suture cutter or arthroscopic scissors . The same suture technique was also used for posterior horn tears [figure 3a - c]. In this group, the injury area of the anterior horn was located in the red - red zone (<3 mm from the meniscocapsular junction) and all injuries were longitudinal tears parallel to the capsule in the red - red region . After freshening the tear edges, the tear segments were located 13 mm from the capsule if our two puncture points were 12 mm from the tear edge . We fastened the pretied self - sliding knot outside the capsule, and the anchors adhered firmly to the inferior surface of the meniscus . As observed through the arthroscope at the end of surgery, the anchors were depressed in the soft meniscus . Diagrammatic representation of outside - in technique (a) a 2-mm syringe needle was used to determine the puncture point and direction for making an incision . (b) after releasing the first anchor, we withdrew and reinserted the needle into the joint cavity to puncture the meniscus segment 5-mm lateral to the first insertion point . (c) when the second anchor was in place, the delivery needle was removed from the knee joint, leaving the free end of the sutures and the self - sliding knot outside the capsule . Postoperatively, all patients underwent routine rest, ice, compression, elevation (rice) therapy and used a hinged brace . Active motion was restricted between 0 and 60 for the first 3 weeks after surgery and between 0 and 90 in the fourth week; this was followed by an increase in the range of motion (rom) between 0 and 120 for another 2 weeks . Continuous passive movement (cpm) was begun earlier, starting shortly after the acute response to the operation regressed (at 34 days postoperatively). Rom of passive knee joint flexion was applied according to this program: 90 in the first week, 100 in the second week, 110 in the third week, and 120 in the fourth week . All patients with a meniscal body injury were restricted from weight - bearing until 2 weeks after surgery . In the third week, 25% weight - bearing was allowed, followed by 50% and 75% weight - bearing in the fourth and fifth weeks . The patients progressed to full - weight - bearing by 68 weeks postoperatively . With anterior horn injuries, jogging was permitted after the 10 postoperative week, and full activity was allowed at 6 months for all patients . Statistical analyses were performed using spss version 13.0 (spss inc, chicago, il) for windows . Data are shown as mean standard error of the mean, except where indicated otherwise . The chi - square test was used to evaluate the differences in clinical outcomes between potential associated factors . A total of 96 patients who underwent meniscus repair with the fast - fix device were followed for a mean of 3.7 years (range 25 years). There were no complications, such as infection, or neurovascular injury, during the perioperative period . In this group, no anchor failed and no loose body was detected in the anterior horn suture until the present time . At the last followup visit, we found no symptoms of meniscal tears in 88 patients (91.7%). Of the eight patients with surgical failures, 2 (2.0%) had symptoms (joint locking and/or snapping) and a positive mcmurray test at 6 and 11 months postoperatively . Arthroscopic reexploration of these patients identified anchor loosening or exfoliation into the joint space; one was successfully treated by reinserting the suture, and the other underwent partial meniscectomy . Five patients (5.2%) had tenderness on palpation of the joint line; one of these patients also had a positive mcmurray test . One patient (1.0%) sustained a sports injury 13 months after the first operation, which required a second operation for anterior cruciate ligament reconstruction . Lysholm, tegner, and ikdc rating systems were used to determine knee function and patient activity levels [table 2]. The mean postoperative lysholm score of the operated knees was 85.7 12.8 (range 51100), which was significantly better than the mean preoperative value of 47.8 10.4 (range 2562) (p <0.001, paired t - test). The mean preinjury tegner activity score was 7.4 1.6 (range 59) and the mean preoperative tegner score was 2.1 0.9 (range 04), which increased postoperatively to 7.2 2.2 (range 410) (p <0.001). A total of 92 patients (95.8%) had returned to full time work by the time of the last followup . The ikdc score increased from 32.7 10.7 (range 10.351.7) preoperatively to 82.5 5.1 (range 65.191.2) postoperatively (p <0.001). Preoperative and postoperative clinical scores outcomes were not significantly associated with any of these factors, including chronicity of the injury; patient age; or length, zone, or location (anterior horn, body, or posterior horn) of the tear [table 3]. Meniscectomy was initially viewed as a simple and at least in the short term, effective approach to treat meniscus injuries . With the recognition that meniscectomy carried the latent risk of cartilage degeneration and osteoarthritis in the long term, new approaches to correct meniscus injuries were developed . At present, most experts recommend meniscus preservation or reconstruction techniques whenever possible . Repair techniques generally fall into three categories: inside - outside, outside - inside, and all - inside . Compared to other techniques, the all - inside approach became popular because it is a less invasive and simpler surgical technique with a shorter surgical time and minimal surgical risk . Many all - inside meniscal repair techniques have been described.15 fast - fix is one of the most popular recently - developed meniscal repair devices . Biomechanical research reported that fast - fix exhibits superior biomechanical characteristics.161718 fast - fix is a suture - based and self adjusting approach that uses two 5-mm plla suture anchors, connected via a preloaded, pretied, self sliding, self - locking knot of no . 0 nonabsorbable braided polyester suture . In the procedure, after inserting the two anchors, the pretied self sliding knot is tightened with the aid of a knot pusher, which further compresses the torn meniscal segments together . The auxiliary components include a split sheath insertion cannula to avoid soft tissue tangling and a separate knot pusher / suture cutter . . Most scholars192021 suggest suturing tears in the red - red (<3 mm from the meniscocapsular junction) or red - white (between 3 and 5 mm from the junction) zones . Studies suggest that meniscal tears in the avascular zone do not have the capability to heal spontaneously, whereas the vascularized peripheral one third of the meniscus has a greater healing potential because a blood supply is essential for tissue repair . Reported that 80% of 198 meniscal tears extending into the avascular zone remained asymptomatic at followup after surgical repair.22 the chance of healing is increased if either the tear is located in the vascularized area or if access to blood elements is created.23 many techniques have been reported to promote healing of vascular and avascular areas, including trephination, fibrin blood clots, fibrin glue, and meniscal rasping . We agree with noyes and barber - westin,24 who repaired meniscus tears that extended into the avascular zone with good results . If there is any possibility to save the meniscal tissue, then we should try our best to recover the original meniscal shape and avoid simple resection, even if the tear extends into the avascular zone . In the current study, two patients had symptom (joint locking and snapping) recurrence at 6 and 11 months postoperatively and arthroscopic reexploration identified anchor loosening or exfoliation into the joint space; one was successfully treated by overhauling the sutures and the other by partial meniscectomy . To avoid anchor dislocation, the needle tip must penetrate the surface of the meniscus fragments and be withdrawn from the meniscus with a gentle oscillating motion, leaving the anchors; if the rim of the meniscal fragment is too fragile to suture, we should not be reluctant to remove it . Some patients developed stiffness and muscle atrophy of the operative knee because of poor compliance with early stage rehabilitation training . The rice principle, combined with early - stage no or partial weight - bearing, is helpful in facilitating recovery . We believe that a meniscal repair that is asymptomatic postoperatively does not always reflect true meniscal healing, which is only verifiable by second look arthroscopy . Postoperative mri was not performed unless clinical evaluation suggested a failure of the meniscal repair; this was a limitation of our study . Nevertheless, morgan et al . Reported that clinical examination is a reliable method of evaluating the status of repaired menisci.25 we also combined the examination with strict criteria to determine the clinical results . The clinical results of the present series were similar to those of previous reports . After a mean followup of 3.7 years, our success rate was 91.7% (88 of 96 patients) using the criteria of barrett et al.14 the mean preinjury tegner activity score was similar to that of postoperative score . By the last followup, there are no vessels and nerves in the medial portion of the meniscus; they exist in the peripheral portion . When the meniscus is torn, symptoms of pain originate from the torn meniscus causing drag across the joint capsule and shearing in the tibio femoral joint . Accordingly, we consider that the key point in achieving clinical cure is to make all efforts to restore meniscal continuity and original shape by suturing or meniscoplasty . Usually, we use the outside - in technique to repair anterior horn injuries, which in this study were all longitudinal tears parallel to the capsule in the red or red - white region . When the knots were tightened outside the capsule, the anchors fastened the anterior horn to the capsule . The anchors were beneath the meniscus and all patients felt soreness or pain on palpation around the suture area for 3 months postoperatively . However, there were no other complications, such as locking, or pain in hyperextension . With active local therapy, these symptoms gradually resolved, so that at the last followup, all patients obtained good results . Meniscal repair with the fast - fix meniscal repair system provides excellent clinical results in the vast majority of patients, with a success rate of 91.7% in this relatively short term followup study; this is comparable to the success rates of traditional suture techniques . Long term followup studies are needed to determine whether the repaired menisci will maintain structural and functional integrity over time . In addition, we found that the fast - fix system has the advantage of avoiding neurovascular complications . An acceptable cure rate using this device can be expected, even in chronic tears, tears extending into the red - white zone, and patients more than 30-years - old . The fast - fix system is an efficient, safe and effective suture technique for meniscal repair.
Flexible ureteroscopy (furs) is nowadays a common intervention for the management of kidney and ureteral stones . It is associated with lower morbidity, shorter hospital stay and higher stone - free rates (sfrs) in comparison to traditional procedures [1, 2]. The use of a ureteral access sheath (uas) during the procedure is becoming a very popular practice among urologists . Studies have shown improvements in the effectiveness of surgery, mainly due to a reduction in operative time and overall costs, as it enables repeated passage of the ureteroscope, while minimizing damage to inner structures and to the ureteroscope itself . It also decreases intrarenal pressure, leading to an optimization of the flow of irrigation fluid and less damage to the renal pelvis, even using a small diameter sheath . Nevertheless, the use of uas is not exempt of complications and has been associated with increased risk of ureteral injury, such as abrasion of the urothelium to ischaemia or even avulsion . Use of a ureteral stent [us] after furs is known to reduce postoperative pain and to prevent complications such as hydronephrosis, ureteral obstructions and strictures . However, the criteria for postoperative stenting are not well defined for all clinical scenarios and most guidelines do not contain recommendations . Although some authors recommend it, in order to prevent potential obstructions associated with postoperative ureteral edema or residual stones, the presence of us is not totally free of complications and it is associated with higher costs due to a second necessary procedure for its removal . The presence of a us prior to the procedure is involved in passive dilation of the ureter and is associated with a decrease in ureteral injuries . Some have suggested that pre - stented patients might have better outcomes, in terms of pain and complication rates . Our objective is to determine if postoperative stenting is necessary in pre - stented patients that underwent furs using uas . Once approved by the local ethics committee, we retrospectively reviewed clinical records from all patients who had undergone furs with use of uas at our hospital between july 1 2013 and may 31 2016 . Our inclusion criteria were: presented patients who underwent uncomplicated furs with use of uas, thus patients who suffered intraoperative complications were excluded from the study . Ureteral injury and fornix rupture, demonstrated in retrograde ureteropyelography at the end of the procedure, were considered as intraoperative complications . All the presented patients were selected and separated into two main groups, according to the use or not of postoperative us all procedures were performed using the same uas (boston navigator tm . The decision to stent or not to stent the patient was made by discretion of the urologist . Stone characteristics (diameter, localization), preoperative stenting information, operative time, post - operative events (urinary tract infections (utis), renal colic), emergency room (er) visits and need of hospital readmission were recorded . After descriptive statistics for the variables referred, categorical variables were compared with exact fisher test . Once approved by the local ethics committee, we retrospectively reviewed clinical records from all patients who had undergone furs with use of uas at our hospital between july 1 2013 and may 31 2016 . Our inclusion criteria were: presented patients who underwent uncomplicated furs with use of uas, thus patients who suffered intraoperative complications were excluded from the study . Ureteral injury and fornix rupture, demonstrated in retrograde ureteropyelography at the end of the procedure, were considered as intraoperative complications . All the presented patients were selected and separated into two main groups, according to the use or not of postoperative us all procedures were performed using the same uas (boston navigator tm ., 1113 fr . ). The decision to stent or not to stent the patient was made by discretion of the urologist . Stone characteristics (diameter, localization), preoperative stenting information, operative time, post - operative events (urinary tract infections (utis), renal colic), emergency room (er) visits and need of hospital readmission were recorded . After descriptive statistics for the variables referred, categorical variables were compared with exact fisher test . From 115 patients who underwent furs, we selected 73 patients who had a us at the moment of surgery as the main study group . Mean age of the patients was 51 years old (sd 12.8). Mean stone size was 8.5 mm (sd 7.06) and the reasons of preoperative stenting were: 14 (19.18%) because of ureteral stricture, 17 (23.29%) because of urosepsis, 29 (39.73%) because of residual stones after a first intervention and 13 (17.8%) because of unsuccessful extracorporeal shockwave lithotripsy (swl). One of them suffered a ureteral injury during the procedure, classified as grade 3 in the ureteral wall injury scale, and the other patient presented a fornix rupture . A third patient suffered from acute urine retention and was also excluded, because of his need of being catheterized, which would modify further postoperative outcomes . At the end of the surgery, out of 70 patients, 32 (45.71%) were stented and 38 (54.28%) were not . The same us (26 cm 6 fr percuflex, boston scienfic) was used for all stented patients . Mean operative time for the stented group was 88 minutes (sd 6.13) and 87 minutes for the not stented group (sd 6.27), with no significant differences between both groups (p = 0.85). Regarding postoperative outcomes we compared both groups (stented vs. not stented) based on different parameters: postoperative events (utis and renal colic), visits to the er and need for hospital readmission . There were 4 patients per group with postoperative events (p = 1). Four stented patients visited the er and 2 were readmitted, while 3 non - stented patients visited the er and 1 was readmitted (table 1). Postoperative outcomes: comparison between two groups of patients, with and without postoperative ureteral stent er emergency room, uti urinary tract infection flexible ureteroscopy is widely known as an effective treatment for proximal ureteral or renal stones . Utilization of uas during the procedure has been associated with some benefits, such as a decrease in intrarenal pressure, allowance of repeated passage of the ureteroscope, reduction of ureteral damage, improvement of visibility and sfr [3, 9, 10, 11]. Have suggested using uas in all patients undergoing furs because of their superior clinical results: high stone clearance and low complication rate . The uas used in our study is the smallest that is capable of allowing the insertion of all flexible ureteroscopes . The use of a us after performing a semi - rigid ureteroscopy to manage medial or distal ureteral stones is not recommended [9, 14]. Have investigated the incidence of complications and possible ureteral damage after the use of a uas and postoperative us . They found that us would have a positive role in avoiding initial ureteral edema and directly minimizing pain secondary to residual stone fragments and blood clots . On the same subject, rapoport et al . Have published that patients in whom uas was used and us was placed were less likely to return to the er . Kawahara et al . Recommend catheterization after furs with uas in uncomplicated cases, in which early catheter removal is also suggested and demonstrated to be safe, except in patients with potential risk for the development of ureteral strictures, for instance those with presence of impacted stones, pre - operative ureteral stricture, intra - operative ureteral injuries and longer operation time . Although postoperative stenting is linked to the reduction in the pressure of the collecting system and in minimizing ureteral mucosa damage after instrumentation, it is not free of risks . Potential risks include prolonged hydronephrosis, higher pain scores, stent migration, incrustation and discomfort [16, 17]. Studies have shown that these complications are related to bladder and lower urinary tract symptoms and can cause decreased quality of life [18, 19]. In addition, a second necessary procedure for its removal increases the costs and morbidity for the patient . These are some of the reasons why some authors have argued that postoperative us is not always necessary . However, this is not a completely clear matter, as they have failed to demonstrate exactly in which particular situations it should be avoided . Recommend not using us after furs, independent of the presence or absence of preoperative stents, which are known to passively dilate the ureter and an important factor to consider, in as much as the absence of postoperative us does not augment complications . These findings are described in furs without use of uas . With a preoperative stent, the ureter is wider during the surgery, allowing for a faster and easier procedure . This could potentially decrease the ischaemia associated with uas, causing fewer complications after its use [5, 22]. In this context, we suggest not using postoperative us, which is supported by our results . Advantages of stentless urs are decreasing urinary symptoms and no need for additional procedures . The need of a complementary procedure to remove the stent, suggests that proper criteria for postoperative stenting need to be defined . In this context, according to our findings, we compared postoperative outcomes between both groups of patients, with and without postoperative us, after undergoing furs with uas . There were no statistical differences between stented and not stented patients in those terms (p = 1). Our findings are similar to the conclusion of the study performed by torricelli et al ., which concluded that it is not necessary to re - stent presented patients after surgery, given that they are a safer group to perform furs on, independently of the use of uas [8, 23]. This would lower overall costs and morbidity, as it would not be necessary for the patient to undergo a second procedure for stent removal, which also is not exempt of risks . The number of patients included is not very high, given that the study was developed in one single hospital . Selection bias could also be present as the urologists were the ones to decide whether to stent or not, without guidelines or previous agreement . Costs of a second procedure to remove postoperative stents were not included in the analysis . Postoperative ureteral stenting is not always necessary after using uas during flexible ureteroscopy in a pre - stented patient . There were no significant differences in postoperative events, er visits or need of hospital readmission . However, a prospective randomized clinical trial would be necessary to support our findings with a higher level of evidence . We consider that this is a subject worth further investigation because of its impact on costs and morbidity.
