text
stringlengths
0
868k
I squeeze into the back, next to the two community - owned resource persons (corp) and a tanzanian phd student under the supervision of the principal investigator of the urban malaria control programme (umcp). Our first stop is on the western edge of town, a 20-minute drive from my hotel on the peninsula . Where the electric lights grow few and far between, we turn off the tarmac and bounce along a network of washed - out mud roads . It quickly becomes too narrow to drive, so we get out of the car and make our way single - file through the back alleys, straddling streams, heaps of garbage and small garden plots . Around the corner of a house, we find a young man with his pants rolled up, a headlamp and a rubber tube in hand . Seeing us approach, he stands up, stretches and hands the student a form . The student picks up the netting - covered plastic cup on the ground near the man's feet . He makes a note on his datasheet, pats the man on the back, and turns to leave . He's a good one, this guy, the student says, always here. The visit is short; there is a lot more to do . Behind us we leave him there in the moonlight, rats running along the drainage ditches and radio playing in the street . The investigative focus of the umcp is the effectiveness of larval control in reducing the incidence of malaria in dar es salaam . In contrast to ddt, bti is safe for nontarget organisms and because it contains multiple toxins, its use is less likely to result in resistance . But while highly effective in killing mosquito larvae, with little residual activity, bti must be re - applied on a weekly basis . To prove the effectiveness of bti as a viable instrument of disease control, the principal investigator required up - to - date evidence of mosquito densities across the city . For this purpose, the human landing catch (hlc) the key methodological advantage of the hlc is that mosquitoes are caught as they come to feed . Thus, in contrast to those captured by a light trap, the samples obtained can be deemed representative of disease transmission . Hlc is also cheap and relatively simple; an aspirator (a mesh - covered glass vial attached to a rubber sucking tube), cotton wool, some rubber bands, a few plastic cups, a source of light and a human volunteer are the only necessary equipment . As most anopheles gambiae the most common malaria vector are nocturnal, hlcs perform their duties between sunset and sunrise . Customarily, the hlc is conducted within homes and can be reinforced or supplemented by a bed - net trap . But after decades of spraying homes with insecticide and covering beds with insecticide - treated nets, dar es salaam's mosquito populations, once domestic, now seek their hosts in the streets . Therefore, in the context of the umcp, placing hlcs outdoors is the only way of collecting accurate evidence . Catching mosquitoes over night is both mentally and physically exhausting . Sitting in a chair, waiting for mosquitoes to land, sucking them off the legs into a tube and then blowing them into a cup demands patience, intensive focus, and above all, stamina . With catches going on in 268 routinely maintained sites in dar's back alleys hourly records of catches may reduce the possibility of data - fabrication, but random spot checks are still necessary to ensure volunteers stay at their posts . Because collectors differ in their attractiveness to mosquitoes and in their skill in catching them, another obvious problem with the hlc is that it involves direct exposure to mosquito - borne infections . Precautions are taken all volunteers are screened weekly for malaria and, when infected, treated with artemisin - based combination therapy . Because it involves placing the catcher in a compromising position, the hlc is restricted to men over 18 years of age . But particularly at a time when drug - resistant malaria is on the rise, becoming a target for mosquitoes poses what may seem unnecessary risks . But for the purposes of this paper, i would like, for the moment, to suspend the visceral discomfort the experimental scenario provokes and consider first its value . I use the term value, broadly to describe both the moral virtues of knowledge - production and the monetary costs of malaria control . Drawing on theoretical resources from anthropology, science and technology studies and economic sociology, this paper examines how political, economic, and scientific logics are inter - articulated through public health research practice . The paper tracks these overlapping and countervailing forms of value across three sections and each of them conceptualizes the role of the hlc differently . It begins by examining the hlc as a species of experimental subjectivity particular to the informal economy of tanzania . In dar es salaam, the formation of the hlc's experimental subjectivity is in continuity with a post - colonial, post - socialist trajectory . I suggest that in the case of the umcp, the practices of transnational knowledge production overlap with residual forms of civic identification . In the second section, i elaborate the collective character of experimental participation as technical work by linking the hlc to the particular investigative demands of the project . Of particular interest is the relationship between the hlc as knowledge - producer and the transformation of dar es salaam into a venue for disease management . The third and final part of the paper considers how the value of the hlc's labour coincides with the organization of global health . Markedly out - of - step with current r&d trends, the umcp investigates an environmental strategy associated with colonial governments . The malaria investigated here is defined by ecological and administrative specificity relations that lie outside the current figuration of malaria as a threat to the global economy . My argument is that the hlc reanimates those relations and projects them on a future civic order . The theoretical consequences of immobility i leave for the conclusion where i briefly consider the hlc as a counterweight to the project form of humanitarian engagement (boltanski & chiapello 2005). In presenting this particular account of these dynamics, i point to different alignments of knowledge, work, science and place and suggest how these shape the value of research . The first place to look for the value of the hlc is where money changes hands . On average, this sum reflects a moderate increase on what they might make from selling batteries, oranges, or phone cards the activity that provides most catchers with their primary source of income . Of course, the payment of $2.45 is strictly not a salary, but rather a minimal emolument for volunteered and consented participation (fillinger et al . 2008). Here, as in all biomedical research, the motivation of the subject provides an ethical anchor; the exploitative potential of putting the body to use is mitigated by the degree to which it is freely offered (geissler, this issue). Monetary exchange whether framed as compensation, reimbursement, or reward must be kept ideologically distinct from the logics of accumulation; any disambiguation of the pragmatics of participation risks impugning the purposes of research . Work in the social sciences has repeatedly shown that the trope of volunteerism lacks empirical traction in the context of clinical research (e.g. Geissler et al . Scholars have situated participation within the social and political circumstances in which research is conducted . Kaushik sunder rajan's ethnographic work on the emerging indian bio - industry is of note in this regard . Zeroing - in on clinical research conducted in parel once the hub of mumbai's textile industry and now the home of a genome company, hospital and lab -sunder rajan excavates the collective identity of experimental subjects who were formerly mill workers . For sunder rajan, the integrity of the individual participant's consent is not of concern indeed the trials conducted in parel adhere to the highest ethical standards . The violence he identifies is structural, introduced through the specific colonial histories and political economies of mumbai and exacted within the institutions in which work takes place . In contrast to the social character of factory work, formalized through unions and materialized in the built environment of the mills, participating in trials is individual, placeless and (by ethical prescription) anonymous . As the indian economy shifts from commodity - based to speculative capital, the working - class identity is: under threat of erasure . This is because part of the evisceration of the industry involves pushing more and more workers into informal sectors of work, and therefore away from trade unions the structurally formed subject - position in bombay is not one of shared social identification, but rather one of desperate individuation and alienation . (sunder rajan 2002, p. 169, p. 173) the rise in contingent forms of labour has replaced a politically robust class - consciousness with thinly imagined human rights . For sunder rajan, the professional experimental subject is not an ethical aporia but an archetype of the disenfranchisement of the labourer under advanced capitalism . Following sunder rajan, the question we might ask is how the hlc tallies with the distinct economic realities of contemporary life in dar es salaam? Is being bait yet another expression of neo - liberal logics? Like parel, dar es salaam is dominated by an informal economy (tripp 1997). But though a flexibly configured economic landscape is characteristic of african urbanization (simone 2004), dar es salaam's informal sector bears the distinct marks of a failed socialist project . Here, the informal economy does not merely denote unregulated economic activities, but rather the creation of resources through which people sustain the civic capacities formally articulated by the state . Nyerere's political philosophy of ujamaa drew heavily on a british tradition of welfare economics that recognized the state as the guarantor of equity, and thus the rightful distributor of key resources . He aspired to liberate tanzania from the chronic underdevelopment to which it was condemned by colonialism by righting the imbalance between production and consumption, the needs of the countryside and those of the metropolis . The engine of modernity for nyerere's independent state was thus not the formal urban sector . Rather, social progress would be the outcome of state - initiatives realized through the diligent participation of a self - reliant citizenry . To advance that vision, villiganization the forced relocation of rural populations to organized sites of cooperative production . In the city, trade was heavily regulated; private industry and sideline employment, deemed contrary to the spirit of ujamaa, were persecuted (lewinson 2007). His social polices alienated aid donors from the west . His efforts to restructure agricultural production disregarding heavy industry impoverished the country further (pratt 1999). As economic crisis struck and structural adjustment measures were put in place, informal businesses became the primary source of household income . Locally organized groups took responsibility for public services that the state no longer could provide such as waste removal, infrastructural upkeep and security . While counter to the official political ideology, the informal sector supported government institutions and thus mitigated their deterioration . As mari ali tripp suggests, the resiliency of society and its ability to reproduce itself with considerable autonomy from the state is one of the reasons the entire fabric of society did not fall apart during the unprecedented hardship (tripp 1997, p. 5). The volunteer was not enrolled into the project as an experimental subject, rather he was first employed as a member of the community - owned resource persons (corps), and in that capacity was delegated the responsibility of performing the landing catch . In the past, corps had been appointed by members living within ten cell units (tcu) a cluster of about 10 houses -to perform basic public health services and small - scale maintenance tasks, such as garbage collection, road cleaning and soap distribution . A feature of nyerere's urban reforms, but like many national programmes they fell victim to the economic reforms in the 1980s . Though many continued to work on a volunteer basis, with little administrative or financial support from the city council, corps no longer functioned as a coordinated system . Recruiting participants through this network offered considerable operational advantages for the umcp . In ecological studies, access is of critical importance . Selected by street chairman, the corps guaranteed the project's acceptance among local residents . Their familiarity with the physical and social landscape enabled the research team to locate mosquito - breeding sites, many of which were occurring within private homes and gardens . The mosquito collector received a compensation equivalent to that offered to a volunteer municipal servant for any odd job, like road cleaning (chaki et al . 2009). The use of a dormant social infrastructure within the research project raises some interesting questions about how to value the mosquito catcher's labour . Paid by the research project but enrolled as a corp, the hlc's experimental role is embedded within a civic sociality . His labour falls partly outside the economy of transnational clinical research, even as it is sustained by it . How, then, do we understand the value of that labour at the intersection of different modes of economic rationality? Do we agree that $2.45 is a fair compensation for the risks he sustains and, further, for his contribution to the project's outcomes? In the following section, i begin to respond to these questions by widening the scope of analysis to the other forms of experimental work associated with corps . The heuristic value of the night mosquito catches lies in tracking the density of urban mosquito populations and, by extension, revealing the transmission rate of malaria . But within the umcp, that task also serves to demonstrate the work of larval control the size of the hlc's collection indicates whether the application of larvicide has been comprehensive, and, if not, the areas that have been missed . Those responsible for larval control and those enrolled to catch mosquitoes are kept separate in order to achieve evaluative rigour . However, they constitute the same volunteer municipal body . The aggregative function of these groups points to the particular relationship of experimental work and the production of knowledge in the context of the umcp . On any given night in dar es salaam, men can be found catching mosquitoes in a garden, on a curb, along a drain . These randomly selected sites serve to build a picture of urban mosquito transmission . But these locations also constitute key coordinates in the geography of the experiment . In this section, i will examine the hlc's location as part of a broader project transforming dar es salaam into a model city for larval control in africa . I suggest that the civic epistemology of mosquito mapping resituates the value of experimental work as not only an index of disease but also as an instrument to experimentally format the city . Because mosquito - breeding sites are bounded and easily located, cities are regarded as the most suitable environments for larval control . But to generate the conditions under which larval control is possible necessitates an ecological understanding of man - mosquito dynamics on fine spatial scales . Dar es salaam encompasses a diverse range of habitats including sewage pools, cattle troughs, rain gutters, water buckets and ponds caused by poor drainage . And these are only the most identifiable sties mosquitoes are highly associated with human activity and are just as likely to breed in footprints as they are in swamps . However, advances in remotely sensed (rs) imagery and global positioning systems (gps) have provided the necessary tools to identify and record these habitats . With these technologies, the umcp research team produced a high - resolution map that related the minor ecology of each area to the spatial distribution of disease across the city . While accurate, the maps were not practical . As with the hlc, larval control was delegated to a group of volunteers, selected by street chairmen, and enrolled into the project as members of the corps . Larval control is also highly demanding: locating and monitoring the diverse and shifting mosquito habitats that characterise dar es salaam make staying awake in a chair over night seem easy . Because they bore no relation to how the corps visualized the city, the maps produced did little to ease that task . To bridge these different understandings, the umcp developed a protocol for participatory mapping, whereby each larval control corp was asked to draw a sketch of the area for which he was responsible . Mosquitoes provided the cartographic anchor of these depictions; the corp identified any potential breeding sites and habitats and related their position to features of the plot such as roads, drains, walls or houses . Knowing where to spray was only part of the problem: watchdogs, gates and intimidating owners were often enough to dissuade a corp from even approaching a house, let alone asking if they could enter, check and spray any potential breading grounds in their gardens . The guidelines for spraying stress the interdependence of ecological capacity and social knowledge: to find all mosquito breeding habitats, you have first to know each and every square metre in your mtaa [neighbourhood] the only sure way to do this is to know who owns, occupies or uses which plot of land regardless of whether it is surveyed or unsurveyed . 2007, additional file, guidelines for larval control) with the help of a member of the research team, corps calibrated their sketch maps with a blown up aerial photograph of their area; boundaries whether administrative, natural or socio - economic were marked with non - permanent pens . The prints were laminated to protect them during intensive use in the field, and to encourage corps to adapt the map to their daily experiences and to new data from night mosquito catches . Capturing the dynamic reality of the encounter between man and mosquito demands a flexible methodological format: tied to the demands of place, these technologies of spatial representation are subject to continual modification . Night - catches render visible mosquito movements and reorient larval control activities to new breeding grounds . This finely tuned process of vision - and - revision stands in stark contrast to the geographic colonization of territory described in theories of the state - formation (e.g. Mitchell 2002). Dar es salaam is here elaborated as an active network of relations, references and practices the making of a mosquito map is embedded in the sociality of the city streets . The hlc sits as a sentinel along that chain of designation; his night - catches reveal the slippage between scientific space and urban place . Thus, though the work of the corps is highly physical, it also entails more immaterial, affective aspects . Their intimate knowledge of the field and its inhabitants generates the conditions for the cartographic liveliness critical to the generation of ecological knowledge . In terms of project value, one question we might ask is how that socio - technological praxis tallies with the work of the research team . This is a familiar question for the sociology of scientific knowledge: steve shapin explores the role of the invisible technicians who designed, constructed, and operated robert boyle's foundational experiments (shapin 1989). Shapin argues that the division between technical and analytical labours and the difference in their value was grounded in the status of the workers as servants and not gentlemen . In other words, while boyle could pursue knowledge freely, the technicians were all remuneratively engaged to work at boyle's request . That is they agreed to exchange a certain amount of autonomy and work for a certain amount of money (shapin 1989, p. 561). Once they entered into monetary exchange, their contribution was disconnected from the authority of science . Though scientists now receive a wage, the division between menial and mental labour continues to have a bearing on contemporary scientific research . However, in africa, the relationship of scientific assistants to the production of knowledge has a slightly different significance . Some of the earliest forms of colonial education were aimed at extending the arms and hands of colonial medical officers (hunt 1999). The colonial training and employment of spray - men, medical technicians, and volunteer health attendants was animated by logics of expansion (in volumes of patients, samples, analyses), socio - spatial access, divisions of labour, and hierarchies of scientific practice . After independence, these biomedical middlemen became central to large - scale social engineering projects aimed at eradicating inequity and establishing a strong nation state (beinart et al . The first comprises that practical aspects of experimentation that are kept radically distinct from the truth these experiments produce; the second functions as a means of exerting geographic and demographic control . The alignment of research protocol and governmental practice is transformative; the corps work to make dar es salaam a typical african city, a neutral backdrop against which to diagnose and predict the effectiveness of larval control . But in so doing, they also render the city manageable as an object of control . Through the corps handy - work dar es salaam becomes a collaborative project, a site of development . In the final section, i will elaborate further the economic forms of value that underpin that process of transformation . It is a proof - of - concept, a demonstration of chemical efficacy, a test of cost - effectiveness, and a simulation of environmental management . As a pilot for a future policy, the umcp's persuasive power depends upon the social and material connections it forges between test setting and site of intervention (lezaun & millo 2006). Those connections come about through the participation of the corps who, by the consistency of their practice, forecast the validity of the trial and close the gap between science and city . Between research pilot and public health programme, their work encompasses different techniques of calculation, configured around the resources brought to bear by malaria, international science, and the state . Let me now return to the emolument offered for a night's work in the chair . A competitive wage in dar es salaam, $2.45 seems at odds with the millions of dollars in capital and material resources made available to the project by the gates and melinda foundation, usaid, the wellcome trust and the swiss tropical institute . More broadly, the project sits squarely within the funding priorities of global health; in 2009, the global fund awarded tanzania $680 million to expand malaria treatment and prevention . In the sections above, i discussed the mosquito - catchers labour first, in terms of their experimental subjectivity, and, second as a scientific practice . Now, i want to explore how these practices participate in each other, and how their technical and ideational compatibility influences the way in which malaria is framed as an object of intervention . In his analysis of how economics constitute markets economic and, further, in the socio - technical consequences of that framing . An ancient disease, malaria is an externality with considerable puissance; the parasite has overturned battles, dispatched sovereigns, and relocated civilizations . It has shaped agricultural techniques, methods of building, and the planning of cities . Taking malaria into account was the founding goal of tropical medicine; often viewed as the benevolent aspect of colonialism, modern public health was (and continues to be) intertwined with the interests of international commerce (e.g. Anderson 2006). The international system of economic governance that emerged after world war two reframed malaria as a threat to markets on a global scale . This transformation from situated illness to international pandemic took shape through epidemiological models that defined malaria not as a problem of social ecology, but as a probabilistic relationship between mosquitoes, malaria parasites and human hosts (packard 2007). Second, that relationship was costed in terms of worker productivity, school absenteeism, medical costs, cognitive ability, population mobility, trade and tourism through a raft of social - technical algorithms and multiple regression analyses . Third, those costs have been aggregated, stabilized and projected . According to john gallup and jeffery sachs, malaria costs african nations roughly $12 billion annually in direct economic losses and many times more in reduced economic development a growth penalty which, for sub - saharan countries like tanzania, is currently calculated at 1.3% per year (gallup & sachs 2001). As an object of economic calculation local methods of control, such as improvements to infrastructure and strategies of environmental management, seem myopic pitted against an epidemic of such global proportions . But most of all they are criticized as inefficient: integrating disease control into social development programmes demands heavy investment with limited returns . In contrast, programmes that specifically target disease transmission on a global scale are expensive, but have far reaching potential . The failure of the global malaria eradication programme in the 1950s was not regarded as a problem of modelling, but was rather blamed on negative externalities drug and insecticide resistance, the environmental movement, and philanthropic fatigue . When malaria returned to the centre stage of global health agendas in the late 1990s, the strategy was to anticipate and neutralize these problems with the breadth of technological innovation and the sheer size of investment . With the support of the bill and melinda gates foundation, international funding of malaria research and control interventions has quadrupled over the last few years from $249 million in 2004 to $1.1 billion in 2008 (mccoy et al . The competing costs incurred by the disease and by its control, again, suggest that obliterating the pathogen is the only way to clear the balance sheet . Anything short of global eradication is a bad decision, for it means, to quote melinda gates, that we will keep bearing forever the human costs of malaria, even as we keep paying forever the financial costs of trying to treat and control it (melinda gates, malaria forum, october 2007). Funds bring with them their own calculative devices performance indicators, accountability measures and systems of audit (strathern 2002). The question, then, is how the work of the hlc renders malaria legible within these forms of valuation . To answer this question, we need to situate the umcp within the technical trajectory of the disease as it has evolved in tanzania and more specifically, dar es salaam . The city has a long history of malaria control, which sets it apart as a venue for intervention and, experimentation . Malaria has been a persistent feature of its urban landscape since the german colonial authorities introduced planning schemes to separate malaria - endemic native bodies from susceptible white ones . Under the direction of robert koch, the city became the site of the most extensive quinine treatment programme in colonial africa . Following world war one, the british, introduced strict legal sanctions for the destruction of ponds and other sources of stagnant water, and, through the deployment of the royal army medical corps, carried out a wide range of vector - control strategies, including comprehensive drainage work, stream straightening, livestock surveillance, and eventually, larvicidal aerial spraying (castro et al . 2004). During independence, malaria control provided an arena for the extension of the newly established state (gerrets 2010). Nyerere's theoretical and political starting point was the link between economic inequality and disease . His plan for tanzania's development, outlined in the arusha declaration (1967), hinged upon restructuring the health sector on the basis of socialism and self - reliance (marsland 2006). Inspired by china's barefoot doctor programme, nyerere created a network of rural centres, and ultimately relocated the rural population to facilitate access (hsu 2007). Urban malaria control was successfully integrated into the general health services, owing in large part to the participatory mechanisms nyerere put in place to decentralize health care . In 1971, the who east africa aedes research unit experimented with an integrated vector control programme in collaboration with the dar es salaam city council . By 1973, the transmission rate of dar es salaam reached its lowest point in a century, ironically just at the moment when tanzania's deepening economic crisis made environmental management programme economically unfeasible . Through the 1980s, dar es salaam's experience mirrors that of sub - saharan africa . As a result of the pressures of the imf, spending on health malaria parasites became drug - resistant and the density of anopheles mosquitoes soared . In 1988, the city once again became the site of intervention, when the government of japan, interested in expanding its development aid portfolio, selected tanzania as its key recipient and launched an integrated urban malaria control programme with an emphasis on mosquito surveillance . Over the course of eight years, the japan international cooperation agency (jica) donated resources, equipment and technical expertise amounting to roughly $21 million us dollars . Despite its success in rehabilitating drainage infrastructure, in an interview with one of the municipal directors, she attributed this failure to the architecture of the intervention . In accordance with japanese government policy, japanese expert advisors rotated every two years, advising tanzanian partners on the techniques of vector control, but neglecting its more managerial aspects such as data collection and analysis . By the time malaria had made its reappearance on the global health stage, it was already highly visible in dar es salaam . Though not sustainable as a programme in vector control, routine remote sensory images and aerial stereoscopic maps documented the city's ecology and epidemiology, already described by records dating back almost a century . In addition to its textual depth, dar es salaam's infrastructural and political landscapes not to mention mosquito populations had been profoundly shaped by repeated efforts at malaria control . Further, the prospect that by 2030 more than half of the sub - saharan african population will live in cities suggests a need for more malaria research conducted in urban settings . Dar es salaam provided an ideal unit of analysis, a - ready - made truth - spot scalable to cities across the tropics (gieyrn 2006). The history of malaria research in dar es salaam and its metropolitan trajectory provided the key selling points for the project's principal investigator, an ecological biologist deeply committed to an integrated - approach to vector control . He managed to secure pilot - funds from the bill and melinda gates foundation though the invention he led did not match the foundation's innovation - focused profile . That support was, however, limited to one year, after which the programme's existence would depend on further ad hoc funding . Because larval control can take years to show an impact on transmission, sustainability was not only a long - term goal for the programme, but also a condition to demonstrate its effects thus, though the efficacy of bti provided the justification for the study, its protocol emphasized the operational feasibility of implementing a large - scale, community - led larval control programme . But while potentially cost - effective, integrating the project into pre - existing municipal structures required a complex system of surveillance stretching across distinct spatial and administrative scales . For instance, corps responsible for the application of larvicide and those performing hlcs reported to separate ward supervisors, who provided weekly summaries of these reports to the municipal mosquito control coordinator (mmcc). Every month, the mmcc sent the aggregated forms with action notes to the city mosquito control coordinator (cmcc). The cmcc, in turn, produced a written narrative of the programme's progress for the city mosquito surveillance officers (cmso). Collection forms, excel spreadsheets, data reports, and written feedback link the administrative layers of the hierarchy, formalise action plans and allow for an unambiguous assessment of performance (riles 2006). This layered system of annotated exchange also extended the temporality of the research from project to programme: overall, the vector surveillance and management systems developed in dar es salaam allow timely collection, interpretation and reaction to field - collected entomologic data with reaction times at ward, municipal and city levels vector density patterns were drafted into manuscript format figures within three weeks of their collection through these standard low - technology procedures, therefore serving as an instant monitoring and teaching tool . 2008, p. 13) the umcp thus became a combination of operational programme, research project and training platform . As part of the infrastructure for malaria control, the hlc's value is calibrated not to the facts the project produced, but to its future . Between the research project and the system of public health management malaria appears both as an economic and sociopolitical entity an obstacle to development and its vehicle . Three years into the umcp the operational costs and the mosquito density have dropped dramatically, malaria transmission rates are down . The national malaria control programme has now set itself the target of establishing similar programmes in five tanzanian cities by 2013, but the country lacks the necessary financial resources to do so . The hope is that further funds will become available as the dream of eradication fades and the need to develop new ways to control malaria comes into sharper focus . Processes of economization render unruly entities subject to management and subject to control (callskan & callon 2009). As an economic object, malaria is detached from its political histories and ecological specificities and costed as a parasitological exchange . What is striking about the hlc is that it reconnects the economics of malaria to its administrative practice the mosquitoes he enumerates entangle the parasite in urban planning, in infrastructure, in community relations, and in local politics . Immobilized in his chair, the hlc enables other things to move the population of mosquitoes, men and parasites, the contours of the urban landscape . These circulations are rendered visible but not static; the presence of the mosquito catcher enables an elastic response to the adaptability of the vector . Mosquitoes change their behaviour in response to human environments and public health interventions; each time the bti is applied the dynamics of that parasitological exchange between men and mosquito and the landscape of infection is subtly adjusted . The situated, persistent work of the hlc also mediates the flow of knowledge between ecologists, volunteers and communities; an ancillary epistemic exchange that runs through the production of facts . In short, his work sediments scientific practice: his collection transforms city streets into project evaluations, experimental techniques into tools of control . This paper has explored the distinct orders of value involved in and generated by the hlc . I tried to locate the act of being - bait both in the economy of tanzanian society and within the relevant protocols of scientific research . I have also suggested how the stationary volunteers of this malaria control project affected the direction and meaning of the experiment . The administrative intimacy of the experiment yields a productive overflow as a pedagogic instrument, a catalyst of community action, and a rationale for urban planning . Finally, i have suggested that the extensibility of the project its capacity for growth through use opens a space for politics in global health research (miyasaki 2004). In the words of hassan mshinda, the head of tanzania's commission for science and technology: unlike cutting - edge molecular biology, semi - field ecological studies and open - field research can be undertaken in any african setting, and constitute an immediate opportunity for malaria - afflicted nations to regain their roles as stakeholders, decision - makers, and eventual owners of this technology (mshinda et al . Though they form a central part of malaria control in dar es salaam, environmental strategies have for the most part been committed to the dustbin of pre - world war two history (who 2008, p. 9). Today, methods that entail this sort of logistical complexity and are bound to specific institutional and geographical topographies run counter to the dominant economic rationale of malaria control, and to the ideological underpinnings of global health . The emphasis of euro - american policy on emerging diseases has shifted public health from a problem of population management to one of surveillance in the interests of establishing networks of information exchange, projects circumvent sovereign states, pursuing partnerships between non - governmental organizations, charities and private industry (king 2002). Indeed, we are accustomed to thinking of scientific significance as a feature of its mobility; reliable knowledge is that proved to hold true regardless of time or place (latour 1983). Boltanski and chiapello (2005) identify the project as the archetype of the new spirit of capital a social order and economic practice that privileges flexible, mobile and temporary forms of labour . In contrast to the top - down hierarchical organizations associated with industry, projects render capital fluid . Assembling disparate groups of people for short periods of intense connection, these pockets of accumulation operate as an encounter . The logic of the encounter is that not being integrated once and for all into an institution or environment, it presents itself as an action to be formed, not as something that it is already there (boltanski & chiapello, p. 110). The links made through projects are continually suppressed to pursue other forms of connection made available in the those unable to join and profit from the shifting array of projects are excluded from the flows of capital . Boltanski and chiapello critique the normative imperative of mobility and its ideological associations with liberation . Immobility, they argue, serves a critical but often hidden function of cultivating social links the values the value of the hlc lies in its peculiar balance of circulation and emplacement . Despite its collaborative potential, within the global public health landscape, the umcp was a discrete project within the global public health landscape, funded by international donors and limited in time . Yet the presence of the mosquito catcher, night after night, embeds the resources of international science into the administrative practices of the municipality . He provides a platform to integrate and entangle mobile resources into fixed, stable institutions (kelly et al . 2010). His is a precarious position in the sense of being financially insecure and physically dangerous, but also one offering potential for new subjectivities, new socialities and a new kind of politics (gill & pratt 2008, p. 3). The capacity of the hlc to be there produces value by forming connections between the world as an object of description and the capacities of those who inhabit it . That epistemic intimacy takes considerable commitment once a week, at six in the evening, he will find his way to one of the four sampling locations in his neighbourhood, roll up his pants, and wait . My first thanks go to the corps, gerry killeen, prosper chaki, and the public health entomology team working with the ihi in dar es salaam . This article benefited greatly from the keen insight and generous attention of the blind reviewers and tony bennett . For their close reading, the research from which this paper draws was conducted with a wellcome trust bioethics grant grant (#2173) and written during a fellowship at the brocher foundation.
National comorbidity survey reveals that major depressive disorder (mdd) is a debilitating disease with a prevalence rate of 16.2% (kessler et al ., 2003). In depression remission is achieved by only one third of the patients after treatment with antidepressant agents (rush et al ., 2006). Another major disease as a global burden is obesity as it is directly associated with increased morbidity from cardiovascular disease, type 2 diabetes and some cancers . Epidemiological data suggest that obesity is linked to an increased risk of depressive and mood disorders (simon et al ., 2006). The current antidepressants like citalopram and fluoxetine have been reported to show resistance in depression associated with obesity (isingrini et al ., 2010). Despite this information, there is presently little information on how the development of obesity heightens the risk for depression . Chronic unpredictable mild stress (cums) is the most important pathogenic factor in several neuropsychiatric diseases such as depressive disorder, as stress exposure modifies the onset and evolution of some neurological diseases (garcia - bueno et al ., 2008). In rodents, cums model is mostly used for assessing the pathophysiology of depression and to study the effect of various therapeutic interventions on cums induced depression (willner, 2005). Furthermore, cums leads to various long term behavioral, neurochemical, neuroimmune and neuroendocrine alterations that resemble to those observed in patients with depression (cryan and holmes, 2005). Clinical reports suggest that obesity and other metabolic disorders are frequently observed among the individuals seeking treatment for mood disorders (mcelroy et al ., 2004). The biological mechanisms associated with increased cardiometabolic risk may contribute to the development of mood disorders such as depression (vogelzangs et al ., 2010). The patients with metabolic syndrome or insulin resistance syndrome experience a significantly elevated risk of developing depression (almeida et al ., 2009) pioglitazone (pgz),a well established drug known as peroxisome proliferator - activated receptor gamma (ppar-) agonist belonging to thiozolidinodienes (tzds) class regulates lipid metabolism, exerts potent central and peripheral anti - neuroinflammatory action and possesses neuroprotective effect (wozniak et al ., 1993; zhao et al ., 2006; garcia - bueno et al ., 2010, heneka and landreth, 2011). Several clinical and pre - clinical studies reported tzds as superior treatments for neurological and psychiatric conditions including autism (boris et al ., 2007), alzheimer s disease (miller et al ., 2011), multiple sclerosis (kaiser et al ., 2009) and mdd (kemp et al ., 2012). Insulin resistance and impaired glucose tolerance has been observed at higher frequency in depression (almeida et al ., 2009). A bidirectional relation between mood disorders and metabolic disturbances is well evident from the literature (barry et al ., 2009). Pioglitazone is well known drug in the treatment of insulin resistance or altered plasma glucose . Considering the insulin resistance or altered plasma glucose as important pathogenic link for depression associated with obesity, the present study was designed to investigate the effect of pioglitazone on cums induced depression in obese mice using behavioral tests and biochemical estimations . Behavioral experiments were conducted using male swiss albino mice (2025 g) that were procured from hissar agricultural university, hissar, india (reg . The animals were housed under standard laboratory conditions (temperature 22 2 c and room humidity 60 10%) and maintained on 12:12 h light / dark cycle and had free access to food and water . In india, committee for the purpose of control and supervision of experiments on animals (cpcsea) is established under prevention of cruelty to animals act 1960 . Cpcsea has a representative body at institute level named as institutional animal ethics committee (iaec). The experimental procedures performed on animals were in compliance with the protocol approved by iaec of birla institute of technology & science, pilani, india (protocol no . Animals were fed with high fat diet (hfd) for 14 weeks, prepared according to srinivasan et al . Pioglitazone and escitalopram was obtained from aarti drugs limited (tarapur, india) and ranbaxy laboratories limited (gurgaon, india) respectively, as a generous gift sample . The diagnostic kits for estimation of plasma glucose, total cholesterol, triglycerides and total proteins were purchased from spinreact, girona, spain . Pioglitazone was prepared as a suspension in 0.25% sodium carboxyl methyl cellulose (cmc) freshly every day . Pioglitazone was administered by oral gavage (p.o .) Daily from day 1428 of the cums procedure (table 1). The dose of pioglitazone (30 mg / kg p.o .) Was selected according to the earlier studies (kashani et al ., 2013, sato et al ., 2011, kubota et al ., 2006). Sixty mice were randomized based on body weight and divided into ten different groups (n = 6/group). Group i consisted of normal pellet diet (npd) mice receiving vehicle by gavage (10 ml / kg p.o . ), group ii comprised of npd + pioglitazone (30 mg / kg p.o . ), group iii comprised of npd + cums control, group iv consisted of npd + cums + pioglitazone (30 mg / kg p.o . ), group v consisted of npd + cums + escitalopram (10 mg / kg p.o . ), group vi comprised of hfd control, group vii consisted of hfd + pioglitazone (30 mg / kg p.o . ), group viii comprised of hfd + cums control, group ix consisted of hfd + cums + pioglitazone (30 mg / kg p.o .) And group x comprised of hfd + cums + escitalopram (10 mg / kg p.o . ). Initially, for one week period, animals were only subjected to different stress procedures . From day 8th to 28th along with stress, animals of group ii, iv, vii and ix received pioglitazone (30 mg / kg p.o . ), group v and x received escitalopram (10 mg / kg p.o .) Using oral gavage daily once, whereas, group i, iii, vi and viii were administered with vehicle orally through oral gavage as a suspension of 0.25% sodium carboxyl methyl cellulose (cmc) (table 1). The cums was performed as described earlier (ducottet et al ., 2003). Briefly, the cums protocol consisted of the sequential application of a variety of mild stressors . These stressors were randomly scheduled over one week period as shown in table 2, and repeated throughout the 4 week experiment . Non - stressed animals were left undisturbed in their home cages except during housekeeping procedures such as cage cleaning . The test was performed as described earlier (casarotto and andreatini, 2007) with minor modifications . Briefly, before the test, mice were trained to adapt to sucrose solution (1%, w / v), two bottles of sucrose solution were placed in each cage for 24 h and then one bottle of sucrose solution was replaced with water for 24 h. after the adaptation, mice were deprived of water and food for 24 h. sucrose preference test was conducted at 9:30 a.m. in which mice were housed in individual cages and were free to access to two bottles containing 100 ml of sucrose solution (1% w / v) and 100 ml of water, respectively . After 24 h, the volumes of consumed sucrose solution and water were recorded and the sucrose preference was calculated by the formula as described in following equation.% sucrose preference = [sucrose consumption (ml)/water + sucrose consumption (ml)] 100 the spontaneous locomotor activity of hfd obese mice subjected to cums was measured by using actophotometer (boissier and simon, 1965, engeland et al ., 2003) (inco, india) which consisted of a square arena (30 30 cm) and walls along with photocells just above the level of floor . On the day of experiment, before beginning of the tests, photocells were checked properly . As the beam of light is cut by the movement of animal the reading is automatically recorded by counter and displayed on the screen . Mice from all the respective groups were gently placed in the center of the box individually . After initial 1 min of acclimatization period, the locomotor activity score was recorded digitally for next 4 min in a dimly lit room . After each test, the floor was cleaned thoroughly with 75% alcohol solution to eliminate possible bias due to odors left by previous mice . Fst was performed as described previously (porsolt et al ., 1977) with slight modification . Briefly, the mice were individually forced to swim in a 25 12 25 cm (l b h) filled with water (23 2 c) up to a height of 15 cm . Animals were allowed to swim for 15 min as training period 24 h before commencement of the test . On the test day, after the initial 2 min of vigorous activity, mice were observed for immobility for next 4 min . An animal was considered to be immobile whenever it remained floating passively in the water in a slightly hunched but upright position, its nose above the water surface . This immobile posture reflects a state of behavioral despair or helplessness (santiago et al ., 2010). Briefly, mice were suspended by the bands and hung from a hook mounted 50 cm above the floor for 6 min . The time that the mice spent immobile during the 6 min of the testing period was measured . The elevated plus maze was performed by the method mentioned earlier (adeyemi et al ., briefly, it consisted of two open and two closed arms (all arms: 20 4 12 cm) made of wooden blocks elevated at a height of 25 cm from floor, which was lighten with 60 w bulb through a height of 100 cm . Each mouse was placed in the central square (5 cm 5 cm) facing an open arm and allowed to explore the maze for 5 min of test period . The parameter measured was time spent in open arm and number of entries in open arm . The maze was cleaned with dilute alcohol in between two test sessions to get rid of residual odor . Two days post behavioral tests, animals were bleeded by sinus retro - orbital route for collection of plasma in a tube containing 10 l of heparin solution and centrifuged at 10,000 rpm for 15 min . Estimation of plasma glucose (trinder, 1969), total cholesterol (meittini et al ., 1978), triglycerides (buccolo and david, 1973) and total proteins (koller, 1984) was done by using commercially available kits (spineract). Data were analyzed using graph pad prism software version 2.01 (graphpad software, la jolla, usa). All the values are expressed as mean standard error of the mean (s.e.m . ). The significance of differences between groups for behavioral and biochemical assays were analyzed using two - way analysis of variance (anova) followed by post hoc bonferroni test . For statistical analysis p hfd control group showed significantly (p <0.01) higher body weight compared to npd control animals . Hfd mice exposed to cums showed significant weight reduction compared to hfd control group (p <0.01). Repeated treatment with pioglitazone (30 mg / kg p.o .) And standard reference drug escitalopram (10 mg / kg p.o .) Significantly [f (9, 50) = 708.7, p hfd control animals showed significantly (p <0.01) reduced sucrose consumption compared to normal control animals (fig . 2). Hfd + cums control group exhibited significantly (p <0.01) decreased sucrose consumption as compared to hfd control animals . Chronic treatment with pioglitazone (30 mg / kg p.o .) And standard escitalopram (10 mg / kg p.o .) Showed significantly [f (9, 50) = 14.18, p <0.01] increased sucrose consumption in obese mice subjected to cums . The locomotor activity in normal, hfd obese and hfd + cums animals is shown in fig . No alteration was observed in the locomotor activity between the normal control and hfd control mice . However, obese mice subjected to cums showed significantly (p <0.01) decreased locomotor activity as compared to hfd control group . Chronic treatment with pioglitazone (30 mg / kg p.o .) And standard drug escitalopram (10 mg / kg p.o .) <0.01] reversed the cums induced reduced locomotor activity in obese mice . Fig . 4 shows the effect of repetitive treatment on immobility time in fst in stressed obese mice . Hfd control animals exhibited significantly (p <0.05) increased immobility time in fst compared to normal control animals . Cums significantly (p <0.05) increased the immobility time in obese in fst compared to obese control group . Pioglitazone (30 mg / kg p.o .) And standard escitalopram (10 mg / kg p.o .) Significantly [f (9, 50) = 18.56, p <0.01) reduced the immobility time in obese mice subjected to cums in fst . The effect of pioglitazone treatment on immobility time in tst is shown in fig . Hfd control animals exhibited significant (p <0.05) higher immobility time compared to normal control group in tst . In obese animals cums significantly (p <0.05) increased duration of immobility as compared to hfd control group . Chronic treatment with pioglitazone (30 mg / kg p.o .) And standard reference drug escitalopram (10 mg / kg p.o .) P <0.01] reduced the immobility time in obese animals subjected to cums compared to hfd + cums control group in tst . Hfd group showed significantly (p <0.01) reduced percent time spent in open arm as compared to normal control animals . Hfd + cums animals showed significantly (p <0.01) decreased time in open arm as compared to hfd control animals . However, percent open arm entries were not significantly altered in hfd and hfd + cums animals compared to normal and hfd control groups, respectively with pioglitazone treatment . Repetitive treatment with pioglitazone (30 mg / kg p.o .) And standard escitalopram (10 mg / kg p.o .) Showed significant [f (9, 50) = 13.11, p <0.01] increased percent time in obese animals subjected to cums as compared to hfd + cums control group . Pioglitazone (30 mg / kg p.o .) And standard escitalopram (10 mg / kg p.o .) Did not showed significant effect on the percent open arm entries in obese mice subjected to cums . The effect of pioglitazone treatment on plasma biochemical parameters is shown in table 4 . Hfd control animals showed significant (p <0.01) increased levels of plasma glucose, total cholesterol, triglycerides and total proteins as compared to normal control animals . Obese mice subjected to cums showed significant (p <0.05) increased plasma glucose as compared to hfd control animals, whereas no significant alterations in plasma total cholesterol, triglycerides and total proteins were observed in obese mice subjected to cums compared to hfd control group . Chronic treatment with pioglitazone (30 mg / kg p.o .) And standard drug escitalopram (10 mg / kg p.o .) Significantly reduced the elevated plasma glucose [f (9, 50) = 9.89, p <0.01], total cholesterol [f (9, 50) = 24.14, p <0.05], triglycerides [f (9, 50) = 19.42, p <0.05] and total proteins [f (9, 50) = 5.46, p <0.01] as compared to hfd and hfd + cums groups, respectively . Several meta - analysis studies demonstrated that obesity is associated with increased risk of developing depression (zhao et al ., 2009). The chronic consumption of hfd risks the anxiety and depressive - like behavior, heightens the hpa axis response to stress and leads to several biochemical modifications (sharma and fulton, 2012). The use of animal model for human mental disorder, despite of their oblivious limitation have proved to be of great value in the pre - clinical analysis for experimental validation of psychopharmacological assessment . It is reported that, chronic stress plays an important role in the onset and relapse of depression (lee et al ., 2002). Cums induced depression is probably the most popular and suitable model to study depressive behavior in rodents as it possesses higher face, construct and predictive validities, reflecting the similarities in the pathogenic and behavioral alteration in human and animal depression . Cums model aims to simulate severe depressive - like condition that is developed gradually as those are generally observed in depression patients (luo et al ., 2008). However, cums model provide insight but obviously cannot recapitulate the complex pathophysiology of major depressive disorder (willner et al ., 1992). These abnormal lipid levels inhibit the release of insulin in response to glucose that further worsens the insulin resistance (borchard, 2001). Stress also plays a crucial role in the development of systemic inflammation that are considered as metabolic syndrome by elevating the levels of pro - inflammatory cytokines such as tumor necrosis factor - alpha (tnf-), interlukin-6 (il-6) (wisse, 2004). Evidence supports the role of these inflammatory markers in development of diabetes (pradhan et al ., 2001). Earlier research has made a clear indication of the relationship between stress response, visceral fat, insulin resistance and hpa axis dysregulation (rosmond et al ., 1998). It has been reported that psychosocial stress in primates leads to development of several abnormal conditions such as elevated corticosterone, insulin resistance, dyslipidemia, hypertension and coronary atherosclerosis (jayo et al ., 1993). In humans stress causes abnormal cortisol secretion that further causes metabolic disorder such as insulin resistance, diabetes and psychological diseases such as depression, anxiety (rosmond and bjorntorp, 2000, raikkonen et al ., 1994). Hippocampus, striatum, frontal cortex and hypothalamus (drew et al ., 2006) and expressed on immune cells (heneka et al ., 2007). Several clinical (kemp et al ., 2006, kemp et al ., 2012) and pre - clinical studies (eissa et al ., 2009, sadaghiani et al ., 2011) have described the antidepressant - like effects of ppar agonists rosiglitazone and pioglitazone . Anhedonia indicates lack of pleasure or interest which is one of the major hallmark of human depressive symptoms and in animals this is evidenced through reduced preference for sucrose (willner et al ., 1987, strekalova et al ., 2006). Further, high predictive validity models (cryan and slattery, 2007, cryan et al ., 2005) like fst and tst were performed . In order to avoid the false positive results, locomotor activity score was measured and no alterations were observed in the basal locomotor activity between normal animals and hfd control animals . Epm is widely used for screening anti - anxiety agents (hogg, 1996) where it reflects the psychomotor and emotional aspects in rodents which correlate with unconditioned anxiety . Anxiolytics elevates the frequency of entries and time spent in open arms in epm (dawson and tricklebank, 1995). Overall, the result of behavioral studies examines the antidepressive - like effect of pioglitazone by improving sucrose consumption, reducing immobility time in fst and tst, increasing percent open arm time in epm on cums induced depression in obese mice . Furthermore, in the biochemical assessments, plasma glucose, total cholesterol, triglycerides and total proteins were estimated in obese mice subjected to cums . Plasma glucose is one of the most important biochemical assessments as insulin resistance is observed in depression and obesity . Earlier reports claimed insulin resistance due to excess cortisol release in the circulation owing to dysregulation of hypothalamus pituitary adrenal (hpa) axis, as observed in depressed and obese subjects (brown et al ., 2004). Obesity is well known metabolic disorder in which insulin resistance holds the key and is characterized by dysregulation of lipids (kahn and flier, 2000, lee et al ., 2013). In the earlier reports it is well understood that, an association of dyslipidemia and obesity with the individuals reflecting more depressive and anxiety - like behavior (van reedt dortland et al ., 2010). Reduced level of total proteins in depression (maes et al ., 1995) whereas, unclear influence of total protein synthesis in obesity is well discussed previously (anderson et al ., 2008). Our study showed elevated plasma glucose, total cholesterol, triglycerides and total proteins in hfd obese mice subjected to cums . Pioglitazone reversed these biochemical alterations through agonistic action at ppar - gamma receptor thereby increasing the peripheral glucose utilization . Moreover, we claim that altered glucose or insulin resistance as major hallmark for depressive behavior associated with obesity and treatment of the altered glucose or insulin resistance ameliorates these co - morbid disorders . The results of biochemical assessments showed similarities with the earlier reports suggesting improved insulin sensitization and lipid lowering properties of pioglitazone by regulating a transcription factor responsible for glucose and fat metabolism (srinivasan et al ., 2004). From a mechanistic standpoint, improved depression severity with repetitive pioglitazone treatment may occur due to decreased in visceral adiposity and inflammation, and improved insulin sensitivity ., 1997) that may mediate improved depressive behavior by increasing neuronal survival (fuenzalida et al ., 2007), increasing glial uptake of excitotoxic molecules (romera et al ., 2007), or modulating calcium dependent pathways in the brain (pancani et al ., 2009). A better understanding of the mechanisms linking insulin resistance with depression could provide therapeutic strategies with novel mechanisms . Although the exact mechanism(s) of pioglitazone is not well understood, it is known to decrease free fatty acid levels and insulin gene transcription, to remodel lipid distribution and to improve glucose disposal in insulin - resistant individuals (schinner et al ., 2009). At the molecular level, it acts as ligands for ppar, a nuclear receptor of the nr1c family, expressed predominantly in adipose tissue . In addition to improving glucose disposal, pioglitazone favorably altered lipid distribution in the body . Deposition of fat in the non - adipose tissue such as liver and muscle has been implicated in the development of insulin resistance . The ppar agonist pioglitazone is known to improve lipid distribution, insulin sensitivity and to suppress hepatic glucose production (vikram et al ., 2010). The plasma glucose and lipid profile was reduced by pioglitazone in our findings in obese animals exposed to chronic stress . This was our preliminary investigation suggesting that as pioglitazone has ability to cross bbb, future research exploring this mechanism could turn out very crucial . Also, pioglitazone has ability to improve peripheral insulin sensitivity by controlling the blood glucose and lipid distribution . Therefore, studying and exploring the mechanisms of pioglitazone including both central action and peripheral action could be very interesting area of for future research in the field of metabolic brain disorders such as co - morbid depression, anxiety associated with obesity . In conclusion, in the present study chronic treatment with ppar agonist, pioglitazone reversed the cums induced behavioral and biochemical changes in obese mice, thus exhibiting antidepressive - like effect . The plasma glucose level indicates that the altered plasma glucose or insulin resistance, to play a crucial role in such co - morbid disorders and pioglitazone through activation of ppar receptors alleviated the altered plasma glucose or insulin resistance and exhibited antidepressant - like effect . However, these are only the preliminary findings and hence, further studies dealing with the role of pioglitazone with respect to molecular mechanisms including brain derived neurotrophic factor (bdnf), corticosterone levels, mrna expression in cortex and hippocampus in depression associated with obesity will shade light on the mechanism aspects.
We describe a case of pseudotumor cerebri in a young man developing 4 years post - traumatic brain injury (tbi). This is a rare clinical scenario and delayed presentation following tbi with chronic headaches should raise this possibility . Detailed clinical history and examination with appropriate investigations must be performed to diagnose this condition . A 29-year - old male was admitted to our unit with head injury following a road traffic accident . His glasgow coma score was 15/15 at admission and had no neurological deficits on examination . Ct brain showed small right frontal extradural hematoma with associated pneumocranium, right orbital roof, and cribriform plate fracture . A repeat ct brain scan revealed an increase in the size of the extradural hematoma following which he underwent a frontoparietal craniotomy and evacuation of the extradural hematoma . He recovered well postoperatively and was discharged home . Since discharge, he experienced intermittent frontotemporal headache and worsening of short - term memory . Five months later, he developed a right - sided facial swelling and erythema, with frontal headache, fever, and episodes of vomiting . Removal of infected bone flap was performed, and staphylococcus aureus was isolated from the bone flap . His headache persisted following treatment, and he had no signs suggestive of raised intracranial pressure . He remained well for the next 12 months apart from episodes of headaches on and off . A lumbar puncture was performed after imaging and was noted to have an elevated csf pressure of 20 mmhg and a diagnosis of pseudotumor cerebri was made . He underwent a lumbar - peritoneal (lp) shunt and postoperatively his symptoms improved transiently over the next few weeks . He had gained 9 kg of weight over the course of 4 years .two months subsequent to lp shunt insertion, he presented with worsening headaches and a new lumbar puncture showed an opening pressure of 25 mmhg, and closing pressure of 8 mmhg with no evidence of csf infection . Ct brain revealed no evidence of increase intracranial pressure, and a right ventriculo peritoneal (vp) shunt was inserted . His headache persisted following vp shunt insertion and subsequent to this he underwent bitemporal decompression (craniectomy) in 3 weeks time with the removal of lp shunt [figure 1]. He had two further vp shunt blockages and he developed a slit ventricle syndrome despite the shunt malfunction [figure 2]. A ct venogram was performed 1 year later, which demonstrated a stenosis of the left transverse sinus and sigmoid sinus with hypoplastic right transverse and sigmoid sinuses . The cerebral venous pressure was measured with significant left transverse sinus stenosis, and pressure gradient of 2612 mmhg,> 50% gradient . This was managed nonoperatively, and it was found not to contribute to his on - going symptoms . He was also commenced on acetazolamide for the management of pseudotumor cerebri . Ct brain demonstrating bitemporal decompressive craniectomy ct brain with vp shunt in situ and slit - ventricle with an underlying shunt malfunction pseudotumor cerebri is more commonly seen in young obese women than men . In a study by durcan et al . Determining the incidence of pesuedotumor cerebri in iowa and louisiana, it was noted that obesity increased the incidence in both males and females with a overall female - to - male ratio of 8:1 . Pseudotumor cerebri is a relatively common neurologic illness and may be an important preventable cause of blindness in obese young women . Pseudotumor cerebri usually presents in adults with transient visual obscuration and blurred vision in contrast to development of diplopia in the pediatric age group . Various clinical conditions and factors are associated with development of pseudotumor cerebri . In our case we focus on the possible etiology following tbi and have attempted to outline the possible causes for the development of pseudotumor cerebri . The question then arises as to why all the patients with tbi do not develop pseudotumor cerebri . The mechanism of csf flow dynamics alteration following central nervous system infection and cerebral blood flow alteration is usually seen during the period of insult to the brain and transient alteration in the physiology is a reversible phenomenon depending on the severity of head injury . The pathological process reverts to normal and very rarely, as in this case, may lead to the development of pseudotumor cerebri . Possible etiologies contributing to pseudotumor cerebri mastoiditis and subsequent venous thrombosis is a known to cause pseudotumor cerebri, and there was no evidence of sinus thrombosis on imaging in our case . The bone flap infection may have altered the cerebral venous drainage and subsequently caused changes in the csf slow dynamics . The patient had gained weight following the head injury, and weight gain and obesity are important etiological factors in the development of pseudotumor cerebri . The management was aimed at preventing the possibility of optic nerve damage and blindness in benign intracranial hypertension (bih), vp shunt, and lp shunt are the surgical options available for pseudotumor cerebri and our patients visual symptoms got better following csf diversion procedures . We experienced the difficulty in managing the patient in the later stage due to shunt dysfunctions with associated slit - ventricle syndrome . This procedure was resorted to, as a last option for controlling headaches and it is known to be effective in symptomatic control in the some group of patients described in the literature . The prognosis for vision in most patients with pseudotumor cerebri is excellent; however, visual loss, which is the only serious complication, may occur either early or late in the course of the disease . When a post - head injury patient presents with history of chronic headache with visual disturbance, pseudotumor cerebri should be considered a strong possibility . Neuroimaging in the form of brain ct, mri, and mr venogram must be considered to rule out vascular pathology and a diagnostic lumbar puncture is recommended . Csf flow diversion techniques must be adopted to treat this condition, and these may require long - term follow - up.
Anthracyclines are the most frequent cause of iatrogenic congestive heart failure ranging from acute reversible minor to irreversible reduction in the left ventricular (lv) ejection fraction and death despite preventive measures . Serial surveillance for cardiotoxicity in patients receiving anthracyclines has most commonly centered on the assessment of lv systolic function by standard echocardiography . The development of new quantitative echocardiographic techniques, such as ultrasonic strain (s) and strain rate (sr) imaging, has enhanced our ability to noninvasively assess regional myocardial function . We investigated the lv function, using doppler derived s and sr imaging, in long - term survivors affected by acute lymphoblastic leukemia (all) treated with a low cumulative dose (210 mg / m) of anthracyclines, and in presence of a normal global lv systolic and diastolic function, as assessed by standard echocardiography . The study population was recruited between january 1983 and december 1990 at the pediatric oncology service of second university of naples and studied at the pediatric cardiology outpatient clinic of the same university . All patients were affected by all: of the original 112 patients diagnosed in that period, 44 were excluded because died of disease, 30 declined the invitation to undergo echocardiogram, and 16 were excluded for inadequate echocardiogram . The remaining 21 patients, who were in continuous remission, presented no cardiac symptoms, have been treated with a low cumulative dose of anthracyclines (210 mg / m), and had received the last dose at least 10 years previously, were considered eligible for the study . In this group, mean age at diagnosis was 3.6 years (range 1 - 11 years) and the mean of follow - up interval from last dose of anthracycline was 15.7 years (range 11 - 20 years). The mean cumulative dose of anthracylines was 180 mg / m (range 120 - 210 mg / m). All patients were recruited in associatione italiana ematologia - oncologia pediatrica - all protocols . In detail, 1 patient was enrolled in 8201-protocol; 5 patients in 8202 protocol; 12 patients in 8702 protocol; and 3 patients in 8703 protocol . The control group consisted of 21 healthy subjects, comparable for age and sex . All patients and controls gave written informed consent to participate in the study . Both the standard echocardiographic study and the color doppler myocardial imaging (cdmi) data were digitally stored and all the measurements were performed off - line by 2 independent observers who were blind to the clinical status of the subjects . The standard echocardiographic study has been performed following a standard methodology . The myocardial performance index (mpi), defined as the sum of isovolumic activity (isovolumic contraction time and isovolumic relaxation time) divided by ventricular ejection time, all cdmi data were acquired at a frame rate of 220 15 frames / s (ge vingmed system seven; 3.5 mhz). The normality kolmogorov - smirnov test was performed to determine whether continuous variables were normally distributed . A comparison between groups of continuous variables was performed by using the student's t test, whereas skewed distributed variables were compared by using the rank mann - whitney u test . Categorical variables were compared by using the chi - square test . A p value <0.01 was used to reject the null hypotesis . All the analyses were performed using a commercially available package (spss, rel 11.0 2002 . The normality kolmogorov - smirnov test was performed to determine whether continuous variables were normally distributed . A comparison between groups of continuous variables was performed by using the student's t test, whereas skewed distributed variables were compared by using the rank mann - whitney u test . Categorical variables were compared by using the chi - square test . A p value <0.01 was used to reject the null hypotesis . All the analyses were performed using a commercially available package (spss, rel 11.0 2002 . Clinical and standard echocardiographic characteristics of the studied sample ivsedd = interventricular septum end - diastolic dimension, pwedd = posterior wall end - diastolic dimension, ef = ejection fraction, dt = deceleration time, ivrt = isovolumic relaxation time, mpi = myocardial performance index, all = acute lymphoblastic leukemia the normal children did not significantly differ from patients in age, sex, heart rate, and blood pressure . Both groups had similar standard measurements of lv systolic and diastolic function (lv ejection fraction and mitral e / a ratios). The lv mpi in the study patients was not statistically different from that of normals [table 1]. Longitudinal s and sr were similar to those measured in healthy subjects [table 2]. Peak systolic longitudinal strain values (%) of the studied sample a4c = apical 4 chamber view, all = acute lymphoblastic leukemia radial s (17 3% vs. 55 6%, p <0.0001) and sr (2.1 0.3 vs. 3.0 0.8 1\s, p <0.0001), assessed on the midsegment of the posterior wall from the parasternal views were significantly reduced when compared to healthy subjects [table 3]. One patient (5%) had both peak systolic radial s and sr <2 sds below the mean of normal subjects . Peak systolic radial strain and strain rate values of the studied sample sax = parasternal short axis view, plax = parasternal long axis view, all = acute lymphoblastic leukemia doppler derived s and sr indices unmask early systolic abnormalities in long - term survivors of all treated with low cumulative dose of anthracycline . Radial myocardial deformation is involved in systolic dysfunction, while longitudinal myocardial deformation is normal . This finding may seem surprising since in several cardiac disease (coronary artery diseases or valvular heart diseases) longitudinal dysfunction generally appears very early as the first stage of subclinical myocardial damage, in contrast radial strain deteriorates later when ejection fraction starts to decrease . The possible explanation of this earlier radial functional deterioration may be related to the different mechanism leading to cardiac dysfunction in in long - term survivors of all treated with anthracycline . Indeed, oxidative stress plays a major role in anthracycline - induced cardiomyopathy, stochastically involving myocites . The longitudinally directed fibers compose only a small portion of the myocardial mass, while myocardial fibers responsible of the radial function are quantitatively more represented, and thus more exposed to oxidative damage . On the contrary in coronary artery disease or valvular heart disease the subendocardial layer, responsible of longitudinal function, significant abnormalities of s and sr occurred in presence of normal standard echocardiogrphic doppler measures of lv systolic or diastolic function . These changes occurred at cumulative dosages as low as 100 - 210 mg / m . In our sample, only four patients had a cumulative dosage between 200 and 210 mg / m . Of note, this finding is in agreement with previous report demonstrating that mpi is able to detect changes in global myocardial function in presence of a cumulative dose of antracycline 200 mg / m . In this preliminary study, the myocardial deformation indices appear to be a more sensitive noninvasive technique for detecting subclinical lv dysfunction than other echocardiographic measurements . Thus, we are limited by angle dependency and we can only assess radial function at the level of the midsegment of the posterior wall . For the same reason, reliable cdmi data were obtained in all patients from the apical 4 chamber view, while relible data were obtained only from 80% of our patients in apical 2 chamber view . Conversely, color doppler derived imaging is the only way to fully resolve sr which is less load dependent compared with s. thus, we are limited by angle dependency and we can only assess radial function at the level of the midsegment of the posterior wall . For the same reason, reliable cdmi data were obtained in all patients from the apical 4 chamber view, while relible data were obtained only from 80% of our patients in apical 2 chamber view . Conversely, color doppler derived imaging is the only way to fully resolve sr which is less load dependent compared with s.
With increasing medical care costs and a weakening economy more attention is being placed upon obtaining value from how health care dollars are spent . Initiatives to obtain increased value from health care purchases are especially focused upon perceived waste (aaron, 2008). The frequency and cost of hospital acquired complications are at the forefront of perceived waste since hospitals, patients and payers are all adversely impacted by their occurrence . Following the final implementation of the national uniform billing committee changes (ub 04) on may 23, 2007, the standard claims form was modified to allow the submission of a present on admission (poa) indicator for each diagnosis . In october of 2007, medicare began requiring that the poa indicator be submitted on all medicare claims . This change has permitted, for the first time, the ability to distinguish, using standard claims data, complications that are hospital acquired from those developed prior to admission . Both payers and hospital providers have responded to this newly acquired, and evolving, information source by developing initiatives to reassure stakeholders that they are focused upon meaningful change to improve the quality of health outcomes . As required by the deficit reduction act of 2005 (p. l. 109 - 171), cms has led the way for payers by enacting a policy whereby any payment increase due to the occurrence of a limited range of hospital acquired complications is eliminated . For cms the anticipated reduction in spending is $21million out of the total $105 billion (.02%) that is currently paid for inpatient hospital operating payments within the inpatient prospective payment system for short term acute hospitals (centers for medicare & medicaid services, 2008). As preemptive initiatives, many hospital associations have responded by creating voluntary guidelines for specified adverse events (so called never events) where no charge is made to payers . While the purpose of these payment reductions is to provide incentives to improve quality, the amount of payment currently associated with these efforts, relative to the total cost of hospital care, is very small . It is the purpose of this article to develop an estimate of the incremental cost of different types of hospital acquired complications and to determine the total incremental cost burden of hospital acquired complications on the health care system . Improved estimates of the magnitude of incremental cost incurred by short term acute hospitals due to hospital acquired complications should stimulate debate around the financial justification for supporting quality improvement efforts aimed at reducing hospital acquired complication rates . Further, the availability of estimates of the incremental cost of individual types of hospital acquired complications will expand the policy options open to cms for broadening the range of the hospital acquired complications subject to payment reductions . While it is important to understand that not all hospital acquired complications can reasonably be thought of as being preventable, high complication rates at individual facilities, after adjusting for the mix and severity of illness of patient admissions, are indicative of low quality care and system waste (peng, kurtz, and johannes, 2006). In order to identify the complete spectrum of hospital acquired complications the potentially preventable complication (ppc) were used in this analysis (hughes et al ., 2006). Ppcs identify potentially preventable harmful events or negative outcomes originating during inpatient care that result from the processes of care and treatment rather than from the natural progression of underlying disease . Ppcs contain 64 mutually exclusive types of inpatient complications that are identified from 1,450 icd-9-cm secondary diagnosis codes not present on admission, and from selected icd-9-cm procedure codes . A post admission complication may be preventable for some types of patients but not for others . Therefore, the ppc methodology includes a series of clinical exclusions that prevent a ppc from being assigned to a patient when there are other underlying diseases present at admission for which the complication would represent an inevitable, natural or expected progression, consequence or manifestation of a pre - existing underlying condition . Patients having one or more ppcs present can be hypothesized as having additional costs in comparison to similar patients who do not . For example hospital costs will increase when a patient develops a urinary tract infection (uti) due to an indwelling urinary catheter (iuc) during a hospital stay . Patient treatment costs vary depending upon the patient's reason for admission, severity of illness at the time of admission and the presence of post admission complications . Isolating and quantifying the incremental cost of a specific type of complication requires the disentangling of these interrelated factors . In order to adjust for the mix and severity of illness of patients, all patient refined diagnosis related groups (apr drg) were used to classify patients in terms of their reason for admission and severity of illness at the time of admission (averill et al ., 2002; sedman et al ., 2004). Version 26.1 of the apr drg system incorporates an admission apr drg as standard output . The admission apr drg differs from the discharge apr drg in that only those conditions that were reported as present, or can be clinically assumed to be present, at the time of admission are used in making the apr drg assignment . Conditions or complications that occurred during the hospital stay are not used to assign a patient to an admission apr drg . Procedures that were clearly related to a post - admission event (i.e., complications) are also excluded from the admission apr drg assignment . Apr drgs assign each patient to one of 314 base apr drgs that describe the patient's reason for admission and further subdivides each base apr drg into four levels of illness severity (soi) subclasses . The term apr drg is used to refer to the 1,256 base apr drg and soi subclass combinations . Maryland and california require the reporting of the poa indicator for all short - term acute hospital patients . In maryland, hospital data can be obtained from the health services and cost review commission (hscrc), while in california, hospital data can be obtained from the office of statewide planning and development . Fiscal year 2008 (july 2007 june 2008) maryland data and fiscal year 2006 (october 2005 the consistency of reporting of the poa data in the two data sets was evaluated using an extensive set of edits . Of the 48 hospitals in the maryland database, five hospitals comprising 83,863 patient claims were removed . Of the 353 hospitals in the california database, patient claims with a discharge status of transferred (2) or expired (20) were excluded from analysis, as were claims that were classified within claims that had total charge values below $200 or above $2,000,000 were similarly excluded because extraordinarily high and low cost claims have the potential to introduce significant estimation error into the regression model . Further, the dollar exclusion threshold was introduced in the absence of a systematically applied policy to determine outliers within apr drgs and the lack of availability of hospital specific cost to charge ratios for the california data . Maryland's hscrc regulates hospital charges to closely track efficient hospital costs thereby obviating the need to incorporate cost to charge ratios . In applying its rate setting methodology the hscrc creates approved base rate values, charge per case (cpc), that factor in estimates for indirect medical education (ime), disproportionate share (dsh), uncompensated care, capital and labor variations . Additionally, charge patterns are constrained so as to match reported cost at a service level . Maryland claims charges were standardized using hospital specific cpcs to equate individual hospital charges with the statewide average . The california data lacked both the hospital specific payment variables available in the maryland data and a hospital specific identifier that could be linked to hospital cost data made public through the medicare program . Instead a single standard approximation of a statewide cost to charge ratio was applied to all charges to transform charge values to more closely approximate actual cost . The cost to charge ratio used was 0.264 and derived from the hospital unweighted median cost to charge ratio used by california's division of workers compensation effective april 1, 2007 (division of workers compensation, 2007). This is a linear transformation with the singular purpose of simplifying subsequent interpretation of coefficient values rather than correcting estimation error . California data was therefore not adjusted for the effect of variation in cost to charge ratios across hospitals and service lines . Similarly, the known effects upon costs posed by teaching programs, the prevalence of indigent patients and geographically induced input cost variation was not adjusted for . As with any predictive estimate attempting to relate costs to charge patterns, the inability to adjust for these factors in the california data reduces the accuracy of the incremental cost estimates . The final california analysis database contained 235 hospitals comprising 1,836,396 patients . Inpatient hospital claims for the maryland and california data sets no adjustment, other than the specified $200/$2 million exclusion, was made to exclude extraordinarily high or low cost claims having created two independent analysis databases (maryland and california), with admission apr drgs assigned, approximate claim level costs calculated and ppcs identified, a simple linear regression was specified of the form: cost i is the adjusted charge for claim i apr drg k, i is a binary variable (0,1) indicating which of the 1,256 admission apr drg k was assigned to the i claim ppc ji is a binary variable (0,1) indicating which of the j ppcs were present on the i claim is the average cost for a reference apr drg, excluding the incidence of ppcs, which acts as a constant cost contribution to each claim k is the coefficient associated with apr drg k and measures the incremental cost above due to the patient's reason for admission and admission severity of illness level j is the coefficient associated with ppc j and measures the incremental cost for patients with ppc j relative to patients that do not have ppc j i is the residual error of the model for discharge i as specified, the regression model hypothesizes that cost increases associated with ppcs are both uniform and act independently of the base apr drg and severity level to which they are assigned . The hypothesized model treats the cost of complications as both additive and uniform across apr drgs . Estimates of incremental cost associated with a specific ppc can therefore be interpreted as constant amounts independent of the specific apr drg in which they occur and independent of the presence of other ppcs . To calculate stable estimates first, if an apr drg had fewer than 21 claims assigned, all patients assigned to the apr drg were omitted from the analysis . Correcting for low volume apr drgs is particularly important because an imprecise estimate of the average cost in an apr drg could impact the estimate of the constant coefficient for a ppc applied across all apr drgs . Second, a t - test was applied to identify apr drgs that had coefficients that were not statistically significant at the 0.05 level . Such apr drgs were omitted from the analysis database because lack of statistical significance implies excessive cost volatility in those apr drgs . No attempt was made to retain apr drgs by introducing a synthetic outlier policy to reduce the impact of extraordinary costly claims . To do so would be to import assumptions surrounding the causation of outliers and potentially their relationship with ppcs . As detailed below, the application of these statistical edits had minimal impact on the final retention of claims within the analysis database . Twenty - nine of the possible 1,256 apr drgs had no claim volume while 217 apr drgs had fewer than 21 claims, resulting in 1,920 claims being removed from the analysis database . An additional 22 apr drgs were not statistically significant resulting in an additional 5,914 claims to being removed from the analysis database . In total 7,834 (1.2%) claims after standardization the sum of adjusted charges (approximate cost) for the remaining claims was $6,504,557,501, approximately $9,980 per included claim . In the maryland database 36,474 patients had one ppc (5.6%) and 14,518 patients had multiple ppcs (2.2%). Nineteen of the possible 1,256 apr drgs had no claim volume while 150 apr drgs had fewer than 21 claims, resulting in 1,214 claims to being removed from the analysis database . An additional 10 apr drgs were not statistically significant resulting in an additional 1,147 claims to being removed from the analysis database . In total 2,361 (0.1%) claims after standardization the sum of adjusted charges (approximate cost) for these remaining claims was $18,509,876,873, approximately $10,090 per included claim . In the california database 72,819 patients had one ppc (4%) and 29,026 patients had multiple ppcs (1.6%). The fit of the regression model for estimating per patient cost, measured by the adjusted r statistic, was 0.58 for maryland data and 0.60 for california data . This result is obtained by using the apr drg assigned at admission with separate identification of ppcs that occur after admission to predict patient cost . The combination of admission apr drgs and ppcs therefore offers a robust fit for the variation in per claim costs . For each of the 64 ppcs in the second column of table 1, the coefficient value (coeff) measures the incremental patient cost (i.e., j) above that of patients in the same admission apr drg associated with the presence of the ppc after accounting for the presence of other ppcs . This value is referred to as the incremental cost of the ppc . Since the regression model is additive, multiplying the frequency (freq) of the ppc by its incremental cost calculates a total cost associated with each ppc . The total cost for all included claims in the maryland data is $6,504,557,501, of which $626,416,710 (9.63%) is associated with ppcs . An asterisk in the standard error column indicates that the incremental cost estimate for the ppc is not statistically significant . Ppc 32 transfusion compatibility reaction is statistically significant but should be interpreted cautiously due to the low volume of observations . The impact upon total costs of the 13 ppcs that are not statistically significant is minimal . In column 6 the total estimated cost for each ppc, (freq*coeff), thus, pneumonia and other lung factors, ppc 5, contributes 0.93% to total inpatient cost . In column 7 the total estimated cost for each ppc, (freq*coeff), is divided by the total cost of all patients who had that ppc expressed as a percentage . Thus, for patients who had the ppc, column 7 is the average per patient cost increase due to the ppc . For example, utis (ppc 22) account for 0.67% of total inpatient hospital costs (column 6) and on average when a uti occurs patient level cost increases by 19.6% (column 7). California claims constitute a similar percentage of total costs associated with ppcs (9.39% percent for california versus 9.63% for maryland). As shown in table 2, 3 ppcs have no volume and 8 ppcs lacked statistical significance . As with maryland data table 3 ranks 48 ppc coefficient estimates that are considered statistically significant in both databases . The spearman's rank correlation coefficient is 0.90 indicating that the relative value of coefficient estimates is highly correlated between the two states . The coefficient estimates for both california and maryland data in table 3 show significant bunching around ppc types . For example the eight ppcs with the lowest predicted values of incremental cost in the california data (ranks 48 41) correspond with the same eight ppcs in maryland data and occupy a range of $2,720 in california and $2,312 in maryland . The california ppc coefficients are larger for 41 of the 48 ppcs while the estimation of the percentage of total cost associated with complications is greater in maryland . Given the independence of the two data sources it is not to be expected that the two sets of results would be identical, but it is worth addressing these findings in more detail . Firstly, while the estimated incremental cost per ppc is generally higher in california than maryland, the cost per claim utilized in the estimates for california is also higher ($10,090 versus $9,980). Moreover, to interpret the difference in coefficient magnitude from the two databases, the average claims value for each needs to be adjusted for case mix intensity . Relative weights for this purpose were calculated using the healthcare cost and utilization project (hcup) claims data for cy2006 . Apr drg v26.1 weights were calculated from claims data based upon time of discharge for this portion of the analysis . The resultant average statewide case mix value, case mix index (cmi), was computed for california and maryland . The cmi for the california claims was found to be 1.08, while the cmi for maryland claims was 1.12 . Deflating the average value observed for each database by its cmi yields adjusted values of $9,323 for california and $8,929 for maryland . A more accurate comparison of coefficients is therefore obtained by reducing the magnitude of coefficients in the california data by 4.4% ($9,323/$8,929). This adjustment results in ppc 14 having a larger estimated coefficient for maryland than california while the estimation differences between other ppcs is narrowed . A second contributing factor to the observed differences is the relationship between patient severity at the time of admission and the frequency of complications (hughes et al ., 2006; thomas and brennan, 2000). Academic medical centers (amcs) tend both to treat patients of higher severity and to be higher cost hospitals . The combination of these two factors means that complications at amcs are likely to be more frequent and to be relatively more costly as they originate in settings with relatively more expensive cost structures . Maryland data was adjusted for the inflationary effects of ime and dsh while california data was not . The lack of standardization acts to increase the estimated coefficients within california relative to maryland . A third contributing factor to the observed differences is the relative completeness with which diagnoses are coded upon claims . Within the california database secondary diagnosis codes were submitted at an average rate of 5.1 per claim . For the maryland database this figure rises to 9.1 per claim . Unsurprisingly the frequency with which ppcs are submitted on maryland claims is greater than that observed in california, both for claims with single (5.6% versus 4.0%) and multiple (2.2% versus 1.6%) ppcs . Maryland's allpayer claims data is the basis for hospital payment and uses the apr drg classification system . The change to apr drg based payment has been accompanied by an increase in coding completeness (health services cost review commission, 2005). Variation in coding completeness impacts both the estimation of per ppc cost and the estimate of total cost associated with complications . The regression model cannot distinguish increased cost attributed to complications where no complication is reported . Since the incremental cost associated with a ppc is estimated relative to the underlying average apr drg cost, the estimate of incremental ppc costs will be reduced if no complications are reported . This results because the cost of unreported complications within the regression is attributed to the apr drg average cost . This effect is likely to be relatively small as claims with ppcs make up relatively small percentages of claims within an apr drg . However, for claims with at least one ppc, the failure to code all ppcs which are truly present causes the incremental cost associated with other uncoded ppcs to be attributed to the incremental cost estimate of coded ppcs . This effect may have a more substantial impact on the estimate of incremental ppc cost than the costs of some ppcs being incorrectly attributed to the apr drg average cost . If complications are being more consistently reported in maryland then the expectation would be for the estimate of incremental ppc cost in maryland to be lower than that for california . Data limitations and differences in the pattern of coding may therefore explain variations in both the frequency of complications and their associated contribution to total hospital cost . The source of variation may also stem from real differences being observed in the data . For example, the increased frequency of complications may result from lower quality hospital care in maryland an interpretation that can neither be rejected nor supported in this analysis; however, there is no externally corroborating evidence that lower quality care in maryland is a causal factor . External rankings of statewide hospital quality tend to indicate that the opposite is in fact true (healthgrades, 2007). Alternatively the frequency of reported complications may be higher in maryland due to a greater underlying complexity in patient mix . The accuracy of the incremental cost estimates for the ppcs assumes that apr drgs provide an adequate measure of patient severity of illness . It is particularly important that there are no unmeasured aspects of severity of illness with strong correlation to the presence of ppcs that would serve to increase costs and upwardly bias estimates of the incremental cost of ppcs . If such unmeasured aspects of severity of illness existed then it can be hypothesized that patients with unmeasured severity would be concentrated in hospitals with certain characteristics . One study simulated an apr drg based payment system using california data in which payments were reduced when a major ppc was present (averill et al ., 2006). Using the hospital payment reduction due to ppcs as the dependent variable, the impact of the reduction upon the hospital case - mix index and number of hospital discharges was estimated using a regression model . The adjusted r for the model was only 13.28 indicating a weak association between ppc related payment reductions and these hospital characteristics . While not conclusive, the results suggest that the extent to which unmeasured severity influences the estimates of incremental cost associated with ppcs is minimal . Central to the analysis is an assumption that the post admission complications identified by the ppcs are preventable . One study demonstrated that catheterrelated blood stream infections, ppc 54, could be reduced by 66 percent through evidence based interventions (pronovost, goeschel, and wachter, 2008). Unfortunately, there is very little data like that for catheter - associated blood stream infection that explicitly quantifies the preventability of specific types of complications . The new york department of health has provided comparative reports on ppc rates to new york hospitals for several years . Some hospitals have reported that they have been able to use the ppc reports to lower the occurrence of complications (editorial board, 2009). Except for a few so - called never events that are almost always related to preventable medical errors such as foreign objects left in after surgery complications will never be totally preventable even with optimal care (averill et al ., 2009). Most post - admission complications (such as pulmonary embolism or post - operative mi) are not clearly linked to medical errors, and although they may relate to errors in judgment or lapses in execution that reflect poor quality care, they cannot be considered always preventable . Of the 64 categories of preventable complications (ppcs) evaluated with the maryland and california data, statistically significant estimates for incremental costs incremental ppc costs are estimated to account for more than 9% of total inpatient hospital cost . Earlier studies have estimated the cost of catheter - related blood stream infections at $18,000 compared to the $22,000 observed in the maryland data found here which offers a measure of reasonableness for the results (perencevich and pittet, 2009). The impact ppcs are seen to have on hospital cost demonstrates that there are substantial opportunities for both hospitals and payers to improve quality while reducing expenditure . The medicare inpatient pps fully incorporates ppc related cost into relative weights . The narrow definition of hacs, as currently employed by cms, has such a limited impact on payments that the medicare inpatient pps essentially continues to pay the full ms drg payment rate for virtually all patients . Thus, if hospitals can reduce their ppc rates, they can substantially increase their per case profit margins . Conversely, payers are paying hospitals at a level that includes substantial costs associated with ppcs . Payers need to provide hospitals greater incentive to reduce complications by reducing payments when a ppc occurs . Hospital payment systems can be complex with many interrelated adjustments, necessitating payment redesign to be carried out with care . For example, in the medicare inpatient pps, the removal of a ppc diagnosis from ms drg assignment can be used to assign the patient to a lower paying ms drg . However, the assignment to a lower paying ms drg may make the hospital eligible for outlier payments which could entirely or partially offset the payment reduction . Thus, as payment adjustments for complications are imposed, the impact on outlier payments must be taken into consideration by adjusting outlier threshold levels . Data on the cost of specific types of complications, such as those presented in this article, will be essential to such adjustments . Identifying the cost of specific complication types can also act as a basis for payers contracting under per diem arrangements to introduce actuarially representative quality incentives . The inherent probabilistic nature of the preventability of complications presents significant problems for the expansion of the current cms payment policy related to hospital acquired complications (hacs). For every case with an hac, the hac payment policy eliminates the entire payment increase generated by the hac implying that hacs are always preventable . As a result, hacs have been limited to the relatively few complications that are, arguably, nearly always preventable but have minimal impact on medicare inpatient hospital expenditures . In order to substantially increase the scope of hacs, the current hac case - by - case payment reductions and the implied preventability of the hac for similarly, the hac payment policy could be revised to reduce payments for hospitals with high hac rates . Assuming that the number of excess hacs in a hospital can be identified by comparison of risk - adjusted hac rates then the number of excess hacs in a hospital will need to be converted into a payment adjustment amount for the hospital . Estimates of incremental costs for ppcs, like those computed here, can provide a basis for converting the excess complications observed in a hospital into a payment adjustment amount, thereby expanding the policy options open to cms for expanding the range of complications applicable to a payment reduction . It was beyond the scope of this analysis to include additional costs associated with a complication that are incurred beyond the inpatient stay . The end of a hospitalization does not mark the period where all hospital acquired complications have become apparent . The estimate of incremental ppc costs carried out here does not factor in the degree of preventability of a complication or how much of the identified hospital cost may be considered fixed rather than variable . The use of claims data, whether to identify complications or to estimate incremental costs, is not free from criticism . Claims submissions are subject to variation in accuracy, both through the coding and documentation process . Hospital accounting functions are rarely sophisticated enough to identify and allocate patient level costs, while the standardizing of hospital cost data has already been described here as both imperfect and offering the potential for bias . Variation in coding completeness can contribute to both bias in the total estimated cost of complications and the estimate of incremental costs for individual ppcs . Despite these potential data limitations the hypothesized model delivers statistically valid estimates for the incremental cost of complications within the data sets from which they are drawn . These results, obtained from two distinct sources, are generally consistent providing an indication of the robustness of both the method and results . Two state's claims databases, from disparate regions of the country, with hospitals paid under different auspices and with cost standardized using different methods, independently yield very similar estimates for the cost of potentially preventable complications . At a patient level the impact of preventable complications on cost for many routinely observed complications, such as utis and catheter - related blood stream infections, is substantial . Potentially preventable complications are estimated to add 9.4% - 9.7% to hospital inpatient costs . With national estimates of inpatient hospital care costs totaling $940 billion in 2006 (american hospital association, 2008), the 0.02% hac payment reduction currently implemented by medicare while very limited in scope is an important first step toward addressing a problem with substantial cost implications . The robust incremental cost estimates for complications, obtained by treating hospital acquired complications as additive, categorical events, may open the door to alternative ways to design payment systems so as to provide greater incentives to significantly reduce hospital complications.