The bony orbit is a pyramidal structure housing the eyeball and the rest of the orbital soft tissues . The bony orbit is composed of fairly strong rim and walls including the inferior wall referred to as the orbital floor, the medial wall, the superior wall referred to as the orbital roof, and the lateral wall . The volume of the orbit is about 30 ml and the anteroposterior diameter of the orbit is between 40 and 50 mm . The base of the orbit has a height of about 35 mm and a width of about 40 mm.1 the orbital apex is the posterior end of the bony orbit and it is composed of a number of openings including the optic foramen, the superior and inferior orbital fissures which transmit quite a number of vital structures . The optic nerve passes through the optic foramen to the eyeball while the superior orbital fissure transmits the lacrimal nerve, the frontal nerve, the trochlear nerve, and the superior ophthalmic vein.1 a 14-year - old female presented with left axial proptosis and loss of vision of 1-year duration [figure 1]. The visual acuity in the left eye was no perception of light (npl) while that of the right eye was 6/6 unaided . Her exophthalmometric readings were 14 mm by 22 mm in the right and left eyes, respectively, on the base of 102 mm . There was left exotropia of about 45 (hirchberg's staging) and computed tomography (ct)-scan revealed a cystic mass behind the eyeball but within the muscle cone [figure 2]. The radiologist's report suggested a cystic mass to rule out either dermoid cyst or optic nerve glioma . Exploratory supero - temporal orbitotomy was done [figure 3] and a huge intraconal cystic mass was encountered but got ruptured in the process of removal with mainly serous fluid release . The walls of the cyst were excised in pieces and sent to the laboratory for histology . A thorough lavage with normal saline was done and the wound was closed with a drain in place and the eye padded for 72 h. the patient was placed on systemic prednisolone 20 mg bid with ciprofloxacin 50 mg bid for 10 days . The sutures were removed after 6 days and patient was discharged home . Visual acuity in the left eye immediately at the opening of the pad after 72 h was counting finger at 1 m unaided . The histology report revealed features suggestive of dermoid cyst . At follow - up visit after 2 weeks further follow - up 12 months later revealed vision had improved vision to 6/9 unaided with no proptosis or exotropia [figure 4]. Case at presentation with axial proptosis and dilated pupil computed tomography scan highlighting intraconal cystic mass in the left orbit supero - temporal orbitotomy of the left orbit showing cystic mass postoperative picture of patient without proptosis or exotropia lesions in the orbital apex invariably cause severe visual morbidity and esthetics depending on the size, duration of the lesions, the type of lesions, and the structures involved.1 some of the structures involved in pathologies of this area include the 3, 4, 6 cranial nerves, the lacrimal and frontal nerves . Other vital structures in this area include the superior ophthalmic vein and the optic nerve.1 depending on the mass effect of the tumor in this area, various presentations are possible ranging from nerve palsies to visual loss . Compression of the optic nerve by tumors in the orbital apex will ultimately lead to blindness.2 some studies carried out have suggested the possibility of spontaneous visual recovery perhaps depending on the level of visual affectation when the patient presents.3 in our case report, the lesion was cystic and quite huge in size with presenting visual acuity of npl . The lesion was a dermoid cyst which could have been there for years before attaining such a size (almost larger than the eyeball size) with ultimate npl vision . The orbital apex is a site that is predisposed to a number of lesions which will ultimately constitute the orbital apex syndrome . Included are (1) head and neck tumors such as nasopharyngeal carcinoma, adenoid cystic carcinoma, and squamous cell carcinoma . (2) neural tumors such as neurofibroma, meningioma, ciliary neurinoma, and schwannoma . (3) metastatic lesions from the lung, breast, renal cell, and malignant melanoma . (4) hematologic tumors such as the burkitt's lymphoma, non - hodgkin's lymphoma, and leukemia . (5) (7) traumatic lesions as in penetrating injury and nonpenetrating injury with orbital apex fracture and retained foreign bodies.24 in general, the orbit attracts a lot of neoplasia including a number of secondary tumors also.5 the early diagnoses of orbital apex lesions pose a great challenge as a myriad of pathologies find their way to this area.6 the lack of the essential tools to diagnose the lesions particularly in the third world makes it even more challenging . Clinical assessment including detailed history, demography and clinical presentation, laboratory investigations including the full blood count and differentials together with radiological imaging techniques can go a long way in assisting in making prompt diagnosis of orbital apex lesions.7 in the history, it is possible to know how the disease started and progressed, the duration of the disease the accompanying symptoms such as pain, loss of sensation on the face, variability during and/or after exertions or sleep, and the age and sex of the patient . Clinical examination will reveal the nature of the disease including the presence of proptosis, the type of proptosis whether axial, nonaxial, whether pulsatile or not whether with visual impairment or not, whether there is relative afferent papillary defects, color desaturations, exposure keratopathy or not, and whether there is a loss of corneal sensation or not . The laboratory investigations including hemogram will be able to reveal whether or not there is associated inflammatory component, parasitic infestations, lymphoproliferative diseases, or otherwise . It is worthy of note that the dermoid cysts are by far the most common orbital cysts in childhood, while the inflammatory cysts due mainly to parasitic infestations are common in the tropics.8910 the availability of high - resolution magnetic resonance imaging (mri) will aid in resolving the nature of the orbital lesions and where injury with fractures of the bony orbit is suspected or mri is contra - indicated the ct - scan will suffice.210 surgical management of orbital apex tumors also poses great challenge . Meticulous dissections are a must! The surgical option for lesions in very tight spaces such as the orbital apex will require advanced endoscopic instruments to overcome the challenges of visualization and reaching of such embedded tumors.1112 gamma knife radiosurgery has revolutionized surgery in such tight spaces as well . The gamma knife radiosurgery uses multisource gamma ray emitter that is able to focus accurately on the targets in concealed spaces like the intracranial tumors and the other spaces and thus replacing the need for open surgeries.13 in our own situation, we did not have such refined equipment and had to contend with bloody surgery and rupture of the cystic lesion though with a favorable visual and esthetic outcome! Any careless assault surgically on this space will result in grave morbidities particularly visual loss in view of the optic nerve and other vital structures . Prompt diagnoses and careful surgical removal of such tumors will go a long way to avoiding the aforementioned morbidities . The challenges in our environment however include inadequate availability of the high - tech diagnostic and surgical tools . We therefore recommend that there should be collaboration with the surgeons and equipment companies in the developed world in the area of capacity building both in terms of manpower training and making the high - tech equipment available at subsidized rates . In our case, however, the npl vision and the exotropia were reversed after the surgical intervention . We advise also in conclusion, therefore, that all orbital apex tumors be immediately operated upon irrespective of the presenting visual acuity . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Stressful events activate the sympathetic nervous system and hypothalamic - pituitary - adrenal axis, which lead to the release of biochemical mediators of stress, such as cortisol, catecholamines, and neuropeptides [1, 2]. These stress mediators trigger a variety of physiological changes meant to improve the performance of the organism, such as increasing blood pressure and heart rate and enhancing the immune response . Thus, a short, acute stress has been shown to exert various beneficial effects . However, when stress becomes chronic, the prolonged exposure to the same stress mediators, which were beneficial in acute stress, often triggers pathological processes and contributes to the development or exacerbation of various diseases, including cancer . Chronic stress has been implicated in the stimulation of tumor development and progression by both clinical and animal studies [46]. Initially, stress - induced suppression of the immune response was suggested as the major mechanism of this phenomenon . As opposed to acute stress, which enhances immunity and has been shown to increase resistance to cancer, chronic stress impairs immune responses and in this way facilitates tumor growth [8, 9]. However, there is also growing evidence indicating that stress mediators, such as glucocorticoids and sympathetic neurotransmitters, can directly affect tumor cell proliferation and survival as well as tumor angiogenesis . The direct effects on tumor cells vary significantly between different stress mediators and types of tumors [1013]. In contrast, their actions on tumor vascularization involve interactions with common angiogenic factors, such as vascular endothelial growth factor (vegf), and seem to be universal between different tumor types [5, 1416]. Thus, stress mediators and their receptors can become novel targets in antiangiogenic tumor therapy . Norepinephrine (ne) and epinephrine (e) belong to a family of catecholamines and are one of the best characterized stress neurohormones . Ne is released primarily from the sympathetic nerves, while e is mainly secreted from the adrenal medulla . As the sympatho - adrenomedullary system is responsible for the body's fight - or - flight stress response, circulating levels of both catecholamines ne and e activate the same and adrenoreceptors (ar), which are widely distributed in all tissues . Recently, ne and e have been implicated in stress - induced augmentation of tumor growth and progression . In an orthotopic model of ovarian carcinoma, the growth - promoting effect of stress was mimicked by a -ar agonist, isoproternol, and blocked by its antagonist, propranolol [5, 6]. Similarly, activation of -ar resulted in an increase in metastases in animal models of lung and breast cancer [18, 19]. In all of the above models, the growth - promoting effects of stress, as well as direct activation of -ars, was associated with a significant increase in tumor vascularization, while -ar blockers reduced vessel density [5, 6]. Moreover, tumors derived from stressed animals had elevated levels of vegf and other angiogenic factors, and the growth promoting actions of -ar activation was reduced by blocking the vegf pathway . Thus, an increase in angiogenesis appears to be the main mechanism of growth - promoting effects of ne and e. indeed, in various cancer cell types, such as ovarian cancer, colon cancer, melanoma, pharyngeal carcinoma, and multiple myeloma, activation of -ars present on tumor cells led to a dramatic increase in synthesis and release of angiogenic factors vegf, il-8, and il-6 [5, 16, 2023]. These effects were mediated primarily via a -ar - dependent increase in camp levels, which resulted in the activation of protein kinase a (pka) and src [5, 22]. Adrenergic stimulation has also been shown to increase the secretion of metalloproteases, mmp-2 and mmp-9, which further augment angiogenic and metastatic processes . Interestingly, catecholamine - induced release of angiogenic factors from tumor cells can be further enhanced by its secretion from stromal cells, such as -ar - positive tumor - associated macrophages [24, 25]. Although the stimulatory effects of ne and e on the release of angiogenic factors seem to be the major mechanism of their tumor - promoting actions, these neurotransmitters can also exert direct trophic effects on endothelial cells (ecs) through -ars . Phenylepinephrine, a non - vasoconstrictive -ar agonist, has been shown to induce ec proliferation and migration as well as promote capillary formation . Since tissue ischemia is known to stimulate ne release from the sympathetic nerves, the direct angiogenic effect of ne can be significantly enhanced in hypoxic areas of tumors . Thus far, the results of experimental studies have confirmed that ar agonists exert strong stimulatory effects on tumor growth and agree that the release of angiogenic factors is the main mechanism of these actions . These discoveries open new possibilities of treatment with well - known drugs, such as antagonists of ars . Some clinical data indicating decreased incidence of prostate cancer among cardiovascular patients treated with -blockers corroborated the above findings [28, 29]. However, it is important to remember that the indirect, pro - angiogenic effect of ar agonists mediated by other angiogenic factors depends on the presence of these receptors on tumor cells, thus it can be tumor - specific . Moreover, the angiogenic actions of ne and e can be further modified by their direct effect on tumor cell proliferation and invasiveness, which in turn may differ among various tumors . In many cancer cell types, such as colon, ovarian, and prostate, . However, adrenergic stimulation can also inhibit proliferation of some tumor cells, as shown in melanoma and neuroblastoma [30, 31]. In breast cancer, the adrenergic agonists seem to increase motility of cancer cells but at the same time inhibit their proliferation [13, 32]. In agreement with these data, another clinical study indicated no effect of treatment with -blockers on the risk of breast cancer among cardiovascular patients [33, 34]. Thus, the success of potential cancer therapy targeting ars will depend on the type of tumor, its receptor expression pattern, and environmental factors, such as stress, which augment ne and e effects . Dopamine (da) is not only a precursor of ne and e but is also an important neurotransmitter in the brain acting via two types of receptors d1 and d2 . In the periphery, da is synthesized in mesenteric organs as well as released from sympathetic neurons and adrenal medulla . Levels of da are elevated during stress, but rather than mediating the fight - or - flight response, as ne and e do, its role involves coping with stress . It has been shown that administration of da inhibits the growth of various tumors, such as stomach, breast, and colon cancers [14, 36]. Consistently, in mice lacking the da transporter, which is normally responsible for uptake of this neurotransmitter, the elevated da levels were associated with reduced growth of lewis lung carcinoma . In gastric cancer, the endogenous levels of da were significantly lower than those in surrounding healthy tissue, indicating that the neurotransmitter acts as an endogenous tumor suppressant that needs to be inactivated to allow tumor progression . The main mechanism of these growth - inhibitory actions of da involves its direct antiangiogenic effect on ecs . In all animal models, treatment with da led to a significant reduction in tumor vascularization [14, 36, 37]. Da has also been shown to block vegf - induced ec proliferation, migration, and vascular permeability . Further studies revealed that da, acting through its d2 receptors, enhances endocytosis of vegf - r2 and decreases its membrane expression . This activity of da interferes with vegf signaling by reducing vegf - induced phosphorylation of its vegf - r2 and preventing the activation of downstream kinases fak and p42/44 mapk [38, 39]. In addition to its effect on mature ecs, da has also been shown to block vegf signaling in endothelial progenitor cells (epcs). As a consequence, da not only inhibits trophic functions of vegf in these cells but also blocks their recruitment from bone marrow . It has been shown that da levels are decreased in the bone marrow of tumor - bearing mice, which facilitates epc mobilization . Since recent data strongly support a role for epcs in the tumor vascularization, da effect on epc function may significantly contribute to its growth - inhibitory effect . The role of da in stress - induced changes in tumor growth and progression has not been characterized . It seems that da is an endogenous inhibitory factor which requires inactivation for tumor growth, rather than sympathetic activation . However, in contrast to ne and e acting on specific tumors, da effects appear to be more universal, influencing various tumor types, via its direct actions on ecs and epcs . Neuropeptide y (npy) is a 36-amino - acid peptide coreleased with ne from sympathetic nerves . Npy is mainly known due to its anxiolytic effect in the brain and central regulation of food intake . In the periphery, npy inhibits the release of ne after sympathetic stimulation and acts as a vasoconstrictor . There is also a growing number of evidences that npy is a growth factor for variety of cells . The peptide has been shown to stimulate proliferation of vascular smooth muscle cells and neuronal precursors, while the trophic effect of npy on ecs revealed its angiogenic properties [4247]. The peptide stimulates proliferation and migration of ecs and promotes capillary tube formation, while in vivo, endogenous npy facilitates vascularization of ischemic tissues [43, 46, 47]. These actions are dependent on endothelial nitric oxide synthase (enos) activation and, partially, on the vegf pathway . The angiogenic activities of npy are mediated mainly by its y2rs, since npy - induced angiogenesis is severely impaired in y2r / mice [48, 49]. Due to its angiogenic properties, npy has been implicated in various pathological conditions associated with a deregulation of tissue vascularization, such as retinopathy, wound healing, atherosclerosis, and obesity [48, 5052]. Recently, its role in tumor angiogenesis has also been shown . In malignancies originating from neuroendocrine tissues, such as neuroblastoma and ewing's sarcoma, npy released from tumor cells seems to be an essential factor involved in their vascularization . Antagonists to npy receptors blocked the effect of both neuroblastoma and ewing's sarcoma - conditioned media on ec proliferation . Consequently, treatment with exogenous npy significantly increased vascularization of subcutaneous xenografts derived from both tumor cell types . As in the case of ne and e, the angiogenesis - related growth - stimulatory actions of npy are further modified by its direct effect on tumor cell growth and survival . For example, in neuroblastoma, the peptide stimulates proliferation of tumor cells via the same angiogenic y2rs, thereby further augmenting the growth of neuroblastoma xenografts . In contrast, in ewing's sarcoma, npy induces tumor cell apoptosis via y1 and y5rs . As a result, exogenous npy inhibits growth of ewing's sarcoma xenografts in vivo, despite increase in their vascularization . Although neuroendocrine tumors, which synthesize and release endogenous npy, seem the most susceptible to tumor growth regulation by this peptide, npy and its receptors have also been implicated in nonneuronal types of tumors . For example, peptide yy (pyy), which belongs to the same family of peptides and acts through the same receptors as npy, has been shown to inhibit proliferation of breast and prostate cancer cells via y4rs and pancreatic cancer cells via y2rs [5356]. Thus, these direct effects on tumor cell proliferation and survival are an important aspect of npy actions in tumors and are often potent enough to overcome its angiogenesis - mediated growth - promoting effect . Thus far, most of the studies addressing the role of stress in promoting cancer growth focus on the best known stress mediators catecholamines and glucocorticoids . There are no studies directly linking npy with stress - induced tumor growth and progression . However, systemic npy levels are also upregulated during stress, particularly those intensive and prolonged in nature . Hence, once stimulated, the elevated levels of npy persist for a longer period of time . The physiological role of npy is to help cope with stress due to its central, anxiolytic effects [58, 59]. However, it has been shown that elevated peripheral circulating levels of npy induced by intensive chronic stress can result in significant deleterious effects, such as enhanced atherosclerosis and diet - induced obesity, both of which are diseases associated with intensive tissue growth and upregulated angiogenesis [52, 60]. Thus, while high levels of npy in the brain improve stress coping, chronically elevated levels of the peptide in the circulation can result in a variety of side effects . As summarized above, the discoveries of recent years provided a significant body of evidence confirming an important role of sympathetic neurotransmitters and, consequently, chronic stress in regulating of tumor vascularization (figure 1). This research opens new avenues for developing novel therapeutics, as well as using already existing and well - characterized drugs, such as -blockers and da receptor agonists, in new clinical settings . This seems to be particularly important, since cancer diagnosis per se is usually a stressful event for the patient . However, careful consideration needs to be given to other actions of stress mediators, such as cancer - specific effects on tumor cells themselves, as well as changes in immune system, which can indirectly affect tumor development and progression . Finally, since patterns of neuro - hormonal activation vary with different types of stress, tumor exposure to particular stress mediators would vary, too . Thus, potential therapeutic value of modifying particular stress pathways may be dependent on a variety of factors.