Chronic kidney disease is defined as kidney damage, as assessed by biopsy or markers of kidney damage, for 3 months with or without changes in glomerular filtration rate, or a glomerular filtration rate 60 ml / min/1.73 m for 3 months with or without kidney damage . Chronic kidney disease is an increasingly prevalent problem that is debilitating, increases premature morbidity and mortality, and is very costly to manage . The prevalence of chronic kidney disease in the united states in 19992004 was estimated to be between 13.1% and 16.8% and will likely continue to increase given the prevalence of obesity, diabetes and hypertension, all risk factors for chronic kidney disease . Patients with end stage disease must receive renal replacement therapy consisting of either renal transplant or dialysis . Despite these therapies, the 5 year survival rate for patients with end stage renal disease year is only 38% . End stage renal disease occurs in 0.03% of the us population, but the management of this disease consumes nearly 7% of the medicare budget . As of 2007, medicare and non - medicare costs for end stage renal disease had reached $20.1 billion and $12.4 billion, respectively . The most recent estimate suggests annual medicare costs of $68,000, $49,000, and $24,000 for hemodialysis, peritoneal dialysis, and transplant patients, respectively . The cost of managing chronic kidney disease varies depending on comorbidities, but it is far less expensive than managing end stage renal disease . In an analysis of over 30 million members across 35 health plans with records from 2000 to 2006, 11,531 patients with diabetes, 74,759 patients with hypertension, and 4,779 patients with both conditions were identified . The adjusted annualized incremental all - cause health care costs associated with chronic kidney disease were $7,190 in the diabetes cohort, $5,450 in the hypertension cohort, and $9,177 in the diabetes + hypertension cohort . So, if chronic kidney disease costs at least $5,000 per year in all 46 million us patients, that would translate into $230 billion of incremental all - cause health care costs if all these patients were members of these health insurance plans . Chronic kidney disease is associated with an increased risk of cardiovascular events, death and hospitalizations, and these risks increase proportionally to kidney functional decline . The importance of the renin - angiotensin - aldosterone system (raas) in the pathogenesis of chronic kidney disease is widely appreciated, and this understanding is due largely to the results obtained with pharmacologic agents that block the system . Angiotensin converting enzyme (ace) inhibitors and angiotensin receptor blockers (arbs) slow the progression of chronic kidney disease[810] and are recommended as first line therapy in the treatment of this disease . Over the past few years our understanding of the complexity and pervasive effects of the raas has grown as new components, functions and regulatory steps have been identified . Moreover, a new drug class, direct renin inhibitors, has been developed that offers another therapeutic option to suppress the raas in cardiorenal diseases . The focus of this review is to discuss recent developments in raas biology of potential clinical relevance to chronic kidney disease and the potential impact of direct renin inhibition on the prevention and management of chronic kidney disease . The raas is a coordinated cascade of sequential enzymatic steps, the first of which is the release of renin from juxtaglomerular cells in the kidney . 1) renin is formed by the proteolytic removal of a 43 amino acid prosegment peptide from its precursor, prorenin . Renin is stored in secretory granules and is released in response to decreases in renal perfusion pressure, decreases in cl in the distal tubule fluid or increased sympathetic nerve stimulation via 1 adrenoceptors . Renin release can also be inhibited by a direct action of angiotensin ii on the juxtaglomerular cells . Many other factors are known to modify renin release and/or expression including vitamin d, uric acid, tgf, and tnf . Renin acts on circulating angiotensinogen derived from the liver as well as locally produced to form angiotensin i (ang i). Ang i is converted to the active peptide, angiotensin ii (ang ii), by membrane bound ace . Dri, direct renin inhibitor; ace, angiotensin converting enzyme; acei, angiotensin converting enzyme inhibitor; arb, angiotensin receptor blocker the renin - angiotensin - aldosterone system . Dri, direct renin inhibitor; ace, angiotensin converting enzyme; acei, angiotensin converting enzyme inhibitor; arb, angiotensin receptor blocker other active and inactive metabolites can be formed from ang i and ii by ace-2, a homologue of ace . Ace-2 is expressed in the kidney, heart and other organs and is not inhibited by ace inhibitors . Ace-2 generates the biologically active peptide, ang (17), from ang ii and the inactive peptide ang (19) from ang i [17, 18]. Ang (17) by activating its receptor, mas, has actions that generally opposed those of ang ii including vasodilation and antiproliferative effects . In mouse models of diabetic nephropathy ace-2 is down regulated and knockout of ace-2 or inhibition of its activity promotes proteinuria and worsens glomerular injury in this model [19, 20]. Therefore, during raas activation ace-2 may counter act the actions of ace by forming ang (17) and by breaking down ang i [17, 18]. The circulating raas is an endocrine system that exerts primary control over the maintenance of extracellular fluid volume and (together with the autonomic nervous system) the regulation of blood pressure . In addition, many tissues, especially those associated with the cardiovascular system, contain all or some of the components of the raas and can therefore form ang ii locally . Based systems can function independently of the traditional circulating system and are thought to act in a paracrine manner to regulate organ function, growth and cellular proliferation, and are involved in pathological events associated with end organ damage . The kidney contains all the elements of the raas, and intrarenal formation of ang ii independent of the circulating system has been amply demonstrated . Ang ii acts on at least 2 different receptor subtypes, the type 1 (at1) and type 2 (at2) receptors . The at1 receptor is the predominate receptor in most tissues and mediates all of the classic physiologic and pathophysiologic actions of ang ii . In addition to the well known actions of ang ii to induce vascular smooth muscle contraction, activate na transport in the proximal tubule and to stimulate aldosterone release from the zona glomerulosa in the adrenal glands, ang ii has been implicated in the processes of inflammation and endothelial dysfunction, both of which are associated with hypertension and chronic kidney disease . For example, ang ii activates nad(p)h oxidases and xanthine oxidase producing reactive oxygen species such as peroxynitrite, superoxide anion and hydrogen peroxide, which reduce nitric oxide bioavailability and contribute to endothelial dysfunction . Ang ii also activates the transcription factor, nf - kb, which induces the formation of chemokines and cell adhesion molecules that are involved in the inflammatory process . In addition, ang ii appears to be an important mediator in the induction of tgf, tissue remodeling, fibrosis, and extracellular matrix formation, all of which are processes involved in the pathogenesis of diabetic nephropathy (fig . 2). Pgc, glomerular capillary pressure multiple roles of angiotensin ii in the pathogenesis of chronic kidney disease . Pgc, glomerular capillary pressure in addition to its well known actions in promoting na reabsorption by the kidney, there is now clear evidence that aldosterone - mediated activation of the mineralocorticoid receptor in non - epithelial tissues of the heart, kidney, and vasculature induces fibrotic changes in these tissues, contributes to oxidative stress and vascular inflammation, and is associated with endothelial dysfunction . The discovery of the (pro)renin receptor has added another dimension to the complexity of the raas . This receptor, which is present in many organs including the heart and kidney, binds both renin and prorenin . More importantly, prorenin, which is normally inactive, becomes catalytically active following binding to this receptor without undergoing proteolysis and thus can contribute to local ang ii formation . This may be of particular importance in diseases such as diabetes in which prorenin is significantly elevated and represents 95% of circulating renin . Activation of the (pro)renin receptor in mesangial cells also activates mitogen - activated protein kinase, erk 1 and 2 and several fibrosis / remodeling mediators such as tgf and pai-1 [28, 31]. These effects are independent of ang ii as they occur in the presence of ace inhibitors or arbs . Although more research is needed, activation of the (pro)renin receptor may contribute to the pathology of renal disease by increasing local ang ii formation and by increasing the expression of profibrotic mediators . However, the in vivo effects of (pro)renin receptor overexpression on end organ damage in experimental animals are mixed and therefore the role of this receptor in chronic kidney disease remains to be determined . The circulating raas is an endocrine system that exerts primary control over the maintenance of extracellular fluid volume and (together with the autonomic nervous system) the regulation of blood pressure . In addition, many tissues, especially those associated with the cardiovascular system, contain all or some of the components of the raas and can therefore form ang ii locally . Based systems can function independently of the traditional circulating system and are thought to act in a paracrine manner to regulate organ function, growth and cellular proliferation, and are involved in pathological events associated with end organ damage . The kidney contains all the elements of the raas, and intrarenal formation of ang ii independent of the circulating system has been amply demonstrated . Ang ii acts on at least 2 different receptor subtypes, the type 1 (at1) and type 2 (at2) receptors . The at1 receptor is the predominate receptor in most tissues and mediates all of the classic physiologic and pathophysiologic actions of ang ii . In addition to the well known actions of ang ii to induce vascular smooth muscle contraction, activate na transport in the proximal tubule and to stimulate aldosterone release from the zona glomerulosa in the adrenal glands, ang ii has been implicated in the processes of inflammation and endothelial dysfunction, both of which are associated with hypertension and chronic kidney disease . For example, ang ii activates nad(p)h oxidases and xanthine oxidase producing reactive oxygen species such as peroxynitrite, superoxide anion and hydrogen peroxide, which reduce nitric oxide bioavailability and contribute to endothelial dysfunction . Ang ii also activates the transcription factor, nf - kb, which induces the formation of chemokines and cell adhesion molecules that are involved in the inflammatory process . In addition, ang ii appears to be an important mediator in the induction of tgf, tissue remodeling, fibrosis, and extracellular matrix formation, all of which are processes involved in the pathogenesis of diabetic nephropathy (fig . 2). Pgc, glomerular capillary pressure multiple roles of angiotensin ii in the pathogenesis of chronic kidney disease . In addition to its well known actions in promoting na reabsorption by the kidney, there is now clear evidence that aldosterone - mediated activation of the mineralocorticoid receptor in non - epithelial tissues of the heart, kidney, and vasculature induces fibrotic changes in these tissues, contributes to oxidative stress and vascular inflammation, and is associated with endothelial dysfunction . The discovery of the (pro)renin receptor has added another dimension to the complexity of the raas . This receptor, which is present in many organs including the heart and kidney, binds both renin and prorenin . More importantly, prorenin, which is normally inactive, becomes catalytically active following binding to this receptor without undergoing proteolysis and thus can contribute to local ang ii formation . This may be of particular importance in diseases such as diabetes in which prorenin is significantly elevated and represents 95% of circulating renin . Activation of the (pro)renin receptor in mesangial cells also activates mitogen - activated protein kinase, erk 1 and 2 and several fibrosis / remodeling mediators such as tgf and pai-1 [28, 31]. These effects are independent of ang ii as they occur in the presence of ace inhibitors or arbs . Although more research is needed, activation of the (pro)renin receptor may contribute to the pathology of renal disease by increasing local ang ii formation and by increasing the expression of profibrotic mediators . However, the in vivo effects of (pro)renin receptor overexpression on end organ damage in experimental animals are mixed and therefore the role of this receptor in chronic kidney disease remains to be determined . Chronic kidney disease is associated with increased cardiovascular events, premature mortality, decreased quality of life, and increased health - care expenditures . Diabetes and hypertension are the leading causes of chronic kidney disease and there is now ample experimental and clinical evidence showing that the intrarenal raas is activated and plays a critical role in the pathogenesis of chronic kidney disease [3336]. Early studies in experimental models of renal disease led to the proposal that following renal injury and decrements in glomerular filtration rate the remaining viable nephrons undergo structural and functional compensatory changes which increase glomerular filtration rate sufficiently to meet excretory demands . However, the increase in glomerular pressure results in injury to glomerular epithelial and endothelial cells and mesangial cell expansion . These changes ultimately lead to further glomerular damage and a vicious cycle of progressive nephron loss . Ang ii is one of the main regulators of glomerular pressure, and ace inhibitors, but not other antihypertensive agents, were found to prevent the rise in glomerular pressure and to offer protection against proteinuria and glomerulosclerosis in these animal models . Based largely on preclinical data in chronic kidney disease models a number of clinical trials were conducted to assess the effects of ace inhibitors and subsequently, arbs, on the progression of diabetic and nondiabetic nephropathy . The first such trial examined the effects of captopril in patients with type 1 diabetic nephropathy . After a median follow up of 3 years, patients receiving captopril as compared to placebo had a 48% reduction in the risk of doubling of serum creatinine and a 50% reduction in the combined risk of death, dialysis and transplantation . In patients with chronic kidney disease of various etiologies, benazepril resulted in a 53% reduction in the doubling of serum creatinine or the need for dialysis . Two subsequent studies evaluated the effects of arbs in patients with nephropathy associated with type 2 diabetes . In the irbesartan diabetic nephropathy trial (idnt), the effect of irbesartan on renal and cardiovascular morbidity and mortality was compared to that of amlodipine and placebo . For subjects receiving irbesartan treatment, the relative risk of reaching the primary composite endpoint of doubling of serum creatinine, end - stage renal disease or death from any cause was 20% lower than the placebo group and 23% lower than the amlodipine group . Similarly, in the reduction of endpoints in niddm with the angiotensin ii antagonist losartan study (renaal), losartan reduced the risk of doubling of serum creatinine, end stage renal disease or death by 16% compared to the placebo group . While losartan treatment was associated with a 28% reduction in the risk of end stage renal disease, there was no effect on the rate of death . In all these trials the benefits of renin - angiotensin - aldosterone system blockade on chronic kidney disease appeared to be beyond those attributable solely to changes in blood pressure . Based on these results, ace inhibitors or arbs early studies in experimental models of renal disease led to the proposal that following renal injury and decrements in glomerular filtration rate the remaining viable nephrons undergo structural and functional compensatory changes which increase glomerular filtration rate sufficiently to meet excretory demands . However, the increase in glomerular pressure results in injury to glomerular epithelial and endothelial cells and mesangial cell expansion . These changes ultimately lead to further glomerular damage and a vicious cycle of progressive nephron loss . Ang ii is one of the main regulators of glomerular pressure, and ace inhibitors, but not other antihypertensive agents, were found to prevent the rise in glomerular pressure and to offer protection against proteinuria and glomerulosclerosis in these animal models . Based largely on preclinical data in chronic kidney disease models a number of clinical trials were conducted to assess the effects of ace inhibitors and subsequently, arbs, on the progression of diabetic and nondiabetic nephropathy . The first such trial examined the effects of captopril in patients with type 1 diabetic nephropathy . After a median follow up of 3 years, patients receiving captopril as compared to placebo had a 48% reduction in the risk of doubling of serum creatinine and a 50% reduction in the combined risk of death, dialysis and transplantation . In patients with chronic kidney disease of various etiologies, benazepril resulted in a 53% reduction in the doubling of serum creatinine or the need for dialysis . Two subsequent studies evaluated the effects of arbs in patients with nephropathy associated with type 2 diabetes . In the irbesartan diabetic nephropathy trial (idnt), the effect of irbesartan on renal and cardiovascular morbidity and mortality was compared to that of amlodipine and placebo . For subjects receiving irbesartan treatment, the relative risk of reaching the primary composite endpoint of doubling of serum creatinine, end - stage renal disease or death from any cause was 20% lower than the placebo group and 23% lower than the amlodipine group . Similarly, in the reduction of endpoints in niddm with the angiotensin ii antagonist losartan study (renaal), losartan reduced the risk of doubling of serum creatinine, end stage renal disease or death by 16% compared to the placebo group . While losartan treatment was associated with a 28% reduction in the risk of end stage renal disease, there was no effect on the rate of death . In all these trials the benefits of renin - angiotensin - aldosterone system blockade on chronic kidney disease appeared to be beyond those attributable solely to changes in blood pressure . Based on these results, ace inhibitors or arbs are recommended as first line therapy for chronic kidney disease . While it is clear that ace inhibitors and arbs reduce the progression of chronic kidney disease in some patients, these agents have not been shown to reduce mortality in this population, and the majority of patients continues to lose renal function and eventually do progress to end stage renal disease . There are a number of possible reasons for this . In early trials such as renaal and indt the treatment regimens did not reduce blood pressure to today s aggressive goals of <130/80 mmhg and in renaal 37% of the patients had no proteinuria reduction at all . Furthermore, factors such as salt intake can have a major impact on the progression of chronic kidney disease especially in the early stages of the disease . Hypertension in chronic kidney disease is often salt sensitive and changes in salt intake in the physiologic range can have major effects on blood pressure and can also attenuate the therapeutic effectiveness of raas inhibition . Polymorphism of the genes encoding for the various components of the raas may also affect the response to treatment in patients with chronic kidney disease . The best characterized of these is the insertion (i)/deletion (d) polymorphism of the ace gene . Patients carrying the d allele (dd or di) have a greater risk of developing diabetic nephropathy compared with the ii genotype [40, 41]. Ace inhibitor therapy seems to be most effective in patients with type 1 or type 2 diabetes with the ii genotype at earlier stages of chronic kidney disease . In patients with type 2 diabetes and overt albuminuria, arbs are more effective in reducing outcomes in patients with the di or dd genotype compared to the ii genotype . Polymorphisms in the genes of other components of the raas have been described but their role in kidney disease progression or effects on treatment regimens are still under investigation . Other potential reasons for suboptimal clinical outcomes with ace inhibitors and arbs may be associated with insufficient blockade of the raas with currently used dosing, especially in the setting of an activated intrarenal system as occurs in diabetes . In up to 50% of patients chronically treated with ace inhibitors, ang ii levels gradually returned to baseline . Ace escape and is likely due to a compensatory increase in plasma renin activity due to disruption of the feedback loop by which ang ii normally inhibits renin release . Under these circumstances ang ii can be formed from ang i by alternative, ace - independent pathways, such as chymase, which has been shown to be upregulated in diabetic and hypertension related nephropathies . Likewise, arbs increase plasma renin activity due to inhibition of the ang ii - renin release feedback loop . In this case the increase in ang ii may compete with the arb for the at1 receptor . Since renal outcomes appear to be directly related to the degree of blood pressure and proteinuria reduction [48, 49], optimizing raas blockade with ace inhibitor / arb combination therapy or high dose arb has been explored mostly in small groups of patients using proteinuria as a surrogate maker . In patients with comorbid type 2 diabetes, microalbuminuria and hypertension, the combination of candesartan and lisinopril produced greater reductions in mean sitting diastolic and systolic blood pressures than did the respective monotherapy . The change in the urinary albumin / creatinine ratio with combination therapy (50%) was significantly better than that observed in the candesartan group (24%) but was similar to that seen in the lisinopril group (39%). The recent analysis of renal outcomes in the large ontarget trial found that ramipril / telmisartan combination therapy decreased proteinuria but worsened the primary renal composite outcome of dialysis, doubling of serum creatinine and death when compared to ramipril and telmisartan monotherapy in patients at high vascular risk . This result was surprising in that proteinuria is a risk factor in patients with type 2 diabetic nephropathy and reductions in proteinuria lead to proportional increases in renal protection . However, this trial was not powered to detect differences in major renal outcomes and overt proteinuria was present in only 12.2% of patients with diabetes and in only 4% of all patients at study entry . Moreover, proteinuria was measured only at 2 year intervals versus the recommended 2 or 3 times a year . Furthermore, in the combination therapy group, the rate of decline in estimated glomerular filtration rate was only slightly above that due to normal aging . Therefore, while this trial suggests that telmisartan / ramipril combination therapy has no renal (or cardiovascular) benefit and may be harmful in patients with little or no proteinuria, this trial did not address the efficacy of ace inhibitor / arb combination therapy on renal outcomes in patients with chronic proteinuric kidney disease . Preventing esrd in overt nephropathy of type 2 diabetes (valid, nct00494715) and the va nephron - d study (nct00555217), are evaluating the ability of ace inhibitor / arb combinations to decrease mortality and the progression to end stage renal disease in patients with diabetic nephropathy . The long - term impact of ras inhibition on cardiorenal outcomes (lirico) trial is evaluating if combined treatment with ace inhibitors and arbs compared with monotherapy is associated with additional cardiorenal benefits, in subjects with microalbuminuria and 1 or more cardiovascular risk factors . Small, short term studies have examined the effects of high dose arb treatment on proteinuria in patients with diabetes and proteinuria . Doses of arbs at 2 to 4 times the maximum recommended doses further reduced protein excretion in these patients with little or no additional effects on blood pressure [5658]. These high doses of arbs were generally well tolerated and, while serum potassium levels increased in some patients, rates of hyperkalemia (k> 5.5 however, long - term renal outcome data are lacking for this potentially promising treatment regimen . In some patients, ace inhibitors and arbs suppress aldosterone levels only transiently and they slowly return to baseline levels over the course of weeks . Observational studies have shown that this phenomenon, known as aldosterone breakthrough, occurs in up to 41% of patients with diabetic nephropathy treated with an arb . These findings, together with the observation that aldosterone blockade in combination with ace inhibitors or arbs reduces kidney damage in experimental models of renal disease, have led to a resurgence of interest in the use of aldosterone antagonists in the treatment of chronic kidney disease . Aldosterone receptor antagonists reduce proteinuria in patients with proteinuric kidney disease who are already receiving ace inhibitors or arbs . Moreover, pilot studies suggest that adding aldosterone antagonists on a background therapy of angiotensin converting enzyme inhibitors or angiotensin receptor blockers may decrease the rate of loss of kidney function in chronic kidney disease patients . Well - designed outcome studies are required to determine whether addition of aldosterone antagonists to angiotensin converting enzyme inhibitor or angiotensin receptor blocker therapy is safe, especially as it relates to potassium homeostasis, and translate into better outcomes in patients with chronic kidney disease . Inhibition of renin activity has long been considered to be the logical step to interrupt the raas as it is the initial and rate limiting step in the formation of ang i. aliskiren, alone or combined with hydrochlorothiazide or valsartan, is the first fda - approved, orally active direct renin inhibitor, a new class of compounds designed to inhibit the raas . Unlike ace inhibitors, arbs and other antihypertensive agents that cause an increase in plasma renin activity, aliskiren directly inhibits the catalytic activity of renin, thus reducing plasma renin activity and, in turn, the production of ang ii and aldosterone . Moreover, aliskiren can counteract the increase in plasma renin activity induced by ace inhibitors, arbs, calcium channel blockers and diuretics [6467] (fig . 3). Therefore, direct renin inhibitors have the potential of more comprehensive suppression of the raas than ace inhibitors and arbs . 3effect of aliskiren alone or in combination with amlodipine (a), hydrochlorothiazide (hctz) (b), ramipril (c) and valsartan (d) on plasma renin activity ., 2007, villamil et al . 2007, uresin et al ., 2007 and oparil et al ., 2007 effect of aliskiren alone or in combination with amlodipine (a), hydrochlorothiazide (hctz) (b), ramipril (c) and valsartan (d) on plasma renin activity . For example, studies in healthy volunteers [68, 69] and in patients have shown that aliskiren decreases elements of the raas (ang ii, plasma renin activity and aldosterone) to a greater extent than arbs . Moreover, in volunteers, maximum doses of aliskiren increased renal blood flow 2-fold greater than maximum doses of ace inhibitors and 40% greater than arbs . In a number of trials aliskiren has been shown to produce marked reductions in aldosterone . For example, in the aliskiren in the evaluation of proteinuria in diabetes (avoid) trial aliskiren when combined with losartan reduced urinary aldosterone by 24% after 6 months compared with a 4% decrease with losartan alone . Likewise, in the aliskiren in left ventricular hypertrophy (allay) study plasma aldosterone was reduced by 21% from baseline with aliskiren / losartan combination therapy, compared with a 5% increase with losartan alone 9 months after the start of therapy . Finally, in patients with symptomatic heart failure, aliskiren when combined with optimal therapy (ace inhibitor or arb and beta blocker) reduced urinary aldosterone by 19% compared with an increase of 2% with placebo . Combined, these results suggest that aliskiren may provide more comprehensive suppression of the circulating and intrarenal raas than ace inhibitors or arbs . Experimental studies have shown that aliskiren has the potential to reduce end organ damage in chronic kidney disease . For example, in animal models of hypertension and heart and kidney damage, aliskiren reduced mortality, proteinuria and end organ damage [7477]. This fact may explain the marked and long lasting aliskiren - induced increases in renal blood flow observed in normal volunteers, as well as the persistent blood pressure - lowering effects of aliskiren in hypertensive patients following drug withdrawal [7880]. The mechanisms of renoprotection observed in preclinical studies with aliskiren are still under investigation . However, in addition to inhibiting the formation of ang i by the circulating and intrarenal raas, aliskiren has also been shown to reduce the renal expression of the (pro)renin receptor in an animal model of diabetes . Thus, aliskiren may contribute to end organ protection by reducing the deleterious actions of ang ii and the ang ii - independent effects of (pro)renin receptor activation . In clinical studies, aliskiren has been shown to be an effective and long - acting antihypertensive agent when used alone [7981] or in combination with other antihypertensive drugs [6467]. Thus far, 3 studies have evaluated it as a potential renoprotective agent in chronic kidney disease, using proteinuria as a surrogate marker . In a small exploratory study designed to investigate the time course of aliskiren treatment, patients with type 2 diabetes and micro- or macroalbuminuria recieved aliskiren and furosemide but no other raas blockers . Mean 24 h systolic blood pressure but not diastolic blood pressure was reduced by 6 mmhg at treatment end (28 days). The urinary albumin creatinine ratio progressively decreased from baseline with treatment and a maximum reduction of 44% was obtained the end of the treatment period . Compared to baseline, plasma renin activity was reduced by 68% and ang ii by 42% at the end of treatment . After aliskiren withdrawal plasma renin activity and ang ii remained below baseline for 1 week and gradually returned to pretreatment levels by 4 weeks . In a larger study, the aliskiren in the evaluation of proteinuria in diabetes (avoid) trial, the effects of dual blockade of the raas with aliskiren plus losartan were evaluated in patients with comorbid hypertension and type 2 diabetes with nephropathy . Patients who were maintained on losartan (100 mg daily) for the duration of the study were randomized to receive aliskiren (150 mg / d for 3 mo, then 300 mg / d for 3 mo) or placebo . Three months of treatment with the combination of aliskiren / losartan (150/100 mg / d), reduced the urinary albumin creatinine ratio by 11% compared with losartan alone . Increasing the dose of aliskiren to 300 mg / d further decreased albumin excretion to 20% by the end of the study . Urinary aldosterone was reduced from baseline by 24% in the aliskiren / losartan group versus those patients receiving losartan alone (4%). The reduction in proteinuria occurred in the absence of significant changes in blood pressure suggesting that addition of aliskiren to losartan had potential renoprotective effects independent of blood pressure . Hyperkalemia was reported in 5.0% and 5.7% of patients in the aliskiren and placebo groups, respectively . The potential renoprotective effects of aliskiren were further examined in an exploratory study of the antiproteinuric effects of 300 mg aliskiren compared to, and in combination with, 300 mg irbesartan, or placebo in a double blind, randomized cross - over trial . Patients with type 2 diabetes, hypertension and albuminuria (> 100 mg / day) underwent a 1-month washout period with no antihypertensive medications, but received furosemide to prevent blood pressure elevation . Following this, they were randomly assigned to receive each of the 4 treatments (aliskiren 300 mg, irbesartan 300 mg, placebo or combination aliskiren + irbesartan using identical doses) for 2 months . Aliskiren was as efficient as irbesartan in reducing the urinary albumin excretion rate: 48% and 58%, respectively (p <0.001 vs placebo for both treatments; p = ns between treatments). The urinary albumin excretion rate was reduced with the combination by 71% (p <0.001 vs placebo), which was significantly greater than that seen with aliskiren (p <0.001) or irbesartan (p = 0.028) monotherapy . The added antiproteinuric effect with combination treatment compared with aliskiren alone was about 31% . This additional decrease in proteinuria with the combination therapy was directly and proportionately correlated with an increase in plasma renin concentration, supporting the concept of increased intrarenal raas suppression by aliskiren . The patients enrolled in this small study had a lower mean baseline uaer compared with that in the avoid trial . In contrast to the avoid study, which reported an additive antiproteinuric effect with aliskiren added to a maximal recommended dose of losartan and optimal antihypertensive therapy, this study directly compared the antiproteinuric effects of aliskiren monotherapy with arb monotherapy in addition to confirming the additive effects seen with the combination . These 3 studies demonstrate that aliskiren alone or combined with an arb reduced albumin excretion in patients with diabetic nephropathy, suggesting that direct renin inhibition may be an additional treatment option in patients with type 2 diabetes and nephropathy . While these initial results are promising, larger long - term trials that measure cardiovascular and renal outcomes such as progression to end stage renal disease and cardiovascular mortality are needed to explore the potential beneficial effects of direct renin inhibition on chronic kidney disease . Such trials are ongoing, which will determine whether aliskiren in combination with an ace inhibitor or an arb reduces endpoints of cardiorenal morbidity and mortality in high risk patients with type 2 diabetes (altitude) or whether aliskiren added to standard therapy reduces mortality and hospitilizations in patients with heart failure (atmosphere, nct00853658). In patients with comorbid type 2 diabetes, microalbuminuria and hypertension, the combination of candesartan and lisinopril produced greater reductions in mean sitting diastolic and systolic blood pressures than did the respective monotherapy . The change in the urinary albumin / creatinine ratio with combination therapy (50%) was significantly better than that observed in the candesartan group (24%) but was similar to that seen in the lisinopril group (39%). The recent analysis of renal outcomes in the large ontarget trial found that ramipril / telmisartan combination therapy decreased proteinuria but worsened the primary renal composite outcome of dialysis, doubling of serum creatinine and death when compared to ramipril and telmisartan monotherapy in patients at high vascular risk . This result was surprising in that proteinuria is a risk factor in patients with type 2 diabetic nephropathy and reductions in proteinuria lead to proportional increases in renal protection . However, this trial was not powered to detect differences in major renal outcomes and overt proteinuria was present in only 12.2% of patients with diabetes and in only 4% of all patients at study entry . Moreover, proteinuria was measured only at 2 year intervals versus the recommended 2 or 3 times a year . Furthermore, in the combination therapy group, the rate of decline in estimated glomerular filtration rate was only slightly above that due to normal aging . Therefore, while this trial suggests that telmisartan / ramipril combination therapy has no renal (or cardiovascular) benefit and may be harmful in patients with little or no proteinuria, this trial did not address the efficacy of ace inhibitor / arb combination therapy on renal outcomes in patients with chronic proteinuric kidney disease . Three trials are currently underway that target this issue . Preventing esrd in overt nephropathy of type 2 diabetes (valid, nct00494715) and the va nephron - d study (nct00555217), are evaluating the ability of ace inhibitor / arb combinations to decrease mortality and the progression to end stage renal disease in patients with diabetic nephropathy . The long - term impact of ras inhibition on cardiorenal outcomes (lirico) trial is evaluating if combined treatment with ace inhibitors and arbs compared with monotherapy is associated with additional cardiorenal benefits, in subjects with microalbuminuria and 1 or more cardiovascular risk factors . Small, short term studies have examined the effects of high dose arb treatment on proteinuria in patients with diabetes and proteinuria . Doses of arbs at 2 to 4 times the maximum recommended doses further reduced protein excretion in these patients with little or no additional effects on blood pressure [5658]. These high doses of arbs were generally well tolerated and, while serum potassium levels increased in some patients, rates of hyperkalemia (k> 5.5 however, long - term renal outcome data are lacking for this potentially promising treatment regimen . In some patients, ace inhibitors and arbs suppress aldosterone levels only transiently and they slowly return to baseline levels over the course of weeks . Observational studies have shown that this phenomenon, known as aldosterone breakthrough, occurs in up to 41% of patients with diabetic nephropathy treated with an arb . These findings, together with the observation that aldosterone blockade in combination with ace inhibitors or arbs reduces kidney damage in experimental models of renal disease, have led to a resurgence of interest in the use of aldosterone antagonists in the treatment of chronic kidney disease . Aldosterone receptor antagonists reduce proteinuria in patients with proteinuric kidney disease who are already receiving ace inhibitors or arbs . Moreover, pilot studies suggest that adding aldosterone antagonists on a background therapy of angiotensin converting enzyme inhibitors or angiotensin receptor blockers may decrease the rate of loss of kidney function in chronic kidney disease patients . Well - designed outcome studies are required to determine whether addition of aldosterone antagonists to angiotensin converting enzyme inhibitor or angiotensin receptor blocker therapy is safe, especially as it relates to potassium homeostasis, and translate into better outcomes in patients with chronic kidney disease . Inhibition of renin activity has long been considered to be the logical step to interrupt the raas as it is the initial and rate limiting step in the formation of ang i. aliskiren, alone or combined with hydrochlorothiazide or valsartan, is the first fda - approved, orally active direct renin inhibitor, a new class of compounds designed to inhibit the raas . Unlike ace inhibitors, arbs and other antihypertensive agents that cause an increase in plasma renin activity, aliskiren directly inhibits the catalytic activity of renin, thus reducing plasma renin activity and, in turn, the production of ang ii and aldosterone . Moreover, aliskiren can counteract the increase in plasma renin activity induced by ace inhibitors, arbs, calcium channel blockers and diuretics [6467] (fig . Therefore, direct renin inhibitors have the potential of more comprehensive suppression of the raas than ace inhibitors and arbs . 3effect of aliskiren alone or in combination with amlodipine (a), hydrochlorothiazide (hctz) (b), ramipril (c) and valsartan (d) on plasma renin activity ., 2007 effect of aliskiren alone or in combination with amlodipine (a), hydrochlorothiazide (hctz) (b), ramipril (c) and valsartan (d) on plasma renin activity . For example, studies in healthy volunteers [68, 69] and in patients have shown that aliskiren decreases elements of the raas (ang ii, plasma renin activity and aldosterone) to a greater extent than arbs . Moreover, in volunteers, maximum doses of aliskiren increased renal blood flow 2-fold greater than maximum doses of ace inhibitors and 40% greater than arbs . In a number of trials aliskiren has been shown to produce marked reductions in aldosterone . For example, in the aliskiren in the evaluation of proteinuria in diabetes (avoid) trial aliskiren when combined with losartan reduced urinary aldosterone by 24% after 6 months compared with a 4% decrease with losartan alone . Likewise, in the aliskiren in left ventricular hypertrophy (allay) study plasma aldosterone was reduced by 21% from baseline with aliskiren / losartan combination therapy, compared with a 5% increase with losartan alone 9 months after the start of therapy . Finally, in patients with symptomatic heart failure, aliskiren when combined with optimal therapy (ace inhibitor or arb and beta blocker) reduced urinary aldosterone by 19% compared with an increase of 2% with placebo . Combined, these results suggest that aliskiren may provide more comprehensive suppression of the circulating and intrarenal raas than ace inhibitors or arbs . Experimental studies have shown that aliskiren has the potential to reduce end organ damage in chronic kidney disease . For example, in animal models of hypertension and heart and kidney damage, aliskiren reduced mortality, proteinuria and end organ damage [7477]. This fact may explain the marked and long lasting aliskiren - induced increases in renal blood flow observed in normal volunteers, as well as the persistent blood pressure - lowering effects of aliskiren in hypertensive patients following drug withdrawal [7880]. The mechanisms of renoprotection observed in preclinical studies with aliskiren are still under investigation . However, in addition to inhibiting the formation of ang i by the circulating and intrarenal raas, aliskiren has also been shown to reduce the renal expression of the (pro)renin receptor in an animal model of diabetes . Thus, aliskiren may contribute to end organ protection by reducing the deleterious actions of ang ii and the ang ii - independent effects of (pro)renin receptor activation . In clinical studies, aliskiren has been shown to be an effective and long - acting antihypertensive agent when used alone [7981] or in combination with other antihypertensive drugs [6467]. Thus far, 3 studies have evaluated it as a potential renoprotective agent in chronic kidney disease, using proteinuria as a surrogate marker . In a small exploratory study designed to investigate the time course of aliskiren treatment, patients with type 2 diabetes and micro- or macroalbuminuria recieved aliskiren and furosemide but no other raas blockers . Mean 24 h systolic blood pressure but not diastolic blood pressure was reduced by 6 mmhg at treatment end (28 days). The urinary albumin creatinine ratio progressively decreased from baseline with treatment and a maximum reduction of 44% was obtained the end of the treatment period . Urinary albumin creatinine ratio remained below baseline for approximately 12 days following washout . Compared to baseline, plasma renin activity after aliskiren withdrawal plasma renin activity and ang ii remained below baseline for 1 week and gradually returned to pretreatment levels by 4 weeks . In a larger study, the aliskiren in the evaluation of proteinuria in diabetes (avoid) trial, the effects of dual blockade of the raas with aliskiren plus losartan were evaluated in patients with comorbid hypertension and type 2 diabetes with nephropathy . Patients who were maintained on losartan (100 mg daily) for the duration of the study were randomized to receive aliskiren (150 mg / d for 3 mo, then 300 mg / d for 3 mo) or placebo . Three months of treatment with the combination of aliskiren / losartan (150/100 mg / d), reduced the urinary albumin creatinine ratio by 11% compared with losartan alone . Increasing the dose of aliskiren to 300 mg / d further decreased albumin excretion to 20% by the end of the study . Urinary aldosterone was reduced from baseline by 24% in the aliskiren / losartan group versus those patients receiving losartan alone (4%). The reduction in proteinuria occurred in the absence of significant changes in blood pressure suggesting that addition of aliskiren to losartan had potential renoprotective effects independent of blood pressure . Hyperkalemia was reported in 5.0% and 5.7% of patients in the aliskiren and placebo groups, respectively . The potential renoprotective effects of aliskiren were further examined in an exploratory study of the antiproteinuric effects of 300 mg aliskiren compared to, and in combination with, 300 mg irbesartan, or placebo in a double blind, randomized cross - over trial . Patients with type 2 diabetes, hypertension and albuminuria (> 100 mg / day) underwent a 1-month washout period with no antihypertensive medications, but received furosemide to prevent blood pressure elevation . Following this, they were randomly assigned to receive each of the 4 treatments (aliskiren 300 mg, irbesartan 300 mg, placebo or combination aliskiren + irbesartan using identical doses) for 2 months . Aliskiren was as efficient as irbesartan in reducing the urinary albumin excretion rate: 48% and 58%, respectively (p <0.001 vs placebo for both treatments; p = ns between treatments). The urinary albumin excretion rate was reduced with the combination by 71% (p <0.001 vs placebo), which was significantly greater than that seen with aliskiren (p <0.001) or irbesartan (p = 0.028) monotherapy . The added antiproteinuric effect with combination treatment compared with aliskiren alone was about 31% . This additional decrease in proteinuria with the combination therapy was directly and proportionately correlated with an increase in plasma renin concentration, supporting the concept of increased intrarenal raas suppression by aliskiren . The patients enrolled in this small study had a lower mean baseline uaer compared with that in the avoid trial . In contrast to the avoid study, which reported an additive antiproteinuric effect with aliskiren added to a maximal recommended dose of losartan and optimal antihypertensive therapy, this study directly compared the antiproteinuric effects of aliskiren monotherapy with arb monotherapy in addition to confirming the additive effects seen with the combination . These 3 studies demonstrate that aliskiren alone or combined with an arb reduced albumin excretion in patients with diabetic nephropathy, suggesting that direct renin inhibition may be an additional treatment option in patients with type 2 diabetes and nephropathy . While these initial results are promising, larger long - term trials that measure cardiovascular and renal outcomes such as progression to end stage renal disease and cardiovascular mortality are needed to explore the potential beneficial effects of direct renin inhibition on chronic kidney disease . Such trials are ongoing, which will determine whether aliskiren in combination with an ace inhibitor or an arb reduces endpoints of cardiorenal morbidity and mortality in high risk patients with type 2 diabetes (altitude) or whether aliskiren added to standard therapy reduces mortality and hospitilizations in patients with heart failure (atmosphere, nct00853658). In a pooled analysis of data from over 7000 patients with hypertension treated with aliskiren for 6 to 8 weeks, the overall incidence of adverse events (aes, 39.8%) was similar to placebo (40.2%). More than 95% of the aes were mild or moderate with headache, nasopharyngitis, diarrhea, and dizziness being the most commonly reported . Mmol / l) with aliskiren treatment (150 mg, 0.7%; 300 mg, 1.0%) was similar to placebo (0.6%) combination of aliskiren (150 mg or 300 mg) with ramipril, amlodipine, valsartan or hydrochlorothiazide (hctz) resulted in an ae profile similar to that of the respective monotherapy . However, the rate of cough was lower with ramipril / aliskiren therapy (1.8%) compared with ramipril alone (4.7%). Likewise the rate of edema was lower with aliskiren / amlodipine therapy (2.1%) compared with amlodipine alone (11.2%). Rates of hyperkalemia were low and similar to the respective monotherapy when aliskiren was combined with amlodipine, valsartan, or hctz . However, hyperkalemia was higher in patients receiving aliskiren / ramipril (5.5%) compared with ramipril alone (2.6%). In a longer term (6 months) study of patients with hypertension receiving aliskiren / valsartan or aliskiren / valsartan / hctz, the most frequent aes were headache, nasopharyngitis, diarrhea, and dizziness . Hyperkalemia was reported in 2.0% of patients and was transient . In the 2 short - term studies that evaluated the effects of aliskiren in patients with diabetic nephropathy, avoid trial there was no difference in the overall incidence of aes between patients recieving losartan alone (67.1%) versus the losartan / alsikiren group (66.8%). Likewise the rates of hyperkalemia (5.7% vs 5.0%) were similar between the groups . In the losartan / alsikiren group 14 however, 9 of the 14 patients treated with losartan / aliskiren had elevated baseline potassium and should have been excluded from the study . These studies suggest that the aes associated with aliskiren alone or in combination with arbs are generally mild and similar to current therapies . However, as with ace inhibitors and arbs, serum electrolyte levels including potassium need to be monitored in patients with impaired renal function when using aliskiren . Chronic kidney disease is a major healthcare problem that will likely continue to increase due to the ageing population and the elevated prevalence of hypertension, diabetes and obesity . The raas is activated in chronic kidney disease and pharmacological modulation of this system has become a cornerstone in the treatment of this disease . While ace inhibitors and arbs have been shown to retard the progression of chronic kidney disease, the majority of patients still progress to end stage disease or die from cardiovascular events . There is a vast need for further improvement in the therapy of patients with chronic kidney disease . Current evidence suggests that inhibition of the raas with ace inhibitors and arbs stimulates a compensatory increase in plasma renin activity that may negate some of the beneficial effects of these agents . Therefore, strategies that more fully suppress the raas in chronic kidney disease are being explored . High dose arb therapy or combination therapies with ace inhibitors and arbs have shown beneficial effects on surrogate markers of chronic kidney disease . Direct renin inhibition with aliskiren represents a novel and potentially more effective way to inhibit the raas . Unlike ace inhibitors and arbs, plasma renin activity is inhibited with aliskiren, and downstream components of the raas are suppressed . Like ace inhibitors and arbs, aliskiren, alone or in combination with an arb, has been shown to reduce proteinuria in patients with diabetic nephropathy . However, whether these new treatment regimens confer better outcomes in patients with chronic kidney disease await the results from ongoing clinical trials with appropriate endpoints.
Skin metastasis from a thyroid carcinoma is rarely a presenting feature of an underlying malignancy . Subcutaneous metastasis from differentiated thyroid carcinoma (dtc) is a rare manifestation of disseminated disease . Some of the authors believe that follicular carcinoma of the thyroid has a higher propensity to metastasize to the skin, followed by papillary carcinoma, then anaplastic carcinoma and finally medullary carcinoma . Others believe that papillary carcinoma is the most common thyroid carcinoma metastasizing to the skin . All agree that the scalp is the most common site of thyroid carcinoma skin metastases . There are no previous reports of positron emission tomography / computed tomography (pet / ct) in patients with loin metastasis from an unknown primary and identified as papillary cancer thyroid . This was a case report of a 45-year - old male patient who presented with subcuataneous swelling in the left loin, which on biopsy showed metastatic papillary cancer . Pet / ct showed an intense uptake in the subcutaneous soft - tissue lesion in the left loin [figure 1]. A diagnosis of primary papillary carcinoma of thyroid with subcutaneous loin metastasis was made and he was advised total thyroidectomy and excision of metastasis . Whole body fluorodeoxyglucose - positron emission tomography/ computed tomography (pet / ct) maximum intensity projection image (a) axial ct (b) pet (c) fused pet / ct (d) showed a intense uptake in the subcutaneous soft tissue lesion in the left loin axial ct (a) pet (b) fused pet / ct (c) showed a intense uptake in the right lobe thyroid nodule cutaneous metastasis from dtc is also a rare manifestation of thyroid cancer . A review on roughly 60 cases of dtc skin metastases, which have been documented in the literatures, stated that pc has a greater preponderance for skin metastases dermal lesions typically present as slowly growing erythematous or purple plaques or nodules, usually on the scalp, face, or neck . This may relate to local vascular factors essential for the highly complex nature of metastases . Pet / ct is very useful in identifying unknown primary cancer from the metastatic lesions . There are reports of pet / ct in identifying occult papillary cancer in a thyroglossal cyst . However, 18 fluorine - fluorodeoxyglucose - pet / ct has a role in 131i - whole body scan negative patients with elevated thyroglobulin . There are reports of pet / ct in identifying muscle and scalp metastasis from a papillary thyroid cancer . This is the first case of identifying primary papillary cancer with subcutaneous metastasis in pet / ct . Recognizing and understanding the clinical findings
Many people, approximately 20% of the population, suffer from allergic rhinitis worldwide . From the clinical point of view, allergic rhinitis causes sneezing, nasal discharge, and nasal obstruction . From the immunological point of view, allergic rhinitis is a typical th2 immune disorder characterized by a high level of antigen specific ige production . Because the enhanced ige production and inflammatory response in rhinitis are due to predominant production of th2 cytokines such as il-4, the allergic symptoms can be alleviated by inhibition of th2 cytokine responses . Many researchers have investigated allergic rhinitis using an animal model.1, 2, 3 the model of allergic mice made by ova sensitization and challenge had increased serum ige and eosinophil . Shin'iseihaito (ssht; magnolia flower lung - clearing decoction; xn y qng fi tng), a formula consisting of nine crude drugs, has been used for the treatment of nasal diseases such as chronic sinusitis in traditional japanese kampo medicine (r bn hn y) and traditional chinese medicine (tcm; zhng y).4, 5 more than 50% of individuals with allergic rhinitis have clinical or radiographic evidence of chronic sinusitis and 2558% of individuals with sinusitis have aeroallergen sensitization . Previous researches suggest that chronic sinusitis could be an atopic disease driven by ige sensitization to aeroallergens . From these studies however, it has not been clarified for its role in anti - allergy therapy before . Thus, in the present study, we investigated whether ssht is able to suppress the murine allergic reaction induced by nasal sensitization . Female balb / c mice (japan slc ltd, hamamatsu, japan) were used . Shin'iseihaito consists of 3.0 g (daily dose for human) of gypsum fibrosum (sh go), 3.0 g of tuber of ophiopogon japonicus (mi mn dng), 1.5 g of root of scutellaria baicalensis (hung qn), 1.5 g of rhizome of anemarrhena asphodeloides (zh m), 0.75 g of fruit of gardenia jasminoides (zh z), 1.5 g of bulb of lilium lancifolium (bi h), 1.5 g of flower of magnolia salicifolia (xn y), 0.5 g of leaf of eriobotrya japonica (p p y), 0.75 g of rhizome of cimicifuga heracleifolia (shng m). These crude drugs were boiled, filtered, and the decoction was dried to yield powdered extract (ssht, 2.5 g for daily human dose). Ssht (lot: 14b019) was provided as a generous gift from the kobayashi pharmaceutical co., ltd (osaka, japan). Ssht was suspended in distilled water to prepare the stock solution at a concentration of 0.1 g / ml and kept in 20 c until use . Allergic murine models were established based on the previously described methods with minor modifications.7, 8 the experimental timetable is provided in fig . 1 . Mice were intraperitoneally administered 0.1 mg / ml ova (sigma aldrich, st . Louis, mo, usa) and 40 mg / ml al(oh3) in saline at a dosage of 100 l / mouse . Sensitization was repeated twice (days 0 and 7), followed by daily injections of ova solution (15 mg / ml in saline, 10 l / each nostril) into nostrils from day 1428 (challenge). In the ssht - treated group, mice were force - fed ssht (10 mg/0.1 ml/10 g body weight (bw)/day, 20-fold of human dosage) from day 1328 . Mice in the control group were given an equal volume of saline and were infected using the same method . At the end of animal experiment, all animal procedures were approved by the institutional animal care and use committee at nagoya city university, japan . Blood samples from the allergic murine model were collected after 2 h of the last challenge on day 28 . The number of leukocyte and eosinophilia were measured in tohkai cytopathology institute (gifu, japan). Concentrations of serum total ige, il-4, and ifn- were evaluated using mouse ige elisa, mouse il-4, and mouse ifn- elisa kit (biolegend inc . San diego, ca, usa) according to the manufacturer's instructions, respectively . Cytokine levels were calculated using standard murine recombinant cytokine curves run on the same immunoplate . The untreated female 6 week - old balb / c mice were injected intradermally with 10 l aliquot of 50 fold diluted anti - ova of serum in saline into shaved dorsal skin sites . After two days, ova (0.1 mg) with 0.5% evans blue (wako pure chemicals, osaka, japan) in saline was injected intravenously into the tail vein . One hour after antigen challenge, mice were euthanized and the dorsal skin of the mouse was removed to measure the pigment area . The area of blue spots on the internal surface of the skin was measured.10, 11 statistical analysis was performed by repeated one - way analysis of variance (anova) and the tukey / bonferroni / dunnett's multiple comparison test . A probability value (p <0.05) was considered to be statistically significant . The leukocyte levels were significantly higher in allergic mice than those in untreated mice, but those levels were not significantly changed by ssht - treatment [fig . The eosinophilia levels were significantly higher in allergic mice than those in untreated mice . Compared to allergic mice, the allergic rhinitis mice treated with ssht had significantly decreased eosinophil levels (p <0.01) [fig . The ige levels were higher in allergic mice than those in untreated mice . Compared to allergic mice, the il-4 levels were significantly higher in allergic mice than those in untreated mice . Compared to allergic mice, the allergic mice treated with ssht had also significantly decreased il-4 levels (p <0.01) [fig . The ifn- levels were significantly lower in allergic mice than those in untreated mice . Compared to allergic mice, the allergic mice treated with ssht had also significantly increased ifn- levels (p <0.01) [fig . 3c]. As we found that the eosinophilia and cytokine level of allergic mouse treated with ssht were remarkably decreased the sera containing ova - specific anaphylactic antibodies were intradermally injected and the pca reaction was measured 1 h after the injection of the evans blue solution containing ova . We observed that pca reactions using the sera of allergic mice were exhibited as blue spots . However, the average sizes of blue spots were significantly decreased in the sera of ssht - treated allergic mice compared to those in the sera of allergic mice . In the present study, we showed that the administration of shin'iseihaito (ssht; magnolia flower lung - clearing decoction; xn y qng fi tng) is capable of suppressing the ige and il-4 levels in murine allergic reaction induced by nasal sensitization . Thus, our result showed that ssht may return the decreased ifn-/il-4 (th1/th2) ratio of the allergic group to the normal range . This result may also explain the reasons why the administration of ssht suppressed the production of anti - ova ige antibody without affecting the development of cd4 t cells, since il-4 is the cytokine known to induce immunoglobulin class switching to ige . Il-4 is known to serve not only as a mast cell growth factor but also as the major mast cell chemoattachment . Therefore, it is possible that the decrease of th2 responses in nasal mucosa modulated the mast cell (ige)-mediated nasal symptoms, in concert with the decreased production of anti - ova ige antibody . Our result of pca reaction also demonstrated that ssht inhibited the anaphylaxic factors such as ige and other antigens . The precise mechanism of the effect of ssht on pca reaction is to be determined in a future study . Although our results demonstrate that ssht had anti - inflammatory effect, each individual component of ssht also shows anti - inflammatory effect . Especially, the flower of m. salicifolia (xn y) has several anti - inflammatory effects including the inhibitory effects of mast cell - derived histamine release and pca reaction.14, 15, 16, 17 the fruit of g. jasminoides (zh z) inhibits the histamine release from mast cells and lowered the serum level of ige and histamine in allergic murine model . The rhizome of a. asphodeloides (zh m) inhibits nf-b transcription activity via the p38 mapk and erk pathway . The leaf of e. japonica (p p y) had anti - inflammatory effect with attenuation of p38map kinase and erk . Some researcher reported that the root of s. baicalensis (hung qn), the bulb of l. lancifolium (bi h), and the tuber of o. japonicus (mi mn dng) had anti - inflammatory activity.21, 22, 23 although each component has anti - inflammation effect, this mechanism in detail has been unknown . Japanese traditional kampo medicine (r bn hn y) is generally composed of several components and the interaction of them may enhance the effect of drugs . As further investigation from this perspective is needed, ssht may have pronounced anti - inflammatory effects . Administration of shin'iseihaito (ssht; magnolia flower lung - clearing decoction; xn y qng fi tng) is capable of improving allergic status in ova - induced allergic murine model . Further studies are required to confirm the anti - allergy effects and elucidate the mechanisms of anti - allergy action of ssht in allergic murine model.
Ectopia cordis is a rare congenital malformation in which the heart is located partially or totally outside the thoracic cavity . Ectopia cordis may occur as an isolated malformation or it may be associated with body wall defects that affect the thorax, abdomen, or both . With the advances in the medical field and surgical technique, a 24-year - old, unbooked primigravida delivered spontaneously, a 34-week, male stillborn weighing 1,870 g at kasturba hospital, mgims, sevagram . There was no history of intake of any teratogens or exposure to unusual environment in antenatal period . An anterior thoracoabdominal defect with extrathoracic heart, a cleft sternum, and omphalocele were recognized at birth . The physical examination revealed an exposed heart totally outside of the thoracic cavity without pericardium protection . The abdominal wall defect that caused evisceration of liver, stomach, and the intestines [figure 1]. Other abnormal features included asymmetrical face with medial epicanthal folds, low set ears, micrognathia, asymmetrical bossing of the skull, and high arched palate . Ectopia cordis is a very rare anomaly with an estimated prevalence of 0.079/10,000 births and may occur more frequently in females . It is related to the malformation of the anterior wall of the thorax, with an extrathoracic location of the heart . In 1958, cantrell described this syndrome, which occurs sporadically, with variable degrees of expression . Ectopia cordis can be classified into five types: 1) cervical, in which the heart is located in the neck with sternum that is usually intact; 2) thoracocervical, in which the heart is partially in the cervical region, but the upper portion of the sternum is split; 3) thoracic, in which the sternum is completely split or absent, and the heart lies partially or completely outside the thorax; 4) thoracoabdominal, which usually accompanies cantrell's syndrome; and 5) abdominal, in which the heart passes through a defect in the diaphragm to enter the abdominal cavity . Our case had thoracoabdominal type ectopia cordis in which the bifid sternum, extrathoracic heart, absence of parietal pericardium, and an omphalocele was present . The formation of the thoracic and abdominal walls is complete in the 9 week of pregnancy and of the heart in the 8 week . Complete or incomplete failure of midline fusion at this embryonic stage can result in a variety of disorders ranging from isolated ectopia cordis to complete ventral evisceration . Ventricular septal defect, atrial septal defect, tetralogy of fallot, and diverticulum of the ventricle are the most commonly encountered heart lesions . Ectopia cordis has also been reported with other congenital anomalies such as abdominal wall defects, cranial and facial malformations, cleft lip and palate, anencephaly, hydrocephaly, neural tube defects, pulmonary hypoplasia, genitourinary malformation, gastrointestinal defect, and chromosomal abnormalities . The defect of the abdominal wall can range from simple diastasis to huge omphaloceles with bowel, liver, and heart . The ectopic heart may either simply bulge out of the chest or be entirely out of the chest . The diagnosis has been made as early as 17 weeks, but in some cases complicated by oligohydramnios, these cases may be missed entirely . The differential diagnosis includes isolated thoracic ectopia cordis, amniotic band syndrome, and body stalk anomalies . The key features for distinguishing these conditions is the position of abdominal wall defect in relation to the umbilical cord insertion, eviscerated organs, the presence or absence of membranes or bands, and associated anomalies . Omphalocele in cantrell's pentalogy usually involves a midline defect at the umbilical cord insertion . An eccentric large lateral defect and adherence of the placenta to the defect the presence of an unexplained ventral wall defect along with extremity deformity with an adherent band suggests amniotic band syndrome . The prenatal diagnosis is easily made with ultrasound by visualizing the heart outside the thoracic cavity . In view of the poor prognosis, the prognosis depends on the degree of the intracardiac involvement and associated malformations, as well as the degree to which the heart is exposed . Attempts at surgical correction are already widely performed, with immediate covering of the heart and exposed abdominal contents using silastic prosthesis being recommended . Additionally, a complete evaluation and correction of the intracardiac defects should be performed before closing the abdominal wall . In conclusion, ectopia cordis with omphalocele is a rare congenital malformation from fatal to nonfatal, therefore it must be adequately evaluated for appropriate prenatal and postnatal management.
During the past two centuries, the anatomical variations of the axilla have been described in both textbook of human anatomy and more recently in those of operative surgery . A muscle extending from the latissimus dorsi to the pectoralis major muscle has been called axillary arch or langer's axillary arch . This occurs in at least 7% of different populations but may not always be clinically apparent . Among the muscles the usual lesion is absence of the sternocostal portion, with or without absence of the pectoralis minor muscle . In a period of one year, we identified two patients (4%) with axillary arch and one patient (2%) with absent pectoralis major and minor muscle among fifty subjects which undergoing axillary dissection for breast cancer surgery . The anatomy of axilla regarding muscular variations was studied in 50 patients who had an axillary dissection for the staging and treatment of invasive primary breast cancer over one year . The axillary vein was identified and all fatty and lymphatic tissue was removed inferior to the axillary vein, between the anterior border of latissimus dorsi muscle laterally and the lateral border of the pectoralis minor muscle (level of first rib) medially . During the procedure, two individuals with axillary arch muscle and one individual with absent pectoralis major and minor muscles were identified . Of the 50 patients, 3 had a variation from the anatomy described in the standard textbooks of anatomy and operative surgery . There were two patients who had an abnormal band of muscle arising from the latissimus dorsi muscle and crossed the axilla medially towards pectoralis major muscle, pectoralis minor muscle and the coracoid process, without interruption by any type of tendinous fibres . Axillary arch (aa) muscle crossing anteriorly over right axillary vein (av) there was left sided absence of pectoralis major and minor muscles in a 45 years old woman operated for left sided carcinoma of breast [figure 2]. There was little interest in ramsay's description until langer, in 1846, described the muscle more accurately and it became known as the embryological derivation of langer's arch remains unknown, but the most reliable theory supports its origin from the panniculus carnosus, which is an embryologic remnant of skin - associated musculature, lying at the junction between the superficial fascia and the subcutaneous fat . In lower mammals the panniculus carnosus is highly developed to form the pectoral group of muscles . However, in man it has regressed because its functional importance decreased during evolution in favour of wide upper limb mobility . Langer's arch is usually asymptomatic and its main importance is the confusion it can cause during routine axillary surgery for breast cancer . An axillary arch may be palpable in living subjects and should be borne in mind during clinical examination of the axilla as it may be mistaken for a tumor . The presence of axillary arch can impede adequate exposure of the true axillary fat and in particular may limit access to the lower lateral group of lymph nodes, thus resulting in an incomplete clearance of the axilla . Because of its close proximity with neurovascular and lymphatic structures within the axilla, as the axillary arch crosses the vessels and nerves, it may present with axillary vein obstruction . The axillary arch may lead the surgeon one level above the axillary vein and as a result the neurovascular bundle of the axilla may be injured . The pectoral musculature is derived from dorsal limb bud masses which arise from myoblasts that migrate out of last five cervical and first thoracic myotomes into developing limb buds during fifth week of development . The pectoral muscles assume their final form through a combination of migration, fusion and apoptosis of muscle cell precursors . Absence of one or more skeletal muscles is more common than is generally recognised; common examples are the sternocostal head of the pectoralis major, the palmaris longus, trapezius, serratus anterior and quadrates femoris . Usually only a single muscle is absent on one side of the body, or only part of the muscle fails to develop . Occasionally the same muscle or muscles may be absent on both sides of the body . These structures fail to develop in the embryo.the muscles develop partly, fail to attach to the bone and subsequently atrophy.the premuscle mass, which in normal development goes to form the pectoralis minor and two portions of the pectoralis major, fails to differentiate into its separate parts.in one study, pectoralis major was absent in three of 15,000 cases and in another study, the muscle was absent in five of 54,000 cases . On average, the premuscle mass, which in normal development goes to form the pectoralis minor and two portions of the pectoralis major, fails to differentiate into its separate parts . Paraskevas george noted that anomalies of the pectoralis major muscle are of prominent interest for plastic surgeons because that muscle is harvested during total, segmental or turn over flap graft removal for coverage of major sternal wound infections after cardiac surgery, breast reconstruction, or local mediastinal wounds and may serve as treatment for a paralytic elbow . Furthermore, the pectoralis minor muscle is useful as a free flap in cases of facial palsy . Clinical detection of this muscle is difficult; however, it is possible to detect the presence of the axillary arch on performing computed tomography scan or magnetic resonance imaging of the axillary region . Caution should be exercised while performing fnac, core needle or tru cut biopsy of breast lesions in patients with poland syndrome . The procedure should be preferably performed under image guidance in such patients in order to minimize the risk of complication of pneumothorax . The reported incidence of this complication varies between 3 in 100 and 1 in 10,000 . When present, axillary arch should always be accurately identified and formally divided to allow adequate exposure of axillary contents in order to achieve a complete lymphatic dissection . Axillary arch can easily cause difficulty for the inexperienced surgeon if, by following the band, the dissection is carried higher than normal, into the region of the axillary artery and brachial plexus . The defects of pectorals usually cause little or no functional disability and often go unnoticed by the patients or relatives . However an understanding of the spectrum and complexity of this anatomical variation may be of benefit to the surgeon and pathologists while performing fnac, core needle or tru cut biopsy . Absence of these muscles may increase the chances of direct spread of cancer breast through chest wall into cavity, which can worsen the prognosis.
Vestibular schwannoma (vs) usually arises within the internal auditory canal (iac) from either the superior or inferior vestibular nerve . These tumors usually grow very slowly with the growth rate 0.66 to 2 mm per year6,7). With time, they cause erosion of iac . The location of tumor in iac was closely related in erosion of iac, tumor that arise laterally along the course of eighth nerve could tend to cause varying degree of erosion before they extend into cerebellopontine angel (cpa) cistern4). Almost all vs usually widens iac only and could not invade the temporal bone beyond the confines of the bone of iac . In this report, we describe a patient without previously known bone disease who presented with aggressive temporal bone invasion of unilateral vs. a 51-year - old male presented with progressive hearing loss of last 4 years and dizziness of few months duration . He did not have a history of a head trauma or of any brain surgery . On admission, neurological and physical examination revealed left side deafness, no facial weakness, or no other low cranial nerve deficit like loss of gag reflex, uvular deviation, tongue deviation . The patient did not have any known systemic disease of bone and family history or physical characteristics of neurofibromatosis . His blood profile, including his serum calcium, phosphorus, and alkaline phosphates, was normal . Ct scan showed that the tumor mass had destructed iac completely and temporal bone to petrous apex, grown around the cochlea, reached the carotid artery in its petrous portion, extended to jugular foramen (fig . We noticed pneumatized area of opposite temporal bone corresponded to eroded area by tumor (fig . The tumor was a 43.83 cm sized, heterogeneous lobulated, well - defined mass with destruction of iac and extended to cpa cistern . The tumor was confined to posterior fossa and not extended to meckel's cave (fig . The combined translabyrinthine with retrosigmoid suboccipital approach was used for the resection of the tumor . At the first time of surgery, we removed the tumor piece by piece within temporal area with translabyrinthine approach, but we could not find facial nerve with this approach . So we performed additional retrosigmoid suboccipiral approach, and it allowed the exposure the lateral recess area easily and origin site of facial nerve from brain stem . After detection of facial nerve with intraoperative facial nerve monitoring, we dissected facial nerve from proximal to distal area . The dissection of the facial nerve within the temporal bone was very difficult, because the facial nerve was severely adhered to the tumor mass (fig . The tumor was extended to jugular foramen by destruction of superior wall of jugular foramen . The consistency of temporal bone was felt to be normal and the colors and the consistency of the tumor were typical of vs. we successfully achieved total removal of tumor and preserved facial nerve in continuity . The postoperative course was uneventful with normal facial nerve function and the vertigo was resolved . The patient was good condition after 18 months of follow - up without cranial nerve dysfunction . He also did not show any evidence of the recurrence or residual tumor in postoperative mri performed at 15 months of follow up . Vs typically originates lateral to the glial - schwann junction, and this point is usually located within the iac, and thus can erode the iac . But the mechanism of widening of iac by a vs still unknown . Takada et al.5) hypothesized that the mechanism involved in the destruction of iac is as follows: 1) the repeated strokes of the tumor caused by brain pulsation gradually eroded the bony wall of iac (especially, that of the posterior wall). The apparently less destruction of iac in cases with mostly cystic large tumors might be due to the restriction of this pulsatile movement . 2) increased cerebrospinal fluid pressure on the site had some influence on the mechanism of bone erosion as also does solidity of the tumor . This case presented with aggressive pattern of invasion of temporal bone, which is more extensive than expected in case of unilateral vs. temporal bone destruction over iac in vs is very rare . To our knowledge feghali and kantrowitz2) reported 4 cases of temporal invasion of unilateral vs, in which one cases had experienced previous schwannoma surgery . They suggested that the invasion to temporal bone occurred through two mechanism in growth of vs. one of them was that the destruction of bone in the petrous apex can actually follow the pneumatized tracts when the cortex of the iac was eroded . The second mechanism was that a thick membranous scar had " trapped " and confined the tumor within the temporal bone and separated it from the recurrent tumor in the cpa . We examined various factors related in the excessive erosion of temporal bone in this patient . In this case, the patient showed no signs of osteoporosis and no abnormal laboratory findings including serum level of calcium, phosphorus and alkaline phosphatase . Histologic findings demonstrated typical nature of benign schwannoma, and there were not excessive unusual vascularity nor any malignant features . If cortex of iac was eroded, the tumor could grow into the temporal bone through the pneumatized area . But we cannot determine why this unilateral tumor first eroded cortex of iac and destructed temporal bone to the petrous apex before growing along the area of least resistance toward the cpa cistern . Trigeminal schwannoma usually widen meckel's cave and extend into middle fossa and posterior fossa, may destruct petrous apex and grow into temporal bone . Mri showed that the tumor was confined to posterior fossa and not extended to meckel's cave . And tympanic segment is the most frequently involved3), so temporal bone might be destructed . The patient presented no facial palsy, no facial sensory change, and no facial pain . The most common surgical approaches for vs is the translabyrinthine or suboccipital approaches1). Because of hearing loss and mass in temporal bone, we performed combined translabyrinthine with retrosigmoid suboccipital approach to detect the facial nerve earlier and remove the tumor in temporal bone . The facial nerve was severely compressed and irregularly distorted by tumor, bony edges, and crests along the invaded petrous apex . Temporal bone destruction beyond the cortex of iac in vs is very rare, which cause facial nerve compressed and distorted severely . During operation, it is very difficult to dissect and preserve the facial nerve because of uneven erosion of temporal bone.
Left ventricular thrombus (lvt) is one of the most common complications of myocardial infarction (mi). The incidence of lvt in patients with acute anterior mis in the prethrombolytic era is ranged from 20% to 40% and with a non anterior acute myocardial infarction (ami) and the risk of lvt was <5% . Although controversial, in the contemporary era of routine early revascularization and more aggressive anticoagulation, the incidence of lvt complicating as an anterior ami is likely reduced and is currently estimated at 5 - 15% . The risk factors for the development of lvt are consistently irrespective of infarct treatment and include large infarct size, severe apical akinesia, or dyskinesia left ventricular (lv) aneurysm, and anterior mi . Two - dimensional transthoracic echocardiography is the imaging modality used most often for assessing the presence, shape, and size of an lv mural thrombus with an excellent specificity of 85 - 90% and sensitivity of 95% . Here, we report a case of 40-year - old male patient who is presented in emergency department with the complaint of substernal chest pain radiating to left arm and back associated with sweating for the last 1 day, there was no history of dyspnea, palpitation, any limb weakness, or any history suggestive of transient ischemic attack and peripheral embolization . His 12-lead electrocardiogram was suggestive of inferior wall mi [figure 1]. His total leukocyte and eosinophil counts were normal, prothrombin time / international normalized ratio and activated partial thromboplastin time were normal, and other tests for hypercoagulable states were planned for the follow - up evaluation . A transthoracic echocardiogram was performed bedside which revealed hypokinesia of basal, mid inferior, and inferoseptal wall [figure 2 and video 1]. Surprisingly, it also revealed a mobile mass which is the most probably thrombus attached to hypokinetic inferobasal septum just near the lv outflow tract (lvot) [figure 3 and video 2]. Considering the possibility that this mass was high risk for embolism, we planned for coronary angiogram followed by the surgical extraction of possible thrombus . However, unfortunately, despite the proper counseling and explanation of the risk of embolism, the patient refused for further intervention and got discharged against medical advice . Small arrows showing hypokinesia of basal inferior septum, large arrow indicates left ventricle probable thrombus apical four chambers view thrombi formation at basal interventricular septum near lvot is extremely rare as it is a region of high - velocity blood flow . Traditionally, the causes of lvt formation after acute st - segment elevation mi include segmental dysfunction of the infracted myocardium resulting in the stasis of blood, endocardial tissue inflammation that provides a thrombogenic surface and a hypercoagulable state . The higher mortality has been reported in patients with lv thrombi after infarction, especially when these develop within the first 48 h after infarction . The treatment for cardiac mass is a prompt surgical resection of the mass with the patients placed on cardiopulmonary bypass . Therefore, better understanding of the circumstances in which lv thrombosis occurs may influence the patient management . In our case, thrombus formed at the very unusual site and could lead to dreaded complication for the patient . The possible etiology of thrombus formation, in our case, is hypokinesia of basal septum due to mi, but the presence of a subtle septal rupture which is not detectable on echocardiography could not be ruled out.
Administration of an antibody (natalizumab) to the alpha 4 integrin molecule binding site to the head region of the vascular cell adhesion molecule 1 (vcam-1) molecule was found to be associated with systemic jc viremia and subsequent progressive multifocal leukoencephalopathy (pml) in a 60 year old crohn s disease patient who had been previously treated with infliximab and azothioprine . After only 6 administrations of the natalizumab antibody, serum jc viral load rose from being undetectable to 520 copies / ml and then to 6600 dna copies / ml two months later when pml was suspected, and required brain biopsy for diagnosis; up to 3.9 million jc virus dna copies per brain glial cell were found . Since the exact cause of the jc viremia remains unclear in this case, the future therapeutic role for natalizumab in treating multiple sclerosis and other disorders remains uncertain . To help understand the pathogenesis of antibody related jc viremia and subsequent pml, it is hypothesized here that the alpha 4 integrin antibody may disrupt the peripheral binding of the virus in natural tissue reservoirs in certain individuals; jc viremia after blockade of the normal alpha 4 integrin binding sites for the virus in lymphoid tissue such as spleen and the tonsils could overwhelm the normal cytotoxic t cell immune surveillance defense mechanisms . Indirect support for this hypothesis of peripheral binding of vp1 to alpha 4 integrin in lymphoid tissue comes from the work of caruso et al . Who found an important vp1 receptor function for the alpha 4 integrin molecule, which like the beta 1 integrin molecule is heavily glycosylated with terminal sialic acid residues, which were already known to mediate vp1 attachment . This study therefore attempts to identify critical amino acid binding sequences that may mediate an interaction between alpha 4 integrin molecules in normal host tissue and the jc virus vp1 coat proteins . Since idsp is a critical vcam-1 amino acid sequence for binding to the alpha 4 integrin, a search was made to find a similar sequence in the vp1 protein that could mediate an attachment to integrins . Using accession number j02288.1, the protein sequence for the polyoma vp1 coat protein was analyzed for idsp sequences using the national center for biotechnology information on - line data base (on - line web address: http://www.ncbi.nlm.nih.gov/). Enumeration of the amino acid residues followed the convention of numbering vp1 residues after the initial met residue (caruso et al . ). Alignment information for different strains of polyoma virus was analyzed by a conserved domain search at the following on - line web address: http://www.ncbi.nlm.nih.gov/structure/cdd/wrpsb.cgi . The localization of the dsp sequence for the human polyoma vp1 protein was studied using the molecular modeling database (mmdb), which enables reconstruction and interactive viewing of the three dimensional macromolecular structures with cn3d software; web address: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=structure the individual vp1 protein structure was analyzed as well as one of the 72 pentameric icosahedral capsids that cover the surface of the polyoma virus, and visualized in relation to hydrophobicity as well as charge . Although the full idsp sequence was not found, a dsp sequence was found for the jc polyoma virus vp1 coat protein (accession number p03089) as well as mouse polyomavirus (strain p16 small - plaque; accession - number 1sie_a), as well as chain 1, simian virus 40 (accession number 1sva_1), but not for kilham polyomavirus (accession number p24595), budgerigar fledgling polyomavirus (bfpyv; accession number p13891), hamster polyomavirus (hapyv; accession number p03092), african green monkey polyomavirus (accession number p04010), or bovine polyomavirus (accession number p24848). Alligned short segments of vp1 which display the homologous dsp sequence are shown in red in figure 1 with residues 70,71, and 72 for the jc polyoma virus being aspartic acid (d), serine (s), and proline (p) respectively . The three dimensional external view of a single pentamer capsid (figure 2) reveals accessible dsp residues for interaction and potential ligand binding . A detailed interactive review of a ball and stick type model (figure 3) one of the five individual molecules that form a pentamer suggests a peripheral location to the dsp loop in relation to the bulk of the vp1 molecule, with the suggestion that a pocket is formed by this eccentric peripheral loop that could allow insertion of a small ligand molecule into this site . Although the full idsp sequence was not found, a dsp sequence was found for the jc polyoma virus vp1 coat protein (accession number p03089) as well as mouse polyomavirus (strain p16 small - plaque; accession - number 1sie_a), as well as chain 1, simian virus 40 (accession number 1sva_1), but not for kilham polyomavirus (accession number p24595), budgerigar fledgling polyomavirus (bfpyv; accession number p13891), hamster polyomavirus (hapyv; accession number p03092), african green monkey polyomavirus (accession number p04010), or bovine polyomavirus (accession number p24848). Alligned short segments of vp1 which display the homologous dsp sequence are shown in red in figure 1 with residues 70,71, and 72 for the jc polyoma virus being aspartic acid (d), serine (s), and proline (p) respectively . The three dimensional external view of a single pentamer capsid (figure 2) reveals accessible dsp residues for interaction and potential ligand binding . A detailed interactive review of a ball and stick type model (figure 3) one of the five individual molecules that form a pentamer suggests a peripheral location to the dsp loop in relation to the bulk of the vp1 molecule, with the suggestion that a pocket is formed by this eccentric peripheral loop that could allow insertion of a small ligand molecule into this site . As reported in preliminary form by meyer, a dsp sequence has now been found that may represent a alpha 4 integrin binding site for the major jc polyoma virus external coat protein known as vp1 . Since the idsp sequence is critical in binding vcam-1 to the alpha 4 integrin molecule, and since the alpha 4 integrin molecule is also thought to serve as a post - attachment receptor for vp1, it is possible that that antibodies to the alpha 4 integrin molecule leaves the virus in peripheral lymphoid tissue in a free and unbound state . Since the alpha 4 integrin antibody natalizumab is associated with jc viremia and subsequent overwhelming brain infection by the virus (pml), it is hypothesized that alpha 4 integrin molecules in lymphoid tissue normally binds to the jc virus vp1 protein to render it non - infective by successfully competing with other receptors for the virus . The binding may be mediated by the dsp motif at residues 70,71, and 72 for jc, and at 88,89,90 for the murine polyoma a2 strain; for the latter, a nearby critical arginine residue at position 77 governs infectivity of the virus and is believed to bind to sialic acid containing molecules such as integrins . It is unclear if dsp mediated binding of vp1 to the alpa 4 integrin integrin molecule produces secondary conformational changes at the nearby vp1 arginine 77 sialic acid binding site to alter infectivity of the virus . Extensive literature exists regarding other viruses that display specific binding to integrins; antibodies to specific integrins can prevent infection by specific cytopathic viruses that normally do not show the jc phenomenon of long term benign persistence and dormancy within tissue . The alpha 6 integrin likely serves as a cellular receptor for papillomaviruses, whereas the alpha 5 beta 6 integrin binds to cocksackie virus a9 through a rgd amino acid sequence; this sequence is also implicated in the binding of b cell lymphotropic polyoma virus capsids to the alphav beta 3 integrin . When the alphav is found in combination with beta 8, this integrin can serve as a receptor for the foot and mouth disease virus; when alphav combines with beta 1, the integrin molecule dimer can be a receptor for the adenovirus . The alphav integrin is particularly important, as other combinations yield different viral specificities: when combined with beta 3, the integrin dimer can bind the west nile virus, cytomegalovirus, as well as rotavirus . Regarding the kaposi s sarcoma - associated herpesvirus, viral entry infectivity seems to depend on binding to inactive, bent, alphavbeta3-integrin molecules at a specific bend site at the plexin - semaphorinintegrin (psi), where molecular motion could otherwise take place to straighten the molecule into an active form . Further research is needed to understand if alpha 4 integrin binding to the dsp sequence of vp1 normally leaves the jc virus in a non - infective state . Successful competition with other tissue receptors for the virus might be an adequate explanation for why the jc virus can found in normal tissue of over 70% of normal individuals without causing pml, which is extremely rare in fully immunocompetent individuals, yet linked to pml in up to 4 to 6% of immunosuppressed hiv infected patients . In vitro studies are needed as well to test if synthetic dsp sequences can inhibit binding of vp1 to alpha 4 integrin molecules; should such an interaction be documented, it may have relevance to the understanding the natural biology of the jc polyoma virus, which can remain non - infective in not only kidney and lymphoid tissue, but also even the brain . Further understanding of how the jc virus persists is important in understanding multiple disease states, including primary brain tumors, which have been found to harbor the virus and express t antigens in oligodendrogliomas . This study has limitations in that the key publications by caruso et al . Which found a viral vp1 protein receptor function for the alpha 4 integrin molecule, derived their research findings from the murine polyoma virus; however, like the beta 1 integrin molecule and the serotonin receptor molecule, the alpha 4 integrin molecule is heavily glycosylated with terminal sialic acid residues . It is important to also note that blockade of the serotonin receptor 2a by risperidone does not inhibit jcv attachment, internalization and replication in primary human fetal glial cells, raising questions about the biologic relevance about data concerning the serotonin receptor also serving as a proposed receptor for the jc virus in light of the well established role for integrin molecules as receptors for other viruses; furthermore, linear sialylated pentasaccharides with the sequence neunac-2,6-gal-1,4-glcnac-1,3-gal-1,4-glc present on host glycoproteins and glycolipids have now been found to serve as a specific jcv recognition motif future research is needed to understand how this applies to integrin alpha 4 terminal oligosaccharide sequences . Finally, it is important to point out that caution with the use of natalizumab is strongly advised, as the latest data has revealed an incidence rate of 212 confirmed cases of pml among 99,571 patients treated with natalizumab, equating to 2.1 cases per 1000 treated patients.
Gliomas account for more than 70% of all brain tumors, and of which, malignant gliomas, the most common primary brain tumor in adults, are generally associated with poor survival relative to other types of brain tumors . Many environmental and lifestyle factors, including several occupations, ionizing radiation, cellular phones, smoking, and diet, have been considered to be associated with an increased glioma risk . Recently, accumulating evidence suggests that inherited risks may play an important role in glioma . Genetic studies, including genome - wide association studies (gwas), demonstrated that several genetic factors might be associated with glioma, such as ccdc26, egfr, rtel, gstp1, tert, and phldb1 genes . Usually, dna damage can be induced by exogenous carcinogens, such as ultraviolet rays and ionizing radiation, and contributes to genomic instability . Dna repair, playing an important role in the maintaining genomic integrity, involves several dna repair pathways, including base excision repair (ber), mismatch repair (mmr), and nucleotide excision repair (ner). Previous studies indicated that variants in dna repair genes might impair the dna repair capacity and contribute to cancer risk . Excision repair cross complementation group 1 (ercc1), ercc2, and ercc5 genes are dna repair genes, whose products are important in ner . Recently, several studies have focused on the association between polymorphisms in ercc1 gene (rs3212986, rs11615), ercc2 gene (rs1799793, rs13181, and rs238406), or ercc5 rs17655 polymorphism and glioma risk . However, the results were inconclusive, which might be due to studies with limited sample sizes or ethnic differences . To date, several meta - analyses reported the association between ercc1 or ercc2 polymorphisms and glioma risk, whereas these studies only focused on the 2 polymorphisms (rs3212986 in ercc1 gene and rs13181 in ercc2 gene). Thus, we conducted a comprehensive meta - analysis to investigate whether 6 polymorphisms in ercc1 (rs3212986 and rs11615), ercc2 (rs13181, rs1799793 and rs238406), and ercc5 (rs17655) genes are risk factors to the glioma susceptibility . We performed this meta - analysis according to the guidelines of preferred reporting items for systematic reviews and meta - analyses (prisma) statement . A comprehensive literature search was performed through the pubmed, embase, and web of science up to september 6, 2016 . Search strategies were as follows: glioma or brain tumor, polymorphism, and ercc1, in addition, the reference lists of all selected articles were checked by hand - search for additional potential studies . Studies were included in the meta - analysis if they met the following criteria: case control or cohort studies; association between ercc1 (rs3212986and rs11615), ercc2 (rs13181, rs1799793, and rs238406), or ercc5 (rs17655) polymorphism and glioma risk; available allele and genotype frequencies . Major reasons for exclusion of studies were as follows: articles only with an abstract, review articles, and comments; articles considered overlapped with other studies; and studies that had no control group . The following information from each eligible study was extracted independently by 2 investigators: first author's name, publication year, ethnicity (europeans and asians), whether cases and controls were matched (for case control studies), and genotype distribution in cases and controls . If the article did not provide sufficient genotype distribution, the corresponding author was contacted for the detailed data . Disagreements were resolved by discussion between the 2 investigators . Moreover, our analyses were based on previously published studies; thus, no ethical approval and patient consent are required the quality of the studies was independently assessed by 2 authors according to the quality scoring criteria, which is modified from previous meta - analyses (table 1). Quality scores ranged from 0 points (worst) to 13 points (best). Studies scoring less than 9 points were classified as low quality, and those scoring 9 points or higher were classified as high quality . The strength of the association between 6 polymorphisms in ercc1, ercc2, and ercc5 genes and glioma risk was estimated by odds ratios (ors) with corresponding 95% confidence intervals (cis). The genetic models evaluated for the pooled or of rs3212986 polymorphism were allele contrast (a vs c), homozygote comparison (aa vs cc), heterozygote comparison (ac vs cc), dominant model (aa+ac vs cc), as well as recessive model (aa vs ac+cc). The significance of the pooled or was determined by the z - test, and a p value less than .05 was considered as statistically significant . Heterogeneity was considered significant for p <.10, and then the random effect model was selected; otherwise, a fixed - effects model was used . In addition, galbraith plot was used to visualize the impact of individual studies on the overall heterogeneity, which spotted the outlier as the possible origin of heterogeneity . The hardy weinberg equilibrium (hwe) in the control group was also assessed, and a p <.05 was considered as significant disequilibrium . Sensitivity analysis was performed by sequential excluding a single study each time in an attempt to identify the potential influence of the individual data to the pooled ors . Cumulative meta - analysis was carried out for each polymorphism in association with glioma to evaluate the trend of the genetic risk effect (or) of the allele comparisons as evidence accumulates over time . If significant publication bias was detected, trim and fill methods was used to adjust ors and 95% cis . Analyses were performed using stata software, version 12 (statacorp lp, college station, tx). We performed this meta - analysis according to the guidelines of preferred reporting items for systematic reviews and meta - analyses (prisma) statement . A comprehensive literature search was performed through the pubmed, embase, and web of science up to september 6, 2016 . Search strategies were as follows: glioma or brain tumor, polymorphism, and ercc1, in addition, the reference lists of all selected articles were checked by hand - search for additional potential studies . Studies were included in the meta - analysis if they met the following criteria: case control or cohort studies; association between ercc1 (rs3212986and rs11615), ercc2 (rs13181, rs1799793, and rs238406), or ercc5 (rs17655) polymorphism and glioma risk; available allele and genotype frequencies . Major reasons for exclusion of studies were as follows: articles only with an abstract, review articles, and comments; articles considered overlapped with other studies; and studies that had no control group . The following information from each eligible study was extracted independently by 2 investigators: first author's name, publication year, ethnicity (europeans and asians), whether cases and controls were matched (for case control studies), and genotype distribution in cases and controls . If the article did not provide sufficient genotype distribution, the corresponding author was contacted for the detailed data . Disagreements were resolved by discussion between the 2 investigators . Moreover, our analyses were based on previously published studies; thus, no ethical approval and patient consent are required the quality of the studies was independently assessed by 2 authors according to the quality scoring criteria, which is modified from previous meta - analyses (table 1). Quality scores ranged from 0 points (worst) to 13 points (best). Studies scoring less than 9 points were classified as low quality, and those scoring 9 points or higher were classified as high quality . The strength of the association between 6 polymorphisms in ercc1, ercc2, and ercc5 genes and glioma risk was estimated by odds ratios (ors) with corresponding 95% confidence intervals (cis). The genetic models evaluated for the pooled or of rs3212986 polymorphism were allele contrast (a vs c), homozygote comparison (aa vs cc), heterozygote comparison (ac vs cc), dominant model (aa+ac vs cc), as well as recessive model (aa vs ac+cc). The significance of the pooled or was determined by the z - test, and a p value less than .05 was considered as statistically significant . Heterogeneity was considered significant for p <.10, and then the random effect model was selected; otherwise, a fixed - effects model was used . In addition, galbraith plot was used to visualize the impact of individual studies on the overall heterogeneity, which spotted the outlier as the possible origin of heterogeneity . The hardy weinberg equilibrium (hwe) in the control group was also assessed, and a p <.05 was considered as significant disequilibrium . Sensitivity analysis was performed by sequential excluding a single study each time in an attempt to identify the potential influence of the individual data to the pooled ors . Cumulative meta - analysis was carried out for each polymorphism in association with glioma to evaluate the trend of the genetic risk effect (or) of the allele comparisons as evidence accumulates over time . If significant publication bias was detected, trim and fill methods was used to adjust ors and 95% cis . Analyses were performed using stata software, version 12 (statacorp lp, college station, tx). A total of 166 studies were identified during our premature searches . After a review of titles and abstracts, 1 article only with an abstract, 8 about other tumors, 3 review articles, and 2 articles reported other polymorphisms . Finally, a total of 14 articles met our selection criteria . 1 . Among them, 1 article reported data on 2 different series, and we treated them independently . Finally, 15 studies comprising 4878 cases and 6748 controls were included in the meta - analysis . Studies were conducted in 2 populations of ethnic descent: 8 europeans and 7 asians . The distribution of genotypes in the control groups of all studies was in agreement with hwe except one . The association between the ercc1 rs3212986 polymorphism and susceptibility to glioma was assessed in a total of 3539 cases and 5035 controls . As summarized in table 3 and fig . 2a, a significant association was observed in allele comparison (a vs c: or = 1.079, 95% ci = 1.0071.157, p = .032), homozygote comparison (aa vs cc: or = 1.280, 95% ci = 1.0831.514, p = .004), and recessive model (aa vs ac + cc: or = 1.263, 95% ci = 1.0741.486, p = .005) in overall population . In the subgroup analysis by ethnicity, a significantly increased glioma risk was found in asian population (a vs c: or = 1.132, 95% ci = 1.0221.254, p = .018; aa vs cc: or = 1.298, 95% ci = 1.0431.630, p = .025; and aa vs aa + ac: or = 1.250, 95% ci = 1.0041.556, p = .046). However, in europeans, a significant association between rs3212986 polymorphism and glioma risk was only observed in recessive model (aa vs aa + ac: or = 1.280, 95% ci = 1.0041.631, p = .046). Moreover, the results did not show significant association between ercc1 rs11615 polymorphism and glioma risk . Forest plots for the association between theercc1 rs3212986 and ercc2 rs13181 polymorphisms and glioma risk . (a) ercc1 rs3212986 polymorphism (a vs c); (b) ercc2 rs13181 polymorphism (c vs a). The sizes of the squares reflect the weighting of included studies; the center of diamonds reflect summary effect, the left and right extremes of diamonds reflect 95% confidence intervals . Meta - analysis findings of association between rs13181 polymorphism and glioma are summarized in table 4 . When stratified by ethnicity, a significantly increased glioma risk was found in asians (c vs a: or = 1.259, 95% ci = 1.0951.466, p = .001) (fig . 2b). For the rs1799793 polymorphism, significantly increased glioma risk was also observed in asians (a vs g: or = 1.274, 95% ci = 1.1181.451, p <.001). However, nonsignificant correlation was observed between rs238406 polymorphsim and glioma risk . Chi - square based q test showed that significant heterogeneity existed in 3 genetic models for rs13181 polymorphism (c vs a: p = .045, ca vs aa: p = .070, cc+ca vs aa: p = .051, cc vs ca+aa: p = .037). Galbraith plots showed that 1 independent study was the possible origin of heterogeneity, and the heterogeneity was removed when this study was excluded (c vs a: ph = .452, ca vs aa: ph = .242, cc+ca vs aa: ph = .254) (fig . The 95% confidence interval is between the 2 outer parallel lines at 2 units above and below the regression line . A total of 1989 patients and 3216 controls were analyzed for ercc5 rs17655 polymorphism and glioma risk . The results showed that the risk for glioma was not significantly increased in persons carrying a c allele compared with those carrying a g allele (c vs g: or=1.036, 95% ci=0.8991.195). Moreover, the chi - square based q test and i test indicated that between - study heterogeneity was not significant in all genetic models . Sensitivity analysis was performed by sequential removal of each study, the results of which showed that the pooled ors were consistently significant by omitting 1 study at a time (fig ., pooled ors tended to be significant and stable with the accumulation of more data over time (fig ., these results suggested that the results of this meta - analysis were highly stable . Sensitivity analysis on the association between the ercc1 rs3212986 and ercc2 rs13181 polymorphisms and glioma risk . (a) ercc1 rs3212986 polymorphism (a vs c); (b) ercc2 rs13181 polymorphism (c vs a). Results were computed by omitting each study (left column) in turn . A cumulative meta - analysis on the association between the ercc1 rs3212986 and ercc2 rs13181 polymorphisms and glioma risk . (a) ercc1 rs3212986 polymorphism (a vs c); (b) ercc2 rs13181 polymorphism (c vs a). Pooled or estimates with the 95% ci as information accumulates at the end of each year (left column). The shapes of the funnel plots did not reveal evidence of obvious asymmetry in all comparison models (fig . Moreover, the results of egger test confirmed this finding (p = .566 for aa vs cc in rs3212986 polymorphism, p = .163 for tt vs cc in rs11615 polymorphism, p = .311 for cc vs aa in rs13181 polymorphism, p = .973 for aa vs gg in rs1799793 polymorphism, p = .076 for aa vs cc in rs238406 polymorphism, and p = .735 for cc vs gg in rs17655 polymorphism). Funnel plots of the association between the ercc1 rs3212986 and ercc2 rs13181 polymorphisms and glioma risk . (a) ercc1 rs3212986 polymorphism (aa vs ac+cc); (b) ercc2 rs13181 polymorphism (cc vs ca+aa). The vertical line in the funnel plot indicates the summary estimate, while the sloping lines indicate the expected 95% ci for a given standard error, assuming no heterogeneity between studies . A total of 166 studies were identified during our premature searches . After a review of titles and abstracts, 1 article only with an abstract, 8 about other tumors, 3 review articles, and 2 articles reported other polymorphisms . Finally, a total of 14 articles met our selection criteria . 1 . Among them, 1 article reported data on 2 different series, and we treated them independently . Finally, 15 studies comprising 4878 cases and 6748 controls were included in the meta - analysis . Studies were conducted in 2 populations of ethnic descent: 8 europeans and 7 asians . The distribution of genotypes in the control groups of all studies was in agreement with hwe except one . The association between the ercc1 rs3212986 polymorphism and susceptibility to glioma was assessed in a total of 3539 cases and 5035 controls . As summarized in table 3 and fig . 2a, a significant association was observed in allele comparison (a vs c: or = 1.079, 95% ci = 1.0071.157, p = .032), homozygote comparison (aa vs cc: or = 1.280, 95% ci = 1.0831.514, p = .004), and recessive model (aa vs ac + cc: or = 1.263, 95% ci = 1.0741.486, p = .005) in overall population . In the subgroup analysis by ethnicity, a significantly increased glioma risk was found in asian population (a vs c: or = 1.132, 95% ci = 1.0221.254, p = .018; aa vs cc: or = 1.298, 95% ci = 1.0431.630, p = .025; and aa vs aa + ac: or = 1.250, 95% ci = 1.0041.556, p = .046). However, in europeans, a significant association between rs3212986 polymorphism and glioma risk was only observed in recessive model (aa vs aa + ac: or = 1.280, 95% ci = 1.0041.631, p = .046). Moreover, the results did not show significant association between ercc1 rs11615 polymorphism and glioma risk . Forest plots for the association between theercc1 rs3212986 and ercc2 rs13181 polymorphisms and glioma risk . (a) ercc1 rs3212986 polymorphism (a vs c); (b) ercc2 rs13181 polymorphism (c vs a). The sizes of the squares reflect the weighting of included studies; the center of diamonds reflect summary effect, the left and right extremes of diamonds reflect 95% confidence intervals . Meta - analysis findings of association between rs13181 polymorphism and glioma are summarized in table 4 . There was no significant association observed in the overall population . When stratified by ethnicity, a significantly increased glioma risk was found in asians (c vs a: or = 1.259, 95% ci = 1.0951.466, p = .001) (fig . For the rs1799793 polymorphism, significantly increased glioma risk was also observed in asians (a vs g: or = 1.274, 95% ci = 1.1181.451, p <.001). Chi - square based q test showed that significant heterogeneity existed in 3 genetic models for rs13181 polymorphism (c vs a: p = .045, ca vs aa: p = .070, cc+ca vs aa: p = .051, cc vs ca+aa: p = .037). Galbraith plots showed that 1 independent study was the possible origin of heterogeneity, and the heterogeneity was removed when this study was excluded (c vs a: ph = .452, ca vs aa: ph = .242, cc+ca vs aa: ph = .254) (fig . The 95% confidence interval is between the 2 outer parallel lines at 2 units above and below the regression line . A total of 1989 patients and 3216 controls were analyzed for ercc5 rs17655 polymorphism and glioma risk . The results showed that the risk for glioma was not significantly increased in persons carrying a c allele compared with those carrying a g allele (c vs g: or=1.036, 95% ci=0.8991.195). Moreover, the chi - square based q test and i test indicated that between - study heterogeneity was not significant in all genetic models . Sensitivity analysis was performed by sequential removal of each study, the results of which showed that the pooled ors were consistently significant by omitting 1 study at a time (fig ., pooled ors tended to be significant and stable with the accumulation of more data over time (fig ., these results suggested that the results of this meta - analysis were highly stable . Sensitivity analysis on the association between the ercc1 rs3212986 and ercc2 rs13181 polymorphisms and glioma risk . (a) ercc1 rs3212986 polymorphism (a vs c); (b) ercc2 rs13181 polymorphism (c vs a). Results were computed by omitting each study (left column) in turn . A cumulative meta - analysis on the association between the ercc1 rs3212986 and ercc2 rs13181 polymorphisms and glioma risk . (a) ercc1 rs3212986 polymorphism (a vs c); (b) ercc2 rs13181 polymorphism (c vs a). Pooled or estimates with the 95% ci as information accumulates at the end of each year (left column). The shapes of the funnel plots did not reveal evidence of obvious asymmetry in all comparison models (fig . 6). Moreover, the results of egger test confirmed this finding (p = .566 for aa vs cc in rs3212986 polymorphism, p = .163 for tt vs cc in rs11615 polymorphism, p = .311 for cc vs aa in rs13181 polymorphism, p = .973 for aa vs gg in rs1799793 polymorphism, p = .076 for aa vs cc in rs238406 polymorphism, and p = .735 for cc vs gg in rs17655 polymorphism). Funnel plots of the association between the ercc1 rs3212986 and ercc2 rs13181 polymorphisms and glioma risk . (a) ercc1 rs3212986 polymorphism (aa vs ac+cc); (b) ercc2 rs13181 polymorphism (cc vs ca+aa). The vertical line in the funnel plot indicates the summary estimate, while the sloping lines indicate the expected 95% ci for a given standard error, assuming no heterogeneity between studies . Logor natural logarithm of the or, s.e . Of logor standard error of the logor . Dna repair plays an important role in the maintaining genomic integrity, which consists of several pathways . Recent studies showed that ner was one of the most important pathways during dna repair . Ercc1, ercc2, and ercc5 were core factors that participated in the ner pathway . During ner, the ercc1 gene codes for a protein that makes the 5 incision by forming a complex with xpf . Moreover, melton et al showed that mutant cells from ercc1-deficient mice showed ner deficiency and had an increased mutation frequency as well as an elevated level of genomic instability . Moreover, accumulated genetic epidemiological studies have been conducted to explore the association between ercc1, ercc2, and ercc5 polymorphisms and glioma risk; however, the results were inconclusive . Therefore, we performed a comprehensive meta - analysis with published studies to clarify the role of these polymorphisms in glioma . This meta - analysis demonstrated that ercc1 rs3212986 polymorphism was significantly associated with glioma risk under the following genetic models (aa vs cc: or = 1.280, 95% ci=1.0831.514, p = .004 and aa vs ac + cc: or = 1.263, 95% ci = 1.0741.486, p = .005). When stratified by ethnicity, the significant association was still observed in asians (aa vs cc: or = 1.298, 95% ci = 1.0431.630, p = .025), but not among europeans in major genetic models, suggesting that the contribution of ercc1 rs3212986 polymorphism might vary across different populations . Generally, europeans more frequently suffered from glioma than people of african or asian descent, which was also observed in children . In addition, the pooled or did not change in the sensitivity analysis by excluding 1 study each time, indicating that the results of this meta - analysis were highly stable . Finally, cumulative meta - analysis indicated that pooled ors tended to be significant and stable with the accumulation of more data over time . The ercc2 rs13181 polymorphism showed significant association with glioma susceptibility (cc vs aa: or = 1.539, 95% ci = 1.1222.109, p = .007) in asians . (aa vs gg: or = 1.474, 95% ci = 1.0901.994, p = .012). In the analysis of rs11381 polymorphism, significant heterogeneity existed in major genetic models when all eligible studies were pooled into analysis . However, the results of galbraith plots analyses indicated that 1 independent study was the main potential origin of heterogeneity; when excluding, the heterogeneity was removed . Moreover, a sensitivity analysis showed that no single study qualitatively changed the pooled ors . However, there was no significant association observed between rs11615, rs238406, or rs17655 polymorphism and glioma susceptibility . Our analyses demonstrated that the ercc1 rs3212986 and ercc2 gene (rs13181 and rs1799793) polymorphisms had a moderate increase in glioma susceptibility . Second, it is clear that genetic susceptibility to cancer is complex because of interactions between genes and environmental factors . However, we could not assess gene environment interactions due to insufficient data in most studies . Recently, pan et al investigated the association between language biases and selective reporting in human genome epidemiology, which demonstrated that chinese studies showed more prominent genetic effects than non - chinese studies, whereas the sample size of chinese studies was always smaller . Thus, more non - chinese studies in asian populations were needed to confirm the significant association in asians . In addition, gwas have identified single nucleotide polymorphisms implicating hundreds of replicated loci for common traits and became a powerful tool to detect the susceptibility genes in cancers . Accumulated gwas have provided strong evidences for the association between glioma risk and numerous genes, including tert, terc, egfr, ccdc26, and rtel .. however, to date, association of polymorphisms in ercc genes with susceptibility to glioma has not been investigated in gwas . Thus, further genetics studies, especially gwas studies, are required to confirm the possible role of ercc polymorphisms in glioma . Future studies with larger sample size in different ethnic groups (e.g., asians and africans) are needed to clarify the possible roles of ercc1, ercc2, and ercc5 genes in the etiology and progression of glioma . In addition, studies investigating gene environment may lead to a better understanding of the role of the ercc gene polymorphisms in glioma.
Obesity, which is caused by imbalance between energy intake and energy expenditure, can be multifactorial (unhealthy lifestyle, genetic, economical, cultural and social status). Analysis of 144 studies in different countries during 2010 showed that 43 million preschool children were overweight or obese . In asia, prevalence of overweight and obesity in preschool children was 4.9% in 2010 . Recent reports indicate that over 15% of children living in iran and neighboring countries are overweight or obese. [59] according to a national report, it was estimated that 4.4% of school children of iran were obese . Following this, the prevalence of obesity in preschool children was recorded as 4.8% in boys and 4.5% in girls in tehran . It is reported that 80% of obese children become obese adults, which can bring about non - communicable diseases, academically unsuccessful, socially inept and behavioral problems. [1315] hence, a valuable strategy to promote healthy lifestyle from early childhood is behavioral lifestyle modification, focused on dietary and activity habits by parental involvement as the primary agents . Thus, alarming and motivating them for stability of lifestyle changes is crucial. [1620] as long as family bonding has a vital role in the child's behavioral modeling, and also school age is the most appropriate time for acquiring knowledge and habits, and because of there being limited research on obesity in preschool children, this study was the only one taken specifically on 7-year - old obese children to evaluate a family - based behavioral intervention to promote physical activity and healthy dietary habits in tehran in 2011 . This was a field trial study conducted in a random sample of 7-year - old obese children (n = 156) who were selected from nine health centers of three districts in the north of tehran . Five hundred and fifty obese children were introduced by nine health centers based on study criteria (child age 7 years old, 95 percentile of body mass index (bmi) for age and willing to participate). Afterwards, a trained member of the research team called them to describe the study and to confirm an initial screening for eligibility . Children got a code number and were randomly divided into two groups; intervention (n = 70) and control (n = 86). Then, based on timetable schedule, they were invited to fieldwork (national nutrition and food technology research institute) for secondary screening . Parents and children who expressed their interest were assigned and then they completed the consent form . Ultimately, based on exclusion criteria (mental retardation, psychiatric symptoms, current obesity treatment, chronic disease and use of medication), 156 obese children were recruited . The study was designed in four phases as follows [figure 1]. In this phase, we measured anthropometric indices and completed socio - demographic and semi - quantitative food frequency questionnaires (ffq). For each subject in addition, biochemical analysis was only done at phases 1 and 4 because of ethical obligations . Weight was measured to the nearest 0.1 kg using a calibrated and certified portable digital scale (beurer, made in germany) with lightly dressed, without shoes and empty pockets . Height was determined on a standing position, barefoot using a portable height gauge (seca) with accuracy of 0.1 cm . The waist circumference was measured at the smallest area between the edge of the lower chest and iliac crest bone . Hip circumference was measured at the maximum level over light clothing and at the widest girth of the hip using an unstretched tape meter without any pressure to the body surface . The scale was calibrated and the mean of the two measurements was recorded . For blood sampling, subjects were asked to be 12 h overnight fasting and were invited to a health center near the fieldwork . Blood (5 cc) was taken from the cubical vein after confirming the 12-h fasting with parents . The fasting blood glucose, triglyceride (tg), total cholesterol low - density lipoprotein - cholesterol (ldl - c) and high - density lipoprotein - cholesterol (hdl - c) concentrations were analyzed on fresh blood (on the day it was collected) using a commercial kit based on the enzymatic method (pars azmoon, iran) with an auto - analyzer (selectra e, vita lab, netherlands). Questionnaires on socio - demographic characteristics and ffq were completed by interviewing with trained dieticians who are experienced in working with obese children . Socio - demographic questionnaire included family number, parents occupation and education, birth weight, duration of breastfeeding, gestational diabetes, history of obesity in family, walking to school, play with computer game and watching tv . The validated ffq was used to assess typical food intake over the previous year and, currently, included 168 items . For converting portion sizes to grams parents attended to eight sessions weekly, for the first 2 months, then four sessions remained, which were held monthly . Each session lasts 4 h and started with a review of parent progress in implementing the strategies developed for changing their child's eating or exercise habits . Parents were intimated by group leaders about the successes, challenges and barriers encountered as they attempted to make lifestyle changes as well as the possible strategies for overcoming various challenges during the previous session . Sessions topics such as learning about the reasons of the childhood obesity, receiving nutritional information (e.g., food pyramid, food choices, food labels, food preparation and cooking, eating habits, regular meals, controlling environments that stimulate overeating, special dietary consideration during holidays, vacations and at the restaurants) and guidelines for physical activity and reducing sedentary behaviors (e.g., reduce watching television and playing computer games, use stairs instead of elevators and play outside instead of inside). According to the study design for this phase, the intervention group did not perform any type of training, educational and follow - up programs . While for the control group, training programs (two sessions) were conducted according to the ethical obligations . After rechecking all the data, statistical analyses were performed using excel, access and spss software package (version 16; [spss] statistical package for the social sciences inc ., chi - square, student's t - test, fisher, paired - t - test and friedman test were used to compare the ratios and the means of the groups . Because we measured our variables 4 times during the study, a repeated measurement anova was used to compare data among several times . In this analysis, time effect, group effect and interaction between them were assessed, but, because the group effect was not significant, only the other two p values were mentioned . Five hundred and fifty obese children were introduced by nine health centers based on study criteria (child age 7 years old, 95 percentile of body mass index (bmi) for age and willing to participate). Afterwards, a trained member of the research team called them to describe the study and to confirm an initial screening for eligibility . Children got a code number and were randomly divided into two groups; intervention (n = 70) and control (n = 86). Then, based on timetable schedule, they were invited to fieldwork (national nutrition and food technology research institute) for secondary screening . Parents and children who expressed their interest were assigned and then they completed the consent form . Ultimately, based on exclusion criteria (mental retardation, psychiatric symptoms, current obesity treatment, chronic disease and use of medication), 156 obese children were recruited . In this phase, we measured anthropometric indices and completed socio - demographic and semi - quantitative food frequency questionnaires (ffq). For each subject in addition, biochemical analysis was only done at phases 1 and 4 because of ethical obligations . Weight was measured to the nearest 0.1 kg using a calibrated and certified portable digital scale (beurer, made in germany) with lightly dressed, without shoes and empty pockets . Height was determined on a standing position, barefoot using a portable height gauge (seca) with accuracy of 0.1 cm . The waist circumference was measured at the smallest area between the edge of the lower chest and iliac crest bone . Hip circumference was measured at the maximum level over light clothing and at the widest girth of the hip using an unstretched tape meter without any pressure to the body surface . For blood sampling, subjects were asked to be 12 h overnight fasting and were invited to a health center near the fieldwork . Blood (5 cc) was taken from the cubical vein after confirming the 12-h fasting with parents . Also, parents were allowed to accompany their child during sampling . The fasting blood glucose, triglyceride (tg), total cholesterol low - density lipoprotein - cholesterol (ldl - c) and high - density lipoprotein - cholesterol (hdl - c) concentrations were analyzed on fresh blood (on the day it was collected) using a commercial kit based on the enzymatic method (pars azmoon, iran) with an auto - analyzer (selectra e, vita lab, netherlands). Questionnaires on socio - demographic characteristics and ffq were completed by interviewing with trained dieticians who are experienced in working with obese children . Socio - demographic questionnaire included family number, parents occupation and education, birth weight, duration of breastfeeding, gestational diabetes, history of obesity in family, walking to school, play with computer game and watching tv . The validated ffq was used to assess typical food intake over the previous year and, currently, included 168 items . For converting portion sizes to grams an applicable 12-session training program for 6 months was designed with parents in the intervention group . Parents attended to eight sessions weekly, for the first 2 months, then four sessions remained, which were held monthly . Each session lasts 4 h and started with a review of parent progress in implementing the strategies developed for changing their child's eating or exercise habits . Parents were intimated by group leaders about the successes, challenges and barriers encountered as they attempted to make lifestyle changes as well as the possible strategies for overcoming various challenges during the previous session . Sessions topics such as learning about the reasons of the childhood obesity, receiving nutritional information (e.g., food pyramid, food choices, food labels, food preparation and cooking, eating habits, regular meals, controlling environments that stimulate overeating, special dietary consideration during holidays, vacations and at the restaurants) and guidelines for physical activity and reducing sedentary behaviors (e.g., reduce watching television and playing computer games, use stairs instead of elevators and play outside instead of inside). According to the study design for this phase, the intervention group did not perform any type of training, educational and follow - up programs . While for the control group, training programs (two sessions) were conducted according to the ethical obligations . After rechecking all the data, statistical analyses were performed using excel, access and spss software package (version 16; [spss] statistical package for the social sciences inc ., chi - square, student's t - test, fisher, paired - t - test and friedman test were used to compare the ratios and the means of the groups . Because we measured our variables 4 times during the study, a repeated measurement anova was used to compare data among several times . In this analysis, time effect, group effect and interaction between them were assessed, but, because the group effect was not significant, only the other two p values were mentioned . The participants in this study were 156 obese children (80 girls and 76 boys). Family characteristics are shown in table 1 . According to this table, most children were from families with four members per household (48%). Most of the mothers and fathers were housewife and employee, 72% and 42%, respectively . The mean of children's birth weight was 3290 620 g, and more than half of them were breastfed for more than 6 months (52%). Moreover, only 5% of the mothers gestational diabetes and 44% of the children had a history of obesity in their family . Two study groups were broadly similar at baseline, and these variables were not significantly different between them . Characteristics of the study participants evaluation of physical activities and sedentary behaviors of children showed that walking time increased and watching tv and playing computer decreased significantly in intervention group especially during the 2 and 3 phases . The results of repeated measurement analysis showed that walking, watching tv and playing with computer increased significantly in both groups, but each of these variables was managed better in the intervention group than in the control group; however, the interaction of time and group was not significant . Evaluation of anthropometric indices in obese children showed that although weight, height and bmi increased significantly in both groups, this increase was lower in the intervention group compared with the control group, especially at the second and third phases . In addition, decline in waist and hip circumferences were also seen during the intervention phases [table 2]. The trend of anthropometric indices of obese children in 4 phases as shown in table 3, among biochemical indices, although positive trends of tg and cholesterol were observed, interaction between the two groups was not significant . The trend of biochemical indices of obese children in phases 1 and 4 evaluation of ffq showed that consumption of milk and fruit increased significantly in the intervention group (p <0.05). Consumption of bread and sugar and jam decreased significantly in both groups [table 4]. In contrast different types of fat and oil decreased significantly in the intervention families rather than in controls (p <0.05) [figure 2]. The trend of food consumption (g / day / person) of obese children in 4 phases the trend of familys fat and oil consumption the results of this family - based intervention for controlling excess weight among young children showed a combination of variables, nutrition behaviors, physical activity and parental involvement as the primary agents of change, and indicated that these can be effective in preventing childhood obesity . In this study, in phases 2 and 3, waist and hip circumferences decreased in the intervention group compared with the control group . But, this increment was lower in the intervention group than in the control group, like flodmark et al . Family - based studies[3033] have also shown that the combination of exercise and behavioral modification can be effective for reducing waist circumference and bmi in the intervention group rather than in the control group . The reason of this success was educational program for parents and children with free sport classes and cooperation of school staff . Unlike our results, in another family - based study that was conducted for 2 years, bmi declined significantly in the intervention group . In this study, children's physical activity increased and sedentary behaviors were managed at close to the standard range . Similarly, after family - based interventions in the sacher, epstein, muller and robinson studies, children's physical activity was increased and sedentary behaviors decreased by regulating the time of television viewing . Because the school is the best place for providing an opportunity for education and increased physical activity, and children spend most of their time there, unfortunately, in our schools, the strategies to motivate and increase physical activity in children are powerless . Also, in the hours after school and on holidays, parents were unsupportive and did not have the ability to plan for promoting physical activity because of individual and environmental barriers such as urbanization, lack of safe and easy - access places, family funds, time (working mother, traffic) and pollution, and children had to choose the last option that is watching tv and playing on the computer . It seems that a positive trend was observed toward the intervention group to improvement in blood levels of some biochemical parameters, similar to the jiang et al . And studies that showed that total cholesterol and triglyceride were decreased in the intervention group . In this study, the consumption of dairy products and fruits were increased significantly . In the faghihi study, the average consumption of milk and dairy group was significantly increased in the intervention group compared with the control group . Sugar and confectionery ingredients consumption also decreased relative to the baseline, which reflected the control and management of mothers, although the interaction between the two groups was not significant . Similar to the epstein, gortmaker and sahota studies an improvement in children's dietary habits was shown with increased fruit and vegetable consumption and balancing the intake of foods that contain high sugar . Evaluation of the total consumption of oils and fats group of households showed that it was significantly lower in the intervention group compared with the control group, similar with armitage, himes and caballero studies, which could be representative of the skills and consumption management of mothers . There are several limitations in this study; first is that the majority of children suffered from severe obesity and thus lifestyle modification could have been more difficult to achieve . Otherwise, parents of the control group were keen to know more about this matter, and we did not see a significant difference between the two groups . The family - based lifestyle program had limited effects on anthropometric and metabolic outcomes of obese children . We suggest that if interventions were performed in longer periods with a teamwork including a dietitian, psychologist, coach and all family members and school staff, weight control and lifestyle modification would have been more efficient . It is obvious that government policy and organization support are also effective ways to decrease childhood obesity and to have a healthy society in the future.
5-hydroxytryptophan (5-htp) is a metabolite of l - tryptophan and the immediate precursor of serotonin . L-3,4-dihydroxyphenylalanine (l - dopa) is a metabolite of l - tyrosine and the immediate precursor of dopamine . Brain barrier.1 l - dopa freely crosses the blood brain barrier, then is synthesized into dopamine without biochemical feedback inhibition.2 greater amounts of l - dopa need to be administered if increased synthesis of dopamine in the central nervous system is required.312 l - tyrosine does not have this ability, due to norepinephrine biochemical feedback inhibition of tyrosine hydroxylase . To understand the discussions contained herein, the concepts of the endogenous state and competitive inhibition state need to be defined.1,1220 humans taking no supplemental serotonin or dopamine amino acid precursors are in the endogenous state . The endogenous state also exists when l - dopa or 5-htp is administered without adequate amounts of serotonin or dopamine precursors, respectively . The amino acid intermediates 5-htp and l - dopa do not occur in the normal diet in amounts sufficient to produce a significant metabolic effect . The competitive inhibition state does not occur with normal or optimal food intake due to biochemical feedback inhibition of l - tyrosine and l - tryptophan . Their respective conversion to l - dopa and 5-htp in a normal or optimal diet are inadequate to establish competitive inhibition . This limits the amount of dopamine and serotonin synthesized to levels less than are required to place the system into the competitive inhibition state.1220 when daily dopamine and dopamine amino acid requirements are higher than can be achieved in a normal or optimal diet, the state is known as a relative nutritional deficiency.12 the concept of competitive inhibition between serotonin and dopamine is well known to science . Competitive inhibition is the interaction of serotonin and dopamine that may occur in synthesis, transport, and metabolism only when adequate and properly balanced amounts of serotonin and dopamine amino acid precursors are administered simultaneously . Full optimization of the competitive inhibition state requires simultaneous administration of properly balanced 5-htp, l - dopa, l - tyrosine, a thiol (l - cysteine, glutathione, s - adenosylmethionine, or l - methionine), and cofactors (vitamin c, pyridoxal phosphate, or calcium carbonate). To date, the only published methodology for optimization of the competitive inhibition state is organic cation transporter type 2 (oct2) functional status determination.1220 the focus of this paper is not l - dopa efficacy, which has been firmly established by numerous past studies; this paper focuses on management of l - dopa dosing utilizing a novel technique that identifies overdose in the competitive inhibition state relative to optimal daily dosing, and assists in identifying the optimal dosing range . Administration of l - dopa in parkinson s disease has been studied since the early 1960s.21 since then, numerous side effects and adverse reactions have been documented.2,12 most agree with the mayo clinic s observations that l - dopa is the most effective parkinson s disease treatment available.22 typically, other less effective drugs are used to control symptoms as long as possible prior to prescribing l - dopa . This delays the inevitable onset of progressive side effects and adverse reactions associated with concomitant administration of l - dopa and carbidopa (or benserazide).21 past research documented the use of general decarboxylase inhibitors such as carbidopa and benserazide for the management of l - dopa - induced nausea.23,24 these drugs have no direct benefit in the management of parkinson s disease symptoms . The primary reason for administering carbidopa or benserazide is to decrease daily l - dopa dosing requirement, thereby decreasing l - dopa - induced nausea . During l - dopa monotherapy (administration without a decarboxylase inhibitor), these side effects may prevent the patient from ingesting enough l - dopa to control symptoms.2 the enzyme l - aromatic amino acid decarboxylase (aaad) catalyzes synthesis of serotonin and dopamine from 5-htp and l - dopa, respectively . Through competitive inhibition of aaad, carbidopa or benserazide compromises peripheral synthesis of serotonin and dopamine . This drug - induced inhibition of peripheral aaad l - dopa metabolism leaves more l - dopa unmetabolized and available to freely cross the blood when carbidopa or benserazide is administered, lower l - dopa daily intake values are required to achieve the same central nervous system results.2 carbidopa and benserazide also inhibit peripheral metabolism of 5-htp to serotonin and can cause a drug - induced depletion of peripheral serotonin . Dopamine is metabolized to norepinephrine, which, in turn, is metabolized to epinephrine . Physicians may fail to recognize the signs, symptoms, adverse reactions, and side effects that result from this drug - induced peripheral depletion of serotonin, dopamine, norepinephrine, and/or epinephrine by carbidopa . It is known that inhibition of aaad with drugs may induce life - threatening side effects, including myocardial infarction, neuroleptic malignant syndrome, agranulocytosis, hemolytic and nonhemolytic anemia, gastrointestinal bleeding, thrombocytopenia, and hypokalemia (table 1).2,12 hinz et al2,12 previously published papers demonstrating that l - dopa - induced nausea can be nutritionally managed by addressing serotonin and dopamine imbalance . Proper administration of 5-htp with l - dopa effectively controls nausea, eliminates the need for carbidopa, and, as they are no longer required, removes the signs, symptoms, side effects, or adverse reactions associated with carbidopa or benserazide in virtually all patients . With the removal of carbidopa, the risks and problems associated with peripheral depletion of the centrally acting monoamines are eliminated, which is a great safety advantage . L - dopa is an amino acid that may be classified by the us food and drug administration (fda) as a drug, a medical food, or a nutritional supplement, depending upon the application . As a nutritional supplement, l - dopa is classified by the fda as generally recognized as safe (gras), with a side effect profile safe enough to allow for over - the - counter sales . The combination of l - dopa with carbidopa is only classified as a drug; it is not listed as gras by the fda . Currently, in the us, if a patient experiences a carbidopa side effect, the only available form of l - dopa without carbidopa is a nutritional supplement product containing standardized l - dopa . It is the experience of hinz et al2,12 that few physicians are aware of the availability of the nutritional supplement form of standardized l - dopa over the counter in the us, and even fewer understand the management of l - dopa - induced nausea without the use of carbidopa . Table 1 is a previously published list of side effects and adverse reactions associated with peripheral depletion of centrally acting monoamines (serotonin, dopamine, norepinephrine, and epinephrine) due to carbidopa administration.2,12 the current standard of care for parkinson s disease is based on the endogenous state perspective . There is no consideration that nausea is caused by the imbalance between the serotonin and dopamine systems . The depletions of serotonin, thiols, l - tyrosine, l - tryptophan, and other monoamines associated with the clinical course of parkinson s disease, l - dopa monotherapy, and the use of general decarboxylase inhibitors are not addressed (see table 2).2,12 under the current standard of care, the etiology of the signs and symptoms associated with these depletions is not adequately recognized, understood, or controlled . Standard treatment of parkinson s disease under endogenous conditions is to simply increase l - dopa / carbidopa if symptoms of parkinson s disease are not optimally under control . Competitive inhibition research has identified the causes of the depletion and previously published the steps required to increase the synthesis in a properly balanced manner, leading to optimal functional results . The properly balanced competitive inhibition approach avoids the extensive depletion of serotonin, thiols, l - tyrosine, and l - tryptophan that is known to exist with l - dopa monotherapy . It also eliminates the nausea dosing barrier that may occur when l - dopa is administered without the need for a general decarboxylase inhibitor.2,12 a total of 813 medical patients with a diagnosis of parkinson s disease were queried from a database owned by dbs labs (duluth, mn, usa). These were patients who had collected urine samples in the competitive inhibition state and then submitted them for serotonin and dopamine assay followed by oct2 functional status determination.1,2,1320 the parkinson s disease patients diagnostic evaluations were performed under the care of a licensed medical doctor or doctor of osteopathic medicine and then entered as a working diagnosis on submission of laboratory samples . The diagnosis of parkinson s disease was then added to the database without further diagnostic verification . Total number of parkinson s disease patients included for consideration in this paper: n=813 of which males were n=554 (68.14%) and females were n=259 (31.86%). The male age range was 4295 years with a mean of 70 years and a standard deviation of 10.0 years . The female age range was 2891 years with a mean of 66 years 8 months and a standard deviation of 10.6 years . Amino acid formulas were obtained from chk nutrition (duluth, mn, usa). The following formulas were utilized: neuroreplete (eight pills containing 5-htp 99% + pure 300 mg, l - tyrosine 3,000 mg, l - lysine 500 mg, vitamin c 1,000 mg, vitamin b6 75 mg, calcium carbonate 220 mg, and folate 400 g) d5 mucuna 300 mg pills of 40% l - dopa standardized (each pill containing 120 mg l - dopa) d5 mucuna powder (one level tablespoonful [2.4 g] containing 840 mg l - dopa) cysreplete (six pills containing l - cysteine 4,500 mg, selenium 400 g, and folate 400 g). The patients were started on one pill of neuroreplete in the morning and at 4 pm to achieve 5-htp control of l - dopa - induced dopamine and serotonin depletion symptoms, including nausea and/or vomiting . If nausea and/or vomiting become a problem, the 5-htp daily dosing value is addressed by adjusting the neuroreplete within the range of 37.5600 mg per day until the symptoms are controlled . As 5-htp levels can be either high or low relative to l - dopa for nausea control, if that change is not effective, at 3-day intervals the 5-htp level is increased in daily incremental values going up to 112.5 mg / day, then up 150 mg per day, then 300 mg per day, then up to a maximum of 600 mg per day . No patients (n=813) experienced nausea that was refractory to this 5-htp approach . With regard to l - dopa administration, patients were started on two pills of d5 mucuna 40% in the morning, noon, and at 4 pm . The d5 mucuna 40% was then increased weekly in six - pill increments (l - dopa daily dosing value increases of 720 mg) until symptoms were brought under control or an l - dopa daily dosing value of 6,720 mg was achieved, whichever came first . If there was no symptom relief at 6,720 mg per day, a pill stop, as outlined in the following section, was started in order to identify whether the daily l - dopa dosing value was overdosed or underdosed relative to optimal therapeutic dosing . The optimal therapeutic range for the daily l - dopa dosing was from 720 mg to 16,800 mg per day with a mean of 5,880 mg per day and a standard deviation of 1,190 mg . All patients were started on two pills of cysreplete three times a day, with the first dose at noon to prevent and/or reverse thiol depletion associated with parkinson s disease and/or the administration of l - dopa . The daily l - cysteine dose was static and not adjusted . For a discussion of the establishment of the static dosing requirements of the cysreplete formula, the reader is referred to prior writings of hinz et al (2009).12 if the patient was experiencing residual symptoms associated with parkinson s disease when the daily dosing value of l - dopa was established at 6,720 mg per day (equal to 56 pills each containing 120 mg of l - dopa), a 2-day pill stop of all amino acids was implemented . This was utilized to define whether the patient s daily l - dopa intake was too high or too low relative to the optimal therapeutic dosing value . With each pill stop, one of three general outcomes was typically observed: if in the morning following the first day of a complete pill stop the patient s parkinson s disease symptoms, from the patient s perspective, were markedly improved, it was interpreted that the patient was overdosed relative to the optimal daily dosing value requirements . If in the morning following the first day of a complete pill stop the patient s parkinson s disease symptoms were the same or worse, it was interpreted that the patient s daily l - dopa dosing value was too low relative to the optimal therapeutic requirements . If a patient experienced a deterioration of symptoms the same day that the pill stop was initiated, all amino acids should be restarted immediately at the previous daily dosing values, as the patient was underdosed . A patient s daily l - dopa dosing value was considered to be optimal when it corresponded with the greatest relief of symptoms . At that point, no further pill stops were required . For those patients who did not achieve optimal symptom relief after the first pill stop the patient who reported relief of symptoms the morning following the pill stop was designated as being given an l - dopa overdose relative to the optimal dosing needs . The overdosed value was then referenced against the daily l - dopa dosing value of the most recent previous pill stop where the patient underdosed . With these high and low values recorded the patient was placed on the higher daily l - dopa dosing value minus 240 mg per day of l - dopa and evaluated again in 7 days . If symptoms were not at the level experienced the morning after the pill stop when the l - dopa was overdosed, the daily dosing value was decreased another 240 mg per day . This combination of pill stops with decreases of 240 mg l - dopa daily dosing values was continued until optimal relief of parkinson s disease symptoms was achieved . Symptomatic relief should be on a par with the marked improvement experienced the morning after the initial pill stop where the l - dopa overdose relative to optimal therapeutic needs was identified . Those patients who failed to show improvement the morning after the pill stop were interpreted as having been administered l - dopa daily dosing values that were too low relative to the required optimal dosing needs . The l - dopa daily dosing value was then increased by 720 mg and another pill stop was performed in 1 week . The pill stop criteria require answering the following questions from the patient s perspective with regard to overall parkinson s disease symptoms: whether symptoms were better, whether symptoms were worse, or whether symptoms were the same . A patient s response to a question is not always direct . When the caregiver is not confident in the response to the questions, it is recommended that another pill stop be performed . One physician reported performing three pill stops with a patient on the same daily l - dopa dosing value before being convinced that the proper clinical data were in place to make a dosing change decision . If the patient was experiencing residual symptoms associated with parkinson s disease when the daily dosing value of l - dopa was established at 6,720 mg per day (equal to 56 pills each containing 120 mg of l - dopa), a 2-day pill stop of all amino acids was implemented . This was utilized to define whether the patient s daily l - dopa intake was too high or too low relative to the optimal therapeutic dosing value . With each pill stop, one of three general outcomes was typically observed: if in the morning following the first day of a complete pill stop the patient s parkinson s disease symptoms, from the patient s perspective, were markedly improved, it was interpreted that the patient was overdosed relative to the optimal daily dosing value requirements . If in the morning following the first day of a complete pill stop the patient s parkinson s disease symptoms were the same or worse, it was interpreted that the patient s daily l - dopa dosing value was too low relative to the optimal therapeutic requirements . If a patient experienced a deterioration of symptoms the same day that the pill stop was initiated, all amino acids should be restarted immediately at the previous daily dosing values, as the patient was underdosed . A patient s daily l - dopa dosing value was considered to be optimal when it corresponded with the greatest relief of symptoms . At that point, no further pill stops were required . For those patients who did not achieve optimal symptom relief after the first pill stop the patient who reported relief of symptoms the morning following the pill stop was designated as being given an l - dopa overdose relative to the optimal dosing needs . The overdosed value was then referenced against the daily l - dopa dosing value of the most recent previous pill stop where the patient underdosed . With these high and low values recorded, the optimal l - dopa dosing was then defined . The patient was placed on the higher daily l - dopa dosing value minus 240 mg per day of l - dopa and evaluated again in 7 days . If symptoms were not at the level experienced the morning after the pill stop when the l - dopa was overdosed, the daily dosing value was decreased another 240 mg per day . This combination of pill stops with decreases of 240 mg l - dopa daily dosing values was continued until optimal relief of parkinson s disease symptoms was achieved . Symptomatic relief should be on a par with the marked improvement experienced the morning after the initial pill stop where the l - dopa overdose relative to optimal therapeutic needs was identified . Those patients who failed to show improvement the morning after the pill stop were interpreted as having been administered l - dopa daily dosing values that were too low relative to the required optimal dosing needs . The l - dopa daily dosing value was then increased by 720 mg and another pill stop was performed in 1 week . The pill stop criteria require answering the following questions from the patient s perspective with regard to overall parkinson s disease symptoms: whether symptoms were better, whether symptoms were worse, or whether symptoms were the same . A patient s response to a question is not always direct . When the caregiver is not confident in the response to the questions, it is recommended that another pill stop be performed . One physician reported performing three pill stops with a patient on the same daily l - dopa dosing value before being convinced that the proper clinical data were in place to make a dosing change decision . The pill stop concept evolved from initial observations where parkinson s disease patients taking higher daily dosing values of l - dopa (> 10,800 mg) had either missed pills or stopped their pills during treatment . Physicians reported patients who in the morning of the day following the stopping of all amino acid pills experienced what turned out to be a period of optimal symptom relief . A brief period of time (36 hours) these patients spontaneously volunteered comments such as this is the best i have felt in years or for 20 years i have wanted to feel this good . They clearly indicated that from the patient s perspective an abrupt dramatic and positive change in the patient s symptoms had occurred . It was subsequently determined that in these patients the daily l - dopa dosing value in the competitive inhibition state prior to the l - dopa pill stop was too high . When all amino acids are stopped, systemic l - dopa and dopamine levels decrease through the levels that are required for optimal control of symptoms . A period of optimal symptom relief occurs approximately 24 hours after the pill stop where the first l - dopa dosing was missed . Identical parkinson s disease symptoms of the same intensity were present when l - dopa daily dosing values were too high or too low relative to optimal daily dosing value . Typically, it is clinically impossible to determine whether the patient s daily l - dopa dosing value is too high or too low without a pill stop . An l - dopa overdose cannot be determined based on traditional signs and symptoms observed in the endogenous state . These novel clinical overdose observations do not exist in the endogenous state, and observations in the endogenous state do not have predictability with regard to outcomes of amino acid administration in the competitive inhibition state . When administering properly balanced l - dopa with 5-htp, l - tyrosine, and thiols in the competitive inhibition state, this novel pill stop approach is required to prevent l - dopa overdose and to assist in identifying the optimal therapeutic dosing range.12 as noted in figure 1, there is an l - dopa daily dosing value range where symptoms are optimally controlled . This dosing range is very narrow: 240 mg relative to the optimal therapeutic value . Figure 1 also illustrates the phenomenon observed with this narrow optimal dosing value range where symptoms abruptly resolve or return with small increases or decreases of the daily l - dopa dosing value (120 mg). When these inflection points are reached, it is not a gradual resolution or return of symptoms . Changing the daily l - dopa dosing value by 120 mg can have dramatic clinical results . In general, this is independent of the size of the daily l - dopa dose . For example, a patient was taking 10,800 mg of l - dopa per day (equivalent to 90, 120 mg l - dopa pills) in the competitive inhibition state . After a pill stop the patient was placed on 89 pills per day (10,680 mg of l - dopa). After a daily decrease in the l - dopa dosing value of only 120 mg, the patient was able to rise without assistance and ambulate . No l - dopa discussion relative to parkinson s disease would be complete without touching on the topic of dyskinesias . In the competitive inhibition state, no problems or concerns were noted with dyskinesias under this approach in the 10 years of implementation . The novel focus of this paper is that in the competitive inhibition state l - dopa daily dosing values that are too high or too low relative to the optimal therapeutic range manifest the same symptoms with identical intensity . This phenomenon is so pervasive that pill stop evaluation needs to be conducted with all patients if optimal relief of symptoms is not achieved when the daily dosing value is increased to a specific set point . The pill stop should be performed if relief of symptoms has not been achieved at l - dopa daily dosing values 6,720 mg per day, or if a question exists regarding the direction of the next change in the l - dopa daily dosing value . It is impossible to empirically determine with absolute certainty whether patients in the competitive inhibition state are taking too much or too little l - dopa without a pill stop . The only exception is if the l - dopa daily dosing value happens to be established at the optimal therapeutic value during a dosing adjustment . Blindly increasing the daily l - dopa dosing values in a linear manner based on endogenous reference points (status of symptoms) in the competitive inhibition state has a high potential for l - dopa overdose relative to the optimal therapeutic dosing value . In the competitive inhibition state, the daily l - dopa dosing value range where optimal relief of symptoms is obtained is as narrow as 120 mg of l - dopa in some patients . With l - dopa daily dosing value increases of 720 mg or more, it is common to exceed the optimum dosing value, leading to an overdose situation . Efficacy has been established by numerous studies over the last 50 years it has been administered . This paper reports a novel observation relating to l - dopa in the competitive inhibition state . L - dopa daily dosing values that are either excessive or insufficient relative to the optimal therapeutic requirements are clinically associated with the exact same symptoms of parkinson s disease, each with identical intensity . These novel findings document that there are no clinical signs or symptoms for the physician to formulate a conclusion that the patient is overdosed on l - dopa and is above the optimal therapeutic dosing range . From a safety standpoint, the pill stop is required in the competitive inhibition state to prevent l - dopa overdose and facilitate realization of the therapeutic dosing value . It has been previously documented how depletions of serotonin, l - tyrosine, and thiols are associated with parkinson s disease and potentiated by l - dopa monotherapy with or without a general decarboxylase inhibitor in the endogenous state . Peripheral depletion of serotonin, dopamine, norepinephrine, and epinephrine is facilitated by administration of carbidopa or benserazide . If these depletion issues are to be addressed properly, the patient has to be placed in the competitive inhibition state, and l - dopa daily dosing value needs to be guided by pill stops . The purpose of this paper is to outline a novel safety concern identified with administration of l - dopa in the competitive inhibition state that has not been previously described in the literature and to facilitate discussion of these findings.