Many of the hemolytic anemias and platelet disorders respond to splenectomy after failure of medical therapy . Removal of the spleen can play an important role in reducing the mortality of hematologic conditions . Diagnostic splenectomy, while there is no enough data, is still performed in the general surgery . However, there is no indication in gaucher disease for diagnostic splenectomy . The differential diagnosis of the gaucher disease is considered in patients with unexplained organomegaly, easy bruise, bone pain, or a combination of these conditions . All suspected diagnoses are confirmed by the determination of the acid - glucosidase activity in isolated leukocytes or cultured fibroblasts . We hereby report the four patients, three of whom were easily diagnosed gaucher's disease with classical methods using bone marrow aspiration cytology, and one underwent teh splenectomy due to splenic mass and wasdiagnosed gaucher's disease after pathological examination . A 39-year - old woman who intermittently suffered from nasal bleeding lasting 3 days was admitted to our hematology department . Her vital signs on admission were as follows: blood pressure was 110/75 mmhg; pulse rate was 72 per minute; and temperature was 36.8 c . The peripheral blood count revealed a hemoglobin level of 10.5 g / dl, hematocrite value of 33.0%, white blood cell count of 7000/mm3 and trombocyte count was 50,000/mm . Examination of the bone marrow cytology showed gaucher cells . Upon this, we diagnosed gaucher and supported our diagnosis with - glucosidase activity in isolated leukocytes or cultured fibroblasts . A 42-year - old woman who complained of fatigue lasting 4 months was admitted to our internal medicine department . Her laboratory examination revealed a hemoglobin level of 11.5 g / dl, a hematocrite value of 34.0%, a white blood cell count of 9000/mm3 and a trombocyte count of 60,000/mm . Then, we diagnosed gaucher's disease . A 51-year - old man with the complaints of a 10-day history of fatigue and rectal bleeding admitted to our emergency department . The laboratory test revealed pancytopenia . Under the light of all these findings, we performed bone marrow examination, and gaucher was diagnosed . A 75-year - old man with lower back pain lasting for 2 months admitted to our orthopedic clinic . On physical examination, the abdominal computed tomography scan (ct) showed hepatomegaly, splenomegaly of 14 cm in width and 4 cm mass at spleen (fig . Afterwards, we obtained findings of gaucher's disease (figs 2, 3). Bone marrow aspirate with hematoxylen and eosin stain, showing the curtain like macrophages known as gaucher's cells . A 39-year - old woman who intermittently suffered from nasal bleeding lasting 3 days was admitted to our hematology department . Her vital signs on admission were as follows: blood pressure was 110/75 mmhg; pulse rate was 72 per minute; and temperature was 36.8 c . The peripheral blood count revealed a hemoglobin level of 10.5 g / dl, hematocrite value of 33.0%, white blood cell count of 7000/mm3 and trombocyte count was 50,000/mm . Examination of the bone marrow cytology showed gaucher cells . Upon this, we diagnosed gaucher and supported our diagnosis with - glucosidase activity in isolated leukocytes or cultured fibroblasts . A 42-year - old woman who complained of fatigue lasting 4 months was admitted to our internal medicine department . After her physical examination, we just found hepatosplenomegaly . Her laboratory examination revealed a hemoglobin level of 11.5 g / dl, a hematocrite value of 34.0%, a white blood cell count of 9000/mm3 and a trombocyte count of 60,000/mm . A 51-year - old man with the complaints of a 10-day history of fatigue and rectal bleeding admitted to our emergency department . The laboratory test revealed pancytopenia . Under the light of all these findings, we performed bone marrow examination, and gaucher was diagnosed . A 75-year - old man with lower back pain lasting for 2 months admitted to our orthopedic clinic . On physical examination, a slight hepatosplenomegaly was found . There were not any palpable lymphadenopathy . The abdominal computed tomography scan (ct) showed hepatomegaly, splenomegaly of 14 cm in width and 4 cm mass at spleen (fig . Afterwards, we obtained findings of gaucher's disease (figs 2, 3). Bone marrow aspirate with hematoxylen and eosin stain, showing the curtain like macrophages known as gaucher's cells . Ther is no enough data in the literature about diagnostic splenectomy, however in some uncleared conditions (especially in hematologic disorders) many surgeons have to perform this procedure throughout their lives . On the other hand, therapeutic splenectomy today is performed in various cases . Although splenectomy does not alter the course of a patient with gaucher's disease, it is the procedure of choice if there are signs of hypersplenism . Some authors have proposed performing a partial splenectomy for hypersplenism in gaucher's disease to limit the hypersplenism while preserving some splenic functions . There are three different recognized types of gaucher's disease, which are differentiated from each other depending on the presence or absence of neurological symptoms[45]. The first symptom occur before 10 years of age in more than 50% of the patients . Early onset of the clinical symptoms and signs predispose patients to severe phenotype and irreversible complications . The most prevalent variant of the disease is the non - neuronopathic form (type 1 gaucher's disease, or the so - called patients in this group usually bruise easily and experience fatigue due to anemia and low blood platelets . They also have an enlarged liver and spleen, skeletal disorders, and, in some instances, lung and kidney impairment . Patients have extensive and progressive brain damage and usually die by 2 years of age . In the third category, called type 3, liver and spleen enlargement is variable, and signs of brain involvement such as seizures gradually become apparent . Atypical bone pain, pathological fractures, avascular necrosis and extremely painful bone crises have a great impact on the quality of lives of many . In addition to clinical suspicion, some morphologic, hematologic and biochemical indicators can help establish the diagnosis . In a study conducted, the proportion of correct diagnosis (and treatment) of gaucher patients in germany is only between 10 to 20% . The history of treatment of gaucher's disease started with splenectomy and continued with bone marrow transplantation, before the recent introduction of safe and effective enzyme replacement therapy . Intravenous administration of the enzyme results in the breakdown of accumulated glycolipids and, subsequently, in reversal of the manifestations of the disease . In gaucher disease today, splenectomy alleviates hematologic abnormalities in patients with hypersplenism, but it does not correct the underlying disease process . Pollock et al ., showed that even after a successful open splenectomy procedure, morbidity was about 21% and mortality was 2% . The morbidity and mortality increase especially in patients with the spleen of extremely great size . Concept, the diagnosis of gaucher disease should be made with less invasive methods than surgery . If the surgeon decided to perform splenectomy due to splenomegaly or splenic mass, the gaucher disease should be considered.
Bone is a dynamic tissue which undergoes continuous self - renewal, and bone homeostasis relies on functional equilibrium among three types of cells: osteoclasts essential for bone resorption, osteoblasts responsible for bone matrix formation, and osteocytes involved in the reception and transduction of mechanical stimuli and in the regulation of osteoclast / osteoblast differentiation and function . The balance between bone synthesis and resorption is finely tuned and any perturbations of this balance in adults trigger bone disease . Osteopetrosis (osteo: bone and petros: stone) regroups a set of rare, heterogeneous, and inherited bone diseases characterized by increased bone mass . Osteopetrosis is therefore an osteocondensing disease . In principle, two causes could give rise to this osteocondensing phenotype: increased bone formation or failure of resorption by osteoclasts . However, osteopetrosis is known to result from defective osteoclast differentiation or function [3, 4]. Important progress has been made during the past decades in understanding the molecular mechanisms underlying the development of hereditary diseases characterized by increased bone mass [3, 5]. Our objective in this review is not to give a detailed description of all the sclerosing bone diseases; such information can be found in other reviews [3, 4, 6, 7]. Instead, we discuss recent findings regarding osteopetrosis and how the study of this disease has contributed to new understanding of functions associated with the skeleton [810]. Osteoclasts are highly specialized cells responsible for the dissolution of bone mineral and for the degradation of organic matrix . Osteoclasts are multinucleated cells (containing up to 50 nuclei), derived from the fusion of mononuclear cells belonging to the monocyte - macrophage lineage . Under the influence of factors secreted by osteoblasts and/or stromal cells present in the bone microenvironment m - csf (macrophage colony stimulating factor) is expressed by osteoblasts and binds the c - fms receptor on osteoclast precursors, stimulating their proliferation and the expression of rank (receptor activator of nf-b) receptor . The interaction of rank - l, expressed and secreted by osteoblasts and stromal cells, with its receptor propels the fusion of osteoclast progenitors to form a giant multinucleated cell . A terminally differentiated osteoclast is able to degrade extracellular bone matrix by the action of specific proteins . To resorb bone matrix, osteoclasts must be perfectly polarized with a ruffle border and a sealing zone . These two features allow the creation of a resorption lacuna into which h ions are actively secreted in order to acidify it, leading to dissolution of bone matrix hydroxyapatite . Type ii carbonic anhydrase (caii) hydrates co2 to form carbonic acid, which spontaneously dissociates into protons and hco3 ions . The protons are actively transported into the resorption lacuna by a vacuolar atpase proton pump located in the ruffled border domain [1, 11]. The hco3 ion is exchanged with cl by a bicarbonate / chloride antiport on the basolateral membrane of the cell . The chloride ion is translocated into the resorption lacuna through chloride channel 7 (clcn7), recently reclassified as chloride / proton antiport . The acidic environment promotes the dissolution of inorganic content and also exposes the organic matrix, which is then ready to be digested by secreted proteolytic enzymes [1, 11]. The collagenous bone matrix is dissolved by two groups of enzymes, the matrix metalloproteases and the lysosomal cathepsins . This enzyme is secreted into the resorption lacuna and degrades type i collagen in the acidic environment . The acquisition and maintenance of osteoclast membrane polarity require a complex system of vesicle trafficking and ongoing cytoskeletal renewal . One of the proteins involved in these processes is plekhm1 (pleckstrin homolog domain containing family m with run domain member 1). This protein plays a crucial role in acidification and trafficking of intracellular vesicles [13, 14]. A recently discovered protein important for osteoclast trafficking activity is snx10 (sorting nexin 10). Snx10 belongs to a family of about 30 proteins sharing the px (phox homology) phospholipid binding domain and is involved in protein trafficking and osteoclast differentiation / function [15, 16]. Osteopetrosis is a generic name for a group of rare genetic bone diseases characterized by osteoclast failure . The adult autosomal dominant type ii form or albert - schnberg disease classified as mild is sometimes associated with bone symptoms . In contrast, the infantile recessive osteopetroses are severe forms and usually lethal in childhood without treatment [3, 57, 17]. Mutations in at least 8 genes (table 1) have been identified as being responsible for osteopetrosis pathogenesis in humans . Autosomal recessive osteopetrosis is a severe disease diagnosed in the first months of life owing to a variety of problems . They also show bruising and frequent bleeding secondary to medullar hyperplasia caused by bony invasion of the medullar space . Untreated children usually die during their decade from hemorrhage, pneumonia, anemia, or infection . Hematopoietic stem cell transplantation (hsct) is the only treatment option currently far available [3, 5, 18]. The number of osteoclasts is normal or high, but their acidifying activity, compulsory for bone resorption, is impaired . Several genes are known to be involved in this form of osteopetrosis (table 1, figure 1). About 50% of aro patients harbors loss - of - function mutations of tcirg1 which codes for the proton pump v - atpase 3 subunit [17, 19]. Loss - of - function mutations of the clcn7 gene, coding for chloride channel 7, have also been described in ~10% of aro patients . Mutations in ostm1 (osteopetrosis associated transmembrane protein 1), coding for a protein involved in transport of clcn7 to the ruffled border (and considered as a subunit of clcn7), have been described as causing severe osteopetrosis in ~5% of patients [2123]. Primary neurological defects can also be present in patients bearing ostm1 or clcn7 mutations [20, 23]. Deformity of the distal femora, bone pain, and chondrolysis of the left hip were described in one patient . Recently, a mutation in the snx10 gene was found in 15 families in which the patients displayed a heterogeneous phenotype . Mild growth retardation, hypocalcemia, hydrocephalus, severe hematological abnormalities, and visual impairment have been described in patients with loss of function mutations of snx10 [3, 15, 16, 24]. Less than 4% of aro patients harbors loss - of - function mutations of tnfsf11, encoding rank - l, or of tnfrsf11a, encoding rank receptor, and constitute a distinct subgroup of recessive osteopetrosis . Indeed, bone biopsies from these patients revealed a complete lack of osteoclasts [2527]. In addition, patients with tnfsf11 mutations exhibit some immune abnormalities and not palpable lymph nodes, but b and t lymphocyte numbers are normal . By contrast, most of the patients with tnfrsf11a mutations have a more severe immunological phenotype with a defect in memory b lymphocyte differentiation and a reduction in immunoglobulins levels [2527]. However, osteopetrosis caused by tnfsf11 mutations cannot be treated by hsct, because an osteoblast defect is the basis of this pathology . In practice, a molecular genetic diagnosis should be made before transplantation to ensure that the pathology is not due to a rank - l mutation . In 1983, renal tubular acidosis can explain the hypotonia, apathy, and muscular weakness occurrence in some patients . By radiography caii deficiency resembles other forms of osteopetrosis, but brain calcifications can develop during childhood and osteosclerosis and bone modeling spontaneously decrease instead of increasing in the course of pathology evolution . Metabolic acidosis occurs during the neonatal period, and renal tubular acidosis, both proximal and distal, has been described [29, 30]. Caii is expressed in many different tissues including brain, kidney, red blood cells, cartilage, lung, and digestive mucosa . Ado ii is commonly called benign osteopetrosis but presents with an extremely heterogeneous course from asymptomatic to rarely fatal . Adoii clinical and radiological signs occur quite late in childhood or in the teens, although earlier occurring has sometimes been reported . Adoii patients usually displayed osteosclerosis at the vertebral level (so - called sandwich vertebrae) and also a bone in bone aspect observed mainly in the iliac bones, but sometimes in other epiphyses . In addition, on radiography, alternating dense and light bands are often seen in iliac bones and at the extremities of long bones [7, 33]. Bone fractures occur in 80% of patients, with a mean of 3 fractures per patient . The femur is the most fractured bone in this pathology, but fractures can occur on any long bones and even at the posterior arch of the vertebrae, which often leads to a spondylolisthesis . Hip arthritis is frequent (in 50% of the cases) and could be due to excessive stiffness of the subchondral bone . Auditory or visual impairment occurs in less than 5% of affected individuals [7, 33]. Arthropathies are technically difficult and postsurgical complications, such as strengthening delay, infections, and pseudoarthritis are frequent (50% of cases) due to bone stiffness . For example, in 3 families in which most of the affected individuals expressed only a mild form of adoii, some members exhibited anemia and blindness caused by optical nerve compression . This phenotype has been called intermediate osteopetrosis because of its overlap with that of mild aro . About 70% of patients affected by adoii harbors heterozygous dominant negative mutations of the clcn7 gene (figure 1, table 1). In the remaining ~30% of cases, no mutations in clcn7 gene sequences were found, suggesting involvement of further genes in the pathogenesis of this form of osteopetrosis . Osteopetrorickets is a bone disorder characterized by increase of bone mass with a defect of skeletal mineralization . Schinke and coauthors performed histological analysis of undecalcified bone biopsies of 21 patients who received a diagnosis of osteopetrosis . In patients with loss - of - function mutations in the tcirg1 gene, the same pathological enrichment of osteoid was confirmed in oc / oc mice carrying a loss - of - function mutation of the tcirg1 gene, while no increase was revealed in osteopetrotic scr mice . The increase of osteoid volume was associated with hypocalcemia, due to a defect of intestinal calcium uptake . Indeed it was shown that tcirg1 is also expressed in the fundus, a region of the stomach involved in gastric acidification, and loss - of - function mutations induce hypochlorhydria and reduced intestinal calcium uptake in both humans and mice . Gastric acidification is a prerequisite for efficient intestinal calcium uptake; in hypochlorhydria, intestinal calcium uptake is lowered leading to parathyroin hormone (pth)-dependent activation of osteoclasts and an osteoporosis phenotype . In the case of loss - of - function mutation of tcirg1, intestinal calcium uptake is reduced and pth - dependent stimulation of bone resorption is blocked, resulting in an osteopetrorickets phenotype . Performed histomorphometric analysis of bone biopsies of 9 osteopetrotic patients with loss - of - mutation in the tcirg1, clcn7, and tnfsf11a genes . In contrast, there was no sign of osteopetrorickets in patients with clcn7 and tnfsf11a gene mutations [3537]. Osteocalcin can exist in two different forms, undercarboxylated and carboxylated on 3 glutamic acid residues [10, 38]. The carboxylated form has high affinity for the hydroxyapatite, facilitating its engraftment in the bone matrix . Ferron et al . Investigated whether acidic bone resorption lacuna promotes the decarboxylation of osteocalcin . Indeed they observed that in oc / oc mice the levels of undercarboxylated osteocalcin were reduced by 30% compared to wild - type animals . Similar features were observed in wild - type mice that received fetal liver hematopoietic stem cells (hscs) from oc / oc mice confirming the relevance of osteoclast function in osteocalcin - insulin signaling . Moreover they observed that oc / oc mice were glucose intolerant, with reduced serum insulin levels, pancreas insulin content, and insulinexpression in the pancreas [40, 41]. Interestingly, it was shown that osteopetrotic patients affected by autosomal dominant osteopetrosis with osteoclast acidification defects have lower levels of insulin and a lower undercarboxylated / carboxylated osteocalcin ratio but diabetes was not reported [40, 41]. Osteocalcin is very important for the cross talk between bone and the systems responsible for male fertility [42, 43]. Karsenty's group showed that osteocalcin is able to stimulate, in a camp response element binding (creb) protein - dependent manner, the production of testosterone by testes . This function is mediated by the interaction of osteocalcin with gprc6a, a g - coupled receptor expressed in leydig cells [42, 43]. In 1997 cohen et al . Showed that op / op mice (which lack colony stimulating factor 1, csf-1) have reduced mating ability, low sperm numbers, and low serum testosterone levels due to decreased leydig cell steroidogenesis . The study also showed how csf-1 is essential for the development and function of the hypothalamic - pituitary - gonadal axis . Further studies in osteopetrotic animal models will be important to confirm the interaction between bone and male fertility . It now well established that there is a tight correlation between bone and the immune system, which has led to a new discipline called osteoimmunology . This research area is just now expanding and we are beginning to better understand the relevance of this interplay in bone diseases . Associated defects in b cell function were attributed to mutations in genes involved in osteoclast differentiation or function or to an abnormal medullary microenvironment . Oc / oc mice display a block at the pro - b to pre - b cell transition, which is due to a defect of the bone microenvironment rather than to a cell autonomous defect of b cells, because in vitro experiments showed that b cell progenitors isolated from osteopetrotic mice were able to differentiate into immature b cells apart the alterations of b cell differentiation, kong and coauthors described a reduction in thymus size and a block of thymocyte development at the cd4cd8cd44cd25 stage . Many studies have been published regarding the effects on osteoclast differentiation and function following alterations of immune cells . In particular, it was shown that animal overexpressing the transcription factor foxp3 (forkhead box p3) displayed osteopetrotic phenotype with increased bone mass and reduced osteoclast number and activity . Moreover in vitro experiments suggested that treg cells could inhibit osteoclast differentiation and function by suppression of cytoskeletal reorganization . Bone and bone marrow can be considered as two distinct compartments of the same functional unit, the bone - bone marrow organ . Indeed it was shown that dysfunction of osteoclast activity results in aberrant formation of the hsc niche, leading to retention of hsc in the spleen . The frequency and absolute number of linnegsca1ckit (lsk cells) were decreased by 90% and 99.8%, respectively, in the bone marrow of oc / oc mice compared to controls . This alteration was associated with a defect of mesenchymal stem cells to differentiate into osteoblasts . The effect was revealed by a dramatic reduction in the expression of the osteoblast markers runx2, alp, osteocalcin and bsp and a reduced proportion of cells expressing cd51 and the integrin 5 (cd49e). The study showed that osteoclasts promote the formation of the hsc niche, regulating the osteoblast differentiation important for the niche . Indeed the authors showed that the absence of osteoclast activity affects formation of the bone marrow hsc niche and impairs ability of mesenchymal stem / stromal cells to recruit hematopoietic progenitor cells . Moreover the restoration of osteoclast function by treatment with cd45sca1 cells reestablishes normal levels of hematopoietic progenitors in the bone marrow [46, 53]. The relationship between bone and adipose tissue is an area of intensive investigations because molecules involved in bone - fat interactions could be used as pharmacological targets to prevent osteoporosis and bone fractures . In particular, ligands for ppar- include long - chain fatty acid and synthetic compounds such as thiazolidinedione . Ppar- functions are associated with activation of the adipogenesis and inhibition of the osteoblastogenesis [56, 57]. These mice developed increased bone mass with a parallel reduction of bone marrow cavities and extramedullary hematopoiesis . Indeed deletion of ppar- resulted in impaired osteoclast differentiation and activity, since it regulates c - fos expression involved in rankl signaling . Demonstrated that the absence of ppar- in white adipose tissue led to lipodystrophy, increased bone mineral density, and extramedullary hematopoiesis in spleen . This interplay between bone and adipose tissue has clinical important implications, since a long - term treatment with the ppar- agonist rosiglitazone in patients affected by type 2 diabetes could result in osteoporosis and bone fractures [54, 58]. Rare hereditary diseases inducing a bone condensation have shed new light on several aspects of bone cellular biology that were not well known . Indeed the study of these diseases allowed the identification of new mechanisms of osteoclast differentiation and function and the discovery of new functions associated with the skeleton . Much evidence suggests that the skeleton has a central role in bone physiology since bone disorders usually impact other organs [8, 9, 42, 43, 45, 53, 54, 60]. However, there are some features of these diseases that require further investigation . For example, as in other monogenic diseases, the genotype - phenotype correlation is not always clear and consistent . Indeed, the same mutations can give rise to different phenotypes, as exemplified by the clcn7 gene heterozygous mutations . Efforts to identify the mutations responsible for the remaining 30% are on - going . From a pathophysiological point of view, it is worth noting that the pathologies caused by reduced osteoclastic activity such as osteopetrosis lead to frequent fractures . This might be linked to a skeleton elasticity defect, but also to an inability to repair micro damage in bones because of a lower rate of bone turnover . This situation illustrates the well - known discrepancy between the bone quantity and its resistance to mechanical stress . In contrast, pathologies caused by an increase in bone formation due to increased activity of the wnt signaling pathway (striated osteopathy) or to tgf activating mutations (camurati engelmann disease) are not associated with an increased incidence of fractures . In conclusion, further study of osteopetrosis will allow us to better understand the physiology of bone and its impact on the whole body . Moreover our challenge for the future will be to identify new therapeutic approaches for this disabling disease, particularly for those forms for which only palliative intervention is currently available.