Endothelial cells (ecs) are key cellular components of blood vessels, functioning as selectively permeable barriers between blood and tissues . Under pathological conditions, endothelial cell (ec) apoptosis leads to excess neointima formation [1, 2], a lipid transport disorder [3, 4], and plaque rupture . Thus, maintaining endothelial cell viability by inhibiting the induction of apoptosis could be used in the prevention and/or treatment of atherosclerosis [6, 7]. Oxidatively modiflied ldl (oxldl) has been implicated in the development of atherosclerosis and plaque rupture by promoting lipid accumulation, proinflammatory responses, release of metalloproteinases, and apoptotic cell death of ecs [8, 9]. Oxldl also increases endothelial expression of adhesion molecules, which recruit inflammatory cells that adhere to and migrate through the endothelial barrier . These processes are followed by endothelial dysfunction and loss of expression of antiapoptotic proteins, which in turn causes ecs to become apoptotic [1012]. Lectin - like oxldl receptor-1 (lox-1) is considered the major receptor for oxldl in human and various animal vascular endothelial cells (ecs). 6-shogaol is the major bioactive compound present in zingiber officinale which possesses antitumor, antioxidant, anti - inflammatory [1618], antiplatelet aggregation, antihypertensive [20, 21], and antiatherosclerosis [22, 23] effects . The mechanism of anti - as action of ginger extract is associated with a significant reduction in plasma and ldl cholesterol levels and a significant reduction in the ldl basal oxidative state, as well as their susceptibility to oxidation and aggregation [22, 23]. The present study evaluated effects of 6-shogaol on oxldl - induced insults to huvecs and its possible molecular mechanisms . Lucigenin, dimethylsulfoxide (dmso), 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (mtt), diphenyleneiodonium (dpi), was obtained from sigma (st . Louis, mo). 6-shogaol was purchased from national institute for the control of pharmaceutical and biological products (beijing, china). The identity and purity of the compound were determined using hplc (high - performance liquid chromatography) and 2d nmr and were> 99% . Blood was processed for ldl separation within 1 day by sequential flotation in nabr solution containing 1 mg / ml edta . Cu - modified ldl (1.0 mg protein / ml) was prepared by exposure of ldl to 5 mm cuso4 for 18 h at 37c . The extent of ldl oxidation was determined by thiobarbituric acid - reactive substances (tbars). This experiment was approved by the research ethics committee of shanghai east hospital, tongji university school of medicine . After receiving written consent from the parents, we obtained fresh human umbilical cords from normal full - term neonates shortly after birth and suspended them in hanks' balanced salt solution (hbss; gibco) at 4c . Briefly, huvecs were removed from human umbilical veins after collagenase type i digestion and cultured in medium 199 containing 20% fetal calf serum, penicillin (100 u / ml), streptomycin (100 u / ml), and heparin (50 u / ml), supplemented with l - glutamine (2 mm), sodium pyruvate (1 mm), and endothelial cell growth factor (b - ecgf, 5 ng / ml), at 37c in 5% co2 on 0.1% gelatin - coated culture flasks . 6-shogaol was dissolved in dimethyl sulfoxide (dmso) and stored at 20c until use . Final concentration of dmso in culture media was 0.1% huvecs were randomly divided into six groups: a normal control group, a oxldl group, four 6-shogaol groups . The huvecs in the oxldl group were incubated for 24 hours with medium containing 200 g / ml oxldl . In the 6-shogaol groups, the cells were preincubated for 2 h with different final concentrations of 6-shogaol: 1 m, 5 m, 10 m, and 30 m, followed by a 24-hour incubation with 200 g / ml ox - ldl . Thp-1, a human monocytic leukemia cell line, was obtained from atcc (rockville, md) and cultured in rpmi with 10% fbs at a density of 25 10 cells / ml as suggested in the product specification sheet provided by the vendor . Cells were seeded at density of 5 10 cells / ml in 96-well plates and the cell viability was measured using the mtt assay . Briefly, at the indicated time points after the treatment as before, the culture supernatant was removed, and the cells were washed with pbs, incubated with mtt (5 mg / ml) in culture medium at 37c for another 3 h. after mtt removal, the colored formosan was dissolved in 100 l of dmso . The absorption values were measured at 490 nm using a sunrise remote microplate reader (grodlg, austria). The viability of huvecs in each well was presented as percentage of control cells . Briefly, 5 10 huvecs were cultured in 12-well tissue culture plates overnight and then cotreated with drugs and 2,7-dichlorofluorescin diacetate . Relative fluorescence intensities of cells were quantified using a flow cytometer (facs calibur, becton dickinson, san jose, ca, usa). To evaluate the role of nadph oxidase and lox-1 in oxldl - induced ros generation, we preincubated cells with the flavoprotein inhibitor dpi (5 m) and anti - lox-1 monoclonal antibody (mab; 40 g / ml) for 2 h before exposure to oxldl . Sod activity in the homogenate was determined by an enzymatic assay method using a commercial kit (calbiochem) according to the manufacturer's instructions . Specific nadph - dependent o2 production was measured by lucigenin (5 mm) chemiluminescence as previously described . The cells were pretreated with various concentrations of 6-shogaol or vehicle for 60 min, after which oxldl (200 g / ml) was added for additional 60 min . Then cells were scraped into ice - cold hbss supplemented with 0.8 mm mgcl2 and 1.8 mm cacl2, disrupted by rapid freezing in liquid nitrogen followed by sonication . Oxygen radical production was measured in the presence of 5 mm lucigenin, with or without nadph (100 mm) for 10 min . The relative light units (rlu) of chemiluminescence were read in turner td 20/20 luminometer . Apoptosis was also examined by analysis of dna fragmentation using flow cytometry [27, 28]. Huvecs were washed and double - stained by using an annexin v - fitc apoptosis detection kit . Annexin v has a strong ca - dependent affinity for phosphatidylserine (ps), which translocates from the internal to the external surface of the plasma membrane as a probe for detecting apoptosis . Cells that have the loss of membrane integrity will show red staining (propidium iodide, pi) throughout the nucleus and therefore will be easily distinguished between the early apoptotic cells and the late apoptotic cells or necrotic cells . Samples were incubated at room temperature for 15 min in the dark with annexin v and pi and quantitatively analyzed by a facs vantage se flow cytometer . The activities of caspase-3, caspase-8, and caspase-9 were measured according to the kit manufacturers' instructions . In brief, after 24 h treatment by different medium conditions, huvecs of each group were lysed and removed from culture dishes, washed twice with pbs, and pelleted by centrifugation . Cell pellets were then treated for 10 minutes with iced lysis buffer supplied by the manufacturers: caspase-3, caspase-8 assay cellular activity kit, and caspase-9 assay kit (calbiochem). Then the suspensions were centrifuged at 10000 g for 10 minutes, and the supernatants were transferred to a clear tube . To each tube, specific substrate conjugate [acetyl - asp - glu - val - asp - p - nitroaniline (ac - devd- p - na) for caspase-3, acetyl - ile - glu - thr - aspaminotrifluoromethyl coumarin (ac - ietd - afc) for caspase-8 and acetyl - leu - glu - his - asp - p - nitroaniline (ac - lehd - p - na) for caspase-9] was added and the tubes were incubated at 37c for 2 hours . During incubation, the caspases cleaved the substrates to form p - na or afc . Caspase-3 and -9 activities were read in a microtiter plate reader at 405 nm . Caspase-8 activity was read in a fluorescent plate reader at 400 nm for excitation and at 505 nm for emission . Assays were performed in triplicate and three independent experiments were performed in this study . Mrna from huvecs exposed to 6-shogaol, oxldl, or a combination of 6-shogaol and oxldl were prepared for real - time polymerase chain reaction (pcr) analyses of lox-1 and gapdh mrna . The oligonucleotides for the pcr analyses of lox-1 and gapdh mrna were designed and synthesized by invitrogen laboratories (palo alto, ca, usa). The oligonucleotide sequences for these mrna analyses were 5-tcttagcatgaatttggaaat-3 and 5-cccagctaaagggcccatgg-3 for lox-1, and gapdh (forward: 5-cca - ccc atg gca aat tcc atg gca-3 and reverse: 5-tct aga cgg cag gtc agg tcc acc-3. A real - time pcr analysis was performed using iqsybr green supermix (bio - rad, hercules, ca, usa) and the myiq single - color real - time pcr detection system (bio - rad). Cells were lysed in a modified ripa buffer (150 mm nacl, 10 mm tris, ph 7.4, 1 mm edta, 1% triton x-100, 1% deoxycholic acid, 1 mm pmsf, with addition of complete tm protease inhibitor cocktail). Protein concentrations were determined by a bca assay and separated by an 8% sdspage, and then transferred to a pvdf membrane (millipore, usa). The membrane was blocked at rt for 2 h in 5% nonfat dry milk diluted with tbst (in mm: tris - hcl 20, nacl 150, ph 7.5, 0.1% tween 20). The membrane was incubated overnight at 4c with a polyclonal rabbit anti - human lox-1 and bcl-2 (1: 500 dilution; santa cruz biotechnology inc . The membrane was incubated for 1 h with a goat anti - rabbit igg conjugated to horseradish peroxidase (1: 10000 dilution; santa cruz biotechnology inc . At last, the levels of lox-1 and bcl-2 protein were determined using amersham ecltm western blotting detection reagents (ge healthcare, uk). Incubation with polyclonal rabbit -actin antibody (1: 1000 dilution; santa cruz biotechnology inc . Relative intensities of protein bands were analyzed by scan - gel - it software . Pcmv6-xl5-lox-1 plasmids, which were constructed with full - length human lox-1 cdna, were purchased from origene technologies (rockville, md, usa). Pcmv6-xl5-lox-1 plasmids were transfected into huvecs usinga fugene 6 transfection reagent (roche diagnostics, mannheim, germany) as previously described . Briefly, huvecs were cultured in antibiotic - free dulbecco's modified eagle's medium at 37c for 24 hours, then the sirna duplex solution was added . Activation of nf-b was assessed by measuring the p65 protein - dna binding activity in nuclear extracts of huvecs . When the cells were 7090% confluent, the medium was changed to 15 ml of complete m199 (20% fbs) and incubated for 2 h in the absence or the presence of 6-shogaol or anti - lox-1 monoclonal antibody (mab; 40 g / ml), after which huvecs were challenged with 200 g / ml ox - ldl . For comparison purposes, huvecs were also incubated for 1 h with pyrrolidine dithiocarbamate (pdtc), a known inhibitor of nf-b activation [30, 31]. After 1 h of incubation with ox - ldl, the reaction was stopped by washing the cells with cold pbs . Nuclear extracts were prepared according to the manufacturer's instructions, and the dna binding activity of p65 was measured by elisa (active motif, carlsbad, ca). Briefly, nuclear extracts were added to wells previously coated with dna containing specific sequences for the binding of p65 . After incubation at room temperature for 1 h, wells were washed and sequentially incubated for 1 h with a primary antibody raised against p65 and a secondary enzyme - linked antibody . The plate was developed by addition of chromogen, and the absorbance at 450 nm was recorded in a plate - reader spectrophotometer (spectromax 190). Huvecs were grown to confluence, then pretreated with 6-shogaol for 2 h, and stimulated cells with oxldl (200 g / ml) for 24 h. at the end of stimulation, huvecs were harvested and incubated with fitc conjugated anti - icam-1, anti - e - selectin, and anti - mcp-1 (r&d systems) for 45 min at room temperature . After the huvecs had been washed three times, their immunofluorescence intensity was analyzed by flow cytometry using a becton dickinson facscan flow cytometer (mountain view, ca) huvecs at 1 10 cells / ml were cultured in 96-well flat - bottom plates (0.1 ml / well) for 1 - 2 days . Cells were then pretreated with the indicated concentrations of 6-shogaol for 2 h and incubated with oxldl (200 g / ml) for 24 h. the medium was then removed, and 0.1 ml / well of thp-1 cells (prelabeled with 4 m bcecf - am for 30 min in rpmi at a 1 10 cell / ml density) were added in rpmi . The cells were allowed to adhere at 37c for 1 h in a 5% co2 incubator . The number of adherent cells was estimated by microscopic examination; the cells were then lysed with 0.1 ml of 0.25% triton x-100 . The fluorescence intensity was measured at 485-nm excitation and 538-nm emission using a labsystems fluorescence microplate reader . Data analysis values were expressed as mean sd, statistical significance was determined by student's two - tailed t - test or one - way anova followed by bonferroni posttests when more than two treatments were compared . Concentration - response curves were analysed by two - way anova followed by bonferroni posttests . Treatment of mouse huvecs with 1, 5, 10, and 30 m 6-shogaol for 24, 48, and 72 hours did not affect cell viability (data not shown). Meanwhile, after exposure for 72 hours, 6-shogaol at 60 m caused a significant 27% decrease in cell viability . When the treated concentration reached 100 mol / l, administration of 6-shogaol for 48 and 72 hours, respectively, decreased the viability of huvecs by 41% and 61% (data not shown). Next, we observed the 6-shogaol antioxidation activity by mda measurement and used fluorescence microscopy to analyze the effect of 6-shogaol on the lox-1 mediated redox - sensitive signaling pathway in endothelial cells . As shown in figure 1(a), when ldl was reacted with copper sulfate for 1, 6, 12, 18, and 24 hours, amounts of malondialdehyde significantly increased by 3.62-, 8.18, 12.74-, 16.47-, and 19.44-fold, respectively . 6-shogaol at 0.5 m did not affect the oxidation of ldl by copper sulfate (figure 1(b)). Meanwhile, when the concentrations reached 1, 5, 10, 30 m, 6-shogaol decreased copper sulfate - caused oxidation of ldl by 10.3%, 29.1%, 39.1%, and 59.8%, respectively . The intracellular ros concentration in huvecs was determined by measuring the intensity of dcfh fluorescence . When dcfh - da - labeled cells were incubated in the medium for 2 h, a sudden increment in fluorescence intensity indicated the oxidation of dcfh - da by intracellular radicals (figure 1(c)). The production of dcfh fluorescence in huvecs with oxldl increased significantly to 364% of the vehicle - treated control group, whereas preincubation with 6-shogaol (130 m) significantly reduced the increased fluorescence induced by oxldl in a concentration - dependent manner . In addition, oxldl - induced ros was abrogated by pretreatment with monoclonal antibody of lox-1 (anti - lox-1 mab) or dpi (figure 1(c)). In addition, the involved ros is able to inactivate antioxidative enzymes that additionally increase the imbalance in favor of oxidative stress . We next turned our attention to the total activity of sod in endothelial cells in response to oxldl . As shown in (figure 2(a)), 6-shogaol at 5, 10, and 30 m significantly decreased the suppression of sod activity caused by oxldl . Endothelial nadph oxidase is a major source of ros in vascular endothelial cells, and atherogenic levels of ldl have been shown to induce a marked increase in nadph oxidase - generated ros by the endothelium . As shown in figure 1(d), incubation of huvecs with oxldl (200 g / ml) for 1 h increased the nadph oxidase activity by 132% (p 6-shogaol at 10 and 30 m significantly reduced nadph oxidase activity of huvecs from 87.18 5.06 rlu / s / mg protein to 63.92 6.82 rlu / s / mg protein and 55.53 3.95 rlu / s / mg protein, respectively (p <0.05). As shown in figure 2(b), the survival rate of huvecs was about 52.37 6.59% after exposure to 200 g / ml oxldl . However, preincubation of huvecs with different concentrations of 6-shogaol (1, 5, 10, 30 m) markedly increased the viability of oxldl - treated huvecs in a concentration - dependent manner . The treatment with 1, 5, 10, and 30 m concentrations of 6-shogaol increased the viability of huvecs in a statistically significant fashion to 69.68 4.40%, 76.91 3.06%, and 83.15 3.07%, respectively . In addition, no difference was seen in cell viability between cells treated with 6-shogaol (130 m) alone and controls (data not shown). These results suggest that 6-shogaol protected huvecs from oxidative stress - related cellular injuries . As shown in figure 2(c), in the vehicle - treated control group, the percentage of apoptotic cells was 4.78% 1.40% . After exposure to 200 g / ml oxldl for 24 h, the percentage of apoptosis increased to 32.43% 2.75% . Nonetheless, preincubation with 6-shogaol (130 m) for 2 h prior to ox - ldl exposure concenteration - dependently arrested the apoptosis, and the values of apoptosis were decreased to 27.93% 2.85%, 21.58% 2.27%, and 16.53% 2.37%%, respectively (p <0.05). Moreover, the induction of apoptosis in huvecs treated with 6-shogaol (130 m) alone was not observed (data not shown). Application of lox-1 sirna into huvecs for 24 and 48 hours decreased the levels of lox-1 receptor (figure 3(a)). Exposure to lox-1 sirna for 24 and 48 hours caused significant 32% and 79% decreases in the levels of lox-1 . Exposure of huvecs to 6-shogaol or lox-1 sirna alone did not induce cell apoptosis (figure 3(c)). Treatment with 6-shogaol and lox-1 sirna, respectively, caused significant 58% and 65% decreases in oxldl - induced huvecs apoptosis . Cotreatment with 6-shogaol and lox-1 sirna synergistically reduced oxldl - caused cell apoptosis by 88% (figure 3(c)). By comparison, overexpression of lox-1 alone in huvecs did not affect cell apoptosis but completely attenuated 6-shogaol involved protection against oxldl - induced apoptotic insults (figure 3(b)). Consistent with previous study, incubation of huvecs with oxldl (200 g / ml) enhanced lox-1 expression at both the gene (figure 4(a)) and protein levels (figure 4(b)). Pretreatment of huvecs with 6-shogaol for 2 h before exposure to oxldl for 24 h resulted in suppression of lox-1 expression in a concentration - dependent manner . Notably, pretreatment with dpi, an inhibitor of ros production, markedly inhibited oxldl - induced lox-1 upregulation (figures 4(a) and 4(b)), strongly suggesting that ros plays a critical role in the increased expression of lox-1 . Oxldl binding to lox-1 decreased the expression of antiapoptotic proteins such as bcl-2 and c - iap-1, subsequently activated apoptotic signaling pathway caspase-9 and caspase-3, and finally resulted in apoptosis . Consistent with these studies, oxldl treatment decreased the expression of antiapoptotic protein bcl-2 (figure 5(a)), while 6-shogaol significantly blocked the decreasing bcl-2 expression induced by oxldl on huvecs . Caspase-3 is one of the downstream effectors of the caspase family and is involved in both the mitochondrial apoptotic pathway and the death receptor pathway . The activity of caspase-3 and caspase-9 were not affected by 6-shogaol (figure 5). Treatment of huvecs with 200 g / ml oxldl led to a significant increase in activity of caspase-9 (figure 5(b)) and caspase-3, not for caspase-8 (figures 5(b), 5(c), and 5(d)) as compared to control; however, 6-shogaol administration significantly decreased oxldl - induced caspase-3 and caspase-9 activation (figures 5(b) and 5(c), p <0.05). Devd - cho (25 mol / l), an inhibitor of caspase-3, was applied to huvecs to further evaluate the roles of this protease in 6-shogaol - caused protection (figure 6(a)). Treatment with devd - cho significantly decreased oxldl - induced augmentation of caspase-3 activity by 68.5% (figure 6(a)). Cotreatment with 6-shogaol and z - veid - fmk completely lowered oxldl - caused enhancement of caspase-3 activity . The oxldl - caused huvecs apoptosis was significantly ameliorated by 65.45% following administration of devd - cho (figure 6(b)). Simultaneous exposure to 6-shogaol and devd - cho completely lowered oxldl - induced cell apoptosis . Oxldl - induced ros can activate nf-b activation, which facilitates nuclear translocation and subsequent regulation of proinflammatory gene expression [32, 33]. A shown in figure 7(a), activation of nf-b, as indicated by nuclear translocation and dna binding of its p65 subunit, was decreased by 6-shogaol in a concentration dependent manner, meanwhile 10 m pyrrolidine dithiocarbamate and 40 g / ml anti - lox-1 monoclonal antibody also exerted strong inhibition (figure 7(a)). The effect of 6-shogaol on the surface expression of adhesion molecules on huvecs exposed to oxldl was subsequently examined . As shown in figure 7(b), the expression levels of icam-1, mcp-1, and e - selectin were significantly higher in huvecs that had been treated with oxldl (200 g / ml) for 24 h than in the control cells (229, 304, and 460%, resp . Flow cytometry revealed that the induction of adhesion molecule expression was significantly ameliorated by the presence of 130 m 6-shogaol . In addition, oxldl - induced expression of adhesion molecules was abrogated by pretreatment with monoclonal antibody of lox-1 (anti - lox-1 mab) or sirna (figure 7(b)). Oxldl - enhanced recruitment, retention, and adhesiveness of human monocytes and monocytic cell lines to endothelium have been implicated in the initial stage of atherogenesis . To test the effect of 6-shogaol on monocyte adhesion to huvecs, confluent monolayers of huvecs were pretreated with various concentrations of 6-shogaol or anti - lox-1 monoclonal antibody (mab; 40 g / ml) for 2 h and then stimulated with oxldl (200 g / ml) for 24 h, followed by incubation with thp-1 cells for 1 h at 37c . As shown in figure 7(c), oxldl stimulated an increase in adherence of thp-1 cells to huvecs (472 17%, p <0.05); however, the effect was significantly inhibited by 6-shogaol treatment in a concentration - dependent manner (all p <0.05). Oxldl is an important initiating factor for endothelial activation and injury contributing to endothelial dysfunction, one of the earliest hallmarks of atherosclerosis [8, 34, 35]; lox-1, as the primary oxldl receptor on endothelial cells, plays an important role in the pathogenesis of atherosclerosis [3638]. The binding of oxldl to lox-1 initiates ros formation, which in turn upregulates lox-1 expression, thereby contributing to further ros generation . The present study shows the effectiveness of 6-shogaol, the major bioactive compound present in zingiber officinale, in suppressing endothelial lox-1 expression and lox-1-mediated proatherogenic effects . This effect of 6-shogaol on endothelial lox-1 expression appears to be exerted at the transcriptional level, as reflected by the parallel decrease in lox-1 mrna and protein levels in 6-shogaol -treated cells (figure 3). Furthermore, pretreatment with dpi or blockade of lox-1 with anti - lox-1 mab or sirna - lox-1 prevented oxldl - induced ros generation and cell apoptosis, which suggests that the binding of oxldl to lox-1 and the consequent formation of ros may be the first event in lox-1-mediated endothelial dysfunction (figures 1 and 4). Because regulation of lox-1 gene expression is redox sensitive, suppression of oxldl - induced ros production by 6-shogaol may contribute to the reduction of lox-1-mediated expression of a number of proinflammatory molecules and cell apoptosis . Nadph oxidase is recognized as the major source of ros in endothelial cells and the increased nadph activity has been detected in atherosclerotic arterie . It has been shown that oxldl - induced endothelial dysfunction is caused by an increase in nadph oxidase - generated superoxide concentrations and a decrease in antioxidative enzyme activity, resulting in the activation of multiple ros - sensitive signaling pathways . Consistent with the literature, our data show that 6-shogaol treatment significantly reduced the level of oxldl - induced ros generation (figures 1(c) and 1(d)) and increased the level of sod activity (figure 2(a)). Ros can activate nf-b and enable nuclear translocation and subsequent regulation of proinflammatory molecules, including cytokines, chemokines, enzymes, and adhesion molecules . In the present study, ros production in huvecs occurred within 5 min (data not shown), and nf-b was activated within 1.5 h of the addition of oxldl . However, pretreatment with anti - lox-1 mab, ros production, and nf-b activation, and icam-1, mcp-1, and e - selectin expression were decreased markedly, which suggests that the binding of oxldl to lox-1 and the consequent nf-b activation . Furthermore, our stuy showed that 6-shogaol inhibited nf-b activation (figure 7(b)) and repressed the oxldl - induced icam-1, mcp-1, and e - selectin expression (figure 7(c)). From these, we speculated that 6-shogaol protection against oxldl - induced endothelial dysfunction may be by blockading the binding of oxldl to lox-1, and subsequently decrease intracellular ros generation and the proinflammatory molecules expression . All of these findings strongly indicate that 6-shogaol elicits antioxidative and anti - inflammatory effects . Apoptosis, also called programmed cell death, is an important process of many pathological conditions including atherosclerosis . Lox-1 activation by oxldl stimulates endothelial proinflammatory gene expression and production of superoxide radicals and leads to activation of apoptotic signaling pathway [13, 45]. Their findings suggested that oxldl binding to lox-1 subsequently decreased the expression of antiapoptotic proteins, such as bcl-2 and c - iap-1, then activated apoptotic signaling pathway caspase-9 and caspase-3, and finally resulted in apoptosis . Consistent with previous reports, the results presented here indicated that oxldl induced decrease in bcl-2 expression, but 6-shogaol completely normalized this oxldl - induced alterations . Application of lox-1 small interference (si)rna into huvecs simultaneously increased 6-shogaol protection from oxldl - induced cell apoptosis . By comparison, overexpression of lox-1 attenuates 6-shogaol protection . Both 6-shogaol and therefore, this study shows that 6-shogaol may protect huvecs from oxldl - induced apoptotic insults via downregulating lox-1-mediated activation caspase protease pathway . In summary, the results from our experiments indicate that 6-shogaol prevents the oxldl - induced lox-1-mediated biological events in huvecs, probably via its antioxidative and anti - inflammatory functions . Our work adds 6-shogaol to the growing list of herbal remedies whose mode of action has been at least partially revealed on a molecular level.
Human listeriosis is a relatively rare but serious zoonotic disease, with high morbidity, hospitalization and mortality in vulnerable populations . Among all zoonotic diseases under eu surveillance, listeriosis caused the most severe human disease, with 93.6% of cases hospitalized and 134 fatal cases (fatality rate 12.7% in 20102011).1 the relevance of this contamination is underlined by the updated compliance guideline recently released by the food safety and inspection service of the us department of agriculture, which provides specific recommendations that official establishments producing postlethality exposed readytoeat meat and poultry products may follow to meet the requirements of 9 cfr part 430, the listeria rule.2 listeria spp . Have the ability to grow in cool damp environments where other pathogens may not grow, and are capable of surviving freezing temperatures . For these reasons, readytoeat products that are consumed without cooking are of particular concern for listeria monocytogenes contamination.3 significant support in the fight against pathogenic microorganisms may derive from food packaging, which not only acts as a barrier against moisture, water vapor, gases and solutes but may also serve as a carrier of active substances such as antimicrobials in active packaging.4 active packaging is defined as a mode of packaging in which package, product and environment interact to prolong shelflife or to enhance safety and/or quality of the food product.5 recent research toward the development of new and ecofriendly preservation methodologies is stimulated by the increasing demand for natural, disposable, biodegradable and/or recyclable food packaging materials.4 in this context, paper is a simple but promising lowdensity material . In view of its properties (cost, acceptance, sustainability), paper may be regarded as an excellent material for controlled release of antimicrobials in active packaging, also taking into account that papermakers are capable of providing products with a broad range of mechanical, physical and chemical properties . Coatings such as waxes or polymeric materials can also be used to improve the otherwise poor barrier properties of paper.6 as regards natural antimicrobials, bacteriocins represent an attractive solution owing to their selective mode of action against foodborne and/or spoilage bacteria.7, 8 sakacina, produced by lactobacillus sakei, belongs to the class iia bacteriocins . Sakacina is a listeriatargeting peptide of 41 amino acid residues with one disulfide bridge and a calculated molar mass of 4308 da.9 in previous works, we investigated the production profile of sakacina in a lowcost medium formulation and the molecular mechanism of the antilisterial activity.10, 11 sakacina is able to kill listeria cells by making their membranes permeable, and possesses also a slow hydrolytic action toward listeria cell walls, suggesting that it can break specific bonds in the peptoglycan structure.12 the present study was aimed at obtaining an active packaging material by applying a sakacina coating on the surface of polyethylene (pe)coated paper sheets, used for primary food packaging of thincut veal meat . Beef carpaccio was taken as an example of a readyto eatfood product, as it is considered a highrisk food because of the possibility of contamination with pathogenic bacteria, including listeria coming from the animal reservoir, and the minimal processing it undergoes.13 in the present research, an enriched sakacina preparation obtained from a cellfree supernatant of an l. sakei culture was coated onto the pe side of the aforementioned paper . Active package was assessed by performing an in vitro antimicrobial test against listeria innocua, a surrogate strain commonly used in the laboratory to give a margin of safety to researchers and prevent unnecessary exposure to pathogens.14 finally, a shortterm preliminary storage trial was carried out on actual carpaccio slices . Lactobacillus sakei dsmz 6333 was used as the sakacina producer and l. innocua dsmz 20649 as the indicator strain (deutsche sammlung von mikroorganismen und zellkulturen gmbh, braunschweig, germany). Lactobacillus sakei was maintained on mrs broth (scharlau chemie, barcelona, spain) and l. innocua on tsb (tryptic soy broth; difco, darmstadt, germany). Strains were stored as frozen stocks at 80 c in appropriate liquid medium in the presence of 0.5 g ml glycerol . Sakacina production by l. sakei was performed in a culture medium containing (g l) bacto peptone (10), meat peptone (8), yeast autolysate (4), glucose (10) and caco3 (3) in deionized water . All ingredients were purchased from costantino (type fm, fermentation media, torino, italy). Trials were carried out in 2 l flasks, each containing 1.4 l of culture medium and inoculated with 70 ml of preculture . Cultures were incubated in stationary conditions at 30 c for 20 h, corresponding to maximum bacteriocin concentration.12 bacteriocin production was expressed as arbitrary units (au ml), measured by agar diffusion assays using l. innocua as the indicator organism.10 a foodgrade freezedried preparation of sakacina was obtained from the culture broth of l. sakei after centrifugation at 10 000 g for 35 min at 4 c . The supernatant (culture filtrate, cf) was diafiltered in a 200 ml amicon cell (millipore, billerica, ma, usa) fitted with an ultracel pl3 membrane with molecular weight cutoff (mwco) 3000 da (millipore), by concentration to 40 ml and dilution to the original volume with milliq water . The final concentrate (40 ml) was frozen at 20 c for 4 h and freezedried at 25 c and 1.33 pa for 48 h in an alpha 24 ld plus lyophilizer (christ, osterode am harz, germany) connected to a savant vp 190 vacuum pump (savant instruments inc ., farmingdale, ny, usa). Trials were carried out incorporating the enriched sakacina in a gelatinbased coating solution, whose composition is reported in table 1 . To prepare the coating, gelatin was first dissolved in water at 60 c, then glycerol and enriched sakacina were added while stirring at room temperature . Sheets (a4, 210 mm 297 mm, 75 g m) of a commercial pecoated paper (burgo group, altavilla vicentina, italy) were used for the application of the coating solution onto the pe side . An automatic film applicator (sh1137, sheen instruments, west molesey, uk) equipped with a 50 m wire bar coater was used at a controlled speed of 110 mm s. coated sheets sheets coated with gelatin / glycerol solution without sakacina were also prepared as negative controls . Mass composition of coating solution an aliquot (300 l) of overnight listeria culture in tsb was added to 30 ml of soft tsa (tsb with 8 g l agar) in a petri dish and left at room temperature until solidification . Wells (8 mm diameter) were made on the plate and aliquots (150 l) of sakacina (either cf or enriched sakacina) were poured inside . Bacteriocin activity (au) was quantified as the reciprocal of the highest dilution that exhibited a clear zone of inhibition.11 in the case of coated paper sheets (both active and negative control), antimicrobial activity was evidenced qualitatively using the plate overlay assay . Samples (1 cm2) were placed on the surface of listeria tsa plates prepared as described above . Solid cultures were then incubated overnight at 37 c, and antimicrobial activity was evaluated by the formation of a clear halo of listeria growth inhibition around the sample . Readytoeat thincut veal meat (meant for consumption as raw food within 24 h, known in italy as samples were aseptically cut into sections (5 cm 10 cm, 78 g) and inoculated with an appropriate dilution of l. innocua overnight culture to obtain a microbial load of approximately 103 cells cm . After inoculation, samples were kept at room temperature for 30 min to allow for cell attachment . Inoculated slices were covered (top and bottom) with sections of sakacina active paper sheets and transferred onto glass trays that were manually wrapped in pvc film under aerobic conditions (fig . A negative control set of trials was also performed employing paper sheets coated with gelatin in the absence of sakacina . On days 0 and 2, individual meat slices were transferred aseptically into a stomacher bag (vwr blender bag, milano, italy) containing 6372 ml of sterile peptone water (10 g l bacteriological peptone; costantino) and blended in a stomacher (star blender lb 400, vwr, milano, italy) at high speed for 3 min . Tenfold dilution series of the obtained suspension were made in the same sterile peptone water and used for l. innocua determination and total aerobic plate count . Selective l. innocua determination was performed employing the aloa culture medium (agar listeria ottaviani agosti added with enrichment and selective supplements; biolife, milan, italy). Plates were surface inoculated and incubated at 37 c for 2448 h. total aerobic plate count was performed on nutrient agar (scharlau chemie) plates incubated at 30 c for 48 h. experiments were replicated twice . Counts were reported as log colonyforming units (cfu) g meat, and means and standard deviations were calculated . Thincut meat slices intentionally inoculated with listeria innocua and stored in contact with sakacina active paper (left, +) and negative control (right,). Enriched sakacina was characterized by novex nupage sodium dodecyl sulfate polyacrylamide gel electrophoresis (sdspage) (life technologies, carlsbad, ca, usa). A 1 mg portion of the freezedried preparation was dissolved in 1 ml of denaturing buffer (0.125 mol l tris hcl, ph 6.8, 500 g l glycerol, 17 g l sds, 0.1 g l bromophenol blue, 10 ml l 2mercaptoethanol) diluted twofold with water . After treatment at 100 c for 10 min, an appropriate volume of the solution was used for nupage sdspage on nupage novex 412% bis tris protein gel, run at a constant 200 v. gels were stained with simply blue safe stain . Novex nupage sdspage was used also to quantify the amount of enriched sakacina incorporated into the coating . A paper sample of 1 cm was cut, directly placed into 0.2 ml of denaturing buffer (diluted twofold with water) and heated at 100 c for 10 min . After centrifugation at 10 000 g for 2 min, an aliquot of the clarified suspension was used for nupage sdspage . The intensity of individual bands was compared with the intensity of bands obtained with known amounts of the original enriched sakacina preparation.15 obtained data were submitted to twoway analysis of variance . Kramer test was used for comparison of means, with significance assigned at p <0.05 . Lactobacillus sakei dsmz 6333 was used as the sakacina producer and l. innocua dsmz 20649 as the indicator strain (deutsche sammlung von mikroorganismen und zellkulturen gmbh, braunschweig, germany). Lactobacillus sakei was maintained on mrs broth (scharlau chemie, barcelona, spain) and l. innocua on tsb (tryptic soy broth; difco, darmstadt, germany). Strains were stored as frozen stocks at 80 c in appropriate liquid medium in the presence of 0.5 g ml glycerol . Sakacina production by l. sakei was performed in a culture medium containing (g l) bacto peptone (10), meat peptone (8), yeast autolysate (4), glucose (10) and caco3 (3) in deionized water . All ingredients were purchased from costantino (type fm, fermentation media, torino, italy). Trials were carried out in 2 l flasks, each containing 1.4 l of culture medium and inoculated with 70 ml of preculture . Cultures were incubated in stationary conditions at 30 c for 20 h, corresponding to maximum bacteriocin concentration.12 bacteriocin production was expressed as arbitrary units (au ml), measured by agar diffusion assays using l. innocua as the indicator organism.10 a foodgrade freezedried preparation of sakacina was obtained from the culture broth of l. sakei after centrifugation at 10 000 g for 35 min at 4 c . The supernatant (culture filtrate, cf) was diafiltered in a 200 ml amicon cell (millipore, billerica, ma, usa) fitted with an ultracel pl3 membrane with molecular weight cutoff (mwco) 3000 da (millipore), by concentration to 40 ml and dilution to the original volume with milliq water . The final concentrate (40 ml) was frozen at 20 c for 4 h and freezedried at 25 c and 1.33 pa for 48 h in an alpha 24 ld plus lyophilizer (christ, osterode am harz, germany) connected to a savant vp 190 vacuum pump (savant instruments inc ., trials were carried out incorporating the enriched sakacina in a gelatinbased coating solution, whose composition is reported in table 1 . To prepare the coating, gelatin was first dissolved in water at 60 c, then glycerol and enriched sakacina sheets (a4, 210 mm 297 mm, 75 g m) of a commercial pecoated paper (burgo group, altavilla vicentina, italy) were used for the application of the coating solution onto the pe side . An automatic film applicator (sh1137, sheen instruments, west molesey, uk) equipped with a 50 m wire bar coater was used at a controlled speed of 110 mm s. coated sheets sheets coated with gelatin / glycerol solution without sakacina were also prepared as negative controls . An aliquot (300 l) of overnight listeria culture in tsb was added to 30 ml of soft tsa (tsb with 8 g l agar) in a petri dish and left at room temperature until solidification . Wells (8 mm diameter) were made on the plate and aliquots (150 l) of sakacina (either cf or enriched sakacina) were poured inside . Bacteriocin activity (au) was quantified as the reciprocal of the highest dilution that exhibited a clear zone of inhibition.11 in the case of coated paper sheets (both active and negative control), antimicrobial activity was evidenced qualitatively using the plate overlay assay . Samples (1 cm2) were placed on the surface of listeria tsa plates prepared as described above . Solid cultures were then incubated overnight at 37 c, and antimicrobial activity was evaluated by the formation of a clear halo of listeria growth inhibition around the sample . Readytoeat thincut veal meat (meant for consumption as raw food within 24 h, known in italy as samples were aseptically cut into sections (5 cm 10 cm, 78 g) and inoculated with an appropriate dilution of l. innocua overnight culture to obtain a microbial load of approximately 103 cells cm . After inoculation, samples were kept at room temperature for 30 min to allow for cell attachment . Inoculated slices were covered (top and bottom) with sections of sakacina active paper sheets and transferred onto glass trays that were manually wrapped in pvc film under aerobic conditions (fig . A negative control set of trials was also performed employing paper sheets coated with gelatin in the absence of sakacina . On days 0 and 2, individual meat slices were transferred aseptically into a stomacher bag (vwr blender bag, milano, italy) containing 6372 ml of sterile peptone water (10 g l bacteriological peptone; costantino) and blended in a stomacher (star blender lb 400, vwr, milano, italy) at high speed for 3 min . Tenfold dilution series of the obtained suspension were made in the same sterile peptone water and used for l. innocua determination and total aerobic plate count . Selective l. innocua determination was performed employing the aloa culture medium (agar listeria ottaviani agosti added with enrichment and selective supplements; biolife, milan, italy). Plates were surface inoculated and incubated at 37 c for 2448 h. total aerobic plate count was performed on nutrient agar (scharlau chemie) plates incubated at 30 c for 48 h. experiments were replicated twice . Counts were reported as log colonyforming units (cfu) g meat, and means and standard deviations were calculated . Thincut meat slices intentionally inoculated with listeria innocua and stored in contact with sakacina active paper (left, +) and negative control (right,). Enriched sakacina was characterized by novex nupage sodium dodecyl sulfate polyacrylamide gel electrophoresis (sdspage) (life technologies, carlsbad, ca, usa). A 1 mg portion of the freezedried preparation was dissolved in 1 ml of denaturing buffer (0.125 mol l tris hcl, ph 6.8, 500 g l glycerol, 17 g l sds, 0.1 g l bromophenol blue, 10 ml l 2mercaptoethanol) diluted twofold with water . After treatment at 100 c for 10 min, an appropriate volume of the solution was used for nupage sdspage on nupage novex 412% bis tris protein gel, run at a constant 200 v. gels were stained with simply blue safe stain . Novex nupage sdspage was used also to quantify the amount of enriched sakacina incorporated into the coating . A paper sample of 1 cm was cut, directly placed into 0.2 ml of denaturing buffer (diluted twofold with water) and heated at 100 c for 10 min . After centrifugation at 10 000 g for 2 min, an aliquot of the clarified suspension was used for nupage sdspage . The intensity of individual bands was compared with the intensity of bands obtained with known amounts of the original enriched sakacina preparation.15 kramer test was used for comparison of means, with significance assigned at p <0.05 . Sakacina production by l. sakei reached the maximum level at 20 h incubation, corresponding to the highest cell population (109 cfu ml), as reported by trinetta et al . 11 the culture filtrate (cf) obtained after centrifugation showed an antimicrobial titer of 107 au ml . Cf was ultrafiltered and diafiltered in order to concentrate the preparation and to remove lowmolecularweight compounds such as salts, small peptides, sugars, etc . The mass yield of freezedried enriched sakacina was approximately 3 g from 200 ml of cf . 2, where a marked band at 3.5 kda could be identified with sakacina.12 no other noticeable proteins are evident . However, other peptides retained during the ultrafiltration step may be present, as suggested by the weak smear over the 3.5 kda band . Nupage sdspage analysis of enriched sakacina preparation: lane s, freezedried enriched sakacina preparation (20 g); lane m, molecular mass markers . The antimicrobial titer of enriched sakacina was about 1.4 au mg, as determined by agar well diffusion assay employing l. innocua as the indicator strain . Thus, on an activity basis, the overall yield of the enrichment process was 19.6% . Antimicrobial activity of the sakacina solutions used for paper coating and of sakacina active paper was demonstrated by a clear zone of growth inhibition on listeria tsa plates (fig . No activity against the indicator strain was noticed in negative controls, demonstrating that neither the paper itself nor the gelatin coating had antimicrobial activity in the absence of sakacina . Antimicrobial activity against listeria innocua of (1) sakacina / gelatin solution used for paper coating, (2) active paper (coated with sakacina) and (3) negative control paper (coated with gelatin, in the absence of sakacina). The listeria population and total aerobic count (tac) were determined in samples of carpaccio (thin meat slices meant for consumption as raw meat within 24 h after purchasing) purposely contaminated with l. innocua (3.46 log cfu g) and then stored at 4 c for 48 h (table 2). A surrogate is a bacterium that has physiological characteristics nearly identical to a pathogenic bacterium of interest, and is used to give a margin of safety to researchers and prevent unnecessary exposure to pathogens.14 listeria population and total aerobic count in samples of thincut veal slices as such or inoculated with listeria innocua and then stored for 48 h at 4 1 c in active paper sheets coated with sakacina (active package) or paper sheets without sakacina coating (negative control) means in the same column with different letters are significantly different (p <0.05). After 48 h, the listeria population of carpaccio slices stored in contact with the active paper sheets was found to be lower than that used for the initial inoculum (from 3.46 to 3.05 log cfu g). On the contrary, in negative controls (carpaccio slices stored in contact with paper coated with gelatin in the absence of sakacina), the listeria population increased by about 1 log unit (from 3.46 to 4.46 log cfu g). Meat slices stored in presence of sakacina active paper sheets also evidenced a slight decrease in aerobic populations (0.3 log unit) after 48 h storage at refrigerated temperature . On the contrary, slices packed without sakacina coating evidenced a 0.35 log unit increase with respect to the initial value . These experiments demonstrate the antimicrobial activity of the sakacina active paper sheets and their effectiveness against l. innocua in storage trials . Sdspage was used to characterize the presence of enriched sakacina on the active paper (fig . 4, lanes 1 and 2) as well as its release from the coating in storage trials (fig ., proteins present in the coating were completely extracted from the paper by solubilization under denaturing conditions (i.e. Upon heating at 100 c in sdspage denaturing buffer). Nupage sdspage analysis of active paper and negative control: proteins extracted from active paper (with sakacina) and negative control (without sakacina) before (lanes 1 and 2 respectively) and 48 h after (lanes 3 and 4 respectively) being placed in contact with food . Protein extracted from the negative control (paper sheets without sakacina) showed a broad distribution of proteins of medium high molecular weight that can be assigned to the gelatin used for the preparation of the coating (fig . No proteins are visible around 3.5 kda, i.e. In the sakacina region . As clearly shown in fig . 4 (lane 1), a band corresponding to sakacina is evident, in addition to the gelatin bands, in samples from the paper coated with sakacina . The intensity of this band was compared with the intensity of bands obtained with known amounts of the enriched sakacina preparation,15 allowing us to estimate the concentration of sakacina in coated paper sheets at 0.63 mg cm . This estimated concentration is in good agreement with the amount of enriched sakacina used for the preparation of the coating and with the volume of the coating solution spread on the paper sheets . As for sakacina release in storage trials with food, active packaging containing nonvolatile antimicrobial agents is assumed to work through contact with wet food.15 the contact between food and packaging lead to the migration of the active compound from the packaging to the food surface and vice versa . The release of sakacina was studied through sdspage by extracting proteins from paper that had been in contact with meat slices . In both samples (negative control and active paper, lanes 3 and 4 in fig . The absence of both sakacina and gelatin in paper that had been in contact with food is indirect evidence that the antimicrobial agent must be transferred, together with gelatin, onto the food . In this contest, bioactive content was triggered by the swelling of gelatin upon taking up water from the wet food . Otherwise, in the sdspage traces of the above samples, new distinct bands are visible . These bands could be attributed to soluble meat proteins dissolved in the liquid phase and migrated from food to the paper . Sakacina production by l. sakei reached the maximum level at 20 h incubation, corresponding to the highest cell population (109 cfu ml), as reported by trinetta et al . 11 the culture filtrate (cf) obtained after centrifugation showed an antimicrobial titer of 107 au ml . Cf was ultrafiltered and diafiltered in order to concentrate the preparation and to remove lowmolecularweight compounds such as salts, small peptides, sugars, etc . The mass yield of freezedried enriched sakacina was approximately 3 g from 200 ml of cf . 2, where a marked band at 3.5 kda could be identified with sakacina.12 no other noticeable proteins are evident . However, other peptides retained during the ultrafiltration step may be present, as suggested by the weak smear over the 3.5 kda band . Nupage sdspage analysis of enriched sakacina preparation: lane s, freezedried enriched sakacina preparation (20 g); lane m, molecular mass markers . The antimicrobial titer of enriched sakacina was about 1.4 au mg, as determined by agar well diffusion assay employing l. innocua as the indicator strain . Thus, on an activity basis, the overall yield of the enrichment process was 19.6% . Antimicrobial activity of the sakacina solutions used for paper coating and of sakacina active paper was demonstrated by a clear zone of growth inhibition on listeria tsa plates (fig . No activity against the indicator strain was noticed in negative controls, demonstrating that neither the paper itself nor the gelatin coating had antimicrobial activity in the absence of sakacina . Antimicrobial activity against listeria innocua of (1) sakacina / gelatin solution used for paper coating, (2) active paper (coated with sakacina) and (3) negative control paper (coated with gelatin, in the absence of sakacina). The listeria population and total aerobic count (tac) were determined in samples of carpaccio (thin meat slices meant for consumption as raw meat within 24 h after purchasing) purposely contaminated with l. innocua (3.46 log cfu g) and then stored at 4 c for 48 h (table 2). A surrogate is a bacterium that has physiological characteristics nearly identical to a pathogenic bacterium of interest, and is used to give a margin of safety to researchers and prevent unnecessary exposure to pathogens.14 listeria population and total aerobic count in samples of thincut veal slices as such or inoculated with listeria innocua and then stored for 48 h at 4 1 c in active paper sheets coated with sakacina (active package) or paper sheets without sakacina coating (negative control) means in the same column with different letters are significantly different (p <0.05). After 48 h, the listeria population of carpaccio slices stored in contact with the active paper sheets was found to be lower than that used for the initial inoculum (from 3.46 to 3.05 log cfu g). On the contrary, in negative controls (carpaccio slices stored in contact with paper coated with gelatin in the absence of sakacina), the listeria population increased by about 1 log unit (from 3.46 to 4.46 log cfu g). Meat slices stored in presence of sakacina active paper sheets also evidenced a slight decrease in aerobic populations (0.3 log unit) after 48 h storage at refrigerated temperature . On the contrary, slices packed without sakacina coating evidenced a 0.35 log unit increase with respect to the initial value . These experiments demonstrate the antimicrobial activity of the sakacina active paper sheets and their effectiveness against l. innocua in storage trials . Antimicrobial activity of the sakacina solutions used for paper coating and of sakacina active paper was demonstrated by a clear zone of growth inhibition on listeria tsa plates (fig . No activity against the indicator strain was noticed in negative controls, demonstrating that neither the paper itself nor the gelatin coating had antimicrobial activity in the absence of sakacina . Antimicrobial activity against listeria innocua of (1) sakacina / gelatin solution used for paper coating, (2) active paper (coated with sakacina) and (3) negative control paper (coated with gelatin, in the absence of sakacina). Sakacinacoated paper sheets were evaluated for their antilisterial effectiveness on food samples . The listeria population and total aerobic count (tac) were determined in samples of carpaccio (thin meat slices meant for consumption as raw meat within 24 h after purchasing) purposely contaminated with l. innocua (3.46 log cfu g) and then stored at 4 c for 48 h (table 2). A surrogate is a bacterium that has physiological characteristics nearly identical to a pathogenic bacterium of interest, and is used to give a margin of safety to researchers and prevent unnecessary exposure to pathogens.14 listeria population and total aerobic count in samples of thincut veal slices as such or inoculated with listeria innocua and then stored for 48 h at 4 1 c in active paper sheets coated with sakacina (active package) or paper sheets without sakacina coating (negative control) means in the same column with different letters are significantly different (p <0.05). After 48 h, the listeria population of carpaccio slices stored in contact with the active paper sheets was found to be lower than that used for the initial inoculum (from 3.46 to 3.05 log cfu g). On the contrary, in negative controls (carpaccio slices stored in contact with paper coated with gelatin in the absence of sakacina), the listeria population increased by about 1 log unit (from 3.46 to 4.46 log cfu g). Meat slices stored in presence of sakacina active paper sheets also evidenced a slight decrease in aerobic populations (0.3 log unit) after 48 h storage at refrigerated temperature . On the contrary, slices packed without sakacina coating evidenced a 0.35 log unit increase with respect to the initial value . These experiments demonstrate the antimicrobial activity of the sakacina active paper sheets and their effectiveness against l. innocua in storage trials . Sdspage was used to characterize the presence of enriched sakacina on the active paper (fig . 4, lanes 1 and 2) as well as its release from the coating in storage trials (fig ., proteins present in the coating were completely extracted from the paper by solubilization under denaturing conditions (i.e. Upon heating at 100 c in sdspage denaturing buffer). Nupage sdspage analysis of active paper and negative control: proteins extracted from active paper (with sakacina) and negative control (without sakacina) before (lanes 1 and 2 respectively) and 48 h after (lanes 3 and 4 respectively) being placed in contact with food . Protein extracted from the negative control (paper sheets without sakacina) showed a broad distribution of proteins of medium high molecular weight that can be assigned to the gelatin used for the preparation of the coating (fig . No proteins are visible around 3.5 kda, i.e. In the sakacina region . As clearly shown in fig . 4 (lane 1), a band corresponding to sakacina is evident, in addition to the gelatin bands, in samples from the paper coated with sakacina . The intensity of this band was compared with the intensity of bands obtained with known amounts of the enriched sakacina preparation,15 allowing us to estimate the concentration of sakacina in coated paper sheets at 0.63 mg cm . This estimated concentration is in good agreement with the amount of enriched sakacina used for the preparation of the coating and with the volume of the coating solution spread on the paper sheets . As for sakacina release in storage trials with food, active packaging containing nonvolatile antimicrobial agents is assumed to work through contact with wet food.15 the contact between food and packaging lead to the migration of the active compound from the packaging to the food surface and vice versa . The release of sakacina was studied through sdspage by extracting proteins from paper that had been in contact with meat slices . In both samples (negative control and active paper, lanes 3 and 4 in fig . The absence of both sakacina and gelatin in paper that had been in contact with food is indirect evidence that the antimicrobial agent must be transferred, together with gelatin, onto the food . In this contest, bioactive content was triggered by the swelling of gelatin upon taking up water from the wet food . Otherwise, in the sdspage traces of the above samples, new distinct bands are visible . These bands could be attributed to soluble meat proteins dissolved in the liquid phase and migrated from food to the paper . The present research was aimed at developing a novel antimicrobial food packaging system employing a foodgrade preparation of sakacina . The bacteriocin was produced in liquid cultures employing a medium formulated with lowcost ingredients, suitable for largescale industrial processes.11 purification is usually an essential step in the characterization of unknown bacteriocins, but it represents a timeconsuming and lowyield step in such studies . Indeed, owing to the high number of steps in current protocols, protein yields are very often low.16 in practical terms, purification to homogeneity is redundant and sometimes not suitable for foodgrade application.17 in the present work, sakacina was concentrated from a foodgrade medium by onestep diafiltration, giving a freezedried enriched sakacina free from contaminant proteins and with an antimicrobial titer of 1.36 au mg . Total activity yield was nearly 20% better than other methods of rapid purification (10% in guyonnet et al . 16), although lower than vastly timeconsuming methods (83% in holck et al . 9). Incorporation of bacteriocins into food packaging materials to control the growth of spoilage and pathogenic organisms has been much researched in the last decades.4 paper and paperboard for food packaging provide mechanical strength, are biodegradable and have good printability, but display poor barrier properties to liquids, gases and vapors . To overcome these drawbacks, coatings with polymeric matrices or waxes in addition, coatings can also be added with antimicrobials, to obtain an active food package.18, 19 two methods are commonly used to prepare antimicrobial paperbased food package materials for meats and/or meat products . One is to incorporate them directly into polymers, i.e. Heatpress and casting.4 ming et al . 20 incorporated nisin and pediocin in cellulose casings to reduce l. monocytogenes in meats and poultry . Pediocincoated bags completely inhibited the growth of inoculated l. monocytogenes during 12 weeks of storage at 4 c . In a previous paper, we reported on the incorporation of lysozyme and lactoferrin as antimicrobials in a cellulosebased food package . Those studies indicated that these proteins were simultaneously released in a biologically active form, and the synergism between the two antimicrobials was evident in tests against common food contaminants.15 another method to incorporate bacteriocins is to coat or adsorb them onto polymer surfaces . 21 investigated the interaction between three bacteriocins (nisin and bateriocins produced by lactobacillus curvatus and lactobacillus plantarum) and five different pe films used for food packaging . The results indicated that each film bacteriocin pair showed different antimicrobial activity owing to the establishment of chemical and surface interactions . 22 produced threelayer films of ethylcellulose, hydroxypropylmethylcellulose and ethylcellulose (ec / hpmc / ec) including either nisaplin or nisin . These multilayer films showed significant antimicrobial activity against kocuria rhizophila atcc 9341 (formerly micrococcus luteus). 23 produced sakacinacontaining (1 mg cm) pullulan films by incorporation and tested them on turkey breast experimentally inoculated with l. monocytogenes . The results showed reductions of up to 3 log cfu g after 3 weeks under refrigerated storage and demonstrated the efficacy of this bacteriocin against different epidemic clones of the pathogenic bacterium . In our preliminary assessment employing simple packaging conditions, the application of a sakacina / cellulosecoated material on meat samples gave positive results at a concentration of sakacina in the packaging material of 0.63 mg cm . In storage trials with veal carpaccio, all components of the active surface layer in the active paper appear to have migrated to the food after 48 h at 4 c . Thus an antilisteria active packaging solution, not to be regarded as a way to clean a contaminated food product, can contribute significantly to reducing the l. monocytogenes population in food items and lowering the risk of foodrelated diseases . This work, which should be considered as a preliminary investigation into the potential applicability of sakacina in an antilisteria active package, provides an example in which the bacteriocin was coated onto the surface of a pecoated paper commonly used for primary food packaging . Coating was efficient (no peptide loss was observed) and the bacterocin was released in a biologically active form . Future work will indicate whether the antimicrobialloaded paper sheets used here may find other practical uses (e.g. Paper liners or wraps) and whether they will be effective to improve the safety and extend the shelflife of other meat products.
In the last decade the amount of data regarding micrornas (mirs) and their target genes described in the literature has expanded tremendously . The volume of information on this new group of regulators (i.e., mirs) has complicated attempts to integrate this data within existing metabolic and signalling networks . As regulators of gene expression in addition, a single mir can potentially regulate multiple different genes at the same time, leading to complex functional outcomes . However, from another perspective, the identification of groups of genes targeted by the same mir and the clustering of these genes within individual signalling pathways represents a means to understand the cross talk between multiple signalling networks and their role in a common biological process . The focus of this review is to summarize the validated groups of mirs functionally linked to the cross talk between tgf-, notch, and wnt signalling during the common biological process of epithelial - to - mesenchymal transition (emt). In particular, this review will address whether the documented cross talk between these three important emt - associated pathways could be further reinforced by the identification of a signature of mirs, already depicted in the literature but not yet sharpened or clearly defined in this role . In the past years, many studies have elegantly described the role of tgf-, notch, and wnt pathways in promoting emt and emt - associated disorders including fibrosis and metastatic dissemination in cancer [16]. Here we identify published and validated interactions between mirs and genes involved in tgf-, notch, and wnt signalling . This led to the discovery of a signature of 30 mirs each regulating all three pathways . We then searched for additional validated genes targeted by these 30 mirs and then further clustered these into the tgf-, notch, and wnt signalling pathways . Interestingly, in our attempt to identify mirs that were common to all three of these signalling pathways, we found that the 30-mir signature strongly reinforced existing evidence supporting cross talk between these three pathways during emt . In this review we used tarbase v6.0, the largest currently available manually curated mir target gene database, which includes targets derived from specific and high throughput experiments . Using tarbase v6.0 we searched the collection of manually curated, experimentally validated mir - gene interactions for tgf- (hsa04350), wnt (hsa04310), and notch (hsa04330) signalling kegg pathways in homo sapiens . Using diana - mirpath, a mir pathway analysis web - server, we clustered the validated mirs using experimentally validated mir interactions derived from diana - tarbase v6.0 . Results were merged using a union of genes and analysed with a priori analysis methods (overrepresentation statistical analysis). This statistical analysis identified pathways significantly enriched with targets belonging to a union of genes . A p value threshold of 0.05 was applied with false discovery rate (fdr) correction to the resulting significance levels . Using tarbase v6.0 we explored the collection of manually curated, experimentally validated mir interactions with genes in the tgf-, wnt, and notch kegg pathways . We identified 84 experimentally validated mirs interacting with genes involved in the tgf- signalling pathway, 104 mirs in the wnt pathway, and 48 mirs interacting with genes involved in notch signalling . We clustered the mirs identified in our search in order to obtain a list of experimentally validated mirs shared between all three pathways focusing first on clusters of two out of three pathways (i.e., experimentally validated mirs shared between only tgf- and notch, tgf- and wnt, or notch and wnt) (figure 1). We identified 2 experimentally validated mirs shared between the tgf- and notch pathways (figure 1 and supplementary table 1 available online at http://dx.doi.org/10.1155/2015/198967); 10 mirs shared between the notch and wnt pathways (figure 1 and supplementary table 2); 39 mirs shared between the tgf- and wnt pathways (figure 1 and supplementary table 3). We further identified a signature of 30 experimentally validated mirs targeting all three pathways (figure 1 and tables 1, 2, and 3). Within this 30-mir signature, 4 mirs (mir-103a, mir-132, mir-30a, and mir-10a) had validated target genes not ascribable to the manually annotated interactions within the kegg pathways . Diana - mirpath was used to collect the complete list of manually annotated, experimentally validated, and published target genes for the 30 mirs identified . This was done in order to get better insight into the experimental data and understand the functional relevance of our analysis . Of all validated target genes 48 genes could be ascribed to the tgf- pathway (p value = 6.9e 09), 30 to the notch pathway (p value = 4.7e 05), and 88 to the wnt signalling pathway (p value = 5.07e 14). Using the same approach as for the mirs, a cluster of genes was found to be shared between only two of the three pathways (i.e., experimentally validated mir - gene interactions from tgf- and notch, tgf- and wnt, or notch and wnt kegg pathways). With this procedure, we identified 8 manually annotated and validated target genes shared by tgf- and wnt kegg pathways (smad2, smad3, smad4, rock2, rhoa, myc, ppp2r1a, and ppp2r1b) and 5 manually annotated and validated target genes shared by notch and wnt kegg pathways (ctbp1, ctbp2, dvl2, dvl3, and psen1). Interestingly, no genes were shared between tgf- and notch kegg pathways (figure 2). Finally, we determined whether a new cluster of experimentally validated target genes coupled to our signature described above could be connected to a common biological process among tgf-, notch, and wnt signalling pathways . Strikingly, only 2 validated target genes, the transcriptional coactivator camp - response element - binding protein- (creb-) binding protein (cbp) and the adenovirus e1a - associated cellular p300 transcriptional coactivator protein p300 (ep300), were shared exclusively between the tgf-, notch, and wnt signalling kegg pathways (figure 2). These results indicate the relevance of the 30-identified - mir signature thus suggesting a possible link between these mirs and cross talk between tgf-, notch, and wnt pathways during emt . Tgf- signalling plays complex roles during tumor progression and can either inhibit or promote tumor growth depending on the cellular context . The complexity of tgf- signalling derives in part from the capability of its receptors to activate distinct canonical and noncanonical signalling pathways . In the smad - dependent canonical pathway, tgf- ligands assemble their specific type ii and type i transmembrane serine kinase receptors, allowing the constitutively active type ii receptor kinase to phosphorylate the type i receptor, thereby activating its kinase . The active type i receptor then phosphorylates its cognate cytoplasmic smad proteins which then enter the nucleus to regulate the transcription of target genes . By contrast, the noncanonical pathway is smad - independent and includes tgf- signalling via the rho family of gtpases and mapk / pi3k pathways . In this context, tgf- has been shown to rapidly activate the rho - gtpases and its activation of rhoa in epithelial cells leads to induction of stress fibers and acquisition of mesenchymal characteristics, thus promoting emt . Additionally, rhoa is a crucial regulator in the signal transduction events that link activation of latent tgf- by plasma membrane receptors (e.g., integrins) to the assembly of focal adhesions and sites of f - actin fiber organization . Interestingly, we have identified interactions between rhoa and a group of 5 validated mirs (mir-155, mir-124, mir-375, mir-122, and mir-31) [1217] (figure 3). More specifically, in endothelial cells, mir-155 was shown to block the acquisition of the mesenchymal phenotype induced by tgf- by directly targeting rhoa . Similar observations were made in osteoclast precursor cells, where overexpression of mir-124 decreased rhoa expression and reduced cell migration . Dramatic effects on migration and cytoskeleton disruption have also been reported for mir-122 in hepatocellular carcinoma (hcc). In this context, mir-122 and rhoa interact directly and overexpression of rhoa reverts mir-122-induced mesenchymal - to - epithelial transition (met) and inhibition of migration . Finally, in breast cancer cells it was demonstrated that overexpression of mir-31 decreases invasion and metastasis via downregulation of rhoa (figure 3). Together, these findings highlight the relevance of these mirs in interfering with rhoa mediated emt . Modulation of stress fibers and cytoskeletal rearrangements are key events in the acquisition of a mesenchymal phenotype and in the modulation of cellular motility . Two key players in this process are the rho - serine / threonine kinases rock1 and rock2 which regulate smooth muscle contraction, formation of stress fibers, and focal adhesions . Rock1 and rock2 are two major downstream effectors of rhoa that constitute additional important mediators of tgf--induced emt . Interestingly, among the 30 mirs in our signature, we found 2 validated mirs (mir-335 and mir-124) that regulate expression of rock1 and rock2 [20, 21]. Low levels of mir-335 were correlated with poor overall patient survival in neuroblastoma while overexpression of this mir strongly reduced cell migration and impaired f - actin organization . Further analysis revealed that mir-335 directly targets rock1 providing an explanation for its ability to reduce cell invasion . Low levels of mir-124 have been associated with poor prognosis in aggressive hcc while overexpression of mir-124 in hcc cell lines strongly decreased rock2 expression and inhibited emt, formation of stress fibers, filopodia, and lamellipodia . Taken together these experimental data highlight an important role for mir-335 and mir-124 in smad - independent, noncanonical tgf- effects on cytoskeletal rearrangements via rhoa - dependent signalling pathways (figure 3). Tgf- also induces mesenchymal characteristics via canonical signalling, that is, via smad2 and smad3 . In the previous paragraph we described the ability of mir-155 to directly decrease rhoa expression and thereby interestingly, mir-155 has also been shown to interfere with the canonical tgf- pathway by directly affecting the formation of the smad2/3 signalling complex . Have demonstrated that mir-155 directly targets smad2, leading to a reduction of tgf--induced smad2 phosphorylation and blocking smad2-dependent activation of a tgf--inducible, smad - dependent caga reporter plasmid . Additionally, mir-155 targets presenilin 1 (psen1), a catalytic subunit of the gamma - secretase complex which catalyzes the cleavage of membrane proteins including notch receptors . In this have shown that psen1 plays a crucial role in mediating the interaction between tgf- and notch signalling by promoting the association between the tgf- type i receptor intracellular domain (tri - icd) and the notch intracellular domain (nicd) which in turn triggers cell - invasive behaviour in prostate cancer . Altogether, these data suggest that mir-155 can disrupt both the canonical and noncanonical tgf- pathways and might represent an interesting modulator of cross talk between tgf- and notch signalling pathways (figure 3). The observation that tgf- alone can be sufficient to induce emt in epithelial cells while other cell types may not be sensitive to this effect of tgf- suggests that induction of emt by tgf- requires cooperation with other signalling pathways . Indeed, several studies indicate that tgf- acts together with the notch and wnt pathways to promote emt [4, 6, 26, 27]. Remarkably, in our analysis we could not identify any validated mir target genes shared exclusively between the tgf- and notch pathways . However, notch is able to antagonize tgf- via sequestration of ep300, a factor that in turn acts as a transcriptional coactivator for notch1 . The interaction in the cluster of mir target genes ascribable to notch signalling and their interactions with mir target genes associated with both tgf- and wnt signalling pathways are discussed below . Concerning wnt signalling, two interesting genes highlighted in our analysis are ppp2r1a and ppp2r1b . These are the catalytic subunits of the pp2a holoenzyme, a protein phosphatase that reverts the action of protein kinases in many signalling cascades, including wnt signalling . Several reports support the notion that pp2a plays a dual role in wnt signalling and can act as either a positive or a negative regulator of the pathway . On one hand, in the absence of wnt, -catenin forms a complex with apc, axin, and gsk3. This allows gsk3 to phosphorylate -catenin that is then ubiquitinated and targeted for proteasomal degradation . In this context, different pp2a subunits bind to axin and apc, decreasing -catenin levels and thereby negatively regulating wnt signalling . On the other hand, in the presence of wnt, pp2a seems to exert a positive role in -catenin stabilization . In this situation, the complex of apc, axin, and gsk3 is degraded by dishevelled (dsh) leading to nuclear -catenin accumulation and activation of wnt target genes . Stabilized -catenin can subsequently localize at plasma membrane in complex with e - cadherin and pp2a, thus reducing emt . Recently, we have demonstrated that activation of wnt signalling via gsk3 inhibition in metastatic and androgen independent prostate cancer cells (pc3, du145, and c4 - 2b) induces dramatic changes in their morphology, blocks their migration, reduces their metastatic growth, and strongly affects their mesenchymal phenotype . This highlights the ability of wnt signalling to stabilize e - cadherin and interfere with emt in prostate cancer suggesting that pp2a may act as a negative regulator of emt . Consistent with this possibility, it has been shown that restoring expression of a catalytic subunit of pp2a can revert emt and suppress tumor growth and metastasis in an orthotopic mouse model of human prostate cancer . Interestingly, we identified two mirs in our signature (mir-16 and mir-124) that directly block the expression of catalytic subunits of pp2a (ppp2r1a and ppp2r1b) and that have been positively validated by proteomics and microarray, respectively [13, 23]. Strikingly, homozygous deletion (hd) of the mir-16 locus was observed in androgen independent prostate cancer in xenograft models . The hd of mir-16 in a subset of androgen independent prostate cancer xenograft might suggest that, in this context, pp2a is present and stable . In turn, this might also suggest that activation of wnt signalling in androgen independent prostate cancer cells could act synergistically with pp2a to promote stabilization of -catenin and e - cadherin leading to reduced emt . Taken together, these data might identify a subset of androgen independent prostate cancers in which restoration of wnt signalling reduces the aggressiveness of tumor cells and abolishes their mesenchymal phenotype . The involvement of mir-16 in emt in the context of prostate cancer is further reinforced by an interesting observation regarding its role in the tumor - supportive capacity of stromal cells . Have shown that mir-16 is downregulated in fibroblasts surrounding prostate tumors in patients . Additionally, they have demonstrated that mir-16 restoration considerably impairs the tumor - supportive capability of stromal cells in vitro and in vivo . From this perspective, it is important to note that the prostate tumor microenvironment is rich in tgf- superfamily members including tgf-s, bone morphogenetic proteins (bmps), growth / differentiation factors (gdfs), activins, inhibins, nodal, and anti - mllerian hormone (amh). Among them, mir-16 has been suggested to regulate activin / nodal signalling via direct interaction with teratocarcinoma - derived growth factor 1 (cripto, tdgf1). Have indeed shown using luciferase reporter assays that mir-16 (together with mir-15a) directly interacts with the 3utr of cripto . Cripto is a small, gpi - anchored protein that functions as a secreted growth factor and as an obligatory cell surface coreceptor for a subset of tgf- superfamily ligands including nodal . Cripto regulates both cell movement and emt during embryonic development and cancer and, strikingly, nodal, which has been implicated in enhancing tumor cell plasticity and aggressiveness, is expressed in cancerous but not normal human prostate specimens . Although it is required for nodal signalling, cripto suppresses tgf- signalling in multiple cell types, reinforcing the inclusion of mir-16 in our signature . Therefore, the reduced expression of mir-16 in the tumor microenvironment in prostate cancer is predicted to facilitate cripto - dependent nodal signalling which together with cripto's other tumor - promoting effects could trigger invasiveness, bone metastasis, and emt . Similar to mir-16, overexpression of mir-124 in androgen independent prostate cancer cell lines (du145) strongly reduces aggressiveness and invasion . This further supports the hypothesis that the increased pp2a stability caused by low levels of mir-16 and mir-124 in a subset of androgen independent prostate cancer cell lines could explain reduced cell migration and invasion, an effect that we also documented upon gsk3 inhibition . Mir-124 is also likely to be an important player in wnt signal transduction since proteomics and microarray analyses have revealed that it interacts with dvl2 (a member of dsh protein family) [13, 42]. Dvl2 binds the cytoplasmic c - terminus of the frizzled family of wnt receptors and transduces the wnt signal to downstream effectors . Interestingly, dvl2 also interacts with insulin receptor substrates (irs1/2) and thereby promotes canonical wnt signalling . Moreover, irs1/2 have been identified as key players in the regulation of e - cadherin expression during emt [44, 45]. The irs1/2 ratio has been shown to be significantly lower in malignant prostate tumors than in benign prostatic tissue and functional polymorphisms in irs1 have been associated with a more advanced gleason score [46, 47]. Also reduced migration was documented after mir-124 overexpression in androgen independent prostate cancer suggesting a mechanism in which low levels of mir-124 boost dvl2 . This, in turn, would be predicted to lead to gsk3 blockade with subsequent -catenin and e - cadherin stabilization . Additionally, low levels of mir-124 strengthen pp2a, which further contribute to stabilization of -catenin and e - cadherin, therefore reducing emt . Another mir in our signature, mir-324, has also been shown to regulate expression of dvl2 . Interestingly, dysregulation of mir-324 has been linked to macrophage dysfunction in colorectal cancer, where altered wnt signalling is known to play a pivotal role . More specifically, mir-324 was found to be highly expressed in infiltrated macrophages in fresh colon cancer tissues isolated immediately after surgical removal . Additionally, in the same work, the oncogene c - myc was identified as a candidate transcription factor capable of regulating mir-324 . This, combined with the identification of mir-324 in our analysis, suggests a fascinating role for mir-324 in the cross talk between tgf- and wnt signalling in emt and colorectal cancer . Double edged sword during colon cancer progression has been extensively documented in the literature . In its tumor suppressive role, tgf- inhibits progression of the cell cycle by inducing the tumor suppressors p15 (ink4b) and p21 (cdkn1a) and inhibiting expression c - myc . At the same time, c - myc is also a crucial downstream target of altered wnt signalling in colon cancer and has been shown to cause loss of e - cadherin, which is a hallmark of emt . Therefore, mir-324 could be involved in a feedback loop between wnt, tgf-, and c - myc . More specifically, altered wnt signalling during colorectal cancer development could modulate c - myc levels and therefore mir-324 expression . In turn, abnormal mir-324 levels can interfere with dvl2 expression leading to alteration in the wnt signalling pathway that further alter c - myc and e - cadherin levels (figure 3). We have identified a group of 6 mirs (mir-335, mir-34a, mir-21, mir-98, mir-24, and mir-145) directly linked to c - myc, reinforcing the role of c - myc as a common downstream target between tgf-- and wnt - mediated emt . Among them, we have already discussed the role of mir-335 in emt induced by tgf-, particularly its interaction with rock1 and rock2 . Interestingly, tavazoie et al . Have shown by microarray that mir-335 also interacts with c - myc, suggesting a more comprehensive role for mir-335 in tgf-- and wnt - mediated emt . Additionally, sampson et al . Have suggested that mir-98 (from let-7/mir-98 family) might regulate c - myc expression . They have shown that administration of 10058-f4, a compound that inhibits myc, strongly increases the expression of mir-98 and other let-7 family members . Strikingly, treatment of melanoma cells with 10058-f4 efficiently diminished emt mediated by tgf- and s - phase kinase - associated protein 2 (skp2). Taken together, these data suggest that mir-98 could represent an important mediator in the cross talk between tgf- and wnt and their effect in modulation of emt . Deregulated expression of c - myc has been reported in a wide variety of human cancers and among several key regulators of c - myc expression, an important role is exerted by p53 . Interestingly mir-145 has been reported to repress c - myc in response to the p53 pathway reinforcing its identification in our emt signature . Similarly, members of mir-34 family are known to be direct transcriptional targets of p53 and p53-binding sites are localized on the mir-34 gene promoter . However, christoffersen et al . Demonstrated that mir-34a is capable of repressing c - myc in a p53 independent manner . This suggests that, beside the cross talk between p53 and c - myc, there are additional mechanisms that contribute to fine tuning of the role of c - myc in tgf-- and wnt - dependent emt . From this perspective, a crucial outcome of deregulated myc signalling lal et al . Have shown that mir-24 directly targets myc, suggesting that this mir could potentially play an interesting role in emt modulation . To support this hypothesis, mir-24 has also been recently shown to regulate the emt program in response to tgf- in breast cancer cells . Papadimitriou et al . Have demonstrated that mir-24 is capable of modulating tgf--induced breast cancer cell invasiveness through regulation of rhoa - specific guanine nucleotide exchange factor net1 isoform2 (net1a), a protein that is necessary for tgf--mediated rhoa activation . The last mir included in the group of those targeting c - myc is mir-21 . Singh et al . Have suggested that mir-21 regulates self - renewal in mouse embryonic stem (es) cells and could potentially interact with myc and other self - renewal markers (oct4, nanog, and sox2). They have shown that enforced expression of mir-21 in es cells downregulates renewal markers, including c - myc . This suggests that in specific contexts modulation of mir-21 could potentially affect c - myc expression and therefore modulate e - cadherin levels and affect emt . Finally, in the previous paragraphs we have described the role of mir-155 as an interesting player capable of disrupting the tumor - promoting effects of smad - dependent and smad - independent tgf- signalling . Interestingly, in our analysis we identified another group of 4 mirs linked to tgf- signalling and belonging to the mir-17 - 92 cluster (i.e., mir-19a, mir-19b, and mir-92a) and to its paralog cluster mir-106b-25 (i.e., mir-93). Interestingly, c - myc has been reported to upregulate the mir-17 - 92 cluster, providing further evidence of cross talk between wnt and tgf- signalling . Dews et al . Performed a detailed study to elucidate the mechanism of interaction between the mir-17 - 92 cluster and tgf- signalling, particularly with smad4 . Using qpcr and microarray analyses they provide evidence suggesting that mir-19a, mir-19b, and mir-92a regulate smad4 indirectly, that is, without interacting with the smad4 3utr . As mentioned above, ep300 (p300) and crebbp (creb - binding protein, cbp) are the only two kegg pathway genes shared among all three pathways (i.e., tgf-, wnt, and notch). Ep300 and crebbp are functionally related transcriptional coactivator proteins that play many important roles in processes including cell proliferation, differentiation, and apoptosis . In the context of wnt signalling, ep300 has been shown to act synergistically with -catenin and t cell factor (tcf) during neoplastic transformation . Similarly, in the context of tgf- signalling, it has been reported that phosphorylated smad3 interacts with the crebbp / ep300 complex to augment transcriptional activation . Additionally, the notch intracellular domain (nicd) can recruit the complex crebbp / ep300 to interact with the transcription factor csl (cbf1/su(h)/lag-1) which, in turn, activates the transcription of two known notch related basic - helix - loop - helix transcription factor families, hey and he s . Ep300 and crebbp were originally identified in protein interaction assays through their association with the transcription factor creb and with the adenoviral - transforming protein e1a, respectively [6870]. The roles of crebbp and ep300 and their interaction during emt have been extensively studied . However, the large degree of cellular heterogeneity within different organs and tissues makes the role of ep300 in emt difficult to define with precision . Strikingly, some reports have linked the expression of wild - type ep300 in colorectal and prostate cancer with the degree of intravascular dissemination of cancer cells (probably affected by ongoing emt) and poor prognosis [7274]. In this context, ep300 seems to promote cancer cells emt . In support of this, elevated expression of ep300 in hepatocellular carcinomas (hcc) correlates with enhanced vascular invasion, intrahepatic metastasis, shortened survival, and, strikingly, low e - cadherin expression . Ep300 knockdown strongly increased e - cadherin expression and significantly decreased migration and invasion in a hepatoma cell line (hle) that is otherwise highly invasive and poorly differentiated . In the context of cancerous hepatocytes, tgf- is one factor that plays a major role in the induction of emt, causing type i collagen induction and formation of liver fibrosis . In this situation, ep300 interacts with smad3 and functions as signal integrator for mediating regulation of collagen synthesis by tgf- . Treatment with hdac inhibitor strongly decreases ep300 levels and restores e - cadherin distribution to the hepatocytes cell membrane therefore reducing tgf--induced emt . As outlined above, targeting the expression of ep300 and/or crebbp can simultaneously affect tgf-, wnt, and notch pathways . In this regard, mir-9, which is represented in our 30-mir signature, was shown to target ep300 as determined by microarray analysis (figure 3). Remarkably, mir-9 has also been shown to be involved in the modulation of e - cadherin levels via c - myc . More specifically, ma et al . Have shown that myc acts as a transcriptional activator of mir-9 and that mir-9, in turn, directly targets e - cadherin . Therefore, not only is mir-9 one of the common mirs linking tgf-, wnt, and notch signalling but also it has the ability to target e - cadherin which links it directly to emt . Thus, it appears that mir-9 might represent an interesting regulator of the cross talk between tgf-, wnt, and notch signalling pathways in both normal cells and cancer cells . On one hand, through its effect on e - cadherin and ep300, mir-9 may maintain the balance between epithelial and mesenchymal cell state in normal cells . On the other hand, in cancer cells that have lost the tumor suppressive effect of tgf-, the disruption of the tgf- cytostatic program could cause c - myc induced upregulation of mir-9 leading to loss of e - cadherin and subsequent emt . Have further shown that, in the context of notch signalling, in addition to its connection with ep300, mir-9 also interacts directly with hes1 . This reinforces the hypothesis that mir-9 represents an interesting regulator of the notch signalling pathway with a role in the cross talk between tgf-, wnt, and notch . Regulation of the crebbp / ep300 complex by mir-9 represents an interesting mechanism of coregulation of tgf-, wnt, and notch signalling pathways . In this regard, it is interesting to note that we identified another group of 5 mirs (mir-26b, mir-194, mir-182, mir-374, and mir-324) that also were shown to interact with ep300 and crebbp by microarray . Among these, have shown that mir-26 is strongly downregulated in ht-29 colon cancer cells undergoing tgf--induced emt, whereas ragan et al . Have described an interaction between mir-324 and crebbp by transcriptomic analysis [48, 82]. Moreover, interestingly in our analysis we have also identified mir-1, that has been shown to interact with ctbp1/2, two proteins that bind to the c - terminus of adenovirus e1a protein and act as corepressors of notch target genes (figure 3). As discussed above, there is a connection between mir-324 and dvl2 in the context of wnt signalling and colon cancer [48, 49]. In particular, in the context of colon cancer, the cascade of events that drives tumor progression is characterized by series of genetic modifications involving components of the wnt and tgf- signalling pathways . In colon cancer, the adenoma - carcinoma sequence is initiated by alteration in wnt signalling (i.e., inactivation of apc). Subsequently, the late stage adenoma shows loss of 18q - arm, where it maps the best candidate tumor suppressor gene dpc4/madh4, which encodes smad4, involved in the tgf- pathway . This event drives the progression from the intermediate adenoma stage to late adenoma, resulting in loss of the cytostatic effect of tgf-. Strikingly, the interaction between -catenin and the tgf- pathway depends on the transcriptional coactivator crebbp as demonstrated by zhou et al . Who used chromatin immune precipitation to show that a complex forms between smad3, -catenin, and crebbp . These findings together with the identification of ep300 and crebbp in our analysis suggest that mir-26 and mir-324 may link tgf- and wnt signalling with emt in colon cancer progression . Recent studies have indicated that the switch in tumor cells from a sessile, epithelial phenotype towards a motile, mesenchymal phenotype is accompanied by the acquisition of stem / progenitor cell characteristics . In particular, cells undergoing emt acquire chemoresistance, a key property attributed to cancer stem cells (cscs). The mir-200 family includes mir-200c-3p, mir-200b-3p, and mir-429 (all identified in our analysis) and inhibits emt and cancer cell migration by directly targeting the e - cadherin transcriptional repressors zeb1 and zeb2 . Additionally, downregulation of mir-200 family has been described in docetaxel resistant prostate cancer cells, reinforcing the link between emt and resistance to chemotherapy . Mizuguchi et al . Have shown that acetyltransferase ep300 regulates expression of mir-200c-3p overcoming its transcriptional suppression by zeb1 . The same authors showed that treatment with an hdac inhibitor significantly increased mir-200c-3p levels causing a decrease in vimentine and zeb1 and upregulation of e - cadherin . Strikingly, mir-200c-3p, mir-200b-3p, and mir-429 have also been shown to interact with ep300 by microarray and protein analysis . These observations enhance the complexity of the regulatory mechanisms governing the interplay between ep300 and e - cadherin and suggest a positive feedback loop between mir-200 family and ep300 . The inhibitory effect of zeb1 on mir-200 could be attenuated by ep300 which upregulates mir-200 expression . Furthermore, higher levels of mir-200 could decrease zeb1, suggesting that the positive effect of ep300 on e - cadherin expression could also be mediated via mir-200 family (figure 3). In this review, we discussed and summarized the known interactions between mirs and genes involved in tgf-, notch, and wnt signalling pathways and highlighted a signature of 30 validated mirs linking these pathways to the process of emt . Our novel approach led to the identification of a cluster of validated and known mirs involved in different pathways in an attempt to reduce the extraordinary volume of information related to the interaction between mirs and different target genes . We believe that the identification of groups of genes targeted by the same mir and the clustering of these genes in different pathways could potentially represent an interesting strategy to better understand the cross talk between multiple signalling networks, thus facilitating the understanding of their connections and their role in a common biological process.
Dengue infection causes various clinical symptoms ranging from mild fever to severe hemorrhagic fever and dengue shock syndrome [13]. The virus uses host cell ribosomes to translate its genomic rna to full - length precursor polyprotein . Subsequently, the host cell furin and dengue ns2b - ns3 serine protease (ns2b - ns3pro) cleave viral polyprotein at various regions to produce structural and nonstructural viral proteins [46]. The ns3 protein is one of the viral non - structural proteins that possess enzymatic activities . The n - terminal of this protein contains 180 amino acid residues that represent ns3 protease [7, 8], while c - terminal region contains amino acid residues that represent rna helicase and rna - stimulated ntpase [9, 10]. The activity of ns2b - ns3pro depends on the interaction with its cofactor ns2b to form a ns2b - ns3pro complex . It has been found that the disruption of ns2b - ns3pro functions inhibits viral replication . Therefore, ns2b - ns3pro is considered as a potential target for the design of antiviral drugs . At present, a legitimate vaccine or treatment to prevent or to cure this disease is unavailable . These facts emphasize the need for a better understanding of the mechanism of viral infection and propagation in the host cell to combat this disease . Recently, computational studies indicated that cationic cyclic peptides have potential inhibition towards dengue ns2b - ns3pro [15, 16]. Protegrin-1 (pg-1, rggrlcycrrrfcvcvgr) is an eighteen amino acids cationic cyclic peptide with high content of basic residues and two disulphide bonds . The peptide is originally isolated from porcine white blood cells and considered as an antibiotic agent against a broad range of microorganisms [17, 18]. The formation of two disulphide bonds between cysteine residues endows pg-1 with a stabile -hairpin secondary structure that is crucial for antimicrobial activity [19, 20]. Therefore, removal of these two disulphide bonds is found to noticeably reduce the antimicrobial activity of pg-1 . The peptide is able to penetrate and disrupt the cell membrane by homodimerization [22, 23]. The mechanism of this activity depends on the secondary structure and the cationic nature of pg-1 molecules which are essential to generate pores in the cell membrane of microorganism [2427]. In this study, our objective was to examine the efficacy of pg-1 as cationic cyclic peptide to inhibit dengue serine protease and subsequently reduce viral replication in host cells . The linear peptides were prepared by automated peptide synthesis using symphony parallel synthesizer (protein technologies, tucson, az, usa) by standard solid - phase peptide synthesis . The lyophilized peptide was dissolved in 20% dmso solution in a round bottom flask and stirred on a magnetic stirrer to produce a peptide concentration of 1.1 mm . The formation of the first disulphide bond was completed within 24 hrs . The solution was then lyophilized to proceed for second disulfide formation . The lyophilized peptide with the first disulphide bond was dissolved in acetic acid water (4: 1) so that the peptide concentration was 1.2 mm and iodine (10 equivalents) was added in one portion . The reactions were stirred at 25c for 60 min and then quenched by diluting with water and extracting with ccl4 to remove excess iodine . Purification of crude cyclised peptide was accomplished by rp - hplc (agilent 1200 series). The identity of the purified peptide with 98% purity was confirmed by lc - ms (shimadzu lc / ms 2020, single quad). To produce single chain protease nsb2- (g4-t - g4)-ns3, the ns2b fragments were amplified individually by pcr using the primer pairs ns2b - f (5-atactgaggatcc gccgatttggaactg-3) and ns2blinker - r (acctactaggtacctcctccacccagtgtctgttcttc). The ns2b - ns3 was amplified by ns3linker - f (5-atctataggtaccggcggtggaggtgctggagtattgtgg-3) and ns3-r (5-agcataagcttaagcttcaattttct-3). The linker sequence was added to ns2blinker - r and ns3linker - f primers which included the site for kpni restriction enzyme (all restriction sites are underlined). The pcr product of ns2b fragment was digested with bamhi and kpni while ns2b fragment was digested with kpni and hindiii . Purified fragments were cloned into pqe30 plasmid downstream of 6his tag . The escherichia coli x - the recombinant e. coli was inoculated in luria - bertani liquid medium (1% tryptone, 1% nacl, 0.5% yeast extract, w / v, ph 7.0) supplemented with 100 mg / l ampicillin and cultured overnight at 37c . In brief, 10 ml of overnight grown culture was added to 1000 ml of medium and incubated with shaking at 37c until the optical density at 600 nm reached 0.5 . Subsequently, isopropylthio--d - galactoside (iptg) was then added to a final concentration of 0.5 mm and the bacteria were cultured for an additional 5 hrs at 37c in a shaking incubator to induce protein expression . Finally, bacterial cells were harvested by centrifugation at 4000 rpm for 15 min at 4c . The recombinant ns3pro was produced as soluble proteins and, therefore, the purification had been performed by his gravitrap flow precharged ni sepharose 6 fast column (amersham biosciences, usa) according to the manufacturer's instructions . In brief, the column was normalized with phosphate buffer (20 mm sodium phosphate buffer and 500 mm nacl, ph 7.4). The sample was loaded into the column and the column was washed with binding buffer (phosphate buffer containing 20 mm imidazole, ph 7.4). The recombinant protein was eluted with elution buffer (phosphate buffer containing 200 mm imidazole, ph 7.4). The bioassay used in this study was modified from the method published by kiat and coworkers . These reaction mixtures consisted of 100 m fluorogenic peptide substrate (boc - gly - arg - arg - mca), 2 m ns2b - ns3pro complex, with or without pg-1 of varying concentrations, buffered at ph 8.5 with 200 mm tris - hcl . The pg-1 was initially prepared in tris - hcl buffer and assayed at five different concentrations . Subsequently, the substrate was added and the mixture was further incubated at the same temperature for 30 minutes . Triplicates were performed for all measurements and the readings were taken using tecan infinite m200 pro fluorescence spectrophotometer . Substrate cleavage was optimized at the emission at 440 nm upon excitation at 350 nm . The readings were then used for calculating km values of peptide substrate and ic50 values of peptide inhibitors using nonlinear regression models in graphpad prism 5.01 software . The mk2 cell lines were seeded at 1 10 cells per well in triplicate at optimal conditions (37c, 5% co2 in humidified incubator) in 96 well plates . Pg-1 was diluted to serial concentrations 2.5, 12.5, 25, 50, 100 and 200 m with dmem media supplemented with 2% fbs . The cell culture was analyzed at 24, 48 and 72 hours using nonradioactive cell proliferation assay (promega, usa) according to the manufacture protocol . The mk2 cell lines were grown in a 24-well tissue culture plate (1 10 cells / well), incubated 24 hrs under optimal conditions (37c and 5% co2). Denv-2 was added to the wells (moi of 2) followed by incubation for 1 hr with gentle shaking every 10 min for optimal virus to cell contact . The virus supernatant was removed, and the cells were washed twice with fresh serum free dmem media to remove residual virus . New complete dmem media containing 2.5, 7.5 and 12.5 m of pg-1 were added and the cultures were incubated for 24, 48 and 72 hrs . Afterwards, cellular supernatants were collected and stored at 80c for viral quantification by real - time pcr . For quantification of denv-2 copies, the standard curve was generated by 10-fold serial dilution of known copies of denv-2 rna . Viral rna was extracted from culture supernatant using qiamp viral rna minikit (qiagen, germany) according to the manufacturer's instructions . A fragment located at the 5utr region of the virus genome one - step rt - pcr using sybr green master kit (qiagen, germany) was used to conduct absolute quantification using abi7300 machine from applied biosystems (foster city, ca). The pcr programme included 1 cycle of 50c for 2 min, 1 cycle of 95c for 10 min, and 40 cycles of 95c for 15 sec and 60c for 1 min . Results were analyzed using sequence detection software version 1.3 (applied biosystems, foster city, ca, usa). All the assays were done in triplicates and the statistical analyses were performed using graphpad prism version 5.01 (graphpad software, san diego, ca). The recombinant ns2b - ns3pro was produced as a soluble protein in e. coli and purified by nickel column (figure 1(a)). Further purification was applied using gel affinity chromatography to achieve more than 95% of enzyme purity (figure 1(b)). The activity of purified enzyme had been assessed at 37c by catalyzing the fluorogenic peptide substrate t - butyloxycarbonylglycyl - l - arginyl - l - arginyl - l-4-methylcoumaryl-7-amide (boc - gly - arg - arg - mca). The pg-1 peptide was added to the protease reaction at different concentrations and the inhibition profile was plotted as shown in figure 2 . It was observed that the inhibition potential increased with pg-1 concentration and the highest inhibition (95.7%) with low concentrations of pg-1 was at 40 m . The kinetic assay study indicated that pg-1 competitively inhibited ns2b - ns3pro activity (alpha value 3.14) with ki value 5.85 m (table 1). Intriguingly, the maximum enzyme velocity decreased threefold when pg-1 concentration was 20 m (figure 3). Previous studies have shown that various types of natural and chemical compounds were able to inhibit dengue ns2b - ns3pro activity . For example, some of plant natural compounds, such as chalcones, have shown good inhibition potential against the dengue protease (ki value 2125 m). The synthesized peptidic -keto - amide compound inhibited dengue ns2b - ns3pro with ki value of 47 m . Most recent study indicated that the retrotripeptides with an arylcyanoacrylamide group as n - terminal cap exhibited high inhibition potential against dengue protease with ki value of 4.6 m . Most recent study showed that the inhibition potential of some chemical compounds towards ns2b - ns3pro measured by ic50 was 15.4, 20.4, and 27.0 m . Cytotoxicity and compound stability can be considered as major limitations of the practical application of protease inhibitors . In this study, to test pg-1 toxicity, mk2 cell lines were incubated with increasing concentrations of pg-1 for 24, 48, and 72 hrs . The pg-1 peptide showed toxic effect against mk2 cell lines at concentrations greater than 12.5 m (figure 4). Other studies indicated that pg-1 was also toxic to 293a cell lines (human embryonic kidney cells) at 50 g / ml (25 m) and more than 50% of human red blood cells lyses were observed at 80 g / ml (40 m). Therefore, three concentrations at nontoxic range were used to test pg-1 stability and ability to reduce dengue viral replication in mk2 cell lines . The results showed that the viral copy number significantly (p <0.001) reduced with increasing concentrations of pg-1 (figure 5(a)). Furthermore, the highest inhibition percentage was observed when the pg-1 concentration was 12.5 m at 24, 48 and 72 hrs (figure 5(b)). However, the low concentrations exhibited less inhibition percentage at 48 and 72 hrs as compared with 24 hrs, indicating that the pg-1 stability declined with longer incubation in culture media (figures 5(a) and 5(b)). Similarly, it has been showed that at low doses (4 g / ml), pg-1 has significant in vitro antimicrobial activity with low in vivo toxicity (up to 8 mg / kg i.v . This may be accounted by its short half - life in vivo as its level in mice plasma that was injected with 4 mg / ml i.v although pg-1 showed significant inhibition profile towards dengue virus in this study and to human immunodeficiency virus 1 (hiv1) in another study, the peptide instability should be considered as a major concern . The results in this study may give a clear picture that would then help in engineering new sequence of peptides to retain the antiviral activity against dengue while increasing its stability and eliminating the toxic characteristics of pg-1.