Ocular trauma is a worldwide cause of visual morbidity, a significant proportion of which occurs in the workplace and includes a spectrum of simple ocular surface foreign bodies (fbs)/minute corneal abrasions to devastating perforating injuries causing blindness . The significance of the problem is compounded by the fact that most of these injuries are preventable, thus making it a social and medical concern . To study: (1) the profile of ocular trauma at a hospital caters exclusively to factory employees and their relatives, particularly in garments and grinding factories . (2) to correlate the demographic and clinical profile and to identify the risk factors . Patients of all ages and both genders with various levels of ocular injuries were included while severe local and systemic conditions which would alter the outcome of vision like infection, anemia, head injury, immune compromised status, with preexisting diseases like glaucoma, operated eyes (injury to previously operated eyes), proliferative vitreoretinopathy of diabetes mellitus, hypertension, eales and so on were excluded . To study: (1) the profile of ocular trauma at a hospital caters exclusively to factory employees and their relatives, particularly in garments and grinding factories . (2) to correlate the demographic and clinical profile and to identify the risk factors . Patients of all ages and both genders with various levels of ocular injuries were included while severe local and systemic conditions which would alter the outcome of vision like infection, anemia, head injury, immune compromised status, with preexisting diseases like glaucoma, operated eyes (injury to previously operated eyes), proliferative vitreoretinopathy of diabetes mellitus, hypertension, eales and so on were excluded . A total of 306 patients with ocular trauma, presented at eye outpatient department and emergency services in the esic model hospital, rajajinagar, bangalore, from june 2010 to may 2011 were included . Institutional ethical committee approval was obtained . A special protocol designed to note demographic data, nature and cause of injury, time interval between the time of injury, and presentation along with any treatment received were recorded . Ocular evaluation including visual acuity, anterior and posterior segment findings (lid or facial injury, subconjunctival hemorrhage or laceration, presence or absence of corneal / scleral perforation, hyphaema, iris injuries and afferent pupillary defect, presence or absence of vitreous hemorrhage, retinal detachment or foreign body, endophthalmitis, retinal breaks, choroidal rupture, and/or macular hole), intraocular pressure and gonioscopy in closed globe injuries were done . Results of x - rays for intraocular foreign body, b - scan and computed tomography scan if done were noted . Data analyzed and classified as per the ocular trauma classification group described by pieramici et al . The rehabilitation undertaken in the form of spectacles, contact lenses and/or intraocular surgeries was analyzed . At follow - up, the final best corrected visual acuity noted . The results showed 72.2% of ocular trauma occurred in the age category of 21 - 40 years and 230 (75%) cases in men versus 76 (25%) were women [table 1]. Age and gender distribution in ocular trauma the analysis of place of injury showed that, 155 (50.7%) were work place related while 55 (18%) were at home, 50 (16.3%) were road traffic accidents (rtas), 36 (11.8%) other accidental, 10 (3.3%) were due to assault as depicted in table 2 . Place of ocular trauma as per ocular trauma classification group, 94.4% were closed globe injuries, while 2.9% were open globe injuries, and 2.6% were chemical injuries . The spectrum of ocular injuries (few examples shown in figures 17) found in this study is shown in table 3 . Of the closed globe injuries, fall of fbs led this list occurring in 190 (62.1%) cases, followed by cataract in 34 (11.1%), lid and adnexal injuries in 27 (8.7%), corneal abrasions in 19 (6.2%), optic neuropathy in 7 (2.3%). Fall of fbs seen in 128 of 190 (67.4%) and corneal abrasions seen in 13 of 19 (68.4%) were due to employment injuries (eis), while traumatic optic neuropathy seen in six of seven (85.7%) occurred due to non - eisof nine open globe injuries, seven (77.8%) were due to rtaof chemical injuries, 6 (75%) occurred at work place and 2 (25%) in domestic place [table 3]. As per ocular trauma classification group, 94.4% were closed globe injuries, while 2.9% were open globe injuries, and 2.6% were chemical injuries . The spectrum of ocular injuries (few examples shown in figures 17) found in this study is shown in table 3 . Of the closed globe injuries, fall of fbs led this list occurring in 190 (62.1%) cases, followed by cataract in 34 (11.1%), lid and adnexal injuries in 27 (8.7%), corneal abrasions in 19 (6.2%), optic neuropathy in 7 (2.3%). Fall of fbs seen in 128 of 190 (67.4%) and corneal abrasions seen in 13 of 19 (68.4%) were due to employment injuries (eis), while traumatic optic neuropathy seen in six of seven (85.7%) occurred due to non - eis of nine open globe injuries, seven (77.8%) were due to rta of chemical injuries, 6 (75%) occurred at work place and 2 (25%) in domestic place [table 3]. Perforating foreign body (preoperative) post removal of perforating foreign body traumatic cataract with adherent leucoma (preoperative) post cataract extraction with intra ocular lens implantation (postoperative) chemical injury with epithelial defect at presentation chemical injury with healing epithelial defect on treatment spectrum of ocular trauma as per ocular trauma classification group the time interval between trauma and patient presentation the work place injuries presented within 3 days in 152 (98.1%) cases, while non - ei injuries presented beyond 3 days in 94 (62.2%). Time interval between ocular trauma and presentation at work place, 79 (50.9%) were wearing protective glasses at the time injury, 42 (27.1%) were not wearing, and 34 (21.9%) were not aware of protective glasses [table 5]. Ocular trauma and protective devices medical line of treatment was the main stay in 252 (82.4%), anterior segment surgeries like cataract surgeries, amniotic membrane transplantation (amt), lid and adnexal surgeries were done in 45 (14.5%), and posterior segment surgeries like pars plana vitrectomy, lens aspiration, rd surgeries, and so on were done in nine (2.9%) cases [table 6]. Management of ocular trauma cases final visual outcome from presentation to post treatment at available follow - up showed that 166 (54.2%) were in good vision (more than or equal to 6/12) in pretreatment phase, while it was 205 (66.9%) in post treatment phase and 62 (20.1%) cases who had poor vision (<6/60) in pretreatment phase were reduced to 34 (11%) with treatment as shown in table 7 . The common age for ocular trauma in this study was found to be 21 - 40 years (72.2%) and is similar to a prospective study by shukla and verma involving 400 patients who showed that the commonest age group of people involved was in the third decade . A study done in baluchistan by qureshi also showed similar age group involvement (21 - 30 years). Eye injuries remain a significant risk to worker health, especially among men in jobs requiring intensive manual labor . Many hospital- and population - based studies indicate a large preponderance (70 - 85%) of injuries affecting males . The present study having been done in a hospital catering exclusively to factory employees (manufacturing units like garments, grinding, and so on) and their families showed higher incidence of work place - related ocular trauma . Of 306 cases, 155 (50.6%) were work place - related in present study . Work place injury ranged from 31% to 39% as per other studies . Closed globe injuries were 54.7% from work place in our study which is comparable to karaman et al ., study in his retrospective analyses of 383 patients in general population found 67.3% closed globe . Rta cases reported with a delay due to involvement of other systems, while isolated ocular trauma cases at work place reported within 6 hours in 64 (41.3%). Ocular injuries are usually not given priority if it is accompanied with multiple system injuries . After identifying major organ injury and stabilizing the general condition of the patient, ocular injuries should be given preference to simple fractures, because visual loss can be a great morbidity if neglected for the patient once he recovers from the minor ailment . The present study showed that only 51% were wearing protective glasses, while 27% were not wearing though, they were provided with and 22% were not aware of protective glasses . Ocular injuries at work are preventable and are attributable to the misuse or nonuse of protective eyewear . Safety education has been highlighted by previous studies as they have reported worker noncompliance with personal protective equipment with up to half of workers not complying with health and safety regulations . To meet these requirements and to reduce accidents, many larger companies in the construction industry use the construction skills certificate scheme to improve education and certify awareness of these issues . Though, visual outcome did improve after medical and/or surgical management, still 11% were left with poor vision . The physical disability adds to the social, emotional, and psychological impact on the overall development of an individual . Employees need to be emphasized on work safety cultures, proper training, and use of protective equipments.clinicians should be referring the patients as early as possible for eye care after stabilizing general conditions or else it would be too late to restore the potential vision . Employees need to be emphasized on work safety cultures, proper training, and use of protective equipments . Clinicians should be referring the patients as early as possible for eye care after stabilizing general conditions or else it would be too late to restore the potential vision . Hence, we conclude that, targeting groups most at risk, increasing worker training, providing effective eye protection, and developing workplace safety cultures may together reduce occupational eye injuries.
Interference screws used for knee ligament reconstructive surgery are a popular application of bioabsorbable materials in orthopedics . They offer various advantages [1, 2] over traditional metallic implants, such as the ability to engineer them to provide an optimum degradation profile, a reduced need for implant removal, and less distortion on magnetic resonance imaging (mri). Polylactide carbonate (plc) is a combination of an amorphous bioabsorbable polymer, poly dl - lactide - coglycolide (pdlg), with calcium carbonate, a bone - stimulating material and neutralizing agent . Plc was used to develop the calaxo (smith & nephew, andover, ma, usa) interference screw for knee ligament reconstruction surgery . A 26-year - old man underwent arthroscopic reconstruction of his anterior cruciate ligament (acl), posterior cruciate ligament (pcl) and posterolateral corner following a multiple - ligament knee injury obtained while playing rugby . The patient had undergone a twisting knee injury during a tackle and was immediately diagnosed as having a severe knee injury and referred to the senior author (fsh). An mri scan performed within twenty - four hours of the injury confirmed a tear of the acl, pcl and posterolateral corner . For acl reconstruction, two semitendinosus allografts were used to fashion a four - strand 10 mm - thick graft which was fixed with an endoloop (smith & nephew) on the femoral side and a 9 mm by 25 mm plc (calaxo, smith & nephew) interference screw on the tibial side . For the pcl reconstruction, an achilles tendon allograft was fixed to the femoral side by a 9 mm by 25 mm plc (calaxo, smith & nephew) screw and to the tibial side by a 9 mm by 35 mm plla (rci, smith & nephew) screw . For the reconstruction of the posterolateral corner of the knee, two semitendinosus allografts were passed: one into an anterior - to - posterior through - and - through hole in the fibula, and the other through an anteroposterior tunnel in the tibia adjacent to the fibula . The tibial end of the graft was fixed with an 8 mm by 25 mm plc (calaxo, smith & nephew). The two free ends of the fibular allograft and one free end of the tibial allograft were then passed subfascially and fixed into a 9 mm tunnel drilled at an isometric point above the lateral epicondyle of the femur . The allograft was then fixed in the femoral tunnel using a 10 mm by 35 mm plc (calaxo, smith & nephew) screw . Meticulous care was taken to ensure that, when bone tunnels were adjacent, they were placed such that no compromise to bone strength would occur (see postoperative radiographs fig . 1). 1immediate postoperative plain radiographs with illustration of tunnel positions on the lateral femoral condyle illustrated on the ap view . The lateral tunnel is placed in a more anterior plane in relation to the acl tunnel immediate postoperative plain radiographs with illustration of tunnel positions on the lateral femoral condyle illustrated on the ap view . The lateral tunnel is placed in a more anterior plane in relation to the acl tunnel postoperatively the patient was mobilized nonweight - bearing for 2 months in a knee brace, and specialist physiotherapy was initiated for muscle strengthening and range of movements . The immediate postoperative recovery was unremarkable and the patient made satisfactory progress with regards to rehabilitation . Six months after the procedure, the patient presented with sudden onset of knee pain after minor trauma that involved slipping but not falling in a changing room . There was no preceding trauma . On a computed tomography scan (ct fig . 2), the femoral fixation screw [10 mm by 35 mm plc (calaxo, smith & nephew)] of the posterolateral corner allograft was found to be completely degraded, and a minimally displaced fracture was noted through the tunnel (fig . 3). Was not compromised, the patient was managed conservatively by immobilization in a brace for six weeks . The recovery was satisfactory, with a return to premorbid function by approximately 14 months after surgery (see weight - bearing radiographs fig ., the patient continues to have very good functional results, with bilaterally equal range of movements in the knee . Clinical examination using lachman s test, the drawer test and the collateral stress test have confirmed a stable knee joint.fig . 4plain radiographs taken at 14 months suggest a healed fracture ct image of the fracture in the femoral tunnel . Please note the empty tunnels on the rotation views plain radiographs taken at 14 months suggest a healed fracture for acl reconstruction, two semitendinosus allografts were used to fashion a four - strand 10 mm - thick graft which was fixed with an endoloop (smith & nephew) on the femoral side and a 9 mm by 25 mm plc (calaxo, smith & nephew) interference screw on the tibial side . For the pcl reconstruction, an achilles tendon allograft was fixed to the femoral side by a 9 mm by 25 mm plc (calaxo, smith & nephew) screw and to the tibial side by a 9 mm by 35 mm plla (rci, smith & nephew) screw . For the reconstruction of the posterolateral corner of the knee, two semitendinosus allografts were passed: one into an anterior - to - posterior through - and - through hole in the fibula, and the other through an anteroposterior tunnel in the tibia adjacent to the fibula . The tibial end of the graft was fixed with an 8 mm by 25 mm plc (calaxo, smith & nephew). The two free ends of the fibular allograft and one free end of the tibial allograft were then passed subfascially and fixed into a 9 mm tunnel drilled at an isometric point above the lateral epicondyle of the femur . The allograft was then fixed in the femoral tunnel using a 10 mm by 35 mm plc (calaxo, smith & nephew) screw . Meticulous care was taken to ensure that, when bone tunnels were adjacent, they were placed such that no compromise to bone strength would occur (see postoperative radiographs fig . 1). 1immediate postoperative plain radiographs with illustration of tunnel positions on the lateral femoral condyle illustrated on the ap view . The lateral tunnel is placed in a more anterior plane in relation to the acl tunnel immediate postoperative plain radiographs with illustration of tunnel positions on the lateral femoral condyle illustrated on the ap view . The lateral tunnel is placed in a more anterior plane in relation to the acl tunnel postoperatively the patient was mobilized nonweight - bearing for 2 months in a knee brace, and specialist physiotherapy was initiated for muscle strengthening and range of movements . The immediate postoperative recovery was unremarkable and the patient made satisfactory progress with regards to rehabilitation . Six months after the procedure, the patient presented with sudden onset of knee pain after minor trauma that involved slipping but not falling in a changing room . There was no preceding trauma . On a computed tomography scan (ct fig . 2), the femoral fixation screw [10 mm by 35 mm plc (calaxo, smith & nephew)] of the posterolateral corner allograft was found to be completely degraded, and a minimally displaced fracture was noted through the tunnel (fig . 3). Was not compromised, the patient was managed conservatively by immobilization in a brace for six weeks . The recovery was satisfactory, with a return to premorbid function by approximately 14 months after surgery (see weight - bearing radiographs fig ., the patient continues to have very good functional results, with bilaterally equal range of movements in the knee . Clinical examination using lachman s test, the drawer test and the collateral stress test have confirmed a stable knee joint.fig . 4plain radiographs taken at 14 months suggest a healed fracture ct image of the fracture in the femoral tunnel . Please note the empty tunnels on the rotation views plain radiographs taken at 14 months suggest a healed fracture the main disadvantages associated with the use of bioabsorbable implants are their comparatively low mechanical strength, their relatively high cost, and the undesirable biological response they may produce . The persistence of bioabsorbable screws for up to 3 years after their insertion is well documented in mri studies after knee ligament reconstruction surgery [46]. In ovine models, the plc screws have shown gradual and controlled degradation, stimulating ossification of the graft within the bone tunnel . New bone thus formed was noted around the margin of the screw as early as 612 weeks . This was followed by partial integration of the screw with bone by 26 weeks and complete replacement with new bone at 52 weeks . Computed tomography data followed this pattern, with extensive integration of the screw to bone by 26 weeks and disappearance of the screw by 52 weeks . An interference screw that would replenish the bone tunnel would be an ideal choice for knee ligament reconstruction surgery . However, clinical studies looking at the outcome of plc screws are lacking . There are few reports of femoral fractures at the sites of graft fixation associated with acl reconstruction (table 1). Noah et al . In 1992 and radler et al . In 2000 reported an extracondylar femur fracture at the site of extra - articular augmentation of acl reconstruction . In the former case, the fracture occurred 6 months after an iliotibial band augmentation of a patellar tendon graft acl reconstruction, whereas the latter case followed 20 months after the removal of a lateral augmentation device used in an acl reinsertion.table 1femur fractureauthorprocedurefixationtime from procedurenoah et al . Patellar tendon acl reconstruction and itb extra - articular tenodesisinterference screw6 monthsternes et al . Gore - tex graft acl revisionn / a8 weekswiener and siliski patellar tendon acl revision7 monthsmanktelow et al . Hamstring tendon acl reconstruction with extra - articular tenodesis24 months fracture from staple of extra - articular augmentation to intraosseous tunnelberg et al . Patellar tendon acl reconstruction7 25 metal interference screw for a 10 mm tunnel5 months . Size9 months, fallsheps et al . Quadrupled st - g autograft acl reconstructionendoloop button5 months, head injury,? The fracture extended from the staple of the extra - articular augmentation to the intraosseous tunnel, 24 months after a hamstring autograft acl reconstruction with extra - articular tenodesis . In a case reported by ternes et al . In 1993, the femoral tunnel used for the placement of a gore - tex prosthetic graft was the site of the fracture, which occurred 8 weeks following the procedure . Multiple anterolateral femoral cortex perforations were reported as the etiology for the fracture reported 7 months following a patellar tendon acl reconstruction by weiner et al . In 1996, and 5 months following quadrupled hamstring graft acl reconstruction by sheps et al . In 2006 . Berg et al . In 1999 reported a fracture through the femoral tunnel 8 weeks after a bone patellar tendon bone acl reconstruction . At the time of the operation, the femoral tunnel had been over - drilled and the femoral tunnel was itself noted to be the stress riser, precipitating a fracture 5 months following patellar tendon acl reconstruction by mithoefer et al . In 2005, and 9 months following a similar procedure by wilson et al . In the same year . Cases of tibial plateau fracture through the distal fixation site of the acl grafts have also been reported [1621] (table 2). In the case reported by thaunat et al . In 2006, a 9 mm bioabsorbable screw (polyglycolide - co - trimethylenecarbonate, endofix, mansfield, ma, usa) was used to fix the tibial end of a bone patellar tendon bone acl reconstruction . Four years later the patient presented with tibial plateau fracture following a valgus compression trauma to his knee . Imaging demonstrated screw resorption and tunnel enlargement.table 2tibial plateau fractureauthorprocedurefixationtimeel - hage et al . Achilles tendon acl reconstructionrichards interference screw18 months post - traumamorgan and steensen acl reconstructiondelcogliano et al . Patellar tendon acl reconstruction10 mm tibial tunnel and 9 25 interference screws7 monthsmithofer et al . Acl reconstruction8 mm tunnel fixed with 9 25 rci screws12 months, fallthaunat et al . Acl reconstruction11 mm tunnel, 9 mm pga - co - tmc screw4 years, valgus compression injury after fall tibial plateau fracture biomechanical studies have shown that a bone defect such as a screw hole can concentrate stress and decrease the bone strength to torsional loading [2224]. This may explain the fractures noted in the osseous tunnels following knee ligament reconstruction surgery . Both mechanical and biological factors have been recognized to contribute to tunnel enlargement after acl reconstruction . Mechanical factors include motion of the graft within the tunnel, fixation methods / devices, stress shielding of the graft, improper graft placement, and accelerated rehabilitation . Graft swelling, the use of allograft tissue, synovial fluid propagation within bony tunnels, and increased cytokine levels within the knee are all biologic modes of osteolysis contributing to tunnel enlargement . In most cases unpredictable bioabsorbable screw resorption results in graft in empty tunnel and perhaps synovial reaction and cytokines, all contributing to persistent tunnel enlargement and bone weakening . In our case, rapid degradation of the plc screws in the osseous tunnel in the absence of any attempted bone integration may have predisposed to the fracture by a similar mechanism . Ongoing clinical concerns with the unpredictable absorption of the plc screws (calaxo, smith & nephew) lead to their withdrawal from the market in 2007 . It is crucial to be aware of adverse effects where this particular interference screw has been used . In conclusion, stress risers may occur following the use of bioabsorbable screws for ligament reconstruction surgery, particularly if screw resorption is rapid and bone integration is not complete . Femoral fracture presenting as a late complication following the use of bioabsorbable interference screws in knee ligament reconstruction surgery is rare . It is important to be aware of this potential postoperative complication when considering which form of screw fixation to use.
It is widely believed that the rate of mortality associated with anesthesia is steadily decreasing, and that anesthesia today is very safe indeed . However, this assertion has been questioned by lagasse, who argues that the definitions of anesthetic mortality used in different studies over the years have not been consistent . Perhaps the best data on anesthesia mortality come from australia, where the state - based anesthetic mortality review committees have followed a relatively consistent approach with clear definitions (table 1) for 20 years . Case mix clearly makes a substantial difference to the risk of anesthesia, but the sequential triennial reports of these committees do suggest that anesthesia has become safer over time and that the risk of death definitely and entirely attributable to anesthesia today is close to 1 in 200,000 in patients who are essentially healthy and undergoing minor or moderate surgical procedures . It is disappointing, however, that even these data relate primarily to deaths within either 24 or 48 hours of anesthesia, whereas most people would probably be more interested in knowing their chances of actually going home from hospital and surviving for a reasonable period thereafter (30 days post - surgery, for example). There is very little information on this, although at least one european study suggests that these risks may be much higher than generally appreciated . This european study also confirms earlier evidence suggesting that anesthesia makes an important contribution to outcome after surgery . Fundamental to any discussion of the safety of anesthesia is the matter of when mortality should be attributed to anesthesia . The australian mortality committees have provided definitions by which perioperative deaths can be attributed to one of eight categories, three of which relate to anesthesia (table 1). The critical words are: caused by the anesthesia or other factors under the control of the anesthetist . It is these other factors that have largely been overlooked in efforts to estimate the true incidence of mortality (let alone morbidity) attributable to anesthesia . Perioperative myocardial ischemia is a case in point: clearly it may be attributable or amenable to factors under the control of the anesthetist; its consequences often manifest several days postoperatively so are easily overlooked, particularly in studies that focus on the first 24 or 48 hours after surgery; and it may contribute to death, although often only some time later . In a study by the study of perioperative ischemia research group, patients surviving a postoperative in - hospital myocardial infarction had a 28-fold increase in the rate of subsequent cardiac complications within 6 months following surgery, a 15-fold increase within 1 year, and a 14-fold increase within 2 years . Are these extra deaths attributable to anesthesia? We would argue that they are . In the perioperative ischemic evaluation (poise) study, a multicentre prospective blinded controlled trial involving 8,351 patients, the incidence of perioperative myocardial infarction in patients randomized to receive metoprolol was 4.2% compared with 5.7% in those receiving placebo (confirming the value of beta - blockers in protecting the heart), but the overall mortality was 3.1% and 2.3%, respectively . In other words, the perioperative use of beta - adrenergic blocking drugs, a factor very much under the control of anesthetists, was associated with an excess mortality rate of 0.8% . The wider question of how and when to use beta - blockers during anesthesia, and of the other factors relevant to optimal management, is of course complex, which is exactly why anesthetists are rebranding themselves as experts in perioperative medicine . However, one cannot have it both ways: the fact that the overall management of patients perioperatively can make a substantial difference to outcome is strong endorsement of the argument for a central role for well - resourced medically qualified practitioners in the provision of anesthesia, but it also makes a nonsense out of blanket claims that the risk of dying from an anesthetic is very low . There are many parts of the world in which anesthesia mortality rates are many multiples of those in high income countries such as the usa, europe, and australia [11 - 13]. Clearly, many advances that have been made in the safety of anesthesia have not been realized everywhere . Even worse, many patients do not receive desperately needed surgical and anesthetic services at all . The number of surgical operations undertaken around the world every year has only recently been estimated, and, at about 234 million, actually exceeds the number of births . Unfortunately, these operations are very unevenly distributed, with only 3.5% being undertaken amongst those 34.8% of the global population who live in countries spending $100 or less per person on healthcare . It seems that about 11% of the global burden of disease measured in disability - adjusted life years arises from conditions amenable to surgery, so access to appropriate surgery is clearly essential, and obviously depends on equal access to safe anesthesia . Even in high income countries there is substantial variance in access to services: more disturbingly, there is astonishing variance in practices over and above the variance attributable to resource differences . Furthermore, there is ongoing evidence that even those patients who actually do receive appropriate healthcare (including surgery and anesthesia) are at unacceptable risk of harm from avoidable errors [17 - 20]. The safe surgery saves lives initiative of the world health organization has developed a surgical safety checklist to address some of these errors through a cost - effective tool applicable to surgery and anesthesia everywhere . In a study undertaken in eight pilot sites around the world, introduction of this checklist significantly and substantially reduced harm associated with surgery . The pilot study was not a randomized controlled trial, but it was prospective and large (data from almost 4,000 patients collected at baseline were compared with data from a similar number after the introduction of the checklist). It will not eliminate errors, but it is highly likely to reduce them and, through enhanced teamwork, to improve outcomes more generally . There is now a considerable onus on senior clinicians to promote the use of the checklist in a meaningful manner involving the engaged participation of all members of the operative team . There is also considerable onus on the organizations associated with anesthesia to continue to support initiatives to improve the training and resources available for anesthesia in resource - limited regions of the world . The world federation of societies of anaesthesiologists has provided strong leadership in this regard and in recent years the support for anesthesia from the world health organization has increased considerably . As with so many things, the sophistication and accuracy of the way in which we measure outcome has increased in parallel with other advances in anesthesia . This has the effect of highlighting risks of anesthesia that, in previous years, may not have been appreciated at all . So is anesthesia becoming safer? Certainly - and this is self evident to anyone who has practiced for more than three decades . Certainly not, especially in higher - risk patients, and in low - income regions of the world . We are making commendable progress, but there is a long way to go to achieve the goal that no patient shall be harmed by anaesthesia . The authors have financial interests in safer sleep llc, which produces a system to promote safety in anesthesia.
Severe sepsis is characterized by acute release of systemic inflammatory (systemic inflammatory response syndrome [sirs]) and anti - inflammatory mediators (compensatory anti - inflammatory response syndrome [cars]) caused by infection [1, 2]. The cytokines associated with sirs include interleukin- (il-) 1, il-6, il-12, il-17, and tumor necrosis factor- (tnf-). The cytokines associated with cars include il-4, il-10, and transforming growth factor- (tgf-) 1 . This immune imbalance results in multiorgan dysfunctions and eventually death in patients with severe sepsis . Dexamethasone inhibited lipopolysaccharides- (lps-) stimulated release of tnf-, il-6, il-8, and il-10 from whole blood of septic patients . Similarly, hydrocortisone decreased il-1 and il-6 production from ex vivo lps - stimulated whole blood of septic shock patients . Steroid might affect cytokine production from circulatory immune cells of septic patients . According to the surviving sepsis campaign (ssc) guidelines for the management of severe sepsis and septic shock (2008 and 2012), patients with septic shock can be prescribed low - dose steroids if adequate fluid resuscitation and vasopressor therapy are unable to restore hemodynamic stability [6, 7]. Septic shock patients treated with low - dose steroids could reverse shock at an early stage, but final mortality rate was similar to those without low - dose steroids . The adjusted hospital mortality rate was significantly higher (odds ratio = 1.18, p <0.001) in patients who received low - dose steroids compared with those who did not . However, a multicenter observation study found that steroid use was associated with low mortality rates in patients with severe sepsis . Thus, the use of low - dose steroids in patients with severe sepsis is still controversial . Serial increase in monocyte human leukocyte antigen - dr (hla - dr) expression and il-12 response in stimulated peripheral blood mononuclear cells (pbmcs) are associated with higher survival rate in patients with severe sepsis . Thus, we analyzed our study database to explore the relationship of low - dose steroid treatment with hla - dr expression and cytokine responses in patients with severe sepsis by repeated detections . This study is a post hoc analysis using our previously published study database . From july 2008 to june 2009, 35 patients who were admitted to a 20-bed intensive care unit (icu) in a regional teaching referral hospital for severe sepsis were enrolled in this study . Six nonsurvivors died within 7 days and they all received low - dose steroid therapy . The data of these six patients was excluded because of lack of repeated cytokine response results for analysis . The sirs was defined as two or more of the following criteria: (1) body temperature> 38c or <36c; (2) respiratory rate> 20 breaths / min; (3) heart rate> 90 beats / min; and (4) white blood count> 12000/l or <4000/l or> 10% bands . Sepsis was defined as sirs according to a confirmed infectious etiology . For validating experimental findings, 22 men and 8 women visiting our health evaluation center for examinations were enrolled as healthy controls with mean age of 60.8 1.9 years old . Severe sepsis was defined according to the consensus criteria of sepsis with one or more organ dysfunctions such as shock, respiratory failure, acute renal failure, jaundice, and thrombocytopenia [14, 15]. Septic shock was defined as sepsis - induced hypotension unresponsive to fluid resuscitation within 24 hr after admission to icu . Acute renal failure was defined as a rapid increase in creatinine levels (> 0.5 mg / dl). Jaundice was defined as hyperbilirubinemia (total bilirubin> 2 mg / dl), whereas thrombocytopenia was defined as a platelet count of <150,000/l . Disease severity was assessed by the acute physiology and chronic health evaluation (apache) ii score . Standard treatment according to guidelines was provided to all patients [6, 8]. A course of low - dose steroid therapy could be prescribed in septic shock patient with 7 days of intravenous hydrocortisone 50 mg every 6 hours if shock developed within 24 hr after admission to icu . The institutional review board at chang gung memorial hospital approved our previous study (96 - 1465b) and the patients' close family members provided informed consent . Patients who survived longer than 28 days after icu admission were defined as survivors . Whole blood (10 ml) was obtained from each patient at 08:30 a.m., within 48 h of admission to icu, and immediately mixed with heparin . Pbmcs were isolated via differential centrifugation over ficoll - plaque (amersham biosciences, uppsala, sweden) from 8 ml of residual whole blood within 2 h of collection . 2.5 10 of pbmcs were suspended in 50 l of phosphate - buffered saline (pbs) and incubated in the dark for 15 min at room temperature with 20 l of hla - drpercp, cd11bpe, and cd14fitc antibodies (becton dickinson, ca, usa). The monocytes were detected by a three - color flow cytofluorimeter (beckman coulter, ca, usa) with positive controls for cd11bpe and cd14fitc . Monocyte hla - dr measurements were expressed as percentages of hla - dr - positive monocytes and as means of fluorescence intensities (mfi) in relation to the entire monocyte population, thus reflecting the hla - dr density per cell . Flow cytometry analysis was performed using kaluza software v1.1 (beckman coulter, ca, usa). The figure of analysis strategy for monocyte hla - dr expression was presented in our previously published paper . 5 10 pbmcs were plated in two wells of a flat - bottomed 24-well plate (nunclon, aarhus, denmark) in 1 ml of sterile rpmi 1640 tissue culture medium containing 5% heat - inactivated bovine serum, 1 mm of l - glutamine (gibco, grand island, usa), and 1 mm sodium pyruvate . The cells in second well were stimulated with 1 pg/l of lps (sigma, missouri, usa). The plate was incubated at 37c in 5% carbon dioxide for 24 h. supernatants of the culture wells were sampled and stored at 80c until use . Cytokine levels of supernatants were measured with a human enzyme - linked immunosorbent assay (elisa) kit, according to the manufacturer's instructions . The elisa kit of il-10 was manufactured by pierce biotechnology, illinois, usa . The il-6, tgf-1, and il-17 were purchased from r&d systems, inc ., the il-12, tnf-, and il-1 were purchased from becton dickinson, ca, usa . Cytokine responses were defined as the difference in supernatant levels with and without lps stimulation . Changes in cytokine responses were defined as the difference in cytokine response on day 7 minus the cytokine response on day 1 . Statistical analysis was performed using the statistical package for the social sciences (spss) software v17.0 for windows (spss inc ., differences in continuous variables between two groups were analyzed using the mann - whitney test, whereas differences in categorical variables were analyzed using the chi - square test or fisher's exact test . Differences in continuous variables in the same subjects were analyzed using the wilcoxon signed - rank test . Generalized linear model analysis was used to determine the association between clinical characteristics and cytokine response . Of the final 29 enrolled subjects with severe sepsis, 18 patients were prescribed low - dose steroids and 11 were not (table 1). In the low - dose steroid group, 12 patients survived for 28 days and six died (table 2). The apache ii score in low - dose steroid group was higher than no - steroid group, although the statistical analysis did not show difference . There were no significant differences in age, gender, histories, infection sources, and initial appropriateness of antibiotics between groups with and without low - dose steroid therapy . Patients administered low - dose steroid therapy displayed higher percentages of septic shock (94% versus 36%), compared with no low - dose steroid group . The rates of gastrointestinal bleeding, acute renal failure, thrombocytopenia, jaundice, bacteremia, and mortality were similar between the two groups . Tnf- response in the control group was significantly higher than in both patient groups (table 3). However, il-1 response in the control group was significantly lower than in both patient groups . Il-12 and tnf- responses on days 1 and 7 in steroid group were significantly lower than in no - steroid group . There were no differences in il-1, il-6, il-10, il-17, and tgf-1 responses on days 1 and 7 between the two patient groups . Il-1 and tgf-1 responses in patients administered low - dose steroid therapy decreased from day 7 to day 1 (table 3). Compared to day 1, there were no changes in il-6, il-10, il-12, il-17, and tnf- responses on day 7 in patients who received low - dose steroid therapy . Il-12 response in patients without low - dose steroid treatment significantly increased from day 7 to day 1 (figure 1). Similarly, there were no changes in il-1, il-6, il-10, il-17, tgf-1, and tnf- production in patients treated without low - dose steroid therapy from day 7 to day 1 . In survivors with severe sepsis, there were no changes in il-1, il-10, il-17, tgf-1, and tnf- production from day 7 to day 1 in survivors . All cytokine responses detected did not change from day 7 to day 1 in nonsurvivors (table 4). Table 5 shows regression analysis results demonstrating the relationship between changes in il-1 levels and low - dose steroid therapy and other clinical characteristics . Apache ii score levels were independently and positively associated with changes in il-1 response (b = 3.110). Patients who were severely ill produced more il-1 in pbmcs after 6 days compared with those who had milder illness . However, low - dose steroid therapy was not independently associated with the change in il-1 levels . Low - dose steroid therapy did not influence il-1 production in pbmcs of severe septic patients . Low - dose steroid therapy was also independently and negatively linked to the increase in il-12 after regression analysis (b = 750.743; table 6). Il-12 recovery from day 7 to day 1 was lower in patients with low - dose steroid therapy . The presence of septic shock did not independently correlate with the change in il-12 levels . Il-12 recovery from day 7 to day 1 was high in male patients (b = 447.838). Although tgf-1 response in patients receiving low - dose steroidtherapy decreased from day 7 to day 1, the regression analysis did not find independent factors associated with the change in tgf-1 levels (table 7). There was no difference in monocyte percentage, positive hla - dr percentage in monocytes, and mfi of hla - dr between patients treated with or without low - dose steroids on day 1 or 7 (figure 2). In addition, there was no change in monocyte percentage, positive hla - dr percentage in monocytes, and mfi of hla - dr in patients treated with or without low - dose steroids from day 7 to day 1 . Previous studies often used in vitro cultures to test the effectiveness of different doses of steroids or repeatedly measured plasma levels between the patients receiving or not receiving steroids at specific times . These studies have a common fault; they indirectly detect the function or response of immune cells after a course of low - dose steroid therapy . Since circulating cytokines can be produced by immune and nonimmune cells, such as smooth muscle cells and endothelial cells, circulating cytokine levels only reflect a relatively broad response . In this study, we demonstrated that a complete course therapy with low - dose steroid was associated with decreased il-12 production in pbmcs from patients with severe sepsis . In contrast to our results, a 6-day crossover study with serial detecting plasma cytokine levels in patients with septic shock reported that the inhibitory effect of hydrocortisone infusion did not decrease plasma il-12 level . The first possible reason for this result is that only 3 days of hydrocortisone infusion was administered to each group; therefore, the effect of low - dose steroid did not have a chance to develop . Second, ficoll density gradient centrifugation for monocytes isolation resulted in lower cell function than by positive selection by magnetic microbeads . The function of il-12 production from pbmcs in this study might be influenced by ficoll solution . Other reasons may be that there is increased il-12 production in dendritic or human b - lymphoblastoid cells, resulting in similar amounts of circulating il-12 . In this study, we did not find an association between il-6 response and low - dose steroid therapy . They found that il-6 production in lps - stimulated diluted whole blood transiently fell from day 1 to 3 and returned after day 5 in a low - dose hydrocortisone