Bronchial atresia resulting from a localized defect in normal bronchopulmonary embryogenesis is a rare disease . It can produce emphysematous changes in the affected pulmonary segment or lobe with or without dyspnea and/or episodic pulmonary infection . We herein report a case of bronchial atresia associated with pneumothorax which was successfully treated with lobectomy . A 32-yr - old korean male patient was admitted to inha university hospital, incheon, korea due to dyspnea and right chest pain for 1 day . On physical examination, the breath sound in the right lung fields was decreased without shifting of the maximal point of the cardiac impulse . He had a history of the right pneumothorax one and a half years ago, which was treated with tube thoracostomy . The posteroanterior chest radiograph revealed increased radiolucency along with overinflated lung parenchyma and sparse vasculature in the upper half of the right lung . The chest ct taken in the state of full expansion of the right lung after tube thoracostomy showed a branching soft tissue density in the region of the posterior segment of the right upper lobe . The orifice of the posterior segmental bronchus was visualized but the orifice of the subsegmental branch of the posterior segmental bronchus could not be visualized separate from the origin (fig . 2). There were no endobronchial lesions in the bronchial tree on the bronchoscope and each orifice of the segmental bronchi of the right lung was seen normal . His forced expiratory volume at 1-sec (fev1) was 3.49 l (91%) and forced vital capacity (fvc) was 4.57 l (100%). There was a localized emphysematous change in the posterior segmental area of the right upper lobe with the apical pleural adhesion and the remaining lungs were normal . The pathological findings of the resected right upper lobe showed overinflation of the posterior segment . There were no obstructed lesions of the orifices of the three segmental bronchi of the right upper lobe . However, one of the subsegmental branch of the posterior segmental bronchus was obstructed and there was a 2.51.51.5 cm sized cystic mass containing brownish mucus material at the distal portion of the obstructed subsegmental bronchus . Microscopically the distal air spaces of the atretic segmental bronchus showed overinflation only . However the foci of the subpleural bullae in the overinflated segment were observed (fig . Bronchial atresia is a rare disease, which develops due to the failure of embryogenesis of the segmental or lobar bronchial tree . Since the first report of bronchial atresia by ramsay et al . In 1953, there have been many illustrations and reports about bronchial atresia (1 - 8). According to the reports, most of the patients with bronchial atresia were asymptomatic and it was diagnosed incidentally in the second or third decade of life on routine chest radiography (2 - 4). The common radiographic findings of bronchial atresia are hyperinflation of the involved lung parenchyma and collapse of the affected lobe with a radioopaque extrahilar mass with mucocele in patients who had pulmonary symptoms such as fever, cough, and shortness of breath due to recurrent pulmonary infection or overinflation of the involved lung parenchyme (3, 4, 6, 8). However, bronchial atresia associated with pneumothorax is extremely rare in spite of overinflation of the involved lung parenchyma . We report a case of bronchial atresia in the subsegmental branch of the posterior segmental bronchus of the right upper lobe associated with mucocele and recurrent spontaneous pneumothorax, which was treated with right upper lobectomy . The resected specimen showed atresia of the subsegmental branch of the posterior segmental bronchus of the right upper lobe with hyperinflated lung with subpleural bullae . The cause of pneumothorax was thought to be due to the rupture of the bulla in the hyperinflated lung segment . The exact mechanism of bulla formation of the affected lung parenchyma could not be proved . However, we think the bullous change have been resulted from mechanical stress to the alveoli wall from hyperinflation of the lung parenchyma distal to the atretic bronchus due to aeration by check - valve mechnanism through the collateral channels of the interalveolar pores of kohn and bronchoalveolar channels of lambert.
Nonalcoholic steatohepatitis (nash) is a progressive form of non - alcoholic fatty liver disease (nafld). The pathogenesis of nash is multifactorial, indicating a significant association with inflammation . In its severe form, nash can lead to cirrhosis, with permanent liver damage (1, 2). Patients with nash show significantly higher serum levels of tumor necrosis factor - alpha (tnf-) and interleukin-6 (il-6), compared with patients with simple steatosis (3). Tumor necrosis factor - alpha is produced by several types of inflammatory cells and tissues, such as monocytes, macrophages, neutrophils, endothelial cells, neuronal tissue, t cells, hepatocytes, and kupffer cells (4). The tnf- is significantly involved in the development of nash and nafld in animal models and humans (5 - 8). Interleukin-6 plays a pivotal role in liver pathology and synthesis of acute phase proteins, such as c - reactive protein and serum amyloid a (9). On one hand, il-6 can improve liver regeneration in il-6 knockout mice with diet - induced nash and, on the other hand, it can promote hepatocyte apoptosis in patients with nash (10 - 12). Interleukin 8 (il-8) is produced by peripheral blood mononuclear cells, macrophages, and infiltrated lymphocytes . (13) reported that il-8, alanine aminotransferase (alt), age, and adiponectin were independently associated with nash . Pentoxifylline (ptx) is a methylxanthine derivative and an antitnf- agent, which is reportedly administered for the treatment of nash . It can decrease the production of several pro - inflammatory cytokines, including tnf- and shows anti - inflammatory properties, through the inhibition of nuclear factor - kappa b (nf-b) (14 - 16). The results of several studies, involving the use of ptx in patients with nash, have shown the effect of ptx in nash . Published studies have several limitations, due to variation in characterization of patients, such as those with biopsy - proven nash or nash based on sonography and alt and aspartate transaminase (ast) levels . Differences in study designs, such as prospective cohort studies, with control group, or randomized and controlled trials and, also, difference in sample size are other reasons for different findings of studies on the effects of ptx, in patients with nash (17 - 24). The primary aim of this study was to evaluate the effectiveness of ptx for 6 months, in a randomized, double - blind, placebo - controlled clinical trial, in patients with nash, in the city of kerman, in south - eastern iran . The other aims were to assess the effect of ptx on the serum levels of alt, ast, tnf-, il-8, and il-6 in patients with nash . Thirty patients with nash were recruited at the kerman university of medical sciences, besat clinic, kerman, south - eastern iran . Written informed consent was obtained from each participant in the study and the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki . Patients were considered for the study if they had a diagnosis of nash, based on sonography, and a 1.5-fold mean change from baseline of ast and alt levels . Patients were excluded if they had a past history of excessive alcohol consumption or any cigarette smoking or narcotics use . Patients with hypertension (140/90 mmhg) and those who tested positive for hepatitis c virus or hepatitis b virus infection were also excluded . Additionally, patients were excluded if they had high serum levels of alpha-1-antitrypsin, ceruloplasmin, anti - smooth muscle antibody, and antinuclear antibody . Patients were also excluded if they were taking anti - hypertensive, anti - hyperlipidemic, anti - hyperglycemic medications, or amiodarone or oral contraceptive pills . Patients who were suffering from acute or chronic liver disease were excluded before and during the intervention . The study was designed as a randomized, double - blind, placebo - controlled trial . The study protocol was approved by the ethics committee of kerman university of medical sciences, kerman, iran . The study was designed for 30 patients; 15 patients (frequency: male = 80%, female = 20%, age = 35.7 6.6 years) in the intervention group, who received a ptx dose of 400 mg thrice a day, for 6 months, and 15 patients (male = 80%, female = 20%, age = 39.4 9.4 years) in the placebo group, who received a placebo for 6 months . All patients attended the gastroenterology clinic, at afzalipour hospital, and were given advice concerning low calorie diet and the importance of daily exercise by a resident in gastroenterology . There were no differences with regard to shape, taste, and color between the placebo and ptx . The placebo and ptx were labeled by an unblinded pharmacist, as a and b, respectively, before random allocation to the patient . Patients, the medical examiner, laboratory and pharmacy staff did not know the nature of the drugs . On completion of data collection, statistical analysis was performed by a statistician who was unaware of the nature of the compounds represented by a and b. fifteen untreated healthy subjects were enrolled to determine the serum levels of cytokines, to present a cut - off point when comparing with that of the patients . Demographic data for the 15 controls were as follows: males = 36%, females = 64% the healthy controls, selected from kerman blood transfusion centre, kerman, iran, had no history of systemic or organ specific autoimmune diseases, allergy, infectious diseases, cancer, and metabolic disorders . Laboratory studies were performed to measure levels of ast and alt, in patients with nash, at the baseline, 3 months, and 6 months . The serum levels of il-6, il-8, and tnf- were also measured in patients at baseline and 6 months . Weight and height of the patients were measured, to determine body mass index (bmi) at baseline and during the clinical trial at 3 and 6 months . The height of placebo and intervention groups at baseline, 3 months and 6 months was 171.2 9.8 and 172.8 7.2, respectively . The weight of the placebo group at baseline, 3 months and 6 months was 82.2 13, 80.2 13 and 77.7 13.1 kg, respectively, and the weight of the intervention group at baseline, 3 months and 6 months was 80.8 12.5, 78.2 13.1 and 73.9 12.7 kg, respectively . Sampling lasted 6 months . During this period, five patients in the intervention group stopped treatment, four of which because of adverse effects and one for personal reasons . Nine patients in the placebo group stopped treatment, five of which because of problems similar to adverse effects of ptx and four for personal reasons . Liver aminotransferases, including alt and ast, were measured for patients with nash by enzymatic photometry . Serum levels of il-6, il-8, and tnf- were determined for patients with nash and healthy controls by an enzyme - linked immunosorbent assay (elisa) technique, according to the manufacturer s instructions (bosterbio, pleasanton, ca, usa). According to the previous study (18), by considering alpha error of 5% and the power of 90% and also employing the formula for two - sample comparison of means, the sample size was calculated to be nine, for each group . Statistical analyses, such as descriptive statistics, repeated measurement test, one - way anova, and independent t - test were performed by spss software version 17.0 (spss inc ., thirty patients with nash were recruited at the kerman university of medical sciences, besat clinic, kerman, south - eastern iran . Written informed consent was obtained from each participant in the study and the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki . Patients were considered for the study if they had a diagnosis of nash, based on sonography, and a 1.5-fold mean change from baseline of ast and alt levels . Patients were excluded if they had a past history of excessive alcohol consumption or any cigarette smoking or narcotics use . Patients with hypertension (140/90 mmhg) and those who tested positive for hepatitis c virus or hepatitis b virus infection were also excluded . Additionally, patients were excluded if they had high serum levels of alpha-1-antitrypsin, ceruloplasmin, anti - smooth muscle antibody, and antinuclear antibody . Patients were also excluded if they were taking anti - hypertensive, anti - hyperlipidemic, anti - hyperglycemic medications, or amiodarone or oral contraceptive pills . Patients who were suffering from acute or chronic liver disease were excluded before and during the intervention . The study was designed as a randomized, double - blind, placebo - controlled trial . The study protocol was approved by the ethics committee of kerman university of medical sciences, kerman, iran . The study was designed for 30 patients; 15 patients (frequency: male = 80%, female = 20%, age = 35.7 6.6 years) in the intervention group, who received a ptx dose of 400 mg thrice a day, for 6 months, and 15 patients (male = 80%, female = 20%, age = 39.4 9.4 years) in the placebo group, who received a placebo for 6 months . All patients attended the gastroenterology clinic, at afzalipour hospital, and were given advice concerning low calorie diet and the importance of daily exercise by a resident in gastroenterology . There were no differences with regard to shape, taste, and color between the placebo and ptx . The placebo and ptx were labeled by an unblinded pharmacist, as a and b, respectively, before random allocation to the patient . Patients, the medical examiner, laboratory and pharmacy staff did not know the nature of the drugs . On completion of data collection, statistical analysis was performed by a statistician who was unaware of the nature of the compounds represented by a and b. fifteen untreated healthy subjects were enrolled to determine the serum levels of cytokines, to present a cut - off point when comparing with that of the patients . Demographic data for the 15 controls were as follows: males = 36%, females = 64% . The healthy controls, selected from kerman blood transfusion centre, kerman, iran, had no history of systemic or organ specific autoimmune diseases, allergy, infectious diseases, cancer, and metabolic disorders . Laboratory studies were performed to measure levels of ast and alt, in patients with nash, at the baseline, 3 months, and 6 months . The serum levels of il-6, il-8, and tnf- were also measured in patients at baseline and 6 months . Weight and height of the patients were measured, to determine body mass index (bmi) at baseline and during the clinical trial at 3 and 6 months . The height of placebo and intervention groups at baseline, 3 months and 6 months was 171.2 9.8 and 172.8 7.2, respectively . The weight of the placebo group at baseline, 3 months and 6 months was 82.2 13, 80.2 13 and 77.7 13.1 kg, respectively, and the weight of the intervention group at baseline, 3 months and 6 months was 80.8 12.5, 78.2 13.1 and 73.9 12.7 kg, respectively . Sampling lasted 6 months . During this period, five patients in the intervention group stopped treatment, four of which because of adverse effects and one for personal reasons . Nine patients in the placebo group stopped treatment, five of which because of problems similar to adverse effects of ptx and four for personal reasons . Liver aminotransferases, including alt and ast, were measured for patients with nash by enzymatic photometry . Serum levels of il-6, il-8, and tnf- were determined for patients with nash and healthy controls by an enzyme - linked immunosorbent assay (elisa) technique, according to the manufacturer s instructions (bosterbio, pleasanton, ca, usa). According to the previous study (18), by considering alpha error of 5% and the power of 90% and also employing the formula for two - sample comparison of means, the sample size was calculated to be nine, for each group . Statistical analyses, such as descriptive statistics, repeated measurement test, one - way anova, and independent t - test were performed by spss software version 17.0 (spss inc ., the mean ages of the patients in the intervention and placebo groups were 35.7 and 39.4 years, respectively . The difference between the two groups, concerning age, was insignificant (p = 0.220). The means of bmi in the intervention and placebo groups were 26.9 and 26.6, respectively, and the difference was statistically insignificant (p = 0.912). Data regarding laboratory parameters and ultrasonography of the liver, for patients with nash are presented in table 1 . The levels of ast and alt, measured at the baseline, 3 and 6 months, are presented in table 2 . Results in table 2 were presented after repeated measure anova with greenhouse - geisser correction . Post - hoc tests were performed to obtain mean studied parameters between time points and results were statistically significant after bonferroni correction . Abbreviations: alt, alanine transaminase; ast, aspartate transaminase; bmi, body mass index . Significant difference was detected from comparison between the baseline and 3 months and also between the baseline and 6 months . There was no significant difference with regard to the serum level of alt, between the placebo and intervention groups, at baseline (p = 0.217), at 3 months (p = 0.446) or at 6 months (p = 0.236). Similarly, no significant difference was observed in the serum level of ast between the groups, at baseline (p = 0.701), at 3 months (p = 0.857) or at 6 months (p = 0.125). The bmis obtained at baseline, 3 and 6 months, are presented in table 2 . There was no significant difference in term of bmi between the groups, at baseline (p = 0.912), at 3 months (p = 0.346), and at 6 months (p = 0.391). The serum levels of il-6, il-8, and tnf-, as mean sd, in healthy controls, were 6.3 3.9, 18.0 7.5, and 16.8 11.3 pg / ml, respectively . Levels of these cytokines were significantly higher in patients with nash, compared with healthy controls . Serum levels of these cytokines were unchanged between baseline and 6 months in the intervention and placebo groups, with the exception of il-8, where a statistically lower level in the intervention group at baseline had increased at 6 months (table 3). Abbreviations: il-6, interleukin 6; il-8, interleukin 8; tnf, tumor necrosis factor . Most clinical trials on the effect of ptx in patients with nash have sufficed to compare the cytokine levels in the intervention and placebo groups, without including the healthy controls . In the present study, patients with nash had significantly higher serum levels of il-6, il-8, and tnf-, as compared to healthy individuals, which confirmed the important role of inflammation in the pathogenesis and progression of nash (11, 12). In the present study, ptx decreased the serum levels of liver transferases in patients with nash, without any significant differences between the intervention and placebo groups . The results of a study by van wagner et al . Which measured and compared the serum levels of alt, ast, tnf-, and il-6, in patients with nash during 12 months, shows that their intervention versus placebo clinical trial is in accordance with our findings (25). Reported serum levels of liver transferases, as well as serum levels of tnf- and il-6 in patients with nash, which were decreased in intervention and placebo groups in a 3-month, randomized, double - blind, placebo - controlled trial (17). They recommended daily exercise and a low - calorie diet to both the groups and reported no significant difference between the groups, with regard to the serum levels of tnf-, il-6, ast, and alt at the end of the clinical trial . Their results are also in agreement with our findings . However, our findings are in disagreement with the results of another randomized, double - blind, placebo - controlled trial, which was performed by buranawui et al . On 32 patients with nash (26). They reported a significant decrease of alt and ast in the intervention group, as compared to that in the placebo group . They also stated no significant differences in tnf- and bmi between the groups, at the end of a 6-month clinical trial, which is in agreement with our findings . Our results are in disagreement with the findings of zein et al ., who showed that liver fibrosis and the histological features of nash could be improved by ptx administration for one year (27). Georgescu ef and georgescu m carried out a non - randomized and uncontrolled prospective study on an outpatient database to determine the efficiency of several agents, including ptx, for the treatment of nash (19). The bmi, serum levels of alt, glutamyl transpeptidase, alkaline phosphatase, total cholestrol, triglycerides and liver biopsies were determined at baseline and at the end of the treatment . They concluded that ptx showed efficacy in treating non - hypertensive / non - dyslipidemic patients with nash . However, this study did not control for the confounding effect of dietary and lifestyle interventions . Performed a systematic review on the treatment with ptx in patients with nash until june 2010 (28). They extracted their results from six studies, including two randomized, double - blind, placebo - controlled trials and four prospective cohort studies . They showed that the serum levels of ast and alt were significantly decreased in ptx - treated patients . However, there were no significant differences between the serum levels of il-6 and tnf-, in the intervention group, as compared to that in the placebo group . They have suggested performing more well - designed, randomized, controlled clinical trials, with a larger sample size, as well as more prospective observational studies, to investigate the effect of ptx in reducing levels of cytokines . They reviewed all relevant controlled trials of the effect of ptx in patients with nafld / nash from 1997 to july 2013 . Two prospective cohort studies with controls and three randomized, double - blind, placebo - controlled trials were included in their meta - analysis . Their findings indicated that ptx administration results in improved liver function and histological changes, as well as weight loss, in patients with nafld / nash . One study, which was included in their meta - analysis, had a limitation, as the researchers ignored to evaluate the influence of exercise and a low - calorie diet in ptx - treated patients with nash . The small sample size of several trials and low number of trials were other limitations of the meta - analysis . Recently performed a clinical trial to evaluate the effect of ptx on liver aminotransferases, in patients with nafld (30). Although the levels of liver aminotransferases were reduced during the trial in intervention and control groups, their results did not show significant differences between the groups, which are in agreement with our results . The lack of biopsies from the liver of patients with nash, as a gold standard confirmation method, was a limitation in our study . Satapathy et al . Showed that five out of six patients with nash improved histologically and with improved liver aminotransferases, particularly alt, after 12 months of ptx (21). Therefore, they suggested that measurement of liver transferases can be an acceptable criterion for evaluating patients with nash . In general, our results suggest that ptx administration does not significantly help in the treatment of patients with nash . However, other studies show different results and it might be premature to draw conclusions about the efficacy of ptx in the treatment of nash . Hence, we suggest that a further randomized, double - blind, placebo - controlled trial should be performed, with the enrolment of more patients with nash from different races, to confirm the effect of ptx on liver aminotransferases, histological findings, and inflammatory cytokines, in patients with nash . Employment of modern techniques, such as microarray to evaluate and define more inflammatory cytokines genes, which are potentially involved in nash, may help scientists and clinicians to address the efficacy of ptx therapy on inflammation in the future.
The nose is positioned on the center of the face and is significantly anteriorly protruded compared to the other facial structures . Nasal bone fracture is the most common facial fracture, accounting for approximately 40% of all facial fractures . If proper treatment is not provided at an appropriate time, nasal bone fracture may cause not only a change in facial contouring but also complications in the upper airway, and septoplasty or augmentation rhinoplasty could be required due to the patients low functional and aesthetic satisfaction . For nasal bone reduction, general or local anesthesia, open or closed reduction, and the time elapsed until operation after fracture should be considered . These factors may affect patient satisfaction or complications . In the case of non - complex nasal bone fracture, closed reduction under systemic anesthesia is conventionally known to be effective . Accordingly, the authors reviewed the fracture classification, type of anesthesia, reduction type, and time elapsed until operation after fracture in patients who had visited the department of oral and maxillofacial surgery in pusan national university dental hospital and pusan national university hospital due to nasal bone fracture during a period of three years, from 2010 to 2012 . The patients, who were classified according to their age, gender, and cause of fracture according to a specific classification, received the same treatment . The authors conducted a clinical assessment and an analysis of the results for the effective diagnosis and treatment of nasal bone fracture . Of the outpatients and emergency patients who had visited the department of oral and maxillofacial surgery in pusan national university dental hospital and pusan national university hospital during a period of three years, from january 1, 2010 to december 31, 2012, 186 patients who had been diagnosed with nasal bone fracture via physical examination, plain radiograph, and computed tomography were studied retrospectively . Patients age, gender, cause of fracture, fracture severity, concurrent fracture, clinical finding, time elapsed until operation after fracture, and postoperative complications were reviewed . In particular, in the case of postoperative complications, a comparison was performed between nasal bone fracture without and with concurrent facial fracture . Patient information including complications was collected via the patients medical records, phone interview, interview, physical examination, and radiograph examination . Those with a previous history of nasal bone fracture or who had undergone septoplasty, augmentation rhinoplasty, or corrective rhinoplasty were excluded from the study . After computed tomography, hwang et al.s classification method (2006) was used to evaluate the fracture severity based on the deviation or depression degree and the concurrent fracture of the septal bone . Accordingly, the patients were classified according to the following six groups: type i simple, without displacement; type ii simple, with displacement / without telescoping (iia unilateral, iias unilateral with septal fracture, iib bilateral, iibs bilateral with septal fracture); and type iii comminuted with telescoping or depression (fig . All patients except for the type i group underwent closed reduction with external nasal splinting under systemic anesthesia . After surgery, gauze packing and external nasal splinting were maintained for four and seven days, respectively . The patients were followed - up for at least three months to assess the complications, such as fracture recurrence and functional abnormality . The institutional review board of the ethics committee of the pusan national university hospital approved this study (2 - 2014023). Regarding the age distribution, patients in their 20s accounted for the highest proportion, and those in their 40s to 50s accounted for the second highest proportion . However, the number of pediatric patients aged 9 years or below and elderly patients aged 70 years or higher was small . Regarding the gender distribution, most were male in all types (table 1). Regarding the causes of fracture, 61 patients suffered a slip down, which accounted for the highest proportion, followed by collision and fist trauma, in that order . Sports trauma, motorcycle ta and unknown cause were also included in the causes of fracture (table 2). The number of type iia cases (lateral fracture without septal fracture) accounted for the highest proportion . The number of type i cases, which are non - indicative for surgery, followed type iia, while the number of cases of nasal bone fracture with septal fracture was relatively low, and the number of type iii cases (with depression and comminuted fracture) was also low (table 2). The mean time elapsed until operation after diagnosis was 4.1 days, indicating that surgery was performed promptly . In addition, in the case of the defected septal bone or higher classification type, the number of patients who required more than one week until surgery tended to increase, although the number was small . However, no surgery was delayed for more than two weeks . Regarding adjacent fractures that occurred together with nasal bone fracture, 32 patients had orbital blow - out fracture (bof), which accounted for the highest proportion . Zygomaticomaxillary complex (zmc) fracture and mandible fracture accounted for the second and third highest proportions, respectively . Regarding the frequency of accompanying fracture by nasal bone fracture type, accompanying fracture occurred most frequently in type i. regarding the rate of accompanying fracture, the highest rate was 63% in type iib . However, the overall rate of accompanying fracture was 38.7%, which was relatively low (table 3, fig . The complication types were classified according to esthetic deformity, hyposmia, and hypoesthesia following yang et al ., in addition to obstruction and pain, but rhinorrhea was excluded because there were no appropriate patients . The esthetic deformity type included depression, deviation as well as ecchymosis, bruise, swelling, and scar formation . Early type, which occurred between one week after surgery and one month after surgery, and the late type, which occurred since one month after surgery and then followed - up regularly for at least three months after surgery . Of the patients, except for those who refused surgery and type i patients who were non - indicative for surgery, the esthetic deformity type of complications included six early cases and four late cases . Regarding deformity, among type iia or iias patients, no one complained of deviation or depression, while three of six early cases and two of four late cases were observed in type iib and iibs patients . Two of four late complications had a symptom of scar formation only, and other acute complications were ecchymosis or bruise . Regarding pain, six early cases and three late cases were observed, which accounted for the highest proportion of all complications . Pain was evenly observed by type, but its frequency tended to be slightly higher in type iii patients . Regarding hypoesthesia, an early case was observed in type iias and iii patients, respectively . Regarding hyposmia, an early case was observed in type iibs and iii patients, respectively (fig . 3, 4). Regarding the age distribution, patients in their 20s accounted for the highest proportion, and those in their 40s to 50s accounted for the second highest proportion . However, the number of pediatric patients aged 9 years or below and elderly patients aged 70 years or higher was small . Regarding the gender distribution, most were male in all types (table 1). Regarding the causes of fracture, 61 patients suffered a slip down, which accounted for the highest proportion, followed by collision and fist trauma, in that order . Sports trauma, motorcycle ta and unknown cause were also included in the causes of fracture (table 2). The number of type iia cases (lateral fracture without septal fracture) accounted for the highest proportion . The number of type i cases, which are non - indicative for surgery, followed type iia, while the number of cases of nasal bone fracture with septal fracture was relatively low, and the number of type iii cases (with depression and comminuted fracture) was also low (table 2). The mean time elapsed until operation after diagnosis was 4.1 days, indicating that surgery was performed promptly . In addition, in the case of the defected septal bone or higher classification type, the number of patients who required more than one week until surgery tended to increase, although the number was small . However, no surgery was delayed for more than two weeks . Regarding adjacent fractures that occurred together with nasal bone fracture, 32 patients had orbital blow - out fracture (bof), which accounted for the highest proportion . Zygomaticomaxillary complex (zmc) fracture and mandible fracture accounted for the second and third highest proportions, respectively . Regarding the frequency of accompanying fracture by nasal bone fracture type, accompanying fracture occurred most frequently in type i. regarding the rate of accompanying fracture, the highest rate was 63% in type iib . However, the overall rate of accompanying fracture was 38.7%, which was relatively low (table 3, fig . The complication types were classified according to esthetic deformity, hyposmia, and hypoesthesia following yang et al ., in addition to obstruction and pain, but rhinorrhea was excluded because there were no appropriate patients . The esthetic deformity type included depression, deviation as well as ecchymosis, bruise, swelling, and scar formation . Early type, which occurred between one week after surgery and one month after surgery, and the late type, which occurred since one month after surgery and then followed - up regularly for at least three months after surgery . Of the patients, except for those who refused surgery and type i patients who were non - indicative for surgery, the esthetic deformity type of complications included six early cases and four late cases . Regarding deformity, among type iia or iias patients, no one complained of deviation or depression, while three of six early cases and two of four late cases were observed in type iib and iibs patients . Two of four late complications had a symptom of scar formation only, and other acute complications were ecchymosis or bruise . Regarding pain, six early cases and three late cases were observed, which accounted for the highest proportion of all complications . Pain was evenly observed by type, but its frequency tended to be slightly higher in type iii patients . Regarding hypoesthesia, an early case was observed in type iias and iii patients, respectively . Regarding hyposmia, an early case was observed in type iibs and iii patients, respectively (fig . 3, 4). Regarding age distribution, patients in their 20s, particularly male patients, accounted for the highest proportion . This result was similar to that of a study conducted by small, which reported a male - to - female ratio of 4:1 . Turvey reported that ta accounted for the highest proportion of causes of fracture . In this study, however, slip down, fist trauma, and collision were the main causes of fracture . These results are likely to be attributable to the fact that pusan national university hospital was easy to reach and that the nearby workers and males in their 20s were involved in many social activities . In addition, the low occurrence rate of nasal bone fracture due to ta is likely to be attributable to the fact that the rate of ta is lower than that of other causes of injury and that nasal bone fracture is easily ignored due to the other concurrent factures that frequently occur . Regarding the fracture type, type iia, which is a unilaterally simple fracture according to hwang et al.s classification, accounted for the highest proportion, while the occurrence rate of type iias or iibs, which has septal fracture without depression, was low . This is likely to be attributable to the fact that due to the structural feature of the nose, the patients visited the hospital mainly due to mild fracture caused by slip down . All patients underwent primary reduction within two weeks; however, the operation tended to be delayed as the fracture type became more severe . This is likely to be attributable to the fact that due to the feature of closed reduction, surgery was performed once the patient s edema and other symptoms were somewhat relieved after the fracture, and that the time for surgery was delayed as the recovery time was delayed in severe cases . Regarding the classification of nasal bone fracture, stranc and robertson s classification based on the direction of force and clinical assessment, harrison s classification based on associating bones and with / without displacement, haug and prather s classification based on the degree of fracture of the nasal and adjacent bones, and murray et al.s classification based on the pathologic criteria and others are used . In this study, hwang s classification based on fracture severity, bone segment displacement, and the presence of septal fracture, which was presented in 2006, was used in conduct of the study by focusing on the fracture severity and range . Open reduction for nasal bone fracture is performed to secure a vision field or to fix using a metal plate in treatment of compound and comminuted fracture . However, open reduction has the disadvantages of infection risk and difficulty of controlling the amount of bone segment absorption . Closed reduction has the advantages of relatively easy manipulation and short operation time but has the disadvantage of difficulty of accurate bone segment reduction . Thus, a proper surgical method should be selected considering the fracture severity and degree of nasal deformity . In the case of reduction, a satisfactory outcome was reported to have been clinically achieved in many cases, and a successful prognosis in terms of patient satisfaction and postoperative status was achieved in children . In this study, statistical analysis was performed on patients who underwent closed reduction to achieve the reliability of postoperative assessment . In the case of type iii, the patient number was small, but the complication rate was the highest . In cases of types however, early complications were observed in most type iib cases, and late complications were observed in type iibs patients, who showed the most deformity complication . In the case of type iii, many patients particularly suffered from pain . This is likely to be attributable to the fact that the more severe septal bone fracture, depression, and deviation in type iii increased the preoperative and postoperative pain, and that the number of patients who suffered from deformity as a late complication was different as the patients recognized the deformity by themselves . However, this result means that patient satisfaction after closed reduction is relatively lower in type iibs or iii patients than in the other groups . Thus, for type iibs or iii patients, open reduction should be considered or the patients should be informed of the possibility of postoperative septorhinoplasty . Wild et al . Reported that a satisfactory result was obtained in terms of stability or complication in reduction under sedation . Conducted a study on the effectiveness of reduction under sedation, but cook et al . Reported that a successful closed reduction could be achieved under general anesthesia . In this study, however, closed reduction under systemic anesthesia was performed for pain reduction during surgery, and for more accurate nasal bone reduction . In addition, nasal plain films were taken from all patients for effective preoperative and postoperative evaluations, and 4-day gauze packing with antibiotic treatment and 7-day external nasal splinting were applied to the patients according to the conventional treatment protocol . In examination of other fractures near the nasal bone via computed tomography, the frequency of concurrent fracture increased the more adjacent the site is to the nasal bone, such as bof, zmc fracture, and mandible fracture . In particular, in the case of bof, concurrent fracture was observed in 32 of 72 cases . The rate of concurrent fracture was high in severe cases, such as types iib, iibs, and iii . In the case of type i, the rate of concurrent fracture was 52.3%, which was relatively high . This is likely to be attributable to the fact that the direction impact on the nasal bone was lower and the impact on the adjacent bone was higher according to the direction of force application, as shown in stranc and robertson s classification . Complications observed during the 3-month follow - up after surgery included esthetic deformity, hyposmia, hypoesthesia, rhinorrhea, obstruction, and pain . However, infection, re - fracture, or epiphora did not occur . According to chung et al ., long - term follow - up should be required after surgery on nasal bone fracture, for the following reasons . First, because the nose is covered with thin soft tissues without muscles for reconstruction of the bone, fibrosis, scar formation, and contracture frequently occur during treatment . Second, it is difficult to set the standard of satisfaction evaluation . Third, the treatment goal is not always clear . Fourth, due to the complex anatomical structure, the clinical manifestations and surgical method vary depending on the adjacent anatomical structures . If proper treatment is not provided, nasal bone fracture may cause functional and aesthetic abnormalities . This study was conducted on outpatients and emergency patients who visited the department of oral and maxillofacial surgery in pusan national university dental hospital and pusan national university hospital due to nasal bone fracture for the past three years, to investigate the types and causes of nasal bone fracture and to evaluate the efficacy and prognosis of closed reduction according to the fracture classification . The same treatment protocol was applied to all patients, followed by follow - up of at least three months . As a result, the complication occurrence rate was insignificant in most cases, and in such cases, mild complications were observed . However, postoperative pain, deformity, and hypoesthesia of the nasal bone were observed in type iibs and iii patients . Therefore, closed reduction should be considered, or postoperative septorhinoplasty should be required, for type iibs and iii patients.
Desmoid tumors (dts), also called aggressive fibromatosis, are very rare with an estimated incidence of 25 cases per million of inhabitants in european countries [1, 2]. Dts lack the capacity to metastasize but may behave in a locally aggressive fashion and possess a high risk of local recurrence despite adequate surgical resection with negative margins [1, 3]. Dts can develop in any musculoaponeurotic structure and they may be located at virtually any anatomical site . The principal sites of involvement for extra - abdominal fibromatosis are the shoulder, chest wall and back, thigh and head and neck region . Intra - abdominal fibromatosis arises in the mesentery or pelvis while abdominal tumors arise from musculoaponeurotic structures of the abdominal wall, especially the rectus and internal oblique muscles and their fascial coverings [4, 5]. In the surgically treated patients who experience recurrence of dt (local recurrence rates are about 2565%) a wide excision is needed in some cases . Synthetic meshes often used in extensive abdominal wall reconstruction may present with complications, including infection, bowel adhesion, extrusion, and fistula according to the prosthetic material used . A prosthetic material with more favorable properties than traditional mesh could have a major effect on surgical practice and patient outcomes, avoiding chronic inflammation and resisting infection after implantation . Considering baumann's description of the ideal biomaterial for abdominal wall repair, our choice was directed towards a not cross - linked acellular dermal matrix (adm) which remodels into host tissue . The matrix serves as a scaffold and becomes rapidly revascularized and infiltrated with host cells, avoiding fibrotic reaction and encapsulation as well as seroma formation . The revascularization of biological matrices is thought to promote access of host immune cells as well, thereby providing further resistance to future infections . This is the first report about the use of the not cross - linked dermal matrix egis in a case of abdominal wall recostruction after extensive dt resection . In 2008, a 37-year - old woman underwent, in a different hospital, exeresis of a neoformation in the epigastric region of the abdominal wall and reinforcement with small prosthetic mesh . She reported an appendectomy, two pregnancies with cesarean births and a voluntary interruption of pregnancy . In 2014, a recurrence occurred in the context of the rectus abdominis in the left iliac fossa . The patient therefore underwent tamoxifen therapy for 1 year followed by 3 months of neoadiuvant chemotherapy for progressive disease . In september 2015, magnetic resonance imaging (mri) 1a, c, e), which revealed a marked progression of the disease (calculated size 18 10 6.4 cm). After discussions at our multidisciplinary sarcoma meeting, the group decision was to treat the patient surgically . One month later, the woman had a surgical resection through a suprapubic transverse incision . The abdominal flap was cranially detached; the neoformation invaded completely the left abdominal rectus muscle and partially oblique muscles with an extension of approximately 30 20 cm (fig . 1a, 2a). The rectus muscle and a large portion of the oblique and transverse muscles were removed en bloc with 1 cm of healthy margin from the mass (fig . Intraperitoneal drainage was placed, and a wide continuous solution was adopted in the left abdomen . The not cross - linked porcine dermal matrix egis (decomed, venice, italy) 30 20 cm, 1.5 mm thick, was hydrated for 10 min in sterile saline solution and then secured with interrupted absorbable suture (vicryl 2/0) to the fascia and abdominal wall muscles (fig . We performed caudal mobilization of the abdominal flap and then dermolipectomy of the superfluous integument . The postoperative course was uneventful and the patient was discharged on the 8th postoperative day . There was no evidence of recurrence of the tumor or incisional hernia at 12 months of follow - up (fig . 1b, d, f) and the membrane turned out to be completly incorporated with the sourrounding tissues . Histological examination of the resected specimen (17 10 6 cm) revealed tumor - free margins and a whitish lesion with increased thickness and fibrous appearance, which had almost completely invaded the abdominal muscle . The diagnosis was confirmed by the presence of spindle - cellular tumors which had immigrated through muscle tissues as shown by nuclear -catenin staining . Dfs are neoplasms with infiltrating growth and with a tendency toward local recurrences; nevertheless, they lack metastatic potential . Although the morphologies of these tumors have been well characterized, their nature and pathogenesis have remained obscure for many years [6, 9]. According to the literature, the median age at the diagnosis of dfs is about 35 years, and the majority of patients are women . In particular, patients between puberty and the fourth decade of life tend to be female, and in these patients the abdominal wall is the preferred site of involvement . Supposed risk factors of desmoids are previous surgical interventions, pregnancy, and hormonal treatment with estrogens . Because the tumor biology is notoriously unpredictable, periods of rapid tumor growth can be followed by stability or even regression . The treatment with tamoxifen, as well as chemotherapy and radiation, is controversial, since the long - term clinical improvement is minimal, while surgical excision should be performed only when absolutely necessary . Abdominal wall integrity after full - thickness surgery can be restored with direct suture, but the occurrence of postoperative incisional hernia is highly reported . For this reason one - stage reconstruction with prosthetic abdominal wall reinforcement increases the chance of definitive cure, enhancing the patient's perceived quality of treatment . Randomized controlled trial observed a double rate of hernia recurrence in the primary suture group compared with the mesh reinforcement group . The meshes used are classified according to their gap size which defines the porosity of the mesh and consequently the behavior with surrounding tissue, but a common tendency to develop postoperative complications was reported with all these devices . Synthetic meshes are usually associated with an increased risk of extrusion, adhesion, and following obstruction and enterocutaneus fistula formation, especially when placed in an overlay fashion . Moreover, patients who have had radiation to the abdominal wall prior to reconstruction are at increased risk for wound healing complications and subsequent mesh exposure . For that reason, butler et al . Recommend avoiding synthetic meshes in patients with radiated abdominal walls . The advent of biological matrices has added a valuable option to the field of abdominal wall reconstruction . The inherent ability of biological matrix to turn into patient self - tissue, and therefore resist infection, allows to implant it in direct contact with the bowel, resulting in fewer adhesions than prosthetic mesh [8, 12]. These bioprosthetic devices, deriving from human or animal dermis, are chemically and enzymatically cleaned to remove all cellular components while maintaining the extracellular matrix, which can be cross - linked or not . It is hypothesized that cross - linking treatment adds strength to the matrix, theoretically resulting in lower rates of hernia recurrence as compared to non - cross - linked products . In contrast butler et al . In a comparative study had not appreciated any mechanical differences between cross - linked and non - cross - linked matrices . Moreover cross - linked matrices revealed delayed revascularization and higher percentage of adhesions resulting in poor integration regarding non - cross - linked adms . Despite the great advantages reported about the biological matrices, the high price that distinguishes them, ranging from usd 8.60/cm to usd 22.00/cm, remains a high deterrent to their use . One variation of the biological materials, egis, has not been described yet in the literature for abdominal wall reconstruction after tumor excision . Egis (decomed, venice, italy) is a dry porcine adm, non - cross - linked, without any chemical preservative; its very competitive price, about half of the aforementioned costs, allows us to choose the benefits of a biological matrix with the advantage of controlled expense . We report for the first time the successful use of egis in a complex abdominal wall reconstruction following the resection of a large dt . The matrix was well accepted without any postoperative complications and no evidence of recurrence of the tumor or incisional hernia has been reported 12 months later . In conclusion, this single - case experience makes us to consider the biological matrix egis, as well as other adms, an ideal alternative to synthetic mesh, mainly in cases with a potential risk of infection . The protocol for data collection of this case has been approved by the institute's committee and complies with the helsinki guidelines for human studies.
One of the most important issues of the health system in the worldwide is obesity, which is presented as one of the top 10 global health problems by the world health organization . Nowadays, some believe that it is the most perilous disease in the world . In recent years, with increasing prevalence of obesity, an intense interest in clarifying the mechanisms underlying the formation of adipose tissue has been formed . Caloric excess, inactivity, and inherited factors are the main causes of changes in adipose tissue, which leads to alterations in its normal function as a lipid buffer, energy store, and a dynamic endocrine organ that is critical for normal metabolic homeostasis . Peroxisome proliferator - activated receptor gene (pparg) is a candidate gene with a direct link to adiposity . Ppar is a transcription factor, which is abundantly expressed in adipose tissue and has a key role in adipocyte differentiation . These receptors form heterodimers with the retinoid x receptor (rxr), bind to ppar response elements (ppres) in the regulatory region of target genes, and modulate their transcription . There are a lot of evidence shows that ppar is a prominent regulator in the formation of fat cells and their ability to function normally in the adults . Ppar is induced during adipocyte differentiation and forced expression of ppar in non - adipogenic cells effectively changes them into mature adipocytes . There is a vast range of naturally compounds seeming to act as ligands for ppars . It seems that long - chain polyunsaturated fatty acids (lc - pufas) are probable candidates as compounds, which regulate ppar expression . Also, a range of eicosanoids have been shown to be ppar ligands, which often have more coherence than their parent molecules . Some from animal studies showed that n-3 lcpufa supplementation can reduce weight gain and diminish body fat, in particular visceral fat, which is related to changes in gene expression . Some ex vivo studies showed that activation of ppar in adipose tissue is a possible cause of apoptosis of large fat cells in visceral and/or sc fat depots from rodents . Some studies showed that treatment of zucker (fa / fa) rats with thiazolidinedione (a ppar agonist), increased the number of small adipocytes and decreased the number of large adipocytes . Results of these studies imply that ppar gene expression partially could be controlled, by nutritional regulation . However, the direct effect of various nutrients on ppar gene expression is ambiguous . Recent evidence demonstrated interactions between ppar and thyroid hormone nuclear receptors (trs) that regulate some genes involved in lipid oxidation and thermogenesis . The aim of the present study was to verify the effects of n-3lc pufa supplementation on plasma levels of ppar and thyroid hormones in obesity . This was a randomized, double - blind, placebo - controlled study in adults with obesity . Sixty six persons were recruited from a specialty and subspecialty clinic of tabriz university of medical science, tabriz, iran, by local advertisements . The study was carried out from april to november 2011 . By considering 0.05% significant level and 95% power, from other studies, the maximum sample size was calculated 25 in each groups, based on t4 (sd=1.78 for placebo group, sd=2.81 for intervention group and a difference equal 1.4). Taking in to account a drop - out rate of 30% we increased sample size to 33 in each group, which at the end of the study remained 29 and 31 persons in placebo and intervention groups, respectively . Inclusion criteria were non - smoking, aged 1845 years with body mass index> 30 kg / m and not trying to lose weight . Persons should not have endocrine causes of obesity, history of any medical illness, including hiv, diabetes, hepatic, renal or thyroid disease . Additional inclusion criteria were no medication, which would affect their plasma lipid levels, no treatment with blood dilutors, beta blockers, anti - inflammatory drugs and omega 3 or vitamin a supplements for the last 2 months . The study protocol was approved by the medical ethics committee of the tabriz university of medical science (code 901). The protocol and aims of the study were fully explained to the participants and all volunteers gave informed consent at the beginning of the study . Eligible participants were randomly assigned to receive either 1,000 mg of n-3lc pufa capsules containing 180 mg of epa and 120 mg of dha (n=33) or 1,000 mg of paraffin as placebo (n=33) twice a day for 4 weeks . Therefore, neither the participants nor the investigators were aware of treatment assignments in this double blind study [figure 1]. Flowchart of subject screening and enrollment placebo was similar in size, color and shape to n-3lc pufa capsules . The capsules were provided by zahravi pharmacy, tabriz, iran . At the beginning of the study some variables (gender and bmi) participants were instructed to consume the supplements with a meal and to maintain their usual dietary habits and physical activity during the study . Consumption of capsules was followed by phone in study duration and if they did not take more than 5 capsules was excluded . Blood samples were collected before and at the end of the study after 12 h fasting . Venous blood was drawn into edta tubes and within 1 h after the samples were taken centrifuged, and plasma was frozen at -70c until analyses were performed . Ppar levels in plasma were determined using an elisa kit (cusabio biotech co., china) according to the manufacturer s specifications . Total triiodothyronine (t3), thyroxine (t4) and thyrotropin (tsh) were measured in plasma using an elisa kit (monobind inc, usa). Weight and height measurements were performed at baseline and on 30 day of the study . Weight was measured without shoes using a carefully calibrated scale (seca, germany) and height was measured with use of wall - mounted calibrated meter scales . The food intakes of participants were collected at the beginning and the end of the study using three 24-h dietary recalls . Regarding the physical activity, all participants were in similar category . All analyses were performed using statistical software minitab15 and spss15 for windows and p value of less than 0.05 was considered statistically significant . This was a randomized, double - blind, placebo - controlled study in adults with obesity . Sixty six persons were recruited from a specialty and subspecialty clinic of tabriz university of medical science, tabriz, iran, by local advertisements . The study was carried out from april to november 2011 . By considering 0.05% significant level and 95% power, from other studies, the maximum sample size was calculated 25 in each groups, based on t4 (sd=1.78 for placebo group, sd=2.81 for intervention group and a difference equal 1.4). Taking in to account a drop - out rate of 30% we increased sample size to 33 in each group, which at the end of the study remained 29 and 31 persons in placebo and intervention groups, respectively . Inclusion criteria were non - smoking, aged 1845 years with body mass index> 30 kg / m and not trying to lose weight . Persons should not have endocrine causes of obesity, history of any medical illness, including hiv, diabetes, hepatic, renal or thyroid disease . Additional inclusion criteria were no medication, which would affect their plasma lipid levels, no treatment with blood dilutors, beta blockers, anti - inflammatory drugs and omega 3 or vitamin a supplements for the last 2 months . The study protocol was approved by the medical ethics committee of the tabriz university of medical science (code 901). The protocol and aims of the study were fully explained to the participants and all volunteers gave informed consent at the beginning of the study . Eligible participants were randomly assigned to receive either 1,000 mg of n-3lc pufa capsules containing 180 mg of epa and 120 mg of dha (n=33) or 1,000 mg of paraffin as placebo (n=33) twice a day for 4 weeks . Therefore, neither the participants nor the investigators were aware of treatment assignments in this double blind study [figure 1]. Flowchart of subject screening and enrollment placebo was similar in size, color and shape to n-3lc pufa capsules . The capsules were provided by zahravi pharmacy, tabriz, iran . At the beginning of the study some variables (gender and bmi) participants were instructed to consume the supplements with a meal and to maintain their usual dietary habits and physical activity during the study . Consumption of capsules was followed by phone in study duration and if they did not take more than 5 capsules was excluded . Blood samples were collected before and at the end of the study after 12 h fasting . Venous blood was drawn into edta tubes and within 1 h after the samples were taken centrifuged, and plasma was frozen at -70c until analyses were performed . Ppar levels in plasma were determined using an elisa kit (cusabio biotech co., china) according to the manufacturer s specifications . Total triiodothyronine (t3), thyroxine (t4) and thyrotropin (tsh) were measured in plasma using an elisa kit (monobind inc, usa). Weight and height measurements were performed at baseline and on 30 day of the study . Weight was measured without shoes using a carefully calibrated scale (seca, germany) and height was measured with use of wall - mounted calibrated meter scales . The food intakes of participants were collected at the beginning and the end of the study using three 24-h dietary recalls . Regarding the physical activity, all participants were in similar category . All analyses were performed using statistical software minitab15 and spss15 for windows and p value of less than 0.05 was considered statistically significant . Of all the participants, 60 participants finished the intervention (n=31 in intervention group and n=29 in placebo group). Two of the participants receiving n-3lc pufa capsules and four participants in placebo group dropped out . Baseline characteristics of study participants (n=60) clinical variables at baseline and after 4 weeks of intervention in two groups are shown in table 2 . After 4 weeks of supplementation, there were no significant differences between the groups in ppar levels (p=0.972). Clinical variables at baseline and after 4 weeks of intervention in two groups as shown in table 2, plasma t3, t4 and tsh levels in n-3lc pufa and placebo groups were 1.80 0.02, 8.06 0.37 and 2.26 0.36, respectively, after supplementation . Among the thyroid hormones, t4 concentration was increased considerably over this period in the n-3lc pufa group but not in the placebo group (p=0.009). However, there were no significant differences between the groups in the change in t3 and tsh . Although, their level was also increased in n-3lc pufa group but it was not statistically significant . Pufas act via nuclear receptors such as ppar and thyroid hormones . In this study, we assessed the effect of epa and dha on plasma levels of ppar, and thyroid hormones . As a result of our study [table 2], ppar levels had no significant changes after 4 weeks . No published data are available about the effects of n-3lc pufa supplementation on plasma ppar levels in obesity in vivo . For example, our results were similar to the study conducted by maclaren et al . Which reported that epa supplementation by dose of 100 m for 24 h, had not significant effects on ppar mrna levels in cultured bovine endometrial cells . Our result was also in line with the lack of effect of rosiglitazone, a potent activator of ppar, and is also in agreement with previous results obtained in human fat cells . On the other hand, li et al . Reported that 10 mol / l epa and 100 mol / l dha increased ppar mrna levels in hk-2 cells . In the other study, chambrier et al . Showed that 50 m epa but not dha significantly increased ppar mrna levels in human isolated adipocytes . These authors suggest, therefore, that ppar probably does not regulate the expression of its own gene in human adipocytes . In rodent adipose cell lines, however, activation of ppar with thiazolidinediones appeared to reduce ppar expression, conflicting results from these studies suggesting that there may be species - related differences in the regulation of the ppar gene in adipocytes . The lack of effect of n-3lc pufa (synthetic agonist of ppar) on plasma ppar in this study might be a consequence of a low level of retinoid x receptor (rxr), the partner of the ppars to form active heterodimers . These ppar - rxr heterodimers bind to dna at direct repeats (dr) in promoters of many genes that regulate gene expression . We did not assess differential effects of epa and dha and this is a limitation of our study . The authors suggest that epa or dha may have a different effect on ppar gene expression and other researches are necessary in the future . However, in this study, epa and dha did not induce a significant increase together in ppar levels . N-3lc pufa supplementation had no noticeable effect on plasma t3 and tsh but a significant increase in t4 concentration was observed in our study [table 2]. Contradictory results are apparent in a study by souza et al . That 2 groups of rats consumed fish oil or soybean oil as an isocaloric and normolipid diets during lactation . Souza et al . Suggested similar serum total t3, t4 and tsh between 2 groups of rats . In knoop study, animals were fed ad libitum the above basal diet with fish oil or cocoa butter . After 3 weeks of dietary treatment, the findings of the same level of thyroid hormones - t4 and t3 - showed that there was no effect of fish oil supplementation on the thyroid function in rats . T4 is the most abundant thyroid hormone, accounting for 80%, while t3 accounts for 20% of the thyroid hormones . T4 significant changes in our observation may be due to its high levels in the blood . Trs bind to tr receptor (tres) not only as homodimers but also as heterodimers with other members of the receptor superfamily, such as rxrs . Heterodimerization with rxr dramatically increases the binding of trs to tres, the responsiveness of tr to t3, and the transcriptional activation . Recently, it was shown that tr competes with ppar for binding to dr1 as a heterodimer with rxr in vitro and in vivo to repress the transcriptional activity of ppar . Thyroid receptors interact with ppars in part by sharing binding sites and heterodimeric partners such as rxr . In summary, the present study shows that n-3lc pufas supplementation in obese adults resulted in higher t4 levels accompanied by no significant changes in t3, tsh and ppar plasma levels . These findings suggest that the increase in thyroid hormone may be one of the mechanisms by which n-3lc pufas exert part of their effects in obesity . First, we could not assess differential effects of epa and dha in this study and second was short duration of the intervention . Future studies are needed to show long - terms effects of n-3 lcpufas on ppar in obesity . First, we could not assess differential effects of epa and dha in this study and second was short duration of the intervention . Future studies are needed to show long - terms effects of n-3 lcpufas on ppar in obesity.
If genetic variation affecting patterns of trait covariation have fitness consequences, then a particular pattern of integration that allows for a closer match to a new local multivariate phenotypic optimum should be favoured [13]. Alternatively, ancestrally conserved patterns of integration may act to constrain the rate and direction of evolution by preventing certain functions from evolving [4, 5]. Either way, modularity may influence the pace of evolution and determine evolvability [6, 7]. It is therefore not surprising that the study of trait integration has been of interest to biologists for more than half a century [810] and has recently seen renewed attention [3, 1114]. The study of integration has more recently been extended to the closely related concept of modularity the relative degrees of connectivity in systems . A module is a tightly integrated unit that is relatively independent from other such modules . For morphological data, modularity has been studied in a variety of contexts including those that are developmental, genetic, functional, and evolutionary in their focus [1522]. An emerging consensus is that patterns of modularity in complex phenotypes likely represents a balance between functional and developmental integration and that modularity is better viewed as a matter of degrees rather than an all - or - nothing phenomenon . It has been suggested that modularity can facilitate divergence by allowing organisms to alter aspects of their phenotype without facing the developmental or fitness tradeoffs that would be present in a wholly integrated unit [12, 13]. In this way, the evolution of modularity could be tied to the idea of key innovations (see for an example). The origin or evolutionary success of taxa key innovations may enhance competitive ability, relax adaptive tradeoffs, or permit exploitation of a new productive resource base . The african cichlids from lakes victoria, tanganyika, and malawi in east - africa's great rift valley represent the largest extant example of vertebrate adaptive radiations known . Certain anatomical features of this group have been proposed as key innovations that have facilitated the rapid evolution of these fishes [25, 26]. The best known of these represents an important example of functional modularity, wherein the highly derived cichlid pharyngeal jaw mechanism allows the processing of prey within the throat to be decoupled from prey capture by the oral jaws [12, 26]. This is thought to have allowed african cichlids to exploit a wide array of niches that would be unavailable if only one set of jaws was present . The cichlid radiation of lake malawi is particularly interesting, because although it is intermediate to tanganyika and victoria in terms of age and morphological diversity [28, 34], it has produced the greatest number of endemic species (well over 700) [35, 36]. The evolutionary history of malawi cichlids suggests that current diversity arose via three stages of diversification: (1) early divergence of the sand - dweller and rock - dweller clades, each of which has adapted to a major macrohabitat, (2) competition for trophic resources within each of these clades that caused further differentiation of trophic morphology, and (3) divergent sexual selection resulting in differentiation of male nuptial coloration [37, 38]. We recently completed an extensive analysis that explored patterns of craniofacial shape variation in african cichlids from each of the three rift lakes . Our data, which represented approximately 80% of the genera across lakes, revealed that all three cichlid radiations share a common trajectory of divergence with respect to each lineage's major axis of divergence (pc1). Our geometric morphometric analysis also showed that these changes were primarily related to changes in the relative length and size of the preorbital region of the skull, which encompasses the oral jaws and supporting structures, with shape posterior to the orbital region remaining relatively stable . These trends suggest that a large portion of the head diversity seen in african cichlids has been achieved by relatively simple and repeated shifts in jaw shape and that these may have happened relatively early in their evolutionary history . African cichlids with longer oral jaws are either suction feeders and forage on zooplankton, or they are piscivorous and feed on other fishes . Alternatively, species with shortened jaws are typically biters that possess a higher mechanical advantage to scrape algae or forage on large macrobenthic prey . In lake malawi, this fundamental division is reflected in the cladogenic split between rock- and sand - dwelling species . On average, rock - dwelling species have a shorter jaw in common morphospace, whereas sand - dwellers species have relatively longer jaws [28, cooper unpublished data]. Notably, these morphological patterns seem to be a common theme in the adaptive radiation of other fish assemblages (e.g.,) and even in population - level divergence among ecomorphs of charr whitefish, and sunfish [4042]. Thus, a propensity for changes in the size of oral jaws seems to exist in teleosts at multiple levels of biological organization and perhaps represents a key innovation for this group as a whole . While the evolutionary origins for a preorbital module may not lie within african cichlids examining potential patterns of craniofacial modularity in cichlids may identify important targets for future developmental genetic research to understand the proximate mechanisms that have facilitated these important radiations and divergence in other groups of fishes . Cichlids may be especially useful for this research, because species with widely variable jaw morphologies can be hybridized, facilitating the creation of large populations for genetic mapping to identify the loci and genetic pathways that underlie changes in jaw shape [43, 44]. As mentioned, liem's seminal work on the pharyngeal jaw apparatus in cichlids suggested that the functional decoupling of prey capture and processing should free the oral jaws to more readily adopt an array of niche - specific shapes for food capture, largely independent of other traits . Implicitly, this insight confers a level of modularity to the cichlid oral jaw apparatus . Recent work in our lab, as well as from others, supports this assertion by demonstrating that morphological divergence among rift lake cichlids is characterized by prodigious shifts in oral jaw shape [28, 34] and has lead to the specific hypothesis that the preorbital region of the skull represents an evolutionary module that is conserved among cichlids from each of the three east african rift lakes . Here, we objectively test this hypothesis by comparing multiple combinations of models of cichlid head variational modularity . Specifically, we use an approach of model selection recently introduced by mrquez to statistically assess patterns of variational modularity across a large sample of rift valley lake cichlids . To determine whether similar patterns of modularity are operating at different levels of biological organization, we also examine craniofacial modularity in each lake separately, as well as within the rock- and sand - dwelling clades of lake malawi . The data used for this study has been previously published in cooper et al ., where further details, including a full list of specimens sampled, can be found . Briefly, our sampling included 78.8% of the genera endemic to the three east - african rift lakes, with the following percentages from each lake: tanganyika (74.5%), malawi (88.5%), and victoria (57.1%). Within lake malawi, 19 rock - dwelling species, representing 11 genera, were sampled, and 36 sand - dwelling species, representing 31 genera, were also sampled . Dissections were performed on cichlid heads in order to expose anatomical landmarks important for oral jaw function (figure 1). A total of sixteen anatomical landmarks were plotted on the images of each specimen using the software program tpsdig2 . Our goals were to determine first whether modularity was present in the cichlid head and second what the best - supported pattern of modularity was in our data . This required comparative testing of alternative a priori models, each of which specified a particular modular structure in the cichlid head . In this approach, each model is comprised of a series of partitions defined as anatomical regions delimited by landmarks, each representing a hypothesized module predicted to be highly integrated relative to other such partitions . Based on knowledge of the development and biomechanical function of cichlid heads, we constructed a number of hypotheses of modularity that were intended to extensively cover potential patterns of covariance . We selected a total of five a priori models representing the spatial distribution of developmental units and functional components of the cichlid head (see table 1). An additional null model representing a lack of any integration or modularity was included in our analyses . Because it is not biologically realistic to expect that patterns of modularity predicted by these developmental and functional models are mutually exclusive, all possible nonnested combinations of the modules defined by the original five hypotheses of modularity were also included in model comparisons . In total it is important to note that while this list of hypotheses is far from exhaustive, it represents an extensive collection of models likely covers a substantial proportion of the developmental and functional processes capable of affecting covariation in the cichlid head . The methodology for testing a priori hypotheses of modularity was adapted from an approach proposed by mrquez consisting of four basic steps implemented in the mint software package (available at: http://www-personal.umich.edu/~emarquez/morph/). (1) computation of an expected covariance matrix from each model of modularity, by assuming that each module resides in its own subspace within the phenotypic space occupied by the entire structure, as described in mrquez . (2) computation of a goodness of fit statistic,, to measure the dissimilarity between observed and expected covariances for each model, as (1) = trace {(s s0)(s s0)t}, where s and s0 are the observed and modeled covariance matrices and t is the transpose symbol . To ensure the comparability of this statistic across models, is standardized twice: first, all values are divided by max, corresponding to the null model describing complete absence of integration, so that is scaled to vary within the interval [0, 1]; second, scaled is standardized via linear regression to remove the effect of the number of estimated parameters in models, which takes advantage of the linear relation observed between and the number of zeros in models . The standardized statistic is defined as the residual m * = f(z), where f(z) represents the linear function relating the values of computed from all possible models of modularity to their corresponding counts of zero elements, z. even though it would be computationally unfeasible for most studies to include all possible models, the fact that scaled values are restricted to the interval [0, 1], where 0 corresponds to the observed covariance matrix and 1 to the null model of no integration, implies that f(z) must also vary within these limits, which are sufficient to define the linear function for any given set of variables . Given a large random sample of models, with values symmetrically distributed about their mean, e() f(z), and thus e(*) 0 . In which * <0 correspond to comparisons where observed covariances are relatively low on average and hypothesized to be zero, and conversely, cases where *> 0 occur when relatively high covariances are on average hypothesized to be zero, the best - fitting model is that with the lowest * value . Note that this approach differs slightly from the one used in mrquez, where f(z) was estimated via regression using only the models included in a study, as opposed to all possible models . 95% confidence intervals were computed as the 2.5 and 97.5 percentiles of a distribution of 1,000 jackknife subsamples formed by removing random subsets of 10% of the specimens from each sample . (3) the statistical significance of * was assessed using a parametric monte carlo approach . In these tests, a null distribution for the statistic is generated by comparing the original observed covariance matrix s to each of 1,000 random matrices generated from a wishart distribution with mean vector 0 (i.e., the same mean as procrustes residual data) and covariance matrix s [45, 49]. (4) finally, to allow choice among the multiple models that are significantly better than chance according to the monte carlo approach described above, models are ranked by their goodness of fit (i.e., * values, in ascending order). The relative support for each model is determined by computing the stability of its rank using a jackknife approach in which * values and model ranks are recomputed after removing a random portion of the samples . In this study, we removed 10% of the data in each of 1,000 jackknife replicates . If a single model fits two of our groups (lake tanganyika, lt; lake malawi, lm; lake victoria, lv; rock dwellers, rd; sand dwellers, sd) equally well, it would not necessarily mean that they were close to each other in our model space . This is because two objects that are equally distant from a third (the best supported model) are not required to occupy the same position, especially in a high - dimensional space . In our case, the * values calculated for each group represents reference points useful for determining their relative position . This vector of * values can have two interpretations, the first as a set of distances between the observed covariation matrix and known patterns of modularity and the second as coordinates for the data in model space centered on a group covariance pattern . Because each group may be centered at a different position, only the direction of these vectors can be compared, which was achieved through the use of correlations between * vectors of each group . This involved two separate analysis; first, we determined levels of correlation for * across the three lakes; second, we determined levels of correlation for * among lm, rd, and sd groups . However, we did not use all 137 possible gamma values in these correlations; rather, we used the ten top - ranked models in for each group . This increased the likelihood that we were testing associations between the most biologically relevant models . Monte carlo tests were unable to distinguish among models, suggesting that hypotheses were too similar to distinguish amongst each other given available sample sizes . We, therefore, focus our interpretations on the basis of the relative rankings of * values and their jackknife support . Overall, there was strong support for the hypothesis that modularity is present in the heads of african cichlids . Across the three lakes the null model of no integration was ranked 57th, 100th, and 102nd, out the 137 models in lv, lm, and lt, respectively . In the rd and sd jackknife tests provided high support for these rankings in all groups . At all levels, the best supported hypothesis included one preorbital and one postorbital module . In our pooled data set across all lakes, as well as separate data sets for lv and rd, a preorbital module that defined the upper jaws and encompassed the exact same set of landmarks support for these patterns of modularity was high with the top model in the pooled sample of cichlids being ranked number 1 in 96.6% of jackknife reps . Lv and rd groupings had top models that were similarly highly supported with 84%, and 85% of jackknife reps, respectively . For lm as a whole and the sd sample, the top ranked models displayed a preorbital module that encompassed both the upper and lower jaws (figure 2). Statistical support for the lm model was high with 86% of jackknife reps maintaining its top ranking . In the case of the sd sample, there were two, statistically indistinguishable top models: the highest - ranked model included three modules, one encompassing the oral jaws, one defining the orbital size, and another that covers much of the posterior region of the head . The second ranked model was identical to the first with the exception that it did not possess an eye / orbital module . Support for the best sd model (i.e., three modules) was low, with only 47% of jackknife reps supporting its ranking . The second best sd model (i.e., two modules) was also ranked as the best model in 44% of jackknife reps . However, a subsequent set of analyses found that when one of these models was removed, support for the other model significantly improved to where its top ranking was supported in over 97% of jackknife reps . The lt dataset also showed strong support for a preorbital module in its top - ranked hypothesis (supported in 98.6% of jackknife reps). However, it differed from the other groups by having a preorbital module comprised primarily of the lower jaw (figure 2). Across the three lakes, we observed strikingly similar patterns of covariation . We used * values from a total of 23 hypotheses of modularity, reflecting the top ten ranked models for each of the three lakes, meaning that 7 of these hypotheses were shared among lakes . The r - values for our tests were all extremely high, and positively correlated, indicating that in spite of differences between top - ranked models, very similar patterns of covariance underlie each of these adaptive radiations (table 2). We used a total of 18 models to describe the top ten models across lm and within the rd and sd datasets . Thus, a total of 12 out of a possible 30 models were shared among these groups . The correlation between * values for lm as a whole and sd dataset was particularly strong, indicating that sand dwellers may be influencing the overall pattern of modularity exhibited by malawi cichlids . This result could be due, in part, to their larger relative sample size compared to rd cichlids . Alternatively, lm as a whole showed almost no relationship with rd species, and there was a strong negative relationship between sd and rd species (table 3). These data suggest that patterns of trait covariance are being repelled between sd and rd . Our results demonstrate that a preorbital module is present in the oral jaws of east african rift valley cichlids and that this pattern of covariation is conserved across all lakes . This trend strongly supports the hypothesis that this pattern of modularity has influenced the rate and direction of adaptive phenotypic divergence among african cichlid radiations an idea rooted in the proposal that the cichlid pharyngeal jaw apparatus is a key innovation that freed the oral jaws from a functional constraint, formalized in light of quantitative patterns of trophic divergence among cichlid lineages, and empirically tested here . While our results are compelling, we suggest that the comparisons of rates of evolution to other groups which lack a pharyngeal jaw apparatus (e.g., salmonids and characids), and possibly a preorbital module, may be needed to confirm whether the patterns of modularity identified in cichlids represent a key innovation . While the results of our correlation analyses indicate that general patterns of covariance are conserved across lakes, there were several notable differences in the top - ranked hypotheses of modularity among groups, suggesting that while conserved patterns exist, modularity itself is capable of evolving . The lm dataset had a pattern of modularity in which the preorbital module encompassed both the upper and lower jaws, while in the lt dataset, the preorbital module was exclusive to the mandible . The lv radiation is the youngest of the three rift lakes, and correspondingly, our prior analysis found relatively low levels of shape variation (disparity) in this lake compared to lm and lt cichlids . Also, more than 60% of the morphological variation among species in lv can be explained by a single major axis (principal component), considerably more than was explained by this shared axis for lm and lt (i.e., victoria cichlid head anatomies were relatively more integrated). Taken together, these results suggest that the younger divergence in lv is determined by a more limited set of strong interactions among traits . Since the upper jaw contains the anatomical linkages most responsible for highly kinetic jaw movements, such as jaw protrusion, this would imply that both the functional and morphological evolution of this lineage has been constrained . As the youngest of the three rift lake lineages, patterns observed within lv may offer insight into the proximate mechanisms that have shaped cichlid radiations in general . It is possible that the pattern of modularity we have identified in lv has played a dominant role in the early patterns of divergence of cichlids in lm and lt . Consistent with this idea, the preorbital module identified in the upper jaw for lv was very similar to one identified in the top - ranked model for our pooled data set across all cichlids (figure 2). The top - ranked models for the sd and rd clades within lm also exhibited notable differences . Whereas the sd group exhibited a preorbital module that included both the upper and lower jaws, rd species expressed a pattern of modularity similar to that of lv, where only the upper jaws were integrated . Moreover, the sd / rd division within malawi was characterized by a strong negative relationship in covariance patterns, suggesting that ecological competition between these clades during the early history of the lake may have caused patterns of trait covariance to diverge . This pattern is consistent with character displacement, but at a different biological scale (groups of species or clades) than where it is usually recognized [5153]. Character displacement is often thought to occur between two closely related species; however, research suggests that character displacement can also occur between distantly related species, as well as whole communities [54, 55]; see also [56, 57] for evidence of character displacement in african cichlids . Therefore, it is appropriate to speculate that this process is contributing to divergence between sd and rd clades in lm . Integration between the upper and lower jaws, as displayed by the sd dataset, may be especially advantageous for ram / suction - feeding predators, a predominant sd trophic niche, because both jaws need to work together in a highly coordinated fashion to produce kinematic force . Alternatively, in rd species that most often employ a biting tactic whereby the upper jaw is relatively more stationary during foraging, the upper jaw is integrated, and the lower is not . This implies that the lower jaw in rd species is free to evolve a wide array of geometries, which may be advantageous for substrate feeding species, where demands on the lower jaw should be more variable relative to the upper jaw apparatus . However, this is not to say that there is a complete lack of integration between the upper and lower jaw, as modularity is a matter of degree rather than an all - or - nothing phenomenon . Also, it is important to note that patterns of divergence among sd and rd are still acting within the overall context of a preorbital module (i.e., both upper and lower jaw for sd, upper jaw for rd,) suggesting that the rate and direction of phenotypic evolution is being dictated by historical constraints that are manifested in patterns of covariance and modularity . In other words, putative character displacement between sd and rd species in malawi cichlids may be proceeding along genetic lines of least resistance [5, 53]. Although there are a number of possible functional explanations for patterns of craniofacial modularity, it is important to remember that selection must work within the context of developmental systems to improve functional performance . That is not to say development inherently constrains evolution, but rather that it can direct its outcome in concert with selection . In fact, simulations have shown that some degree of order may actually be required for evolution to proceed with ease . It is, therefore, probable that the patterns of craniofacial modularity identified here, while probably causing an increased propensity for adaptations involving the oral jaws, are also dictated by underlying developmental processes . Clues to these potential processes may lie in early embryological events during the formation of craniofacial anatomy in fishes (see for a similar view in mammals). Structural progenitors of the ossified structures in the preorbital region of the skull include the trabeculae and ethmoid cartilages (i.e., anterior neurocranium), palatoquadrate (i.e., upper jaw precursor), and meckel's cartilage (i.e., lower jaw precursor). All of these structures are derived from the same population of anterior cranial neural crest (cnc) cells that migrate away from neural tissue beginning at approximately 12 hours afterfertilization (hpf) in zebrafish . Thus, the preorbital region of the skull is defined early in development, and these events may underlie the persistence of a preorbital module among african riftlake cichlids . For instance, lm cichlids show integration between the upper and lower jaws, suggesting that this developmental hypothesis may have particular merit for this adaptive radiation . The modular divisions between the upper and lower jaws found between lv and lt may be influenced by slightly later developmental events . Fate mapping experiments in zebrafish show that at approximately 24 hpf the stomodeum forms as an invagination of the oral ectoderm, and both the pterygoid process and anterior neurocranium reside within a compact condensation of cells closely associated with dorsal edge of this structure, whereas meckel's cartilage forms from cells ventral to this structure . Thus, while early ontogenetic events (i.e., cnc migration) regionalize the skull along the anterior - posterior axis, slightly later events (i.e., formation of the mouth) are necessary to specify the dorsal - ventral identity of the jaws within the preorbital region of the skull . Later still in development, the sequence of ossification in bones of the craniofacial region may play a role in determining patterns of modularity . Evidence from zebrafish and nile tilapia (oreochromis niloticus) show that the oral jaws (premaxillae, maxillae, and dentary) are among the first structures to become mineralized in the teleost head [63, 64]. In fact, the only other structures that are ossified as early as the oral jaws include the basio - occipital and opercle . Functional reasons have been attributed to this chronological pattern in teleost development [63, 6567]. Specifically, bones involved in early basic functions such as respiration and feeding have been observed to ossify first . This suggests that the bones of the oral jaws and opercular regions of the skull are predisposed to reflect the patterns of variational modularity we have identified . Ossification sequence, and heterochronic shifts in this process, could, therefore, act as another early mechanism that sets the stage for craniofacial modularity throughout life history . Beyond initial ossification, bone remodeling over ontogeny could represent another means of achieving modularity of the oral jaws and a way of simultaneously integrating developmental and functional mechanisms in a straightforward way . Bone is a dynamic, metabolically active tissue that is constantly being renewed and changed . Bone cells are strain sensitive and can transduce signals from mechanical loading into cues that result in either reduced bone loss or gain [6871]. Disuse usually causes an acceleration of bone turnover, with resorption being the dominant process . Conversely, excessive strain can damage bone, which may in turn be repaired or further reinforced through remodeling . Importantly, both bone resorption and deposition involve highly conserved genetic and developmental pathways [7274]. Mechanical stimuli may be particularly important for inducing adaptive patterns of modularity through the process of bone remodelling . Bone turnover tends to be most effective in areas of high stress, thus reducing the risk of injury . In teleosts, the oral jaws are used for both respiration and food acquisition, but it is likely that the oral jaws are under the highest stress during food acquisition and processing, which should in turn provide the greatest stimulus for bone remodeling . Indeed, several lab - based studies on cichlids have documented that different diet treatments can induce changes in bone and head shape [75, 76], demonstrating the ability of elements in the upper and lower jaws to respond to mechanical stimuli through changes in shape . Within the rd lineage of lm, it is certainly possible that a high degree of remodeling and plasticity of the lower jaw has led to a pattern of modularity, wherein the mandible lacks a measurable degree of integration across species . The lower jaw may be more amenable to remodeling due the greater degree of movement that it is afforded in the rd lineage . Alternatively, patterns of integration within the lower jaw may differ between species, resulting in a perceived lack of integration in the combined dataset . In either case, the conclusion that must be drawn is that the lower jaw is a highly evolvable trait within the rd lineage . Perhaps the most compelling evidence for a fundamental link between developmental and functional processes comes from work in the bmp family of signaling proteins (reviewed by). Critical roles for bmp signaling during bone and cartilage development are well established (reviewed by), and variation in bmp expression over ontogeny has been associated with the origin and adaptation of key vertebrate innovations including the turtle shell, bat wing, cichlid mandible [44, 80], and bird bills [8183]. All of these examples involve differential bmp expression that is presumed to be due to mutational effects (either cis or trans), but several studies have also documented environmentally induced changes in bmp expression in skeletal tissue . Specifically, tensile stress has been shown to alter bmp expression during bone growth [84, 85], remodeling, and repair [87, 88]. Thus, a scenario wherein patterns of craniofacial modularity are established via early developmental mechanisms and then either reinforced or altered by functional processes might represent the true nature of variational modules within the cichlid skull . Examining how patterns of integration potentially shift over ontogeny and under different feeding regimes in different cichlid lineages would represent a fruitful line of future research . Recent reviews suggest that an extended evolutionary synthesis (ees) is necessary to account for the origins of variation that is acted upon by natural selection [6, 7]. The empirical center for the ees will lie in discovering the features of organisms that determine evolvability . While specific definitions of evolvability are numerous and vary according to context, modularity figures prominently in these discussions insofar as it imposes a constraint on direction or speed of evolutionary change [12, 13]. In this context, we suggest that modularity can act as a key innovation . While key innovations are typically defined by the appearance of an anatomical structure that precedes an adaptive radiation, as is the case for the pharyngeal jaws, we contend that patterns of modularity, whereby the cichlid oral jaws represent a module that allows them to change with a high degree of autonomy, have had a strong influence on the rate and direction of adaptive divergence in this group . This pattern of modularity is likely what has allowed for the rapid lengthening or shortening of the oral jaws relative to the rest of the head in cichlids and shape changes that comprise the major axes of variation in each of the three african rift lakes, and likely, it represents the template upon which additional changes in trophic morphology occur . In other words, the evolution of this pattern of modularity may facilitate evolution, providing an example of the evolution of evolvability (see). The degree to which these patterns are specific to cichlids, or represent a more generalized perciform innovation, will be an important area of future study . Several avenues may have lead to preorbital modularity; therefore, finding groups that lack this pattern of modularity and comparing rates of diversification will be important for identifying its potential role as a key innovation . As discussed above, several avenues may have led to the consistent patterns of preorbital modularity we have discovered . In the order of their ontogenetic appearance, these include (1) migration and specification of progenitor cells, (2) dorsal - ventral division of the oral cavity, (3) sequence of ossification with early calcification of the jaws and operculum region, and (4) remodeling of bone in response to mechanical stimuli . These all represent separate hypotheses and processes that can be tested to understand the developmental and genetic basis of a preorbital module . We predict that each of these processes may play important roles in determining modularity in the cichlid head, depending on the lineage being queried . Fortunately, we have the means to assess patterns of modularity over ontogeny in cichlids and can statistically track when the patterns we have identified in adult cichlids begin to emerge . We also have the means to identify qtl associated with these anatomical modules and to track changes in gene expression during the emergence of these patterns [43, 44]. In all, cichlids represent an attractive model to reveal both the genetic basis of modularity and the evolvability of the craniofacial skeleton.
Aspergillosis is the most common fungal infection of the paranasal sinuses and it usually occurs unilaterally in maxillary sinus . On the other hand, transverse maxillary deficiency (tmd) is one of the most common skeletal dysplasias observed in clinical practice . It can be treated with several techniques such as slow orthodontic expansion, rapid palatal expansion, and surgically assisted rapid palatal expansion (sarpe), and the recommended technique for adult patients is sarpe because of limited osteogenic activity of palatal suture . The use of sarpe to treat tmd decreases adverse effects of orthodontic expansion such as lateral tipping of posterior teeth, extrusion, periodontal membrane compression, buccal root resorption, alveolar bone bending, fenestration of the buccal cortex, palatal tissue necrosis, inability to open the midpalatal suture, pain, and instability of the expansion . Although sarpe is a relatively easy and an effective operation, complication possibility due to technical sensitivity of surgical approach and patient's systemic condition must be considered . In this case report, perforation - related fistula formation on inferior meatus and unilateral aspergillosis infection in maxillary sinus associated with sarpe, treated with functional endoscopic sinus surgery (fess), were evaluated . A 32-year - old systemically healthy woman with tmd was referred from the orthodontics department . The patient was operated under general anesthesia with nasal endotracheal intubation . Before the surgical procedure, expansion device was activated . Following the full - thickness sulcular incision on the deepest level of the vestibular sulcus incision, the lateral surface of the maxilla was exposed with subperiosteal dissection . Nasal mucosa was elevated from the lateral nasal wall without any perforation, and bilateral corticotomy starting from the pyriform aperture to the pterygomaxillary fissure was performed . The medial walls of maxillary sinuses were separated bilaterally using guided osteotomes, and the palatal suture was separated using sharp chisel osteotome . The incision was closed primarily, and anterior nasal packs (merocel standard dressing) were applied . The patient was discharged on the same day, and the 1 week of healing period was uneventful . The patient consulted an ent specialist and computed tomography revealed that the left middle meatus was congested with radiopaque substance [figure 1]. Besides, endoscopic sinus examination showed that there was pus drainage from maxillary sinus to inferior meatus through fistula [figure 2], and augmented amoxicillin with clavulanic acid (augmentin, 1 g) was prescribed for 2 weeks to control sinusitis . Computed tomography imaging of congested ostium and radiopaque appearance defluxion from fistula after 2 weeks, a granulation tissue in the maxillary sinus was observed during the endoscopic examination [figure 3], and fess was performed for decontamination of the maxillary sinus and correction of ostium function . Augmented amoxicillin with clavulanic acid (augmentin, 1 g) was prescribed for 2 weeks again after fess, and histopathological examination of the substance removed from the sinus revealed aspergillosis [figure 4a c]. Granulation formation (a) middle meatal antrostomy, (b) removal of substance located in the maxillary sinus, (c) postoperative appearance of the middle meatus after 3 weeks, it was observed that the ostium was functioning and there was no sign of aspergillosis . In 3 months correction of tmd in adult patients is more challenging because of changes in osseous articulations of the maxilla with adjoining bones . Procedures described for the correction of tmd have conventionally been grouped into two categories as segmenting the maxilla during the le fort 1 osteotomy in a widened transverse dimension and sarpe . However, sarpe has become a common procedure and it has been considered as the procedure which has the lowest morbidity incidence, especially when compared with other orthognathic surgery procedures . Sarpe allows clinicians to achieve satisfactory maxillary expansion in a skeletally mature patient and it decreases adverse effects of orthodontic expansion . Although sarpe is a relatively simple procedure among other orthognathic surgery techniques, complications related with surgical technique and systemic condition of the patient must be considered . In this case, fistula formation between the maxillary sinus and the inferior meatus occurred during osteotomy step of sarpe procedure, and the alteration of the sinus ventilation was complicated by the presence of aspergillosis . It is well - known data that the use of wide broad spectrum antibiotics in a long period can cause fungal infection . The middle meatus dysfunction and the operation trauma are other reasons of aspergillosis formation in this case . Although potential association between aspergillosis and sarpe was not described before in literature, it must be noted that sarpe causes perforation and fistula formation between the nasal cavity and maxillary sinuses . Despite the frequent use of the procedure, only limited data on the prevalence of postoperative complications after sarpe are available in literature . On the other hand, some severe and unusual complications have been reported . It should be noted that fistula formation and meatus dysfunction related with sarpe operation cause fungal infection development.
This fundamental concept has a military origin . The united states navy considers proficiency in basic damage control skills as part of basic seamanship . The stated objectives of shipboard damage control are as follows: take all practicable preliminary measures to prevent damageminimize and localize damage as it occursaccomplish emergency repairs as quickly as possible, restore equipment to operation, and care for the injured personnel . Take all practicable preliminary measures to prevent damage minimize and localize damage as it occurs accomplish emergency repairs as quickly as possible, restore equipment to operation, and care for the injured personnel . These objectives and the overriding principle of performing the minimum repairs necessary to maintain ship worthiness have been adapted to the care of severely injured patients . The most pervasive concept in trauma care over the last 2 decades has been the adoption of damage control principles . Damage control is a fundamental shift from the traditional surgical focus of anatomical restoration to that of physiological restoration . Pringle perhaps ushered the damage control concept by advocating temporary inflow occlusion and perihepatic packing for liver hemorrhage in 1908 . In 1982, kashuk et al . Described the development of the vicious cycle of hypothermia, coagulopathy, and acidosis in major abdominal vascular injuries [figure 1]. Described truncating the operative procedure at the first indication of major coagulopathy in the following year . Initially, the patient undergoes resuscitative, abbreviated surgery, where control of hemorrhage and contamination is rapidly obtained and definitive repairs deferred . The patient is then transported to the intensive care unit (icu) where active rewarming, correction of coagulopathy and acidosis occurs . Once normal physiology is restored, definitive surgical management is completed . Independently, hypothermia, coagulopathy, and acidosis have been demonstrated to worsen the outcome of severely injured patients . If not corrected, each component can further perpetuate the vicious cycle, resulting in certain death . Hypothermia results as an imbalance between heat loss and the body's ability to generate and maintain metabolic energy . Clinically significant hypothermia occurs when the core temperature is <35c; 21% of all severely injured patients and up to 46% of all trauma patients requiring laparotomy are hypothermic . In 1987, jurkovich et al . Demonstrated a 100% mortality in those severely injured patients undergoing laparotomy, who had a core temperature of <hypothermia is associated with an increase in sympathetic drive with resulting peripheral vasoconstriction, end - organ hypoperfusion, and metabolic acidosis from anaerobic respiration . In addition, hypothermia may exacerbate coagulopathy by causing dysfunction of the intrinsic and extrinsic coagulation pathways, as well as platelet activity . Traditionally, the causes of coagulopathy in severely injured patients have been attributed to acidosis, hypothermia, consumption of clotting factors, and hemodilution . However, this theory has been challenged by recent data suggesting that acute coagulopathy in trauma is due to hypoperfusion rather than the aforementioned causes. [1517] brohi and colleagues have suggested that hypoperfusion leads to activation of protein c and systemic hyperfibrinolysis . Acidosis is a result of tissue hypoperfusion and subsequent switch from aerobic to anaerobic respiration . The adverse effects of acidosis on cardiac function were documented in physiological studies over 40 years ago . In addition, impairment of oxygen utilization and coagulation dysfunction are associated with the acidotic state. [2224] et al's original series, only patients with major vascular injury and 2 or more visceral injuries showed a survival benefit with a damage control approach . Thus, only those with a severe injury pattern, whose physiologic reserve is insufficient to tolerate a prolonged, definitive operative procedure, should be subjected to a damage control approach . Asensio et al . Identified pre - operating room characteristics predictive of exsanguinating syndrome, in which a damage control approach would be appropriate [box 1]. There is a 98% probability of developing life - threatening coagulopathy if the injury severity score is> 25, systolic blood pressure <70 mmhg, ph <7.1, and temperature <34c . Hirshberg and mattox furthermore recommend that injury pattern recognition guide the experienced surgeon toward an abbreviated operation . Although originally described for those patients requiring abdominal operative interventions, the same criteria for damage control apply for other body regions . Damage control principles have been described for thoracic, vascular, neurosurgical, and orthopedic injuries, as well as trauma anesthesia. [2841] for example, in orthopedic procedures, severe associated head injury and/or pulmonary contusion have been suggested as indications for damage control surgery. [4244] damage control principles are applicable in all initial phases of care of the severely injured patient [figure 2]. Damage control sequence summary of damage control and defi nitive interventions prehospital and emergency department damage control interventions are aimed toward temporarily stopping hemorrhage and maintaining minimum perfusion until definitive hemorrhage control can be achieved . Rapid transport of the patient from the scene to early surgical care has enabled the survival of many injured patients, who previously had a significant risk of dying in the prehospital phase . The injury to admission interval was reduced from 12 - 18 h in world war ii to 1.25 h for the vietnam war, with a corresponding decrease in mortality from 9.5% to 2.3% . The us army has adopted a staged approach to battlefield treatment, where damage control principles are practiced by forward surgical teams and/or at the combat support hospital . Tourniquet use has been demonstrated to be effective and life - saving during recent military conflicts in iraq and afghanistan. [4851] tourniquets must be applied correctly, as inappropriately applied devices cause an increase in bleeding due to occlusion of low - pressure venous outflow and inadequate occlusion of arterial inflow . Topical hemostatic agents for external bleeding include dry fibrin sealant dressings, chitosan dressings, and mineral zeolite . These agents have been used again in military conflicts with success for mainly large soft tissue injuries with small vessel bleeding . The concept of permissive hypotension was originally noted by cannon et al . And subsequently shown by bickell et al . To be beneficial in patients with penetrating injuries to the torso . The concept behind this strategy is that early replacement of blood, plasma, and platelets will prevent spiralling into the vicious cycle due to excessive infusion of crystalloid solution . The military experience in iraq indicated a physiological improvement in those injured soldiers resuscitated with a 1:1:1 ratio of packed red blood cells tofresh frozen plasma and platelets, respectively. [5760] emerging data suggest that this strategy may likewise improve survival in severely injured civilian trauma patients,[6163] but awaits confirmation in prospective trials . Within the operating room, damage control anesthesia aims to rapidly establish a definitive airway, maintain oxygenation, prevent hypothermia, initiate correction of coagulopathy, and maintain permissive hypotension until definitive hemorrhage control has been obtained [table 2]. Anesthetic resuscitation goals during and after damage control surgery (from dutton et al .) Abdominal damage control entails rapid celiotomy, control of hemorrhage, limiting contamination, and temporary abdominal closure . Surgical bleeding may be controlled by a combination of packing, direct arterial ligation, vascular clamping in situ, splenectomy, and nephrectomy, whereas contamination is limited by rapid stapled resections, temporary hollow viscus closures and pancreatic drainage. [21125276467] temporary abdominal closure is most commonly achieved with a vacuum - assisted dressing . Alternative methods of temporary closure include towel clip or running nylon skin closure, bogota bag, or silo closure . Removal of packs, thorough re - exploration, complete vascular repair, establishment of gastrointestinal continuity or stoma formation, and fascial closure are carried out in the definitive phase . Thoracic injuries present a unique challenge, as structures within the chest are not easily controlled with temporary maneuvers . Packing is limited to the apices and cardiophrenic angles, but lung injuries can be rapidly controlled with nonanatomic, stapled wedge resections . Definitive procedures at re - operation include removal of packs, thorough exploration for air leaks, and chest wall closure . Damage control principles for vascular trauma hinges on 2 categories of vascular repairs: simple and complex . Complex repairs include vascular reconstructions, such as patch angioplasty, end anastomosis and graft interposition, which are time consuming and not ideal in the hypothermic, coagulopathic patient . Once appropriate physiology has been restored, definitive vascular reconstruction can be achieved before delayed closure of fasciotomy wounds . Since the 1980s, early total care has been the standard of care for orthopedic injuries following bone's landmark paper demonstrating an increase in pulmonary complications with delayed femoral fracture repair . However, an increasing understanding of the inflammatory process and effects of orthopedic intervention, otherwise known as the second hit, led to the concept of damage control orthopedics . Temporary external fixation or traction for long - bone fractures and minimally invasive pelvic stabilization for pelvic fractures are the initial orthopedic interventions . Some data suggest that definitive fixation should occur within 24 h of injury or after 5 days to avoid pulmonary complications . Optimizing the general condition of the patient is essential in optimizing outcomes from head injury . Damage control neurosurgery involves rapid arrest of intracranial bleeding, the evacuation of intracranial hematomas and the early debridement of compound wounds to the skull . Craniectomy may be beneficial for cerebral edema, however, dural closure should be attempted to prevent intracranial infection . The extent of debridement, however, remains a controversial issue, as aggressive debridement of brain tissue, bone and missile fragments, may at times worsen neurologic deficits . The aims as previously stated are to rewarm the patient and correct acidosis and coagulopathy . Rewarming to a temperature of 37c can be achieved by warming the icu room, removing any wet sheets or clothing, covering the patient with warm blankets and applying a forced air - warming device . Initial coagulation targets should include inr <1.2, fibrinogen> 100 mg / dl, platelets> 100,000/mm . Although activated factor vii was a promising adjunct in the arrest of nonsurgical sources of hemorrhage, recent trials failed to show a mortality benefit . A review by rotondo et al . Identified an overall 50% mortality and 40% morbidity in 961 damage control patients . The early reports of damage control surgery demonstrated a significant improvement in mortality when comparing patients undergoing abbreviated procedures to those patients undergoing conventional surgery . It is important to note that these comparisons apply to damage control laparotomy; mortality outcomes have not yet been demonstrated in other damage control procedures . Complications from damage control laparotomy include intra - abdominal abscess formation (0%83%), enteric fistula (2%25%), dehiscence (9%25%), abdominal compartment syndrome (2%25%), and inability to reapproximate the fascia edges (1040%). Orthopedic external fixation may increase pin - site infection and damage control vascular procedures may increase graft infections . It is essential that trauma providers be au - fait with the principles of damage control for they are clearly life - saving in many patients with multisystem trauma . The damage control concept originated over 100 years ago, and has since grown to encompass all phases of the initial care of the severely injured patient . By learning from the accumulated experience, outcomes and complications of damage control, modern surgeons can apply this strategy following a rationalized approach . Nowadays, damage control principles are also applied for non - trauma care, including the treatment of abdominal compartment syndrome and intra - abdominal sepsis . Ongoing and future developments will continue to define the most appropriate patients that may benefit from damage control.
A 68-year - old male patient visited konkuk university hospital due to epigastric pain lasting 2 to 3 seconds 2 months before hospitalization . According to his anamnesis, he was taking 50 mg of atenolol because he had been diagnosed with hypertension 2 years before . He had been diagnosed with esophageal diverticulum 10 years before; since then he had experienced no symptoms . He underwent a cardiac computed tomography (ct) scan 3 weeks prior to hospitalization . The ct scan showed that mild stenosis (20% to 30%) had formed in left anterior descending artery, left circumflex artery, and right coronary artery . He underwent gastroesophageal endoscopy; 5 cm of diverticulum was found 20 cm from the incisor tooth (fig . 1). There were no other findings except for erosive gastritis in the antrum of the stomach . The esophagography 2 weeks prior to the hospitalization showed that there was 10 cm of diverticulum projecting to anterolateral side; killian - jamieson diverticulum (kjd) was considered (fig . Although the location of the diverticulum on the esophagogram was right side, we decided left cervical approach for surgeon's convenience . Left cervical incision was conducted under general anesthesia and the cervical esophagus was exposed following dissection along the sternocleidomastoid muscle . Diverticulum (105 cm sized) was found with a wide base and which contained a small amount of necrotic tissue (fig . The diverticulum adhered to circumjacent tissues; in particular, it strongly adhered to the prevertebral fascia in the rear of the trachea . Cervical esophagus proximal to the diverticulum was dissected cautiously and looped with a silastic drain . The diverticulum was excised with a ta 60 stapler (ethicon endo - surgery, cincinnati, oh, usa). Esophageal myotomy of about 3 cm was conducted along the distal part of the esophagus after the excision of the diverticulum . Reinforcement sutures were inserted with 3 - 0 silk along the excision area of diverticulum . The esophagography on the fourth day after the surgery showed that there were not abnormalities such as leakage or stenosis; therefore, dietary treatment was initiated . The patient was discharged from konkuk university hospital on the sixth day after the surgery . At the time of discharge follow - up observation has been performed for 6 months, during which the patient has not shown any abnormalities such as diverticulum relapse, dysphagia, or stenosis . Kjd is a rare form of esophageal diverticulum which appears through the killian's dehiscence, a mucosal protrusion below the cricopharyngeal muscle . Kjd is similar to zenker's diverticulum (zd) due to the protrusion of esophageal mucosa . Kjd is rare in that the incidence of kjd is a fourth of that of zd . The two diseases have similar symptoms (e.g., dysphagia, coughing, and chest pain). However, according to previous studies, kjd has more non - specific symptoms than zd . Location is a standard for distinguishing them: zd occurs mainly in the rear of the esophagus in the upper cricopharyngeal muscle, and kjd occurs mainly in the front or side of the esophagus 2 cm away from the lower cricopharyngeal muscle . The two diseases, zd and kjd, have been observed simultaneously . In rare cases, because of its symptom or greater size, endoscopic treatment and surgical treatment are used for kjd . Generally, endoscopic treatment is considered preferable in treating zenker's diverticula smaller than 3 cm . Endoscopic treatment has the possibility of occluded view when there is food or a foreign body in the diverticulum . The treatment of the kjd is more closely adjacent to the recurrent laryngeal nerves than zd . For kjd treatments that do not come into contact with the recurrent nerves, treatments other than endoscopic treatments are preferable . According to the previous studies, the safety of endoscopic treatment has not been established for kjd, due largely to the rarity of cases, and for zd the recurrence rate of endoscopic treatment is 10 times higher than that of surgical treatment . Furthermore, myotomy should be adopted as a treatment for kjd, since its treatment is closely related to the prevention of the recurrence of zd from the perspective of the features of diverticular disease . In conclusion, konkuk university hospital experienced the successful treatment of a case of kjd that had been accompanied by rare symptom and discussed the result together with the review of the relevant literary works.