therapy group . In terms of circulating cytokine levels, there were no significant differences in plasma il-6 levels between treatment groups of continuous 6 h infusion of endotoxin + hydrocortisone or endotoxin + saline in an animal study . Furthermore, a double - blind, randomized, placebo - controlled study showed similar results . Two doses of hydrocortisone (100 mg per 8 h) were administered after bilateral total knee replacement in the study group . Il-6 levels were 40% lower in the study group after 10 h but returned to levels similar to that of the control group at 24 h. however, other studies have reported different results . Stress dose of hydrocortisone infusion in patients with septic shock significantly decreased plasma il-6 levels on day 5 between the steroid and placebo groups . Hydrocortisone infusion reduced plasma il-6 levels in a 6-day crossover study in patients with septic shock . Generally, low - dose steroid therapy may influence plasma il-6 levels but not il-6 response in pbmcs, based on current evidence . Il-10 production in stimulated pbmcs did not differ between patients receiving or not receiving low - dose steroid therapy on day 1 or 7 . Even after 6 days of therapy, il-10 response did not change in the low - dose steroid group . Moreover, dexamethasone inhibited lps - stimulated release of il-10 from diluted whole blood of septic patients in a dose - dependent manner . After in vivo administration of high or low amounts of cortisol, high cortisol therapy further increased lps - induced il-10 expression in isolated monocytes from healthy participants, whereas low cortisol therapy decreased il-10 expression . More studies are needed to determine the role of low - dose steroid therapy on il-10 production in patients with severe sepsis . Endogenous cortisol is one of the main anti - inflammatory mediators induced by our central nervous system during severe sepsis . It has been described that steroids have downregulating effects on monocyte hla - dr expression [2527]. High endogenous cortisol levels observed in septic shock patients may play a role in the loss of monocyte hla - dr expression via its effect on hla - dr transcription . However, monocyte hla - dr expression seems not to be influenced by low - dose steroid therapy . In this study, there was no change in monocyte percentage, positive hla - dr percentage in monocytes, and mfi of hla - dr in patients with low - dose steroid therapy from day 1 to 7 . Cortisol can influence the immune system and is crucial for the host for defense against pathogens . Cytokines mediate a high glucocorticosteroid output with regulation from the neuroendocrine to the immune - endocrine system . As a result, high levels of adrenal glucocorticosteroid are vital in preventing an uncontrolled inflammatory response to cytokines . The main immunological function of il-12 is to enhance native t lymphocyte differentiation to type 1 help t (th1) cells . Th1 cells secrete interferon- that regulates macrophage and natural killer (nk) cell activation, stimulates immunoglobulin secretion by b cells, and enhances th1 cell differentiation . In this work, this might explain why low - dose therapy was associated with an increase in adjusted hospital mortality in ssc database . Decreased il-12 response in patients receiving low - dose steroid therapy may depress a protective effect by decreased cellular immunity and phagocytic functions . First, the percentage of septic shock was different between steroid and no - steroid groups . The reason why steroid group had higher percentage of shock is that patients with septic shock are appropriate for steroid treatment according to guidelines . In septic shock group, not in no - shock group, patients with low - dose steroid had significantly lower change of il-12 response than those without low - dose steroid . Although generalized linear model analysis was used to exclude the confounding effect of shock, there was not a directly statistical analysis to demonstrate low - dose steroid affected il-12 response recovery in patients without septic shock . Second, patients with low - dose steroid treatment have received steroid when their blood was drawn on day 1 . Although the time from onset of steroid treatment to blood sampling was short and not more than 48 hr, cytokine responses and hla - dr expression might be influenced . Il-12 response observed in pbmcs increased from day 7 to day 1 in severe septic patients . We demonstrated that a course of low - dose steroid therapy influenced il-12 production from in vitro lps - stimulated pbmcs of severe septic patients . There was no correlation between low - dose steroid therapy and monocyte hla - dr expression.
Total body irradiation (tbi) for patients with acute lymphatic leukemia (all) is a vital technique used prior to bone marrow transplant . Tbi is used in the treatment of all to obliterate the malignant cells and in the mean time to support the immune system, to avoid rejection of the donor bone marrow transplant, thus to allow for successful bone marrow transplantation . Since the treatment is delivered at an extended source skin distant (ssd) of 400 cm, it is important to monitor the skin dose to ensure the accuracy of the delivered dose to patients . For this procedure of extended distance, the treatment planning system (tps) cannot perform the calculation for the dose, thus, the dose has to be calculated by a point - dose determination at the dose prescription point . The variation in the energy dependence for both mosfets detectors is beyond the scope of the present study . Metal oxide semiconductor field - effect transistors have 2 types of detectors, the onedose mosfet and the metal oxide semiconductor field - effect transistors mobile mosfet dose verification system dosimeter . Onedose mosfet detectors verification system (figure 1) (sicel technologies, inc ., morrisville, nc; distributed by med tec, orange city, usa), which is a solid - state detector, now is used in radiotherapy treatment applications to measure the entrance and exit dose during the treatment . The system is small (3 mm diameter, 25 mm length), factory calibrated, wireless, and easy to use . The accuracy of the detectors, as specified by the manufacturer, is 1 cgy for a dose of less than 20 cgy and 5% for a dose of 20 to 500 cgy (sicel technologies inc). The detectors are factory calibrated with a co-60 beam with full build - up conditions . They are normalized to a 6-mv photon beam, and each detector is valid for 1 use only . In contrast, the mobile mosfet system (tn-502rd mosfet dosimeters, thomson and nielsen electronics ltd, ottawa, canada) (figure 2), consists of 5 high - sensitivity dosimeters attached to a reader . The attached reader records a voltage difference in each of the dosimeters when exposed to radiation . The mobile mosfet channels are used in the standard basic setting, giving a normal sensitivity of ~1 mv / cgy . The overall physical size of the sensors is 1.01.03.5 mm, and the actual sensitive volume is 0.20.2 mm0.5 m . Mosfet calibrations were performed under full buildup conditions, which then produced a very small sensing volume and less than 2% isotropy under full build - up through 360 degrees rotation . A group of mosfet detectors were exposed to 100 cgy dose using 6 mv from varian clinac 2300 ex accelerator at 10 cm water equivalent depth . Both mosfets detectors are characterized for energy response,; however, the details of energy depend for mosfet is out of the scope of the present study . All 5 channels of the mobile mosfet are made for multiple uses and can accumulate a dose up to 7000 cgy before it needs to be replaced . The system is controlled by remote dose - verification software running on a personal laptop . The present study aimed to compare the target prescribed dose to the dose that is the measured by onedose mosfet detector and mobile mosfet dosimetry in order to determine which system is superior in monitoring and measuring the tbi doses . Patients with all (n=32; 16 males, 16 females) receiving total body irradiation of 1200 cgy prior to bone marrow transplantation participated in this study . All patients consented to their treatments and were selected randomly from our patients to measure their skin dose during the treatment of tbi using dosimetry detectors . The patients were divided into 2 groups, and each group had 16 patients . For measurements, the first group was measured using onedose mosfet detectors, and the second group was measured using mobile mosfet detectors . All the anatomical sites, patient s position and the treatment protocol were the same in both groups . Monitoring skin dose during treatment is considering an essential tool for quality assurance in radiation therapy . For a treatment such as tbi it is essential to monitor the dose that is actually delivered compared to the prescribed dose . The tbi technique used in the department of radiation oncology, king fasial specialist hospital and research center, riyadh, saudi arabia takes into account recommendations of the aapm task group 29 based on delivering 2 opposed bilateral fields (right and left lateral), allowing for sufficient field size to cover the whole body during the treatment . The patient is supine and the radiation beam is directed horizontally across the treatment room directly on the patient . The treatment was delivered at an extended source - to - surface distance (ssd) of 400 cm, with radiation field size 4040 cm at 1 meter and the collimator was rotated through 45 and gantry angle of 270, using 18 mv x - ray beams generated by a varian clinac-2300 ex linear accelerator (palo alto, california, usa). The dose rate was 200 to 300 mu / min, depending on the patient s separation . A 1.5 cm thick perspex beam spoiler was used in front of the patient to make the dose uniform, with a total dose of 1200 cgy delivered by a hyper - fractionated technique with 6 fractions of 200 cgy twice a day over 3 days . Rice bags and tissue - equivalent bolus were used to compensate for missing tissues to make the dose uniform around the patient s body . One - dose mosfet detectors were used with the first group of patients (n=16). The detectors were first zeroed by the handheld reader and then were placed at 10 selective anatomical points for every patient . The total 10 points selected in the patients to measure the skin dose were the neck (right and left), lungs (right and left), midline point of the patient (between the legs), abdominal area (right and left), right eye, umbilicus level and right knee, and the last point was the ionization chamber point which was used at the groin for absolute dose verification placed between the thighs in the mid - perineal region to monitor the dose during treatment . After the treatment the detectors were collected and then 2 minutes later each detector was placed in the handheld reader and the resulting doses were recorded . For the second group of patients (n=16), 2 sets of mobile mosfet were used . One was to cover the superior part of the body and the second was to cover the inferior part of the body . The 10 individual dose points recorded by the 2 mosfet systems were placed in the same selected 10 points as the one - dose mosfet . All dose measurements were carried out with the flat side of the mosfet placed to face the beam . The results were compared using one - way anova analysis followed by tukey s test for multiple comparison tests . Statistical analysis was performed by means of graphpad prism package for personal computers (graphpad software, inc ., san diego, usa) and figures was performed by means of grafit package for personal computers (erithacus software limited, surrey, uk). Patients with all (n=32; 16 males, 16 females) receiving total body irradiation of 1200 cgy prior to bone marrow transplantation participated in this study . All patients consented to their treatments and were selected randomly from our patients to measure their skin dose during the treatment of tbi using dosimetry detectors . The patients were divided into 2 groups, and each group had 16 patients . For measurements, the first group was measured using onedose mosfet detectors, and the second group was measured using mobile mosfet detectors . All the anatomical sites, patient s position and the treatment protocol were the same in both groups . Monitoring skin dose during treatment is considering an essential tool for quality assurance in radiation therapy . For a treatment such as tbi it is essential to monitor the dose that is actually delivered compared to the prescribed dose . The tbi technique used in the department of radiation oncology, king fasial specialist hospital and research center, riyadh, saudi arabia takes into account recommendations of the aapm task group 29 based on delivering 2 opposed bilateral fields (right and left lateral), allowing for sufficient field size to cover the whole body during the treatment . The patient is supine and the radiation beam is directed horizontally across the treatment room directly on the patient . The treatment was delivered at an extended source - to - surface distance (ssd) of 400 cm, with radiation field size 4040 cm at 1 meter and the collimator was rotated through 45 and gantry angle of 270, using 18 mv x - ray beams generated by a varian clinac-2300 ex linear accelerator (palo alto, california, usa). The dose rate was 200 to 300 mu / min, depending on the patient s separation . A 1.5 cm thick perspex beam spoiler was used in front of the patient to make the dose uniform, with a total dose of 1200 cgy delivered by a hyper - fractionated technique with 6 fractions of 200 cgy twice a day over 3 days . Rice bags and tissue - equivalent bolus were used to compensate for missing tissues to make the dose uniform around the patient s body . One - dose mosfet detectors were used with the first group of patients (n=16). The detectors were first zeroed by the handheld reader and then were placed at 10 selective anatomical points for every patient . The total 10 points selected in the patients to measure the skin dose were the neck (right and left), lungs (right and left), midline point of the patient (between the legs), abdominal area (right and left), right eye, umbilicus level and right knee, and the last point was the ionization chamber point which was used at the groin for absolute dose verification placed between the thighs in the mid - perineal region to monitor the dose during treatment . After the treatment the detectors were collected and then 2 minutes later each detector was placed in the handheld reader and the resulting doses were recorded . For the second group of patients (n=16), 2 sets of mobile mosfet were used . One was to cover the superior part of the body and the second was to cover the inferior part of the body . The 10 individual dose points recorded by the 2 mosfet systems were placed in the same selected 10 points as the one - dose mosfet . All dose measurements were carried out with the flat side of the mosfet placed to face the beam . Data from each sample were run in duplicate and expressed as means sd (cgy, n=32 patients). The results were compared using one - way anova analysis followed by tukey s test for multiple comparison tests . Statistical analysis was performed by means of graphpad prism package for personal computers (graphpad software, inc ., san diego, usa) and figures was performed by means of grafit package for personal computers (erithacus software limited, surrey, uk). Table 2 shows the means sd of the measured skin doses for the selected 10 anatomical sites in each patient . The result showed that there was no significant difference between the 2 systems (one - dose mosfet dosimetry and the mobile mosfet) measurements of skin dose at the treatment of tbi as compared to the prescribed dose . Early treatment of acute lymphoblastic leukemia (all) with chemotherapy and radiation therapy showed a good response . Tbi is used in cases of all to demolish the cancer cells and to suppress the immune system to allow for bone marrow transplantation . Tbi is considered as an essential technique used prior to bone marrow transplantation . During the treatment it is important to measure and monitor the skin dose using patient dosimetry such as mosfet or thermo - luminescent dosimetry (tld). The present results of our study suggest that if there is any major difference between the outcome of using one - dose mosfet dosimeter and mobile mosfet in the treatment of tbi, to monitor the skin dose . It is a very important point because clinical decisions are currently made with respect to skin dose . It is necessary to monitor the skin dose and in the meantime to ensure accurate dose delivery to patients, determined by using selected points in the patient s body for verifying the accuracy in delivering of the prescribe dose . Our results (table 2) show that for one - dose mosfets measured dose as compared to the prescribed dose for right and left neck decreased by 3% . The percentage mean difference in the lung site (right and left) decreased by 1% and 2%, respectively . The percentage mean difference in midline point using the ionization chamber increased by 0.5% . For the abdominal area (right and left) percentage mean difference decreased by 2% and 0.5%, respectively . Umbilicus region percentage means difference decreased by 2% and at the right knee site the percentage mean difference decreased by, for the right eye the percentage means difference decrease by 3% . However, for the mobile mosfet measurement of the 10 selected anatomical sites, the percentage mean difference between the measured dose and the prescribed dose for the neck area (right and left) decreased by 1% and 0.7%, respectively . In the lung area (right and left) the percentage mean difference between the measured dose and the prescribed dose decreased by 1% and 2%, respectively . The midline ionization chamber dose using mobile mosfet gave a decreased percentage mean difference of 2% as compared with the midline prescribed dose . For the abdominal area, in both right and left, the percentage mean difference between the measured and prescribed doses decreased by 1% and decreased by 3%, respectively . The umbilicus percentage mean difference decreased by 2%, the percentage mean different right knee decreased by 2%, and for the right eye the percentage means difference decrease by 2% . For the midline, which is the point of the ionization chamber, it was proven that the dose delivered matched the prescribed dose with upper and lower dose limits, decreased by only 0.5% of the prescribed dose . However, our data showed that there is no significant difference between the measured dose by using any mosfets system and the prescribed dose as shown in table 2 . It is possible that the small and insignificant differences in the results for the both mosfets and prescribed dose could be the results of the additional buildup from the rice bag and/or the bolus that was placed on the patient s anatomical sites . Because of the use of a 1.5-cm acrylic spoiler plate, the bolus, and the large field size, should have been in a relatively flat dose region close to the depth of the maximum dose . Furthermore, although the mosfet has an inherent buildup of 0.88 mm, we had expected that the dose absorbed by both of the mosfet detectors should have been nearly the same at most of the selected points . The addition of the rice bag (with an approximate thickness of 2 cm) put those detectors beyond the depth of the maximum dose, where the additional inherent buildup of the mosfets should have led to a negligible decrease in the percent difference by 3% as compared with the measurements close to depth of the maximum dose . Finally, our study is limited by inadequate treatment plans and dose calculation procedure, such as wrong inverse square law corrections or errors due to limitations of the two - dimensional treatment planning system used . Our results are consistent with previous studies [1722] in finding no variation between the measured doses using any mosfets system as compared to the prescribed dose . Both the one - dose mosfet and the mobile mosfet are suitable options for measuring skin dose for total body irradiation treatment . Both systems can provide valuable skin dose information in areas where the treatment planning system may not be accomplished, such as for tbi.