Viral respiratory infections, particularly in young children and the elderly, can lead to substantial morbidity, such as increased rates of lower respiratory tract infections and hospitalization ., relatively few prospective, communitybased studies to define etiologic agents for respiratory infection have been reported .,, moreover, existing studies are limited in that most are not prospective communitybased studies, and did not use highly sensitive diagnostic testing such as rtpcr . Data are particularly sparse on the epidemiology of respiratory viruses other than influenza, respiratory syncytial virus (rsv), and parainfluenza,, and most of these studies are based on culture, antigen testing or serology that are less sensitive and specific relative to molecular assays . With the exception of influenza, specific vaccines or antiviral medications are either not widely available or have not proved effective for respiratory viral infections . Nevertheless, as vaccine development evolves and new therapeutic agents are produced, characterizing the epidemiology of viral respiratory infections will delineate the appropriate populations in whom these agents should be targeted . Furthermore, this could lead to better insights concerning those at highest risk for bacterial superinfection following viral infection . Hutterites live in british columbia, alberta, saskatchewan, and manitoba, as well as several northcentral american states where they practice communal farming on small colonies of typically 80120 people, relatively isolated from towns and cities . However, outbreaks of respiratory infection in hutterite colonies occur regularly, as viruses are introduced from exposure to people outside the community . As the colonies are not very large, it is possible to obtain detailed demographic, health, and immunization information from all members . The implementation of a cluster randomized trial aimed at reducing influenza in the canadian hutterite community allowed us to prospectively collect data on other respiratory viruses . In this report, we sought to determine agespecific incidence of laboratoryconfirmed respiratory virus infection occurring in the hutterite community and to document the temporal relationship of virusspecific attack rates . Participants were 3273 community members of 46 hutterite colonies from alberta, saskatchewan, and manitoba who were enrolled in a cluster randomized trial (september 22 to december 23, 2008). By randomizing children in the hutterite colonies to either trivalent inactivated influenza vaccine or hepatitis a vaccine, as a control, the trial was designed to determine the indirect effectiveness of influenza vaccine on unimmunized residents . The present data are based on the first year of the trial where children in colonies allocated to influenza vaccine received the vaccine recommended for the 20082009 influenza season (a / brisbane/59/2007 [h1n1]like virus, a / brisbane/10/2007 [h3n2]like virus, b / florida/4/2006like virus; vaxigrip, sanofi pasteur, lyon, france). As previously described, participants were assessed for signs and symptoms of respiratory illness over the followup period, defined by the start date (> 1 laboratoryconfirmed influenza case in two consecutive weeks from sentinel sites) and stop date (no laboratoryconfirmed influenza cases for two consecutive weeks in the sentinel sites). This period extended from december 28, 2008, until june 23, 2009 . Research nurses assessed all study participants twice weekly using a standardized checklist of selfreported symptoms or signs from study participants or parents . One representative from each household (e.g., the mother) was designated to complete the checklist for all family members and provide this when the research nurse made a site visit . If anyone reported new symptoms, the nurse interviewed the study participant to confirm their symptoms and date of onset . A nasopharyngeal specimen was obtained if two or more of the following symptoms were present: fever (38c), cough, nasal congestion, sore throat, headache, sinus problems, muscle aches, fatigue, ear ache or infection, or chills . Research nurses would also contact the household representative if the selfreported checklists were incomplete, to followup on missing data . Influenza was detected using the centers for disease control and prevention s human influenza virus realtime rtpcr detection and characterization panel, which targets the matrix gene for influenza a and nonstructural gene for influenza b. respiratory viruses were detected using a rtpcr method (xtag rvp assay; luminex, tx, usa). This assay detects coronavirus 229e, nl63, oc43, parainfluenza virus type 1, 2, 3, 4, entero / rhinovirus, respiratory syncytial virus a and b, human metapneumovirus, and adenovirus . All 3273 participants were kept in the analyses for noninfluenza viruses . However, to reduce the potential for biased estimates, 1945 participants who either individually received influenza vaccine or were in study colonies assigned to the intervention arm (influenza vaccine) were excluded from the analysis for seasonal influenza virus infection, leaving 1328 participants for the analysis . To calculate incidence, we counted only the first viral infection for a specific virus, as the numerators (agespecific), while the denominators were agespecific persondays, which included the entire period of surveillance for participants who were not infected with the specific virus along with the persondays up to the point of infection for those who were infected . If a participant was swabbed more than once within 14 days, and if the same virus was detected on 1 occasion in this time frame, then only the first episode detected was used in the analysis . To quantify the temporal relationship between the respiratory viruses, we defined an epidemic midpoint as the date when 50% of the cumulative cases of virus detected were reached over the period of surveillance . We calculated incidence using events per 1000 persondays and estimated differences in rates assuming a poisson distribution . Participants were 3273 community members of 46 hutterite colonies from alberta, saskatchewan, and manitoba who were enrolled in a cluster randomized trial (september 22 to december 23, 2008). By randomizing children in the hutterite colonies to either trivalent inactivated influenza vaccine or hepatitis a vaccine, as a control, the trial was designed to determine the indirect effectiveness of influenza vaccine on unimmunized residents . The present data are based on the first year of the trial where children in colonies allocated to influenza vaccine received the vaccine recommended for the 20082009 influenza season (a / brisbane/59/2007 [h1n1]like virus, a / brisbane/10/2007 [h3n2]like virus, b / florida/4/2006like virus; vaxigrip, sanofi pasteur, lyon, france). As previously described, participants were assessed for signs and symptoms of respiratory illness over the followup period, defined by the start date (> 1 laboratoryconfirmed influenza case in two consecutive weeks from sentinel sites) and stop date (no laboratoryconfirmed influenza cases for two consecutive weeks in the sentinel sites). This period extended from december 28, 2008, until june 23, 2009 . Research nurses assessed all study participants twice weekly using a standardized checklist of selfreported symptoms or signs from study participants or parents . One representative from each household (e.g., the mother) was designated to complete the checklist for all family members and provide this when the research nurse made a site visit . The nurse would review the checklist . If anyone reported new symptoms, the nurse interviewed the study participant to confirm their symptoms and date of onset . A nasopharyngeal specimen was obtained if two or more of the following symptoms were present: fever (38c), cough, nasal congestion, sore throat, headache, sinus problems, muscle aches, fatigue, ear ache or infection, or chills . Research nurses would also contact the household representative if the selfreported checklists were incomplete, to followup on missing data . Influenza was detected using the centers for disease control and prevention s human influenza virus realtime rtpcr detection and characterization panel, which targets the matrix gene for influenza a and nonstructural gene for influenza b. respiratory viruses were detected using a rtpcr method (xtag rvp assay; luminex, tx, usa). This assay detects coronavirus 229e, nl63, oc43, parainfluenza virus type 1, 2, 3, 4, entero / rhinovirus, respiratory syncytial virus a and b, human metapneumovirus, and adenovirus . All 3273 participants were kept in the analyses for noninfluenza viruses . However, to reduce the potential for biased estimates, 1945 participants who either individually received influenza vaccine or were in study colonies assigned to the intervention arm (influenza vaccine) were excluded from the analysis for seasonal influenza virus infection, leaving 1328 participants for the analysis . To calculate incidence, we counted only the first viral infection for a specific virus, as the numerators (agespecific), while the denominators were agespecific persondays, which included the entire period of surveillance for participants who were not infected with the specific virus along with the persondays up to the point of infection for those who were infected . If a participant was swabbed more than once within 14 days, and if the same virus was detected on 1 occasion in this time frame, then only the first episode detected was used in the analysis . To quantify the temporal relationship between the respiratory viruses, we defined an epidemic midpoint as the date when 50% of the cumulative cases of virus detected were reached over the period of surveillance . We calculated incidence using events per 1000 persondays and estimated differences in rates assuming a poisson distribution . Approximately, 40% of participants were 15 years of age or younger and comorbidity was infrequent . 362 (11%) were aged 04 years, 366 (11%) aged from 5 to 8 years, 574 (18%) aged from 9 to 14 years, 310 (10%) aged from 15 to 19 years, 410 (13%) aged from 20 to 29 years, 380 (12%) from 30 to 39 years, 409 (13%) from 40 to 49 years, and 462 (14%) aged 50 years . There were 149 (112% of 1328) with laboratoryconfirmed influenza and 595 (182% of 3273) with at least 1 episode of laboratoryconfirmed respiratory viral infection other than influenza . Of the 149 with laboratoryconfirmed influenza, 32 were also infected with another respiratory virus . Influenza (including a (h1n1), a (h3n2), and b) had the highest incidence (080/1000 persondays ci: 074087), followed by entero / rhinovirus (069/1000 persondays, ci: 065073), rsv (028/1000 persondays, ci: 025030), coronaviruses (026/1000 persondays), and parainfluenza (023/1000 persondays). The age group specific incidence of respiratory virus infection is shown in figure 1 . Among children of age <5, entero / rhinovirus had the highest incidence (136/1000 persondays; ci: 120153), but this was not significantly higher than rsv (129/1000 persondays, ci: 112145), p = 0809). Influenza b was not detected among those aged 30 and among those 4049 years of age and older, a decline in incidence was observed for entero / rhinovirus, coronaviruses, rsv, and influenza a. the incidence of parainfluenza increased among those aged 4049 years and older; in contrast, hmpv (human metapneumovirus) was not detected in those 2029 years of age or older (figure 1). In addition, the highest incidence of parainfluenza was in children aged 04 years (111/1000 persondays, ci: 095126). Specific incidences of respiratory viruses, including seasonal influenza, during the influenza season per 1000 persondays . Entero / rhinovirus had the highest agespecific incidence among participants with age 50 (033/1000 persondays, ci: 026040), which was higher than for seasonal influenza (025/1000 persondays, ci: 014036), although statistically not significant, p = 0744) (figure 1). The incidence of entero / rhinovirus in this age group was significantly higher than coronavirus (027/1000 persondays, ci: 021033, p = 001) and to rsv (006/1000 persondays, ci: 003009, p = 0005). The weekly occurrence of influenza and noninfluenza viruses was plotted in bar graphs (figure 2). The epidemic midpoint for seasonal influenza was march 23, 2009, whereas individual date values for influenza a (h1n1), a (h3n2), and b were march 9, april 7, and april 18, respectively . For coronaviruses, parainfluenza viruses, entero / rhinovirus, rsv, and hmpv these values were march 2, march 2, april 30, march 9, and march 27, respectively . Periods of occurrence and numbers of cases of respiratory viruses by cdc weeks during the influenza season 20082009 . The periods of occurrence for each virus are indicated by a horizontal line with the corresponding epidemic midpoint identified by a black circle . There are few prospective communitybased surveillance data on the circulation of noninfluenza viruses during the influenza season . In the hutterite communities we studied, a high attack rate of influenza was followed by entero / rhinovirus and then by rsv, coronavirus and parainfluenza . Most respiratory viruses had their highest incidence in children aged 08, except coronaviruses and h1n1 seasonal influenza, which had the highest incidence in ages 4049 and 1519, respectively (figure 1). Coronaviruses occurred among persons in all age groups . Typically, rsv is the most common respiratory virus identified in hospitalized children under the age of 5 years .,,, the fact that the virus with the highest attack rate in children under the age of five was entero / rhinovirus and not rsv was unanticipated even though the difference in incidence between the two was not statistically significant . It may be explained by the fact that entero / rhinovirus has a wide spectrum of disease and milder cases in our communitybased study were detected . Previous studies have reported hospitalized children with lower respiratory tract disease or severe pneumonia,, emphasizing the predilection of rsv to lead to hospitalization, but not reflecting a dominant circulating virus in the community . Our findings also suggest that the incidence of entero / rhinovirus infection in the community has been underestimated . The high incidence of entero / rhinovirus we detected might also be related to our use of rtpcr, which yields a substantially higher sensitivity compared to conventional culture . The codominance of entero / rhinovirus with influenza in this study is consistent with a recent study reporting a high incidence of entero / rhinoviruses during the influenza season . Our data suggest that entero / rhinovirus may be more common in the elderly than previously recognized, because entero / rhinovirus had the highest agespecific incidence among participants with age 50 . The relatively high incidence of entero / rhinovirus and coronavirus compared to rsv in this age group is in keeping with a previous report that included an elderly population . Parainfluenza is generally reported as the second most common virus after rsv to cause lower respiratory tract diseases in young children . In contrast, parainfluenza was less common in our study than influenza, entero / rhinovirus, coronaviruses, and rsv . The highest incidence was, however, in children aged 04 . From a clinical perspective, the high degree of cocirculation of other respiratory viruses along with influenza as shown in figure 2 raises the question of the degree to which signs and symptoms of respiratory infection are falsely attributed to influenza, which has implications for the empiric use of antivirals . A consistent finding across all respiratory viruses was that the highest incidence was in children aged 04 years or from 5 to 8 years . The incidence generally decreases in teenaged participants and in young adults and then either reaches a plateau or increases slightly with advanced age . This could be explained by the higher incidence of viral respiratory infection in age <5 compared to older individuals, but also by the lower detection rate of respiratory virus in the elderly due to reduced viral shedding in older age groups . Influenza b infection, unlike influenza a, was not observed among adults> 30 . The most likely explanation is due to the relative conservation of influenza b immunity in older individuals, as previously reported ., the incidence of entero / rhinovirus and coronavirus infection in older individuals was relatively higher than that of other viruses, consistent with previous studies . First, the respiratory virus test is performed only within symptomatic participants during the influenza season, and the respiratory virus shedding in asymptomatic control is not evaluated . Second, because the study is performed during the 20082009 influenza season, it potentially underestimates the annual incidence of respiratory viruses other than influenza which may have different season or which may cause biannual epidemic . Third, it is performed in hutterite colonies that do not represent the general population of canada . Another limitation is that there were three colonies dropped out of the study after randomization . However, as the characteristics of these colonies do not differ from those of the 46 colonies that participated the study, we consider this did not affect the results . In conclusion, there were multiple cocirculating viruses over the influenza season . Agespecific incidence of respiratory viruses was highest in young children but with unexpected high incidence of entero / rhinovirus in this group . Tae hyong kim wrote this manuscript as first author and involved in data collection and analysis . Margaret l. russell and kevin fonseca designed the study and involved in data collection, the writing and major revision of this manuscript, final approval . Gregory horsman, paul van caeseele, khami chokani, mark voight, lorraine moss richard webby, and cassandra howse involved with data collection, writing, and major revision . Lorne babiuk, david j. d. earn, pardeep singh, and fred aoki involved with analysis, writing, and major revision . Mark loeb designed the study and involved in data collection, the writing and major revision of this manuscript . Department of pathology and molecular medicine, mcmaster university, hamilton, ontario, canada . Division of infectious diseases, departments of internal medicine, soon chun hyang university seoul hospital, seoul, republic of korea . Department of community health sciences, university of calgary, alberta, canada . Provincial laboratory for public health and department of microbiology and infectious diseases, calgary, alberta, canada . Judes children s research hospital, memphis, tennessee, usa . Department of mathematics and statistics, mcmaster university, hamilton, ontario, canada . Michael g. degroote institute for infectious disease research, mcmaster university, hamilton, ontario, canada . Department of clinical epidemiology and biostatistics, mcmaster university, hamilton, ontario, cananda.
Mental disorders there was since of human creation, and based on the world health organization (who) estimation, 25% of the people suffer from at least one of these disorders . These multi - factorial syndromic disorders (genetic, physical, chemical, biological, psychological, and socio - cultural) are known to be associated with destruction in thought, mood, or behavior, and cause maladaptive behavior, disability in coping with usual stress, and destruction in function . Mood disorders are among the mental disorders that are accompanied by mood imbalance, unusual mood, and changes in physical, emotional, and behavioral responses . They range from mania to depression and involve individuals of all ages and of any gender and history . This social function disorder influences the individuals in familial, marital, occupational, and educational dimensions . Statistics show that mood disorders comprise 25% of all diseases in the us with prevalence of 1.2 - 1.6% in the general population . About 33% of iranians are involved in a type of mental diseases and the prevalence of mood disorders has been reported to be between 2 and 25%, of which two thirds suffer from depression . Trend of type ii bipolar disorder as a mood disorder is chronic and needs long - term treatment . About 40% of type i bipolar disorder patients and 20% of depressed patients have a chronic trend . Major depression is the most severe type of mood disorder and the fourth cause of disability in the world . Families are involved in numerous conflicts and problems with these patients, including treatment costs, patients conduct and control, giving daily care to these patients as a result of their lowered independency, and helping them to join the society and to have social communication with others . One of the determinants for quality of life is familial health which is expressed through family members physical health, familial psychological atmosphere, and familial socio - population characteristics . Quality of life is a vast concept influenced by personal health, mental status independence level, social communication, and communications with the environment, and each factor which has a negative effect on individuals well - being and ability in conducting their daily activities can lower the quality of life . This concept always includes five dimensions: physical, mental, spiritual, social, and disease - related signs . In families of patient with mental disease, there are problems such as sleep disorder, eating disorder, physical stress related manifestations, changes in health status behavior, and sexual problems, as well as burnout due to lesser leisure time that the family can have . In mental dimension, due to presence of the patient in the family, the family experiences problems such as daily conflicts and concerns about patients occupational and educational future, emotions like fiasco, anxiety, fear, depression, guilt, and sorrow, hopelessness, insolvency, lowered self - esteem, and feeling of shame and sadness resulting from internalizing negative social attitudes . In social dimension, there are problems like changes in social communications and a reduction in social activities and isolation, and in disease - related signs dimension, with regard to high stress and anxiety, which exists in the family, signs of physical psychosomatic diseases are observed . Family's capability to react toward the disease can be empowered through conducting interventions and making changes in the quality of life . These interventions include group psycho - education, which emphasizes on mental, social, and biological dimensions and makes a cognitive frame that helps the individuals to understand logical ideas and problems in terms of treatment and to make the best use of their acquired experiences in life . Group psycho - education is an intervention based on the needs of the group, which focuses on perception, knowledge, and skills in families who are in relation with a diseased member . The outcomes of this intervention are increased feeling of well - being, lowered level of families and individuals stress, improvement of social function, reduced negative signs and symptoms, improved insight and judgment, and lowered family's caring burden and family adaptation . Research has shown that group psycho - education can improve the quality of life in patients with major depression and bipolar disorder in the contexts of occupational, social, emotional, and physical functions, and leads to a better recovery from depression signs and patients quality of life, compared to conventional and personal treatments . In a study conducted in 2008, it was reported the group psycho - educational program was effective on reduction of disease recurrence and re - hospitalization treatments through increase of caregivers awareness and promotion of coping skills . A study conducted in 2009 showed that group psycho - education caused improvement in quality of life, a reduction in treatment costs, disease recurrence, and re - hospitalization, and higher capacity of treatment compliance, as well as a reduction in disease signs in bipolar patients . The notable point is that most of the research on group psycho - education focused on the patient and few studies were conducted on the effect of this program on these patients families and their quality of life . As the patient is a member of the family unit, and in a unit, the members affect one another, and considering the fact that quality of life is of great importance in various social groups, especially among the individuals with special physical and mental conditions and their related tensions, improvement of patients quality of life cannot be expected prior to improvement of their families quality of life . Therefore, the researchers decided to study the effect of group psycho - educational program on the quality of life in families of patients with mood disorders . This is a two - group three - step interventional study conducted on 32 families of patients with mood disorders in iran, isfahan in 2011 . The research environment comprised farabi and nour hospitals in isfahan and the study population consisted of the family members of the patients with mood disorders (spouse, father, mother, child, sister, and brother) who had caring, supportive, emotional, and economic responsibilities of the patient . Inclusion criteria were feeling to be the principal caregiver of the patient and having caring responsibility in this regard, age> 18 years, the ability to understand and speak in persian, having a fixed contact address or with phone number available, education level above primary school, residing in isfahan, attending the study as the principal caregiver, not concurrently taking care of more than one patient with a mental disorder or physical disease, taking care of a patient with mood disorder for at least 3 months, no previous attendance in family education classes, and no consumption of psychotic medication or drug abuse . The subject was excluded if he / she did not attend the family education sessions for more than two sessions or when his / her family members died during the study . Sampling was randomly conducted through referring to nour and farabi hospitals and checking the existing files related to the patients with one of mood disorders and meeting the inclusion criteria in the men and women psychiatry wards . After selecting the patients, their families were called and the research process and its goals were explained to them . Next, based on the inclusion criteria and after obtaining their consent, two 16-subject groups were selected by random numbers chart as the study and control groups . The subjects were assured about the confidentiality of their information and they were informed that they could have the research results if they liked . The subjects in the control group were informed that they would receive an educational booklet and a related cd . The first section was on personal characteristics of the family members and the patient, and the second one contained world health organization's quality of life - bref (whoqol - breef) including the four domains of physical health, mental health, social communications, and environmental health . This tool was firstly validated in iran with a goal of translation and measurement of its validity and reliability and structural factors by nejat et al . The questionnaire reliability was measured by cronbach's alpha and intra - class correlation was obtained by test the values on intra - class correlation and cronbach's alpha were obtained over 0.7 in all domains, except for social communications with cronbach's alpha of 0.55, possibly due to lesser number of questions in this domain or presence of sensible questions . Reliability of the questionnaire was assessed by linear regression in the groups of healthy and diseased subjects by distinguishing the ability of tools . The obtained results revealed validity, reliability, and acceptability of structural factors of this tool in iran in healthy and diseased subjects groups . The subjects filled the questionnaire before beginning the study, immediately after (after 10 sessions), and 1 month after the intervention . The control group received no intervention and the subjects were asked not to attend any other educational programs during the study . Group psycho - educational program [table 1] was conducted by an ms of psychiatry nursing for ten 90-min sessions twice a week for 5 weeks in the study group . Content of group psycho - educational program (length of each session was 90 min) methods such as lecture, question and answer, role play, and techniques like brain storming, group discussion, and small groups were adopted . In the end of the sessions, the related cd containing the relaxation techniques, and anger and tension control, and an educational booklet which was briefly prepared and related to the content of each session were given to the subjects . Inferential statistical tests and independent t - test showed no significant difference in the means of age, number of family members, and length of care between the two groups [table 2]. Chi - square and mann whitney tests also showed no significant difference in the personal characteristics of the family members and the patients (variables of sex, marital status, type of accommodation and occupation, relativity with the patient, and the level of education) in the two groups of study and control (p> 0.1). Independent t - test showed no significant difference in the mean scores of the quality of life before intervention in the dimensions of physical health, mental health, social communications, and environmental health and the mean total scores of quality of life, and in the mean scores of quality of life in the domain of physical health immediately after intervention between the two groups (p> 0.3). Comparison of mean scores and sds of age, number of family members, and length of care among the subjects in the study and control groups but there was a significant difference in the domains of mental health, social communications, environmental health, and the mean total scores of quality of life immediately after intervention (p <0.05). There was also a significant difference 1 month after intervention in the mean scores of quality of life in the domains of mental health, social communications, and environmental health and the mean total score of quality of life in the two groups (p <0.05), but there was no significant difference in the domain of physical health (p = 0.1). Repeated measure anova showed an increase in the mean scores of quality of life in the domain of physical health immediately after and 1 month after intervention in the study group, but this increase was not statistically significant . In the domains of mental health and social communications, there was a significant increase in three time points, whereas the mean score of quality of life firstly showed an increase and then a decrease in the domain of environmental health, but the changes were not statistically significant . In the control group, despite a reduction in the mean score, there was no significant difference in environmental health during three time points . In the study group, there was a significant increase in the mean total score of quality of life in three time points . In the control group, although there was a reduction in the mean total scores of quality of life, the reduction was not significant [table 3]. Comparison of mean total scores of quality of life and mean scores of quality of life in four domains and three time points in the two groups of study and control in this study, we tried to investigate the effect of group psycho - educational program on the quality of life in families of patients with mood disorders . Findings showed that intervention led to an increase in the mean total score of quality of life in the study group, while lack of intervention in the control group resulted in a reduction in quality of life, but the difference was not statistically significant . Therefore, the intervention resulted in prevention of the reduction in quality of life and led to its improvement in families of patients with mood disorders . Sanchez (2009) showed that group psycho - education could be effective on reducing the severity of the disease signs and improving the quality of life in patients with minor and moderate depression, and resulted in recovery, reduction in the signs, and improvement of quality of life . (2005), in a study on the effect of group psycho - education with time limitation on the perception of quality of life in bipolar patients, showed that the mean score of quality of life notably increased immediately after the intervention . The common point of the studies conducted earlier with the present study is the type of intervention, which is group psycho - education, and measurement of quality of life concept . Meanwhile, there were differences in the study population, and the number of subjects and educational sessions, and future follow - ups . (2009), in a study on families with adolescents suffering from bipolar disorder, showed that family - focused psychological education resulted in an increase in their quality of life . (2008), in a study on the efficacy of modified psycho - educational interventions on family burden and improvement of quality of life in families of bipolar patients, showed that the total score of quality of life increased in three time points (at the time of intervention and at 3 and 6 months after the intervention) in the study group . In these studies, the quality of life in families of patients with bipolar disorder, as one of the mood disorders, was measured, which is similar and consistent with the present study . Meanwhile, there were differences in the type of educational intervention, number of subjects, and future follow - ups . (2010), in a study on the effect of cognitive behavioral training on improvement of quality of life in cardiac patients, showed that cognitive behavioral education had a significant effect on the three subscales of emotional, physical, and social functions of quality of life, as well as the total score of quality of life . 2012), in a study on the effects of peer support group on promoting quality of life in patients with breast cancer, showed that the patients, supported by peers, had a higher quality of life after the intervention, and the increase in mean total score of quality of life was significant . The common point between these studies and the present study is the measurement of quality of life and its final outcome, but the study population, the type of intervention, and the number of subjects are different from those of the present study . Despite this, it is observed that the interventions with educational origin can affect not only patients quality of life but also their families quality of life in different populations . The reason can be attributed to the increase of awareness, perception, knowledge, and insight, which is obtained through receiving information by this type of intervention . Quality of life is defined as individuals perception from their situations in life from the cultural point, the value system in which they live, as well as their goals, expectations, standards, and priorities . It is absolutely personal and cannot be observed by others, and is founded on individuals perceptions from their life, so these positive results and effects can be interpreted . Repeated measure anova showed an increase in the mean scores of quality of life immediately after and 1 month after the intervention in the domains of physical health, mental health, and social communications in the study group, of which except for the domain of physical health, the increase was significant . In the domain of environmental health, the mean score of quality of life firstly showed an increase and then a decrease, but the difference was not significant . (2005), in a separate study on the domains of quality of life, reported significant changes in the domains of physical health and general satisfaction, but no significant difference in the domain of social communications despite its increasing trend . (2008) showed that there was an increase in the mean scores of physical health, mental health, and environmental health and a decrease in the mean score of social communications, 3 months after intervention, but the increase and decrease were not significant . Six months after intervention, there was an increase in the mean scores of physical health, mental and environmental health, but the difference was not significant . There was a decrease in the mean score of social communications, which was not significant . In the study group, only in the domains of physical health and mental health, there was a significant difference in the 6 month . (2012) showed that the differences in subscales were significant in two phases of intervention in tehran . The differences in the results of some of the domains including physical health and social communications in the studies conducted, compared to the present study, can be due to the difference in sample size, type of intervention and its length, and the follow - ups . In the present study, a lower sample size has been adopted compared to other studies and the follow - up lasted for 1 month after intervention, but in other studies, a longer time was considered to investigate the longevity of effect for intervention . The obtained finding of the present study showed the positive effect of the group psycho - educational program on quality of life of the families with patients of mood disorders . The findings of the present study are expected to be applied in counseling, clinical and research domains . Psychiatric nurses are in touch with these families in their counseling sessions and can use group psycho - educational method for family group counseling . Research showed that if group psycho - education is administered by trained nurses, more participants join the program . Nurses can also conduct this program in psychiatric ward to increase patients and families awareness and knowledge, in order to take steps toward promotion of their quality of life . The limitations of the present study included less number of subjects and short time of follow - up to investigate the longevity of intervention effect . The researchers hope their obtained results to be useful to conduct further studies to promote the quality of life of the families with a patient of a mental disorder . It is suggested to conduct a study with higher sample size and longer follow - up to investigate the effect of a group psycho - educational program not only on the quality of life of families of patients with mood disorders but also on the families with patients of other mental disorders.
Pyoderma gangrenosusm (pg) is a chronic, rare, inflammatory cutaneous disorder and is manifested by the development of painful ulcers, bulla, pustules and rarely vegetating lesions and histologically by predominantly neutrophilic infiltration . We report a case of severe pg in a girl since her 4 months of age . The difficulty in diagnosis and methodical approach in such cases is highlighted . A 6-month - old hindu girl presented with progressive, extensive, and painful ulcers since her 4 months of age . Ulcers developed from erythematous papules and vesicles, had purple red undermined margin, raw or crusted surface, merged with other ulcers in the neighborhood and formed large (even> 8 cm) lesions with annular, polycyclic or crescent shape . They were distributed over scalp, face, ear, trunk (less over anterior trunk), buttocks, thigh, legs, dorsum of hands and feet without any mucosal involvement [figure 1]. (a) face, (b) arm, (c) dorsum of hand, (d) leg, (e) thigh, (f) back, (g) encircled site where intradermal normal saline was injected, (h) same site after 48 h showing pustulation (positive pathergy test) the child was playful with normal physical and intellectual growth . There was mild fever, moderate pallor without any cyanosis, clubbing, organomegaly, lymphadenopathy, or joint abnormality . Pustule developed following intradermal injection of normal saline on normal skin (positive pathergy test) [figure 1 (g, h)]. There was low hemoglobin (8.9 gm / dl), leucocytosis (22,600/cmm), neutrophilia (70%), and elevated sedimentation rate (69 mmhg). Chest x - ray, mantoux test, dna - pcr for tuberculosis, immunoglobulin level, ra factor, ana (hep-2 cell), vdrl, c - anca, hiv- elisa, pus culture, and colonoscopy of rectal mucosa revealed no abnormality . Histopathology of the skin biopsies with h and e stain from the margin of the ulcer from two different sites showed epidermal ulceration and dense dermoepidermal collection of inflammatory exudates consisting predominantly of neutrophils with occasional multinucleated giant cells [figure 2]. One of the biopsies also showed foci of granulomatous reaction [figure 2, inset]. Z - n stain (for afb) and pas stain (for fungus) were negative . Photomicrograph showing ulceration of epidermis and collection of inflammatory exudates along with occasional giant cells (h and e, 100). Inset showing ill formed granuloma with giant cells (h and e, 400) it was diagnosed as a case of pyoderma gangrenosum . The patient responded satisfactorily to oral prednisolone (2 mg / kg / day). However, there were signs of relapse with dose less than 1 mg / kg / day . At that time, the patient became irregular in follow - up and finally lost to follow up . In most of the cases, pg is associated with some systemic diseases like inflammatory bowel diseases (ibd), rheumatoid arthritis, myeloproliferative disease, etc . Extensive distribution of the disease was unusual for an infant with pg who generally have ulcers on head and buttocks . Onset at 4 months of age was extremely rare and possibly not reported so far . Due to much atypicality, diagnosis was difficult and many possibilities were considered like pg, tuberculous, atypical mycobacterial infection, fungal, malignant and vasculitic ulcers, wegener's granulomatosis, sweet's syndrome, and epidermolysis bullosa . Violaceous undermined margin with erythematous halo, pain, characteristic histological appearance and positive pathergy test were helpful for diagnosis . Multiple site colonoscopic biopsies from even normal rectal mucosa could have increased the diagnostic yield for any subclinical evidence of ibd . The case
We studied two prospective cohorts recruited antenatally in southampton, u.k . In the pah study, caucasian women 16 years old with singleton pregnancies <17 weeks gestation were recruited and a validated food frequency questionnaire (23) was administered at 15 weeks gestation; patients with diabetes and hormonally induced conceptions were excluded . Two hundred and sixteen (47%) attended a clinic, and adiposity was measured using dual energy x - ray absorptiometry (dexa); 78 had dna available from an umbilical cord sample collected at birth and stored at 80c . Women aged 2034 years were recruited when not pregnant; those who subsequently conceived were followed through pregnancy and the offspring followed up (22). To replicate associations with adiposity found in the pah cohort, we studied 239 children selected as having both umbilical cord dna available and childhood adiposity measurements . Both groups underwent adiposity measurement by dexa (pah study, age 9 years: lunar dpx - l, pediatric software, version 4.7c; ge corporation, madison, wi; sws, age 6 years: hologic discovery, pediatric scan mode; hologic, bedford, ma). Follow - up of the children and sample collection / analysis was carried out under institutional review board approval (southampton and sw hampshire research ethics committee) with written informed consent . Dna from 15 randomly selected pah study umbilical cords underwent methylation - specific chromatin precipitation followed by hybridization to a commercial tiled oligomer microarray (nimblegen systems hg17_min_promoter array), which uses 50-mer oligonucleotides positioned on average every 100 bp from 3,750 bp to + 500 bp relative to the transcription start site of 24,134 human genes . We focused our analysis initially on a panel of 78 candidate genes, 28 selected on the basis of animal data from our and other laboratories (25,26) and 50 selected from the array as having the highest sd between subjects relative to the sd of within - subject replicates . For this panel we identified those with correlations between overall gene methylation status and dexa measurements of adiposity at age 9 years and from these genes chose five genes for further study based on individual oligomers showing evidence of correlation with dexa measurements at age 9 years, biological plausibility and feasibility of designing amplicons suitable for sequenom analysis; genes selected were retinoid x receptor- (rxra), endothelial nitric oxide synthase (enos), superoxide dismutase-1 (sod1), interleukin-8 (il8), and phosphoinositide-3-kinase, catalytic, -polypeptide (pi3kcd). These genes all had associations of comparable strength between childhood body composition and both overall gene promoter methylation and the methylation of individual oligomers . All chromosomal coordinates are based on university of california santa cruz, human genome march 2006 assembly (hg18). Genomic dna was purified from frozen cords by proteinase k digestion and phenol: chloroform extraction . Briefly, gene - specific amplification of bisulfite - treated dna was followed by in vitro transcription and analysis by matrix - assisted laser desorption ionization time - of - flight (maldi - tof) mass spectrometry (27,28). Dna (1 g) was bisulfite converted using ez dna methylation kit (zymo research). Each reverse primer contained a t7-promoter tag for in vitro transcription (5-cagtaatacgactcactatagggagaaggct-3), and the forward primer was tagged with a 10mer to balance tm (5-aggaagagag-3). Supplementary table 1 lists amplicons, primer sequences, pcr annealing temperature, and genomic coordinates for the extended promoter regions measured . Bisulfite - treated dna was pcr amplified (qiagen hotstar taq polymerase) in 5 l reactions and treated with shrimp alkaline phosphatase (sequenom) (20 min at 37c), heat inactivated (85c for 5 min), and simultaneous in vitro transcription / uracil - cleavage reaction was carried out (7 l reactions) using sequenom t - cleavage reagent mix . Transcription cleavage products were desalted with 6 mg of clean - resin and 20 nl spotted on a 384-pad spectrochip (sequenom) using a massarray nanodispenser (samsung). Mass spectra were acquired using a massarray maldi - tof ms (bruker - sequenom) and peak detection, signal - to - noise calculations, and quantitative cpg site methylation performed using proprietary epityper software v1.0 (sequenom). Consistent with the manufacturer s specification (www.sequenom.com) agreement between technical replicates was good, duplicate measures differing by <10% methylation in almost all cases . We excluded from analysis samples that failed to give a reliable pcr product or produced spectra with low confidence scores (<2.9 in epityper). For fragments containing a single cpg site, dna methylation was calculated by the ratio of methylated to unmethylated fragments . Limitations imposed by sequenom analysis treat cleavage products containing multiple cpg sites as single units, and the methylation values reported are weighted averages across the unit (referred to as a cpg group). Dna quality and no - template controls, 0%, and 100% methylated dna were included in all assays . Supplementary table 2 shows the distributions of methylation values for cpgs and cpg groups and numbers of subjects with measurements available . Pyrosequencing analysis (pyromark q96md; qiagen) was undertaken to exclude single nucleotide polymorphisms (snps) involving cpg dinucleotides, which would result in loss of potential for methylation . Briefly, dna was pcr amplified, and the product annealed to streptavidin - coated sepharose beads and denatured (0.2 m naoh) to a single - stranded product . Nucleotides were incorporated to the open 3 dna strand in which pyrophosphate is released and used in a sulfurylase reaction emitting atp, measured in a luciferase reaction, and analyzed using pyromark md v1.0 software (qiagen) (29). Using stata 11 (statacorp) study variables were transformed using fisher - yates (30) (for methylation measurements) or logarithmic transformations where necessary to satisfy statistical assumptions of normality . A priori we restricted the analysis to cpgs with median methylation 5% and a 595% range 10% . In pah subjects we first used pearson correlation (rp) and linear regression to examine cpg methylation in relation to child s adiposity . Mutually adjusted regression models were built including cpg sites significantly associated with each outcome in univariate analyses (p <0.05). Because the measurements of childhood adiposity are on the log scale and the cpg measurements are z scores, the exponentiated results are interpreted as percent change in childhood adiposity measurements per sd change in methylation . To allow assessment of the influence of taking account of the child s sex, exponentiated regression coefficients are first presented excluding and including adjustment for child's sex . We then preadjusted all adiposity measurements for sex and took account of the mother s age, adiposity (as continuous variables), and smoking during pregnancy (as a binary variable, yes / no) by including them as covariates in the regression model; we next related mother s diet to cpg methylation at birth . Finally, we sought replication of the associations between cpg methylation and child s adiposity in the sws cohort . Sws measurements, taken over a wider age range than those in pah subjects, were preadjusted for age and sex . Dna from 15 randomly selected pah study umbilical cords underwent methylation - specific chromatin precipitation followed by hybridization to a commercial tiled oligomer microarray (nimblegen systems hg17_min_promoter array), which uses 50-mer oligonucleotides positioned on average every 100 bp from 3,750 bp to + 500 bp relative to the transcription start site of 24,134 human genes . We focused our analysis initially on a panel of 78 candidate genes, 28 selected on the basis of animal data from our and other laboratories (25,26) and 50 selected from the array as having the highest sd between subjects relative to the sd of within - subject replicates . For this panel we identified those with correlations between overall gene methylation status and dexa measurements of adiposity at age 9 years and from these genes chose five genes for further study based on individual oligomers showing evidence of correlation with dexa measurements at age 9 years, biological plausibility and feasibility of designing amplicons suitable for sequenom analysis; genes selected were retinoid x receptor- (rxra), endothelial nitric oxide synthase (enos), superoxide dismutase-1 (sod1), interleukin-8 (il8), and phosphoinositide-3-kinase, catalytic, -polypeptide (pi3kcd). These genes all had associations of comparable strength between childhood body composition and both overall gene promoter methylation and the methylation of individual oligomers . All chromosomal coordinates are based on university of california santa cruz, human genome march 2006 assembly (hg18). Genomic dna was purified from frozen cords by proteinase k digestion and phenol: chloroform extraction . Briefly, gene - specific amplification of bisulfite - treated dna was followed by in vitro transcription and analysis by matrix - assisted laser desorption ionization time - of - flight (maldi - tof) mass spectrometry (27,28). Dna (1 g) was bisulfite converted using ez dna methylation kit (zymo research). Each reverse primer contained a t7-promoter tag for in vitro transcription (5-cagtaatacgactcactatagggagaaggct-3), and the forward primer was tagged with a 10mer to balance tm (5-aggaagagag-3). Supplementary table 1 lists amplicons, primer sequences, pcr annealing temperature, and genomic coordinates for the extended promoter regions measured . Bisulfite - treated dna was pcr amplified (qiagen hotstar taq polymerase) in 5 l reactions and treated with shrimp alkaline phosphatase (sequenom) (20 min at 37c), heat inactivated (85c for 5 min), and simultaneous in vitro transcription / uracil - cleavage reaction was carried out (7 l reactions) using sequenom t - cleavage reagent mix . Transcription cleavage products were desalted with 6 mg of clean - resin and 20 nl spotted on a 384-pad spectrochip (sequenom) using a massarray nanodispenser (samsung). Mass spectra were acquired using a massarray maldi - tof ms (bruker - sequenom) and peak detection, signal - to - noise calculations, and quantitative cpg site methylation performed using proprietary epityper software v1.0 (sequenom). Consistent with the manufacturer s specification (www.sequenom.com) agreement between technical replicates was good, duplicate measures differing by <10% methylation in almost all cases . We excluded from analysis samples that failed to give a reliable pcr product or produced spectra with low confidence scores (<2.9 in epityper). For fragments containing a single cpg site, dna methylation was calculated by the ratio of methylated to unmethylated fragments . Limitations imposed by sequenom analysis treat cleavage products containing multiple cpg sites as single units, and the methylation values reported are weighted averages across the unit (referred to as a cpg group). Dna quality and no - template controls, 0%, and 100% methylated dna were included in all assays . Supplementary table 2 shows the distributions of methylation values for cpgs and cpg groups and numbers of subjects with measurements available . Pyrosequencing analysis (pyromark q96md; qiagen) was undertaken to exclude single nucleotide polymorphisms (snps) involving cpg dinucleotides, which would result in loss of potential for methylation . Briefly, dna was pcr amplified, and the product annealed to streptavidin - coated sepharose beads and denatured (0.2 m naoh) to a single - stranded product . Nucleotides were incorporated to the open 3 dna strand in which pyrophosphate is released and used in a sulfurylase reaction emitting atp, measured in a luciferase reaction, and analyzed using pyromark md v1.0 software (qiagen) (29). Using stata 11 (statacorp) study variables were transformed using fisher - yates (30) (for methylation measurements) or logarithmic transformations where necessary to satisfy statistical assumptions of normality . A priori we restricted the analysis to cpgs with median methylation 5% and a 595% range 10% . In pah subjects we first used pearson correlation (rp) and linear regression to examine cpg methylation in relation to child s adiposity . Mutually adjusted regression models were built including cpg sites significantly associated with each outcome in univariate analyses (p <0.05). Because the measurements of childhood adiposity are on the log scale and the cpg measurements are z scores, the exponentiated results are interpreted as percent change in childhood adiposity measurements per sd change in methylation . To allow assessment of the influence of taking account of the child s sex, exponentiated regression coefficients are first presented excluding and including adjustment for child's sex . We then preadjusted all adiposity measurements for sex and took account of the mother s age, adiposity (as continuous variables), and smoking during pregnancy (as a binary variable, yes / no) by including them as covariates in the regression model; we next related mother s diet to cpg methylation at birth . Finally, we sought replication of the associations between cpg methylation and child s adiposity in the sws cohort . Sws measurements, taken over a wider age range than those in pah subjects, were preadjusted for age and sex . Median (interquartile range) birth weight, age, fat mass, and% body fat at follow - up values for the pah subjects were 3,330 g (3,0103,790), 8.66 years (8.528.73), 5.41 kg (3.978.41), and 18.3% (14.427.0), respectively . Comparable values for the 239 sws children were 3,485 g (3,2053,773), 6.59 years (6.416.78), 4.60 kg (3.665.69), and 23.4% (19.727.6), respectively . Similar percentages of mothers smoked in the pah and sws cohorts (21 vs. 24%, respectively); median maternal age and prepregnancy bmi were lower in the pah mothers (28 vs. 31 years and 22.3 vs. 24.3 kg / m, respectively). The above characteristics are similar to the overall values for participants in the two cohorts . Supplementary table 2 shows the distribution of percent methylation of the 68 cpgs and cpg groups among the 78 pah subjects; 31 cpgs / cpg groups met a priori criteria for further analysis . Particularly marked interindividual variation in percent methylation was seen at some sites (for example, rxra chr9:136355885 + had a median of 59% with 595th centiles 499%; enos correlations between methylation of different cpgs were generally low (for example rp= 0.03, p = 0.81, n = 55 between the above two cpgs). Of the 31 cpgs with variable methylation above the a priori threshold, seven had significant associations with the child s adiposity at age 9 years (supplementary table 3). Table 1 shows the results of uni- and multivariate analyses of cpg sites with significant independent associations with the child s adiposity . Comparison of the regression coefficients for the univariate and multivariate associations of rxra chr9:136355885 + and enos chr7:150315553 + methylation with child s fat mass,% fat, and ratio of trunk to limb fat shows that mutual adjustment for each other and sex has little effect on the coefficients; adiposity measurements were therefore preadjusted for sex in further analyses . Rxra chr9:136355885 + methylation had positive associations with childhood fat mass,% fat mass (scatterplots shown in supplementary fig . 1), and ratio of trunk to limb fat, with similar positive associations for enos chr7:150315553 +: exponentiated regression coefficients () (95% ci) per sd change in methylation were 17% (431), p = 0.009; 10% (119), p = 0.023; and 6% (012), p = 0.039, respectively (n = 64). Comparable values for enos chr7:150315553 + methylation were 20% (932), p <0.001; 12% (420), p = 0.002; and 7% (213), p = 0.007, respectively (n = 66). Methylation of rxra chr9:136355885 + and enos chr7:150315553 + had similar positive associations with child s bmi (= 3% [06], p = 0.037; and 4% [27], p = 0.001, respectively). Independently of rxra chr9:136355885 + and enos chr7:150315553 + methylation, sod1 chr21:31853660/63 + methylation was also inversely related to child s trunk - to - limb fat ratio (p = 0.037). The associations reflect clinically important shifts in adiposity such that the mean fat mass rose from 4.8 kg (17.3% body fat) in the lowest quarter of rxra chr9:136355885 + methylation to 6.6 kg (21.3% body fat) in the highest quarter of the distribution . Taking account of rxra chr9:136355885 + methylation and sex explained 26% of the variance in fat mass in pah children, and simultaneous analyses showed that the association between rxra chr9:136355885 + methylation and child s fat mass was not attenuated after adjustment for birth weight and mother s age, smoking, and bmi . Univariate and multivariate analyses of umbilical cord cpg methylation in relation to child s adiposity measured by dexa at age 9 years values are the percent change in outcome variable per sd change in cpg methylation and p value . Univariate analysis rows show the regression coefficients and p values relating each of enos chr7:150315553 +, rxra chr9:136355885 +, and sex to outcomes individually, whereas multivariate analysis rows show regression coefficients and p values for a combined analysis of enos chr7:150315553 +, rxra chr9:136355885 +, and sex in relation to outcomes, together with the variance explained by the multivariate model . For variances explained, n = 55 . In this population we have previously linked lower maternal carbohydrate intake in early pregnancy with higher neonatal adiposity (21). Relating umbilical cord cpg methylation to maternal carbohydrate intake in early pregnancy, higher methylation of rxra chr9:136355885 +, but not of enos chr7:150315553 +, was associated with a lower maternal carbohydrate intake (fig . The mother s early pregnancy fat and protein intakes in early pregnancy were not associated with cord rxra chr9:136355885 + methylation (p = 0.7 and p = 0.6, respectively), and no additional variance in rxra chr9:136355885 + methylation was explained by simultaneously taking account of maternal fat and protein intakes in early pregnancy or macronutrient intakes in late pregnancy . Relating umbilical cord cpg methylation to the infant s size at birth, only three cpgs showed a significant correlation with birth weight adjusted for sex and gestational age (pik3cd chr1:9609980 + [rp= 0.32, p = 0.013, n = 58], pik3cd chr1:9635676/79 + [rp= 0.36, p = 0.028, n = 37], and sod1 chr 21:31853827 + [rp= 0.27, p = 0.029, n = 65]). Rxra chr9:136355885 + methylation showed a weak association with the subjects sex and age - adjusted height (rp= 0.24, p = 0.054) but was not associated with the infant s weight or ponderal index at birth . Lower maternal carbohydrate in early pregnancy is associated with higher umbilical cord rxra chr9:136355885 + methylation in the pah cohort . We next sought to replicate the stronger associations found in the first cohort (enos chr7:150315553 + and rxra chr9:136355885 + cpg methylation and child s adiposity) in the sws cohort (20). In these 239 sws children, enos chr7:150315553 + showed no association with adiposity, but rxra chr9:136355885 + showed remarkably similar and statistically significant associations (fat mass, = 6% [210], p = 0.002;% fat mass, = 4% [17], p = 0.002, both as in the pah cohort, these associations were little changed after taking account of birth weight and maternal age, smoking, and bmi . Figures 2 and 3 show the graded associations between cord rxra chr9:136355885 + methylation and child s fat mass and% fat mass in the two cohorts . Child s% fat mass and fat mass at age 9 years increase with higher umbilical cord rxra chr9:136355885 + methylation in the pah cohort . * fat mass and percentage fat mass are preadjusted for sex . In a second independent cohort, child s% fat mass and fat mass at age 6 years increase with higher umbilical cord rxra chr9:136355885 + methylation in sws subjects . Pyrosequencing across rxra chr9:136355885 + in sws subjects showed no c allele snps that could account for differences in methylation observed between individuals . Supplementary table 2 shows the distribution of percent methylation of the 68 cpgs and cpg groups among the 78 pah subjects; 31 cpgs / cpg groups met a priori criteria for further analysis . Particularly marked interindividual variation in percent methylation was seen at some sites (for example, rxra chr9:136355885 + had a median of 59% with 595th centiles 499%; enos correlations between methylation of different cpgs were generally low (for example rp= 0.03, p = 0.81, n = 55 between the above two cpgs). Of the 31 cpgs with variable methylation above the a priori threshold, seven had significant associations with the child s adiposity at age 9 years (supplementary table 3). Table 1 shows the results of uni- and multivariate analyses of cpg sites with significant independent associations with the child s adiposity . Comparison of the regression coefficients for the univariate and multivariate associations of rxra chr9:136355885 + and enos chr7:150315553 + methylation with child s fat mass,% fat, and ratio of trunk to limb fat shows that mutual adjustment for each other and sex has little effect on the coefficients; adiposity measurements were therefore preadjusted for sex in further analyses . Rxra chr9:136355885 + methylation had positive associations with childhood fat mass,% fat mass (scatterplots shown in supplementary fig . 1), and ratio of trunk to limb fat, with similar positive associations for enos chr7:150315553 +: exponentiated regression coefficients () (95% ci) per sd change in methylation were 17% (431), p = 0.009; 10% (119), p = 0.023; and 6% (012), p = 0.039, respectively (n = 64). Comparable values for enos chr7:150315553 + methylation were 20% (932), p <0.001; 12% (420), p = 0.002; and 7% (213), p = 0.007, respectively (n = 66). Methylation of rxra chr9:136355885 + and enos chr7:150315553 + had similar positive associations with child s bmi (= 3% [06], p = 0.037; and 4% [27], p = 0.001, respectively). Independently of rxra chr9:136355885 + and enos chr7:150315553 + methylation, sod1 chr21:31853660/63 + methylation was also inversely related to child s trunk - to - limb fat ratio (p = 0.037). The associations reflect clinically important shifts in adiposity such that the mean fat mass rose from 4.8 kg (17.3% body fat) in the lowest quarter of rxra chr9:136355885 + methylation to 6.6 kg (21.3% body fat) in the highest quarter of the distribution . Taking account of rxra chr9:136355885 + methylation and sex explained 26% of the variance in fat mass in pah children, and simultaneous analyses showed that the association between rxra chr9:136355885 + methylation and child s fat mass was not attenuated after adjustment for birth weight and mother s age, smoking, and bmi . Univariate and multivariate analyses of umbilical cord cpg methylation in relation to child s adiposity measured by dexa at age 9 years values are the percent change in outcome variable per sd change in cpg methylation and p value . Univariate analysis rows show the regression coefficients and p values relating each of enos chr7:150315553 +, rxra chr9:136355885 +, and sex to outcomes individually, whereas multivariate analysis rows show regression coefficients and p values for a combined analysis of enos chr7:150315553 +, rxra chr9:136355885 +, and sex in relation to outcomes, together with the variance explained by the multivariate model . For variances explained, n = 55 . In this population we have previously linked lower maternal carbohydrate intake in early pregnancy with higher neonatal adiposity (21). Relating umbilical cord cpg methylation to maternal carbohydrate intake in early pregnancy, higher methylation of rxra chr9:136355885 +, but not of enos chr7:150315553 +, was associated with a lower maternal carbohydrate intake (fig . The mother s early pregnancy fat and protein intakes in early pregnancy were not associated with cord rxra chr9:136355885 + methylation (p = 0.7 and p = 0.6, respectively), and no additional variance in rxra chr9:136355885 + methylation was explained by simultaneously taking account of maternal fat and protein intakes in early pregnancy or macronutrient intakes in late pregnancy . Relating umbilical cord cpg methylation to the infant s size at birth, only three cpgs showed a significant correlation with birth weight adjusted for sex and gestational age (pik3cd chr1:9609980 + [rp= 0.32, p = 0.013, n = 58], pik3cd chr1:9635676/79 + [rp= 0.36, p = 0.028, n = 37], and sod1 chr 21:31853827 + [rp= 0.27, p = 0.029, n = 65]). Rxra chr9:136355885 + methylation showed a weak association with the subjects sex and age - adjusted height (rp= 0.24, p = 0.054) but was not associated with the infant s weight or ponderal index at birth . Lower maternal carbohydrate in early pregnancy is associated with higher umbilical cord rxra chr9:136355885 + methylation in the pah cohort . We next sought to replicate the stronger associations found in the first cohort (enos chr7:150315553 + and rxra chr9:136355885 + cpg methylation and child s adiposity) in the sws cohort (20). In these 239 sws children, enos chr7:150315553 + showed no association with adiposity, but rxra chr9:136355885 + showed remarkably similar and statistically significant associations (fat mass, = 6% [210], p = 0.002;% fat mass, = 4% [17], p = 0.002, both as in the pah cohort, these associations were little changed after taking account of birth weight and maternal age, smoking, and bmi . Figures 2 and 3 show the graded associations between cord rxra chr9:136355885 + methylation and child s fat mass and% fat mass in the two cohorts . Child s% fat mass and fat mass at age 9 years increase with higher umbilical cord rxra chr9:136355885 + methylation in the pah cohort . * fat mass and percentage fat mass are preadjusted for sex . In a second independent cohort, child s% fat mass and fat mass at age 6 years increase with higher umbilical cord rxra chr9:136355885 + methylation in sws subjects . Pyrosequencing across rxra chr9:136355885 + in sws subjects showed no c allele snps that could account for differences in methylation observed between individuals . This study provides novel evidence for the importance of the developmental contribution to later adiposity . We found that greater methylation of rxra chr9:136355885 + measured at birth was strongly correlated with greater adiposity in later childhood in two independent cohorts . Although we studied a subset of children in both cohorts these were selected on the basis of subject and specimen availability, so it is unlikely that selection bias could explain the relationships observed unless the association between rxra methylation and adiposity was different in the remainder of the cohort . The data build on animal experiments suggesting that the developmental environment acts through epigenetic processes to exert a strong influence on postnatal body composition and metabolic function (711). Our study shows that specific components of the epigenetic state at birth predict later childhood adiposity . The associations with adiposity were linked to specific cpgs 5 to the start site of the selected candidate genes . Although some of the cpgs studied were either within the proximal promoter or close to it, others were more distal and may be exerting effects through the regulation of other genes . Our observation that adjacent or nearby cpgs within the same promoter showed differences in the strength of association with child s adiposity suggests highly specific changes in the transcriptional regulation of these genes induced by the developmental environment, rather than generalized changes in promoter methylation . Both cpg hyper- (enos chr7:150315553 + and rxra chr9:136355885 +) and hypomethylation (sod1 chr21:31853660/63 +) at different sites were associated with body fat distribution, again indicating complexity in transcriptional control . The specificity of the associations between methylation of an individual cpg and both maternal diet and child s phenotype endorses the concept of a fine control of development by environmental factors via epigenetic processes . Our observation indicates one potential mechanistic pathway involved, because induction of transcription by rxra is dependent on its binding to ligands including the peroxisome proliferator activated receptors, involved in insulin sensitivity, adipogenesis, and fat metabolism (31,32). Moreover, rxra chr9:136355885 + is located in a region considered to contain positive regulatory elements of transcription (33). Figure 4 shows the proximity of rxra chr9:136355885 + to proposed binding sites for rxr, maf, nf-b, and ap1 . Retinoid receptor biology is complex, and increased rxra methylation might be acting through a variety of pathways (34); however, an association between increased rxra methylation and adiposity is consistent with the observation of strongly diminished rxra expression in visceral white adipose tissue from obese mice (35). Moreover, a role for retinoid receptor methylation in developmental influences on later metabolic risk is supported by recent experimental data showing an influence of maternal diet during pregnancy on methylation of lxra, a heterodimeric partner of rxra (36). Schematic diagram of the rxra promoter region, showing the position of the cpg group at rxra chr9:136355885 + (underlined) and of neighboring transcription factor binding sites . Genome - wide association studies suggest that fixed genetic variation makes a relatively small contribution to risk of obesity, heart disease, and diabetes (1,2); our findings raise the possibility that the developmental environment component may be equally or more important . We excluded the presence of a snp at rxra chr9:136355885 + by sequencing, but without genome - wide analysis it is not possible to exclude a genetic effect of distant snps, which could influence both dna methylation of a particular sequence and child s phenotype . However, even if this were the case, our data clearly indicate that epigenetic measures at birth may have prognostic value . Although epigenetic changes can be dynamic, experimental studies have shown that environmental factors acting on the genotype during development relate to epigenetic profile in adulthood (7,15), and there are longitudinal human studies showing that dna methylation is often stable over time (37). Such changes can be tissue specific, and in this respect the umbilical cord may be advantageous because it contains a high proportion of fetal vascular tissue and mesenchymal cells, which may be relevant to later adiposity . Furthermore, unlike the placenta it is a tissue in which consistency of sampling between individuals is more likely . Although experimental work in the rat suggests that methylation changes induced by maternal diet can be similar in the umbilical cord and liver (38), further work is needed to determine the relevance of epigenetic changes in human umbilical cord tissue . Recent data show that for some genomic regions methylation appears largely independent of tissue of origin, whereas for others there is a clear tissue - specific dependence (39). Many epidemiological studies have shown associations between fetal development, through the proxy measure of birth size, and later adiposity and metabolic function (3,4), but the developmental contribution to such phenotypic characteristics has remained uncertain and controversial . This study provides the first estimate of the developmental contribution to phenotype associated with human disease risk based on measures of the underpinning biology: our data for rxra chr9:136355885 + suggest that a substantial proportion of the variation in adiposity in prepubertal children can be explained by epigenetic measurements made at birth . Although our data are correlative and thus can only imply an association between dna methylation at birth and later phenotype, the importance of the observation stands irrespective of whether the rxra methylation is causally related to the development of adiposity . Even if it is simply a noncausal association, the changed epigenetic status provides an objective marker of altered developmental trajectory by the time of birth . Despite the limitations of dietary intake assessment tools, the instrument we used is both validated and provides information that can be used to rank the nutrient intakes of individuals (23). Methylation of enos chr7:150315553 + was associated with later adiposity in the initial cohort only . This may reflect a chance finding, or different maternal characteristics in the two cohorts, such as the greater maternal adiposity and maternal folate supplementation in the sws cohort (22,40,41). Alternatively, adipocyte proliferation is high during the first year of life but then remains low until a second proliferative phase from age 914 years (42). Thus the processes that determine adiposity at age 9 years might differ from those at age 6 years . Therefore, a further possible explanation is that enos methylation in umbilical cord marks capacity for adipogenesis which has a greater net contribution to adiposity at age 9 years than age 6 years . Our findings show strong associations between epigenetic markers and childhood total and central body fat . Beyond these simple associations, multivariate analysis indicates that the associations explain substantial proportions of the variances in outcomes, emphasizing an important developmental contribution to phenotypes associated with metabolic dysfunction and disease risk . It is noteworthy that the genes for which we report effects are not imprinted . In vitro fertilization increases risk of imprinting disorders (44), and methylation effects on imprinted genes have been reported in offspring of mothers exposed to famine during various periods of pregnancy (45,46), but with no associations with phenotype reported . The current study implicates the human prenatal environment with epigenetic changes in nonimprinted genes and is the first to link epigenetic status at birth with clinically relevant later phenotypic variation . Variation in the degree of methylation of nonimprinted genes and in later cardiovascular and metabolic physiology can be induced experimentally by manipulation of the developmental environment, for example by altering maternal nutrition or administering glucocorticoids during pregnancy (8,9), often without necessarily affecting the birth size of the offspring . Although we found associations between some epigenetic markers and birth weight, these were weaker associations than those with later phenotype and were for different markers; moreover, previous reports on the same cohort showed only modest associations between birth weight and later body composition (6). Because birth weight in humans is influenced by multiple factors including the mother s own birth weight and height and by gestational length (40), epigenetic changes may provide a more sensitive index than birth weight of environmentally induced effects on fetal development . There are potentially important implications of the strong and replicated association between rxra chr9:136355885 + methylation and later adiposity . First, the effect is considerably greater than that of factors such as birth weight or maternal body composition, suggesting that epigenetic measurements made in the neonate may be useful predictors of later obesity and other phenotypic outcomes . Second, the association between cpg methylation and child s adiposity operates within the normal ranges of maternal nutritional state and birth size; this supports the argument that developmental programming is the consequence of an evolved and potentially adaptive process involving the mechanisms of developmental plasticity (10). Indeed the data provide strong evidence supporting a role for developmental plasticity in determining individual risk of metabolic disease . Third, the data suggest that developmental factors may be more significant in contributing to phenotypic variation and disease risk than generally considered . Fourth, the association between rxra chr9:136355885 + methylation and mother s carbohydrate intake raises the possibility that conditions in early pregnancy could affect child s adiposity through this pathway . This provides additional support for the argument that all women of reproductive age should have appropriate nutritional, education, and lifestyle support to improve the health of the next generation . Finally, our data suggest that epigenetic measures at birth may have prognostic value and potential utility for monitoring programs to optimize maternal health and nutrition for long - term benefits to the offspring; however, evaluation of this possibility will require further research correlating methylation measurements in early life with those in later life.
The beijing genotype is commonly present in russian population and in eurasia as a whole . This lineage, especially bo\w subline is characterized by high - level virulence,,, . For our analysis, we chose the mycobacterium tuberculosis strain b9741, isolated from a 33-years - old hiv - positive female patient from irkutsk oblast, russia, with firstly diagnosed fibrocavernous tuberculosis, provided by the scfhhrp, irkutsk, russia . This strain was resistant to isoniazid (inh), rifampin (rif), streptomycin (sm) and pyrazinamide (pza). Genome sequencing was carried out on roche 454 gs junior instrument (roche, switzerland), in the laboratory of bacterial genetics, vigg ras (moscow, russia). All reads were assembled to an initial draft genome: 4,322,170 bp (total length) nucleotides at 13-fold coverage using the gs de novo assembler (version 3.0; roche) (table 1). The automatic functional annotation results were obtained using ncbi prokaryotic genome annotation pipeline (pgaap) (http://www.ncbi.nlm.nih.gov/genomes/static/pipeline.html). The b9741 genome contains 4193 genes (total), 4 rrnas, and 46 trnas . A total of 250 pseudogenes, 3 noncoding rnas (ncrnas), 1 clustered regularly interspaced short palindromic repeats (crispr) were predicted using the pgaap . According to housekeeping gene and toxin - antitoxin analysis,, we classified this strain to belong to b0/w beijing lineage . We compared our output sequence with dna sequence of the high - virulent m. tuberculosis w-148 strain which belongs to b0/w cluster of beijing group . In this announcement, we focused on genes, which determine virulence and drug resistance . In addition, we analyzed snps in genes, which are associated with drug resistance to inh, rif, sm, and pza . Analysis we provide the comparison of sequenced dna with b0\w dna sequences and revealed the presence of three polymorphisms at virulence genes . In the gene mce3f, which essential for survival of mtbs in macrophages and invasion to the host cells, we have found substitution - d410a, in irtb gene, which encode the part of irtab iron importer - a175 t, . This protein play an essential role for iron homeostasis in stress conditions . And in vapc46 - a38 g, . Thus, identified genes will be used for understanding of m. tuberculosis adaptation to patients with low immune level, including hiv + patients . Othis whole genome shotgun (wgs) project has been deposited at genbank under the accession lvjj01000000 (mycobacterium tuberculosis strain b9741). This whole genome shotgun (wgs) project has been deposited at genbank under the accession lvjj01000000 (mycobacterium tuberculosis strain b9741). The beijing genotype is commonly present in russian population and in eurasia as a whole . This lineage, especially bo\w subline is characterized by high - level virulence,,, . For our analysis, we chose the mycobacterium tuberculosis strain b9741, isolated from a 33-years - old hiv - positive female patient from irkutsk oblast, russia, with firstly diagnosed fibrocavernous tuberculosis, provided by the scfhhrp, irkutsk, russia . This strain was resistant to isoniazid (inh), rifampin (rif), streptomycin (sm) and pyrazinamide (pza). Genome sequencing was carried out on roche 454 gs junior instrument (roche, switzerland), in the laboratory of bacterial genetics, vigg ras (moscow, russia). All reads were assembled to an initial draft genome: 4,322,170 bp (total length) nucleotides at 13-fold coverage using the gs de novo assembler (version 3.0; roche) (table 1). The automatic functional annotation results were obtained using ncbi prokaryotic genome annotation pipeline (pgaap) (http://www.ncbi.nlm.nih.gov/genomes/static/pipeline.html). The b9741 genome contains 4193 genes (total), 4 rrnas, and 46 trnas . A total of 250 pseudogenes, 3 noncoding rnas (ncrnas), 1 clustered regularly interspaced short palindromic repeats (crispr) were predicted using the pgaap . According to housekeeping gene and toxin - antitoxin analysis,, we classified this strain to belong to b0/w beijing lineage . We compared our output sequence with dna sequence of the high - virulent m. tuberculosis w-148 strain which belongs to b0/w cluster of beijing group . In this announcement we developed the catalog of 342 genes determinate virulence,, . For this analysis, in addition, we analyzed snps in genes, which are associated with drug resistance to inh, rif, sm, and pza . We provide the comparison of sequenced dna with b0\w dna sequences and revealed the presence of three polymorphisms at virulence genes . We carried out a deeper analysis of these genes involved in virulence . In the gene mce3f, which essential for survival of mtbs in macrophages and invasion to the host cells, we have found substitution - d410a, in irtb gene, which encode the part of irtab iron importer - a175 t, . This protein play an essential role for iron homeostasis in stress conditions . And in vapc46 - a38 g, . Thus, identified genes will be used for understanding of m. tuberculosis adaptation to patients with low immune level, including hiv + patients . Othis whole genome shotgun (wgs) project has been deposited at genbank under the accession lvjj01000000 (mycobacterium tuberculosis strain b9741). This whole genome shotgun (wgs) project has been deposited at genbank under the accession lvjj01000000 (mycobacterium tuberculosis strain b9741). The authors declare that there is no conflict of interests with respect to the work published in this paper . This research did not receive any specific grant from funding agencies in the public, commercial, or not - for - profit sectors.
Almost all of our knowledge about the effect of inflammatory events on blood - brain barrier is related to chronic diseases or acute events, in which exacerbated responses to pathogens are present . The role of low - grade inflammation in the generation or exacerbation of neuropathologies is recently explored because several conditions such as obesity and diabetes concur with this inflammatory status during long - term periods and, perhaps, it may be related to systemic and central comorbidities . Sleep loss per se, including sleep deprivation, sleep restriction, or sleep fragmentation (see table 1 for a full differentiation between the concepts), generates a pathogen - independent low - grade inflammatory status . Here, we will review (1) the inflammatory mediators that increase during periods of sleep loss and their association with general disturbances in peripheral endothelium and epithelium and (2) how those inflammatory mediators might alter the blood - brain barrier during sleep loss . With the evidence presented in this review, we propose a hypothetical mechanism by which sleep restriction could induce blood - brain barrier disruption, emphasizing the effect of inflammatory molecules on tight junction maintenance . Sleep is one of the most widely observed phenomena in mammals and is recognized to play a vital regulatory role in a number of physiological and psychological systems [1, 2]. The paramount role of sleep in the physiology of animal models and humans is evident by the effects of sleep loss . Serious physiological consequences of sleep loss include decreased neurogenesis, cognitive dysfunction (deficits in learning, memory, and decision - making), metabolic alterations, cardiovascular diseases, immune disturbances, and blood - brain barrier disruption [18]. Both chronic and acute sleep loss associate with energy balance disturbances and changes in cellular and humoral immunity [10, 11]; however, the direct mechanism by which sleep induces a low - grade inflammatory status is unclear . Experimental research has demonstrated that acute and chronic sleep loss result in impairments in the immune response, characterized by deficits in the cellular component (both in number and in function) and increased levels of proinflammatory mediators, such as tumor necrosis factor- (tfn-), interleukin-1 (il-1), il-6, il-17a, and c - reactive protein (crp) (for details of the cytokine levels related to varying periods of sleep loss see). In addition to immune - derived inflammatory mediators, sleep loss also increases the levels of other inflammatory molecules such as cyclooxygenase-2 (cox-2), nitric oxide synthase (nos), endothelin-1 (et-1), vascular endothelial growth factor (vegf), and insulin - like growth factor-1 (igf-1) [8, 13]. The major aim of this review is to discuss the role of low - grade inflammation in the blood - brain barrier disruption induced by sleep loss; nevertheless, because endothelial cells form the blood - brain barrier we considered it relevant also to discuss the effect of sleep loss on peripheral endothelial and epithelial cells as early markers of inflammation . Endothelial and epithelial cells form protecting barriers in the central nervous system but also in the periphery . Several pathological states are known to target peripheral epithelial and/or endothelial barriers; therefore the knowledge of regulatory mechanisms in those peripheral barriers may contribute to improving the understanding of central barriers . Among the pathologies affecting body barriers, those involving infections and also diabetes, cardiovascular diseases, psoriasis, and cancer are associated with sleep disturbances [1416]. Here, we present evidence regarding the disrupting effect of sleep loss on peripheral epithelial and endothelial cells . When fluid compartmentalization goes awry, homeostasis is altered and the possibility exists of induction of inflammation by microorganism invasion and even of tumor microenvironment induction . In humans sleep restriction increases sympathetic activity and, concomitantly, causes endothelial dysfunction at the venous level; the effect may be mediated via endothelin-1 (et-1) because et-1-mediated vasoconstriction is greater in adults with short sleep duration (less than 7 h per night) than in those with normal sleep duration (79 h per night). The link between sleep restriction and increased et-1 activity is not clear, but the role of the inflammatory status induced by sleep loss may partially explain this association . In this way, inflammatory cytokines, insulin, and epinephrine altered during sleep loss the cytokines that may increase in sleep - deprived humans (e.g., tnf-, il-1, and il-6) raise arterial vascular tone via endothelin receptors . Several reports indicate that sleep loss induces vascular alterations related to inflammatory markers (for a review see). Some studies have tried to clarify the underlying mechanism; for instance, sleep deprivation in humans induced magnesium deficiency, which produces arterial constriction, and is a possible cause of myocardial damage . Other barriers are not yet studied in sleep - deprived or sleep - restricted humans, but some studies indicate that sleep deficiency alters skin conductance . Animal models currently used in sleep research include those that model shift work by totally sleep depriving rodents; human sleep deficiency by sleep restricting; and sleep loss - associated with pathologies, such as obstructive apnoea, by promoting sleep fragmentation . Contrary to the human studies, in the case of animal models, several studies have identified negative effects of sleep loss on peripheral endothelia and epithelia . For instance, sleep fragmentation in mice (20 weeks) induces vascular endothelial dysfunction and mild blood pressure increases . Those physiological effects are accompanied by morphological vessel changes characterized by elastic fiber disruption and disorganization, increased recruitment of inflammatory cells to the vessel wall, and increased plasma levels of il-6 . In rats, this endothelial dysfunction is independent of blood pressure and sympathetic activity but is associated with changes in nos and cox pathways . The effect of sleep loss on physical barriers such as the intestinal barrier or blood - testis barrier is not reported; however, gut bacteria are present in blood after sleep deprivation and both sleep - deprived and sleep - restricted rats exhibit lower sperm viabilities associated with an increase in endothelial nos expression . Those data suggest that sleep loss also might alter the physiology of the above - mentioned barriers with the ensuing tissue damage . We reported for the first time that sleep restriction induces blood - brain barrier hyperpermeability in rats . We used a procedure consisting of 20-hour sleep deprivation plus 4 hours of sleep opportunity during 10 consecutive days; because a reduction in total sleep time is observed, it is named sleep restriction . In our conditions, rapid eye movement (rem) sleep is fully suppressed and non - rem sleep is 30% reduced since the first day of sleep restriction . In those conditions we showed a widespread breakdown of the blood - brain barrier . We described that brief periods of sleep opportunity (40 to 120 minutes) induced a progressive recovery of blood - brain barrier permeability to evans blue (> 60 000 da) in the majority of brain regions studied, with exception of the hippocampus and cerebellum . We also observed that in the hippocampus the number of pinocytic vesicles increased threefold . In a subsequent study, mice were subjected to sleep restriction for 6 days in a rotatory bar for 12 hours per day . Sleep restriction by this method induced rem sleep loss in the first 3 days with partial rem sleep recovery afterwards; at the end of the 6th day of sleep restriction, there was 13.3% increase of wakefulness, 10.2% reduction of non - rem sleep, and 2.1% reduction of rem sleep . Under these conditions, increased blood - brain barrier permeability to sodium fluorescein, a low molecular - weight tracer, was observed; sleep recovery by 24 hours fully reverted the effect . In the same way, sleep restriction decreased the mrna levels of the tight junction proteins claudin-5, zonula occludens-2 (zo-2), and occludin . In the first study a yoked control was included to avoid any potential confounding effects of stress on blood - brain barrier permeability; rats were placed on large platforms during the same period of time as sleep - restricted subjects and despite being in the same stressful conditions as the sleep - restricted subjects they have a fully functional blood - brain barrier . The second study did not include a yoked control, a newly developed sleep deprivation method was used that involves a rotating bar at the bottom of the house - cage with random changes of direction; this method may certainly be stressful to the rodents due to the presence of forced exercise; however, our recent results replicate their findings (hurtado - alvarado et al . Personal communication). Therefore, the evidence of changes in the blood - brain barrier integrity induced by sleep loss is substantial and inflammatory molecules appear to play a key role in the mechanism subjacent to this phenomenon . The increase in the levels of inflammatory mediators during chronic sleep loss may be related to blood - brain barrier disruption because several previous reports show that per se those inflammatory molecules affect the integrity of the blood - brain barrier (see table 2 for a summary). Tumor necrosis factor- (tnf-) is a protein synthesized mainly by monocytes and macrophages that plays an essential role in the initial activation of the immune system . In the central nervous system tnf- is a multipotent cytokine produced by neurons, glia, and microvascular endothelial cells that is implicated in several physiological events, such as memory consolidation and sleep regulation . The role of tnf- as an inductor of blood - brain barrier disruption includes its overexpression in microglia, astrocytes, and microvascular endothelial cells . Several reports indicate that sleep loss increases the plasma and brain levels of tnf- [2933], the mrna expression of tnf- in the brain [33, 34], the spontaneous production of tnf- in lymphocytes, and the mrna expression of tnf- in peritoneal and epididymal adipose tissue [36, 37]. Despite the fact that the changes in tnf- induced by sleep loss are 2 to 5 times higher compared to rats sleeping ad libitum, the levels are below those reported in the case of infectious diseases; however, the chronic exposure to this inflammatory mediator may underlie the sleep - induced blood - brain barrier dysfunction . The effect of tnf- in endothelial cells is well studied . In vivo and in vitro studies report an increase in the permeability of microvascular endothelial cells after the administration of tnf- in both animal models and human cell lines [3841]. Nonetheless, the tnf- levels used in those studies are 100,000 times higher compared to concentrations reported under sleep loss conditions . The lower dose of tnf- used in in vitro studies (1 ng / ml) results in a transendothelial electric resistance (teer) reduction at 60 minutes after treatment with teer recovery at 210 minutes after administration, which is similar to the results observed using higher doses of tnf- (50, 100 ng / ml), suggesting that the effect mediated by tnf- receptors is saturable . While we can infer that peripheral changes mediate the main effect of tnf- on blood - brain barrier, we must not ignore the fact that tnf- levels also increase in the brain . In this way, it is known that after the administration of tnf- (250 ng) in the lateral ventricle an increase in the transport from cerebrospinal fluid (csf) to blood of i - human serum albumin is observed in rats, which demonstrates that tnf- promotes the clearance of macromolecules from the csf to the venous blood . Taking into consideration that the restorative function of non - rem sleep may be a consequence of the enhanced removal of waste products accumulated in the awaking brain via the glymphatic system, the tnf- increase during sleep loss may contribute to the clearance of toxins by efflux of potentially neurotoxic waste products via the blood - brain barrier . Interestingly, in the brain, sleep restriction increases the mrna expression of tnf- in a region - dependent manner in the mouse, suggesting that if tnf- regulates the microvascular brain endothelial cells from inside the brain, it may do it in specific areas, such as the somatosensory and frontal cortices, which indicates that blood - brain barrier regulation by inflammatory molecules is heterogeneous (a finding reported by us in the case of blood - brain barrier changes induced by sleep loss and recovery; see). Another example of tnf- role in blood - brain barrier regulation during peripheral inflammation occurs after the induction of acute pancreatitis in rats, where an increase in tnf- levels is observed as early as 6 hours after pancreatitis induction and at the same time increases the blood - brain barrier permeability to sodium fluorescein (365 da) in the hippocampus and cerebellum as well as to evans blue in the hippocampus, basal nuclei, and cerebellum . In the case of the low molecular - weight tracer the normal blood - brain barrier permeability reestablishes at 24 hours after induction, while, for evans blue, reestablishment occurs 48 hours after induction . We also observed region - dependent effects of sleep loss and recovery on blood - brain barrier integrity; for instance, in the cerebellum the hyperpermeability remained even after sleep opportunity periods of 40120 minutes; meanwhile the cortex recovered the normal blood - brain barrier permeability at the same time points . Therefore, the cerebellum could be considered as a highly susceptible region to inflammatory mediators such as tnf- in comparison with other brain regions (e.g., the hippocampus and cortex). The differential distribution of tnf- receptors in the brain may explain why tnf- regulates blood - brain barrier function in a region - dependent manner; however, is it also possible that other molecules may have synergic effects with tnf- to regulate blood - brain barrier physiology . Classically, phagocytic cells in response to inflammatory stimuli release il-1; in the brain il-1 activates the regions involved in the generation of hyperthermia . Similar to the effect of tnf-, il-1 administration promotes sleep in mammals and sleep deprivation has been shown to increase serum il-1 levels both in humans and in animal models [3, 4, 29, 49]. In addition, sleep loss induces il-1 gene expression in the brain [34, 45], cardiac muscle, and adipose tissue and on phytohaemagglutinin (pha) activated peripheral blood mononuclear cells (pbmc). In the case of the brain, several reports indicate that the expression of the il-1 receptor-1 (il-1r1) in endothelial cells is high in the preoptic area, subfornical organ, and supraoptic hypothalamus, while a lesser expression is found in the paraventricular hypothalamus, cerebral cortex, nucleus of the solitary tract, ventrolateral medulla, trigeminal and hypoglossal motor nuclei, and the area postrema [5153]. In in vitro models of blood - brain barrier, il-1 (in doses of 5, 100, and 1000 ng / ml) decreases the teer similar to the levels observed after tnf- administration [42, 54]. Il-1 also promotes the release of il-6 and prostaglandin e (pge2) in rat brain endothelial cells . Likely, in vivo studies have shown that il-1 induces sickness behaviour mediated by endothelial il-1r1 activation in rats; the probable mechanism may be the induction of cox-2 in brain endothelial cells after il-1r1 activation with the concomitant increase in the synthesis of pge2 . Il-1 may have a key role in blood - brain barrier dysfunction during sleep loss because it has been reported that sleep loss increases il-1 gene expression in the cerebral cortex, hippocampus, and basal forebrain . In addition, il-1 released from activated microglia increases blood - brain barrier permeability; this effect may depend on the suppression of astrocyte - derived signals that maintain blood - brain barrier integrity (e.g., sonic hedgehog, shh). Il-1 action on blood - brain barrier may induce the expression of other inflammatory mediators produced by microglia and astroglia . For instance, the lack of il-1r1 specifically in endothelial cells precluded the brain increase of il-1, tnf-, and il-6 in stressed rats despite the presence of reactive microglia [59, 60], which places il-1 and its receptor on endothelial cells as central mediators of brain inflammatory responses . Hence, the role of il-1 in blood - brain barrier could be mainly related to endothelial - glial interactions . Sleep onset is associated with an increase in circulating levels of il-6; nevertheless, the potential role of il-6 in sleep regulation is controversial, and it may take a secondary role as compared to its primary role in the acute - phase response . Some studies indicate an increase of il-6 circulating levels in sleep - deprived subjects [6466] and also in gene expression in immune cells [35, 50, 67], whereas others report a delay in the sleep - related peak of plasma il-6 in sleep - restricted subjects . Even some authors report that plasma levels of il-6 are maintained without change despite sleep loss [30, 68]. Some studies also show that sleep recovery after total sleep deprivation increases plasma levels of il-6; however, others found that in immune cells il-6 levels remain unchanged during sleep recovery . Il-6 is a pleiotropic cytokine key for immune regulation and if secreted during sleep loss and recovery may have neuroprotective effects; indeed, it has been reported that il-6 appears to be neuroprotective and is involved in endothelial survival after shear stress . However, given the high variability of il-6 after sleep loss and recovery, the role of il-6 as a possible modulator of blood - brain barrier during sleep is unclear . It is necessary to elucidate the precise changes in il-6 levels both centrally and peripherally to clarify the role of il-6 in blood - brain barrier modulation during sleep . Il-6 has pyrogenic effects when endogenously released during systemic inflammation; it achieves this function by its binding to il-6 receptor (il-6 r) on brain endothelial cells and the subsequent induction of pge synthesis . However, those effects require high levels of il-6 (> 1 ng / ml). In humans, il-6 serum levels were less than 100 pg / ml and the normal levels for il-6 in csf are around 10 pg / ml, significantly lesser than those measured in several in vitro and in vivo experiments . For instance, treatment with 50 or 500 ng of il-6 reduced the infarct volumes and symptoms of neurological deficit in a rat model of cerebral ischemia . In addition, the administration of il-6 decreased the blood - brain barrier permeability to evans blue by suppressing the expression of matrix metalloproteinase-9 (mmp-9). The role of il-6 as well as tnf- and il-1 may depend on the brain region, for example, the stimulation with lipopolysaccharide (lps) induces in the brain the expression of the il-6 receptor (il-6r) in the cortex and hippocampus but not in the cerebellum . Therefore, considering il-6 a proinflammatory cytokine it is possible to suggest that its role in blood - brain barrier physiology during sleep loss may be related to the modulation of the expression of other proinflammatory cytokines . Th17 cells have been identified as a subset of t helper lymphocytes characterized by the production of a number of cytokines including il-17a, il-17f, and il-22 . For instance, high expression of il-17a is associated with autoimmune inflammatory diseases including multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, and systemic lupus erythematosus . During sleep loss a subtle increase of il-17a il-17a high levels were found in plasma even after 24 hours of sleep recovery in sleep - restricted rats . Sleep loss also increases the mrna and protein expression of il-17a on pha activated pbmc in humans . Particularly, the receptor for il-17a is expressed in epithelial and endothelial cells and promotes the expression of inflammatory mediators such as il-6 and chemokines . Il-17a induces epithelial and endothelial dysfunction; it decreases the teer and concomitantly increases tracer permeability; the mechanism is mediated through tight junction disruption . Finally, from in vitro experiments it is known that il-17a increases endothelial cell permeability at 10 or 100 ng / ml doses [78, 79]. These data suggest that il-17a might be involved in blood - brain barrier disruption during sleep loss . C - reactive protein (crp) is the major acute - phase protein involved in the resistance to microbes and autoimmune diseases and is an important risk marker of cardiovascular and cerebrovascular disorders . The plasma levels of crp increase faster and at higher magnitude than other acute - phase proteins . Sleep loss increases the circulating levels of crp (0.5 g / ml), which is associated with increased risk of cardiovascular disease and stroke [4, 8, 50, 67, 81, 8183]. The synthesis of crp in the liver is controlled by proinflammatory cytokines, including tnf-, il-1, il-6, and il-17a [82, 84]. Crp (1020 g / ml) induces blood - brain barrier disruption because brain endothelial cells express high levels of crp receptors (cd16 and cd32) and also because brain endothelial cells express high levels of the p22phox subunit of the nad(p)h - oxidase . The high expression of both exacerbates the generation of reactive oxygen species (ros) with the resultant oxidation of tight junction proteins . The expression of icam-1 in endothelial cells is pivotal in supporting lymphocyte migration across the vascular endothelium . Icam-1 associates with an endothelial cytoskeleton fraction, suggesting that icam-1 redistribution is an early event in the signalling cascade during inflammatory events, particularly in lymphocyte transmigration . The expression of endothelial cell adhesion molecules increases in the central nervous system during inflammation secondary to pathogen intracerebral administration (e.g., corynebacterium parvum). Brain vessels located in the centre of the cellular infiltrate began to express markers of fenestrate endothelium such as the endothelial - specific expression of meca32 suggesting an altered functional status of the endothelial cell . Abundant icam-1 expression has been observed after il-1 or tnf- stimulation of cultured heart endothelial cells . Elevated levels of icam-1 may contribute to cardiovascular disease and are associated with obstructive sleep apnoea (osa) and obesity, in which sleep deficiency is present . In the same way, it has been shown that patients with diabetes mellitus type 2 and poor sleep present higher morbidity of cardiovascular diseases than diabetes mellitus patients sleeping normally; those patients also present higher plasma levels of icam-1 . Icam-1 higher serum levels were also found during the sleep recovery period after 40 hours of total sleep deprivation in healthy men . Therefore it seems that the mediator between poor sleep (with bad quality and poor sleep recovery) and higher risk for cardiovascular diseases is icam-1 . Inflammation is characterized by upregulation of vascular endothelial growth factor (vegf). In in vivo experiments, increases in vegf during neuroinflammation (e.g., in experimental autoimmune encephalomyelitis (eae)) are accompanied with increased blood - brain barrier permeability and decreased expression of tight junction proteins (e.g., claudin-5 and occludin). Likely, vegf administration to human brain endothelial cells increases permeability of the monolayer and downregulates claudin-5 and occludin, but not junctional adhesion molecule-1 (jam-1), cingulin, peripheral plasma membrane protein (cask), or zo-1 . Given the role of vegf in regulating blood - brain barrier during neuroinflammation, it may participate in generating the vascular changes associated with sleep loss . Indeed, it has been shown that vegf is overexpressed in osa patients and it is generally considered that vegf increases are associated with hypoxia events . However, osa patients also have severe sleep fragmentation; therefore, in addition to chronic intermittent hypoxia, vegf changes may be related to sleep loss . In fact, in a study with major depressive disorder patients, sleep deprivation increased vegf plasma levels . Sleep deprivation decreases igf-1 levels in rats and humans and one night of sleep recovery is sufficient to restore its basal levels . The neuroprotective effects of igf-1 are unclear but it is known that igf-1 receptors are present in brain endothelial cells, microglia, and astroglia and even in neurons . Indeed, it has been suggested that igf-1 may promote neuroprotection by acting on the blood - brain barrier; in an experimental model of ischemic stroke igf-1 reduced the inflammatory infiltrate in the brain . In an in vitro experiment with brain endothelial cells igf-1 reverted the hyperpermeability to bovine serum albumin induced by oxygen - glucose deprivation (an in vitro model of ischemic stroke). Changes on inflammatory molecules during sleep loss are well described but we do not know what the source of those alterations is . In this way the role of microbiota could appear a good candidate to induce the low - grade proinflammatory status during sleep loss . The source of inflammatory mediators during sleep loss remains unclear; however, microbiota may play a key role in this event . In other conditions that exhibit low - grade systemic inflammation, such as chronic depression, obesity, and diabetes, evidence from murine models initially suggested a role for the gut microbiota in the generation of low - grade inflammation, with the consequent increased risk of endothelial and epithelial dysfunction [98, 99]. For instance, changes in gut microbiota composition increase intestinal permeability . In the same way, during sleep deprivation gut microbiota has been detected in blood, suggesting the induction of systemic inflammation and deficits in gut epithelial permeability . In addition, preclinical evidence from germ - free mice suggests that the microbiota can also modulate the blood - brain barrier; exposure of germ - free adult mice to the faecal microbiota from pathogen - free donors decreased the blood - brain barrier permeability and increased the expression of tight junction proteins in brain endothelial cells, therefore strengthening the hypothesis that the blood - brain barrier may also be sensible to changes in the gut microbiota composition . The candidate pathways to induce barriers dysfunction under altered gut microbiota composition include serotonin, cytokines, toll - like receptor activation, and short chain fatty acids . Moreover, the inflammatory response subsequent to microbiota - induced barriers disruption may underlie the sleep loss - related cognitive deficits and the exacerbation of neurological disorders such as depression . These data might support the theory of a coevolution between sleep and blood - brain barrier proposed by korth in 1995 . Because the brain and blood - brain barrier react sensitively to the exposure to bacterial cell wall constituents and sleep is regulated by gut microbiota products, korth proposed that low amounts of bacterial cell wall constituents that induce sleep under sleep loss conditions, by themselves or by cytokine production, increase the blood - brain barrier permeability ensuing their passage into the brain . Cytokines and other inflammatory mediators induce blood - brain barrier disruption through mechanisms involving signalling pathways that converge in the disorganization of tight junctions (figure 1). For instance, it has been reported that proinflammatory cytokines, including tnf- and il-1, decreased zo-1 expression and zo-1-occludin coassociation, concomitant to increased zo-1 phosphorylation in tyrosine and threonine residues . Zo-1 phosphorylation in tyrosine residues is also observed after vegf administration . In this way, vegf - a also promotes disruption of blood - brain barrier by downregulating the expression of claudin-5 and occludin . Low cytokine concentrations (> 1 ng / ml) led to activation of effector caspases via c - jun n - terminal kinases (jnk) and protein kinase c (pkc) signalling pathways, increased paracellular flux, and redistribution of zo-1 and ve - cadherin but failed to induce apoptosis . In addition to caspase-3, tnf- activates the production of mmp-9, which is also associated with high levels of il-1 in brain parenchyma . Cox-2 plays a crucial role in the inflammatory response of the blood - brain barrier (for review see); particularly cox-2 derived pge2 increases blood - brain barrier permeability . Other cytokines, such as il-1, use other signalling pathways that finally converge in cox-2 induction; particularly, the il-1 receptor-1 (il-1r1) signals via the p38 mitogen - activated protein kinase (mapk) and the c - jun pathway to induce cox-2 synthesis, whereas activation of the il-6 receptor leads to cox-2 expression through activation of signal transducer and activator of transcription-3 (stat-3). The activation of nfb by tnf- and il-1 is also correlated with cox-2 expression in microvascular endothelial cells . Indeed, both ib and cox-2 are expressed within the same endothelial cells, suggesting a potential interaction between the transcription factor and cox-2 expression in the cerebral endothelium of animals with systemic inflammation . Tnf- and il-1 promote the release of crp . The putative mechanism by which crp increases blood - brain barrier permeability is by its action on cd16/cd32 receptors present in the cell membrane of brain endothelial cells . This association activates the myosin light chain (mlc) phosphorylation by mlc - kinase (mlck) and the activation of p38-mapk, with the subsequent formation of actin stress fibers . Brain endothelial cells express the p22phox subunit located in the cell membrane; this enzyme uses nadh or nadph as the electron donor for the single electron reduction of oxygen to produce ros during crp stimulation . The assembly of active nadph oxidase requires translocation of cytosolic subunits, p47phox, p67phox, and rac1 (a cytosolic gtpase), to the plasma membrane, where they interact with gp91phox and p22phox and associate with other membrane cofactors to form a functional enzyme complex . In addition, crp stimulation also disorganizes zo-1 via mlck and ros production . In this way, il-17a also induces nadph oxidase- or xanthine oxidase - dependent ros production and downregulates the expression of occludin by activation of mlck . The signalling of inflammatory mediators and particularly nadph oxidase may promote the upregulation of adhesion molecules such as icam-1 via jak / epidermal growth factor receptor (egfr) signalling contributing to a possible leukocyte infiltration . Therefore, these changes may be deemed as the mechanisms involved in brain endothelial cell dysfunction during sleep loss . We propose that inflammatory mediators increased during chronic sleep loss might promote blood - brain barrier disruption (figures 1 and 2). For aims of clarity the hypothesis does not explicitly distinguish between rem and non - rem sleep and we know that other molecules altered during sleep loss also should be studied because they may have a potent role in the blood - brain barrier disruption such as adenosine and hormones . In interpreting these data, for instance, the cellular components of the blood - brain barrier that promote inflammation in the brain, such as microglia and astroglia, in addition to regulating blood - brain barrier may also be affecting several brain functions during sleep and sleep loss . On the other hand, pericytes have a unique synergistic relationship with brain endothelial cells in the regulation of capillary permeability through secretion of inflammatory mediators including cytokines, chemokines, nitric oxide, and matrix metalloproteinases . Those inflammatory mediators released during sleep restriction may directly induce pericyte detachment from the vessel wall ensuing blood - brain barrier disruption (for review see hurtado - alvarado, 2014). Summarizing, chronic sleep loss induces systemic low - grade inflammation that may be related to epithelial and endothelial disturbances both at the systemic and at the central level . Particularly, the role of inflammatory mediators in the blood - brain barrier disruption induced by sleep loss might explain the cognitive impairment associated with sleep loss . The systemic and local effect of inflammatory molecules accumulated during chronic sleep loss should be taken into account for the study of general consequences of sleep deficiency including the risk of developing neurologic and neurodegenerative diseases.
They are congenital benign tumor accounting for 15 - 20% of intraventricular mass but only about 1% of intracranial ones (1 - 3). They can be diagnosed at any age but usually become symptomatic in the third to sixth decades and more common in men than women . They usually found incidentally and are asymptomatic; but in some instances may associate with rapid neurologic deterioration, herniation, and sudden death . So, recognition of this rare but important diagnosis may result in decreasing mortality (4). In this report, we presented a 13-year - old boy with complaint of two times drop attack and final diagnosis of colloid cyst in the third brain ventricle . A 13-year - old boy was brought to the emergency department (ed) with complaint of two times drop attack . The patient mentioned that he felt sudden weakness in both lower limbs, which led to drop . These attacks were happened about 4 hours before admission and he did not have any same experience previously . He did not have complaint of nausea, vomiting, headache, vertigo, blurred vision, or palpitation . The subject did not have any known structural or congenital heart disease, but suffered from asthma and used salbutamol spray irregularly . The patient did not have trauma history and there was no positive history of any known medical illness in his parents or closed relatives . On arrival, he had 36.9c axillary temperature, 16/minute respiratory rate, 90/minute pulse rate, 120/80 mmhg blood pressure, and 96% oxygen saturation at room air . On physical examination, he did not have focal neurologic findings or even paresthesia or paraplegia . General examination of head and neck, chest, abdomen, and limbs did not reveal any positive findings . Following the evaluation process, a brain computed tomography (ct) was performed (figure-1). A hyperdense round lesion was seen in the third ventricle consequently caused that the corresponding physician requested a neurologic consultation in the ed . Finally, the brain magnetic resonance imaging (mri) confirmed the diagnosis of third ventricle colloid cyst and the patient was underwent surgery and discharged without any problem (figure 2). The colloid cysts commonly settle near the foramen of monro in the anterior third ventricle and so may encounter with drainage of the cerebrospinal fluid (csf) (3). Since even a small lesion can block the mentioned foramen, these cysts may result in hydrocephalus and increase the intra cranial pressure (5). Increased intracranial pressure can be manifested with headache described as severe and intermittent, with short duration, usually located frontally . In contrast with usual headaches, secondary to intracranial tumors, the colloid cyst induced headache can be relieved by lying down (4). Other symptoms include drop attacks, gait abnormalities, progressive dementia, and transient loss of consciousness . In children, the most common symptoms are nausea, vomiting, headache, diplopia, and papilledema (6). The classic clinical description of intermittent headaches and drop attacks occurs in only one - third of patients . Sudden obstruction of the ventricular system and following rapid rising of intracranial pressure can lead to herniation and rarely sudden death (7, 8). Colloid cysts size varies from 3 - 40 millimeters in diameter, but the size do not related to their symptoms or outcome, as even small ones may lead to sudden death (9). Colloid cyst is usually diagnosed by non - contrast computed tomography (ct) as an oval or rounded hyperdense mass on the anterior aspect of the third ventricle . They may occasionally be hypodense or isodense to the brain, or found in other areas of the brain . Colloid cysts have different manifestation on mri . Despite their variable signal characteristics, their location and shape help to the correct preoperative diagnosis in most patients (6). Half of the cases are hyperintense on t1-weighted mri images and hypointense on t2-weighted mri images respected to brain . Isointense cysts are not easily identified on mri, and in such instances ct scan is more useful (9, 10). Small asymptomatic colloid cyst can be considered for close follow up by serial examinations and neuroimaging (11). There is also the rare report of spontaneous resolving of the third ventricle colloid cyst (12, 13). All authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors.
Psoriasis is a common chronic inflammatory skin, nails, and joints disease related to the immune system by periods of exacerbations and remissions . It is characterized by thick end, erythematous, and scaling lesions, which affects about 2 to 4 percent of the general population . The disease occurs equally in both sexes and the most common form of the disease is psoriasis vulgaris . The etiology is unknown but genetic and environmental factors, immune system disorders, and gastrointestinal dysfunction appear to be responsible . The aim of this study is to compare psoriasis and ghooba clinical manifestations and introduce medical treatment of this disease based on authentic books of traditional medicine . This study is a qualitative literature review based on reliable sources of traditional medicine, such as canon of medicine, makhzan - ul - adwiah, qrabadyne kabir, zakhireh - ye khwarazm shahi, tib - e - akbari and exir - e - azam . The causes of disease are poor performance of the liver and spleen and stomach, as well as excessive consumption of foods such as beef and veal, eggplant and fish . Several local treatments such as wheat germ oil, flaxseed oil, black seed oil, and violet oil were recommended . Psoriasis is a chronic, debilitating physical, mental, and sexual disease for which genetic, environmental and immunological factors are recommended for its etiology . This problem could be treated by the oral and topical medications symptomatically; however, major side effects are associated with recent treatments . Change in lifestyle, prevention issues, as well as herbal therapy are recommended for the treatment of psoriasis in traditional medicine.
Although work provide a range of benefits such as increased income, social contact, and sense of purpose, it can also have negative effects on mental health, particularly in the form of stress . The national institute of occupational safety and health in the us (niosh) estimate the following: 40% of american workers reported their job was very or extremely stressful, 25% view their jobs as the number one stressor in their lives, three fourths of american employees believe that workers have more on - the - job stress than a generation ago . Given the global recession, financial strain, and job losses, greater work stress might have adverse consequences in uk . The most recent data from the nhs information centre in uk suggest an increase in the suicide rate for the first time since 1998 . The rate among men increased from 16.8 per 100,000 in 2007 to 17.7 per 100,000 in 2008 . This increase is being interpreted by politicians and the public as a consequence of the global and national recession, increased job insecurity, risk of loss of jobs, and also stress at work, where the demands on the existing workforce have increased (the independent, 18th november, 2010). 11.4 million working days were lost in uk in 2008/2009 due to work - related stress, depression, or anxiety . There are also indirect costs, for example, through presenteeism when employees are at work but are too unwell to function fully . Stress at work also can lead to physical illness, psychological distress and illness, and sickness absence [3, 4]. Stress, depression, or anxiety accounts for 46% of days lost due to illness and are the single largest cause of all absences attributable to work - related illness . Psychosocial work stressors such as job strain, low decision latitude, low social support, high psychological demands, effort - reward imbalance, and high job insecurity have all been implicated as causes of work stress - related anxiety and depressive illnesses . However, psychosocial work stressors can only be tackled by organisational and systemic strategies and policies . In order to consider the evidence base, there needs to be some agreement on the meaning of work stress . A popular model of stress considers inputs such as job characteristics; for example, excess demands, low control, poor social support, adverse life events such as bereavement or divorce, and additional demands outside of work such as carer responsibilities for a dependent relative or spouse [710]. An alternative approach is to theorise that stress is a manifestation of the poor fit between a person and their environment . Stress is then seen to arise due to a discrepancy between the inputs and outputs and the mediating appraisal of stress, personal skills to manage it, and environmental demands and rewards . Transactional models, as those proposed by lazarus and cox and ferguson, conceptualise stress as something that unfolds over time within a series of transactions between the person and their environment . Stress is, therefore, elicited and maintained by the individual's actions and perceptions as well as the characteristics of their work environment . The specific conceptualisations of stress adopted influence the way interventions are constructed to tackle specific mechanisms in order to alter stress and its manifestations . Describe categories of stress management interventions that target the individual or the organisation and specify actions at primary, secondary, or tertiary preventive levels (see table 1). Individual interventions include stress awareness training or cognitive behavioural therapy for psychological and emotional stress . Organisational interventions are those that affect whole populations or groups of people and include workplace adjustments or conflict management approaches in a specific organisation . Some interventions target both the individual and organisation, for example, policies to secure a better work - life balance and peer - support groups . Primary interventions aim to prevent the causal factors of stress, secondary interventions aim to reduce the severity or duration of symptoms, and tertiary or reactive interventions aim to provide rehabilitation and maximise functioning among those with chronic health conditions . The evidence of effective interventions to protect individual mental health and reduce organisational absenteeism rates is difficult to summarise in a manner that is of practical relevance . Therefore, the purpose of this paper is to take the highest level of research evidence (systematic reviews providing narrative synthesis or meta - analyses) and synthesise this evidence to identify the key findings and gaps in the literature on the effectiveness of different stress management interventions for preventing anxiety and depression as the main cause of absenteeism . Consequently, this review of systematic reviews focuses on common mental health problems (anxiety, depression) and absenteeism . Undertaking a review of systematic review is challenging methodologically for two reasons; there is not a conventional accepted process to produce a meta - review or meta - synthesis across different types of systematic reviews, for different outcomes, and different complex interventions which may defy drawing a singular scientific conclusion that requires all sources of heterogeneity be overlooked . Secondly, the ambition of the review and the form the findings take have, in part, to reflect the subject matter and the types of interventions that are being reviewed . So, for complex interventions for managing stress at work, there will be organizational and individual interventions, and different disciplinary approaches to the task of meta - synthesis of narrative findings . The notion of a meta - synthesis of narrative findings is itself contested by different qualitative research disciplines from which such approaches have evolved [20, 21]. The purpose of this paper is then to draw together literature and findings which are consistent across reviews and methodologically variant studies, where this is possible in order to demonstrate the strength of the findings . However, given the complex nature of interventions to tackle stress at work and that stress itself and mental health are so ill - defined in studies, we also wish to highlight findings that emerge from a critical comparison of reviews; we also wish to highlight the findings that are pertinent to well - defined common mental disorders (anxiety and depressive states); we also wish to acknowledge that narrative synthesis (or meta - synthesis, as it is sometimes called) may reveal complexities in the field of study such that the findings cannot be neatly expressed as a single statement of efficacy or effectiveness, but that interventions might need to be developed to target specific subpopulations . The findings can, thus, signal the methodological issues that future research must tackle . The review identified all systematic reviews of evidence on stress management interventions in the workplace and summaries, tabulated extracted, and then synthesized the evidence for the relative merits of different interventions . Consistent with previous work, we restricted the review to papers published since 1990, as recency in the literature is important to ensure the evidence is related to contemporary concepts of stress and work, and to ensure the current work conditions are represented in the evidence synthesis, rather than historical work conditions . The search terms used were: psychological ill health or anxiety or stress or distress or burnout, stress management or intervention or rehabilitation or prevention, work or job or employee or sick leave or occupation or workplace adjustments or employee assistance programmes . The criteria used for inclusion were english language articles, reviews published from 1990 to july 2011, reviews with data / narrative synthesis, the articles excluded were theoretical and educational reviews, those published prior to 1990 . The total number of reviews initially retrieved after excluding duplicates was 7845 (see table 1). . Data were extracted using the headings set out in table 3 by two researchers working independently . A third researcher checked for and resolved any discrepancies with reference to the original publications . The reviewed studies included many outcomes which ranged from physical health measures (e.g., cardiovascular measures) to psychological and psychiatric measures (e.g., well - being, psychological distress, burnout, general mental health, anxiety, depression, stress, psychiatric symptoms, and psychosomatic symptoms) to organisational measures (e.g., employee satisfaction, motivation, absenteeism). In this paper, we focus only on articles reporting, (a) individual outcomes of symptoms of anxiety and depression (including severe stress if measured by a specific rating scale of anxiety and depression) or anxiety and depressive illness formally assessed using specific diagnostic or psychometric measures and (b) absenteeism as an important organisational outcome as this has an economic cost to the employer . We included key words of anxiety and depression and severe stress as inclusion criteria, but many studies and reviews are not flagged on this basis, and the findings pertaining to these outcomes are often hidden in tables of results . Piloting showed that searches specifically for anxiety and depression did not easily permit us to identify all studies that might include anxiety and depression as outcomes; this was only possible after reviewing the full - text paper . Thus, we kept our original searches broad in order to be satisfied all such paper that met our inclusion criteria would be included . Table 3 presents descriptive information on the twenty three reviews including the dates of published studies / papers included in the reviews, the number of published studies / papers, the prevention level (i.e., primary, secondary, and tertiary), whether the interventions were targeting the individual (i) or the organisation (o) level, and which level the outcomes specified: individual mental health (i) and/or absenteeism (o). Due to the heterogeneity of the published reviews in terms of the methodology used (i.e., meta - analyses versus narrative synthesis or meta - narratives), the analysis and synthesis of meta - analytic reviews is reported first (see table 4; 11 reviews), then the narrative synthesis reviews (table 5; 12 reviews), each annotated to indicate individual and organisational interventions, and individual and organisational outcomes (see table 3). Including narrative reviews permitted evaluation of in - depth information that might be overlooked in meta - analytic reviews, as this information is important for constructing appropriate interventions and implementing them in order to prevent severe stress and anxiety and depression at work . For example, components of an appropriate organisational intervention will be difficult to capture in a meta - analytic review given these interventions will vary between organisations; only in - depth descriptions can capture the components that can then be considered for similar organisational contexts . For meta - analyses, the effect sizes and original conclusions are presented, along with the outcomes used, where these were reported (table 4). For narrative reviews, we present the key narrative conclusions (or evidence summary statement), along with the number of studies finding improvement (), deterioration (), or no effect (). This was done for the same two outcomes: mental health and for absenteeism (table 5). Judgements about the number of studies finding a positive, negative or no effect in the narrative synthesis were challenging, as many studies tended to use words such as stress, psychological distress, psychosomatic disorders interchangeably, and negative findings may not have been reported . We only rated studies as having effects on mental health (anxiety and depression), where it was clear they had used a specific measure of mental disorders or severe stress either alone or as part of a composite measure of mental health and well - being . This is an advance on existing reviews which tend to group all types of stress, including that associated with anxiety and depression, and other types of measures of stress such that the findings are interpreted with reference to a large number of emotional and health states . We felt this approach would not permit us to isolate the findings of relevance to the preventing common mental disorders which are the most important cause of sickness - related absenteeism . Eleven reviews included meta - analyses [16, 2231]; 12 included a systematic or literature review [3243] with meta - narrative conclusions (see table 5). As set out in table 3, of the twenty three reviews, four reported on individual interventions only (three with a meta - analysis) [26, 27, 31, 36]; three of these assessed their impact on individual and organisational outcomes [26, 31, 36], whilst the other one assessed impact on individual outcomes only . There were three reviews that examined the effectiveness of only organisational interventions [24, 32, 40]. Six reviews included studies that looked separately at individual and organisational interventions in the same studies [16, 37, 3942]. Of these, mimura and griffiths reported only on individual outcomes, the rest reported on both individual and organisational outcomes . The remaining seven reviews assessed interventions at both individual and organisational levels [23, 25, 29, 30, 3335]. Of these, one looked only at organisational outcomes, and one looked at individual outcomes . Eleven reviews [16, 2231] reported effect sizes from meta - analyses (table 4) on mental health and absenteeism . The overall impression from the meta - analytic reviews is that the effect size is greater at the individual level for individual interventions compared with organisational interventions, and that organisational or mixed interventions can also impact on the mental health of individuals . Of these eleven reviews, six showed that individual interventions lead to benefit on individual mental health outcomes [16, 23, 2527, 31]. Five reviews of organisational interventions [16, 23, 25, 28, 30] together showed mixed evidence of benefit on individual outcomes; thus richardson and rothstein and van der klink et al richardson and rothstein and van der klink et al . Also reviewed mixed interventions, both of which showed benefit at the individual level on mental health status . Four reviews found individual interventions did not impact on absenteeism [23, 25, 28, 30]. Parks and steelman and bond et al . Found some evidence of benefit, whereas richardson and rothstein and van der klink et al . However, conn et al . Showed clear benefit of organisational physical activity interventions on absenteeism . There were no studies of mixed individual - organisational interventions and impact on absenteeism . The overall conclusions from the narrative reviews support the findings from the meta - analyses that individual interventions do provide benefit at an individual level and reduce symptoms of anxiety and depression and stress, but individual interventions do not impact on absenteeism . However, organisational interventions impact at both individual and organisational levels . There are numerous studies of benefit on mental health outcomes, whereas benefit on absenteeism is mainly reported in one review including a number of high quality studies (table 5). Worryingly, some interventions appeared to lead to deterioration in mental health [16, 3235] and absenteeism [33, 36] outcomes (see table 5). For example, marine et al . Identifies smoking cessation to be associated with depression . Although not directly mapping on to absenteeism, preliminary evidence from cancelliere et al . Suggested that some workplace health promotion programmes can reduce presenteeism (being at work whilst unwell). Presenteeism correlated with being overweight, a poor diet, a lack of exercise, high stress levels, poor relationships with coworkers and management . The different types and components of interventions, and whether they are primary, secondary, or tertiary preventive interventions, are set out in table 3 . The meta - analytic reviews found that cognitive behavioural programmes consistently produced larger effects at the individual level compared to other types of interventions (e.g., relaxation). Cognitive behavioural programmes were also suggested to be more effective by some of the narrative reviews [27, 31, 3436] as well as by some of the meta - analyses [23, 25]. Murphy found that multimodal interventions (or combination strategies), which involved cbt produced the most consistent, significant results; a result which was not supported by one meta - analytic review . Overall, the reviews suggested that organisational level interventions are too scarce and there is also a lack of studies that assess organisational - level outcomes . However, two meta - analytic reviews [22, 29] found that participation in organisational wellness programmes was associated with decreased absenteeism and increased job satisfaction . These were the only meta - analytic reviews of organisational based interventions and organisational - level outcomes . Finally, there are insufficient studies to comment on the potential complementarity of interventions that operate at primary, secondary, and tertiary prevention levels . Four studies investigated both primary and secondary prevention but not their interaction [23, 27, 33, 34]. Our methods of isolating findings related to anxiety and depression, and partitioning the tabulation and extraction and synthesis by individual / organisational interventions and outcomes provides a rich, complex but authentic picture of the evidence base . Reviews had to take account of many interventions that differed by their components, mode of delivery and whether they targeted individuals or organisations . This made it difficult for all of the reviews to compare benefits from any single intervention across a number of studies, except for cbt or physical activity . There were also many different outcome measures for assessing anxiety and depression, and many proxy measures of mental health, sometimes without clarity about which outcomes were used in the meta - analyses . In part, these were not specified due to the way multiple outcomes were handled in the analysis . The reviews used standardised differences including mean differences and mean effect sizes, and standardised differences and means . Using a consistent set of outcomes to measure anxiety and depression in future primary studies will ensure that future reviews and meta - analyses can overcome these challenges, such that different intervention, of varying complexity and modes of delivery, might be compared more directly for impacts on absenteeism and on anxiety and depression and interactions between the individual and organisational impacts . Overall, individual interventions show larger effects compared with organisational interventions or mixed interventions; benefits are seen mainly at the individual level although some studies do show organisational benefits . Given that anxiety and depression are common, and mostly account for sickness absence, it is important to develop an evidence base that is specific to these manifestations of mental distress and illness, with an agreed range of acceptable outcome measures and for interventions that prevent and treat anxiety and depression promptly, as well as encourage early return to work . A small improvement in sickness absence statistics might yield substantial benefits for business viability and provision of services . The only organisational intervention to show convincing effects on absenteeism was physical activity programmes, but mental imaging, cbt, and in vivo exposure, each have a useful role, especially in secondary prevention . Although better quality studies should be given greater weight, the quality of individual primary studies was selectively reported, making it difficult to know whether the positive findings reflected better quality studies; certainly, cbt and physical activity interventions are more well defined than say stress management standards or management practices or stress inoculation . Similarly, the duration of the interventions and timing of measurement of outcomes was not a characteristic on which reviews drew conclusions; we were unable to draw any metaevidence about timing unless we had looked at primary studies . Strikingly, although many reviews on face value were reviewing the same evidence, the reviews did not all identify the same primary studies, and therefore did not always reach the same conclusions; our meta - review, for the first time, brings together all of the strongest findings . These included 499 primary studies; the majority of reviews made the point that drawing metanarrative or meta - analytic conclusions was difficult because of this diversity in outcomes, intervention, and methods . Had we undertaken a review of 499 primary studies, it is likely we would draw the same conclusions . Management skills training, and support for staff, along with methods to cope with work stress all seem relevant components, but the review was not convincing about a positive benefit of these and where positive impacts were seen at individual levels [16, 28]; the effect could not entirely be attributed to improved management standards or working relationships . These studies are difficult to design and implement and require further research . On the other hand, more and more interest has been generated towards health promotion in the workplace (e.g., exercise) and encouraging individuals to take ownership of health risk behaviours and decisions about health, well - being, and family outside of work . This may be promising, as it requires the workforce to maintain healthy lifestyles generally and within that context to consider work stress rather than consider work as the only venue for health interventions . This review suggests that there is lack of evidence in comparing the relative effectiveness of stress management interventions that operate at both individual and organisational levels, or interventions that encourage an interactive or systemic effect, yet this might yield greater benefits at both levels . However, there are still a number of evidence gaps . More research is needed in the private sector and in smaller companies as well as research comparing different job types such as education and healthcare to examine whether they respond to the same or different intervention techniques . Similarly, research needs to take into account factors such as socioeconomic status, duration of any effects of interventions, and cost effectiveness . For example, organisations with the most stressful work environments are less likely to participate in research as opposed to organisations with little stress amongst employees . Consequently, organisations with low baseline stress levels would make any effects from targeted interventions more difficult to capture . However, preliminary support was found in one meta - analytic review that interventions conducted with employees at high levels of baseline stress appeared to be at least as effective as interventions conducted with employees at low levels of baseline stress . We did find more of these in more recent years (since 2008) and also reviews of health care workers and law enforcement officers who perhaps need specific attention given the unique circumstances and stressors to which they are exposed at work . The few methodologically rigorous studies that have been conducted with patients have not included nontreatment control groups but have compared 2 treatment types . More work might, therefore, be undertaken on populations at risk using secondary and tertiary prevention interventions . Interventions need to be developed that can provide consistent and stronger effects on organisational outcomes such as absenteeism . There were a number of gaps in the literature, particularly studies investigating the influence of specific occupations, and different sized organisations, different sectors of organisations (public, private, and not for profit). Studies of management practices seemed not to show strong effects, but there are still insufficient studies in this area.