Anorexia nervosa (an) is a severe disorder strongly associated with the female sex and with a number of neurobiological correlates . A review of twin studies suggests a strong genetic vulnerability, with heritability rates ranging from 28% to 74%.1 furthermore, the disorder is associated with several obstetric and perinatal factors.2,3 in addition, patients suffering from an have frequently been found to share personality and temperamental features such as perfectionism, rigidity, obsessive compulsiveness, introversion, and neuroticism.4,5 an is also associated with a number of cognitive difficulties,6,7 especially low set - shifting abilities8 and poor central coherence.9,10 structural brain alterations have been described in an patients.11 electrophysiological alterations have also been reported, but these studies are few in number and the methods have varied considerably . Although many an patients seem to have normal electroencephalograms (eegs),12 a substantial number of patients may have abnormal slowing of background activity or even atypical spike discharges.13 with a quantitative eeg (qeeg), it is possible to localize areas with abnormal brain activity in relation to different frequency bands,14 but few studies have reported resting qeeg in an patients . In previous an studies, reduced 813 hz alpha rhythm amplitude has been reported to occur in posterior regions;13,15 anterior regions;16 or across frontal, temporal, and parietal areas.17 results regarding 47 hz theta activity are variable, as either increased posterior theta16 or normal theta levels15 have been reported in relaxed wakefulness in an patients . Slow 03 hz delta activity in wakefulness, an eeg sign of more severe brain dysfunction, has seldom been reported in an outpatients . In this context, it is important to clarify if reproducible qeeg signs of brain dysfunction can be confirmed, because such data can clarify the importance of organic compared to psychological factors in an . The major aim of this study was to examine regional absolute eeg delta, theta, and alpha amplitudes in patients with an, and, employing a blind study, to contrast these eeg data with results from a group of comparable healthy controls . Inclusion criteria for the patient group were: an as the primary diagnosis at the time of recruitment, norwegian as the first language, and the patient s somatic ability to complete the assessment . Exclusion criteria included confirmed brain damage, psychosis, diabetes, chronic fatigue syndrome, neurological disease, and neuropsychiatric disorders . One patient had to be excluded because she was a demographic outlier with no comparable healthy control, leaving a group of 21 patients with an . At the time of recruitment, 19 of the patients were inpatients and two were outpatients . All patients were in a weight - restoration phase, and to the best of our knowledge, none of them were in a state of starvation . The patients were in different stages of their treatment, and at the time of recruitment, three patients weighed above the weight criterion for an, according to the criteria of the diagnostic and statistical manual of mental disorders, 4th edition, text revision.18 the included patients were using their regular medication . At the time of recruitment, 16 patients used either nontricyclic antidepressants (n=14) or antipsychotics (n=6). A control group of 25 participants of the same age and sex and with the same educational characteristics were recruited for comparison . Exclusion criteria were the same for the control group and patients, with the following supplementary criteria: current or prior eating disorder or eating problems, being on a diet for weight reduction, a body mass index <19 kg / m or> 26 kg / m, and/or currently having a psychiatric diagnosis . Written informed consent was acquired from all participants in accordance with the declaration of helsinki . Eeg was recorded (nicone nervus 5.11, natus medical incorporated pleasanton, ca, usa) and digitized (256 hz sample rate) from 16 scalp electrodes according to the 1020 system, with the participant in supine position and relaxed with closed eyes . All eegs were scheduled for the morning; one was recorded at 9 am and the rest at approximately 10 am . Participants were asked to open and close their eyes every minute to avoid drowsiness, and eye movements were recorded . Eeg sequences without artifacts were selected and analyzed using harmonie software (stellate systems, quebec, canada) by a clinical neurophysiologist who was blind to the participants clinical status prior to the qeeg analysis . A fast fourier transform was applied to source - derivation referenced 4-second sections after cosine tapering (no overlap). For each eeg narrow band delta (0.753.75 hz), theta (4.007.75 hz), alpha (8.0012.75 hz), and beta (13.0030.00 hz) bands and eeg electrode, we calculated the average absolute amplitude (from the square root of the power in v2). Regional averages within the frontocentral (eeg locations f3, f4, c3, and c4), temporal (t3, t4, t5, and t6), and parietooccipital (p3, p4, o1, and o2) regions were calculated as main variables, followed by single - electrode testing within regions of interest (defined as regional p - values below 0.10). A custom - made peak - finding algorithm for the o1 and o2 as secondary variables for exploratory analysis, we also calculated relative band amplitudes (narrow band amplitude / total 0.7530 hz band amplitude) for each eeg band and region . A normalizing transformation was applied to all variables (square root for band amplitudes), followed by two - group student s t - test (pooled variance). Participants also underwent neuropsychological testing and evaluation, including the wechsler adult intelligence scale, 3rd edition (wais - iii).19 the majority of patients and controls belonged to a larger study group examined for neuropsychological performance in previous publications.20,21 the study was approved by the regional committees for medical and health research ethics (reference 4.2007.2229). Inclusion criteria for the patient group were: an as the primary diagnosis at the time of recruitment, norwegian as the first language, and the patient s somatic ability to complete the assessment . Exclusion criteria included confirmed brain damage, psychosis, diabetes, chronic fatigue syndrome, neurological disease, and neuropsychiatric disorders . One patient had to be excluded because she was a demographic outlier with no comparable healthy control, leaving a group of 21 patients with an . At the time of recruitment, 19 of the patients were inpatients and two were outpatients . All patients were in a weight - restoration phase, and to the best of our knowledge, none of them were in a state of starvation . The patients were in different stages of their treatment, and at the time of recruitment, three patients weighed above the weight criterion for an, according to the criteria of the diagnostic and statistical manual of mental disorders, 4th edition, text revision.18 the included patients were using their regular medication . At the time of recruitment, 16 patients used either nontricyclic antidepressants (n=14) or antipsychotics (n=6). A control group of 25 participants of the same age and sex and with the same educational characteristics were recruited for comparison . Exclusion criteria were the same for the control group and patients, with the following supplementary criteria: current or prior eating disorder or eating problems, being on a diet for weight reduction, a body mass index <19 kg / m or> 26 kg / m, and/or currently having a psychiatric diagnosis . Written informed consent was acquired from all participants in accordance with the declaration of helsinki . Eeg was recorded (nicone nervus 5.11, natus medical incorporated pleasanton, ca, usa) and digitized (256 hz sample rate) from 16 scalp electrodes according to the 1020 system, with the participant in supine position and relaxed with closed eyes . All eegs were scheduled for the morning; one was recorded at 9 am and the rest at approximately 10 am . Participants were asked to open and close their eyes every minute to avoid drowsiness, and eye movements were recorded . Eeg sequences without artifacts were selected and analyzed using harmonie software (stellate systems, quebec, canada) by a clinical neurophysiologist who was blind to the participants clinical status prior to the qeeg analysis . A fast fourier transform was applied to source - derivation referenced 4-second sections after cosine tapering (no overlap). For each eeg narrow band delta (0.753.75 hz), theta (4.007.75 hz), alpha (8.0012.75 hz), and beta (13.0030.00 hz) bands and eeg electrode, we calculated the average absolute amplitude (from the square root of the power in v2). Regional averages within the frontocentral (eeg locations f3, f4, c3, and c4), temporal (t3, t4, t5, and t6), and parietooccipital (p3, p4, o1, and o2) regions were calculated as main variables, followed by single - electrode testing within regions of interest (defined as regional p - values below 0.10). A custom - made peak - finding algorithm for the o1 and o2 as secondary variables for exploratory analysis, we also calculated relative band amplitudes (narrow band amplitude / total 0.7530 hz band amplitude) for each eeg band and region . A normalizing transformation was applied to all variables (square root for band amplitudes), followed by two - group student s t - test (pooled variance). Participants also underwent neuropsychological testing and evaluation, including the wechsler adult intelligence scale, 3rd edition (wais - iii).19 the majority of patients and controls belonged to a larger study group examined for neuropsychological performance in previous publications.20,21 the study was approved by the regional committees for medical and health research ethics (reference 4.2007.2229). There was no difference between the an group patients and controls in age, years of education, full - scale iq, or any of the wais - iii indexes.19 both groups were in the upper intelligence quotient (iq) range, as measured by the general ability index22 derived from the wais - iii.19 no epileptiform eeg activity was observed . Occipital alpha peak frequency was mean (standard deviation [sd]) = 10.55 (0.93) hz in an and 10.25 (0.85) hz in controls (student s t - test, p=0.26). Regarding the main qeeg variables (absolute amplitude), no difference in delta or alpha bands was observed . A strong trend toward increased regional frontocentral theta (p=0.051) an subjects had significantly increased theta activity at both the left (f3; p=0.014) and right (f4; p=0.038) frontal electrodes (figure 1). This difference was preserved when patients on antipsychotics were excluded (p=0.012 and 0.022, respectively). There were also a few significant relative amplitude differences between the two groups (table 2) in parietooccipital delta and frontocentral alpha activity . We found no significant group differences, however, in absolute frontocentral alpha or temporal and parietooccipital delta amplitude from either regional variables (table 2) or single eeg electrodes . Anorexia subjects in this study had increased absolute theta amplitudes in both the right and left frontal regions . Theta activity was normal over the posterior frontal lobe margin close to the central sulcus, possibly because this central eeg activity is also influenced by anterior parietal lobe activity . Hence, a more middle / anterior frontal lobe eeg disturbance may be present in an patients . Grunwald et al23 also mentioned that an subjects had an increase in frontal theta during haptic exploration . Rodriguez et al15 did not report theta abnormalities in an subjects, but their method (amplitude of low - resolution brain electromagnetic tomography [loreta] sources) is not comparable to ours . Increased frontal theta activity is an unspecific finding . Drowsiness can probably be ruled out, given that subjects were activated during recording, epochs with drowsiness were not included in the fast fourier transform, occipital alpha was not slowed, and theta was not increased in the parietooccipital area . Frontal theta is reported to occur in young adults in a highly emotional state,24 as a frontal arousal rhythm,25 or while performing mental tasks,26,27 possibly related to retrieval of episodic memory information in the anterior limbic system.28,29 it should be emphasized that in the majority of cases, frontal theta is to be regarded as a normal eeg phenomenon.30 reduced functional activation of various parts of the frontal cortex has been reported in an patients . Phillipou et al31 made a systematic review of the research to date, which consisted of typically small studies with relatively variable results . They found that a number of structural and functional changes have been reported in various parts of the brain in an patients, including enlargement of cortical sulci and ventricles, changes in the gray and white matter, and changes in the basal ganglia . A reduction in volume and gray matter in the anterior cingulate cortex and reduced functional activation of various parts of the frontal cortex have also been reported in an patients . Accordingly, it is possible that our main eeg findings reflect a slightly disturbed frontal lobe dysfunction in an . There were no differences in regional absolute amplitude values between an subjects and controls for either delta or alpha activity, although frontocentral relative alpha and parietooccipital relative delta were slightly lower in an subjects compared to controls . Because low relative alpha power has been reported by others,1517 and mean alpha frequency tended to be higher in an subjects than in controls, we suggest that the present eeg pattern can be related to increased attention among an patients . Increased attention may, in addition to increased frontal theta, explain reduction of relative alpha and delta amplitude,32 as demonstrated in various event - related desynchronization protocols.33 prominent theta power enhancement over frontal regions during various working memory and episodic memory tasks has been consistently reported, but the functional significance of these oscillations in memory processes remains unclear.34 eeg - based neurofeedback has also been explored recently as a possible treatment option for an.35 frontal midline theta is most pronounced during the performance of mental tasks, even though it may occur at rest.36 it has also been suggested that personality traits and platelet monoamine oxidase (mao) activity may be related to frontal midline theta activity.36 this possibility has not yet been examined for an, however . The suspected mechanism leading to the more severe eeg changes previously reported among inpatients with anorexia may start with malnutrition leading to inadequate brain metabolism, particularly related to decreased electrolyte and glucose levels.13 this, in turn, can produce neuronal and synaptic dysfunction reflected by excessive slowing, spikes, instable eeg - hyperventilation responses,13 and reduction of the alpha rhythm amplitude . Our study, however, was performed in subjects in treatment with a relatively high average iq . The mean general ability index of the participants in both groups was more than 1 sd above the normative mean . Hence, no evidence of clinically significant higher - order brain dysfunction was found in our an cohort, either from a neuropsychological or an eeg point of view . Although the association between eeg and iq is weak and variable,32,37 this high iq also suggests that excess frontal theta does not reflect established brain dysfunction in our an subjects . A limitation of this study was the symptomatic psychotropic medication that the majority of an patients had to use . Because it can, at least with large doses, cause eeg slowing,38 drug effects cannot be ruled out completely . Because the frontal theta difference was not weakened by excluding the subgroup using the (most potent) antipsychotic medications, however this eeg pattern, with frontal theta and slight alpha and delta changes, may suggest a different average level of arousal (vigilance) or attention . It could also reflect different mental state or trait in the an group compared to the matched control group, possibly related to a frontal lobe dysfunction . Longitudinal studies are required to follow patients over time, in order to decide whether eeg is stable or changes as a result of an severity fluctuations or other less disease - specific factors, such as emotional instability, mood changes, or metabolic or nutritional factors.