Atrial fibrillation (af) is a common arrhythmia affecting 1% of the general population increasing to 18% for those over 80 years old . Af can cause turbulence in the blood flow within the heart resulting in clot formation . Clots can then migrate to the peripheral circulation resulting in stroke or limb thromboembolism [24]. This risk ranges from 5 to 7% in non - anticoagulated patients and is affected by other factors reflected in the cha2ds2vasc risk score: congestive heart failure, hypertension, age, diabetes mellitus, previous stroke, vascular disease history, and gender [5, 6, 10]. The current recommendation is, therefore, to anticoagulate for at least 3 weeks before cardioversion and 4 weeks after the procedure to minimize the risk of embolization [711]. Traditionally, the vitamin k antagonist, warfarin, has been used; however, this agent has considerable limitations as it can take time to get patients into target international randomized ratio (inr) range, and they run the risk of having dccv canceled if their inr is out of range . The rate of success of dccv in af is largely affected by the duration of the af; a shorter duration of af is associated with a higher rate of success of dccv and less relapse . The use of doacs in this setting to achieve rapid stable anticoagulation is, therefore, an attractive option . The availability of the direct oral anticoagulants (doacs) has dramatically changed the anticoagulation landscape . Dabigatran is a direct thrombin inhibitor (dti) that has several advantages over warfarin . Dabigatran has rapid onset of action with peak plasma concentration within 60 min and a half - life between 12 and 17 h . Dabigatran has a stable pharmacokinetic profile, and there is, therefore, no need to monitor use with blood tests in most patients . This study aimed to compare the safety and efficacy of dabigatran and warfarin around dccv in terms of stroke prevention, time taken to get to dccv, and the success of cardioversion in achieving sinus rhythm . A retrospective study of sequential patients referred for elective dccv to basingstoke and north hampshire hospital over 12 months running from september 2013 to september 2014 . Patients were divided into two cohorts; cohort a received dabigatran, while cohort b was managed with warfarin . All patients with non - valvular af planned for dccv were included in the study . Patients managed with chemical cardioversion and those with mechanical valves and severe valvular heart disease were excluded from the study . Patients who started on anticoagulation with warfarin or dabigatran for dccv were eligible for the study . Those already on warfarin or dabigatran for another indication (pulmonary embolism) were also included . Their inr was checked weekly until the time of dccv with target inr of 23 . In line with normal practice, if the inr was not within the therapeutic range, the procedure was canceled pending adjustment of the dose of warfarin until the inr within the therapeutic range . Patients who were on dabigatran had baseline screening blood tests with coagulation profile, urea and electrolyte (u&es) and liver function tests (lft) with no further blood tests if results were normal / stable . Only patients with stable renal function and creatinine clearance above 30 ml / min commenced on dabigatran . Dabigatran was initiated at a dose of 110 mg twice daily for people over 75 years old and 150 mg twice daily for people less than 75 years old . On the date of the procedure, a written consent obtained from the patient after a discussion with risks and benefits of dccv . In addition, the duration of dabigatran therapy was reviewed ensuring that a full course of 3 weeks had been taken, and if more than two doses had been missed, the procedure was canceled and rescheduled for another date . The following data were collected: patient diagnosis, patient demographics, comorbidities, including cardiovascular risk factors (cha2ds2vasc), time between the referral for af and the date of dccv, the rate of cancelation and rescheduling of dccv, and the success rate of dccv in restoring sinus rhythm . Clinical outcomes, including cerebrovascular accident, transient ischemic attack, and peripheral arterial embolism, and bleeding events, were evaluated during 68 weeks of post - procedure follow - up . Differences between categorical values were analyzed using pearson s chi - square test and fisher s exact test, while the mann whitney u test was used for continuous values . A p value less than 0.050 was considered statistically significant . This article is based on previously conducted procedures and does not involve any new studies of human or animal subjects performed by any of the authors . During the period of 12 months from september 2013 to september 2014, 129 patients were referred for elective dccv for the treatment of af with 107 patients actually receiving dccv . The majority of referred patients 98.1% (105 out of 107) was newly started on oral anticoagulants, and only two (1.9%) patients were already receiving anticoagulants for the indication of pulmonary embolism . Fifty - four patients who received dccv were on dabigatran (50.5%; cohort a), 42 patients were on warfarin (39.2%; cohort b), and 11 patients were on another doac (10.2%). Twenty - two patients were canceled for various reasons; 4 patients with low inr (18%), 4 patients (18%) returned spontaneously to sinus rhythm, while the remaining cancelations were either because the patient was too unwell to receive dccv or because they had been referred for ablation . The majority of the referred patients (96 patients; 89.7%) had a low cha2ds2vasc score of between 0 and 3, while only 10.3% (11 out of 107) had a cha2ds2vasc score of between 4 and 9 . For patients receiving dabigatran, the average cha2ds2vasc was 1.9 1.8, while for warfarin, the average was 2.3 1.3 with no statistical significance (p = 0.291). The average age of included patients was 65.45 years, and there was no statistical significance in age between those on dabigatran and those on warfarin . The total number of male patients was 70, and the total number of females was 26, a ratio of 2.7:1 . In terms of comorbidities in the total number of patients: 38 had congestive heart failure, 36 had hypertension, 11 had diabetes, 14 had a history of vascular disease, and 5 had previous cerebrovascular disease . There was no statistical difference in comorbidities with cha2ds2vasc between cohort a and cohort b (table 1).table 1background data and outcome: cohort a versus cohort bcategorydabigatran (cohort a)warfarin (cohort b) p valuenumber of patients, n 5442mean age sd (range), years64.0 10.9 (2582)66.9 8.0 (4584)0.124 gender, n n 23130.795 diabetes mellitus, n 470.158 vascular disease, n 770.610 cerebrovascular accident, n 320.862 mean cha2ds2vasc score sd1.9 1.82.3 1.30.291 interval between referral and dccv (days)51800.001 cancelation and rescheduling of dccv390.219 dccv with successful outcome33220.391 dccv direct current cardioversion, sd standard deviation mann whitney u test pearson s chi - square test fisher s exact test background data and outcome: cohort a versus cohort b dccv direct current cardioversion, sd standard deviation pearson s chi - square test the average number of days between the date of referral for dccv and the date of dccv for patients who were on dabigatran was 51 days, while for patients on warfarin, this was 80 days (p = 0.001); for those who were on another doac, this was 50 days (table 1). The proportion of cancelation and rescheduling to a later date because of suboptimal inr for warfarin patients was 21.4% (9 out of 42 patients). In contrast, those who received dabigatran had a low rate of rescheduling with only three patients (5.5%) having dccv postponed due to missing doses (table 1). The majority of the patients (73%) received one dccv; 16% and 11% required 2 and 3 dccv, respectively . At 620 week review following dccv, the overall success rate was 57% (61 patients out of 107), and the proportion of patients who failed to maintain sinus rhythm was 46 out of 107 (43%). For those patients on dabigatran, the success rate was 61% (33 out of 54), and the failure rate was 39% (21 patients out of 54; table 1). In comparison, the success rate for patients on warfarin was 52% (22 patients out of 42; table 1), and the failure rate were 48% (20 out of 42). There were no reported cases of cerebrovascular accident, transient ischemic attack, and peripheral arterial embolism or bleeding events in patients who received dabigatran, warfarin, or other doacs . In addition, no discontinuation of any of the drugs was reported . As previous studies have shown that shorter duration of af associated with higher success rate of dccv and less relapse, review of patients with time between referral and date of dccv 45 days included 32 patients out of 107 (30%). Twenty - one patients were on dabigatran, 7 patients were on warfarin, and 4 patients were on another doac . At 620 week review post - dccv, the overall success of dccv in restoring sinus rhythm was 22 patients out of 32 (69%; p = 0.165; table 2) reflecting a higher success rate in this cohort . There were a high number of dabigatran patients receiving dccv within 45 days compared to warfarin, which indicates that dabigatran can be associated with more rapid dccv and a shorter af.table 2analysis of patients who received direct current cardioversion within 45 days and outcome; patients with background of heart failure and outcomecategorynumber of patientssuccess rate p valuenumber of patients with 45 days referral total3222 (69%)0.165 cohort a (dabigatran)21 cohort b (warfarin)7heart failure patients total3828 (73.7%)0.009 cohort a (dabigatran)2017 (85%)0.006 cohort b (warfarin)1811 (61%)0.327 analysis of patients who received direct current cardioversion within 45 days and outcome; patients with background of heart failure and outcome patients with heart failure represented a large group of 38 (39.8% of the total). The total success rate was 73.7% (28 patients; p = 0.009). The percentage of the success of dccv for heart failure who received dabigatran was 85% (17 patients; p = 0.006), while for warfarin patients, this was 61% (11 patients; p = 0.327; table 2). One of the limitations of this study is the relatively small number of patients in this single - center study; however, the data are comparable with other published studies . The relatively higher cost of dabigatran (75.60 per month) may limit its use in comparison with warfarin (0.861.67 per month but with additional monitoring costs). In the uk, it is estimated that the overall cost for outpatient dccv is approximately 722, and this cost is predicted to be higher with cancelation and rescheduling . Shorter duration between the onset of af and the date of dccv is associated with a higher probability of successful dccv . The use of dabigatran in comparison with warfarin facilitated earlier dccv with a lower probability of rescheduling due to inadequate anticoagulation . Sufyan benamer, debbie lusty, and tamara everington declare that they have no conflicts of interest . This article is based on previously conducted procedures and does not involve any new studies of human or animal subjects performed by any of the authors . This article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made.
Subependymoma, first described by scheinker in 1945, is a rare central nervous system tumor . Since its first description in the spinal cord by boykin et al in 1954, 32 involved the cervical cord . In the spinal region, these lesions are predominantly subpial in location, with exophytic components . The location of these lesions in the spinal cord suggest a subpial glial progenitor origin rather than its proposed origin from subependymal progenitor cells. [14] a 37-year - old lady presented to us with complaints of neck pain and gait disturbances of 1 year duration with severe progressive weakness of her right upper limb since 3 months . Mri revealed a long - segment t2 hyperintense intramedullary lesion opposite to the c3 to d4 vertebral levels with mild heterogeneous enhancement on the post contrast study [figure 1]. (a) sagittal t2 and (b) post contrast t1-weighted mr images showing a long segment t2 hyperintense and mild hetrogenous enhancing lesions in the cervical cord, showing cord expansion . Intraoperatively, the lesion was firm, with a poor plane of demarcation from the normal cord, and was seen intermingling with posterior and anterior nerve rootlets . It was eccentric in location, involving more of the left hemicord, with exophytic components [figure 2]. Surgical finding: typical exophytic subpial lesions, with lesion on either sides of the dorsal nerve roots . All of the resected tissue submitted for histopathological analysis was processed and embedded in three paraffin blocks . Histopathological examination [figure 3] revealed characteristic features of a subependymoma (who grade 1) with small monomorphic cells arranged in a lobular pattern against a finely fibrillary background, with occasional rosette like pattern . Features of pleomorphism, mitotic activity, endothelial cell proliferation, and necrosis were not seen . The mib-1 proliferative index was low (<1% of tumor cells) (). Immunohistochemistry revealed diffuse positivity for glial fibrillary acidic protein (gfap), whereas tumor cells failed to express epithelial membrane antigen (ema). Histopathology: (a) h and e staining shows lobular pattern arrangement of monomorphic nuclei in fibrillary pattern (400). (b) mib-1 labeling index is less than 1% of tumor cells (not shown in figure) (400). Immunohistochemistry for (c) gfap highlights diffusely positive tumor cells in a fibrillary background (400) (d) tumor cells are negative for ema (400) she did not receive any adjuvant treatment and has been on follow up for 6 months with periodic mr imaging . Subependymomas are rare central nervous system tumors accounting for 0.7% of all intracranial neoplasms and 8.3% of all ependymal tumors . They are located most frequently in the fourth ventricle (5060% of cases) followed by the lateral ventricles (3040%). So far, only 47 cases have been reported in the english literature in the spinal cord; of which 32 cases were located in the cervical, cervico - medullary, and cervico - thoracic locations . Most are intramedullary in location, with few subarachnoid and extramedullary variants mentioned in the literature . The symptomatic subependymoma generally occur after 40 years of age and are rare in childhood. [13] the salient features 33 in cases of cervical subependymomas they have a mean age of presentation of about 44 years with a strong male preponderance [table 2]. Epidemiology of spinal subependymomas (including our case). [16, 814] histopathologically these tumors are low grade (who grade 1), characterized by homogenous cells with sparse cellularity showing clustering of nuclei over a fibrillary background formed by cell processes and occasional occurrence of microcysts . The tendency to form pseudorosettes and the cells being round with hyperchromatic nuclei are reminiscent of ependymomas . Immunohistochemical characteristics are however identical to that of astrocytic neoplasms with diffuse gfap and s-100 protein positivity . In contrast to ependymomas, the former is evidenced by the processes containing intermediate filaments and the latter by microlumens, cilia, microvilli, and intercellular junctions . The histogenesis of these tumors has been much debated . Due to their ultrastructural similarities with ependymal cells, they were initially thought to arise from ependymal cells, with reactive astrocytic proliferation . Since immunohistochemical profile favors a glial origin, they were grouped with low - grade glial tumors . Tanycytes were also proposed as source of origin, due to the presence of ultrastructural features of glial as well as ependymal components . However, the presence of round cells rather than spindle - shaped cells differentiates these lesions from tanycytic ependymomas . The identification of cells similar to subependymal glial precursor cells suggested alternate cell of origin . Subependymal zone glial precursor cell origin cannot explain the predominant peripheral and exophytic location of these lesions in spinal cord unlike their intracranial counterparts . The current concept seems to suggest that these progenitor cells exist throughout the spinal cord white matter as well as the root entry zones . They are more localized in the outer subpial white matter than the medial zones, especially at the dorsal and ventral spinocerebellar tracts . They tend to proliferate within their template zones and do not possess trans - zonal migratory ability . The tumor origin from these cells better explains the eccentric, subpial, and exophytic locations of spinal subependymomas . The progenitor cells origin postulated by horner et al is an alternative to the conventional old postnatal theory [type 1, figure 4] where the progenitor cells migrate from the subependymal zone to the outer zones . There are two alternative postulates: one where the stem cell divides asymmetrically and the daughter cell migrates to the outer white matter where it remains as a glial progenitor cell and multiplies [type 2, figure 4], and the second which postulates that the stem cells exist separately in the outer zone where tracts are constantly proliferating even postnatally and these give rise progenitor glial cells [type 3, figure 4]. (a) post natal theory: where the subependymal stem cells give rise to glial progenitor cells which then migrate to the periphery . (b and c) alternate new theories where the stem cells themselves migrate to the periphery and become glial progenitor cells (b) or the stem cells already existing in the periphery of the cord become glial progenitor cells (c). Irrespective of their origin the subpial spinal white matter progenitor cells may be the origin of the spinal subependymoma . The subependymomas reported are more commonly located in the cervical cord and the cervico - thoracic cord followed by the pure thoracic and lumbar segments . One rare case occurring in the filum teminale has also been reported [table 2]. Radiologically, these lesions are located eccentrically within the cord, with iso or hypointense on t1-weighted images and mild hyperintensity on t2-weighted images . There is minimal diffuse or no enhancement on contrast. [148] these lesions can usually be excised totally . Only three cases have been reported with recurrence of the tumor after initial total excision . All of them had a resurgery and were not subjected to adjuvant radiation or chemotherapy despite recurrence . The chances of recurrence after total excision are low; hence, a total excision should always be attempted [tables 1 and 2]. However, as with our case, the size of the lesion and its extensive intermingling with the nerve roots made it sometimes necessary to settle for a subtotal excision . There have been instances of postoperative radiation following subtotal excision, but it is generally not recommended . Residual or recurrent tumor on follow up after gross total resection should be strongly considered for a re - excision rather than adjuvant therapy. [268]
Chronic granulomatous disease (cgd) is an inherited phagocytes defect, characterized by defects of nadph - oxidase and inability of bacterial killing, which leads to recurrent life - threatening infections . Respiratory problems, which are the major cause of morbidity in cgd, usually result from recurrent severe infections; however, vigorous inflammatory response could also cause respiratory diseases . Herein, an 11 year - old patient with cgd is presented who suffered from chronic cough and dyspnea for 7 years . Considering the results of chest x - ray, high - resolution computed tomography, and pulmonary function test, the diagnosis of interstitial lung disease was made . Early recognition of manifestations associated with cgd and appropriate treatment could prevent further complications and reduce morbidity and mortality in this group of patients . Chronic granulomatous disease (cgd) is a rare primary immunodeficiency disorder, which is caused by defects in superoxide generation and phagocytes function . Subsequent defect of bacterial killing leads to cytokine release and inflammation of different organs in the patients with cgd [13]. The majority of cgd patients suffer from respiratory disease, including pneumonia, lung abscess, and pulmonary fibrosis . Interstitial lung disease (ild) is a rare pulmonary condition in this group of patients which causes derangements of the alveolar walls and loss of functional alveolar capillary units leading to restrictive lung disease . Typical features of ild include the presence of diffuse infiltrates on chest radiograph, and abnormal pulmonary function test (pft) with evidence of a restrictive defect and/or impaired gas exchange . Exposure - related ild, systemic disease - associated ild, alveolar structure disorder - associated ild, and idiopathic ild in older children are generally considered as the main causes of ild in children . Ild could be as a result of recurrent life - threatening infections, whereas non - infectious inflammation could also be responsible for such lung disease . An 11 year - old boy was diagnosed with cgd in infancy, following severe recurrent lower respiratory tract infections . The patient gradually developed hypoxia, dyspnea on exertion, cyanosis and became worse during childhood . There were some evidences of repeated pneumonia and consequently using intravenous antibiotics in his past medical history . At the time of his admission to our clinic, he had not fever, but physical examination revealed tachypnea, crackles, retraction, and increased anteroposterior diameter of chest . Laboratory findings, including complete cell blood count (cbc), esr, liver function test, sweat chloride test and serum immunoglobulin levels were normal . Arterial blood gas (abg) analysis showed: ph 7.28, o2 saturation 64.7% and pco2 54.3 mmhg . Blood cultures and tracheobronchial secretion cultures for pyogenic, fungal and mycobacterial infections were negative . Polymerase chain reaction (pcr) for aspergillus and candida albicans was negative . Diagnostic bronchoalveolar lavage (bal) was performed to obtain specimens for cytology and culture . The smear of bal showed many isolated bronchial epithelial cells accompanied with few inflammatory cells . The result was compatible with diagnosis of cgd, which was also further confirmed by dihydro rhodamine123 (dhr) dye test . The result of high - resolution computed tomography (hrct) scan revealed ground glass appearance in both lung fields with some areas of decreased attenuation, honeycombing, asymmetric emphysematous change and increased interstitial marking, which was compatible with diagnosis of interstitial lung disease (fig . High resolution ct scan of the patient revealed ground glass appearance and emphysematous change in pft, forced expiratory volume in 1 second (fev1) was decreased to 38.7%; residual volume (rv) and total lung capacity were increased to 773.2% and 203.8%, respectively . The result of pft was air trapping and high airway resistance in favor of restrictive pattern and destructive lung disease . For excluding systemic disease - associated interstitial lung diseases, igm rheumatoid factor, serum antinuclear antibodies reactive to nuclear (ana), cytoplasmic antigens, anti smooth muscle antibody as well as serum angiotensin - converting enzyme level were measured, which were all normal . After considering ild in the patient, prednisolon therapy was initiated at a dose of 1 mg / kg / day associated with hydroxychloroquine . At the time of discharge, 30 days after admission, clinical respiratory findings such as cough and dyspnea subsided . After a 3-month course of prednisolone and tapering the dosage, an increased oxygenation at rest and sleep was achieved . Chronic granulomatous disease (cgd) is an inherited immunodeficiency disease, which is generally considered as a rare disease, but its frequency, especially its autosomal recessive form, seems to be much higher in the regions with high rate of consanguinity [68]. Although several organs could be affected in cgd, the most common site of involvement is lung [3, 6]. Ild is characterized by thickening of the alveolar walls by a wide spectrum of inflammatory cells, immunoregulatory cells and/or fibrosis, accompanied by loss of functional alveolar capillary unit . Diagnostic procedures could be used to detect ild, including chest x - ray, hrct, bronchoalveolar lavage, pft, and sometimes thoracoscopic lung biopsy . Etiology of ild encompasses a group of known and unknown disorders in children, but infections account for many cases of known etiologies . After considering ild, a careful history and serum levels of antibodies is needed for eliminating exposure - related ild and systemic disease - associated ild, respectively . Among disorders affecting the alveolar epithelium and the alveolar space, viral infections, microorganisms can be protected from intracellular killing, which consequently leads to leukocyte accumulation, cytokine release and inflammation . In spite of the fact that laboratory findings and bal specimens revealed no sign of bacterial, mycobacterial, and fungal infection, there was no further adequate facilities for diagnosis of respiratory viral infections in the patient . Idiopathic ild with unknown etiology may be seen even in cgd, but the reason for non - infectious inflammation remains mostly elusive . Recent studies demonstrated that genes encoding polymorphonuclear cells in cgd patients have an increased expression of pro - inflammatory molecules and decreased anti - inflammation mediators . Key regulators of apoptosis, inflammation and host defense were differentially expressed in the absence or presence of reactive oxygen species, respectively . Although cgd patients have increased susceptibility to infections, a higher incidence of sterile inflammatory disorders in these patients has also been noted . Although a favorable response to corticosteroid therapy can be expected in about 50% of cases, significant sequels such as need for long - term oxygen therapy are often observed . In this report, a rare complication of ild in a child with cgd has been reported which could be resulted as of either viral or non - infectious etiology . Early diagnosis of lung disease in an immunodeficient patient and appropriate management can prevent further complications, such as pulmonary fibrosis in this group of patients.
The etiologies of intracranial artery dissection are various, the exogenous triggers like trauma, infection as well as inherited connective tissue disorders like moyamoya disease, fibromuscular dysplasia, and marfan's syndrome . Alpha 1 antitrypsin deficiency and hyperhomocysteinemia are also distributing factors of carotid artery dissection19,25). The internal carotid artery dissection is responsible for less than 2% of all stroke and for 10 - 20% of stroke of young adults22). The dissection tends to occur in proximal internal carotid artery (ica) and rare in distal ica except when the cause is exogenous such as infection . Dissecting aneurysms of the intracranial posterior circulation are also rare that produce acute brain stem infarction or hemorrhage in young, healthy patients13,28,29). We report a case of multiple dissecting aneurysms of left superior cerebellar artery (sca), left posterior inferior cerebellar artery (pica) and right pericallosal artery in patient who presented with subarachnoid hemorrhage . We will also discuss of the relevance between dissecting aneurysm with the patient's medical history, thrombocythemia . A 42-year - old man was admitted to emergency room with a history of decrease in the level of consciousness . He had no previous event of motor weakness or dizziness before the onset of mental change . He had past medical history of hereditary spherocytosis and underwent splenectomy . During the follow up, his bone marrow biopsy reported megakaryocytic hyperplasia and he was diagnosed to essential thrombocythemia (et). After a year, he was diagnosed to cerebral infarction and had been taking oral anti - platelet agent, since then . The routine laboratory tests were normal except the platelet count, 660 k / ul . Serum elastase was also within normal limit . Emergent brain ct showed diffuse subarachnoid hemorrhage (sah) in the basal cistern and acute hydrocephalus (fig . The hematoma was located in posterior fossa, especially in interpeduncular cistern and prepontine cistern . The diffusion mri, which was done one year prior to the time of stroke, showed multiple cerebral infarctions on both cerebellum and body of corpus callosum (fig . With mr angiography, we could identify the fusiform aneurysms on the left sca and the left pica . 2b). The conventional angiography revealed multiple dissecting aneurysms in left sca, left pica and right pericallosal artery (fig . Considering hematoma distribution, we concluded that the sca aneurysm was responsible for sah . Since collateral circulation to midbrain, pons and cerebellum was abundant, we decided to occlude left sca with coil embolization (fig . Postoperative diffusion mri revealed cerebellar infarction; however, the patient showed no clinical symptom and was able to discharge with alert mentality, recovered from hemiparesis after rehabilitation (fig . Intracranial dissection is rare event comparing to extracranial dissection, and is usually demonstrate ischemic event of young adults when it's symptomatic5,22). It usually relates to exogenous triggers like trauma, infection as well as inherited connective tissue disorders . Our case was very rare one because it was a case of multiple intracranial dissecting aneurysms that resulted in sah as well as acute cerebral infarction which was related to no other risk factors except et . Essential thrombocythemia is characterized by a high platelet count, originating from a pluripotent stem cell and usually affects middle aged to elderly . Nearly half of the patients are asymptomatic while the other half has vascular occlusive or hemorrhagic event14). It is known to cause a prothrombic state10,17), and there are reports that describe the relationship between et with cerebral ischemic event . Arboix et al.3) has reported several cases of large - vessel occlusion which resulted in ischemic stroke due to et . Bogousslavsky et al.6) has reported that the ischemic stroke attributed to et was found in 0.4% of cases in the lausanne stroke registry . There have been reports of intrapetrous ica dissection of the patient with et9,12), yet multiple intracrnial dissecting aneurysms of the patient with et has been rarely reported . Piepgras et al.20) has reported the case of distal middle cerebral artery dissecting aneurysm secondary to proximal artery dissection, however, in our case, we could not find any dissection or occlusion in proximal arteries . Et, by changing prothrombotic state, causes a disturbance of microcirculation of vasa vasorum and as a result, increases the vulnerability of the vessel walls10). However, this theory only explains the dissection of extracranial arteries that the vasa vasorum is usually distributed to and does not fit in our case7). Et can induce endothelial damage by activating leukocyte and releasing the elastase and alkaline phosphatase that play a role of the pathogenesis of the prothrombic state8). The most characteristic structure of intracranial artery is internal elastic lamina . Instead of lack of external elastic membrane, thinner adventitia, and fewer elastic fibers of media, in addition, the media and internal layer of intracranial artery is lack of vasa vasorum7). These changes occurs at the level of skull base in the carotid artery and at the 1 cm proximal to the dural perforation in vertebral artery27). With the anatomical differences, there are pathological differences between dissecting aneurysm of extracranial and intracranial arteries . In the extracranial artery, dissection usually occurs between the media and adventitia or outer layer of the media11,13,23,28). In extracranial artery dissection, for example, cystic medial necrosis and degeneration of elastic tissue in the media is observed4,18). In the intracranial artery, on the other hand, intramural hematoma is usually formed between internal elastic lamina and media1,15,16,28,29). When the dissection involves the subadventitia and rupture into the subarachnoid space, sah is presented2,21,24,26,29).
Only several cases have been reported in the literature and most of them concerned mucous cysts (1 - 3). Although many theories have been suggested for the late cyst formation after rhinoplasty, migration or incorporation of mucosal tissue in the subcutaneous space during the surgical procedure has been accepted as an important mechanism (4 - 6). Careful dissection and meticulous manipulation of tissue and implant are necessary to prevent the mucosa from being grafted with the implant material (4 - 6). Rarely, a foreign body type cyst resulting from petroleum jelly impregnated with the packing material has been reported . The authors report a case of dorsal nasal cyst that was presumed to have a different pathogenesis . We describe this case with a brief review of the literature with an emphasis on its pathogenesis and treatment . Thirty years earlier at a local clinic, she had undergone augmentation rhinoplasty with a material presumed to be silicone . She had had no complication afterwards . However, 5 yr previously, a nasal mass developed that had increased gradually . Physical examination showed a 3.52.5 cm round, soft, painless mass on the midline of nasal radix (fig . The nasal dorsum and the tip were firm on palpation and a small cruciate incision scar was found at the infratip lobule, which was supposed to be the entry of the augmentation material . On computed tomography (ct) scan, a heterogeneous cystic mass was observed at the radix and the cyst was continuous with a homogenous density at the nasal dorsum, which was first thought to be a silicone implant (fig . 2). A presurgical diagnosis of nasal radix cyst associated with previous augmentation rhinoplasty was made, and a direct, open approach was chosen to remove the cyst . After a skin incision on the center of the cyst, it was dissected down to the nasal bone . The cyst was connected to the dorsal mass, which were removed together in en - bloc fashion (fig . 3a). For safe removal of the graft material over the tip area and effective tip - plasty, grossly, the removed cystic mass had a thick, fibrous wall with dirty cheesy material inside . The cystic wall was composed of dense fibrous tissue containing dispersed, microsized amorphous foreign materials (fig . Foreign materials were surrounded by foreign body type multinucleated giant cells and induced granulomatous reactions . A scanning electron microscopy (sem) showed a fragment of foreign body (fig . 4a) and energy dispersive radiography spectroscopy (edx) showed presence of silicone (si) in the removed specimen (fig . The lesion was diagnosed as a foreign - body type cyst associated with silicone material used for the augmentation rhinoplasty . The depressed radix, dorsum, and tip after excision of the mass were reconstructed using auricular and septal cartilages . The redundant and thin skin of the radix was trimmed and reinforced with an underlay of the temporalis fascia . The patient has been followed for 9 months postoperatively with a good aesthetic result and no complication (fig . Exact pathogenesis of the cyst formation in our case is not clear because no information about the material that had been used for dorsal augmentation was available . However, considering the gross and histological findings as well as the results from sem - edx analysis, foreign body inflammatory reaction from silicone material, most possibly a liquid type, which had been injected 30 yr ago, probably caused the cyst . First, sem - edx analysis of the cyst revealed silicone in the cyst, which meant that a type of silicone material was used for dorsal augmentation . Second, silicone, whether it is a liquid type or implant type, was and still is the most commonly used material for augmentation rhinoplasty in korea . Third, a small, cruciate incision of the infratip lobule was too small to insert any type of hard material including silicone implant . Although calcification and inflammatory cell infiltration around a silicone implant have been reported, total degradation is impossible considering the bio - characteristics of the silicone implant (7, 8). Sem - edx used for analyzing the graft material in this case adopted the principles that when the electron generated from the electron microscope collides with the object, a specific radiography characteristic to the object is released from the surface . Edx analysis clarifies the object by detecting this radiography, and this technique is widely used in material engineering and archeology . In our case, a small amount of silicone detected in the specimen led us to believe that the foreign body that caused cyst formation was a type of silicone material . Silicone implant has been used for rhinoplasty since 1950 and it still remains one of the most widely used implant materials in asian countries, including korea (9 - 11). Injectable liquid silicone is useful in augmenting the chin, cheek, and glabella area (12). It is not recommended for rhinoplasty because the nasal skin is thin and the silicone frequently results in ridging or beading (12). Serious complications such as severe edema or localized discoloration of the injected area has also been reported (13). Only one case of nasal dorsal cyst after augmentation rhinoplasty using silicone implant has been reported in the literature but it's pathologic findings and pathogenesis were not clarified (1). The mainstay of treating postrhinoplasty nasal dorsal cyst is complete resection and reconstruction . In this case, a direct open approach using the horizontal incision over the cyst center was used given the location and size of the cyst . To expose the tip, an open approach using separate transcolumellar incision was chosen because a previous cruciate incision was located at the infratip lobule and it was too small to expose the nasal tip . In revision rhinoplasties due to complications of the allograft implant, fortunately, we could augment the depressed dorsum and radix with autogenous septal and auricular cartilages without harvesting the rib cartilage despite the large defect.
Dd, caused by mutations in the er ca atpase atp2a2 (sakuntabhai, et al ., 1999), is an uncommon (1:30,000) blistering skin disease . Patients with dd suffer from impaired cell - to - cell adhesion, defective keratinocyte differentiation, and non - physiologic keratinocyte apoptosis . Histologically, dd manifests with suprabasal clefting in the epidermis, acantholysis, rounded dyskeratotic keratinocytes (corps ronds), hyperkeratosis and parakeratotic keratinocytes in the stratum corneum (grains). Current treatments, such as retinoids, do not ameliorate the underlying defect in er ca sequestration, and are ineffective for many patients . This report, by savignac et al (editor, please add reference), advances our understanding of dd in several important ways . First, it illustrates how er stress impairs the formation of both adherens junctions and desmosomes, contributing to dd pathogenesis . Second, it expands our understanding of how er ca signaling may control, not only keratinocyte growth and differentiation, but also keratinocyte cell - to - cell adhesion . Defects in desmoplakin redistribution have been associated with the impaired cell - to - cell adhesion seen in dd (dhitavat, et al ., 2003, defective desmoplakin redistribution after serca2 ca depletion is mediated by protein kinase c alpha (pkcalpha) (hobbs, et al ., 2011). Pkcalpha also may act on desmoplakin to direct the hyperadhesive desmosomal state (hobbs and green, 2012), rearrange desmosome components during wound healing (garrod, 2013), and modulate desmosomal susceptibility to autoimmune attack in pemphigus vulgaris (cirillo, et al ., more recently, cell - to - cell adhesion defects in dd also have been associated with defects in e - cadherin redistribution (celli, a., et al ., 2011). Because both desmoplakin and e - cadherin have been shown to have signaling as well as structural roles (kowalczyk and green, 2013, tu, et al ., 2012), it is likely that interactions among adhesion components involve multiple feedback loops between each other and the serca2-controlled er ca store . Mild and self - limited er stress, due to transient release and refill of er ca stores, is an important physiologic signal for epidermal permeability barrier repair and antimicrobial peptide synthesis (celli, a., et al ., 2011, park, et al ., 2011). Once er ca depletion passes a critical threshold, the er unfolded protein response (upr) is triggered, and apoptotic mechanisms are initiated in many cell types (oakes, et al ., 2003). This report identifies er stress, induced by er ca depletion due to serca2 dysfunction, as an important contributor to dd pathogenesis . Finally, this report demonstrates that treatment of dd keratinocytes with miglustat improves desmoplakin and e - cadherin redistribution and improves (although it does not normalize) cell - to - cell adhesion . The authors propose that miglustat acts as a chaperone that allows adhesion molecules to escape from the er stress - induced upr, thus enabling them to reach the plasma membrane and form adherens junctions and desmosomes . Miglustat, used clinically for gaucher disease, also acts to inhibit glucosylceramide synthase (reviewed in venier and igdoura (venier and igdoura, 2012)), and an additional potential therapeutic pathway may be through its modulation of the ceramide / sphingolipid pathway previous described in dd pathogenesis (celli, a, et al ., 2012). Lastly, since glucosylceramide synthesis is required for epidermal permeability maintenance (jennemann, et al ., 2007), some caution should be used in extrapolating these results from monolayer keratinocytes to a multilayered epidermis or to patients . As the authors note, however, therapeutic options for dd are limited, and miglustat may be the first in a series of agents that treat dd by facilitating redistribution of adhesion molecules to the plasma membrane.
Dorsal root ganglion sensory neurons from adult sprague - dawley male rats were isolated and dissociated using a previously described method (1719). Rats were age - matched control or 3- to 5-month stz - diabetic rats that included cohorts receiving insulin implants (two linplant implants placed subcutaneously; linshin canada, north scarborough, on, canada). Rats were made diabetic with a single intraperitoneal injection of 75 mg / kg stz (sigma, st . End points for body weight, plasma glucose, and hemoglobin a1c are presented in supplementary table 1, which is available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0034/dc1 . Cells were plated onto poly - dl - ornithine and laminin - coated 12-well plates (nunclon surface, ottawa, on, canada) for the neuronal survival study, 25-mm glass cover slips (german glass no . 1; electron microscopy sciences, hatfield, pa) for neurite outgrowth and for immunocytochemistry, and 35-mm glass - bottom dishes for ros measurement (catalog no . W20; bioscience tools, san diego, ca). Neurons were cultured in ham's f12 medium (invitrogen, carlsbad, ca) with 10% fetal bovine serum (fbs; hyclone, logan, ut) for long - term cultures (> 5 days). For short - term cultures, neurons were grown in defined medium with modified bottenstein and sato's n2 medium containing: 0.1 mg / ml transferrin, 20 nmol / l progesterone, 100 mol / l putrescine, 30 nmol / l sodium selenite, and 10 mg / ml bsa (the modified n2 formulation used did not include insulin; all obtained from sigma). Neurons that died in the intervals between examination points were absent, and the viability of the remaining neurons was assessed by morphologic criteria . Neurons with membranes and soma with a smooth round appearance were viable, whereas neurons with fragmented or distended membranes and vacuolated soma were nonviable . Four images were collected from each well and from the same place using marked grids on each well bottom at 1, 4, 7, 21, and 28 days using a light microscope (phase contrast nikon diaphot). Survival was confirmed by trypan blue exclusion at the last time point . For neurite outgrowth measurements, images of cultures the longest axon and total number of neurons and number of intersects of their neurites with a vertical grid were counted using a morphometric approach and sigmascan microsoft software . The total number of intersects per neuron was taken as the parameter of total axon outgrowth as previously described (22). Ros levels were detected using real - time fluorescence microscopy on a carl zeiss lsm510 inverted confocal microscope using two dye - based approaches:1) dihydrorhodamine 123 (dhr123) and 2) 5-(and-6)-chloromethyl-27-dichlorodihydrofluorescein diacetate acetyl ester (cm - h2dcfda). Neurons were loaded with 5 mol / l of dhr123 (in 100% etoh; sigma) or 1.2 mol / l cm - h2dcfda (in 100% anhydrous dmso; molecular probes) for 30 or 15 min, respectively, at 37c, and then washed three times with f-12 and visualized using the argon laser (at 2% power). For dhr123, excitation (max) was 505 nm and emission (max) 534 nm, and for cm - h2dcfda, excitation (max) was 488 nm and emission collected above 510 nm . Images were collected and analyzed as pixel intensity at the level of the axon or cell body . For axonal signals, all axons in each field were assessed, and, using the carl zeiss software package, a line was placed along the length of the axon and pixel intensity collected per micrometer of axon . Control experiments were performed to confirm that the dhr123 and cm - h2dcfda signals were sensitive to antioxidant (n - acetyl - cysteine) or pro - oxidant (h2o2) treatment (not shown). Dorsal root ganglion neurons were fixed with 4% paraformaldehyde in phosphate buffer at ph 7.4 for 15 min followed by permeabilizing with 0.3% triton x-100 in pbs . Nonspecific binding was blocked by incubation with blocking reagent combined with fbs and 1.0 mol / l pbs in proportions of 3:1:1 (catalog no . 1 096 176; roche, indianapolis, in) for 1 h at room temperature and washed with pbs three times . Cells were then incubated with antibodies to -tubulin isotype iii (1:1,000; sigma, oakville, on, canada), caspase 3 (1:100; chemicon, temecula, ca), (e)-4-hydroxy-2-nonenal (4-hne) adducts (1:500 anti-4-hne adducts pab; alexis biochemicals, san diego, ca), manganese superoxide dismutase (mnsod; 1:300; stressgen, ann arbor, mi), and phosphorylated neurofilament h (nfh; 1:500 smi-31; covance, berkeley, ca). For localization of mitochondria, live cultures of dorsal root ganglion neurons were treated for 15 min with 200 nmol / l mitofluor green dye (molecular probes, eugene, or) before being fixed for immunostaining for anti - nfh . Primary antibodies were incubated with slides overnight in a humidified chamber followed by fluorescein isothiocyanate and cy3-conjugated secondary antibodies (jackson immunoresearch laboratories, west grove, pa; 1:250) for 3 h at room temperature . Fluorescence signals were examined and quantified using a carl zeiss axioscop-2 mot microscope with axiovision 3 software and equipped with fluorescein isothiocyanate, cy3, 4,6-diamidino-2-phenylindole filters, and an axiocam camera . Because of the technically difficult nature of the cultures and the image acquisition, not all images were collected in a blinded fashion, although a random approach was taken for image capture from each well . Where appropriate, data were subjected to one - way anova with post hoc comparison using tukey's test (prism 4; graphpad software, san diego, ca). In all other cases, standard two - tailed unpaired student's t test with welch's correction was performed, which does not assume equal variances, with significance levels of p = 0.05, using graphpad prism 4 . Ros levels were detected using real - time fluorescence microscopy on a carl zeiss lsm510 inverted confocal microscope using two dye - based approaches:1) dihydrorhodamine 123 (dhr123) and 2) 5-(and-6)-chloromethyl-27-dichlorodihydrofluorescein diacetate acetyl ester (cm - h2dcfda). Neurons were loaded with 5 mol / l of dhr123 (in 100% etoh; sigma) or 1.2 mol / l cm - h2dcfda (in 100% anhydrous dmso; molecular probes) for 30 or 15 min, respectively, at 37c, and then washed three times with f-12 and visualized using the argon laser (at 2% power). For dhr123, excitation (max) was 505 nm and emission (max) 534 nm, and for cm - h2dcfda, excitation (max) was 488 nm and emission collected above 510 nm . Images were collected and analyzed as pixel intensity at the level of the axon or cell body . For axonal signals, all axons in each field were assessed, and, using the carl zeiss software package, a line was placed along the length of the axon and pixel intensity collected per micrometer of axon . Control experiments were performed to confirm that the dhr123 and cm - h2dcfda signals were sensitive to antioxidant (n - acetyl - cysteine) or pro - oxidant (h2o2) treatment (not shown). Dorsal root ganglion neurons were fixed with 4% paraformaldehyde in phosphate buffer at ph 7.4 for 15 min followed by permeabilizing with 0.3% triton x-100 in pbs . Nonspecific binding was blocked by incubation with blocking reagent combined with fbs and 1.0 mol / l pbs in proportions of 3:1:1 (catalog no . 1 096 176; roche, indianapolis, in) for 1 h at room temperature and washed with pbs three times . Cells were then incubated with antibodies to -tubulin isotype iii (1:1,000; sigma, oakville, on, canada), caspase 3 (1:100; chemicon, temecula, ca), (e)-4-hydroxy-2-nonenal (4-hne) adducts (1:500 anti-4-hne adducts pab; alexis biochemicals, san diego, ca), manganese superoxide dismutase (mnsod; 1:300; stressgen, ann arbor, mi), and phosphorylated neurofilament h (nfh; 1:500 smi-31; covance, berkeley, ca). For localization of mitochondria, live cultures of dorsal root ganglion neurons were treated for 15 min with 200 nmol / l mitofluor green dye (molecular probes, eugene, or) before being fixed for immunostaining for anti - nfh . Primary antibodies were incubated with slides overnight in a humidified chamber followed by fluorescein isothiocyanate and cy3-conjugated secondary antibodies (jackson immunoresearch laboratories, west grove, pa; 1:250) for 3 h at room temperature . Fluorescence signals were examined and quantified using a carl zeiss axioscop-2 mot microscope with axiovision 3 software and equipped with fluorescein isothiocyanate, cy3, 4,6-diamidino-2-phenylindole filters, and an axiocam camera . Because of the technically difficult nature of the cultures and the image acquisition, not all images were collected in a blinded fashion, although a random approach was taken for image capture from each well . Where appropriate, data were subjected to one - way anova with post hoc comparison using tukey's test (prism 4; graphpad software, san diego, ca). In all other cases, standard two - tailed unpaired student's t test with welch's correction was performed, which does not assume equal variances, with significance levels of p = 0.05, using graphpad prism 4 . Initial experiments were designed to test the influence of high concentrations of glucose (50 mmol / l) on survival of sensory neurons in culture, the induction of apoptosis, and markers of oxidative stress . Sensory neurons from adult control rats were grown up to 4 weeks in f12 medium with 10% fbs . Healthy neurons were phase bright, and by 1 week, cultures exhibited high numbers of nonneuronal cells, including schwann cells, satellite cells, and fibroblasts (fig . High glucose concentration had no effect on survival of neurons at any time and did not affect axon outgrowth on day 1 (fig . Surviving dorsal root ganglion neurons did decline over time and had diminished by 50% by the 28th day; however, there was no effect of 50 mmol / l glucose on this process . Oxidative stress and/or induction of apoptosis was assessed by staining for adducts of 4-hne and caspase 3 activation . There was no effect of 50 mmol / l glucose on caspase 3 or 4-hne adduct expression in neuronal perikarya at 2 or 4 weeks (fig . However, there was a small (1020%), but statistically significant, increase of activation of caspase 3 and 4-hne adduct expression in the 4- vs. 2-week group of dorsal root ganglion neurons; this effect was not perturbed by 50 mmol / l glucose . High glucose concentration does not impair adult sensory neuron survival or induce oxidative stress . A and b: phase contrast images of 2-week cultures of adult dorsal root ganglion sensory neurons grown in defined f12 + 10% fbs medium with and without 50 mmol / l d - glucose . Note the phase - bright neuronal perikarya and phase - dark nonneuronal cells (mostly fibroblasts and schwann cells). C: levels of survival of dorsal root ganglion neurons for control (10 mmol / l d - glucose) or 50 mmol / l d - glucose over a 4-week period . Cell numbers were assessed by morphology under a phase contrast microscope . The insert graph shows no difference in total axonal outgrowth at 24 h. values are the means se, n = 3 replicate cultures . D and e: levels of 4-hne adduct expression or caspase 3 activation in neuronal perikarya in arbitrary units of fluorescence intensity at 2 and 4 weeks of culture . A second set of experiments tested whether high glucose concentration induced oxidative stress in neuronal perikarya or axons in cultures of adult sensory neurons under defined conditions in f12 + modified n2medium . To assess oxidative stress, a real - time video microscopy approach was taken using the fluorescent dye cm - h2 dcfda . This dye is believed to give a readout of cellular ros levels, including peroxynitrite, hydrogen peroxide, and hydroxyl radicals . Neurons were grown 24 h under control (10 mmol / l glucose) or high (25 mmol / l) glucose . 1 shows no effect of 25 mmol / l glucose on cm - h2dcfda intensity in neuronal perikarya (supplementaryfig . We next determined whether cultured neurons from stz - diabetic rats were also refractory to high glucose concentration . Neurons from age - matched control rats were grown in defined f12 + modified n2medium under low (10 mmol / l) glucose with 10 nmol / l insulin, whereas neurons from 3- to 4-month stz - diabetic rats were grown in f12 + modified n2medium with 25 mmol / l glucose with no insulin support (to attempt to mimic diabetes in vivo). Cell survival of neurons from normal and diabetic rats over a 4-day period and under defined conditions were identical . Figure 2 shows the phase contrast images of sensory neurons from control (fig . 2a, upper and lower panels) and stz - diabetic (fig . Diabetic dorsal root ganglion neurons exhibited abnormal morphologic changes in neurite outgrowth, which were characterized by less axonal outgrowth (fig . 2c) and appearance of phase - dark axonal swellings and beading along neurites (fig . 2b, lower panel, inset). Separate cultures from control or stz - diabetic rats were grown for 1 day and assessed for level of ros in cell bodies and axons using cm - h2 dcfda (fig . Ros levels in cell bodies did not differ between control and diabetic neurons (not shown). Axonal ros levels in neurons from stz - diabetic rats showed at least a twofold elevation compared with control using both dyes (fig . Cultures were then grown for 4 days and immunostained for 4-hne adducts and -tubulin iii . Control cultures exhibited normal axons with very rare instances of axonal swellings (or varicosities); such swellings were negative for 4-hne adduct staining (fig ., cultures from stz - diabetic rats demonstrated large numbers of axonal swellings that were characterized with positive staining for 4-hne adducts (fig . The cell bodies of control and diabetic cultures revealed similar levels of highly positive staining for 4-hne adducts . Cultured sensory neurons from stz - diabetic rats exhibit abnormal morphology and reduced levels of axon outgrowth . A: upper and lower panels show phase contrast images of neurons derived from normal rats at 4 days in culture in defined f12 + modified n2 medium with 10 nmol / l insulin . B: upper and lower panels show images of cultures derived from 3- to 4-month stz - diabetic rats and grown in defined media with 25 mmol / l glucose and no insulin . C: quantification of axonal outgrowth, longest axon, after 1 and 4 days of culture from control or stz - diabetic rats . 0.001 . Axons of sensory neurons from stz - diabetic rats exhibit elevated level of ros . A and c: images of ros levels in axons at 24 h of adult dorsal root ganglion neuron culture from control rats . Cultures were stained for ros using cm - h2dcfda (a) or dhr123 (c) dye, and cells were grown in defined f12 + modified n2 medium with 10 nmol / l insulin . B and d: axonal ros level at 24 h of adult dorsal root ganglion neuron culture from 3- to 4-month stz - diabetic rats . Cells were grown in defined f12 + n2 medium with 25 mmol / l glucose and without insulin . E and f: quantification of ros accumulation in axons of dorsal root ganglion neurons from control and stz - diabetic rats is shown in a bar graph derived from cm - h2dcfda (e) or dhr123 (f) staining . Axons of neurons of stz - diabetic rats exhibit swellings that include adducts of 4-hne . A, c, and e: merged immunofluorescent images stained for 4-hne (green) and neuron - specific -tubulin iii (orange) at 4 days of sensory neuron culture from control rats (blue nuclei were stained with 4,6-diamidino-2-phenylindole). Cells were grown in f12 + modified n2 defined medium with 10 mmol / l d - glucose and with 10 nmol / l insulin . B, d, and f: merged immunofluorescent images of cultures from stz - diabetic rats grown in f12 + modified n2 defined medium with 25 mmol / l d - glucose and without insulin . (a high - quality digital representation of this figure is available in the online issue .) It was important to determine whether differences in axonal morphology, ros levels, and 4-hne staining between control and diabetic cultures was controlled by acute effects in the culture of glucose concentration and/or insulin . Dorsal root ganglion sensory neurons from stz - diabetic rats were cultured at 10 mmol / l glucose, 25 mmol / l glucose, and 15 mmol / l mannitol (+ 10 mmol / l glucose) in defined f12 + modified n2medium without insulin support . Quantification of ros accumulation in axons using cm - h2 dcfda dye showed a statistical increase in ros levels after high glucose administration compared with low glucose concentration (fig . 4-hne adduct accumulation in axons of sensory neurons from stz - diabetic rats was measured after 3 days of culture (fig . High glucose concentration induced a significant increase in 4-hne adduct accumulation in axons compared with those cultured at 10 mmol / l glucose and mannitol (fig . Neurons isolated from stz - diabetic rats treated for the final month with insulin that significantly lowered hyperglycemia (supplementary table 1) did not respond to high glucose with elevated ros or 4-hne accumulation in axons (fig . Studies were also performed in which stz - diabetic neurons were treated with 10 nmol / l insulin in the presence of low or high glucose concentration, and under such conditions there was no impact on ros or 4-hne levels of the insulin treatment (data not shown). In addition, an alternative control was used for mannitol, 15 mmol / ll - glucose, and results were the same as those seen with mannitol . High glucose concentration elevates ros and adducts of 4-hne in axons of sensory neurons from stz - diabetic rats . A and b: images of sensory neuron cultures, which were assessed for ros in axons on day 1 using cm - h2dcfda at 10 mmol / l d - glucose (a) or 25 mmol / l d - glucose (b) or 15 mmol / l d - mannitol (with 10 mmol / l glucose; image not shown) in defined f12 + modified n2 medium . E: quantification of ros accumulation in axons of dorsal root ganglion cultures from control, diabetic, or diabetic treated with insulin animals using cm - h2dcfda emission . Values are the means se, n = 4457 axons . * p <0.05 vs. 25 mmol / l glucose . C and d: immunofluorescent images of accumulation of adducts of 4-hne in axons in sensory neuron cultures after 3 days in defined f12 + n2 medium with 10 mmol / l d - glucose (c) or 25 mmol / l d - glucose (d) (individual puncta are indicated by white arrows; 15 mmol / l mannitol; image not shown). Values are the means se, n = 36 replicate cultures . * * p <0.05 vs. other groups (one - way anova with tukey's post hoc comparison)., 10 mmol / l glucose;, 25 mmol / l glucose;, mannitol . Experiments now determined whether oxidative stress was causally linked to aberrant axonal structure in neurons derived from stz - diabetic rats . The antioxidant n - acetyl cysteine (nac) was tested for its ability to lower ros . Cultures from control rats were assessed for ros using dhr123 imaging and treated acutely with 1 mmol / l nac (fig . 6). Figure 6a d shows that nac rapidly neutralized ros levels . In a separate experiment, stz - diabetic cultures were plated for 1 day in the presence or absence of 1 mmol / l nac, and effect on axonal outgrowth was determined; nac was clearly able to enhance levels of total axonal outgrowth (fig . Cultures of sensory neurons from control or stz - diabetic rats were maintained for 3 days (at this time point, diabetic neurons exhibited 4-hne staining) (fig . Stz - diabetic neurons were treated with 1 mmol / l nac for a further 24 h. after 4 days all groups of cultures were treated with mitofluor green dye to specifically stain mitochondria and then fixed and immunostained for phosphorylated nfh.figure 7a and b shows control neurons with normal axonal structure and uniform axonal localization of mitochondria . Cultures from stz - diabetic rats demonstrated abnormal accumulations of mitochondria in axonsthat colocalized with phosphorylated nfh staining (fig . / l nac significantly lowered the number of axonal swellings in normal and stz - diabetic cultures (fig . G). Treatment with antioxidant nac lowers ros levels in axons and elevates axon outgrowth . Ros levels, measured using dhr123, in axons before (a) and after (b) 10 min of treatment with 1 mmol / l nac (asterisk indicates perikarya of neuron). C and d: real - time imaging data of ros levels in axons before (c) and after (d) 1 mmol / l nac treatment . E: total axon outgrowth for stz - diabetic neurons cultured for 24 h with () or without () 1 mmol / l nac . Values are the means se, n= 3 replicate cultures . * p <0.05 . Axonal swellings in neurons from stz - diabetic rats exposed to high glucose represent accumulations of mitochondria and phosphorylated nfh, which are eliminated by antioxidant treatment . In the left column of immunofluorescent images is mitofluor green staining; the right column exhibits phosphorylated nfh staining (orange). Dorsal root ganglion sensory neuron cultures were derived from age - matched control or 3- to 4-month stz - diabetic rats and maintained in defined media for 4 days . Stz - diabetic rat cultures were grown in 25 mmol / l glucose without insulin . During the final 24 h of culture time, selected control or diabetic cultures were treated with 1 mmol / l nac . A f: control (a and b), stz - diabetic (c and d), and stz - diabetic culture treated for 24 h with 1 mmol / l nac (e and f). (a high - quality digital representation of this figure is available in the online issue .) Increased ros under high glucose concentration in diabetic neurons may reflect an impaired capacity to scavenge free radicals . Therefore, the effect of diabetes and high glucose on the expression of mnsod was assessed in isolated mitochondrial preparations from dorsal root ganglia and in cultured sensory neurons . In fig . 8, we present western blot data demonstrating that mnsod expression was reduced by 32% (p <0.005) in mitochondria isolated from dorsal root ganglia of stz - diabetic rats, and this was prevented by insulin therapy.figure 9a and b shows axonal staining of mnsod in sensory neurons from age - matched control rats cultured for 1 day under 10 mmol / l glucose . Neurons from stz - diabetic rats cultured under 10 mmol / l glucose for 1 day exhibited diminished immunostaining for mnsod (fig . 9c and d); however, if cultured in the presence of 25 mmol / l glucose, then no alteration in mnsod expression was observed (fig . 9e and f). When cultures were maintained for 3 days in vitro, the ability of 25 mmol / l glucose to maintain or raise mnsod expression was significantly impaired (fig . Mnsod expression is reduced in mitochondria of dorsal root ganglion from stz - diabetic rats . Dorsal root ganglia from 5-month control, stz - diabetic, or insulin - treated diabetic rats were homogenized in mitochondrial isolation buffer containing: 10 mmol / l hepes (ph 7.4), 200 mmol / l mannitol, 70 mmol / l sucrose, and 1 mmol / l egta . The dorsal root ganglion homogenate was centrifuged at 800 g for 10 min at 4c followed by centrifugation of the supernatant at 8,000 g for 15 min, and the mitochondrial pellet was collected . Mitochondrial protein preparations (5 g / lane) were resolved on a 12% sds - page gel and electroblotted (30v, 16 h) onto nitrocellulose membrane . Blots were then blocked in 5% nonfat milk containing 0.05% tween overnight at 4c, rinsed in pbs (ph 7.4), and then incubated with rabbit anti - mnsod polyclonal antibody (1:2,000 dilution) overnight at 4c . Extracellular signal regulated kinase (1:2,000; covance) was probed as a loading control (previously shown not to change in diabetes in dorsal root ganglia). The blots were rinsed, incubated in super signal west pico (pierce biotechnology, rockford, il), and imaged using a biorad fluor - s image analyzer . A and b: shown are the blots (a) and chart (b) in which mnsod signal has been presented relative to total extracellular signal regulated kinase levels . P <0.005 vs. control; * * p = 0.056 vs. diabetic + insulin (one - way anova with tukey's test). Db, diabetic; erk and erk, extracellular signal regulated kinase; ins, insulin . Effect of stz - diabetes on expression of mnsod in axons of cultured sensory neurons . Lumbar dorsal root ganglion sensory neurons were isolated from age - matched normal or 5-month stz - diabetic rats and cultured with 10 mmol / l (white or black bars) or 25 mmol / l (gray or red bars) glucose for 1 or 3 days . F: cells were fixed and immunofluorescently costained for -tubulin iii (red; neuron specific) (panels a, c, and e show double stain) and mnsod (green) (panels b, d, and f show single stain). Charts show 1 day (g) and 3 days (h) of mnsod expression in axons assessed by fluorescence intensity at 100 on a confocal microscope . Values are the means se, n = 6594 axons . * p <0.05 vs. other groups; * * p <0.05 . (a high - quality digital representation of this figure is available in the online issue .) This work demonstrates for the first time that high glucose concentration can induce oxidative stress and axonal degeneration in adult sensory neurons, but only if these neurons exhibit an stz - induced diabetic phenotype . Neurons from normal rats did not exhibit oxidative stress or cell death under high glucose concentrations . High glucose concentration in neurons from diabetic rats triggered elevated ros levels and adducts of 4-hne specifically in axons, with the perikarya being unaffected, and this distally directed process of oxidative stress resulted in axonal swelling and axon degeneration . This neurodegenerative process may have been triggered or exacerbated by impaired anti - oxidant defenses, as evidenced by the diminished expression of mnsod in axons . The appearance and content of the axonal swellings closely resembled dystrophic axons observed in human disease . Previous studies on cultures of embryonic sensory neurons have shown that high glucose concentration triggers oxidative stress, activation of apoptosis, and death of neurons (46). In vitro studies by russell and colleagues (35) and feldman and colleagues (4,6) used glucose concentrations of 4550 mmol / l and higher and showed, using an array of markers of oxidative stress and apoptosis, that these indexes were enhanced in cultured embryonic neurons . Instead, we found that survival of adult sensory neurons from lumbar dorsal root ganglia of normal or diabetic rats did not change under high glucose concentrations . This supports previous in vitro studies on sensory neuron cultures from adult rats and mice (dissociated and explant), where exposure to a hyperglycemic environment failed to induce neuronal death over 18 days (23,24). In addition, embryonic sensory neurons given time to mature in vitro for several weeks also become resistant to the apoptosis - inducing effects of high glucose concentration (25). Differences in culture conditions between embryonic and adult preparations may play a role here, and in particular the presence of nonneurons in the mature and adult cultures may be protective against hyperglycemia . However, this glucose insensitivity of adult rat sensory neurons with respect to cell survival is in good agreement with in vivo studies on experimentally diabetic rodents (810,12,26). In the stz and bb rat models of type 1 diabetes, there is no loss of dorsal root ganglion neurons until 1012 months of disease, and by this time there is already extensive distal axon loss (911,27). There are clearly a range of effects of stz - induced diabetes on neuronal survival and fiber loss in rodent models, depending on the rodent and/or strain . Clearly, in rat models, either in vitro or in vivo, neuronal cell loss is not a feature of the pathogenesis that underlies distal axon loss . It should be noted that sensory neurons under diabetic conditions can express markers of apoptosis, e.g., activated caspase-3, but these indexes are dissociated from cell death (8). These varied effects of the diabetic state on neuronal survival in the animal models must be judged with caution given the findings that neuronal cell loss in the human form of the disease is not a major feature of the pathology . Studies on postmortem lumbar dorsal root ganglion and sympathetic ganglia derived from type 2 diabetic patients showed ultrastructure of the neuronal perikarya to be abnormal, with signs of shrinkage and axonal dystrophy; however, there was no evidence of any cell loss (14,15). This lack of clear neuronal cell loss occurred while there was overt distal axonal loss in the epidermis (2830) and sural nerve (1,2,31) of type 1 and type 2 diabetic patients . The key finding of the current work is that high glucose concentration induced oxidative stress in the axons of sensory neurons isolated from stz - diabetic rats . This effect was not caused by osmotic stress, and the presence or absence of insulin in the culture was irrelevant to the development of neurodegeneration . The failure of glucose to enhance such processes in normal neurons clearly reveals the importance of the stz - induced diabetic phenotype of neurons, which we propose provides susceptibility of these neurons to glucose - induced metabolic stress . Whether such neurons have a metabolic memory related to previous high glucose concentration related stress is impossible to ascertain at this juncture . A more profitable line of reasoning relates to growth factor starvation and alterations in the phenotype of the neuron . During 35 months of stz - diabetes, derived neurotrophic factor, nerve growth factor, and neurotrophin-3 has been well described, and it is known that these growth factors combine to modulate sensory neuron gene expression (3235). Of particular interest is the ability of insulin and neurotrophin-3 to correct abnormalities in mitochondrial function and calcium homeostasis (17,18,36). Therefore, in the cultures from diabetic rats studied herein, it is feasible that the ability to respond to glucose - induced oxidative stress was impaired as a consequence of suboptimal mitochondrial function and dyshomeostasis of ca (37). We believe abnormalities in ca homeostasis leading to raised intracellular ca concentration in neurons in diabetes is important because this key molecular marker of neurodegeneration appears more rapidly in the sensory neurons with the longest axons (36). We know of no other molecular marker of disease that is specifically associated with lumbar dorsal root ganglion sensory neurons with the longest axons . This abnormal ca homeostasis could be attributable to global gene expression changes, including affects on endoplasmic reticulum resident proteins (e.g., serca2 [sarcoplasmic reticulum ca - atpase 2]) (38), and in addition diabetes may impair expression of proteins associated with antioxidant defenses (e.g., mnsod and thioredoxin - interacting protein) (39) and growth factor receptors (e.g., the p75 receptor) (40). Furthermore, sensitivity of sensory neuron axon outgrowth to extracellular matrix proteins is known to alter under stress, e.g., neurons become more sensitive to fibronectin at the expense of laminin after axonal injury (41). These changes in cellular phenotype could combine to sensitize the cell to high glucose concentration and/or changes in growth factor support . The axonal swellings observed in diabetic neurons were comprised of accumulation of phosphorylated nfh and mitochondria, as seen in dystrophic axonal swellings in autonomic ganglia and nerve, lumbar dorsal root ganglia, and epidermal nerve fibers of skin in humans with diabetic neuropathy (14,15,42). We hypothesize that axonal swellings are sites of mitochondrial and structural protein (e.g., nfh) accumulation caused by blockade of their axonal transport, and the outcome is a dearth of functioning mitochondria and structural proteins at distal axonal sites . The absence of structural proteins and atp - generating organelles in the distal axon, where high atp concentration is required for optimal axonal plasticity in the form of axon sprouting and regeneration (43), will trigger pathological conditions that lead to an absence of efficient axonal plasticity . This process may precede or predispose the axon to degeneration and dissolution, and distal axonal degeneration will follow . Stz - induced diabetic state will not be repaired through normal regenerative processes because these repair functions will also be targeted . The diabetic state as envisaged would include toxic effects of high glucose concentration in addition to abnormalities in neurotrophic support . We believe thesedegenerative processes proceed more vigorously in the axon than the perikaryal region of sensory neurons, and this explains the distal dying back nature of diabetic sensory polyneuropathy . The axonal environment during axon sprouting and regeneration would have a very high atp demand; in fact, 50% of all atp synthesized is required for growth cone motility during axon sprouting and regeneration (43). Also, ros scavenging systems, primarily mnsod, may not be as efficient in the axon because of reduced expression.figure 9 shows that sensory neurons with a stz - diabetic phenotype can mount an mnsod - based antioxidant defense in axons in response to high glucose; however, by 3 days in vitro, the upregulation of mnsod expression shows signs of failing and may contribute to enhanced oxidative stress and associated aberrant axon structure (fig . 9h). These events may combine to place an additional load on mitochondrial bioenergetics not seen in the perikarya and sensitize the physiology of the organelle to elevations in ca and high glucose concentration.
Cushing's syndrome (cs) is a fairly common disease entity in endocrine outdoor and indoor departments . However, these features may not be well understood by suregeons and anaesthetists, who face many challenges while dealing with patients of cs . Though cs may have multiple etiological factors, some cases need to be managed surgically . Hence, anaeathetists and surgeons should be made aware of the unique factors in cs which may impact perioperative health . This case report reviews two such cases, while highlighting the anaesthesia related aspects of cs a 38 year old woman (body weight 90 kg, height 165 cm, bmi 33, american association of anaesthetists classification- asa i), consulted an endocrinologist because of hyperglycemia, hypertension, menstrual irregularities, and hirsutism . She underwent a computed tomography angiography (angio ct), ultrasound examination, and blood level testing of cortisol and adrenocorticotrophic hormone (acth): during which left adrenal hyperplasia was revealed [figure 1]. The cortisol and acth blood levels were 929 ng / ml (normal range: 28 - 120 ng / ml) and 21.6pg / ml (normal range: 20 - 113 pg / ml), respectively . Clinical assessment, chest x - ray and electrolyte findings were normal . Preoperative hypertension was treated with metoprolol and valsartan, whereas hyperglycemia (168 to 173 mg / dl of blood glucose) was treated with insulin regimen . Computed tomography angiographic scan of first patient (case 1) which revealed left adrenal hyperplasia the patient was pre medicated with oral diazepam 10 mg the night before the surgery and morphine sulfate 10 mg intramuscularly 30 minutes before the induction of anesthesia . The preoperative treatment included ketoconazole 800 mg per day (for three consecutive days) which was continued until the morning of the surgery . In the operating room after the peripheral venous cannula was inserted, right radial artery and right internal jugular vein were cannulated with 20 g venous catheter and 7.5 f central venous catheter, respectively . Anesthesia was induced with fentanyl 5 mcg.kg, propofol 2 mg.kg, cisatracurium 0.15 mg / kg . Patient monitoring was done by checking the central venous pressure, electrocardiogram (ecg), temperature, urine output, end - tidal carbon dioxide, cortisol level, sugar blood level, electrolyte levels and invasive arterial monitoring . The anesthesia was maintained with sevoflurane, propofol infusion, fentanyl and cisatracurium as needed . The removed adrenal gland in the first patient (case 1) after the open radical left adrenalectomy procedure postoperatively, the hyperglycemia had improved, and no more insulin was needed . Post - operatively, cortisol level was maintained at 98 ng / ml (normal range: 28 - 120 ng / ml), under oral hydrocortisone . The surgery and postoperative period were uneventful and the patient was discharged on the 5 post operative day, and referred to an endocrinologist for further care . A 22 year old woman (body weight 45 kg, height 160 cm, bmi 18, asa i), without significant previous medical history (expect menstrual irregularities), consulted an orthopedic surgeon because of pelvic bone fracture, not associated with any history of trauma . The patient was treated conservatively; however, no efforts were made to diagnose the etiology of the fracture . However, she soon went on to manifest the features of buffalo hump [figure 3], moon facies [figure 4], striae [figure 5] and hirsutism . Right adrenal hyperplasia was confirmed by angio ct [figure 6] and ultrasound examination, and blood levels of cortisol and acth . The cortisol and acth blood levels were 219 ng / ml (normal range: 28 - 120 ng / ml) and 23.7 pg / ml (normal range: 20 - 113 pg / ml), respectively . Buffalo hump in the second patient (case 2) which is a typical feature of cushing syndrome moon facies in the second patient (case 2) which is a typical feature of cushing syndrome the purple striae in the second patient (case 2) which is a typical feature of cushing syndrome computed tomography angiographic scan of second patient (case 2) which revealed left adrenal hyperplasia the patient was pre medicated with oral diazepam 10 mg . The preoperative treatment included ketoconazole 800 mg per day, which was started 3 days before the surgery, and continued until the morning of the intervention day . Preoperative period was uneventful . In the operating room, after peripheral, venous cannula was inserted, right radial artery and left internal jugular vein were cannulated . Anesthesia was induced with fentanyl 3 mcg.kg, propofol 2 mg.kg, cisatracurium 0.15 mg / kg . Patient monitoring was done by checking the central venous pressure, electrocardiogram (ecg), temperature, urine output, end - tidal carbon dioxide, cortisol level, sugar blood level, electrolyte levels and invasive arterial monitoring . The anesthesia was maintained with sevoflurane, propofol infusion, fentanyl and cisatracurium as needed . Post - operatively, cortisol level was maintained at 98 ng / ml (normal range: 28 - 120 ng / ml), under oral hydrocortisone . The surgery and postoperative period were uneventful, and the patient was discharged on the 4 postoperative day and referred to an endocrinologist for further care . A 38 year old woman (body weight 90 kg, height 165 cm, bmi 33, american association of anaesthetists classification- asa i), consulted an endocrinologist because of hyperglycemia, hypertension, menstrual irregularities, and hirsutism . She underwent a computed tomography angiography (angio ct), ultrasound examination, and blood level testing of cortisol and adrenocorticotrophic hormone (acth): during which left adrenal hyperplasia was revealed [figure 1]. The cortisol and acth blood levels were 929 ng / ml (normal range: 28 - 120 ng / ml) and 21.6pg / ml (normal range: 20 - 113 pg / ml), respectively . Clinical assessment, chest x - ray and electrolyte findings were normal . Preoperative hypertension was treated with metoprolol and valsartan, whereas hyperglycemia (168 to 173 mg / dl of blood glucose) was treated with insulin regimen . Computed tomography angiographic scan of first patient (case 1) which revealed left adrenal hyperplasia the patient was pre medicated with oral diazepam 10 mg the night before the surgery and morphine sulfate 10 mg intramuscularly 30 minutes before the induction of anesthesia . The preoperative treatment included ketoconazole 800 mg per day (for three consecutive days) which was continued until the morning of the surgery . In the operating room after the peripheral venous cannula was inserted, right radial artery and right internal jugular vein were cannulated with 20 g venous catheter and 7.5 f central venous catheter, respectively . Anesthesia was induced with fentanyl 5 mcg.kg, propofol 2 mg.kg, cisatracurium 0.15 mg / kg . Patient monitoring was done by checking the central venous pressure, electrocardiogram (ecg), temperature, urine output, end - tidal carbon dioxide, cortisol level, sugar blood level, electrolyte levels and invasive arterial monitoring . The anesthesia was maintained with sevoflurane, propofol infusion, fentanyl and cisatracurium as needed . The removed adrenal gland in the first patient (case 1) after the open radical left adrenalectomy procedure postoperatively, the hyperglycemia had improved, and no more insulin was needed . Post - operatively, cortisol level was maintained at 98 ng / ml (normal range: 28 - 120 ng / ml), under oral hydrocortisone . The surgery and postoperative period were uneventful and the patient was discharged on the 5 post operative day, and referred to an endocrinologist for further care . A 22 year old woman (body weight 45 kg, height 160 cm, bmi 18, asa i), without significant previous medical history (expect menstrual irregularities), consulted an orthopedic surgeon because of pelvic bone fracture, not associated with any history of trauma . The patient was treated conservatively; however, no efforts were made to diagnose the etiology of the fracture . However, she soon went on to manifest the features of buffalo hump [figure 3], moon facies [figure 4], striae [figure 5] and hirsutism . Right adrenal hyperplasia was confirmed by angio ct [figure 6] and ultrasound examination, and blood levels of cortisol and acth . The cortisol and acth blood levels were 219 ng / ml (normal range: 28 - 120 ng / ml) and 23.7 pg / ml (normal range: 20 - 113 pg / ml), respectively . Buffalo hump in the second patient (case 2) which is a typical feature of cushing syndrome moon facies in the second patient (case 2) which is a typical feature of cushing syndrome the purple striae in the second patient (case 2) which is a typical feature of cushing syndrome computed tomography angiographic scan of second patient (case 2) which revealed left adrenal hyperplasia the patient was pre medicated with oral diazepam 10 mg . The preoperative treatment included ketoconazole 800 mg per day, which was started 3 days before the surgery, and continued until the morning of the intervention day . Preoperative period was uneventful . In the operating room, after peripheral, venous cannula was inserted, right radial artery and left internal jugular vein were cannulated . Anesthesia was induced with fentanyl 3 mcg.kg, propofol 2 mg.kg, cisatracurium 0.15 mg / kg . Patient monitoring was done by checking the central venous pressure, electrocardiogram (ecg), temperature, urine output, end - tidal carbon dioxide, cortisol level, sugar blood level, electrolyte levels and invasive arterial monitoring . The anesthesia was maintained with sevoflurane, propofol infusion, fentanyl and cisatracurium as needed . Post - operatively, cortisol level was maintained at 98 ng / ml (normal range: 28 - 120 ng / ml), under oral hydrocortisone . The surgery and postoperative period were uneventful, and the patient was discharged on the 4 postoperative day and referred to an endocrinologist for further care . Symptoms of glucocorticoid excess generally occur with the administration of oral steroids, injections of steroids, inhalers and unguents . Other causes are unilateral or bilateral adrenal hyperplasia, pituitary adenoma (cushing disease), and ectopic acth production . There are similarities between cushing's syndrome and the metabolic syndrome as both are characterized by central obesity, hypertension, insulin resistance, glucose intolerance, and dyslipidemia . There is a study that supports the view that unknown cs is not rare among patients with diabetes mellitus . This is the first demonstration that screening for cs may be feasible at the clinical onset of diabetes in an unselected cohort of patients . Therefore, early diagnosis and treatment of cs may provide the opportunity to improve the prognosis of diabetes . Several studies have demonstrated the concomitance of cs and a number of tumor diseases . These are reported in literature and include conditions like pheochromocytoma, sarcoidosis, pancreatic acinar cell carcinoma, pre - eclamptic findings, malignant gastrinoma, bronchial carcinoid lung tumor, pancreatic neuroendocrinetumor, hippel - lindau disease, and mesenteric neuroendocrine carcinoma . Our patients had unilateral adrenal hyperplasia with all the clinical features of cs, however, none of the above associations were seen . After discharge, she went on to develop the signs of cs as explained above . In cases of such unexplained fractures and osteopenia, m.b . Presented with all the typical clinical features, and hence here, the diagnosis was comparatively easier . After testing the serum cortisol and acth, and the dexamethasone suppression test, the diagnosis was confirmed . It is well known that the patientswith cs tend to suffer from volume overload, hypertension, glucose intolerance, hyperglycemia and hypokalemic metabolic alkalosis . In both patients, oral anti diabetic drugs were preoperatively discontinued and substituted by insulin regimen to maintain the blood sugar levels below 120 mg / dl . The use of etomidate while administering anaesthesia was avoided, as it has a suppression effect on the cortisol levels . We took care to use a minimum dose of muscle relaxants, choosing cisatracurium, a short acting plasma degradation drug . Special importance was given to patient positioning, in order to avoid fractures and/or skin damage . In the case 1 several possible complications, like hypoventilation, could have occurred due to obesity and proximal muscle weakness, contributing to hypoxia and hypercarbia . The mask ventilation was difficult due to obesity, and hence preoxygenation was done before endotracheal intubation . There were no significant changes in the electrolytes and glucose blood level, as well as in the intra operatory acid - basic status . Patients undergoing adrenalectomy may require intra operative glucocorticoid replacement, and hence 100 mg hydrocortisone succinate was administered intra operatively . The replacement continued even in the postoperative period through oral cortisone, guided by blood cortisol level monitoring . Special post operative care needs to be taken to avoid cortisol deficiency, and to mobilize and activate the patient, and prevent atelectasis through respiratory exercises . Even with the recent advances in anaesthetic care, cs is associated with longer hospitalizations and frequent major complications, especially for bilateral adrenalectomy cases, thus warranting special and advanced care . Thus, through our case studies, we concluded that cs presents a challenge to the anesthesiologist, who needs to deal with the volume overload, hyperglycemia, hypokalemia, difficult airway and ventilation . Postoperatively, we must take care to supplement the cortisol (guided by cortisol blood level), correct electrolyte level disturbances to maintain the hemodynamics, and keep the sugar blood levels in the normal range.
Regeneration of oxidized glutathione by glutathione reductase to its reduced form, glutathione (gsh) is vitally important in combating oxidative stress in neurons . To reduce oxidized glutathione, glutathione reductase uses nicotinamide adenine dinucleotide phosphate (nadph) as its cofactor . As levels of reactive oxygen species accumulate in neurons, the demand for nadph increases (ben - yoseph et al ., 1994). The levels of gsh in cells in culture are directly related to the production of nadph by the pentose phosphate pathway (ppp) (salvemini et al ., 1999) and it has been shown that the ppp is the primary source of nadph in cells (pandolfi et al ., 1995). Importantly, in neurons the rate limiting glycolytic enzyme phosphofructokinase b3 is translated but subsequently ubiquitylated and degraded by the proteasome, with the result that neurons preferentially metabolize glucose via the ppp as opposed to glycolysis, in contrast to most other cell types (herrero - mendez et al ., 2009). Inhibiting glucose flux through the ppp in these experiments was shown to cause increased levels of oxidative stress and cell death, emphasizing the extent to which neurons rely on the ppp for survival . The effects of inhibiting the pentose phosphate and gluthathione pathways are similar to many of the pathologic changes associated with parkinson's disease (pd). Depleting glutathione in rats using l - buthionine sulfoximine, has been shown to cause complex i and iv damage (heales et al ., 1995), a phenomenon, which has been documented in postmortem pd brain tissue, with complex i damage in pd widely reported (schapira et al ., 1989). Similarly, decreased levels of total gsh have been measured in pd brains (perry et al . This loss of gsh is found in pd and lewy body disorders, but not multiple system atrophy, progressive supranuclear palsy, or huntington's disease (sian et al ., 1994). One important, but less reported finding is that pharmacologic inhibition of the ppp in rats using the irreversible inhibitor 6-aminonicotinamide, has been shown to cause selective dopaminergic cell death in the striatum and muscle rigidity resembling bradykinesia (herken, 1990). Recent studies investigating metabolism in pd have continued to emphasize the importance of glucose usage in the disease process, with glucose hypometabolism shown in pd using magnetic resonance imaging and fludeoxyglucose (18f) positron emission tomography studies (borghammer, 2012). Genetic microarray studies of the substantia nigra in pd show a strong association with the transcriptional regulator pgc1, which is involved in the control of glucose usage (zheng et al ., 2010) and in animal models, knocking down -synuclein (-syn) a recent article - characterizing metabolism in cultured adipocytes suggests that glucose uptake may be regulated by -syn signaling via the lpar2/gab1/pi3k / akt pathway (rodriguez - araujo et al ., importantly, studies looking at the effect of glucagon - like - peptide 1 on animal models of pd, have shown that modulating glucose metabolism is able to reverse dopaminergic cell loss in rats (harkavyi et al ., 2008; li et al ., 2009) and clinical trials of the glucagon - like - peptide 1 agonist exendin-4 are currently at stage ii for use in pd (tom foltyne, personal communication). Through this study comparison of these results with those from ad and control tissue; will allow any differences in nadph production to be identified . We hypothesize that reduced glucose metabolism via the ppp in neurons, is an early event in sporadic pd pathogenesis . We studied flash - frozen tissue from the frontal cortex (brodmann area 4), putamen, and cerebellar vermis . Cases with pathologically diagnosed pd were stratified according to the mckeith criteria (mckeith et al ., mild cases were grouped according to those with lewy body pathology in the brain stem only (mckeith brainstem predominant). Moderate and/or severe cases were those with lewy body pathology visible in the limbic and neocortical areas (mckeith limbic and diffuse neocortical lewy body pathology). Ad cases were similarly confirmed by postmortem analysis and cases with braak and braak stages iv - vi (braak et al ., 2003) were selected for these experiments . For each brain region 13 controls, 11 mild pd, 12 moderate and/or severe, and 13 ad cases were used . Where tissue was available, cortex, putamen, and cerebellum samples were taken from the same individual . Controls were age matched and showed no lewy body pathology . Cases with braak and braak stages ii and under were used for this study . Tissue was homogenized in an isolation buffer of 320 mm sucrose, 1 mm ethylenediaminetetraacetic acid and 10 mm tris - base, ph 7.4 using a mechanical homogenizer . Homogenates were centrifuged for 15 minutes at 16,000 g at 4 c and the supernatant removed for assaying . We characterized ppp in pd by assessing the total nadph generated by glucose-6-phosphate dehydrogenase (g6pd) and 6-phosphogluconate dehydrogenase (6pgd). This was done using a modified protocol, based on that described by (ninfali et al ., 1997). Tissue homogenate was assayed under 2 separate conditions, 1 containing g6p and 6pg to calculate the total activity of the pentose phosphate pathway and 1 with 6pg alone . G6pd activity was calculated by subtracting the nadph generated in the combined condition, from that in the 6pg condition . Reaction mixture contained a final concentration of 2 mm nadp, 1 mm glucose-6-phosphate, and 1 mm phosphogluconic acid reconstituted in 1 m tris - hcl, 5 mm ethylenediaminetetraacetic acid ph 7.6, 15% (vol / vol) wst-8 dye supplemented with 0.2 mm 1-methoxy phenazinium methylsulfate (all materials were purchased from sigma - aldrich, poole, uk). Samples were added to the reaction mixture and incubated at 37 c for 15 minutes . The levels of the nadph - producing enzymes g6pd and 6pgd were calculated using elisa kits specific for human g6pd and 6pgd, according to the manufacturer's instructions (wuhan life sciences, houston, tx, usa). Samples were run in duplicate . Protein concentration was estimated using the bio - rad dc protein assay kit according to the manufacturer's instructions (bio - rad, hemel hempstead, uk). All results in this study were analyzed using a 1-way analysis of variance (anova) followed by a bonferroni posttest . We set out to characterize utilization of the ppp in flash frozen postmortem pd brain tissue . To look at glucose metabolism via this pathway over the course of disease progression, we identified 2 groups of pd samples, which were classified according to the extent of their lewy body pathology based on the mckeith lewy body pathology criteria (mckeith et al ., 2005). Cases assigned to the mild group were those with lewy body pathology predominantly in the brain stem . Moderate and/or severe cases were those with lewy body pathology that had progressed to the limbic and neocortical areas . All cases in the mild group showed a low level of lewy body deposition in the putamen . Ad cases were confirmed by postmortem neuropathological examination and cases with braak and braak stages iv - vi (braak et al ., 2003) were used for these experiments . Controls were age matched and confirmed to have braak and braak stages of ii and under . Total nadph produced by the ppp was calculated by addition of nadph production by g6pd and 6pgd . To assess the impact of enzyme expression on the production of nadph data for 6pgd elisa and enzyme activity levels are shown as supplementary data . Increased nadph production in the cortex has been shown to occur in response to increased levels of oxidative stress in ad (martins et al ., 1986). Calculation of nadph production by the ppp in our samples showed that generation of nadph is significantly increased in the ad and moderate and/or severe pd groups as compared with controls (fig . 1a gray bars, 1-way anova followed by bonferroni posttest vs. control). This increase was accompanied by higher levels of the rate - limiting enzyme g6pd (fig . 1b, gray bars, 1-way anova followed by bonferroni posttest p <0.05). In the mild pd group, that is pd cases that do not have pathology in the cortex, there was no increase in either the amount of nadph produced or levels of g6pd enzymes (fig . 1a and b gray bars). Calculating the efficiency of g6pd by expressing nadph production per elisa unit of g6pd protein showed that there was no significant change in any of the experimental groups characterized (fig . 1c, gray bars, 1-way anova, p = 0.8017). Total nadph produced by the ppp in the putamen was significantly increased in the brains of those with ad and in the moderate and/or severe pd group (fig . 1a, black bars, 1-way anova followed by bonferroni posttest). In ad, the levels of g6pd enzyme similarly the moderate and/or severe pd group showed no significant increase in protein levels of the rate - limiting enzyme g6pd however, the mild pd group showed a significant decrease, suggesting a down - regulation of this pathway at the protein level (fig . Calculating the efficiency of g6pd for all samples, showed an activation of g6pd in the mild pd and ad groups . In these groups, each elisa unit of the enzyme produced approximately twice as much nadph per minute compared with the control group (fig . Importantly, ad cases with braak and braak stages iv - vi have amyloid beta and tau pathology in the putamen and the activation of g6pd in these samples suggests that an oxidative stress response is occurring . While both the mild and moderate and/or severe pd cases used in this study showed lewy body pathology in the putamen, it is only the moderate and/or severe group which shows increased nadph production in response to this (fig . 1a, black bars) this would suggest that although the mild cases are able to match control nadph production levels, the ability to mount an oxidative stress responsive is decreased and that an increase in nadph is not seen until pd pathology is more extensive . To assess the function of the ppp pathway in a region not affected in pd, we measured nadph production and the enzyme levels of g6pd and 6pgd in the cerebellum . Nadph production across all 3 experimental groups showed no significant change in the cerebellum when compared with controls (fig . Interestingly however, quantification of g6pd protein levels, again showed a down - regulation of the rate - limiting enzyme that was present in both pd groups, with enzyme levels showing a significant decrease compared with control (fig . 1b, white bars, 1-way anova followed by bonferroni posttest). Calculating the efficiency of g6pd in these samples showed a 2-fold increase in nadph production of about 2-fold in these samples when compared with controls (fig . 1c, 1-way anova followed by bonferroni posttest). As shown in the putamen of samples in the mild pd group, despite a significant decrease in nadph producing enzymes, net nadph production in both pd groups remains level with that of the controls, because of each unit of g6pd producing more nadph . Samples in the ad group showed no difference in the nadph produced (fig . 1a, white bars), or in the levels of ppp enzymes measured (fig . Neurons are subjected to high levels of oxidative stress because of a relatively high level of oxidative phosphorylation and nitric oxide signaling from astrocytes (bolanos and heales, 2010 . ), leaving them vulnerable to damage . It has been shown that production of nadph from the ppp is responsible for reduction of oxidative species and therefore reducing levels of oxidative stress, leaving neurons able to function normally . Inhibition of the ppp is deleterious to neurons (filosa et al ., 2003; pandolfi et al ., 1995). Increased levels of oxidative stress are important in the pathogenesis of pd (alam et al ., 1997; dexter et al ., 1989; floor et al ., 1998) and it has been suggested that oxidative stress could play an important role in the formation of lewy body pathology (jenner and olanow, 1996). As the ppp is the main source of defense against oxidative stress in neurons, we thought it important to characterize the usage of this pathway in pd . Studies showing increased activity of the ppp in ad (martins et al ., 1986), neuromuscular diseases (meijer, 1991), myocardial infarction (gupte, 2008), and studies using hepatocyte cell models (ursini et al ., 1997) however, characterization of the ppp in our experiments has shown that nadph production is not increased in the putamen of samples with early stage pd and furthermore, ppp enzyme levels are actually decreased . This is despite widely documented evidence that dopaminergic cell death in the striatum of pd cases is accompanied by increased markers for oxidative stress and neuroinflammation in postmortem samples (alam et al ., 1997; imamura et al ., 2003; marttila et al ., 1988; ouchi et al ., 2005; sanchez - ramos et al ., 1994) and in vivo, by positron emission tomography imaging studies (ikawa et al ., 2011). Similarly, although there are a number of published studies showing increased levels of oxidative stress in the frontal cortex of cases with both clinical and preclinical pd (dalfo et al . 2008), the early stage cases in our experiments again did not show an increase in nadph levels . This could be because of faulty oxidative stress - sensing mechanisms in affected neurons, or because of an active suppression mechanism that is stopping increased nadph production from occurring . An article looking at the ppp in als, showed that neuroblastoma - spinal cord hybrid cell lines (nsc34) carrying g93a or g37r sod1 mutations display decreased levels of g6pd enzyme, which affects the production of nadph by this pathway (kirby et al ., 2005). Similarly ataxia telangiectasia mutated knockout mice also show a reduction of g6pd in the cerebellum (cosentino et al ., 2011), suggesting that downregulation of the ppp in disease could be a key mechanism in some forms of neurodegeneration . Taking our results together with data from cell and animal models, suggests that dysregulation of the ppp could be causing oxidative stress because of less efficient gsh recycling (heales et al ., 1995; herrero - mendez et al ., 2009) and that dysregulation of the ppp could be causative factor in the increased levels of oxidative stress seen in pd . The results of our experiments suggest that there are 2 stages of ppp involvement with oxidative stress in pd . In the early stages of disease, lower levels of ppp enzymes in the putamen could be causing increased levels of oxidative stress . In response to this, g6pd is activated, potentially by posttranslational modification of the enzyme as shown in other studies (cosentino et al ., 2011; ursini et al ., 1997) and the increased demand for nadph met by increased activity per elisa unit of the protein . In the later stages of disease, where pathology has spread to the limbic system and neocortex, our results show that there is a switch from activation of g6pd at its existing levels, to upregulating the nadph - producing enzymes at a protein level . Interestingly, the exact mechanisms for regulation seem to differ between brain regions and despite evidence of increased oxidative stress in the cerebellum in pd, the cerebellum does not show evidence of neurodegeneration . Elucidating the mechanisms underlying these differences could be important in understanding the vulnerability of certain cell types over others in different neurodegenerative diseases . The results of this study come with the caveat that the tissue was from postmortem brains and therefore only provides a snapshot of the changes occurring at that time . Despite this, further investigation into mechanisms that are potentially underlying our findings may prove important in understanding the pathogenesis of pd the results of this study shed light on a potentially new mechanism in the pathogenesis of sporadic pd and when taken with further studies from cell and animal models, may lead to better understanding of these mechanisms . Our data suggest that down - regulation of the ppp in pd could be a primary event in disease progression and further research down this avenue may provide potential targets for future therapeutic avenues . We hypothesize that mitochondrial damage in pd occurs as a direct result of ppp dysregulation and that -syn plays an important role in the altered metabolism of glucose via the ppp in this disease.
Over the last two decades, the biological preeminence of cellular nitric oxide (no) signaling pathways has been intimately linked to many processes and to its regulated enzymatic formation from l - arginine via the actions of no synthases (nos) and to secondary activation of soluble guanylate cyclase as a major physiological target / effector system [120]. Evolutionary pressure has established a functional diversity in cellular expression of nos isoenzymes derived from three distinct genes and designated as endothelial (e), neuronal (n) and inducible (i) nos . E- and n - nos are constitutively expressed, display ca dependent activation, and rapidly produce and release no within spatially defined cellular domains . In contrast, inos expression is intimately linked to proinflammatory processes, displays a significant latency period due to transcriptional and translational processing, and effects unregulated ca independent release of no for extended periods of time [7,2128]. Interestingly, a significant body of literature supports the contention that constitutively released no can attenuate the expression of inos in vascular smooth muscle, neutrophils, microglia, astrocytes and hepatocytes [2935]. Work from our laboratory has demonstrated significant feedback inhibition of no on constitutively derived no release [12,1416,3641] as well as inos derived no release . Within the past decade, an important body of work has challenged the primacy of nos / l - arginine derived no in cellular signaling processes and involves the existence of chemically stable nitrite and nitrite reductase activities in these same cell / tissue types [4256]. Nitrite is a major metabolic product of no and is found in all cell and tissue types that utilize no signaling processes [4246,52,53,5567]. Accordingly, the establishment of a parallel and complementary no signaling pathway utilizing recycled nitrite chemical equivalents, independently expressed from well established nos / l - arginine signaling pathway, requires the identification and biochemical characterization of key candidate enzymes displaying significant nitrite reductase activities within meaningful biological contexts . Until now, accumulated no / nitrite reductase literature has focused on xanthine oxidoreductase (xor) as the major candidate nitrite reductase enzyme linked to cellular no signaling events [49,51,52,5458,6064,6876]. Other candidate nitrite reductases displaying potentially important biological roles as accessory players in no signaling events include the mitochondrial enzymes aldehyde dehydrogenase, cytochrome c / cytochrome c oxidase, deoxymyoglobin and deoxyhemoglobin . Xanthine oxidoreductase has been previously characterized as a housekeeping enzyme responsible for cellular uric acid formation via enzymatic conversion of hypoxanthine and xanthine . Based on its intrinsic state - dependent biochemical properties to exist as both a dehydrogenase and an oxidase, it became apparent to several investigators that xor possessed multi - functional enzymatic activities outside the realm of xanthine metabolism [5456,70,79]. Hallmark positive vascular effects were well established to be mediated by cellular nos / l - arginine no signaling pathways [711]. A small but significant literature has also established a compelling functional association between administered sodium nitrite, xor activation, and pharmacologically characterized no transductive effects in positive cardiovascular function [62,63,75,8082], enhanced pulmonary perfusion, and protection against ischemia / reperfusion injury [64,7275] and hypoxic damage [56,58,8385] and oxidative stress . Similar positive vascular and cellular effects were observed to be functionally associated with mitochondrial aldehyde dehydrogenase, cytochrome c / cytochrome c oxidase . Nitric oxide derived from nos / l - arginine systems functions not only as a vasodilator but as a general antibacterial and antiviral agent and, counter - intuitively, it can down - regulate proinflammatory events [27,8692]. Accordingly, significant anti - inflammatory properties of administered sodium nitrite have been attributed to xor activation via pharmacologically characterized no transductive effects . Work from our laboratory supports the contention that constitutively derived no provides a basal or tonal level of chemical mediator keeps particular types of cells in a state of inhibition . On, i.e., respond to environmental changes, and that this low basal level of no provides an organism with a major pathway that functions to dampen microenvironmental this kind of activation really represents a disinhibition process, i.e., an overcoming of the inhibitory influence of no by changing the balance between basal no and the levels of excitatory signals . In support of the hypothesis stated above, there is considerable evidence that constitutively derived no down - regulates the immunocyte - endothelial interaction . The adherence of monocytes and granulocytes is reduced following the stimulation of cnos and, in the presence of no, monocytes, granulocytes and endothelial cells become round and inactive . These findings strongly indicate that no can diminish the adherence and level of activation of leukocytes and endothelial cells . It also suggests these are phenomena that occur within a microenvironment given no short - half life and the strength of the effect produced by many of these cells via autocrine and / paracrine signaling . It is now possible to add a functionally reinforcing mechanism whereby basal levels of cellular nitrite are recycled to active no equivalents via the actions of xor and accessory nitrite reductases upon physiological demand (figure 1). It has been well established that mitochondrial respiration linked to homeostasis of intermediary energy metabolism is regulated by no signaling systems [12,98104]. For example, pharmacological inhibition of constitutively derived no has been shown to increase oxygen consumption in many animal species [105109]. Furthermore, a novel nos isoform, mtnos, is present in mitochondria and appears to modulate local circuit regulatory functions within electron transport complexes . Interestingly, nitrite - derived no has been shown to potently regulate respiration, reactive oxygen species, and energy metabolism in plant mitochondria [83,111113]. The apparent redundancy of plant mitochondrial nos / l - arginine- and nitrite - derived no signaling systems [83,111113] provides a compelling platform for further investigation into reciprocal regulatory effects of mtnos and concerted nitrate reductase actions in mammalian mitochondria (figure 1) [4246,53,85,114]. A recent important publication has described local circuit nitrite / no cycling to produce biologically active no within liver mitochondria . The investigators have demonstrated that nitrite mediates cellular signaling through its reduction to no via reactions with the mitochondrial electron carrier cytochrome c. cytochrome c - mediated nitrite reductase activity is dependent on pentacoordination of the heme iron in the protein and occurs under anoxic and in the presence of nitrite, pentacoordinate cytochrome c generates bioavailable no that is able to inhibit mitochondrial respiration . An elegant complementary study has demonstrated in yeast that state - dependent hypoxia recruits cytochrome c oxidase as a functionally competent nitrite reductase . The investigators have also evaluated nitrite - dependent no production by specific isoforms of cytochrome c oxidase in support of a functional role of the enzyme in hypoxic signaling events . Additionally, the study findings suggest a positive feedback mechanism for nitrite - derived mitochondrial no on selective gene expression of a cytochrome c oxidase subunit that is functionally associated with enhanced production of no in hypoxic / anoxic cells . On a functional basis it has become clear that the basal level of no derived from cnos in concert with cellular nitrite reduction by xor within a diverse class of nitrite reductases may serve as a key regulatory mechanism underlying complex, cascading, physiological processes associated with maintaining cellular and organ viability . Further studies are required to probe selective regulatory effects of nos - derived and nitrite - derived no on gene expression of their cognate synthetic enzymes . Similar compelling studies are needed to elucidate biologically meaningful cellular coupling of cytosolic xor and mitochondrial nitrite reductases in normal and pathophysiological states (figure 1) [6870,80,115117]. Finally, holistic pre - clinical and studies to evaluate conversion of dietary nitrate to recycling active cellular nitrite pools hold great promise for improving quality of life in human and animal populations.
This study was carried out at mahatma gandhi memorial (mgm) hospital, a 1200 bed government tertiary care teaching hospital located at warangal, india . Present study was approved by the human ethics committee of the medical college / hospital . Inclusion criteria included age greater than 19 years, receiving cancer treatment and exclusion criteria included the ambulatory and terminally ill patients . During data collection patients were informed about the study using patient information form and the written consents were obtained from the patients or their caregivers . Study recruited a consecutive sample of cancer patients attending the outpatient unit of the department of oncology at the study site between january and june 2011 . Patient demographic data like age, weight, date of admission, and medical histories including drug allergies were entered into the specially designed data entry form . The questionnaires were administered (interviewed) to the patients twice, review i on 2 cycles of treatment followed by review ii on 5 cycles of treatment . Qlq - c30, the core questionnaire, is the contribution of more than a decade of research . Various modules like breast cancer module (qlq - br23), head and neck cancer module (qlq - handn35), cervical cancer module (qlq - cx24), gastric module (qlq - sto22) were used among patients . These modules have been proven to have good validity and reliability properties both for the english original and the translation into telugu, the local language . The numerical data obtained from the study were analyzed and the significance of difference was estimated by using statistical methods . The qol questionnaire administered were statistically analyzed, comparison between reviews was done by the non - parametric tests like willcoxon signed rank test and spearman's correlation test, which were performed using computer based sas version 9.1.3 (sas institute inc ., cary, nc, usa). Qlq - c30, the core questionnaire, is the contribution of more than a decade of research . Various modules like breast cancer module (qlq - br23), head and neck cancer module (qlq - handn35), cervical cancer module (qlq - cx24), gastric module (qlq - sto22) were used among patients . These modules have been proven to have good validity and reliability properties both for the english original and the translation into telugu, the local language . The numerical data obtained from the study were analyzed and the significance of difference was estimated by using statistical methods . The qol questionnaire administered were statistically analyzed, comparison between reviews was done by the non - parametric tests like willcoxon signed rank test and spearman's correlation test, which were performed using computer based sas version 9.1.3 (sas institute inc ., cary, nc, usa). Total 104 patients were included during the study period based on their inclusion / exclusion criteria, in which male patients were 39.42% (41/104) and female patients were 60.57% (63/104). A total of 39.42% (41/104) breast cancer patients, 31.73% (33/104) head and neck cancer patients, 14.42% (15/104) cervical cancer patients and 14.42% (15/104) stomach cancer patients were included in the study . Interpretation of diagnosis based on demography reveals that patients with breast cancer were 65.07% (41/63) of the total female cancer patients . The age distribution of the study population is given in table 1 and the characteristics of the study population are given in table 2 . Study population was subjected to various laboratory investigations like hemoglobin (hb), erythrocyte sedimentation rate (esr), red blood cell (rbc) count, white blood cell (wbc) count, platelet count and creatinine levels, which have helped in accurate diagnosis of the disease state and selecting the choice of therapy . Of the total patients, 36.53% (38/104) had nipple discharge, 14.42% (15/104) had abdominal pain and micturition, 26.92% (28/104) had difficulty in swallowing and 2.88% (3/104) had growth in oral cavity . The co - morbidities of the study population was also screened . Among them, 5.76% (6/104) suffered with diabetes and hypertension, 2.88% (3/104) suffered with diabetes, 7.69% (8/104) with hypertension . It was also observed that no head and neck cancer patient was prescribed with combination chemotherapy agents . In combination doxorubicin, vincristine, and cyclophosphamide of overall study population, 32.69% (34/104) were treated with surgery and supported by chemotherapy . The results revealed that there were no surgery cases in head and neck cancer patients . Age distribution of the study population characteristics of the study population the qol of the study population were assessed and the obtained values were subjected to statistical analysis by comparing the qol scores using wilcoxon signed rank test and spearman's correlation test . Wilcoxon analysis for breast cancer revealed that in functional scale, physical function, role function and in the extended functional scale using eortc qlq - br23 questionnaire revealed that future perspective was found to be significant (p<0.05). Where as in symptom scale, fatigue, pain, arm symptoms and upset by hair loss were found to be significant (p<0.05). Spearman's correlation analysis revealed that the global health status when paired with physical function, role function, insomnia, body image, future perspective in functional scale and breast symptoms, arm symptoms in symptoms scale were found to be significant (table 3). Wilcoxon analysis for head and neck cancer revealed that physical, role, social functions in functional scale were found to be significantly correlated (p<0.05). Pain, insomnia and diarrhoea of symptoms scale were found to be significantly correlating (p<0.05) and the extended symptoms scale using eortc qlq handn35 questionnaire revealed that swallowing, speech problems, dry mouth were found to be significant . Also, spearman's correlation analysis revealed that the global health status when paired with the functional scales, physical function, social function, pain, insomnia, speech problems, trouble with social eating and in symptoms scale, nutritional supplements, feeding tube, weight loss were influencing the global health status (table 4). Wilcoxon analysis for cervical cancer revealed that physical and emotional function of the functional scales were found to be significant . Cx24 questionnaire revealed that in symptoms scale, fatigue, nausea and vomiting, pain, insomnia, symptom experience scale, menopausal symptoms were found to be statistically significant (p<0.05). Spearman's correlation analysis revealed that global health status when paired with physical, emotional functions, fatigue, nausea and vomiting, pain, insomnia, sexual / vaginal functions, menopausal symptoms were found to be significantly correlating with global health status (table 5). For gastric cancer, wilcoxon analysis revealed that the physical and role function in functional scale and pain, nausea and vomiting, financial problems were found to be significant in symptom scale (p<0.05). The extended symptom scales using eortc qlq - sto22 questionnaire revealed that dysphagia and reflux symptoms, eating restrictions were found to be significant (p<0.05). Spearman's correlation analysis revealed that the global health status when paired with physical, emotional, cognitive, social function, fatigue, insomnia, appetite loss, diarrhoea, financial problems were significantly correlating with global health status (p<0.05). Under the symptoms scales, reflux symptoms, eating restrictions, taste were found to be very significantly correlating with global health status (table 6). Eortc - qlq - c30 and br23 statistically significant correlations with one another eortc - qlq - c30 and handn35 statistically significant correlations with one another eortc - qlq - c30 and cx24 statistically significant correlations with one another eortc - qlq - c30 and sto22 statistically significant correlations with one another qol refers to global well - being, including physical, emotional, mental, social, and behavioral components . In the last few years, a number of informative and valid qol tools have become available to measure health - related qol . The most widely applicable tool to measure the qol in cancer patients is the eortc qlq - c30 . Using this method, the current study assessed the qol in cancer patients undergoing various treatment modalities . Several studies also support these findings on the influence of treatment on qol among the cancer patients . In fact, improving qol is as important as the survival benefit that a pharmacological treatment may provide . For example, nemati et al . Reported that the level of qol in patients with leukemia was 87.5% lower than that in the control group . Shown that chemotherapy had a measurable adverse effect on qol in women with node - positive operable breast cancer . The results from the current study indicate that disease burden may deteriorate the qol in cancer patients . In two separate studies found that the extent to which qol of cancer patients depends on the time elapsed since initial treatment, with an increase in the extent of the disease, a decrease in the qol was observed . The gender distribution of the study population revealed that females were mostly affected by cancer, which was up to 60.57% (63/104) in this area . One of the reasons behind this may be the inclusion of breast and cervical cancer patients . However, the past studies have shown that incidence of cancer is more predominant among women in this study site . The age distribution indicated that the adult and elderly people were commonly getting affected and similar findings were reported by other literature . Habitat is also a contributing factor for the cancer incidence and our study found that 77.88% (81/104) of the patients were having rural background since the rural population is more in this area . Only 5.76% (6/104) were vegetarians, and 7.69% (8/104) consumed tobacco, 5.76% (6/104) consumed pan, 11.53% (12/104) consumed gutka, nearly 13.46% (14/104) were smokers, 3.84% (4/104) were alcoholics, 24.03% (25/104) having both smoking and alcoholism . This result does not clearly explicit the social habits and its influence on the disease state as explained in the literature . As in the study population 42.30% (44/104) of patients were having clean habits which may be because of large number of women population (about 60.57%, 63/104). Among all the patients only 27.87% (29/104) were literate indicating illiteracy rate in the patient group, which is a major factor for various cancers including cervical cancer of this patient population and there is a need to cause awareness among illiterate population in this area . According to some researchers, performance of marital role or duties, relationship with spouse, looking after the family are important regarding the qol for indian cancer patients and it was found that 21.15% (22/104) of our study population were divorced and/or separated . Cohabitant status revealed that 11.53% (12/104) were living alone and 28.84% (30/104) were living with others like children or relatives . Of the total female population 49.20% (31/63) were in post - menopausal state . Occupationally, most of the patients were on daily wages and housewives, about 25% (26/104) each of the total patient population . Body mass index of the patients was calculated and found that 76.92% (80/104) were having normal weight and 15.38% (16/104) of the patients were underweight . As the cancer treatment may deteriorate the weight of the patients, there is a chance of increasing in the number of underweight patients thereby reducing their qol . Since most of patients were low socioeconomic, there is a need to implement the dietary counselling in this study site according to their financial background . It is a known fact that the treatment modalities for cancer will definitely reduce the hb levels which ultimately leads to anemia . Main reasons for admissions included nipple discharge from breast among 36.53% (38/104) breast cancer patients and difficulty in swallowing among 26.92% (28/104) head and neck cancer patients, white discharge among 8.65% (9/104) cervical cancer patients and abdominal pain among 14.42% (15/104) stomach cancer patients . This shows the need of causing awareness about signs and symptoms for early detection of cancers among common public . Diagnosis of the study population depending on the thorough screening revealed that 39.42% (41/104) have breast cancer, 31.73% (33/104) have head and neck, 14.42% (15/104) have both cervical and stomach cancer cases . Hypertension was found as a major co - morbidity 7.69% (8/104), followed by diabetes among 2.88% (3/104), and both of them were found in 5.76% (6/104). Treatment patterns in this study site were following standards and the patients were treated by chemotherapy, radiotherapy, surgery, or the combination of them . Up to 40.38% (42/104) of the patients have undergone radiotherapy, for treating head and neck cancers . As the inclusion of patients in this study was 2 cycles, 50.96% (53/104) of the patients were in first cycle and the remaining were in the second cycle of treatment . In the early phase after initial treatment (2 cycles), this is especially true for the functional scales and similar observations were also made by dow et al .. with regard to the emotional domain, clinical experience shows that fear about possible relapse and associated depressive reactions play an important role in the process of coping with the illness and its treatment . The majority of the women were housewives, having been responsible for the organization of households . The areas of life affected are those of physical and role functions, social well - being, cognitive functions, and sexuality . This pattern can be observed for physical symptoms like pain, fatigue, constipation and dyspnoea, which occurred in the same extent across all groups . Impairments reported in role functioning might be similarly explained in that support initially offered in occupational and household activities may tend to disappear with time . Rebound effect observed in this study (a recurring reduction of qol after initial improvement) was most pronounced, as mentioned earlier, in the areas of emotional functioning, role functioning, social well - being, and sexual life . Report similar results, indicating that a whole series of psychosocial and sexual problems not only continue to plague cancer patients, but might also worsen with time . Final scores of review - i and review - ii were analyzed with wilcoxon analysis for breast, head and neck, cervical, and stomach cancers . In the functional scale of breast cancer patients, physical, role function and in the extended functional scale, future perspective was found to be significant and in symptom scale, fatigue, pain, arm symptoms and upset by hair loss were also significantly affected . Cancer patients, physical, role function as well as social function and in symptom scale pain, insomnia, diarrhoea were significantly affected . In the extended symptom scale, swallowing, speech problems, dry mouth were significantly affected . These findings are in supportive to past studies by duffy et al .. in cervical cancer patients, physical, emotional function and in symptom scale fatigue, nausea and vomiting, pain, insomnia and in the extended symptom scale, symptom experience scale, menopausal symptoms were significantly affected . Past studies were also similar to this . In stomach cancer, physical, role function and in symptom scale, nausea and vomiting, pain, financial problems were significant and in the extended symptom scale, dysphagia, reflux symptoms, eating restrictions were significantly affected, which are comparable to the studies conducted by mills et al .. therefore, there is a need to focus on all these aspects among various types of cancers patients . The scores were also analyzed with the nonparametric test, spearman's correlation analysis, which revealed that in breast cancer, the global health status when paired with physical, role function and insomnia, body image, future perspective, breast symptoms, and arm symptoms were significantly correlated . The negative sign on the symptoms scale indicates a decrease in the symptoms after the previous cycle treatment . Similarly, in head and neck cancer patients global health status when paired with physical, social function, pain, insomnia, speech problems, trouble with social eating, nutritional supplements, feeding tube, and weight loss were significant . In cervical cancer patients global health status when paired with physical, emotional function, fatigue, nausea and vomiting, pain, insomnia, sexual / vaginal functioning, menopausal symptoms were significantly correlating . Global health status of stomach cancer patients when paired with physical, emotional, cognitive, social function, fatigue, insomnia, appetite loss, diarrhoea, financial problems, reflux symptoms, eating restrictions, taste were found to be significantly correlating . Most of these findings are similar to the past studies in the respective type of cancer patients . Concern for improving the quality of patients lives has in many contexts become as important as regard for extending qol . These findings have shown that, there is a strong correlation between qol and number of treatment cycles and qol was mostly influenced by the various cancer related factors and have some interesting implications for management and treatment of cancer . Many times it may not be possible to alleviate patients worries and concerns in a patient population where the disease is essentially and actually incurable, a simple discussion of these general issues is very important to those patients . So health services should be planned keeping in mind an entire life perspective rather than just the cancer - focused approach and there is a need to understand the underlying factors in the patient's qol, and consider the impact of cancer treatment in each patient.
Acute myocardial infarction (ami) is a secondary thrombus formation in coronary artery induced by unstable atheromatous plaque rupture and bleeding . The thrombus can further cause coronary artery occlusion, as well as serious and long - term myocardial ischemic and myocardial necrosis [15]. Treatment options for ami include conservative treatment with medicine, thrombolytic therapy in the acute phase, percutaneous coronary intervention, and emergency coronary artery bypass grafting [69]. The time window for thrombolysis treatment is short and the success rate of infarct - related vessel recanalization remains low . However, pci treatment requires a skilled medical team and is an expensive procedure, thus its availability in primary hospitals is limited . Furthermore, 25% of patients have no reflow or slow reflow after infarction - related artery recanalization . Emergency coronary artery bypass grafting also requires high technical skill, and very few medical institutions currently are able to implement this technology . Therefore, new therapeutic measures are needed to improve the success rate of myocardial infarction rescue . Increased neutrophil count has been found in the peripheral blood of ami patients, probably as a result of stress response and local myocardial necrosis . It has been shown that increased leukocytes counts after ami can be used in the prognosis of ami . Ami patients with significantly elevated leukocytes count have higher risk of various malignant arrhythmias, acute heart failure, cardiogenic shock, and other acute adverse complications . In ischemic myocardial tissues, leukocytes, especially neutrophils, are activated and aggregated, and the number of infiltrated leukocytes increases significantly with longer duration of myocardial ischemia [1517]. In addition, the infiltrated leukocytes can induce microthrombosis in coronary arteries by disrupting the functions of endothelial cells [1820]. Insufficient microvascular ischemia reperfusion can further aggravate myocardial ischemia and cause extension of the myocardial infarction area [2124]. Aoki et al . Showed that elevated peripheral blood mononuclear cell count serves as an independent predictor for left ventricle remodeling in ami patients . A study of 7651 patients with acute coronary syndromes showed that wbc counts of> 10 000 were associated with increased 30-day and 10-month mortality . Further, neutrophil depletion by antiserum reduces ischemic myocardial injury in dogs . Taken together, these findings show that leukocyte accumulation in response to myocardial ischemia plays an important role in myocardial injury, and that reduced leukocyte content during this process will help reduce myocardial necrosis . Given the relationship between inflammatory response, cytokines production, and ami, we hypothesized that reduced leukocyte count will lead to reduced inflammation, cytokine production, and alleviation of ami lesions . Here, we decreased leukocyte counts by hu treatment in a rat ami model to interrupt the inflammatory reaction process . Fifty male wistar rats aged 810 weeks and weight 180220 g were purchased from the experimental animal center of shandong university school of medicine, china . The 50 rats were divided into an ami model group with 38 rats and a normal control group with 12 rats . Briefly, rats were anesthetized with pentobarbital sodium (3040 mg / kg, intraperitoneal injection) and ventilated mechanically . The heart was then exposed and a ligature using a 3 - 0 prolene was then placed around the proximal portion of the left anterior descending artery (lad). A similar sham operation was performed on rats in the normal control group, except no suture of the lad was performed . Two out of the 38 rats used for the construction of ami models died during the process . The remaining 36 ami rats were randomly divided into the hu group and vehicle control ami group (vehicle ami group) with 18 rats in each group . For rats in the hu group, this study was approved by the institutional animal use and care committee of the shandong university school of medicine, china . Two milliliters (ml) of venous blood was harvested from the angulus venosus of the rats and collected in tubes containing 0.109 ml sodium citrate as anticoagulant . After mixing fully, the blood samples were used for the determination of total leukocyte, neutrophil, and leukomonocyte counts using a sysmex xs800i automated hematology analyzer (sysmex corporation, japan). Serum sicam-1 level was examined by enzyme - linked immunosorbent assay (elisa) (dia - clone, france). Serum p - selectin was measured using an elisa kit (america r&d, usa). . Electrocardiography (ecg) was performed before ami construction and immediately after the successful induction of ami, with a 12-lead ecg instrument (decg-03a, mindray medical international limited, china). Four weeks after ami induction, heart function index was measured using a philips sonos 5500 multi - function color ultrasonography device (philips, usa) with an 8-mhz transducer . The following equations were used according to the american society of echocardiology (ase): lvm left ventricular mass; ivsd: interventricular septal end - diastolic dimension; lvedd left ventricular end - diastolic dimension; lvpwd left ventricular end - diastolic posterior wall dimension; sv stroke volume; lvevd diastolic left ventricular volume; lvevs systolic left ventricular end volume; co cardiac output; hr heart rate; lvef left ventricular ejection fraction; lvedv left ventricular end - diastolic volume; lvesv left ventricular end - systolic volume; fs fraction shortening; lvesd left ventricular end - systolic diameter . Four weeks after the successful construction of the ami rat model and the cardiac function index measurement, hearts of the rats were harvested and fixed in 4% paraformaldehyde solution . The slices were then stained with hematoxylin and eosin (he) and changes of infarction areas were observed under a microscope (olympus bx51, japan). Statistical analysis was conducted using spss 17.0 software, and the results are presented as mean standard deviation (xsd). Fifty male wistar rats aged 810 weeks and weight 180220 g were purchased from the experimental animal center of shandong university school of medicine, china . The 50 rats were divided into an ami model group with 38 rats and a normal control group with 12 rats . Briefly, rats were anesthetized with pentobarbital sodium (3040 mg / kg, intraperitoneal injection) and ventilated mechanically . The heart was then exposed and a ligature using a 3 - 0 prolene was then placed around the proximal portion of the left anterior descending artery (lad). A similar sham operation was performed on rats in the normal control group, except no suture of the lad was performed . Two out of the 38 rats used for the construction of ami models died during the process . The remaining 36 ami rats were randomly divided into the hu group and vehicle control ami group (vehicle ami group) with 18 rats in each group . For rats in the hu group, this study was approved by the institutional animal use and care committee of the shandong university school of medicine, china . Two milliliters (ml) of venous blood was harvested from the angulus venosus of the rats and collected in tubes containing 0.109 ml sodium citrate as anticoagulant . After mixing fully, the blood samples were used for the determination of total leukocyte, neutrophil, and leukomonocyte counts using a sysmex xs800i automated hematology analyzer (sysmex corporation, japan). Serum sicam-1 level was examined by enzyme - linked immunosorbent assay (elisa) (dia - clone, france). Serum p - selectin was measured using an elisa kit (america r&d, usa). Activity of paf was also analyzed by elisa kit (rapid bio, usa). Electrocardiography (ecg) was performed before ami construction and immediately after the successful induction of ami, with a 12-lead ecg instrument (decg-03a, mindray medical international limited, china). Four weeks after ami induction, heart function index was measured using a philips sonos 5500 multi - function color ultrasonography device (philips, usa) with an 8-mhz transducer . The following equations were used according to the american society of echocardiology (ase): lvm left ventricular mass; ivsd: interventricular septal end - diastolic dimension; lvedd left ventricular end - diastolic dimension; lvpwd left ventricular end - diastolic posterior wall dimension; sv stroke volume; lvevd diastolic left ventricular volume; lvevs systolic left ventricular end volume; co cardiac output; hr heart rate; lvef left ventricular ejection fraction; lvedv left ventricular end - diastolic volume; lvesv left ventricular end - systolic volume; fs fraction shortening; lvesd left ventricular end - systolic diameter . Four weeks after the successful construction of the ami rat model and the cardiac function index measurement, hearts of the rats were harvested and fixed in 4% paraformaldehyde solution . The slices were then stained with hematoxylin and eosin (he) and changes of infarction areas were observed under a microscope (olympus bx51, japan). Statistical analysis was conducted using spss 17.0 software, and the results are presented as mean standard deviation (xsd). To verify that the ami model was successfully constructed, electrocardiograms (ecg) were measured in rats before and after ami construction . Ecg of rats before ami is illustrated in figure 1a, which shows that the st segment was at baseline on lead i and avl . In comparison, the ecg of ami rats (figure 1b) showed significant elevation of the st segment on lead i and avl (0.5 mv). Leukocytes, neutrophils, and leukomonocytes were measured 4 weeks after ami construction and hu administration, and the results are presented in table 1 . Leukocytes, neutrophils, and leukomonocytes in the vehicle ami group were significantly higher than in the normal control group (p<0.05), but hu treatment significantly decreased their levels compared to the vehicle ami group (p<0.05). No significant difference was found between the hu ami group and the normal control group (p>0.05). The level of sicam (ng / ml), p - selectin (ng / ml) and paf (10) measured by elisa 4 weeks after ami construction and hu administration are shown in table 2 . Sicam-1, p - selectin, and paf level were significantly higher in the vehicle ami group compared with the normal control group (p<0.05). However, their levels were deceased by hu treatment in the hu ami group compared with the vehicle ami group (p<0.05). No significant difference was found between the hu ami group and the normal control group (p>0.05). Cardiac function was examined with echocardiography 4 weeks after ami induction (table 3). Lvesd and lvedd levels were significantly higher in the vehicle ami group than in the normal control group (p<0.01), hu treatment significantly decreased the levels compared with the vehicle ami group (p<0.05). However, the measurements in the hu ami group were still higher than in the normal control group (p<0.05) (table 3). Lvef and fs percentage was significantly lower in the vehicle ami group than in the normal control group (p<0.05). Hu treatment significantly increased the percentage compared with the vehicle ami group (p<0.05), but levels in the hu ami group were still lower than in the normal control group (p<0.05) (table 3). Figure 2 shows the representative ultrasonic image of rats from the 3 groups . In the normal control group, cardiac muscle thickness (figure 2a, red arrow) and ventricular wall motion were normal, and there was no obvious segmental motion (figure 2a, green arrow). In the vehicle ami group, the cardiac muscle became thinner and the ventricular wall motion in the infarction regional was low (figure 2b). In the hu ami group, cardiac muscle became slightly thicker, and the motion of the infarction regional was slightly lower than in the vehicle group (figure 2c). Myocardial tissue was harvested from rats of the 3 groups and observed under a microscope after he staining . As shown in figure 3a, there were no obvious infarcts, and the myocardial nuclei and the myocardial fibers were uniformly arranged and orderly in the normal control group . No infiltration of inflammatory cells in myocardial interstitium was observed (figure 3a). In the vehicle ami group, obvious swelling in necrotic foci of the heart muscle fiber was observed, and the arrangement of nuclei was disordered . There was a considerable amount of infiltration of inflammatory cells in myocardial interstitium (figure 3b). In the hu ami group, nuclear staining and size of focal necrosis of myocardial tissues and residual cardiomyocytes were uniform, and myocardial fiber tissue showed mild swelling . A small amount of fibroblasts and inflammatory cell infiltration was observed (figure 3c). To verify that the ami model was successfully constructed, electrocardiograms (ecg) were measured in rats before and after ami construction . Ecg of rats before ami is illustrated in figure 1a, which shows that the st segment was at baseline on lead i and avl . In comparison, the ecg of ami rats (figure 1b) showed significant elevation of the st segment on lead i and avl (0.5 mv). Leukocytes, neutrophils, and leukomonocytes were measured 4 weeks after ami construction and hu administration, and the results are presented in table 1 . Leukocytes, neutrophils, and leukomonocytes in the vehicle ami group were significantly higher than in the normal control group (p<0.05), but hu treatment significantly decreased their levels compared to the vehicle ami group (p<0.05). No significant difference was found between the hu ami group and the normal control group (p>0.05). The level of sicam (ng / ml), p - selectin (ng / ml) and paf (10) measured by elisa 4 weeks after ami construction and hu administration are shown in table 2 . Sicam-1, p - selectin, and paf level were significantly higher in the vehicle ami group compared with the normal control group (p<0.05). However, their levels were deceased by hu treatment in the hu ami group compared with the vehicle ami group (p<0.05). No significant difference was found between the hu ami group and the normal control group (p>0.05). Cardiac function was examined with echocardiography 4 weeks after ami induction (table 3). Lvesd and lvedd levels were significantly higher in the vehicle ami group than in the normal control group (p<0.01), hu treatment significantly decreased the levels compared with the vehicle ami group (p<0.05). However, the measurements in the hu ami group were still higher than in the normal control group (p<0.05) (table 3). Lvef and fs percentage was significantly lower in the vehicle ami group than in the normal control group (p<0.05). Hu treatment significantly increased the percentage compared with the vehicle ami group (p<0.05), but levels in the hu ami group were still lower than in the normal control group (p<0.05) (table 3). Figure 2 shows the representative ultrasonic image of rats from the 3 groups . In the normal control group, cardiac muscle thickness (figure 2a, red arrow) and ventricular wall motion were normal, and there was no obvious segmental motion (figure 2a, green arrow). In the vehicle ami group, the cardiac muscle became thinner and the ventricular wall motion in the infarction regional was low (figure 2b). In the hu ami group, cardiac muscle became slightly thicker, and the motion of the infarction regional was slightly lower than in the vehicle group (figure 2c). Myocardial tissue was harvested from rats of the 3 groups and observed under a microscope after he staining . As shown in figure 3a, there were no obvious infarcts, and the myocardial nuclei and the myocardial fibers were uniformly arranged and orderly in the normal control group . No infiltration of inflammatory cells in myocardial interstitium was observed (figure 3a). In the vehicle ami group, obvious swelling in necrotic foci of the heart muscle fiber was observed, and the arrangement of nuclei was disordered . There was a considerable amount of infiltration of inflammatory cells in myocardial interstitium (figure 3b). In the hu ami group, nuclear staining and size of focal necrosis of myocardial tissues and residual cardiomyocytes were uniform, and myocardial fiber tissue showed mild swelling . A small amount of fibroblasts and inflammatory cell infiltration was observed (figure 3c). Increased leukocyte count is part of the inflammation process and participates in the pathogenesis of ami, further affecting the prognosis of ami patients . Our results show that the level of inflammatory cytokines, amount of leukocyte infiltration into myocardial interstitium, and cardiac function index were all reduced by hu treatment in a rat ami model, suggesting that leukocyte reduction through hu treatment might be a promising preventive and treatment option for ami . Why does leukocyte accumulation exacerbate tissue injury in ami? The underlying mechanism might be as follows: first, leukocyte accumulation and activation increases the viscosity of peripheral blood; second, leukocyte accumulation causes capillary plugging and the no - reflow phenomenon, thus leading to coronary artery occlusion; third, migrating leukocytes release proinflammatory mediators, such as lipoxygenase products, free radicals and hydrolytic enzymes, which causes cardiovascular toxicity and myocardial ischemia . The activated neutrophils in the infarct adhere to vascular endothelial cells, affecting the dilation of the coronary artery, increasing the resistance of blood vessels, and further aggravating myocardial ischemia . A feedback loop exists between ami and leukocytes level: increase in leukocytes promotes the development of the ami, and the further development of ami can in turn induce leukocyte accumulation . Leukocytes depletion from the systemic circulation by filtering during cardiopulmonary bypass reduces the expression of neutrophil adhesion molecules . This reduction leads to decreased leukocyte deposition and interaction with the vascular endothelium, and thereby decreases neutrophil - mediated injury . A study showed that 27% of capillaries were plugged after perfusion with whole blood, whereas only 1% capillary had no - reflow with leukocyte - depleted blood . However, leukocyte depletion filters are costly and its benefits need confirmation from large - scale randomized prospective studies . Due to the foreseeable difficulty in applying leukocyte filters in rats, we did not consider leukocyte filters as a method of leukocyte reduction in our experiments . Busulfan, also called myleran, is a bifunctional alkylating agent that is widely used as an alternative to total body irradiation in conditioning therapy for hematopoietic stem cell transplantation . Despite its short half - life (23 h) and quick turnover in vivo, due to the decreased immunity in ami rats, we did not consider busulfan as a leukocyte reduction reagent . Hu selectively inhibits cells at the s phase and is used in the treatment of chronic myelogenous leukemia . Hu distributes rapidly and widely in the body, and concentrates in leukocytes and erythrocytes . Hu has a half - life of 1.55 h, and is probably metabolized and also eliminated through the renal pathway . More than 80% of hu will be secreted 12 hours after administration . Based on these advantages, we chose hu for leukocyte reduction purposes in our ami rat . Ono - ae-248, another drug candidate, is a selective prostaglandin e2 (pge2) receptor type 3 (ep3) agonist . However, ono - ae-248 has a short half - life, is still under clinical development, and is costly, thus it was not considered by us . Metformin was also found to improve cardiac function in a nondiabetic rate model of post - mi heart failure, but it requires long - term administration (12 weeks). Intercellular adhesion molecule-1 (icam-1), also called cd54, is an immunoglobulin (ig)-like cell adhesion molecule . Therefore, monocyte counts and serum icam-1 level can be used as a marker for coronary atherosclerosis . P - selectin (ps) is a member of the selectin family of adhesion molecules that is expressed in platelets and is stored on the membrane of alpha granules and on the weibel - palade bodies of endothelia cells . P - selectin mediates the adhesion of leukocytes to stimulate endothelial cells and to activate platelets . Platelet - activating factor (paf) is a phospholipid mediator and mediates many leukocyte functions, including platelet aggregation . Ps and paf function together to promote the adhesion and accumulation of leukocyte to endothelial cells and the subsequent release of inflammatory mediators . Our elisa analysis showed that icam-1, ps and paf were all increased in ami rats, indicating the role of these inflammatory factors in the pathogenesis of ami . Further, hu treatment significantly decreased their level, concomitant with an improvement of cardiac function in ami rats . However, the exact molecular mechanism by which these inflammatory factors contribute to ami and how hu down - regulated their expression is unknown . Decrease leukocytes count by hu treatment in ami rats can reduce inflammatory reaction significantly and improve heart functions after ami, suggesting that leukocyte reduction through hu treatment might be a promising preventive and treatment option for ami.
A 52-year - old male patient with a height of 163 cm and a weight of 65 kg was admitted to the hospital due to right femoral edema, and following a diagnosis of right femoral abscess, an incision and drainage procedure was performed . With regard to medical history, the patient was paraplegic from the level of the fourth thoracic vertebra due to a t2-level spinal cord injury from a car accident 4 years previously . Due to tetany symptoms in both lower limbs, he had been regularly taking an oral dantrolene formula of 50 mg (anorex cap . 25 mg, yooyoung pharmaceutical, seoul, korea) every night for the previous 3 years . Prior to the operation, the patient's blood pressure was 100/60 mmhg, and his heart rate was 94 beats per minute . There was a systemic inflammation response due to the right femoral abscess, accompanied by an increase in body temperature (38.3); in addition, the prothrombin time was outside the normal range (inr 1.21). When the patient entered the operating room, the standard anesthetic monitoring devices were applied, and the blood pressure and heart rate were 123/78 mmhg and 86 beats per minute, respectively . The neuromuscular monitoring device (tof - watch, organon, boxtel, netherlands) was attached to the ulnar nerve of the left forearm flap . Propofol 2 mg / kg was intravenously administered for induction of anesthesia, and i.v . Rocuronium 0.3 mg / kg (ed95) was administered while ventilating with 5 l / min of oxygen and 4 vol% of sevoflurane . The tof ratio did not fall under 0.25 2 minutes after rocuronium administration, and 10 mg (0.15 mg / kg) of i.v . After 2 minutes, the tof count still had not decreased to 0, and 0.15 mg / kg of i.v . Thereafter, the tof count decreased to 0, and endotracheal intubation was carried out . The mandible was sufficiently relaxed at the time of endotracheal intubation; there was no movement of the vocal cord, and coughing or movement was not observed after intubation . The anesthesia was maintained with 1.2 - 1.5 vol% of sevoflurane and 50% n2o during the operation . The tof ratio was 0.37 at the end of the operation, which was 35 minutes after the last dose of the muscle relaxant had been administered . Intravenous pyridostigmine 0.15 mg / kg and glycopyrrolate 0.003 mg / kg were administered as antagonists of the muscle relaxant . Extubation was carried out; the tof ratio was maintained above 0.9 at around 55 minutes after the last dose of the muscle relaxant had been administered . No sign of respiratory depression was observed after extubation, and no particular signs and symptoms were observed in the recovery unit . Three months later, the patient was diagnosed with chronic osteomyelitis, and an incision and drainage operation was planned . It was decided to perform general anesthesia in consideration of the state of systemic inflammation and the patient's preference . As pretreatment for anesthesia, 0.2 mg of i.m . When the patient entered the operating room, the standard anesthetic monitoring devices and the neuromuscular monitoring device were applied in the same manner as in the previous operation . The blood pressure was 112/70 mmhg, and the heart rate was 93 beats per minute . The neuromuscular monitoring device (tof - watch sx, organon, netherlands) was attached to the ulnar nerve of the right forearm flap . After the loss of consciousness, stabilization and calibration were carried out to establish the initial value of the spasm height prior to the administration of rocuronium . For the calibration of the spasm reaction, a 50 hz tetanic stimulation was conducted for 5 seconds, which was then changed to a 2 hz tof stimulation with 15-second intervals, and the calibration was initiated by pressing the cal switch on the tof - watchsx (cal 2 mode). The tof response change was within 10% 2 minutes after the calibration, and this was considered as the stabilization of the spasm response . Administration of rocuronium 0.3 mg / kg (ed95), a block of more than 80% of t1 failed; therefore, additional i.v . Rocuronium 0.3 mg / kg was administered, and a 100% block of t1 was achieved at just past 300 seconds . The anesthesia was maintained with 1.5 - 2.0 vol% of sevoflurane and 50% of n2o during the operation . The time taken to recover t1 to 25% after the administration of the second dose of the muscle relaxant was 4 minutes and 36 seconds . Twenty - five minutes after endotracheal intubation, t1 had recovered more than 25%; hence, an additional 7.5 mg of rocuronium was administered . With the recovery of the muscle relaxation, the time taken for t1 to recover from 25% to 75% was 9 minutes and 1 second . The tof ratio was 0.33 5 minutes after ceasing sevoflurane administration on completion of the operation . Neostigmine 0.05 mg / kg and glycopyrrolate 0.005 mg / kg were administered to antagonize the muscle relaxation . At 5 minutes and 30 seconds after administration of the antagonist, t1 had recovered more than 95%, and the tof ratio had recovered to more than 0.9 . Therefore, extubation was carried out . The authors confirmed that long - term administration of oral dantrolene for the treatment of spasticity does not significantly affect the muscle relaxant action of rocuronium . Regarding the induction of muscle relaxation in the second operation, t1 did not decrease more than 84% 3 minutes and 30 seconds after the administration of 0.3 mg / kg of rocuronium . Hence, an extra dose of 0.3 mg / kg of rocuronium was administered . A more than 95% reduction in t1 was observed 5 minutes after the administration of the first dose of the muscle relaxant . In both of the operations, the total amount of rocuronium required for endotracheal intubation was twice the ed95 (0.6 mg / kg). For the maintenance of muscle relaxation, the clinical duration (the time taken from the administration of the intubating dose until 25% recovery of t1) was 24 minutes and 36 seconds, which was not extended any further . For the recovery of muscle relaxation, the recovery index (the time taken for t1 recover from 25 to 75%) in the second operation was 9 minutes and 1 second, and the time taken for the tof ratio after the last dose of the muscle relaxant to be greater than 0.9 was 22 minutes and 30 seconds, which was not extended any further . Reported the case of an 8-year - old patient who had been taking oral dantrolene 20 mg daily for the treatment of spasticity for 2 years prior to an operation . When 75 g / kg of vecuronium was administered for general anesthesia, the recovery index was 7 minutes, and the recovery time of t1 to 90% was 25 minutes, which was not extended . After the operation, neostigmine and atropine were used as antagonists of the muscle relaxant when t1 had recovered to 25% . Flewellen et al . Evaluated the dose - dependent effect of dantrolene on the muscle relaxant action in adults without a particular medical history, and 75% twitch depression was observed when 2.4 mg / kg was intravenously administered with the additional administration of 0.1 mg / kg of dantrolene every 5 minutes . However, there was no significant change in maximum expiratory flow rate, lung capacity, or respiratory rate per minute . Driessen et al . Reported the case of a 60-year - old female patient who was administered 350 mg (5.3 mg / kg) of dantrolene for 28 hours prior to an operation for the prevention of malignant hyperthermia . When 45 g / kg of vecuronium was administered for general anesthesia, the spasm response of the 90% recovery time on the electromyogram was extended to 47 minutes . Furthermore, watson et al . Described the case of a 5-year - old female patient who was administered 2 doses of 1 mg / kg oral dantrolene every 6 hours for the prevention of malignant hyperthermia . After the second dose, the patient manifested muscle weakness and partial obstruction of the soft tissue of the upper respiratory tract under respiration . The patient in this case had been administered 50 mg of oral dantrolene once a day, and in both operations, the total dose of muscle relaxant (0.6 mg / kg) required for endotracheal intubation was not particularly different from the dose required in other patients . These results can be attributed to the fact that the patient was taking 0.76 mg / kg of dantrolene, and the elimination half life of dantrolene is 15.8 6.0 h. as the first operation was at 4 p.m. and the second operation was at 1 p.m., the operations were carried out 21 hours and 18 hours after the administration of dantrolene, respectively . Therefore, the reduction in the serum concentration of dantrolene that was administered the day before the operation is considered to be one of the factors influencing the results . The perioperative administration of dantrolene may cause a delay in the recovery of muscle relaxation in a dose - dependent manner, and the timing of preoperative administration is especially important as it is associated with the serum dantrolene concentration . Therefore, for patients taking a high dose of dantrolene, it is helpful to consider the half life of the medication when making decisions about the timing of medication discontinuation . However, there are individual differences in pharmacokinetics . For the use of a muscle relaxant, neuromuscular monitoring
Rab - type small gtpases are conserved membrane trafficking proteins in all eukaryotes, and they mediate various steps in membrane trafficking, including vesicle budding, vesicle movement along cytoskeletons, vesicle docking to specific membranes, and vesicle fusion . Rabs function as a molecular switch by cycling between two nucleotide - bound states, a gdp - bound inactive state (off state) and a gtp - bound active state (on state). Rabs are activated by specific guanine nucleotide exchange factors (gefs), which promote the release of gdp from rab and binding of gtp to rab, and the activated rabs are then inactivated by gtpase - activating proteins (gaps) or spontaneously inactivated by their intrinsic gtpase activity . Thus, investigation of rab - gefs is crucial to understanding the spatio - temporal regulation of rab gtpase activation . Although a large number of putative rab - gefs, including denn - domain - containing proteins, have recently been reported, very little is known about their in vivo roles in rab targeting to specific membrane compartments . Rab17 was originally described as an epithelial cell - specific rab isoform that regulates polarized trafficking but was subsequently found to be expressed in melanocytes and human breast adenocarcinoma, and more recently we demonstrated that rab17 is also expressed in mouse brain . Localization of rab17 in mouse hippocampal neurons is unique, because rab17 is the only rab isoform that is specifically targeted to the dendrites and is not targeted to the axon . The targeting of rab17 to the dendrites is neuronal differentiation stage - dependent: at an early stage (3 d of in vitro culture) it localizes only in the cell body, whereas at a later stage (11 d of in vitro culture) some of the rab17 is translocated from the cell body to the dendrites . By contrast, other rab isoforms are targeted to the axon alone (e.g., rab3a) or to both the axon and dendrites (e.g., rab5a). Targeting of rab17 to the dendrites is known to be crucial for dendrite morphogenesis and subsequent postsynapse formation, because knockdown of rab17 has been found to result in a marked reduction in both total dendrite length and the number of dendrite branches without affecting axon morphogenesis (i.e., total axon length and the number of axon branches). Although several mammalian rab isoforms (e.g., rab7 and rab11) have been shown to regulate dendrite morphogenesis, rab17 is the first reported rab isoform that specifically regulates dendrite morphogenesis, but not axon morphogenesis, in mammalian neurons . We therefore thought that rab17 would be an ideal rab isoform to use to analyze a rab targeting mechanism at the cellular level . However, until recently the molecular basis of the specific rab17 targeting to dendrites had completely remained unknown and no physiological rab17-gefs that function in hippocampal neurons had been identified . In our latest study, we screened for rab17-gefs by performing yeast two - hybrid assays with a constitutive negative mutant of rab17 as bait and succeeded in identifying rabex-5 and als2, both of which were originally described as rab5-gefs, as plausible candidate rab17-gefs in mouse hippocampal neurons . It is noteworthy that overexpression of rabex-5, but not of als2, increased the proportion of rab17 in the dendrites, whereas knockdown of rabex-5 caused a dramatic reduction in the proportion of rab17 in the dendrites . Importantly, overexpression of a gef - activity - deficient mutant of rabex-5 (rabex-5-d313a) failed to increase translocation of rab17 from the cell body to the dendrites . Based on these findings, activation of rab17 by rabex-5 is responsible for the stage - dependent movement of rab17 from the cell body to the dendrites of hippocampal neurons . Actually, forced activation of rab17, i.e., expression of a constitutive active mutant of rab17 (rab17-q77l), increased the dendrite localization of rab17 even in early stage neurons . More importantly, rabex-5 knockdown was found to cause a significant reduction in total dendrite length, the same as rab17 knockdown did, and the reduction was partially rescued by co - expression with rab17-q77l . These findings indicated that rabex-5 functions as an upstream activator of rab17 in developing hippocampal neurons (fig . Proposed model of rabex-5-mediated translocation of its downstream rabs to the neurites of developing hippocampal neurons . Rabex-5 functions not only as a rab17-gef (a) but also as a rab5/21-gef (b), and it determines dendrite targeting of rab17 and axon / dendrite targeting of rab5/21, respectively (dotted arrows). The solid arrows indicate the gef function of rabex-5 that promotes release of bound gdp from rab5/17/21 in exchange for gtp . Because of the different sorting functions of rabex-5, rab17 specifically regulates dendrite morphogenesis, whereas rabex-5 and rab5 are involved in neurite morphogenesis in general . Factor x in (a) is a putative rab17-specific effector that may also interact with rabex-5 and support dendrite targeting of rab17 . Rabaptin-5 is known to interact with both rab5/21 and rabex-5 at early endosomes, but whether rabaptin-5 is involved in neurite outgrowth remains to be determined (b). Determining the molecular mechanism by which active rab17 is translocated from the cell body to the dendrites is an important task that has yet to be achieved . Active rab17 itself is unlikely to have the ability to target dendrites, because unlike endogenous rab17, which specifically localizes in the dendrites, rab17-q77l also localizes in the axon . Interestingly, overexpression of a gef domain (i.e., vps9 domain) of rabex-5 alone similarly increased the translocation of rab17 to both the axon and the dendrites, whereas overexpression of full - length rabex-5 increased endogenous rab17 translocation to the dendrites alone . Thus, some additional domains of rabex-5 besides its gef domain (e.g., a zinc finger domain and/or a coiled - coil domain) must also be involved in rab17 targeting . We speculate that rabex-5 functionally links to dendrite - directed motors and that rab17 activated by rabex-5 is captured by certain motor proteins that transport it to the dendrites . Since some rab effector molecules (or rabs themselves) are known to directly associate with motor proteins, in the future it would be interesting to search for rab17-specific effectors that form a link between rabex-5 and motor proteins . Our finding that rabex-5 determines the dendrite localization of its downstream target rab17 is highly consistent with a recent report showing that rab - gefs (e.g., rabex-5 and rabin8) are major determinants of specific rab membrane targeting . However, one puzzling result of our research is that rab5 and rab21, two other downstream targets of rabex-5, are translocated both to the axon and to the dendrites of developing hippocampal neurons in a rabex-5-dependent manner (fig . 1b), meaning that rabex-5 determines not only the dendrite targeting of rab17 but the axon / dendrite targeting of rab5 and rab21 as well . Because of the multiple roles of rabex-5 in rab targeting to neurites, rabex-5 is involved in both the axon morphogenesis and dendrite morphogenesis of developing hippocampal neurons by activating at least two downstream targets, rab5 and rab17 . However, the molecular mechanism by which rabex-5 sorts different downstream rab proteins into the axon and/or dendrites is completely unknown . Since rabex-5 constitutes a gef cascade by recruiting a rab5 effector, rabaptin-5, to early endosomes, rabex-5 may also recruit an as yet unidentified rab17-specific effector(s) (factor x in fig . 1a) that does not bind rab5 or rab21 and support dendrite targeting of rab17 . Thus, identifying rab17-specific effectors will be one of the most important tasks in future rab17 research designed to understand the molecular mechanism by which rabex-5 determines the targeting of its downstream rab proteins to neurites at the cellular level . Since rab17 is also expressed in epithelial cells and melanocytes, it would be interesting to investigate whether rabex-5 also contributes to the polarized trafficking of rab17 in other cell types.
Avascular necrosis (avn) of the femoral or humeral heads in patients with sickle cell anemia is a common and painful condition . Typically, the pain is managed with narcotics and activity restriction until there has been collapse of the subchondral bone with a degree of arthrosis sufficient to warrant total joint arthroplasty . This method entails prolonged pain for the patient and decreases the ability to function occupationally and recreationally . A 51-year - old african - american woman with a history of sickle cell anemia presented for the evaluation of significant bilateral shoulder pain that was confirmed to be avn via radiographs and magnetic resonance imaging of both her humeral heads without joint collapse . She tried and failed conservative management with physical therapy and optimization of sickle cell treatment with pain medications for years, so she desired surgical management . Arthroscopically assisted core decompression of her humeral heads with synthetic grafting was performed in an attempt at joint preservation . This report demonstrates a technique of staged decompression of necrotic bone in the bilateral humeral heads with synthetic bone grafting to determine if this could function as a joint preservation strategy . This procedure was considered successful to alleviate the patients pain in both of her arms . The application of this procedure is significant because it could be used in various future medical joint preservation cases for a wide range of patients . Avascular necrosis (avn) of the femoral and humeral heads is a frequent and debilitating finding in many patients with sickle cell anemia [1, 2, 3, 4]. The standard treatment is observation with symptomatic pain control until the arthrosis has progressed to the point requiring total joint arthroplasty [5, 6, 7, 8]. There is a lack of published research with regard to joint preservation strategies in this patient population with new data starting to be published on the outcomes of core decompression and arthroplasty on atraumatic osteonecrosis . This case illustrates a patient with bilateral humeral head avn in which staged decompression of the necrotic bone with synthetic bone grafting was performed as a joint preservation strategy . It is our goal to delay end - stage arthrosis and cartilaginous degeneration with early intervention . A 51-year - old african - american woman with a history of sickle cell anemia presented for the evaluation of significant bilateral shoulder pain that was interfering with her activities of daily living and requiring narcotic medication for pain control . The pain and disability had been increasing progressively over several years and was recalcitrant to physical therapy . Radiographs and magnetic resonance imaging (mri) confirmed avn of her humeral heads without joint collapse (fig . Preoperative magnetic resonance imaging demonstrates extensive subchondral osteonecrosis without joint collapse staged surgery was then performed approximately 4-month apart using the identical technique on both shoulders . This consists of admission the evening before surgery to the internal medicine service with acquisition of routine blood work, intravenous hydration, and preoperative blood transfusion as indicated based on hemoglobin level . Surgery was performed in the beach chair position with the c - arm coming in perpendicular to the patient . Diagnostic arthroscopy was performed to evaluate for intra - articular pathology and confirm that there was no significant chondromalacia, which would negate the benefits of the joint preservation procedure . In this case, arthroscopy revealed small partial thickness articular sided supraspinatus tears that were debrided but no visible chondral damage was present . Upon probing, the cartilage was quite soft over the areas of avn noted on mri . Under fluoroscopic guidance, a guide wire was directed into the center of the region of avn, which was done via a small deltoid splitting approach laterally . The arthroscopic probe was placed in the center of the most depressible cartilage region on the head and utilized fluoroscopically to guide pin placement . Once the guide wire was in the center of the defect, an expandable reamer was utilized and the necrotic bone was removed (fig . The arthroscope is critical in this stage to allow complete extraction of necrotic subchondral bone while ensuring no penetration of the cartilage . After full decompression was performed, synthetic bone graft (pro - dense, wright medical) was injected under fluoroscopy and direct visualization . Given the immediate structural integrity of the graft, maximal removal of necrotic segments was attempted . Care was taken under fluoroscopic guidance not to penetrate the articular surface and no cartilaginous defects were encountered . For both procedures, the standard sickle cell protocol was followed with overnight admission for intravenous hydration followed by discharge with 2 weeks of deep venous thrombosis (dvt) chemoprophylaxis . She was allowed activity as tolerated and physical therapy initiated 2 weeks after each surgery . At 8-month follow - up from the index procedure, she is asymptomatic with a full range of motion on the first shoulder and some mild residual stiffness in the second shoulder (4-month follow - up). Radiographs demonstrate incorporation of the bone graft without evidence of joint collapse or further avn (fig . (a and b) 4-month and 8-month images show progressive replacement of graft with new vascularized bone . There are no published articles on surgical shoulder joint preservation in sickle cell anemia to the authors knowledge . In this report, we show a potential method to mitigate this process and prevent or delay the need for total joint arthroplasty with early intervention . Synthetic grafting with an injectable calcium sulfate and calcium phosphate composition (pro - dense) has been shown to be effective in allowing relatively rapid bone regrowth in the setting of femoral head avn [10, 11]. Removal of necrotic bone back to healthy vascularized bone with interposition of a structurally strong osteoconductive substrate allows for gradual revascularization and re - ossification of the region . While decompression and grafting will not change the underlying sickle cell disease process, it is our hope to provide improved the quality of life for these patients . Further study is required to demonstrate the long - term efficacy of joint preservation strategies in the humeral heads of sickle cell patients with humeral head avn before evidence of cartilaginous damage . In terms of indications and contraindications or inclusion and exclusion criteria, we do not feel that joint preservation strategies would be effective after the onset of subchondral collapse, rather in the setting of mri - confirmed symptomatic avn with intact cartilage . The risk profile of any surgical intervention in the setting of sickle cell anemia must also be considered, with appropriate care taken to prevent acute sickle crisis, dvt, and pulmonary embolism . Therefore, coordination with an established sickle cell program is critical to ensure appropriate pre - hydration, transfusion, and anticoagulation protocols are followed to prevent perioperative medical complications . There is no known increased risk in this patient population to using the bone graft material, so the main consideration for contraindications are related to the surgical risk of a sickle cell patient and how well his or her disease is being managed . Avn is a common problem for patients with sickle cell disease and this report demonstrates a technique of staged decompression of necrotic bone in the bilateral humeral heads with synthetic bone grafting to determine if this could function as a joint preservation strategy . This procedure was considered successful to alleviate the patients pain in both of her arms (bilateral humeral heads). The application of this procedure is significant because it could be used in various future medical joint preservation cases for a wide range of patients . Joint degeneration and long - term pain are common outcomes of sickle cell anemia and other disease processes . While decompression and grafting will not change the underlying disease process, it is our hope to provide improved the quality of life for these patients using this procedure . Our goal is to apply this joint preservation technique to more sickle cell patients and patients with other diseases causing joint pain and degeneration to improve not only the quality of joint function, but also the quality of life.
A challenge to increasing early childhood immunizations on a state or local level is the limited ability of standard summary measures of up - to - date (utd) rates to identify barriers to improvement . Typically, early childhood utd rates are based on the number of doses of recommended vaccines, by individual antigen or in total, that a cohort of children receive by either a fixed age or a fixed date of assessment . For the national immunization survey (nis), this represents the proportion of 19- to 35-month - old children having all recommended doses for up to 7 vaccine types . Similarly, health plans utilize a healthcare effectiveness data and information set (hedis) immunization measure, which counts the number of doses received by 24 months of age [2, 3]. However, a low utd rate among a population, derived using these measures, does not aid in determining why the rate is low . The growing complexity of the early childhood immunization schedule, with up to 19 vaccine doses recommended across at least 6 visits by age 2, means that there are many points of time and many reasons by which children can fall behind on immunizations . While immunization summary utd rates for 2-year - olds can identify general problems, there is also a need for more detailed assessment tools to describe local immunization coverage and more specific vaccine usage . One alternative method of evaluation is to consider age - appropriate vaccinations . A substantial body of prior work exists comparing summary utd measures against more specific assessments either for complete antigen series or combinations when actually due without considering late catch - up [79], or in comparison of individual antigens and shots to when they are expected or late . To the extent that early childhood immunizations are often used as a proxy for the quality of early childhood routine care, the timeliness of immunizations is a relevant measure delayed or lagging immunizations may reflect other issues with early childhood care . One perspective on age - appropriate immunizations is to track children's progress through immunization milestones between birth and age 2 . Immunization milestones are the ages at which recommended immunizations first become late according to the schedule developed by the advisory committee on immunization practices (acip). These milestones occur at 3, 5, 7, 16, 19, and 24 months of age . When immunizations are tracked using this approach, children's progression through milestones unfolds as a story of falling behind and catching up with recommended doses . This is a beneficial method as it facilitates identifying provider failure to give all or some of the immunizations that are due at healthcare encounters (missed opportunities) or parental failure to bring children to providers for vaccination - eligible encounters (missed visits). The prevalence of missed opportunities and missed visits at each milestone age can guide immunization interventions . However, basing milestone analysis exclusively on immunization record data may misclassify missed opportunities as missed visits, and shift the apparent burden of children who are not appropriately immunized for their age from providers to parents . This can occur because healthcare encounters during which no vaccinations are administered will not be captured into immunization record datasets . This study provides an example of using a milestone approach to assess a specific population and their progression through early childhood immunizations, where both payor - administrative and state - level immunization information system (iis) data are available . Combining children's healthcare encounter information from payer records with their immunization records gives a more accurate assessment at each milestone age of the effect of missed opportunities and missed visits on age - appropriate immunizations and overall immunization rates . The study population consisted of a birth cohort of oregon children enrolled in the oregon health plan (ohp) and whose immunization records were in the oregon alert immunization information system (alert iis). Alert iis immunization records were merged with provider encounter records from the ohp for this population . The alert iis is a statewide immunization registry which receives immunization records from 97% of oregon private healthcare providers and 100% of the immunization records from public providers . The ohp is oregon's public healthcare plan that provides healthcare coverage for children in families living below 185% of the federal poverty level and covers both those with traditional medicaid eligibility as well as an expanded state children's health insurance program (schip) population . The majority of ohp - enrolled children are placed in commercially available managed care plans . Immunization records for ohp children are available both from ohp collected records for billing and encounters as well as from direct provider record submissions to alert . For this study, alert iis records and ohp encounter records immunization records and encounter data were restricted to those received through the child's 24th month of age . Children's records were merged across the two data systems based on the child's name, date of birth, and county of residence . The matching process was based on the observation that within the 2005 oregon birth cohort, a combination of name and date of birth was over 99.9% unique, with almost all exceptions resolving with the inclusion of residence . This high - probability matching process was selected over the usual process alert uses to incorporate ohp and other administrative data, wherein a hard - match is required also on additional information such as address or phone number . Immunization records were selected for the six vaccines (including combination vaccines) included in the recommended the 4:3:1:3:3:1 series consists of 4 diphtheria, tetanus toxoid, and acellular pertussis (dtap); 3 poliovirus (ipv); 1 measles, mumps, and rubella (mmr), 3 haemophilus influenzae type b (hib); 3 hepatitis b (hepb), and 1 varicella . Records for these vaccines were reviewed for appropriate age and interval between doses, according to the 2007 acip immunization schedule . Doses given too early or with insufficient spacing between doses to be considered valid were removed from the analysis . To ensure that records of encounters would be available to compare with immunizations at all of the milestone ages, children with limited enrollment or nonenrollment at key ages were excluded from the final analysis dataset . The study population was restricted to children enrolled in ohp within 30 days of birth, with a cumulative total of at least 365 days of enrollment by age 2, and continuous enrollment across the key period of 15 to 18 months, when the 4th dose of dtap is due . Because ohp enrollment generally occurs in 12-month blocks, the majority of children meeting the above requirements were also continuously enrolled through their second birthday . Children born outside oregon were excluded since possibly both early encounters and immunizations would not be reported to alert or ohp . Children with only a birth dose of hepatitis b and no other vaccines in alert also were excluded . The ohp requires health plans and providers to submit detailed encounter records on enrolled children for all services received . For ohp - enrolled children, a subset of vaccination - eligible encounters was created from all encounters, based on a review of icd-9 and cpt coding in ohp encounter records . A vaccination - eligible encounter was defined as an encounter occurring in a nonemergent or noninpatient setting with a medical provider, and with either a cpt procedure code indicating that routine care or evaluation was performed, or an icd-9 diagnostic code indicating that the purpose of the encounter was consistent with routine care and immunization evaluation . These criteria were used to identify not only visits that providers would define as well - child visits, but also other visits during which immunizations could have been given, and include nonemergent sick visits . In a few cases, alert had a record of an immunization visit for which there was no matching ohp encounter record . This was usually found to reflect free vaccinations without administration fees at sites outside of those normally reporting to ohp, such as school clinics, and some public health departments . These visits were also counted as vaccination - eligible encounters . Also if cpt codes for vaccine administration were found in ohp data without other evidence of a shot - eligible encounter, the definitions of milestone periods were taken from luman and chu, and reflect the dates at which recommended immunizations are first late according to the 2007 acip schedule . The milestone periods occur at the start of 3 months, 5 months, 7 months, 16 months, 19 months, and 24 months of age . Immunization (utd) status at each milestone was evaluated for the timely receipt of all doses due in the 4:3:1:3:3:1 series by age 2 . Additionally children were categorized according to whether they had vaccination - eligible encounters in the period prior to each milestone . In cases in which a non - utd child at a milestone had multiple encounters in the prior period, and received vaccinations at some encounters and not at others, they were counted as having a vaccination visit . Schematically, this classification is presented in table 1 . At each milestone age, immunization status was compared with the immunization status at the previous milestone age to determine whether children had remained utd, remained non - utd, fallen behind due to a missed visit, fallen behind due to a missed opportunity, or caught up with the immunization schedule . Children remained utd if they were utd at the prior milestone age and utd at the current milestone age . Children remained non - utd if they were non - utd at the prior milestone age and non - utd at the current milestone age . Children fell behind due to a missed visit if they were utd at the prior milestone age, non - utd at the current milestone age, and had no record of a valid healthcare visit or immunization record during the period in between . Children fell behind due to a missed opportunity if they were utd at the prior milestone age, non - utd at the current milestone age, and had a vaccination - eligible healthcare visit during the period in between . Children caught up if they were non - utd at the prior milestone age and utd at the current milestone age . An exception to the missed opportunity calculation is for the 16-month milestone, which includes the first mmr vaccine . The mmr is not valid before 12 months of age, so encounters between 7 months and 12 months were not counted as potential missed opportunities . As a check on the completeness of immunization visits represented by this merged dataset, a lincoln - peterson capture - recapture method was used to estimate the percentage of immunization visits for the study population not captured by the alert iis either by provider records or by ohp administrative records . The total number of immunization visits, both captured and uncaptured, was estimated by (1)n=[(a+1)(b+1)](ab1), where n is the total estimated number of visits, a is the number of visits captured by provider reports in alert, b is the number of visits captured by ohp billing and administrative reports, and ab is the number of visits captured in both by date . The principal assessment tool of this study is a time - based progression of young children across milestones and age - appropriate immunizations, presented in a novel form for easier depiction of change between milestones . The data by milestone are presented for whether children were complete on age - appropriate immunizations along with categories for catching up and falling behind by milestone, and by missed opportunities versus missed visits for non - utd children . Finally, a comparison of age - appropriate milestone results is made to a summary utd measure for the 4:3:1:3:3:1 immunization series assessed at 24 to 35 months of age . Of 20,411 children born in 2005 who were enrolled in the oregon health plan for some period of time, 13,199 met the requirements to be counted among the study population . The numbers of those excluded are listed in the order they were excluded and do not reflect the total prevalence of each criterion in the population; for example, of the 1,004 children excluded for being born out of oregon, the majority would also have been excluded for length of enrollment . The primary reason for exclusions from the study population is nonenrollment after 1 year of age, so that no encounter data would be reported to ohp . Also 2% of the study population met all enrollment criteria except that they did not have any reported immunizations . The capture - recapture estimate of total immunization visits for the study population was 76,087 . Thus the dataset appears relatively complete for all immunization visits of the study population, with the combination of alert iis provider reports and ohp administrative data capturing 98.4% of estimated immunization visits among the study population . As shown in figure 1, only 32% of children had all acip recommended immunizations on time at all milestones, while 14% were not complete at only one milestone, 15% were not complete at 2 milestones, and 9% were not complete at any milestone . Also 41% of children had vaccination - eligible encounters in all of the periods before each milestone, and 35% of children were missing encounters in only one of the periods before milestones . Another 14% were missing encounters in 2 periods, and 10% were missing encounters in 3 or more periods . Rates of completeness of age - appropriate immunizations per the acip schedule varied among the milestone ages, from a high of 82.4% at 3 months of age to a low of 52.5% at 19 months of age . For the final milestone at 24-months, no further vaccinations were due, and the final 24 month completion rate for the study population was 68.6%, with 16.1% catching up from the prior 19-month milestone . The pattern of completion, falling behind, and catching up by milestone period is presented in figure 2 . While 17.6% of the study population had fallen behind by the 3-month milestone, representing a late start on immunizations, the most salient episode of falling behind occurred at the 5-month milestone, where 21.0% of children fell behind . In this analysis the 19-month milestone adds 4 antigens beyond the 16-month milestone, including the fourth dtap and varicella; and the risk of falling behind between these milestones is calculated from table 2 as (16.7/61.3) = 27.2% . This is interpreted as, for those who are on schedule at 16 months, 27.2% will fall behind by 19 months . The largest total percentage of children without age - appropriate immunizations, 47.5%, also occurred at the 19-month milestone . Overall, the percentages of children who were not complete by milestone from table 2 with missed opportunities was 68.5% at 3 months, 72.2% at 5 months, 71.7% at 7 months, 72.5% at 16 months, 58.4% at 19 months, and 60.0% at 24 months . Another approach to interpreting the reasons for children falling behind is to further examine missed visits, missed opportunities, and vaccination visits at each milestone for those who were not complete . Figure 3 describes how children who are not complete for age - appropriate immunizations at any milestone have either missed visits or missed opportunities, where missed opportunities are divided between provider encounters with no shots received versus encounters where some shots are received . The percentage of noncomplete children per milestone with provider encounters on which some shots were received (vaccination visits) ranged from a high of 50.8% prior to the 3-month milestone to a low of 15.2% before the 24-month milestone . The percentage of children with provider encounters and no shots, and without vaccination visits, in each period is a measure of the amount by which immunization - record - only data would misclassify missed opportunities as missed visits . This potential misclassified percentage of noncomplete children having vaccination - eligible encounters with no reported vaccinations ranged from a high of 44.8% at the 24-month milestone, to a low of 21.4% at the 5-month milestone . At the 3-month milestone, noncomplete children were evenly divided between those with no encounters on record during the period (31.4%), those with encounters but no vaccinations (34.1%), and those with encounters during which some vaccinations were given (34.5%). As a final analysis, the results by milestone for encounters and completeness were stratified by children's status on a summary utd measure for having all shots in a 4:3:1:3:3:1 series by age 24 to 35 months, and using a fixed date of assessment . Overall 77.8% of the study population were utd by 24 to 35 months for the 4:3:1:3:3:1 series . The comparison across milestones for children who were utd of the children who were utd by the date of assessment, only 68% were complete for age - appropriate immunizations by the 19-month milestone, 72% were complete by the 16-month milestone, 67% were complete at the 7-month milestone, and 71% were complete at the 5-month milestone . The majority of those who were not complete at any milestone, with the exception of the 24-month milestone, also had encounters with providers on which some shots were given . Figure 5 presents the same analysis across milestones for the 22.2% of the study population who were not utd for the 4:3:1:3:3:1 series at 24 to 35 months . Children not utd at 2435 months were also not complete for age - appropriate immunizations at 19 and 24 months by definition of which shots were required at these milestones . Overall in figure 5 the majority of non - utd children at 24 to 35 months who also were not complete at milestones had substantial volumes of encounters with providers . An analysis using only shot - record data, however, would reach, falsely, the conclusion that the majority of non - utd children were missing provider encounters at each milestone . The reality of children's immunizations in the present study population is a story of falling behind and catching up with recommended immunizations . What this study adds to the understanding of milestones and immunizations is a more accurate representation of how missed opportunities and missed visits contribute to children not being up - to - date for recommended vaccines . The present finding that for many children, periods of missed visits in immunization record data are actually periods of missed opportunities is a first in the analysis of larger, population - based data systems such as immunization registries . This finding should lead at least to caution in assigning reasons regarding why children are not up - to - date according to either state - level immunization registries or other immunization record data, including the national immunization survey . The importance of this is that the prevalence of either true missed visits or true missed opportunities should lead to different interventions to improve immunization rates . Focusing on methods to improve rates of missed visits, such as reminder - recalls to parents of children who appear to have missing vaccinations and visits, may be of limited utility if the greater issue is that the parents have brought their children in to providers across milestones without receiving needed vaccinations . As a recommendation to correct this problem, immunization record data for at least a sample of covered children should be compared with encounter records from billing and administrative sources before considering appropriate immunization interventions . Also, data collected from samples of provider records for immunization assessment should include basic information on all encounters, whether vaccinations were given or not . In this study, the majority of children who were not catching up at each milestone were having encounters with providers . These encounters were potentially ones in which missing vaccinations could be administered; however, converting these missed opportunities to vaccination visits may be difficult . Provider reluctance to administer vaccinations during sick or other nonroutine visits is a known barrier to improving immunization rates, and may be difficult to change [1214]. The type of encounter may also be a barrier to receiving vaccinations in many clinics and healthcare providers; for example, in urgent care encounters, when limited time and a press of higher priority needs make it difficult to include review of records and delivery of vaccinations [1517]. While parental reluctance in such circumstances is likely a factor, at least one study has found that the barrier in such visits is more likely to be provider - based than parental . Also, reimbursement levels may not be sufficient to encourage providers to expand immunizations outside of well - child visits . Finally parents who bring their children in for sick visits or other encounters without immunizations may easily believe that their child has received all needed care, including immunizations . Most parents of children who are not utd believe their child has received all needed immunizations and may not understand the difference between well - child and other types of encounters . Solutions to this problem may lie in the redesign of early childhood care encounters within clinics and healthcare providers that are concerned about their immunization rates, to deemphasize urgent care or access to short, single - purpose visits in favor of longer appointments during which aspects of routine care such as immunizations are also reviewed . A strength of the present study is the combination of administrative data on all encounters with immunization records reported separately to the alert iis . This approach could potentially serve as a standard for the evaluation of immunizations given to health plan participants and public populations in areas that have strong immunization information systems such as alert . A similar approach by dombkowski et al . Has previously demonstrated the utility of combining registry and medicaid data in michigan for assessing missed opportunities to vaccinate asthmatics against influenza . The potential for missed opportunities to be misclassified as missed visits when conducting milestone analysis solely from immunization record data without all encounters should lead to caution in interpreting the balance of responsibility between parents and providers for children not being up - to - date . Also the present study does not address the extent to which parental reluctance to accept all age - appropriate immunizations may limit the ability of provider - based interventions to improve milestone immunization completeness . From the perspective of a state immunization program with concerns for improving immunization rates, the development of a roadmap showing where and how children are falling behind is invaluable for setting policy . While national measurements such as the nis can identify variations in rates between states, state - level programs have been left on their own to identify what in - state factors are affecting their rates . Also because immunization levels are often taken as a measure for overall quality of care in early childhood, counting doses by age two is not as strong a proxy as is the checking of timely receipt of age - appropriate immunizations across the entire period from birth to age two . A risk of solely depending on immunization results at age two is that utd and non - utd status may be taken as discrete categories, irrespective of age - appropriate history . Searching for explanatory factors for these two categories may be misleading for developing an understanding of where barriers exist and where interventions are needed . This is illustrated in the present study by the observation that only a minority of children were consistently on schedule at all milestone ages, and that the majority fell behind at one or more point in receiving immunizations . Falling behind by milestone period is a more useful concept for intervention than final utd status . A useful model then is that most children are at great risk of falling behind at many points, and that their final status reflects the work that providers do to catch them up to standard . The concept of milestone ages and the charting of children's progress through the milestones, as advanced by luman and chu, provides such a roadmap for use by local programs . Local variations in patterns of falling behind and catching up, however, argue for analyzing milestones with available local or state - level data to determine where problems are most salient . Yet, while specific findings may differ, the present study confirms the utility of the milestone approach for a local population . The present study is representative only of a single state population, and of children enrolled through the oregon health plan . Because children in the ohp are generally enrolled in the same health plans, with the same networks of providers and benefits, as privately insured children, their encounters are potentially similar to the wider state population . Overall in 2007, the oip estimated that among all ohp - enrolled 2-year - olds, the utd rate for a 4:3:1:3:3:1 series was 75.2%, as compared to 72.9% among non - ohp - enrolled children . However, the present study population also reflects a group with stable, long - term enrollment in ohp . Children with short - term enrollment or who disenrolled after age 1 are not represented and may have substantially different patterns of falling behind and catching up to recommended immunizations . Also it is expected that individual health plans under the ohp are a significant factor in the receipt of age - appropriate immunizations; however, this information was not included in the present analysis dataset . Another limitation on the present results is that the definition of encounters was deliberately set broadly, to reflect any encounters in which vaccinations could have been delivered as opposed to well - child visits, during which immunization screening should be routine . As such, the possibility of raising immunization rates by converting all missed opportunities here should be taken as an upper figure to what is possible . Institutional, scheduling, reimbursement and parental acceptance are all potential factors on what proportion of encounters without vaccinations could incorporate immunization screening . Also, encounters were not stratified by type of provider or principal reason for each encounter . While some research suggests that provider type is not a key factor for immunization performance when the volume of well - child visits is taken account, no provider information was included in the present study dataset to confirm or identify other relevant provider features . Whether encounters without immunizations are due to children using a spectrum of different provider types, to parental reluctance, or are due to use of settings such as urgent care in place of scheduled well - child visits cannot be determined from the data of this study . The milestone approach to evaluating early childhood immunizations provides a useful perspective for understanding the time - based progression of children through immunization periods . However, the results of this study warrant some caution in the use of immunization record data only in assessing failure to have age - appropriate immunizations because of the chance of misclassification of missed opportunities by providers as missed visits by parents . Nevertheless, for local assessment by public agencies or health plans, and for the design of interventions to improve immunization rates, looking at the patterns by which children fall behind or catch up on immunizations at milestone periods is a valuable next step beyond the count of vaccine doses received by age two.
Leucine - rich repeat kinase 2 (lrrk2) is a large protein of 285 kda that is composed of functional gtpase and kinase domains as well as several protein - protein interaction domains such as wd40 and leucine - rich repeat (lrr) (paisan - ruiz et al ., 2004; zimprich et al ., 2004; gloeckner et al ., 2006; west et al ., 2007). Missense mutations of lrrk2 have been reported to cause parkinson's disease (pd), the second most common neurodegenerative disease, in an autosomal dominant manner (paisan - ruiz et al ., 2004; zimprich et al ., 2004). Among these mutations, g2019s is the most prevalent mutation that exhibits kinase activity stronger than that of the wild type (west et al ., 2005; jaleel et al ., 2007; luzon - toro et al ., 2007; west et al ., 2007; gandhi et al ., 2009) and r1441c may disrupt lrrk2's homodimerization (deng et al ., 2008; gandhi et al ., 2008; klein et al ., 2009). Since g2019s has been found in both familial and sporadic cases of pd (gilks et al ., 2005; lesage et al ., 2007), elucidation of the normal and pathogenic functions of lrrk2 will be critical for our understanding of the etiology of pd . Lrrk2 has been proposed to cause increase of protein aggregation and neuronal toxicity (smith et al ., 2005; greggio et al ., 2006; smith et al ., 2006; 2010), shortening of neurite length in primary neuron cultures (macleod et al . 2008) and regulation of endocytosis rate (shin et al ., 2008). In addition, lrrk2 has been reported to interact with multiple cellular proteins including rab5b (shin et al ., 2008), parkin (smith et al ., 2005), /-tubulin heterodimers (gandhi et al ., 2008), fadd [fas - associated protein with death domain, (ho et al ., 2009)], heat shock protein 90 [hsp90, (wang et al ., 2008)], the dishevelled family members [dvl1 - 3, (sancho et al ., 2009)] and others (dachsel et al ., 2007). Among these, rab5b is an isoform of rab5, which is a member of the rab family, a small gtpase family . Rab5 is present in early endosomes and regulates endocytosis by controlling endosome fusion and motility (gorvel et al . In addition, rab5 is known to be localized in presynaptic vesicles (de hoop et al ., 1994; shin et al ., 2008) and affects endocytosis rates (wucherpfennig et al . Rab5 has been reported to negatively regulate neurite outgrowth in rat pheochromocytoma pc12 cells treated with nerve growth factor [ngf, (liu et al ., 2007)]. Over - expression of rab5 wild type (wt) or of the constitutively active gtpase mutant, q79l, inhibited neurite outgrowth whereas over - expression of the dominant negative gtpase mutant, n133i, enhanced neurite development (liu et al ., 2007). Recently, rab5 has been reported to regulate caspase-8-mediated cell motility (torres et al ., 2010) and to spatially control branching within dendritic arbors (satoh et al ., 2008). Based on our previously finding that lrrk2 interacts with rab5b and that this interaction regulates endocytosis of synaptic vesicles (shin et al ., 2008), we investigated here whether this interaction also affected each partner's ability to regulate neurite outgrowth using pc12 cells treated with ngf as well as primary hippocampal neuronal cultures . Our results suggest that lrrk2 is a more critical factor than rab5 in regulating neurite outgrowth although both proteins functionally coordinate regulation of neurite outgrowth . Cdnas of wild type and mutants of lrrk2 and rab5b were cloned into modified pcdna3.1 plasmids (invitrogen, carlsbad, ca) with myc and flag tags, respectively (shin et al ., 2008). The shlrrk2 plasmids containing lrrk2 specific sequences (5' ctgatccagttaaagaatatggttgtgcc 3') were purchased origene (rockville, maryland). The sequences of sirnas for rab5b are 5' aggcauaugcagaugacaa 3' (rab5 sirna-1) and 5' gcacgaaagcuaagacaua 3' (rab5 sirna-2). Since both rab5 sirnas showed similar neurite lengths, we used only sirab5 - 1 (data not shown). Construction of plasmids containing each gene for lrrk2 g2019s, r1441c and rab5 q79l, n133i were previously reported (shin et al ., 2008). Pc12 or rat primary hippocampal neuron cells were cultured in rpmi 1640 medium containing 10% heat - inactivated fetal bovine serum, 5% horse serum and 1% antibiotics or neurobasal medium (invitrogen, cat no . To induce neurite outgrowth, pc12 cells were seeded at a density of 40% on the cover glass and treated with nerve growth factor (ngf, invitrogen,) at 50 ng / ml for 7 days with replenishment of ngf every two days . For primary neuronal culture, rat e17 primary dissociated hippocampal neurons were prepared and cultured as previously described (shin et al ., 2008). The indicated plasmids and/or sirnas were transiently transfected by lipofectamine 2000 (invitrogen) at the third day of ngf treatment for pc12 cells or at the fifth day after seeding of primary neuronal cells . The amounts of plasmids for transfections were as follows: 4 g for transfection of lrrk2 or shlrrk2 plasmids, 2 g for transfection of rab5 plasmids, 4 and 1 g for cotransfection of lrrk2 or shlrrk2 and rab5 plasmids, respectively, or 100 nm for all sirnas . If necessary, the amounts of plasmid dnas were kept constant at 5 g by addition of vector plasmids . Cells were fixed for microscopic analysis after incubation for 7 more days . To test protein expression level, pc12 cells were transiently co - transfected with the indicated plasmids and pmacs4.1 expressing cd4 (miltenyi biotec, bergisch gladbach, germany) and harvested after 2~3 days of incubation . Co - transfected cells were sorted by macs (magnetic - activated cell sorting, miltenyi biotec, bergisch gladbach, germany). Macs utilizes cd4 antibodies coupled to micromagnetic beads which specifically detect cd4 expressed on the surface of transfected cells . A magnetic field was applied to sort cells bound to the cd4 antibodies with magnetic beads . The protein expression level was determined by immunoblotting of each cell lysates . To identify transfected cells with lrrk2 and/or rab5, cells were stained with antibodies against the corresponding proteins or their specific fusion tags . To detect over - expression of lrrk2 or rab5, antimyc (sigma, cat no . F3165) antibodies were used, respectively . To detect cells transfected with shlrrk2 plasmids or rab5 sirnas, anti - lrrk2 (norvus, cat no . 300 - 268) or anti - rab5 (santa cruz, cat no . Sc-598) antibodies were used, respectively, and cells expressing the corresponding proteins at low level in comparison to neighboring cells were selected for neurite analysis (fig . 1). In addition, to identify cells transfected with sirnas, shdna or vector plasmids alone, gfp plasmids were co - transfected and gfp antibodies (a gift from dr . A11001) or alexa 555 goat anti - rabbit igg (molecular probe, cat no . A21422) were used as secondary antibodies to visualize positive cells . To analyze neurite outgrowth patterns, transfected and immunostained cells for all samples were observed under a fluorescence microscope (olympus model bx61) set up under the same condition . Then, every cell in the images satisfying the experimental conditions such as over- or down - expression of specific proteins was selected for further neurite analysis . The selected cells' total and the longest neurite lengths were analyzed using a computer - assisted image analysis program [meta - morph software program, molecular devices, downingtown, pa, usa (klimaschewski et al ., 2002)]. Values for each cell's total and the longest neurite lengths were divided by its cell body diameter to compensate differences of their soma sizes since cells with larger cell bodies generally contain longer neurites . From these values, the average and the standard error of the mean (sem) for each experimental condition were calculated and shown as relative values to the vector control . Since the data pattern of the total and the longest neurite lengths were very similar to each other, only the pattern of the total neurite length is shown . Cdnas of wild type and mutants of lrrk2 and rab5b were cloned into modified pcdna3.1 plasmids (invitrogen, carlsbad, ca) with myc and flag tags, respectively (shin et al ., 2008). The shlrrk2 plasmids containing lrrk2 specific sequences (5' ctgatccagttaaagaatatggttgtgcc 3') were purchased origene (rockville, maryland). The sequences of sirnas for rab5b are 5' aggcauaugcagaugacaa 3' (rab5 sirna-1) and 5' gcacgaaagcuaagacaua 3' (rab5 sirna-2). Since both rab5 sirnas showed similar neurite lengths, we used only sirab5 - 1 (data not shown). Construction of plasmids containing each gene for lrrk2 g2019s, r1441c and rab5 q79l, n133i were previously reported (shin et al ., 2008). Pc12 or rat primary hippocampal neuron cells were cultured in rpmi 1640 medium containing 10% heat - inactivated fetal bovine serum, 5% horse serum and 1% antibiotics or neurobasal medium (invitrogen, cat no . To induce neurite outgrowth, pc12 cells were seeded at a density of 40% on the cover glass and treated with nerve growth factor (ngf, invitrogen,) at 50 ng / ml for 7 days with replenishment of ngf every two days . For primary neuronal culture, rat e17 primary dissociated hippocampal neurons were prepared and cultured as previously described (shin et al ., 2008). The indicated plasmids and/or sirnas were transiently transfected by lipofectamine 2000 (invitrogen) at the third day of ngf treatment for pc12 cells or at the fifth day after seeding of primary neuronal cells . The amounts of plasmids for transfections were as follows: 4 g for transfection of lrrk2 or shlrrk2 plasmids, 2 g for transfection of rab5 plasmids, 4 and 1 g for cotransfection of lrrk2 or shlrrk2 and rab5 plasmids, respectively, or 100 nm for all sirnas . If necessary, the amounts of plasmid dnas were kept constant at 5 g by addition of vector plasmids . Cells were fixed for microscopic analysis after incubation for 7 more days . To test protein expression level, pc12 cells were transiently co - transfected with the indicated plasmids and pmacs4.1 expressing cd4 (miltenyi biotec, bergisch gladbach, germany) and harvested after 2~3 days of incubation . Co - transfected cells were sorted by macs (magnetic - activated cell sorting, miltenyi biotec, bergisch gladbach, germany). Macs utilizes cd4 antibodies coupled to micromagnetic beads which specifically detect cd4 expressed on the surface of transfected cells . A magnetic field was applied to sort cells bound to the cd4 antibodies with magnetic beads . To identify transfected cells with lrrk2 and/or rab5, cells were stained with antibodies against the corresponding proteins or their specific fusion tags . To detect over - expression of lrrk2 or rab5, antimyc (sigma, cat no . F3165) antibodies were used, respectively . To detect cells transfected with shlrrk2 plasmids or rab5 sirnas, anti - lrrk2 (norvus, cat no . 300 - 268) or anti - rab5 (santa cruz, cat no . Sc-598) antibodies were used, respectively, and cells expressing the corresponding proteins at low level in comparison to neighboring cells were selected for neurite analysis (fig . 1). In addition, to identify cells transfected with sirnas, shdna or vector plasmids alone, gfp plasmids were co - transfected and gfp antibodies (a gift from dr . A11001) or alexa 555 goat anti - rabbit igg (molecular probe, cat no . To analyze neurite outgrowth patterns, transfected and immunostained cells for all samples were observed under a fluorescence microscope (olympus model bx61) set up under the same condition . Then, every cell in the images satisfying the experimental conditions such as over- or down - expression of specific proteins was selected for further neurite analysis . The selected cells' total and the longest neurite lengths were analyzed using a computer - assisted image analysis program [meta - morph software program, molecular devices, downingtown, pa, usa (klimaschewski et al ., 2002)]. Values for each cell's total and the longest neurite lengths were divided by its cell body diameter to compensate differences of their soma sizes since cells with larger cell bodies generally contain longer neurites . From these values, the average and the standard error of the mean (sem) for each experimental condition were calculated and shown as relative values to the vector control . Since the data pattern of the total and the longest neurite lengths were very similar to each other, only the pattern of the total neurite length is shown . To address whether lrrk2 and rab5 coordinately regulate neurite outgrowth, we cultured ngf - treated pc12 cells with a combination consisting of over- or down - expression of lrrk2 and/or rab5 . The resulting cells were analyzed by immunofluorescence using anti - lrrk2 and/or anti - rab5 antibodies . When necessary, anti - gfp or other specific antibody was used to identify transfected cells . A representative immunostaining pattern for each condition is shown in fig . 1 and quantitative analyses of neurite lengths of transfected cells we assessed neurite outgrowth according to two factors, total lengths of neurites and the longest neurite length of each counted cell using metamorph, a computer - assisted program . Analyses using these two factors revealed that both neurite length patterns were similar to each other . We observed that pc12 cells over - expressing the lrrk2 pathogenic mutant, g2019s, had dramatically reduced neurite length while pc12 cells over - expressing the wild type lrrk2 modestly reduced neurite length (fig . When over - expressed, another pathogenic mutant r1441c exhibited neurite length between those of wt and g2019s (fig . As previously reported, down - regulation of lrrk2 expression by specific shlrrk2 plasmids enhanced neurite outgrowth (fig . Our results corroborate previous studies performed with rat primary cultures (macleod et al ., 2006) and human neuroblastoma sh - sy5y cells (plowey et al ., 2008). In addition, our results showed that over - expression of rab5 strongly inhibits neurite outgrowth, in agreement with a previous study [fig . Our side - by - side comparison showed that the inhibitory effect by rab5 was much greater than that by lrrk2 wild type (wt) and was similar to that by g2019s (fig . 1 & 2). In addition, rab5 sirna showed little difference from the vector control in neurite length (fig . Notably, when both of lrrk2 and rab5 were over - expressed, they exhibited neither additional nor synergistic effect on neurite length . Instead, the extent of reduction in neurite lengths was similar to that by lrrk2 over - expression alone (fig . This finding suggests that these two proteins functionally interact and co - regulate neurite outgrowth, which is further supported by co - localization of these over - expressed proteins in both cell body and neurites [fig . Next we tested the effect of over - expressing one protein while knocking down expression of the other . Toward this, we used rab5 sirna-1 (sirab5) and shlrrk2 plasmid, a plasmid containing a short - hairpin rna (shrna) sequence against lrrk2 (origene), to down - regulate rab5 and lrrk2, respectively . As shown in fig . 1c, these methods efficiently knock - down the expression of the corresponding proteins in pc12 cells . As control, we confirmed that either gfp sirna or shgfp plasmid did not detectably affect neurite outgrowth by immunoflulorescence staining and computer analysis (fig . 3 and data not shown). Cells transfected with either mixture of myc - lrrk2 plasmids and rab5 sirnas or mixture of flag - rab5 and shlrrk2 plasmids, were identified by staining with antibodies against myc and rab5, or lrrk2 and flag, respectively (fig . Cells exhibiting over - expression of one protein and simultaneously reduced expression of the other protein were selected and analyzed for neurite lengths . Cells over - expressing lrrk2 with down - expression of rab5 showed no significant differences from cells over - expressing both lrrk2 and rab5 in terms of neurite length (fig . In contrast, cells over - expressing rab5 with down - expression of lrrk2 showed neurite length shorter than cells down - expressing lrrk2 alone and much longer than the cells over - expressing rab5 alone (fig . 1 and fig . 2 lanes 5, 6 & 10). Taken together, our results indicate that lrrk2 expression level more critically determines neurite length than the rab5 expression level . Rab5 is a member of a small gtpase family recycling between active gtp- and inactive gdpbound forms . The active rab5 negatively regulates neurite outgrowth (liu et al ., 2007). To investigate how the active or inactive status of rab5 affects neurite outgrowth regulated by lrrk2, we utilized the rab5b's constitutively active q79l and the dominant negative n133i proteins and performed an extensive analysis (fig . 3). In agreement with the previous study, in ngf - treated pc12 cell, overexpression of q79l and n133i proteins showed reduction and extension of the neurite outgrowth, respectively [fig . 3, lanes 3 & 4 (liu et al ., 2007)], although the neurite length differences among samples in this particular set were smaller than the one observed in fig . 2 (compare lanes 1, 6 & 8 in fig . 2 to lanes 1, 2 & 7 in fig . It is interesting that rab5 sirnas showed neurite length similar to that of the vector control or the sigfp control whereas cells expressing rab5 n133i considerably extended their neurite lengths (fig . 3, lanes 1, 4, 5 & 6). This may indicate that the active status, but not the concentration, of rab5 is critical for regulation of neurite outgrowth . When either lrrk2 wt or g2019s was co - expressed with one of rab5 wt, constitutively active and dominant negative forms, their neurite lengths were similar to those of cells expressing either lrrk2 wt or g2019s protein alone, respectively, regardless of which form of rab5 was co - expressed (fig . This was also the case when sirab5 was used instead of over - expression of rab5 (fig . 3, lane 5, 6 vs lanes 10, 11 & 15, 16). This is striking in that lrrk2 can disable rab5's active signal to regulate neurite outgrowth . In contrast, cells down - regulating lrrk2 while over - expressing rab5 wt or q79l exhibited neurite length of each sample in the middle between the one observed under downregulation of lrrk2 alone and the one seen with over - expressing the corresponding rab5 alone (fig . Down - regulation of lrrk2 with rab5 n133i over - expression resulted in shorter neurite length than down - regulation of lrrk2 alone and over - expression of rab5 n133i alone, both of which showed considerable extension of neurite (fig . 2, lane 5). No additional or synergistic effect by combination of down - regulation of lrrk2 with rab5 n133i over - expression was observed, suggesting again co - regulation of neurite outgrowth by lrrk2 and rab5 . It is not clear why cells down - expressing lrrk2 with rab5 n133i over - expression showed no difference from vector control instead of extension in neurite length . 3 strongly suggests that both cellular concentration and kinase activity of lrrk2 are important for negative neurite outgrowth co - regulated by rab5 . Furthermore, we carried out a similar set of functional analyses using hippocampal e17 primary neuronal cells over - expressing lrrk2 with over- or down - expression of rab5 and found similar patterns of neurite outgrowth regulation as those in pc12 cells (fig . 2 & 4). Specifically, neither overnor down - expression of rab5 showed any difference in neurite length as long as lrrk2 was co - expressed (fig . 4 lanes 5 & 6). However, the over - expression of lrrk2 with over- or down - expression of rab5 in primary neuronal cultures resulted in relatively shorter neurites than over - expression of lrrk2 alone (fig . 4 lanes 2, 5 & 6) whereas the same sets in pc12 cells resulted in neurites similar to or slightly longer than that when lrrk2 alone was over - expressed (fig . 2 & 3). It may be due to differences of cell types used or of protocols to induce neurite outgrowth . However, the results here strongly suggested that, as long as lrrk2 was over - expressed, the identity or cellular concentration of rab5 was not critical to regulate neurite outgrowth . Taken together, our results suggest that lrrk2 and rab5 co - regulate neurite outgrowth and lrrk2 is a more critical factor than rab5 to determine the neurite length . In this study, we confirmed previous findings that lrrk2, especially lrrk2 g2019s, and rab5 negatively regulate neurite outgrowth (macleod et al ., 2006; liu et al . Our data also showed that lrrk2 wt decrease neurite length although the effect is less prominent than that of g2019s . Lrrk2 wt's effect on neurite length was ill defined in previous reports (macleod et al ., 2006; plowey et al ., in addition, there is also a report that lrrk2 wt transgenic mice exhibited no difference in neurite length from that of non - transgenic control mice (parisiadou et al ., 2009). It might be due to difference of cell lines used in each study . In this report, we provide several lines of evidence suggesting that rab5 and lrrk2 co - regulate neurite outgrowth and that lrrk2 is a more critical factor than rab5 . Firstly, over - expression of both proteins clearly showed no additional or synergistic effect (fig . While rab5 either wt or q79l over - expression shortened neurites significantly greater than lrrk2 wt, co - expression of rab5 with lrrk2 wt proteins reduced neurite lengths similar to those observed with lrrk2 alone (fig . 2 & 3). In fact, co - expression of lrrk2 wt or g2019s with one of the rab5 (wt, q79l and n133i) exhibited a pattern of neurite length similar to the one observed with lrrk2 wt or g2019s expression alone regardless of rab5's identity (fig . This was more striking when compared with co - expression of lrrk2 wt or g2019s with rab5 n133i to rab5 n133i over - expression alone . The cells co - expressing lrrk2 wt or g2019s with rab5 n133i reduced neurite length to the level of the corresponding lrrk2 over - expression alone whereas the cells over - expressing rab5 n133i alone considerably extended neurite lengths (fig . Secondly, down - expression of rab5 using rab5 sirna did not affect neurite lengths (fig . 2 & 3). Thirdly, down - regulation of lrrk2 expression with over - expression of rab5 overrided the over - expression effect of rab5 wt or of its constitutively active q79l, resulting in longer neurites compared to over - expression of corresponding rab5 alone, but shorter than down - regulation of lrrk2 alone (fig . 2 & 3). This suggested that when cellular lrrk2 concentration was low, rab5 could partially function as a regulator of neurite outgrowth . Taken together, our results suggest that regulation of neurite outgrowth via lrrk2 and rab5 is not effected independently, but possibly through a shared mechanism . Recently, we have reported that lrrk2 overexpression decreases the endocytosis rate of synaptic vesicles (shin et al ., 2008). Since lrrk2 also inhibits endocytosis of the ngf receptor, trka, which is the first step of neurite outgrowth following ngf treatment, it corroborates the fact that lrrk2 over - expression negatively regulates neurite outgrowth . In addition, rab5 inactivation appears to be essential for endosomes containing trka to become signaling endosomes whose signals result in neurite outgrowth (liu et al ., 2007). Since lrrk2 overexpression with combination of different form of rab5s resulted in neurite length similar to that of lrrk2 expression alone regardless of either cellular concentration or active status of rab5 (fig . 2~4), lrrk2 might function in other steps following endocytosis of trka - containing vesicles and inhibit the negative effect of rab5 . This notion is further supported by the previous reports showing that inhibition of neurite outgrowth, but not of endocytosis, is dependent on the active level of lrrk2 kinase (macleod et al . In other words, over - expression of the lrrk2 g2019s mutant, expressing kinase activity stronger than that of wild type induced shorter neurites, but no apparent difference in endocytosis rate compared to wild type (macleod et al ., 2006; shin et al ., 2008). It may be interesting to investigate whether lrrk2 kinase and/or gtpase activity regulates rab5 activity via signal transduction . A small gtpase protein is active as a signal transmitter only when it binds to gtp . The binding of the gtpase protein to gtp or gdp is facilitated by gef (guanine nucleotide - exchange factors) or gap (gtpase activating protein), respectively . Recently, homodimerization of the gtpase protein has been reported as another mechanism to activate gtpase protein without gef (gasper et al ., 2009). In fact, both lrrk2 and rab5 contain an active gtpase domain and homodimerizations of both rab5 and lrrk2 were reported (daitoku et al ., 2001; since lrrk2 and rab5 interact with each other (shin et al ., 2008) it is possible that their interaction interrupts signal transmission by the gtpase domain of rab5 but still maintains lrrk2's kinase activity that regulates neurite outgrowth . Another possibility is that lrrk2 kinase phosphorylates rab5, resulting in rab5's conformational change and activity.
Recent papers by and show the application of fractional calculus to pharmacokinetics (pk). Leffler function: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e_{\alpha} \left (z \right) = \sum\limits_{i = 0}^{\infty} {{\frac{{z^{i}}} {{\upgamma \left ({\alpha i + 1} \right)}}}} $$\end{document}in place of the mono - exponential:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e^{z} = \sum\limits_{i = 0}^{\infty} {{\frac{{z^{i}}} {i!}}} = \sum\limits_{i = 0}^{\infty} {{\frac{{z^{i}}} {{\upgamma \left ({i + 1} \right)}}}} = e_{1} \left (z \right) $$\end{document}if drug is given as a bolus dose in a venous site, drug concentration in plasma at a time t after the dose administration, c(t), can be represented using a response function of the form:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$c(t) = dose \, \left [{\theta e_{\alpha} \left ({- \lambda t^{\alpha}} \right)} \right] $$\end{document}where dose is the amount of drug given, and 1 have the interpretation of the elimination rate constant and the reciprocal of volume of distribution of the plasma compartment, respectively, if model (3) is seen as solution corresponding to a single compartment model described by a (caputo) fractional differential equation of order, see, e.g., [5, 6]. The paper of shows solutions for some specific two- and three - compartmental structures described by fractional order kinetics . However, as pointed out by, while the connection between response function and compartmental structure is immediate for the single compartment case, this is less so for the case of multi - compartmental ones . The purpose of this communication is to discuss this connection, and to do so we will (1) clarify the distinction between different types of systems of fractional differential equations, in particular discussing the difference between commensurable and non - commensurable ones, (2) show solutions for the corresponding response functions, and (3) discuss their application to the modeling of pk data . Commensurate fractional order linear systems are described by a system of linear fractional differential equations (fde) of the form: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\frac{{d_{\blacktriangle} ^{{^{\alpha}}}}} {{{\text{d}}t}}}{\mathbf{x}}(t) = \left ({\begin{array}{*{20}c} {{\frac{{d_{\blacktriangle} ^{{^{\alpha}}}}} {{{\text{d}}t}}}x_{1} (t)} \\ \ldots \\ {{\frac{{d_{\blacktriangle} ^{{^{\alpha}}}}} {{{\text{d}}t}}}x_{m} (t)} \\ \end{array}} \right) = \left ({\begin{array}{*{20}c} {a_{11}} & \ldots & {a_{1 m}} \\ \ldots & \ldots & \ldots \\ {a_{m1}} & \ldots & {a_{mm}} \\ \end{array}} \right){\mathbf{x}}(t) + {\mathbf{f}}(t) = a{\mathbf{x}}(t) + {\mathbf{f}}(t) $$\end{document}with initial conditions\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathbf{x}}(0) = {\mathbf{x}}_{0} $$\end{document}, where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$d_{\blacktriangle} ^{{^{\alpha}}} $$\end{document} is the caputo fractional differential operator of order> 0, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathbf{f}}(t) $$\end{document}is the (vector valued) input function to the system . These systems are called commensurate because all the differential equations are of the same fractional order, . As a consequence t can be shown that the solution to the system of fde represents the entire state of the system at any given time . In particular, a compartmental system can be obtained, for 0 <1, exactly as for a system of ode, by introducing mass - balance constrains:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$a_{ji} \ge 0,\quad i \ne j $$\end{document}and the following:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}c} {\text{a}}_{ii} \le 0 \\ \left| {{\text{a}}_{ii}} \right|\ge \sum\limits_{\begin{array}{l} j = 1 \\ j \ne i\end{array}} ^{m} {a_{ji}} \hfill \\ \end{array} $$\end{document}which guarantee that all states are non - negative . It can be shown (see e.g.) That the solutions to the system of linear fde (4) depend on the eigenvalues of its characteristic equation, that is, in the laplace domain, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\det \left ({b(s) = a(s) - si} \right) $$\end{document}. In particular if the eigenvalues are real and distinct the solution to eq . 4 takes the form1:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathbf{x}}(t) = b_{1} {\mathbf{u}}_{1}^{(1)} e_{\alpha} (\lambda_{1} t^{\alpha}) + b_{2} {\mathbf{u}}_{2}^{(2)} e_{\alpha} (\lambda_{1} t^{\alpha}) + \cdots + b_{m} {\mathbf{u}}_{m}^{(m)} e_{\alpha} (\lambda_{1} t^{\alpha}) $$\end{document}where b1, b2,, bm are constants, 1, 2,, m and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathbf{u}}_{1}^{(1)}, {\mathbf{u}}_{2}^{(2)}, \ldots, {\mathbf{u}}_{m}^{(m)} $$\end{document} are the eigenvalues and eigenvectors of the characteristic equation for (4). It is immediate from (7) that for a bolus input in the j - th compartment the solution for drug concentration in the same compartment takes the form:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$c_{j} (t) = dose\left [{\theta_{1} e_{\alpha} (\lambda_{1} t^{\alpha}) + \theta_{2} e_{\alpha} (\lambda_{2} t^{\alpha}) + \cdots + \theta_{m} e_{\alpha} (\lambda_{m} t^{\alpha})} \right] $$\end{document}which establishes a direct connection with the familiar multi - exponential response function corresponding to ordinary multi - compartment linear systems with distinct eigenvalues . A non - commensurate fractional order linear system is described by: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left ({\begin{array}{*{20}c} {{\frac{{d_{\blacktriangle} ^{{^{{\alpha_{1}}}}}}} {{{\text{d}}t}}}x_{1} (t)} \\ \ldots \\ {{\frac{{d_{\blacktriangle} ^{{^{{\alpha_{m}}}}}}} {{{\text{d}}t}}}x_{m} (t)} \\ \end{array}} \right) = a{\mathbf{x}}(t) + {\mathbf{f}}(t) $$\end{document}where now 1, 2,, m are distinct (real positive) numbers indicating the fractional order for each equation . As remarked by, in reference to the systems of compartments shown in (2), the equations in do not satisfy mass - balance even if conditions (5) are satisfied, and in general the solution to the system of fde (9) does not represent the states of the system . Non - negativity is also no longer guaranteed by the relationships (6) (and there are non - trivial issues associated with demonstrating the stability, observability and reach - ability of such systems, see .) Numerical methods must be employed to find the solution to (9), since a close form solution equivalent to (7) does not exist [10, 11]. However, solutions can be obtained if is assumed that the fractional orders are rational numbers, that is i = pi / qi where pi, qi are integers, i = 1,, m (12).2 the mathematics necessary to obtain the general solution are quite involved, and for the purpose of this paper we only show a subset of the possible solutions, in particular for c(t) (see [1113] for more general results). For a non - commensurate system, it can be shown that a solution for drug concentration in the j - th compartment takes the form:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$c_{j} (t) = dose\left\ {{t^{{\gamma - \alpha_{j}}} \left [{\theta_{1} e_{{\gamma, \gamma - \alpha_{j} + 1}} (\lambda_{1} t^{\gamma}) + \theta_{2} e_{{\gamma, \gamma - \alpha_{j} + 1}} (\lambda_{2} t^{\gamma}) + \cdots + \theta_{m} e_{{\gamma, \gamma - \alpha_{j} + 1}} (\lambda_{m} t^{\gamma})} \right]} \right\} $$\end{document}where = 1/q, q = m.c.d(q1,, qm), and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e_{\alpha, \beta} \left (z \right) = \sum\limits_{i = 0}^{\infty} {{\frac{{z^{i}}} {{\upgamma \left ({\alpha i + \beta} \right)}}}} $$\end{document} is the two - parameters mittag leffler function (5). One notices two important facts: first, this solution only depends on the fractional order for compartment j, j, and, second in direct analogy to the solution (8) above, the mittag leffler function exponents are determined by the eigenvalues of the characteristic equation for the system . We now have the ingredients to show a simple example of applications of multi - terms mittag leffler response functions to fit pk data . We consider the case m = 2, which for a standard ode system generates the response function:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$c(t) = dose\left ({\theta_{1} e^{{\lambda_{1} t}} + \theta_{2} e^{{\lambda_{2} t}}} \right) $$\end{document}for a commensurate fde system obtains:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$c(t) = dose\left ({\theta_{1} e_{\alpha} (\lambda_{1} t^{\alpha}) + \theta_{2} e_{\alpha} (\lambda_{2} t^{\alpha})} \right) $$\end{document}and for a non - commensurate fde system\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$c(t) = dose \, t^{\gamma - \alpha} \left ({\theta_{1} e_{\gamma, \gamma - \alpha + 1} (\lambda_{1} t^{\gamma}) + \theta_{2} e_{\gamma, \gamma - \alpha + 1} (\lambda_{2} t^{\gamma})} \right) $$\end{document}the parameters 1, 2, 1, 2,, are estimated from the data, with the constraints 1, 2> 0, 1, 2 <0, and 0 <, 1, which guarantee that eq . 13 is non - negative and non - increasing (strictly monotone) for t 0.3 to evaluate the single and two - parameters mittag leffler function we implemented a fortran 90 version the algorithm reported in . We used the computer program nonmem to obtain the parameters estimates . As a check, fig . 11 of, = 1 and 0 <2 . Contrary to, which has a strong influence on the overall shape of the curve, the parameter has its most pronounced influence on the value of the function at t = 0.fig . 1the mittag leffler function e,(t) for = 1 and (0, 2) the mittag leffler function e,(t) for = 1 and (0, 2) figure 2 shows the fit of models (11) (solid line), (12) (widely dashed line), and (13) (dashed line), to error corrupted data simulated using an eight compartments mammillary model . Note the added flexibility introduced by use of a sum of single- and two - parameters mittag leffler functions in respect to exponentials: the values of minus twice log - likelihood for the fit of the simulated data were 316.895, 381.974, and 406.354, for models (11)(13), respectively . Of course, this is just an example to show the feasibility of the approach: for this simulation, a sum of exponentials would fit the simulated data perfectly well.fig . 2simulated data (circles) with superimposed the fit of the response function for a second order ordinary system, eq . 11 in the text (solid line), commensurate fde, eq . 12 (widely dashed line), and non - commensurate fde, eq . 13 (dashed line) simulated data (circles) with superimposed the fit of the response function for a second order ordinary system, eq . 11 in the text (solid line), commensurate fde, eq . 12 (widely dashed line), and non - commensurate fde, eq . 13 (dashed line) following up on the papers of and, and the commentary by, the first purpose of this commentary is to further clarify the nature of systems of fde, and in particular to point out the distinction between commensurate and non - commensurate ones . Commensurate systems of fde have a direct relationship with system of ode, and in particular when formulated in terms of compartmental models (that is, satisfying mass balance and non - negativity constraints, see eqs . 5, non - commensurate systems of fde do not, in general, represent the state of a system . Leaving to the side the issue of what exactly system (9) represents, one is still justified in using it as a black - box type model for single - input / single - output experiments, as long as physical constraints (non - negativity in particular) are satisfied . To do so response functions are a convenient tool, and we show that, for commensurate and non - commensurate fde, relatively simple ones can be derived which satisfy such requirements . The solutions for a system of commensurate fde takes the form of the sum of mittag leffler functions, with a single parameter, eq . 8, while solutions for a system of non - commensurate fde can be expressed by a sum of two - parameters mittag leffler functions, such as eq ., one can establish a direct analogy between the familiar sum of exponentials used in pk, and importantly all the relationships between compartmental transfer rate constants and the intercepts and exponents of the corresponding response functions found in classic textbooks on pk [17, 18], carry forward to fractional differential equations . In conclusion, while insight into the physiological interpretability of fde system might be gained in the future, and the formulation of non - commensurate systems of fde to represent the states of a system (required by, e.g., a physiological flow model) requires further investigation, the response functions (8) and (10) can be used to investigate the existence of pk data sets which might actually show complex fractional kinetics.4
Systemic lupus erythematosus (sle) is an autoimmune disease that is typified by multiple abnormalities of the immune system, and which results in widespread pathology of multiple organs, including skin, kidney, heart, lungs, and joints . In addition to peripheral organ dysfunction in sle, there is a high incidence of neuropsychiatric symptoms especially headaches, cognitive dysfunction, and psychiatric disorders, with roughly 4070% of sle patients demonstrating affective disorders . Brain pathology, loss of integrity of the blood - brain barrier and autoantibodies are thought to play a role in neuropsychiatric systemic lupus erythematosus (np - sle), although some patients with behavioral symptoms have histologically normal brain tissue and no identifiable markers in serum or csf [311]. Neuropsychiatric symptoms, particularly affective disorders, may be among some of the earliest manifestations of sle [1214]. Approximately 40% of the np - sle symptoms develop before the onset of sle or at the time of diagnosis and about 60% within the first year of diagnosis [13, 15, 16], indicating that neuropsychiatric symptoms are reliable indicators of disease activity and are often evident even before gross peripheral organ pathology occurs (in particular kidney disease). Symptoms of np - sle may also be independent of active disease in other organs [1719]. This was found to be the case also in the animal model of lupus which is the subject of this paper, the mrl / lpr mouse, where depressive - like behavior is evident in young animals before significant levels of autoantibody titers and nephritis are evident [14, 20]. There are obvious limits to the search for mechanisms of cns disease in human patients, and furthermore the diagnosis is often made after lupus is in late stages of progression . Thus, murine models can offer many advantages to elucidate the early mechanisms of neuropsychiatric manifestations of np - sle and help to distinguish between cns - specific mechanisms and nonspecific illness . In this paper we focus on a specific murine model of lupus, the mrl / lpr strain, and the ways in which this model reflects some of the most common manifestations of human np - sle . In addition, we discuss experimental data pointing to viable pathogenic mechanisms that underlie cns involvement in sle . Excellent reviews about other aspects of this and other murine models of lupus can be found elsewhere [3, 11, 2134]. To best represent human disease and explore relevant translational aspects of pathogenesis and novel treatment approaches, it is crucial to identify the most appropriate animal model from among the several available mouse strains which spontaneously develop lupus - like disease . Although there are induced models of sle in nonautoimmune mouse strains, organ involvement as a rule is less severe than that observed in genetically susceptible animals [35, 36]. Therefore, spontaneous lupus models are often preferred for modeling of lupus - associated neuropsychiatric or other target organ disease . Murine models that spontaneously develop hallmark diagnostic signs of sle include nzb nzw f1, nzm2410, bxsb, and mrl / lpr mouse strains . All of these strains (to a varying degree) develop lymphoid hyperplasia, b cell hyperactivity, autoantibodies, circulating immune complexes, complement consumption, and glomerulonephritis . These strains differ from human sle in that they display a high penetrance and relatively uniform disease expression over time . However, the disease course in murine lupus models (in the absence of extraneous intervention) is progressive, in contrast to the fluctuating course of flares and remissions typical in human sle [26, 27, 37]. Although many of the spontaneous models of sle develop behavioral abnormalities at some point in the disease, the mrl mouse model has some advantages in the investigation of specific cns dysfunction and np - sle . First, nzb- and bxsb - derived strains of mice have a high incidence of inherited brain anomalies which can confound the assessment of autoimmunity - induced brain damage and the links between lupus - like disease and behavioral changes . Thus the mrl / lpr model permits the examination of interrelationships between behavioral outcomes and their underlying mechanisms without the potential confound of pre - existing cns abnormalities [3840]. As human sle is overwhelmingly more common in females (about a 9: 1 female to male ratio), mouse models that reflect this sex bias, such as mrl / lpr, are also likely to be useful in elucidating the relationship of hormones, negative outcomes, and potential sex - differences in efficacy of therapeutic agents in autoimmune disease . Mrl / lpr mice also express cardiolipin autoantibodies, one of a class of antiphospholipid autoantibodies thought to be important in the development of behavioral outcomes and cns damage [4345]. Although the molecular defect in the fas gene underlying abnormal b cell regulation in mrl / lpr mice is not believed to be a cause for human sle [46, 47], it is clear that the b cell dysregulation that characterizes this murine model is also a critical pathological aspect of human sle [48, 49]. Moreover, the early onset, rapid progression, and other similarities to the human disease state in mrl / lpr mice are also useful features of this model . The mrl lymphoproliferation strain (lpr) mrl / tnfrsf6 lpr / lpr (a.k.a . Mrl / lpr) differs from the congenic (control) mrl/+ strain by a defect in membrane apoptotic - signaling fas protein, which is due to a retrotransposon in the fas gene [50, 51]. In addition to the typical signs of peripheral sle, including autoantibodies, skin disease, arthritis, lymphadenopathy, and nephritis, mrl / lpr mice develop a constellation of behavioral outcomes referred to as autoimmunity - associated behavioral syndrome, particularly in the behavioral domains of emotional reactivity, motivated behavior, and cognitive function [14, 20, 22, 24, 33, 5275]. Nervous system involvement in lupus can include seizures, stroke and other cerebrovascular events, psychosis, cognitive dysfunction, and notably a very high incidence of mood disorders, particularly anxiety and depression [2, 18, 7678]. Estimations of the prevalence of np - sle in human lupus range from 15% to 75% (or higher), reflecting variable diagnostic methodologies, a lack of standard criteria, and the sensitivity of diagnostic instruments to assess various behavioral outcomes [1, 2, 79]. Furthermore, many clinical studies of np - sle address only the most severe cns symptoms, such as seizure, psychosis, and stroke, thus both the prevalence and importance of other neuropsychiatric symptoms are often underestimated . Generally, when specific and well - validated cognitive and affective diagnostic batteries are administered, rather than simple quality of life exams, studies consistently indicate that a great majority of sle patients have some cns outcomes, particularly mood disorders and cognitive dysfunction . Np - sle is a major determinant of morbidity and mortality and is associated with increased disease severity, poorer prognosis and earlier mortality [8085]. Furthermore, np - sle can necessitate potent and long - term immunosuppressive treatment with attendant side effects, is a detriment to quality of life in lupus patients, may be a major factor in employment disability, and substantially increases the financial and emotional costs of sle [86, 87]. Comprehensive reviews of np - sle manifestations, diagnosis, pathology, and treatment in humans are outside the scope of the paper, and can be found elsewhere [2, 4, 9, 8894]. As in humans, development of sle in mrl / lpr mice the most robust and reproducible deficits in mrl / lpr mice are emotional dysfunction, particularly in assays of depressive - like behavior such as the forced swim test and anhedonia . The forced swim test [95, 96] assesses behavioral despair as the proportion of immobility when rodents are placed in a tank of water [97, 98]. Normal rodents placed in a narrow tank of water from which there is no escape will exhibit vigorous swimming and struggling activity for the duration of the test (typically 612 minutes) and only rarely adopt a characteristic immobile posture (floating). In contrast, animals treated with either pharmacological agents (such as hormones or via depletion of the amino acid tryptophan necessary to make serotonin [99, 100]), environmental manipulations (unpredictable chronic stress, social isolation [101103]), or genetic alterations (flinders strain, sert knockouts [104, 105]) thought to be important in the etiology of depression more rapidly become immobile and maintain this immobility for a significantly great proportion of time than control subjects . The forced swim test has been extensively validated, as immobility is reduced by a wide range of clinically active antidepressant drugs and has predicted the antidepressant efficacy of novel therapeutic agents . Mrl / lpr mice develop depression - like behavior in the forced swim test as early as 5 weeks old, and this persists throughout the course of the disease [14, 20, 58, 65]. In addition to feelings of helplessness and despair, depressed patients report anhedonia the inability to experience pleasure or reward from events that normally have a positive hedonic value, such as eating, social interaction, or sexual activity . In rodents, a commonly used measure of anhedonia is the failure to prefer sweet solutions [107, 108]. Mrl / lpr mice exhibit this lack of normal preference for sweet solutions as early as 5 - 6 weeks old and continue to exhibit anhedonia during the active disease phase (4 - 5 months old) [52, 53, 55, 109]. Further symptoms of depression - like behavior include decreased activity, fatigue, and apathy . In rodents, this can be assessed as decreased voluntary activity and exploration in a novel environment, such as an open field . Mrl / lpr mice exhibit reduced exploration and activity during both the nocturnal and diurnal phases [63, 65] by 811 weeks old [14, 33]. Despite the high prevalence of depression in lupus patients and recent evidence that antidepressants may reduce symptoms of depression, in part, by reducing inflammatory responses [111, 112], there have been few studies investigating the efficacy of antidepressant therapies in human lupus or in murine models . Immunosuppressive agents typically used to treat sle, such as cyclophosphamide and steroids, do reduce measures of depression - like behavior in mrl / lpr mice [33, 55, 59, 114] and also typically reduce the other hallmarks of sle, including autoantibody titers, proteinuria (nephritis), and the levels of proinflammatory cytokines [55, 59]. However, there have been few systematic studies to determine if these are effective at reducing measures of np - sle, especially cognitive and affective dysfunction, in humans . Several studies indicate that high levels of both affective and cognitive disorders are present and persistent in np - sle patients undergoing such therapies [115, 116], though these traditional immunosuppressive agents do seem to be effective to prevent and/or treat the more severe np - sle outcomes, such as seizure and cerebrovascular events [13, 117, 118]. Anxiety disorders are also common in np - sle [1, 119] and are often comorbid with depressive disorders . Several commonly used methods can be applied to assess anxiety in rodents, and these include the elevated plus maze and the acoustic startle test [120127]. The elevated plus maze (epm) essentially assesses a preference between a comparatively safe environment (the closed arms) and a risky environment (elevated open spaces). The general principle is that the more anxious the subjects are, the less likely they will be to explore the open arms . The epm has been validated pharmacologically, with other tests of anxiety - like behaviors, and physiologically [120123]. With respect to anxiety in murine models of lupus, some groups have reported increased anxiety in mrl / lpr mice assessed in the elevated plus maze, while others have reported that mrl / lpr mice have normal or less anxiety than mrl/+ controls [14, 20, 70]. The lack of anxiety phenotype is also supported by a generally lower startle reactivity till 11 weeks old . There is also no clear consensus with respect to cognitive dysfunction in murine models of lupus . Mild spatial memory deficits have been reported in the water maze, assessed as the latency to find a new platform position after previous training in the water maze and as deficits in linear maze acquisition as early as 8 weeks . However, behavior in the object placement and novel object recognition tasks [128130] is normal [14, 20]. The predominance and reproducibility of affective dysfunction in mrl / lpr mice are consistent with known pathology and/or dysfunction in several neurotransmitter systems and brain regions important in the regulation of mood . These include altered responses to the dopaminergic drugs amphetamine and apomorphine [52, 109, 132] and higher levels of apoptosis in the dopaminergic neurons in the nucleus accumbens and substantia nigra (thought to be involved in response to reward and anhedonia) in mrl / lpr mice [52, 109]. There are also decreased levels of serotonin in brain regions such as the hypothalamus, which regulate stress and response to appetitive stimuli (among other things), and increased levels in the hippocampus . This observation is consistent with altered serotonin levels in lupus patients similar to those that occur in depressed patients [134136], including those in which depression has been induced by cytokine therapy [137139]. Decreased levels of noradrenaline evident in the prefrontal cortex of mrl / lpr mice would also be consistent with depressive - like behavior [58, 140142]. There is also a fascinating accidental experimental difference in mrl / lpr mice . Over time, this strain of mice displayed a lessening of symptoms such as lymphoproliferation, a greatly delayed development of nephritis, and a longer lifespan . The line was eventually reconstituted and again manifests rapid development of the typical severe autoimmune profile (http://jaxmice.jax.org/: re - coding of stock #485-attenuated disease to stock #6825-reconstituted severe line). This serendipitous circumstance permits the differentiation between negative behavioral outcomes that may result from gross peripheral pathology and specific cns - mediated behaviors [14, 143]. A major difference in the disease - attenuated line is the long delay to develop renal disease and profoundly decreased proteinuria [14, 20]. The levels of autoantibodies tend to increase earlier and to a greater extent in the reconstituted severe line . Furthermore, the disease - attenuated line has normal open field activity from 8 to 18 weeks while in the reconstituted severe line, the females have lower activity levels from 5 weeks, although mrl / lpr males exhibit normal open field activity until at least 18 weeks old [14, 20]. Cognitive functions assessed in novel object exploration and placement tasks were normal in mice 518 weeks old in both sexes and both lines [14, 20]. Motor coordination in the balance beam and anxiety in the elevated plus maze were also comparable in both lines from 5 to 18 weeks old [14, 20]. Interestingly, there was no evidence of social withdrawal assessed in the social preference test in either line from 5 to 18 weeks compared to age- and sex - matched controls [14, 20]. However these results were likely due to the very low social preference evident in both mrl/+ female controls and female mrl / lpr mice . It is thus not clear if social withdrawal, a typical symptom of affective disorders, is evident in the mrl / lpr females due to sle or if there is some influence of the background strain that induces social withdrawal by some other route in females . Depression - like behavior is robustly evident in disease - attenuated line in the forced swim test by 8 weeks and in reconstituted severe line by 5 weeks, although earlier time points were not tested in the disease - attenuated line . Given that there is no evidence of kidney pathology in the disease - attenuated mice, these data confirm the robustness of emotional dysfunction and provide further support that such outcomes are likely a primary manifestation of autoimmunity rather than arising from nonspecific illness and peripheral organ pathology . Finally, the presence of two mrl / lpr strains that share a mutated fas yet which differ in their autoantibody profile and neurobehavioral manifestations [14, 143] is strong evidence that the cns manifestations in these mice are primarily immunologically mediated, rather than resulting from possible effects of abnormal fas - mediated apoptosis on brain development or glial function . These include b cell / autoantibody - mediated nervous system compromise, immune complex deposition, vasculitis, microthrombosis and vasculopathy, aberrant mhc class ii antigen expression with t - cell mediated disease, autoactivated t - cells, and cytokine - induced brain inflammation [145, 146]. However, as there are multiple and quite disparate expressions of lupus involving the nervous system, it is unlikely that a single mechanism can account for every clinical manifestation of np - sle . As the most common behavioral manifestations of np - sle in both patients and murine models are affective and cognitive disorders, especially in the early stages of sle, we focus on below mechanisms thought to be involved in the etiology of affective and cognitive dysfunction . Mrl / lpr mice express a range of autoantibodies including antinucleosome, antiribosomal antiphospholipid, and phosphoprotein (such as anticardiolipin and antinucleolin) autoantibodies . A critical role of autoantibodies in the etiology of lupus - associated nephritis has been well documented . Nephritogenic lupus autoantibodies initiate immune deposit formation through direct or indirect interaction with glomerular antigens [152, 153] and result in kidney pathology that can be prevented by administration of an immunoglobulin - binding peptide [151, 154]. It has been suggested that autoantibodies reacting with brain antigens may similarly play a role in cns pathology and negative behavioral outcomes in np - sle [90, 155]. Evidence supporting the role of autoantibodies in the pathogenesis of np - sle includes the increased titer of autoantibodies in serum of diseased mrl / lpr mice [156158], which occurs earlier in females [156, 159], consistent with the earlier onset of depressive - like behavior in mrl / lpr females . There is also evidence that some of these serum autoantibodies react with brain antigens [160, 161] and occur in serum of as early as 2 - 3 months old in mrl / lpr mice and in csf as early as 4 - 5 months . Nevertheless, as further discussed below, the fact that behavioral deficits are present before major rises in serum autoantibody titers or detectable breaches in the blood - brain barrier indicates that serum antibodies alone are clearly not the sole important pathogenic factor in np - sle, at least early in the disease . The relationship of serum and csf levels of autoantibodies to the disease process is complex, but it is likely that intrathecal autoantibodies are likely to be more critically related to np - sle than are serum autoantibody titers . Some evidence does suggest a role for serum autoantibody levels in np - sle, as mice with more severe peripheral and behavioral manifestations of sle also have more pronounced changes in hippocampal and cortical morphology and increased indices of cell death [163166]. This can be prevented with doses of cyclophosphamide that reduce serum autoantibody titers, although csf levels of autoantibodies were not assessed . However, igg levels in serum, but not csf, are positively correlated with spleen weight, suggesting that central autoimmune processes are relatively independent from systemic manifestations . This is supported by the fact that the patterns of autoantibody expression in serum and csf is not correlated over time in patients with np - sle . Finally, csf from diseased mrl / lpr mice which was treated to remove cytokines is cytotoxic to cultured cells [71, 169] and was more cytotoxic than serum derived from diseased animals, indicating a primary intrathecal source of cytotoxic autoantibodies . Cytotoxicity in culture was correlated with the extent of apoptosis in the brains of aged lpr mice from which the csf was derived, thus toxic mediators produced by the cns of diseased mrl / lpr mice are likely to be more pathogenic than those in serum the site of production of brain reactive antibodies in mrl - lpr mice is however not conclusively identified, although this remains a subject of intense research interest . Autoantibodies recognizing brain antigens, such as the nmda receptor subtype of the excitatory neurotransmitter, glutamate, are also present in the serum and csf of patients with np - sle [168, 170]. When injected directly into the brain of otherwise healthy mice, or when injected peripherally to animals with a compromised blood - brain barrier, in addition, intrathecal administration of antiribosomal p antibodies induces depression - like behavior in the forced swim test . There have also been reports of positive correlations between serum levels of brain reactive autoantibodies and cognitive dysfunction and depression - like behavior [90, 155, 175] although other studies have failed to find such relationships [61, 161, 176] in patients with np - sle . It has thus been suggested that csf levels of brain - reactive autoantibodies may be more important factors than serum titers to the genesis of np - sle pathology and symptoms [90, 177]. These data further support the notion that cns - derived specific factors and possibly intrathecal production of autoantibodies can lead to brain pathology and corresponding negative behavioral outcomes [52, 162, 169]. However, the blood - brain barrier restricts the influx of circulating factors, including lymphocytes and antibodies, from entering the brain and cerebral circulation . Generally, influx of antibodies or lymphocytes requires disintegration of the blood - brain barrier as general or localized lesions . There is no convincing evidence to date that this occurs as early as the earliest manifestations of the negative behavioral outcomes . Therefore, while it is probable that the loss of integrity of the blood - brain barrier eventually occurs and obviously plays role in the resulting cns pathology [9, 178181], possibly in part by permitting the entry of autoantibodies and antibody - producing cells, negative behavioral outcomes might rather be initiated by different mechanisms than those that regulate pathology in peripheral organs and later onset, more severe symptoms of np - sle . Thus, autoantibodies are possibly not the sole or primarily etiology of several of the symptoms of np - sle, especially given the notable role of cytokines and chemokines in affective and cognitive disorders [182186]. Indeed, several lines of evidence suggest that autoantibodies may not be sufficient to induce np - sle in the mrl / lpr strain . First, increased secretion of chemokines and cytokines (such as interferons) cause inflammatory pathology in kidney [187, 188], even in the absence of autoantibody deposits . Furthermore, the high proinflammatory cytokine levels in mrl / lpr mice are progressive and correlated with increasing disease severity . In fact, numerous anti - inflammatory agents with a wide variety of underlying mechanisms of action increase survival, reduce peripheral organ pathology, and normalize t - cell phenotypes in mice without altering the level of autoantibodies [192197]. However, neuropsychiatric symptoms have not been systematically assessed in most of these studies so it is not clear if there are also similar benefits to behavioral outcomes . Further evidence suggesting that autoantibodies are not sufficient to produce np - sle includes the fact that dna - binding antibodies derived from autoimmune mrl mice fail to induce sle - like changes when administered to healthy animals . Actually, all strains of mice thus far tested show some brain reactive autoantibodies in serum even in the absence of abnormal behavior . Last, mrl / lpr mice that express a mutant transgene that prevents the secretion of circulating igg still develop nephritis despite the lack of soluble autoantibody production, indicating that circulating autoantibodies are neither requisite nor sufficient to induce pathology . Thus, serum antibodies could be neurotoxic, but they can only access brain tissue after a compromise of blood - brain barrier integrity . Furthermore, insults to the blood - brain barrier are likely to be regional rather than global and may occur later in the disease than the onset of robust emotional disturbances . So if brain - reactive autoantibodies are not engendering such symptoms early in np - sle, then what is? Cytokines and chemokines are likely to be critical early factors regulating the negative behavioral outcomes, as they need not pass the blood - brain barrier to regulate neural function [57, 183, 201]. Detection of increased secretion of peripheral inflammatory cytokines can occur across an intact blood - brain barrier, in part via the vagus nerve . This induces glia and microglia to produce cytokines and other inflammatory and cytotoxic agents (including prostaglandins and nitric oxide). These are well documented to elicit the physiological and behavioral symptoms of mood disorders, including lethargy, decreased social interaction, immobility in the forced swim test, and anhedonia [183, 184, 202204]. Finally, cytokines have been linked to depression in humans [205213] and to neuropsychiatric symptoms in np - sle patients [8, 12, 170, 185, 214, 215]. The role of cytokines in emotional disturbances in mrl / lpr mice is supported by numerous studies . In very large samples, the severity of behavioral deficits in mrl / lpr mice does not relate strictly to autoantibody titers or brain infiltration by t cells, which would indicate a compromised blood - brain barrier . Cytokine, chemokine, and prostaglandin dysregulation occurs as early as 14 weeks in mrl / lpr mice, well before disease onset and upregulation of autoantibodies [26, 30, 216223]. Clinically, cytokine - mediated depression has certainly resulted from cytokine administration when used as treatments in cancer and viral infections [224228]. Increased levels of il-6 and other cytokines have been found in the cerebrospinal fluid and brains of patients with np - sle . In mrl / lpr mice, treatment with anti - inflammatory cytokines reduces disease severity [189, 230237] while administration of proinflammatory cytokines accelerates glomerulonephritis, vasculitis, and other disease manifestations [231, 233]. Mrl / lpr mice lacking the il-6 receptor have delayed mortality and nephritis and a reduction of autoantibody complex deposition, though these mice have not been behaviorally tested, so the affect on symptoms of np - sle is not known . The early dysregulation of cytokine production, especially tnf - alpha, il-1, il-2, and il-6 [188, 223, 239, 240], corresponds to the onset of symptoms of depressive - like behavior, such as anhedonia and behavioral despair in mrl / lpr mice and in other rodent strains [241, 242]. Anhedonia can be ameliorated by cyclophosphamide, which abolishes the typically early and significant rise of cytokines, particularly il-6 . Notably, anhedonia and other behavioral indices of depressive - like behavior in mice can be replicated by exogenous il-6 and are prevented by knockout of the il-6 receptor . Other proinflammatory immunomodulators, such as tnf - alpha, also increase behavioral indices of depressive - like behavior in mice while blocking their secretion or receptors decreases depressive - like behavior [242, 243]. High levels of proinflammatory cytokines may also impair the function of the blood - brain barrier [244, 245] and may thus be permissive to the negative effects of autoantibodies and lymphocytes . Finally, cytokine dysregulation is a shared characteristic of murine lupus models with different underlying genetic mechanisms . Thus, while recent and substantial evidence indicates a role for cytokines in the early mechanisms of np - sle, several obstacles have prevented the further studies needed to elucidate the specific underlying etiology . First, it is important to recognize that local alterations in brain cytokine levels that can be very relevant to np - sle pathogenesis may be present early in the disease course, yet these may not necessarily be reflected in abnormal serum levels . Second, there are numerous cytokines, and it is a gross oversimplification to assume that an individual cytokine is pro- or anti - inflammatory . Rather, the precise proportions of cytokine levels in serum and brain are likely to be more important than absolute levels of a single cytokine . Furthermore, cytokines are necessary for normal brain development and cognitive function [247250], and thus global knock - outs of specific cytokine receptors can be problematic, as these can cause cognitive, reproductive, and other deficits [248, 251] and also require large breeding colonies to achieve appropriate genotypes . More precise timing of cytokine receptor knockdown can be accomplished by viral vectors, but these are also less than ideal in studies of sle as they are thought to induce immune responses . Moreover, females with autoimmune disease have a higher risk of psychiatric disorders, particularly depression . Disease severity and rate of progression are also accelerated in female mrl / lpr mice as compared to males of this strain . Serum autoantibodies appear earlier in female mrl / lpr mice [14, 156]. Female mrl / lpr mice also have higher levels of igg in the csf compared to males . Symptoms of depressive - like behavior are also worse in female mrl / lpr mice . One possible mediator of sex differences in the prevalence and outcomes of sle is sex steroid hormones, such as estrogens [254263]. Administration of exogenous estrogens can induce a lupus - like syndrome in otherwise healthy mice and exacerbate symptoms in mrl / lpr mice, in which estrogens globally increase igm levels autoantibody titers, glomerulonephritis, lymphoproliferation, mortality, and cytokine levels . Conversely, treatment with the estrogen receptor antagonist, tamoxifen, reduces proteinuria, serum tiers of anti - dsdna autoantibodies and increases survival . Estrogens also differentially affect b and t cell - mediated immune responses in mrl / lpr mice [255, 256]. Immune complex - mediated glomerulonephritis is significantly accelerated by estrogens whereas t cell - mediated lesions, such as renal vasculitis and periarticular inflammation, are reduced in mrl / lpr mice after estrogen treatment [255, 256]. Estrogens can also modulate blood - brain barrier permeability [267, 268] and increase cytokine levels in patients with sle [259, 262, 269, 270]. Moreover, the myriad effects of estrogen on neuroprotection are being increasingly recognized [271273]. While space constraints prevent going into further details about the role of sex hormones in maintaining the integrity of the blood - brain barrier and providing neuroprotection, the interested reader can find additional details in some recent comprehensive reviews [267, 271, 272, 274, 275]. These sex and hormone differences may have clinical implications for treatment of sle, as cyclophosphamide prevents pulmonary disease in male but not female mrl / lpr mice . Similarly, sex differences in the efficacy of treatment in autoimmune disorders is not uncommon . Furthermore, there are notable sex differences in both humans and in animal models in the susceptibility of depression, responses to antidepressant treatments, and in underlying hormonal, immune, and neurochemical alterations in affective disorders [278, 279]. Cns disease in np - sle may share common mechanisms with peripheral organ pathology in sle, especially in the latter stages of the disease, but the distinct nature of cns - mediated immunity and the blood - brain barrier indicates that early manifestations of particularly mood disorders may be derived from some unique mechanisms . Additionally, agents critical to the pathology of np - sle, such as cytokines, are regulated by sex and steroid hormones, which is consistent with the predominance of sle and mood disorders in females . Altered cytokine profiles in serum and/or cns can result in the activation of astrocytes, microglia, and changes in neuronal function and morphology and dysregulation of the blood - brain barrier pathology of the blood - brain barrier could lead to altered homeostasis and play a significant role in impairment of cns function seen in later onset of np - sle as well many other immune disorders . Despite the importance of the mrl / lpr and other murine models for elucidating the underlying mechanisms of np - sle, there are yet many questions that have not been conclusively answered . These include relating measures of the earliest onset of negative behavioral outcomes with intrathecal levels of cytokines and native brain - reactive autoantibodies, systematic study of the efficacy of alternative therapeutics (such as traditional and novel antidepressants), and comprehensive analysis of the time course of blood - brain barrier dysfunction.
Megaloblastic anemia is a group of disorders characterized by ineffective hematopoiesis, frequently manifested by peripheral blood cytopenia . They are usually caused by nutritional deficiencies (most common) of either vitamin b12 or folate or both, inherited disorders of dna synthesis, or following certain drug therapy . The differentiation from pyrexia of unknown origin (puo) in such cases is difficult and often requires exhaustive laboratory investigations . The aim of this article was to highlight this aspect of megaloblastic anemia and the importance of considering this diagnosis in all cases presenting with puo . This study was conducted on 15 patients of megaloblastic anemia associated with fever, attending the outpatient department over a period of 6 months (june 2014 to november 2014). The inclusion criteria for the study were temperature of 100 f (37.8c) or more, hemoglobin level <10 g / dl, mean corpuscular volume (mcv)> 100 fl, peripheral blood film findings consistent with megaloblastosis (including macrocytosis, hypersegmented neutrophils and pancytopenia in few cases), low serum vitamin b12 and/or folate levels, and bone marrow findings consistent with megaloblastic anemia . All other causes of fever were excluded by appropriate investigations (complete hemogram, aso titer, blood film for malarial parasite, widal test, brucella agglutination test, weil - felix test, dengue serology, leptospira serology, rheumatoid factor, blood culture, liver function test, renal function test, complete urine examination, chest radiograph, ultrasound abdomen and pelvis and others). A total of 64 patients of megaloblastic anemia attended our hospital clinics over the mentioned 6 months period . Only 15 of these satisfied the inclusion criteria and were included in the study . Majority of the patients were from rural areas (12 out of 15, 80%). Most of the patients belonged to the age group of 2140 years and most had duration of illness of around 3 weeks . There was no history of cough, headache, arthralgia, rashes, jaundice or exposure to any patient of tuberculosis in any of the patients . On examination, two patients had hyperpigmentation of knuckles . Cardiovascular system examination revealed loud s1 heart sound and ejection systolic murmur in the pulmonary area in 8 patients . Abdominal examination revealed mild to moderate splenomegaly in majority of patients (10 out of 15). 12 patients had fever of 100102 f and 3 had a temperature of> 102 f. two patients had fever lasting for <7 days, 10 had fever from 7 to 20 days and 3 had fever> 21 days . Other symptoms were easy fatigability (8 patients, 53%), anorexia and gastritis (5 patients, 33%) and bleeding tendency in 1 patient (6.7%). Table 2 demonstrates the hemoglobin levels, mcv values and serum folate / vitamin b12 levels of the patients . Nine patients (60%) had low serum levels of vitamin b12 only, 2 (13.3%) had decreased serum folate levels only; while 4 (26.6%) had combined deficiency of both . Bone marrow examinations were available in all 15 patients and revealed moderate to severe megaloblastosis . Initially, all the patients were started on empirical broad spectrum intravenous (iv) antibiotic treatment . Eleven (73%) of them responded to this approach and showed a decrease in temperature levels . However, 4 (26.6%) continued to remain febrile . In these patients, antibiotics were stopped, and vitamin b12 and folate supplementation was started . All of these 4 patients showed symptomatic improvement within 48 h along with the improvement in hematological parameters by the 7 day . Further improvement in hemoglobin, mcv, and other hematological parameters were seen on follow - up . Table 3 describes the clinical and investigation findings in 4 patients who showed improvement with vitamin b12 and folate administration . Most of these patients were females with low - grade fever lasting for the duration of> 2 weeks . Three of the patients had combined deficiency of b12 and folate while 1 had isolated folate deficiency . As observed in our study, infection continues to be the most common cause of fever in patients of megaloblastic anemia . This is evidenced by the fact that 73% of our patients showed improvement on administration of broad spectrum iv antibiotics . This was despite the fact that no obvious focus of infection could be found in them, even after extensive investigations . It has been suggested that patients of megaloblastic anemia are more susceptible to infection due to impaired intracellular killing of ingested bacteria by the neutrophils and macrophages . The metabolic activation is reduced by 3536% in the leukocytes that are deficient in b12 (but not so with folate deficiency). Hence, bacterial killing is reduced and abnormal; and it is reverted after specific therapy . However, 4 of our patients (26.6%) showed no improvement with antibiotics but showed marked improvement within 48 h on administration of vitamin b12 and folate . This shows that though it is rare to find megaloblastic anemia as the sole cause of fever, it still remains an important and often overlooked cause of the same . Such cases are often treated as cases of puo, and precious time and money is wasted on their management . As per the modified petersdorf criteria, fuo is defined as: a temperature exceeding 38.3c duration of the fever of more than 3 weeks and evaluation of three outpatient visits or 3 days in hospital . On the review of literature for causes of puo we found in our study that most of the patients had low - grade fever with temperature <100 f. the temperature was> 102 f in only 3 of the 15 patients (20%). Furthermore, it was observed that most of the patients who presented with megaloblastic anemia being the sole cause of fever; had a longer duration of disease, more severe anemia and higher values of mcv . It has been suggested that since megaloblastic anemia is a panmyelosis, characterized by hypercellular marrow and ineffective hematopoiesis, premature destruction of hematopoietic precursors could possibly release intracellular substances which might function as systemic pyrogens . Alternatively, studies have proposed that defective oxygenation at the thermoregulatory center of the hypothalamus might be the explanation for pyrexia . However, lack of correlation between neurological manifestation and pyrexia in megaloblastic disease negates this theory . To confound matters even further, few studies have shown that a rise in temperature might cause depletion of folate stores, both in red blood cells and serum, leading to disturbances in folate metabolism . Hence, whether pyrexia is a cause or effect of folate deficiency remains to be fully understood . Although the reason behind it remains unclear, the association of fever with megaloblastic anemia remains a well - documented phenomenon . Further studies on bone marrow microenvironment and role of cytokine signaling in these cases would help in discovering the cause in the future . We conclude that though infection remains to be the most common cause of pyrexia in patients of megaloblastic anemia, few cases also show a causal relationship between the two . Hence, measurement of b12 and folate levels should be advised in all patients presenting with fever without any obvious cause . The correct identification of b12/folate deficiency being the cause of fever (after all other causes have been ruled out), would help in adequate and timely management of the patient and avoid unnecessary use of antibiotics.
Radical chemistry has always taken a backseat to ionic chemistry . In the basic undergraduate curriculum of organic synthesis, the aldol reaction, grignard addition, and pericyclic transformations like the diels alder reaction are at the forefront . More advanced texts highlight the vital modern - day use of cross - coupling . However, little emphasis is placed on topics pertaining to radicals . This radical discrimination might be due to a historically accepted notion that these species are chaotic, uncontrollable, and mysteriously baffling . Despite these misconceptions, a plethora of useful and elegant chemistry has been developed over the years using radical intermediates . To properly put this perspective in context, figure 1 outlines some of the great milestones in radical chemistry . The emergence of the first useful radical processes actually preceded fundamental understanding of these chemical entities, as seen with the kolbe electrochemical decarboxylation, the borodin hunsdiecker reaction, and the hofmann discovery of the pinacol coupling spawned modern means of harnessing ketyl radicals, such as the mcmurry coupling and the kagan reagent (first report in 1977), while the mechanistically similar acyloin reaction enabled sheehan to achieve tremendous advances in steroid synthesis . Gomberg discovered the existence of the trityl radical as a trivalent species, and kharasch realized that radicals could allow one to access anti - markovnikov selectivity in an early example of atom - transfer reaction . Shortly afterward, bachmann postulated the persistent radical effect (pre), suggesting the preferential coupling between persistent and fleeting radical species, thus laying a foundation for the rational design of radical reactions (vide infra). Studies by hey and waters unraveled the intricacies of homolytic aromatic substitution which form the tenets of radical arene functionalization . The meerwein arylation showcased the possibility of utilizing high - energy aryl radicals in the hydroarylation of olefins . The birch reduction opened up a new dimension to the synthetic utility of arenes . Waters s thiol - catalyzed aldehyde homolysis in 1952 provided efficient means of accessing acyl radicals; it also raised stimulating discussions on radical polar effects, which were extensively examined by walling, leading to the entire area of polarity reversal catalysis . Studies into stannanes allowed for the mild and chemoselective generation of carbon - centered radicals, setting the stage for later synthetic applications . Oxidative homolysis of alkyl boranes was later found to offer another means of accessing these radicals at low temperatures . Around this time, the barton nitrite photolysis was invented, the impact of which in solving a real - world problem (procurement of aldosterone acetate) was eye - opening . This reaction, together with breslow s remote radical functionalization, demonstrated the immense power of radical translocation . The seeds of what would later become extremely useful transformations were planted starting in the late 1960s with the discovery of mn(iii)-mediated oxidative additions to olefins, radical - cation - mediated cycloadditions, the minisci heterocycle c h alkylation, and radical - based cross - coupling chemistry . The ingenious barton decarboxylation and deoxygenation (barton mccombie) reactions were invented as a consequence of an interaction barton had during a consulting visit to schering - plough . Methodic kinetic investigations by walling, beckwith, and ingold, among others, demonstrated the remarkable selectivity of radicals, thus propelling significant developments in synthetic radical chemistry in the 1980s . Authoritative treatise on the rules for radical ring closure set the stage for the ueno curran s stunning achievements in total synthesis illustrate the innate ability of radical chain reactions to effect tandem bond formations . Others provided absolute rate constants for numerous radical processes (a small sampling of rate data is shown in figure 1b). The scope of radical precursors was appreciably expanded toward the end of the 1980s . Zard s startling xanthate transfer chemistry found applications in both polymerization and organic synthesis . Use of pet, nugent and rajanbabu s epoxide reduction, and mukaiyama s use of in situ - generated metal hydride species opened the door to using ubiquitous functionalities such as carboxylates, epoxides, and olefins as radical precursors . Significant advances were made in multiple directions shortly before the advent of the 21st century . The development of atom - transfer radical polymerization (atrp) in the 1990s led to countless applications in material science . Pioneering efforts by curran, giese, porter, sibi, and renaud furnished elegant methods of stereocontrolled radical additions (depicted in figure 1 is a simplified representation of sibi s chiral lewis acid - mediated enantioselective radical addition). Roberts s enantioselective hydrosilylation offered a complementary approach where a thiyl radical is the source of chirality . Chatgilialoglu s silane reagents, walton and studer s cyclohexadienes, and curran s fluorous stannanes represent practical means of ameliorating the classical tin hydride method . Studer s studies on nitroxyl radicals had tangible impacts on both cyclization and polymerization reactions . Radical - based azide transfer, emerging from renaud s laboratory, forges c they have shown that radicals can be harnessed in unique and exciting ways to deliver useful structures in an incredibly rapid fashion . Sometimes radicals have enabled access to chemical space that was previously unimaginable, and in other cases their use facilitates the most concise route to a target structure . More often than not, embracing radical reactivity leads to unique applications in an industrial setting . In our view, the properties of radicals and the reactions they enable can have a profound impact in drug discovery, agrochemicals, material science, and fine - chemical manufacturing . The next five sections highlight separate areas of radical chemistry that our laboratory has been involved in over the past decade, followed by a perspective on the latest developments in the field of radical chemistry . It is our hope that some of the transformations highlighted will find use by those making materials for the betterment of humankind . The hapalindole family of marine natural products (e.g., 17) combines promising bioactivities with startling structural complexity (figure 2a). A retrosynthetic analysis of these indole alkaloids, aiming to divergently access as many family members as possible, revealed 8 as a common precursor . The union of indole and carvone (11) represented the most direct means to access 8 . However, the electron - rich indole is affixed at c-3 to the -carbon of a ketone, creating a notoriously challenging dissonant relationship which is usually surmounted in ionic chemistry through reactivity umpolung . Such an approach requires extraneous functional group interconversions associated with prefunctionalized building blocks such as 9 and 10 . Evolution of enolate oxidative coupling in our laboratory and its synthetic applications . To avoid these concession steps while utilizing the inherent reactivity of these systems, a single - electron oxidation of enolates was pursued . It was envisaged that interactions between the in situ - formed electrophilic -keto radical and a nucleophilic indole species would afford 8 (putatively via 12 and 13). After some initial forays, cu(ii) 2-ethylhexanoate was found to effect the direct coupling between indoles and enolate - derived -keto radicals (figure 2b). As the reaction takes advantage of the intrinsic nucleophilicity of indoles, coupling takes place selectively at c-3, and protection of the free n ample amounts of 8 were obtained in a single step, allowing protecting - group - free syntheses of various hapalindole alkaloids . The chemoselectivity of this process is notable, with various sensitive functionalities such as epoxides, halides, and alcohols being well tolerated . Enolates of esters and amides can be used as well; this allows introduction of chiral auxiliaries to furnish enantioenriched products . Ma and co - workers beautifully extended this oxidative coupling approach even when the c-3 position of indole was substituted, allowing them to expediently forge challenging quaternary centers en route to ()-communesin f (14), ()-vincorine (15), and n - methyl - decarbomethoxy - chanofruticosinate (16). Unprotected pyrroles (18) are also viable substrates that react regioselectively at c-2 (figure 2c): a four - step synthesis of (s)-ketorolac (20) was developed on the basis of this reactivity . Notably, this anti - inflammatory agent is currently administered in racemic form, even though the (s)-enantiomer is known to exhibit fewer side effects . Efforts were undertaken to explore the radical chemistry of enolates further . In the presence of an iron or copper oxidant, heterodimerization between two enolates was achieved both intramolecularly and intermolecularly (figure 2d). In the latter case, when enolates of amides or oxazolidines (21) are reacted with those of esters or ketones (22), differences in redox potentials are sufficiently large, and heterodimerization products such as 23a c are formed exclusively . This reaction furnishes 1,4-dicarbonyl products (23) with the concomitant creation of two vicinal stereocenters in a redox - economical fashion . The heterocoupling reaction thus permitted short syntheses of a metalloproteinase inhibitor (24) and the natural product bursehernin (25); the intramolecular variant was harnessed to forge highly congested c c bonds in our syntheses of (+) -stephacidin a (26) and (+) -avrainvillamide (27), as well as ()-stephacidin b (28) (figure 2e). Moreover, oxidative enolate heterocoupling has found use in both industrial and academic circles . For instance, gavai and co - workers from bristol - myers squibb used this method to synthesize a series of anticancer agents such as bms-906024 (29) (currently in phase ii clinical trials). The groups of overman, tang, nicolaou, yang, and thomson have applied this approach to the syntheses of ()-actinophyllic acid (30), spirobacillene a (31), furanocembranoid precursors such as 32, (+) -propindilactone g (33), and metacycloprodigiosin (34), and propolisbenzofuran b (35), respectively . Our interest in silver - mediated radical reactions originated from the total syntheses of the axinellamines (38), massidine, and palauamine (figure 3). Imidazole alkaloids each possess a dense array of nitrogenous functionalities, among which the common guanidinium hemiaminal motif stands out as a vexing feature . To avert concessional maneuvers, the installation of this sensitive moiety was deferred to a late stage via a direct oxidation of c-20 . This strategy would simultaneously allow for the synthesis of the entire alkaloid family from a common intermediate . After extensive experimentation, silver(ii) picolinate was identified as the optimal oxidant for this unique transformation (36 37) (figure 3a). Strikingly, the c-20 position was oxidized with admirable chemo- and regioselectivity, delivering the hemiaminal without over - oxidation . This enabling reaction not only led to the total syntheses of the axinellamines, massidine, and palauamine but also allowed us to procure axinellamines in gram quantities to establish their broad - spectrum anti - bacterial activities . 14783 - 00 - 7) has now been commercialized by sigma - aldrich, the initial scope of this reaction is currently limited to the esoteric area of guanidine oxidation . We were thus motivated to look into other silver - catalyzed processes with more translational potential . The venerable minisci reaction is one such example wherein a carboxylic acid undergoes radical decarboxylation in the presence of a silver catalyst . The alkyl radical thus formed can directly functionalize electron - deficient heteroarenes (39). The importance of these omnipresent heteroarenes cannot be overstated they are vital to life and are found in vitamins, drugs, dyes, pesticides, and polymers . Despite the tremendous amount of work describing their functionalizations, societal needs call for more - efficient syntheses of (hetero)biaryl frameworks to access various pharmaceutical core structures, as well as the simple stitching of small alkyl groups for the modulation of physiochemical properties . Such transformations are often achieved by programmed or regiospecific chemistry (figure 3b). Although predictable and programmable methods will continue to be vital in all aspects of chemistry, the method 39 40 41 inherently requires two steps or more . As chemists are constantly searching for rapid and operationally simple ways to generate a large library of related compounds for screening, simple c h functionalization techniques are needed (39 41) to directly access desired c although such one - step methods, exemplified by directed hydrogen metal exchange, already exist, they require cumbersome cryogenic, anaerobic, or anhydrous conditions . With the peculiar reactivity and selectivity of radicals, nevertheless, this classical reaction presents several drawbacks which preclude its broad applications: radical generation from the carboxylic acid is relatively inefficient and limited in scope . Consequently, elevated temperatures as well as prolonged reaction times are often necessary . Formation of aryl radicals via decarboxylation is particularly challenging, and heteroarene acceptors have to be used in super - stoichiometric quantities to trap these fleeting species . This gap in methodology was addressed with the identification of aryl boronic acids as convenient radical progenitors . $380/mol) and a persulfate oxidant can efficiently homolyze the c b bond under ambient temperature (figure 3c). The resulting radical was found to readily attack a variety of heteroarenes in an aqueous medium, affording arylation products 42 following spontaneous re - aromatization . While triplet oxygen is known to combine with radicals at diffusion rates, running the reaction under open air did not diminish the yields, presumably because the effective concentration of oxygen is low in the reaction system . The regiochemical course of the reaction is governed predictably by the innate electron density of the heteroaryl substrates: pyridines or quinolines are preferentially arylated at c-2, and substrates bearing multiple nitrogens such as pyrimidines, pyrazines, or quinoxalines favor arylation at the most electron - deficient positions . This diverse range of substrates encompasses many privileged medicinal scaffolds, making the reaction amenable for drug derivatization . For example, quinine can be functionalized selectively at its quinoline core to furnish 42a in the presence of several other unprotected functionalities, including a highly oxidizable benzylic alcohol, an electron - rich olefin, and a basic quinuclidine nitrogen . Many other functional groups, such as ketones and aryl halides, exhibited compatibility with the mild reaction conditions . The exceptional chemoselectivity of this radical process, coupled with its operational simplicity, allows rapid diversification of densely functionalized active pharmaceutical ingredients (apis). In an analogous fashion, molander developed a manganese - mediated heteroarene alkylation wherein radicals obtained from his eponymous potassium trifluoroborates were found to react with pyridines and quinolines, forming various adducts (43). Shortly before molander s report, benzoquinone (44) was found to undergo c h alkylation under borono - minisci conditions with alkyl boronic acids to give products such as 45a, b (figure 3d). Like -deficient heteroarenes, 44 also reacted smoothly with aryl boronic acids of varying electron densities to afford 45c f . Benzoquinone adduct (45h) was obtained without protecting the steroidal ketone; a farnesyl chain can be appended selectively at the terminal position (45 g). Substituted quinones are viable substrates as well, permitting schwalbe and co - workers to prepare the potent allergen primin (46) in a single step . Although quinones are prevalent motifs in biomedical and material research, few general methods for their direct installations have hitherto been developed . In fact, many of the quinone adducts surveyed during the course of the reaction development represented new structural entities . Despite their semblance of michael acceptors, quinones rarely undergo smooth conjugate additions with organometallic reagents; their inertia toward transition metal catalysis is evidenced by their roles as ligands or oxidants in such reactions . This simple chemical avenue, through a radical process, tames quinones unique electronic properties . Moreover, owing to the development of the suzuki coupling, a multitude of boronic acids are now available to medicinal chemistry practitioners . Capitalizing on the ubiquity of these radical precursors, the borono - minisci reaction represents a unique opportunity to exploit the biomedical niches of both quinones and heteroarenes in depth . B bond - forming methods, from the pioneering efforts of h. c. brown to seminal studies on c h borylation . The scope of this chemistry can thus be expanded far beyond the commercial repertoire of boronic acids . Simplifying retrosynthetic disconnections can therefore be devised on the basis of this innate c h functionalization strategy . For instance, a borono - minisci cyclization was conceived to construct polycyclic scaffolds such as 48 from the corresponding boronic acid derivative 47, which can in turn be obtained from the halide (figure 3e). This method furnishes the central ring in dibenzofurans and fluorenones while obviating the use of hazardous arenediazonium salts employed in the classical pschorr reaction . Capitalizing further on the borono - minisci transform, a terpenyl radical precursor, borono - sclareolide (49), was synthesized (figure 3f). The radical derived from 49 reacted readily with benzoquinone (44), permitting a rapid synthesis of (+) -chromazonarol (50), which diverged further to provide access to various meroterpenoids in a concise and scalable fashion . These sesquiterpenoids possess intriguing bioactivities which remain largely untapped due to material supply issues this joint effort with leo pharma has furnished ample quantities of each product, enabling explorations into a large area of natural product space . In a similar fashion, the borono - minisci reaction allowed expedient syntheses of various valuable molecular architectures . These include sarcodonin (51) and phellodonin, botryllazines a (52) and b, cytotoxic meriolin (53), and photochromic compounds such as 54, as well as the sodium channel inhibitor 55 . Aside from the original silver catalyst, in some of these studies, iron salts or thermolysis was found to initiate radical formation, further bolstering the practicality of the reaction . The trifluoromethyl (cf3) group, in particular, is an excellent methyl bioisostere it imparts various favorable physicochemical attributes, such as lipophilicity and metabolic stability, to a lead target . (hetero)arenes bearing cf3 groups constitute an indispensable part of numerous important drugs, including celebrex (celecoxib), sustiva (efavirenz), and prozac (fluoxetine). Effective means of trifluoromethylation are thus vehemently sought by both academic and industrial scientists . Although cf3 can be introduced by transition metal - catalyzed approaches, such methods are often air- and water - sensitive and require prefunctionalization . A robust and yet operationally simple radical approach to c however, direct application of the borono - minisci conditions with various heteroarenes failed to yield any trifluoromethylation product 56 (figure 4a). After considerable investigation, [cf3so2]na, a reagent originally utilized by langlois for the trifluoromethylation of phenols and anilines, was discovered to effect the conversion of c h bonds into c cf3 bonds in the presence of a cheap industrial oxidant, t - buooh (tbhp). Sensitive functional groups such as alcohols, amines, and olefins are left unscathed . This is ideal for the functionalization of biomedically relevant substrates such as deoxyuridine, leading to trifluridine / viroptic (56a). The reaction proceeds through the intermediacy of a highly reactive trifluoromethyl radical, which readily engages a gamut of both electron - deficient and electron - rich heteroarenes . The addition of this radical onto an unactivated olefin was also observed in our initial report; this precedent has subsequently been extended in many creative ways . Applying this method, molinski and co - workers were able to selectively functionalize the pyrrole ring of agelastatin . The resulting 13-trifluoromethylagelastatin (56b) exhibited considerably higher potency against chronic lymphocytic leukemia than the parent compound . Overall, this c h functionalization protocol allows for the rapid late - stage derivatization of existing drugs and known pharmaceutical motifs under practical (open - flask) conditions . Development and applications of sulfinate reagents as enabling radical precursors in biomedical research . The effectiveness of langlois s salt as a trifluoromethyl radical precursor stems from its weak c s bond (figure 4a); moreover, its propensity to extrude so2 under oxidative conditions entropically favors radical formation . In anticipation of the generality of these properties, syntheses of various sulfinates were undertaken to access a diverse array of carbon - centered radicals . During this process, choice of the cation was found to be critical: while sodium fluoroalkanesulfinates often lack stability or reactivity, the corresponding zinc salts proved superior . The first reagent of the series, zinc difluoromethanesulfinate, or [cf2h so2]2zn (dubbed dfms), is an air - stable compound that allowed for c h to c cf2h transformation (figure 4b). Heteroarene trifluoromethylation was revisited: [cf3so2]2zn (tfms) was synthesized, and the yield - enhancing zinc effect was observed . Building on this positive effect, a flurry of other zinc bis(fluoroalkane)sulfinate reagents were synthesized (only their chemical acronyms are shown here). These reagents can modulate the physicochemical profiles of various drug candidates through chemoselective radical reactions: dfms installs the cf2h group, leading to phenol bioisosteres; dfes creates aryl ether isosteres; psms draws inspirations from nature s s - adenosyl methionine (sam) methyl transferase to enable site - selective methylation . C h functionalization using these salts can be carried out in a variety of biologically relevant media (aqueous and aerobic), including cell lysate, oolong tea, and a lactamase buffer (figure 4b)! It is worth noting that sulfinate salts can also participate in desulfinylative cross - couplings with boronic acid derivatives and carboxylic acids . The sulfinate reagents described above have been commercialized by sigma - aldrich as diversinates (catalog numbers are shown in figure 4b) and have already gained much popularity within the pharmaceutical community . High demand for dfms has prompted large - scale industrial production, providing commercial access to 1 kg bottles . As a testament to the impact of this chemistry notably, roughly 80% of the purchases are made by pharmaceutical companies such as bristol - myers squibb, novartis, merck, gilead, genentech, roche, boehringer ingelheim, and pfizer . Elaborating further on this work, a linker reagent (daas - na) was developed . This difluoroalkyl azide linker enables the bioconjugation of heteroarene drugs to monoclonal antibodies (figure 4b). Typically, only conventional functional groups can be tagged by linkers, but some medicinal scaffolds present the challenge of not having any apparent chemical handles . The linker can be installed onto complex drugs such as pioglitazone and bosutinib with admirable selectivity to yield 58a and 58b . In another application of sulfinate chemistry, dfms was used as a litmus test to predict the vulnerability of a pharmaceutical candidate toward aldehyde oxidase (ao) metabolism, which is thought to proceed via the nucleophilic attack of a high - valent molybdenum species onto a heteroarene s most electrophilic position . Identifications of such positions are prohibitively difficult in fused azaheterocyclic systems; computational modeling has also been largely ineffective . The nucleophilic difluoromethyl radical generated from dfms acts as a rapid diagnostic for ao susceptibility, reacting with electron - deficient heteroarenes that are prone to ao degradation (figure 4b). The addition of a metabolically stable difluoromethyl motif into a position prone to ao offered a potential inroad to a therapeutic agent . Aside from the nucleophilic difluoromethyl radical, (fluoro)alkyl radicals of varying polarities can be accessed from different sulfinate salts . These reagents can be harnessed as probes to elucidate the intrinsic reactivities of heteroarenes . Regiochemical outcomes of such processes were unpredictable owing to the presence of substituents exerting additive effects . The chemoselectivity of sulfinate radical chemistry coupled with its robustness enabled investigations into a large sampling of heteroarenes under various conditions . As a result, a set of general guidelines was furnished to predict the positional selectivity of heteroaromatic radical c h functionalizations (figure 4c). These empirical rules determine the most nucleophilic / electrophilic positions of a heteroarene through the additive effects of various substituents . Thus, site - specific modification of complex drugs such as nevirapine can be formulated, as addition of the nucleophilic isopropyl radical led exclusively to 60, in accordance with predicted selectivity . Tandem functionalization of dihydroquinine was realized with isopropyl and trifluoromethyl radicals attacking the electrophilic c-2 and nucleophilic c-7 sequentially to yield 61 . Relative contributions of opposing substituents were found to depend on external factors such as solvent and ph thus, the regiochemical outcome of certain substrates can be fine - tuned through simple variations in reaction conditions . While in an acidic chloroform / water mixture the electrophilic cf3 radical reacts with 62 selectively at c-4, use of dmso as solvent elicits conjugate reactivity of the ester group and c-5 substitution prevails . In cases where large quantities of a product are needed, the use of stoichiometric tbhp can be circumvented when electrochemistry is used to initiate the desulfinylative radical formation . Various recalcitrant substrates such as pentoxyfylline (56c) or metroindazole (56d) showed improved yields (figure 4d); monitoring of the reaction progress under electrochemical initiation also allowed deconvolution of processes related to radical formation and radical consumption . Some sulfinate reagents (64) can be prepared from the corresponding sulfonyl chlorides (63). However, only a limited number of these expensive starting materials are commercially available . The hu reagent (65) represents an alternative precursor with the pyridylsulfone moiety serving as a sulfinate surrogate . This route, nevertheless, can only furnish difluoroalkyl sulfinates (67) (figure 4e). In an effort to generate a larger repertoire of sulfinates, an interrupted barton decarboxylation was developed, converting carboxylic acids 68, which are inexpensive chemical feedstock building blocks (vide infra), to sulfinates in good yields (figure 4f). This is achieved through sequential barton ester (69) formation with inexpensive n - hydroxy-2-thiopyridone salts (industrial feedstock) and photolytic rearrangement (69 70). Carboxylic acids are often not convenient precursors of reactive radical species but can now be easily converted into designer sulfinates (71), which are efficient radical precursors . Following this simplifying transform, an assortment of sulfinates of medicinal relevance has been synthesized (e.g., 71a these reagents granted rapid access to heteroarene derivatives that would otherwise require laborious de novo preparations . For example, the previous synthesis of 74 was achieved in four steps from a starting material of limited availability, enlisting the use of hazardous diazomethane to append the coveted trifluorocyclopropyl motif over the course of 1 week . Tfcs (71a), on the other hand, allows the installation of trifluorocyclopropyl directly to afford the same product after a two - step, one - pot operation in about 2 h. as with other sulfinates, these reagents have the ability to change the physicochemical and biological properties of the parent molecule to impact various aspects of drug discovery, including lead target modification, bioisostere formation, and bioconjugation . As with both the oxidative enolate coupling and the borono - minisci reaction, the development of iron - mediated radical olefin hydrofunctionalizations in our laboratory can be traced back to natural product synthesis, specifically from the ent - kaurane family of terpenes . Adhering to the two - phase paradigm of terpene synthesis required access to 77 (figure 5a) as a cyclase phase end point . While terpene skeletons have frequently been constructed using cationic polyene cyclizations, the use of radical methodologies in terpene synthesis has largely been limited to the pioneering work of the snider group . It was our hope to develop a complementary radical - based method to forge lowly oxidized terpene frameworks (79 78 77). The pioneering metal - catalyzed olefin hydrofunctionalization approaches of mukaiyama, carreira, boger, and others were particularly path - pointing in this regard . We envisioned that this type of reactivity could be coupled to a giese - type radical conjugate addition to create a reductive olefin coupling between an unactivated olefin and an electron - deficient olefin . N bond construction . Using boger s iron - promoted olefin hydrofunctionalization conditions as a starting point, we eventually found that fe(acac)3 and phsih3 were able to facilitate the desired transformation, where an unactivated donor olefin 80 (figure 5b, x = alkyl or aryl) was able to be directly coupled to an electron - deficient acceptor olefin (82) through the intermediacy of nucleophilic radical 81 . The reaction can be applied to both intermolecular cross - couplings and intramolecular cyclizations and could form quaternary centers (e.g., 83b) with ease . Although the donor scope was somewhat limited in our initial report, the acceptor scope was quite broad, with almost any electron - withdrawing group being competent to activate the acceptor olefin . Upon further investigation, we found that modifying the reaction conditions and switching from fe(acac)3 to a slightly bulkier catalyst, fe(dibm)3, greatly expanded the reaction scope with regard to the donor olefin . Oxygen-, nitrogen-, sulfur-, silicon-, boron-, and halogen - based functionalities could all be tolerated to give products such as 83a, c g . Functionalized olefin cross - coupling allowed for the execution of the synthesis of glucal derivative 83a in a single step from benzyl - protected 80a and methyl vinyl ketone (82a) and in a higher overall yield than the three - step process that has previously been described in the literature . Similar to the case of oxidative enolate coupling, functionalized olefin cross - coupling represents an umpolung of traditional reactivity in the case of oxygen- and nitrogen - substituted donor olefins . The generation of the nucleophilic radical takes place adjacent to the heteroatom, a site that is conventionally electrophilic . The radical - based nature of this reaction is perhaps its main benefit, as its orthogonality to polar and pd - based cross - coupling chemistry allows it to tolerate functionalities that are traditionally viewed as reactive . Inspired by reports of radical additions into hydrazones, we wondered if the fe(acac)3/phsih3 system would allow for a coupling of olefins with hydrazones . Reaction with the hydrazone derived from formaldehyde (85) would generate adduct 86 (figure 5c). However, the real utility would be in eliminating n2 and rso2h from 86 to generate 87, the product of a net addition of methane across an unactivated olefin . Although this is a conceptually simple transformation, there have only been scattered reports in the literature, and a general strategy for olefin hydromethylation did not exist . Attempts to isolate 85 for use in an olefin hydromethylation were unsuccessful; however, preparing the hydrazone in situ allowed the realization of a hydromethylation sequence . Mono-, di-, and trisubstituted olefins could all be utilized, and due to the radical nature of the reaction, free alcohols, halides, pseudohalides, azides, and boronic esters could all be tolerated . This formal addition of methane across an olefin could also be used to introduce isotopically labeled methyl groups into molecules . By using different combinations of deuterated and undeuterated formaldehyde and methanol, one can incorporate any number of deuterium atoms into the methyl group (87a d). The late - stage introduction of a methyl group, or methyl editing, of natural product scaffolds was demonstrated by employing -d - glucofuranose derivatives citronellol, quinine, and gibberellic acid to give 87e h, respectively . Although the transformations previously described enlisted carbon - based electrophiles as coupling partners, it was discovered that non - carbon electrophiles could also be used . When the olefin - to - nucleophilic radical transformation (84 88) was performed in the presence of nitro(hetero)arene (90), hydroamination (89) was observed (figure 5d). Such a coupling was unexpected, as nitro(hetero)arenes have largely been limited to the realm of nucleophilic aromatic substitution and reduction to the corresponding anilines . However, control studies provided evidence that the nitro functionality was first reduced to the nitroso analogue 91 . As nitroso(hetero)arenes are well - documented radical acceptors, it is likely that they serve as the true electrophile in the olefin hydroamination . The scope of the hydroamination was shown to be quite broad owing to the orthogonality that radical processes have to traditional ionic reactivity . Over 100 adducts were synthesized using this methodology, with a host of functionalities present in both the donor olefin and the nitro(hetero)arene scaffold . The utilization of this method at both bristol - myers squibb and kemxtree attests to the translational potential of this transformation . Furthermore, it was found that the olefin hydroamination could be used to accelerate the synthesis of a variety of medicinally relevant molecules such as the glucocorticoid receptor modulator 89a . What previously took two steps to make from the nitrobenzopyrazole 90a and aziridine 93 could be achieved in a single step in over twice the yield by using the same nitroheteroarene to hydroaminate the disubstituted olefin 92 . Two other examples of utilizing the olefin hydroamination to abbreviate the synthesis of medicinally relevant molecules were also presented . This reductive olefin coupling has been utilized by other research groups to achieve transformations that would have been difficult to achieve otherwise . In an elegant approach to emindole sb (95, figure 5e), pronin was able to smoothly cyclize enal 94 with fe(acac)3 and phsih2(oi - pr) to give the natural product after additional elaboration . Furthermore, olefin cross - coupling enabled chemists at astrazeneca to circumvent an issue with the selective deoxygenation of 98 by instead directly coupling the -branched styrene 96 with enones to give diaryl ketone 97 (figure 5f). In a report detailing a transfer hydrocyanation, morandi and co - workers realized that their newly developed method could be used in conjunction with the reductive olefin coupling to effect the addition of ethylene across an unactivated olefin . To demonstrate this, estrone derivative 99 (figure 5 g) transfer hydrocyanation to norbornadiene resulted in concomitant formation of the vinyl group of 101 in 78% yield over two steps . The scope of the electrophilic coupling partners in these transformations has recently been expanded by other groups . Cui has shown that stabilized diazo compounds (102), -nitrostyrenes (104), and para - quinone methides (106) could be used to generate hydrazones (103), styrenes (105), and phenols (107) respectively, when used to intercept the nucleophilic radical intermediate (figure 5h). Furthermore, fu and co - workers demonstrated that the radical conjugate addition into michael acceptors bearing evans oxazolidinones (108) could serve as a useful pathway to access a variety of protected -amino acids (109) with high diastereocontrol . Although our foray into this area was propelled with vague mechanistic hypotheses suggesting that a radical intermediate is involved, shenvi has recently shown that these reactions proceed through radical hydrogen atom transfer (hat) processes, presumably through an in situ - generated transition metal hydride . Further understanding of this mechanism will undoubtedly contribute to the invention of even more creative ways to utilize olefins as nucleophilic radical progenitors . The minisci decarboxylative alkylation of heteroarenes is an incredibly useful tool (vide supra). One notable drawback of this classical reaction is its reliance on the inherent reactivity of heteroarenes with the scope generally limited to electron - deficient systems . Experience in this area coupled with the use of the barton decarboxylation to prepare sulfinate salts (110 113) led us to wonder if the experimental simplicity of minisci / barton chemistry could be combined with the programmability of single - electron transfer (set) cross - coupling catalyzed by ni or fe salts . Part of the attractiveness of minisci chemistry is its use of feedstock carboxylic acids whereas most set - based alkyl cross - couplings use alkyl halides, which often need to be prepared . Alkyl radicals generated from barton esters (e.g., 110) are typically trapped with a hydrogen - atom source (e.g., bu3snh) or a variety of other radical acceptors including protonated electron - deficient heterocycles, but to our knowledge, had never been captured by a transition metal for the purposes of cross - coupling (figure 6a). Development of redox - active esters (raes) as radical precursors in cross - coupling reactions . To our delight, ni complex (1.0 equiv) gave the desired cross - coupling product (115) in 51% yield . However, 115 was still produced in 54% yield in the absence of light at room temperature! Given that barton esters have, for 4 decades, been known to give rise to radicals using either heat or light, it was quite shocking that the same process could be mediated by a transition metal . We hypothesized that the success of this reaction hinged on the ability of the ligated ar ni complex to reduce the barton ester to a radical anion (114) that could then fragment and decarboxylate, thereby generating an alkyl radical that recombines with the ar ni complex followed by reductive elimination to yield the coupled product . While ar ni complexes can be conveniently obtained from stable ni(ii) complexes and organozinc, photosensitivity of barton esters thwarted the direct generalization of this transformation (116e 117). Instead, it was surmised that activated esters commonly used in peptide bond formation might be similarly predisposed to accept an electron . Indeed, carpino s hobt and hoat esters (116c and 116d formed in situ using hbtu or hatu, respectively) worked extremely well . Even nefkens and tesser s active ester, n - hydroxyphthalimide (nhpi, 116a), functioned smoothly in this reaction (figure 6b). Retrospectively, okada s finding that nhpi esters could fragment under pet conditions reinforced the feasibility of such reactions . The tetrachloro derivative of nhpi (tcnhpi, 116b), introduced into organic synthesis in the context of an electrochemical c h oxidation method, was also found to be a great substrate for this type of coupling . However, not all esters that can activate a carbonyl in amide - bond - forming chemistry were competent . For example, n - hydroxysuccinimide (118) or pentafluorophenyl groups (119) were not . Thus, we define a redox - active ester (rae) as one that can serve as a precursor to the corresponding radical under set conditions . Building upon the initial discovery, a catalytic variant was developed, allowing for the coupling of secondary raes (116) with arylzinc reagents using a simple ni salt . A striking feature of this reaction was that both -heteroatom - stabilized carboxylic acids as well as simple unstabilized alkyl acids were competent coupling partners in a simple, thermal process . It was hypothesized that raes could be thought of more generally as a proxy or substitute for alkyl halides in set - based cross - coupling chemistry . Whereas the area of alkyl aryl cross - coupling is expansive, the number of robust alkyl alkyl cross - couplings is comparatively miniscule due to the difficulty associated with controlling such reactions . Sp cross - coupling of raes with dialkylzinc reagents (figure 6c) performed so smoothly . A wide range of carboxylic acids were found to be compatible, featuring multiple examples of carboxylic acid - containing natural products (e.g., 122d), drug molecules (e.g., 122b), and bridgehead tertiary acids (e.g., 123). As an alternative to traditional williamson ether synthesis, alkylation of -oxy raes is presented in numerous examples such as 122e . It is significant that the multitude of carboxylic acid substrates, variegated in nature, were all commercially available . The procedural simplicity is also notable as reactions were carried out without a glovebox with ease comparable to that of classical amide bond formation . Although raes of simple tertiary acids (e.g., pivalic acid) are not competent direct coupling partners with either aryl or alkylzinc reagents, presumably due to steric constraints, a conjunctive coupling between a tertiary rae (124), radical trap (such as benzyl acrylate), and an arylzinc reagent was envisioned, thereby exploiting this perceived limitation (figure 6d). Reasoning that a tertiary radical would react rapidly with an acrylate in a 1,4-fashion as we demonstrated in our fe - based studies (vide supra), it was logical that the resulting -keto radical would recombine with an ar ni complex and reductively eliminate, thereby forging two c c bonds and generating a quaternary center in a single reaction . This scalable three - component coupling rapidly generates structures (125a g) that would be exceedingly difficult to access through traditional ionic chemistry in moderate to good yields . The analogy of this chemistry to amide bond formation really only holds if it exhibits the necessary chemoselectivity to operate in the context of solid - phase peptide synthesis . This was demonstrated in several instances, the most notable of which is the simultaneous sp sp cross - coupling of both aspartic acid and glutamic acid side chains on a resin - bound peptide (figure 6e). This transformation allows for the synthesis of highly diverse functionalized peptides containing non - proteinogenic amino acids such as 127 . Although initial reports focused on the use of organozinc reagents in rae cross - couplings, attention rapidly turned to the use of boronic acids due to their shelf stability and wide availability (vide supra). Boronic acids, like carboxylic acids, are among the most widely commercially available building blocks and are often used by medicinal chemists to generate diversity in a short, timely manner . After extensive optimization, this desirable transformation was realized using cheap nicl26h2o as a ni precatalyst and triethylamine as an inexpensive base (figure 6f). Interestingly, this cross - coupling relied on the exclusive use of the tcnhpi rae (nhpi and other raes explored did not work). A wide range of both aryl (129a c, e, f) and styrenyl (129d) boronic acids, including heteroaromatic ones (129a, b, e), can be coupled using this chemistry, and this reaction shows remarkable chemoselectivity: aryl bromides on the boronic acid coupling partner are tolerated (129c, f) and primary alkyl bromides (129f) present on primary raes remain intact under the reaction conditions, thereby showing orthogonality to other alkyl - suzuki - type arylation reactions . As the component of the method was of utmost importance to us, it was also shown that the reaction requires no special precautions to exclude moisture or air, making the barrier to adoption in a discovery setting quite low . As mentioned above, raes represent a unique way of converting an alkyl carboxylic acid to the functional equivalent of an alkyl halide . For this to be proven as generally true, other transition metal catalysts capable of set - type coupling should work as well . The first choice for exploration in this regard was fe - based catalysis due to its numerous advertised benefits over ni, such as its lack of toxicity and wide abundance . Yet, we sought more than just an alternative to ni for the same reaction . In an extensive study, the use of ni- and fe - based catalysts was benchmarked across a range of over 40 substrates (e.g., 130a, b) to understand the context - dependent advantages of each (figure 6 g). For the fe - system, a catalyst / ligand combination that was pioneered by nakamura and bedford for the analogous alkyl halides was employed . The findings were surprising in that fe catalysis enabled near - instantaneous reaction rates, applicability to tertiary systems (124) including access to exotic cubane structures (131 132), and superiority in the coupling of amino acid and unactivated primary systems (figure 6h). Combined with the obvious advantages of fe over ni, this reaction may prove to be useful not only in a discovery setting but also in the demanding area of process chemistry . Ni- and fe - catalyzed rae cross - coupling presumably operates under mechanisms analogous to those previously reported in the literature for ni- and fe - catalyzed cross - couplings (figure 6i) of alkyl halides . A low - valent fe or ni complex likely undergoes transmetalation with an organometallic reagent (133 134). Set from 134 to the rae (124) generates a radical anion (137) that undergoes decarboxylative fragmentation to generate an alkyl radical (138). This alkyl radical then recombines with the metal center to form 136 (high selectivity of this heterocoupling process over homodimerization of 138 can be attributed to the pre, vide infra). The presence of radical intermediates in all of these transformations has been implicated in radical cyclopropane ring - opening experiments . Further mechanistic studies are underway to understand the role of ligands, stoichiometry, and rae structure on reactivity . Concurrent with our initial studies, weix and co - workers demonstrated the viability of raes in ni - catalyzed cross - electrophile couplings and found that aryl iodides as well as acid chlorides can be coupled to raes under ni catalysis (figure 6j). Inspired by our work, others have adapted raes for additional ni - catalyzed transformations . Judging by the hundreds of different known reactions of alkyl halides in set - based cross - couplings, it is anticipated that raes will find wide use and permit a broad array of carboxylic acid building blocks to be enlisted in similar transformations . They are generally inert to a host of reactive functionalities such as amines and alcohols . Thus, radical reactions can often be carried out on complex substrates in open flasks . Radicals frequently enable the most direct means of reactivity umpolung . Due to their early transition states and lack of stifling aggregation spheres, these properties, in our view, make them eminent candidates to either provide a shortcut to known molecular frameworks or to open up new chemical space altogether . Inspiring recent accomplishments, primarily from other laboratories, that may guide future directions of this vibrant discipline are organized into the following five sections: (1) unique reactivity that is also scalable (figure 7a), (2) rapid generation of complexity in total synthesis (figure 7b), (3) chemo- and regioselective transformations (figure 7c), (4) cross - coupling chemistry (figure 7d), and (5) enantioselective radical reactions (figure 7e). Radical chemistry: selected highlights from the past 5 years that capitalize on the unique power of these reactive intermediates . Mild and robust radical reactions have found numerous applications (figure 7a). This manganese - mediated reaction proceeds through the intermediacy of a benzylic radical and is complete within several minutes, allowing efficient radiolabeling of drug molecules such as enalaprilat with f to afford 139 . A similar radical c h fluorination was utilized by merck to furnish -fluoroleucine methyl ester (140) en route to odanacatib; this protocol, based on polyoxometalate pet chemistry originating in the 1990s, was amenable to process scale in a continuous flow reactor . In another elegant masterpiece of process development, such efforts to harness radicals on a large scale are espoused by milder and more sustainable means of radical generation . In an illustrative example, electrochemistry was used to initiate a radical cationic cyclization, delivering diazonamide analogue dz-2384 (142) on a large scale; skeletons of complex terpenes could also be oxidized electrochemically in an environmentally benign fashion to furnish enones such as 143 . Meanwhile, potassium tert - butoxide was found to promote c h silylation via a putative radical species . This inexpensive and scalable reaction developed by stoltz and grubbs gives rapid access to silylated drug analogues such as 144, boding well for industrial applications . Radicals have continued to play vital roles in the syntheses of complex molecules (figure 7b). While the ability of free radicals to propagate in chain reactions have always been exploited to forge multiple bonds simultaneously, increased mechanistic understanding of such processes enabled fine - tuning of selectivity, affording complexity in a controllable fashion . Maimone s stunning synthesis of ()-6-epi - ophiobolin n (145) embodies this notion: not only did a radical cascade furnish the challenging skeleton in a single operation, the use of a thiol catalyst overrode inherent conformational bias to achieve the desired stereochemical outcome . In their syntheses of (+) -pleuromutilin (146) and ()-maoecrystal z (147), procter and reisman both made use of samarium iodide mediated radical cascades; these reactions expediently stitch together ubiquitous olefins and carbonyls . Overman s synthesis of ()-aplyviolene (148) highlights radicals abilities to prevail against steric crowding, as a strategic radical conjugate addition was enlisted for the convergent union of two complex fragments . Snyder s synthesis of (+) -scholarisine (149) reinforced this point a quaternary center is constructed via a tandem radical translocation cyclization . The affinity of radicals for peroxo species makes them ideal candidates for the rapid incorporation of oxygenated functionalities as well . This is evidenced through maimone s synthesis of (+) -cardamom peroxide (150) wherein three c o bonds are formed in a single step . Oxidative radical cascades also permit the simultaneous construction of c o and c c bonds as can be illustrated by the syntheses of clavilactone a (151) and (+) -fusarisetin a (152) by li and theodorakis, respectively . The utility of radical cyclizations transcends the realm of natural products alabugin and co - workers, for example, employed a reductive radical cascade to prepare polyaromatic nanoribbons such as 153; this remarkable reaction accomplished five cyclizations, tremendously expediting their synthetic endeavor . Zard s bidirectional ketone synthesis convergently merges unactivated olefins through a simple conjunctive radical precursor, offering an alternative retrosynthetic strategy to a diverse range of building blocks such as 154 . Chemo- and regioselective radical methodologies have continued to flourish (figure 7c). Recent research has seen a renewed interest in the use of radicals to activate c h bonds . As has been reviewed extensively, such an approach allows selective functionalization of unactivated c for instance, in their collaborative synthesis of (+) -chlorolissoimide (155), alexanian and vanderwal took advantage of an intermolecular hlf reaction to directly effect regioselective c h chlorination on (+) -sclareolide . While a halogenated amine derivative (a chloroamide) was used to initiate c h abstraction as in the case of traditional hlf protocols, betley and co - workers demonstrated that simple azides are capable of similar reactivities . When treated with an iron complex, alkyl azides were transformed into cyclization products such as 156 via a radical pathway . In another variant of this classical reaction, yu and co - workers achieved a tandem c h functionalization whereby the lactam and olefin in 157 were forged in a single step through consecutive c h homolysis . Through such processes, methods of intermolecular c these reactions enlist copper and iron catalysts to generate highly reactive radical species from selectfluor and zhdankin s reagent; in spite of their high energy, the ensuing radicals exhibited strikingly high selectivity toward complex substrates adorned with multiple functionalities products such as 158 and 159 are obtained in synthetically useful yields . S inspiring work on vinblastine analogues (160) is another testament to the unparalleled chemoselectivity of free radical processes . A late - stage hydroazidation was utilized, where a tertiary radical was formed from an olefin via hat (vide supra). Azidation of this intermediate forged the final c n bond in the presence of multiple functionalities . Notably, the scope of such hat - based methodology is expanding as novel hydrogen atom donors of varying selectivity profiles are being developed . Curran s work on nhc - boranes provides an illustrative example whereby these complexes could selectively reduce alkyl halides in the presence of a labile epoxide to give 161 . On top of carbon - centered radicals, the distinctive characteristics of radical chemistry highlighted above pertain to a variety of other species . N - centered (sulfonyl)imidyl radicals showed high reactivity and selectivity in their interactions with bioactive heteroarenes and functional polyaromatics to afford adducts such as 162 and 163 . These radicals can be unleashed from bench - stable precursors through metal - mediated or photoinduced cleavage of n - heteroatom bonds . The oxygen - centered diradical derived from decomposition of phthaloyl peroxide was found to selectively react with arenes, affording complex phenols such as 164 while sparing various reactive aliphatic c h bonds . The peculiar selectivity can be explained by a reverse rebound mechanism . Another emerging approach to arene functionalization exploits the high electrophilicity of aromatic radical cations . These transient species can be obtained electrochemically or through photoinduced or transition - metal - mediated electron transfer, as shown by the groups of yoshida, nicewicz, and ritter, respectively . In each case, arenes were selectively oxidized into the radical cations, leaving different functionalities unscathed . Regioselective trapping by nitrogen - centered nucleophiles formed amination products such as 165, 166, and 167 . Cross - coupling reactions represent yet another exciting avenue in recent radical research . Building upon kochi s illuminating legacy, empowering synergy between radicals and metal complexes through the pre (vide infra) has significantly expanded the scope of cross - coupling . Through radical reactivity, fu and co - workers demonstrated the challenging coupling of unactivated tertiary halides with boronic acid derivatives (figure 7d). Nickel s propensity to undergo set was harnessed to generate carbon - centered radicals, overcoming hindered halides inertia toward two - electron oxidative additions . Quaternary centers as in the case of 168 can be constructed . In a similar vein, molander designed a single - electron transmetalation process wherein alkyl trifluoroborates were homolyzed under pet conditions, and the resulting benzyl radical engaged in nickel - mediated coupling . Products such as 169, which are difficult to access via classical suzuki coupling, can be obtained . Radicals derived from stabilized carboxylic acids through pet undergo similar nickel - catalyzed reactions . Single - electron processes involving radicals have also been harnessed to aid challenging c n coupling reactions . Through photoinduced phenyl radical generation, fu and peters developed ullmann - type couplings of various nucleophiles . This approach led to aryl amines such as 170 under mild conditions, obviating the need for prolonged heating . N coupling of unactivated secondary and tertiary halides using set - initiated radical formation, affording hindered amine derivates such as 171 . Alkyl radicals derived from hunsdiecker - type reactions were also shown to undergo copper - mediated c an important ramification of this metal radical synergy is the possibility of conducting enantioselective radical reactions with chiral metal complexes . To this end, buchwald elegantly showcased a convenient method to access enantioenriched butyrolactones (173) via copper - mediated enantioselective cyclization . It is noteworthy that this reaction may be initiated by a broad range of radical species . Chiral copper catalyst also allowed stahl and liu to achieve enantioselective benzylic cyanation through a radical relay fu and macmillan synthesized chiral carbamates such as 175, utilizing a chiral nickel catalyst to capture stabilized -amino radicals derived from pet . Weix and co - workers reported that when the nugent rajanbabu reaction was performed with a chiral titanium complex, the resulting radical could be intercepted with nickel in an enantioselective coupling, leading to 176 . In a different approach, drawing inspiration from roberts s precedent, maruoka and co - workers utilized a chiral thiyl radical to mediate enantioselective tandem c c bond formation . Thiyl radicals predisposition to undergo reversible additions with olefins allowed them to be used in catalytic quantities (3%), while the temporal incorporation of chirality led to 177 in good enantiomeric excess . Ingold pre undergirds a significant portion of the chemistry highlighted in figure 7 and warrants further discussion . High selectivity in many radical processes seems baffling at first, as most carbon - centered radicals are transient species (rtra, figure 8) which are expected to recombine at diffusion rates before engaging in any productive reactions . Pre offers a means of suppressing this ultra - fast self - destruction using persistent radicals (rper) that have lower rates of dimerization . When rtra and rper are formed at equal rates in a reaction, incipient homocoupling of rtra quickly depletes its concentration, leading to a buildup of rper . Under steady - state conditions, this excess rper scavenges any rtra that is formed, thereby favoring cross - coupling products . Revisiting the persistent radical effect (pre). This phenomenon underscores the photostability of vitamin b12: when the c co bond in methylcobalamin (178) is photolyzed, dimerization between the resulting methyl radical is kept minimal by the persistent co(ii) complex 179 . Instead, heterocoupling quenches the reactive methyl radicals to regenerate the vitamin (figure 8a) in a degenerate pathway . This equilibrium can be altered in the presence of a radical trap whereby transient radicals derived from cobalamine mimics (e.g., 180) can engage in irreversible addition reactions (182 183). Since homodimerization of 182 is suppressed through pre and reversible heterocoupling with 181 regenerates 180, cyclization proceeds cleanly as the only net reaction . The profound impact of pre extends far beyond organocobalt chemistry it underlies the resurgent interests in radical - based cross couplings . Most paramagnetic metal complexes can be construed as persistent radicals . In cross - coupling reactions, set between metal catalysts and organic electrophiles (halides or rae) generates these species (186, m = ni(i), pd(i), cu(ii), etc .) At equal rates as transient carbon - centered radicals (e.g., 187). Owing to the pre, dimerization of 187 is disfavored, and recombination with the paramagnetic metal occurs preferentially (186 + 187 188). Cross - coupling products can thus be selectively furnished after the ensuing reductive elimination step (188 189). Aside from metal complexes, the barton photolysis (190 194, figure 8b) provides an illustrative example . In this case, the long - lived nitrite radical 191 allows translocation of the alkoxy radical 192 to outcompete premature termination via dimerization . Pre also accounts for the selective coupling between the resulting carbon - centered radical 193 with 192 to afford the final product 194 . In an analogous fashion, pre is operative in many other radical - mediated c h functionalizations using haloamides, halogenated amines (e.g., hlf, vide supra), or hypoiodites (e.g., surez reaction). Nitroxides, exemplified by tempo (196), constitute another important class of persistent organic radicals . While their application in tandem cyclizations (195 198) is depicted in figure 8, these highly stable radicals have also played pivotal roles in living polymerization reactions . Since the focus of this perspective is on the area of small - molecule chemistry, a detailed discussion of these radical polymerization reactions is beyond the scope . Despite this, the collection of studies in this section remains a stunning testament to the versatility of radical species . They enable rapid and practical routes to complex molecules or new bond disconnections that would have been unimaginable even a few years ago . Hence, radicals can provide an opportunity to consider radically different ways of achieving new transformations or synthesis plans . Progress in so many areas of societal need, from agrochemicals to drugs, relies on advances in organic chemistry . A perfect storm of shortened timelines, increased regulatory hurdles, and shrinking ip space has created an ideal opportunity for synthesis to make a real difference ., they can save chemists enormous amounts of time and can access wide areas of unexplored chemical space . In fact, the studies originating from our laboratory outlined in this perspective were born out of necessity: simplifying the synthesis of complex natural products in many cases required the invention of powerful radical - based reactions . Interactions with industry inspired our group to apply the aforementioned advantages of radicals to areas of great need . Looking forward, one can anticipate exciting new frontiers enabled by radical chemistry, such as asymmetric cross - couplings of unstabilized systems, regiocontrolled minisci - type functionalizations, and programmed cross - couplings of olefin - derived radicals . One thing is clear: the translational potential of radicals is high, and it has only just begun to be exploited.
Metronidazole, a nitroimidazole antimicrobial agent is widely used in the treatment of anerobic and protozoal infections for more than three decades . Common side effects are nausea, vomiting, abdominal discomfort, headache, and metallic taste . Neurological effects such as ataxia, dizziness, peripheral neuropathy, and seizures were also reported . We report a rare case of metronidazole - induced encephalopathy (mie) in order to create an awareness of this unusual entity among practitioners . A 39-year - old male without any comorbidities was brought to the emergency department for acute onset of slurring of speech, generalized weakness, and unsteadiness . He was unable to button his shirt, and turn a doorknob due to clumsiness of hands and fingers for the past 24 hours . Four days prior to this admission, he complained of numbness and tingling sensation of toes and dorsum of both feet . Recently, he was treated for amebic liver abscess with ultrasound - guided aspiration and was given tablet metronidazole 800 mg three times a day for 2 weeks . Since repeat ultrasound revealed re - accumulation of liver abscess after 2 weeks, he was advised to continue metronidazole 800 mg three times a day orally for 2 more weeks . Thus, he had taken 67.2 grams of tablet metronidazole over a period of 28 days . Neurologic examination revealed the patient was conscious but confused, with dysarthria, nystagmus, dysmetria on finger - to - nose test, positive romberg's sign; graded sensory loss to pain, temperature, touch, and proprioception over distal lower and upper extremities in a stocking and glove type, and impaired joint position and vibration sense . Clinical assessment of cranial nerve, muscular system, deep tendon reflexes, and gait was normal with absent babinski sign . His hematological, metabolic panel, thyroid profile, cerebrospinal fluid (csf) analysis, viral markers, arterial blood gas, ammonia levels, vitamin b1, b12, and folate levels were within normal limits but for mild derangement of liver function . His magnetic resonance imaging (mri) brain revealed symmetrical areas of altered signal intensity, appearing hyperintense on t2w and fluid - attenuated inversion recovery (flair) images, and involving the dentate nuclei and splenium of the corpus callosum . There was an evidence of diffusion restriction on diffusion - weighted / apparent diffusion coefficient mapping without evidences of hemorrhage or infarct . Imaging findings were in favor of metronidazole toxicity, which was supported by the prolonged history of metronidazole intake . Moreover, his symptoms disappeared on third day after discontinuation of metronidazole, and mri 4 months later showed resolution of the earlier described signal changes . Mie usually occurs at doses exceeding a total of 50 grams / month or 1.5 to 2 grams / day . Although the exact mechanisms are unknown, the possible mechanisms with experimental evidences are furnished . Furthermore, cerebellum of rats has been shown to uptake carbon labeled metronidazole . In vitro, metronidazole incorporated into thiamine analogs, inhibits the phosphorylation of thiamine, thereby antagonizing vitamin b1 effect . Radiolabelled metronidazole binds ribonucleic acid (rna) in a significant manner, and inhibits neuronal protein synthesis and facilitates degeneration . Catecholamine neurotransmitters are oxidized by metronidazole derivatives to produce semiquinone and nito anion radicals which are neurotoxic . The case is presented so as to facilitate practitioners to recognize the symptoms and signs of metronidazole toxicity, and consider them in their differential diagnosis . It is worth to remember the potential neurological abnormalities and imaging findings of this entity, as this agent is frequently prescribed and used in clinical practice.
Expression, purification, and reconstitution of fluc channels were as described in detail27,28 . In the final purification step, fluc protein was collected from a s200 size - exclusion column equilibrated in 100 mm naf (or nacl for zero - f preps), 10 mm hepes ph 7.0, 5 mm n - decylmaltoside (dm). Bpe constructs carried two functionally neutral mutations to enhance expression, r29k / e94s or, for hg labeling, r29k / e94c . Hg labeling was achieved by incubating bpe with a 3-fold molar excess of hg(ii) acetate for 30 minutes between the co - affinity and size exclusion columns . Ec2 constructs bore a single functionally neutral, expression - enhancing mutation, r25k, and, for selenomethionine incorporation, an additional methionine was introduced (a51 m) to enhance phasing power . The c - terminal his6 tag was removed from bpe by treatment with lysine endoproteinase c (roche)27, but was left on ec2 . Fluc protein was typically reconstituted into liposomes at low density (0.1 - 0.2 g protein / mg lipid). For single - channel recording, liposomes were fused into planar lipid bilayers in symmetrical solutions of 300 mm naf, 15 mm mops, ph 7.0, and channels were recorded at 200 mv holding voltage27,29 . N - terminal his6 tags were removed while bound to talon beads by 16-hr treatment with tev protease also carrying a his tag; monobodies with cleaved his tags were eluted from the affinity column with 150 mm nacl, 40 mm tris - hcl ph 7.5 . For the final purification step, the preparation was passed over a s75 size exclusion column in 100 mm naf (or nacl), 10 mm hepes ph 7 . Monobodies were used immediately for crystallization or stored in frozen aliquots for channel - blocking experiments . For crystallization from detergent micelles, fluc protein in solution containing 5 mm dm was concentrated to 10 mg / ml, a maneuver that concentrates the detergent 5 - 10-fold . Monobody solution (10 mg / ml) was supplemented with 4 mm dm immediately before mixing with channel in a 1.2:1 molar ratio . This protein solution was then mixed with an equal volume of crystallization solutions (0.5 l for sitting drops in 96-well plates or 1 l for hanging drops in 24-well plates). Bpe - s7 crystals grew in 3 - 5 days in crystallization solutions of 36 - 41% (w / v) polyethylene glycol 550 mme, 0.2 m mgcl2 or cacl2, 0.1 m tris, ph 8.5 - 8.9 . Ec2-s9 crystals grew in 10 - 14 days in crystallization solutions containing 28 - 32% (w / v) polyethylene glycol 550 mme, 0.05 m lino3, 0.1 m n-(2-acetamido)iminodiacetic acid, ph 6.0 - 6.7 . Crystals were frozen in liquid nitrogen for data collection . For lipidic cubic phase crystallization, fluc protein concentrated to 10 mg / ml as above was dialyzed overnight to reduce the dm concentration to 10 mm . This was then mixed with monobody solution (10 mg / ml, with 4 mm dm) in a 1:1.2 molar ratio . The protein - laden mesophase was prepared by homogenizing 9.9 monoacylglycerol (monoolein) lipid with protein solution (10 mg / ml) at a weight ratio of 1:1.5 (protein: lipid) using a coupled syringe mixing device at 20c30 . Crystallization trials were carried out at 19c in 96-well glass sandwich plates with 50 nl mesophase and 0.8 l precipitant solution using an in meso robot . Crystallization solutions consisted of 2226% (v / v) polyethylene glycol 500 dme, 0.1 m na - citrate ph 5.5 + /- surfboard shaped crystals grew to a maximum size of 100 50 5 m in 5 - 10 days . Wells were opened using a tungsten carbide glasscutter, and the crystals were harvested using 50 - 100 m micromounts (mitegen). Crystals were snap - cooled directly in liquid nitrogen prior to data collection on the diamond light source beamlines i24 or i04 . Liposomes (10 mg lipid / ml, 0.2 - 1 g protein / mg lipid) loaded with 300 mm kf or kcl solutions were freeze - thawed for 3 cycles and then extruded 21 times through a 400 nm filter . Immediately before the assay, a 100 l sample was centrifuged through a 1.5-ml sephadex column equilibrated with flux buffer (fb, 300 mm k - isethionate, 1 mm kf or kcl, 25 mm hepes, ph 7) and was diluted 20-fold into a stirred chamber containing 3.8 ml fb . Halide concentration in the suspension was continuously monitored with a f or cl electrode amplified through a ph meter and digitized at 5 hz sampling frequency . Efflux was initiated by adding 1 m valinomycin, and after several minutes 30 mm octylglucoside was added to obtain the 100% efflux level . For experiments with the bpe n43d mutant, fb contained an additional 100 mm na - isethionate and 25 mm ches buffer . Single - channel block by monobodies was recorded in planar phospholipid bilayers exactly as described28 . Diffraction data for bpe - s7 were processed by the xia2 pipeline33 to xds34 and scaled using aimless35 . The space group was determined to be p21212 with two bpe dimers and four s7 monobodies in the asymmetric unit (extended data figure 1). A phasing strategy was devised that used pre - derivatisation of bpe mutated with a single cysteine residue (e94c) with hg (ii) acetate prior to crystallisation (see above). None of the native crystals were isomorphous with the hg derivatised crystals (riso> 40%), despite having similar cell dimensions . Indeed, hg derivatised crystals were observed to diffract x - rays to slightly higher resolution than native crystals, therefore effort was directed at these samples for phasing and refinement . The four hg sites were located using the single wavelength anomalous dispersion (sad) method as implemented in shelx36 with the positions further refined and initial phases calculated using sharp37 with solvent flattening in solomon38 . To improve the phases a second and third dataset were also collected at the se edge using both hg and seleno - l - methionine derivatized protein and another hg derivatised dataset respectively (extended data table 1). All 16 se plus 4 hg sites were located using shelx and this dataset was combined with the initial 3.6 angstrom hg derivatized data . We did not observe higher resolution diffraction in the native crystals, which typically gave diffraction between 3.6 - 3.8 angstroms . Our highest resolution dataset with optimal scaling statistics was one of the hg - derivatised crystals, we therefore used this dataset for subsequent refinement of the model built into the experimental electron density maps calculated from sharp (see below). For the bpe - l2 crystals, data were similarly processed and scaled in spacegroup p1 . Phases were calculated using molecular replacement as implemented in phaser39 using the experimentally determined bpe model and a homology model of the l2 monobody using a previously determined structure of a loop - library monobody (pdb: 3rzw). The electron density maps clearly showed major differences in the selected, variable regions of the monobody . Phases were calculated using se - sad with 8 se sites, and processed as above . The experimental electron density maps were of exceptional quality following phase extension to the highest resolution shell of 2.58 . Data were collected at advanced light source beamlines 8.2.1 and 8.2.2, and diamond light source, beamlines i24 and i04 . For the bpe - s7 complex structure, a model for the channel was built into the experimental electron density maps calculated from sharp using o40 with sigma - a - weighted 2fo - fc and mfo - dfc electron density maps . The s7 monobodies were initially built using a homology model based a previously determined structure of a side library monobody (pdb: 4jeg). The partial models were further cycled back into phase calculation in sharp to improve the initial solvent envelope used for the solvent flipping procedure . The amino acid side chains were then built using the se and hg sites to determine the correct register . Refinement of the bpe - s7 model was carried out in refmac542,43 against the highest resolution dataset for these crystals, 3.6, which came from one of the hg - derivatised crystals used for phasing (extended data table 1). No prior phase information was used during the refinement, however refinement was improved following anisotropic truncation of the structure factors . To avoid biasing the model, ncs the ec2-s9 model was built directly into the experimental maps, using se sites to ensure the correct register, and then monobodies were placed by molecular replacement using phaser with a homology model based on s7 . The bpe - l2 model was built into the electron density maps calculated from phaser following iterative rounds of structure refinement in phenix45 and refmac5 . Expression, purification, and reconstitution of fluc channels were as described in detail27,28 . In the final purification step, fluc protein was collected from a s200 size - exclusion column equilibrated in 100 mm naf (or nacl for zero - f preps), 10 mm hepes ph 7.0, 5 mm n - decylmaltoside (dm). Bpe constructs carried two functionally neutral mutations to enhance expression, r29k / e94s or, for hg labeling, r29k / e94c . Hg labeling was achieved by incubating bpe with a 3-fold molar excess of hg(ii) acetate for 30 minutes between the co - affinity and size exclusion columns . Ec2 constructs bore a single functionally neutral, expression - enhancing mutation, r25k, and, for selenomethionine incorporation, an additional methionine was introduced (a51 m) to enhance phasing power . The c - terminal his6 tag was removed from bpe by treatment with lysine endoproteinase c (roche)27, but was left on ec2 . Fluc protein was typically reconstituted into liposomes at low density (0.1 - 0.2 g protein / mg lipid). For single - channel recording, liposomes were fused into planar lipid bilayers in symmetrical solutions of 300 mm naf, 15 mm mops, ph 7.0, and channels were recorded at 200 mv holding voltage27,29 . N - terminal his6 tags were removed while bound to talon beads by 16-hr treatment with tev protease also carrying a his tag; monobodies with cleaved his tags were eluted from the affinity column with 150 mm nacl, 40 mm tris - hcl ph 7.5 . For the final purification step, the preparation was passed over a s75 size exclusion column in 100 mm naf (or nacl), 10 mm hepes ph 7 . Monobodies were used immediately for crystallization or stored in frozen aliquots for channel - blocking experiments . For crystallization from detergent micelles, fluc protein in solution containing 5 mm dm was concentrated to 10 mg / ml, a maneuver that concentrates the detergent 5 - 10-fold . Monobody solution (10 mg / ml) was supplemented with 4 mm dm immediately before mixing with channel in a 1.2:1 molar ratio . This protein solution was then mixed with an equal volume of crystallization solutions (0.5 l for sitting drops in 96-well plates or 1 l for hanging drops in 24-well plates). Bpe - s7 crystals grew in 3 - 5 days in crystallization solutions of 36 - 41% (w / v) polyethylene glycol 550 mme, 0.2 m mgcl2 or cacl2, 0.1 m tris, ph 8.5 - 8.9 . Ec2-s9 crystals grew in 10 - 14 days in crystallization solutions containing 28 - 32% (w / v) polyethylene glycol 550 mme, 0.05 m lino3, 0.1 m n-(2-acetamido)iminodiacetic acid, ph 6.0 - 6.7 . Crystals were frozen in liquid nitrogen for data collection . For lipidic cubic phase crystallization, fluc protein concentrated to 10 mg / ml as above was dialyzed overnight to reduce the dm concentration to 10 mm . This was then mixed with monobody solution (10 mg / ml, with 4 mm dm) in a 1:1.2 molar ratio . The protein - laden mesophase was prepared by homogenizing 9.9 monoacylglycerol (monoolein) lipid with protein solution (10 mg / ml) at a weight ratio of 1:1.5 (protein: lipid) using a coupled syringe mixing device at 20c30 . Crystallization trials were carried out at 19c in 96-well glass sandwich plates with 50 nl mesophase and 0.8 l precipitant solution using an in meso robot . Crystallization solutions consisted of 2226% (v / v) polyethylene glycol 500 dme, 0.1 m na - citrate ph 5.5 + /- surfboard shaped crystals grew to a maximum size of 100 50 5 m in 5 - 10 days . Wells were opened using a tungsten carbide glasscutter, and the crystals were harvested using 50 - 100 m micromounts (mitegen). Crystals were snap - cooled directly in liquid nitrogen prior to data collection on the diamond light source beamlines i24 or i04 . Liposomes (10 mg lipid / ml, 0.2 - 1 g protein / mg lipid) loaded with 300 mm kf or kcl solutions were freeze - thawed for 3 cycles and then extruded 21 times through a 400 nm filter . Immediately before the assay, a 100 l sample was centrifuged through a 1.5-ml sephadex column equilibrated with flux buffer (fb, 300 mm k - isethionate, 1 mm kf or kcl, 25 mm hepes, ph 7) and was diluted 20-fold into a stirred chamber containing 3.8 ml fb . Halide concentration in the suspension was continuously monitored with a f or cl electrode amplified through a ph meter and digitized at 5 hz sampling frequency . Efflux was initiated by adding 1 m valinomycin, and after several minutes 30 mm octylglucoside was added to obtain the 100% efflux level . Efflux rates were calculated after calibration with 25 m additions of naf or nacl . For experiments with the bpe n43d mutant, fb contained an additional 100 mm na - isethionate and 25 mm ches buffer . Single - channel block by monobodies was recorded in planar phospholipid bilayers exactly as described28 . Diffraction data for bpe - s7 were processed by the xia2 pipeline33 to xds34 and scaled using aimless35 . The space group was determined to be p21212 with two bpe dimers and four s7 monobodies in the asymmetric unit (extended data figure 1). A phasing strategy was devised that used pre - derivatisation of bpe mutated with a single cysteine residue (e94c) with hg (ii) acetate prior to crystallisation (see above). None of the native crystals were isomorphous with the hg derivatised crystals (riso> 40%), despite having similar cell dimensions . Indeed, hg derivatised crystals were observed to diffract x - rays to slightly higher resolution than native crystals, therefore effort was directed at these samples for phasing and refinement . The four hg sites were located using the single wavelength anomalous dispersion (sad) method as implemented in shelx36 with the positions further refined and initial phases calculated using sharp37 with solvent flattening in solomon38 . To improve the phases a second and third dataset were also collected at the se edge using both hg and seleno - l - methionine derivatized protein and another hg derivatised dataset respectively (extended data table 1). All 16 se plus 4 hg sites were located using shelx and this dataset was combined with the initial 3.6 angstrom hg derivatized data . We did not observe higher resolution diffraction in the native crystals, which typically gave diffraction between 3.6 - 3.8 angstroms . Our highest resolution dataset with optimal scaling statistics was one of the hg - derivatised crystals, we therefore used this dataset for subsequent refinement of the model built into the experimental electron density maps calculated from sharp (see below). For the bpe - l2 crystals, phases were calculated using molecular replacement as implemented in phaser39 using the experimentally determined bpe model and a homology model of the l2 monobody using a previously determined structure of a loop - library monobody (pdb: 3rzw). The electron density maps clearly showed major differences in the selected, variable regions of the monobody . Phases were calculated using se - sad with 8 se sites, and processed as above . The experimental electron density maps were of exceptional quality following phase extension to the highest resolution shell of 2.58 . Data were collected at advanced light source beamlines 8.2.1 and 8.2.2, and diamond light source, beamlines i24 and i04 . For the bpe - s7 complex structure, a model for the channel was built into the experimental electron density maps calculated from sharp using o40 with sigma - a - weighted 2fo - fc and mfo - dfc electron density maps . The s7 monobodies were initially built using a homology model based a previously determined structure of a side library monobody (pdb: 4jeg). The partial models were further cycled back into phase calculation in sharp to improve the initial solvent envelope used for the solvent flipping procedure . The amino acid side chains were then built using the se and hg sites to determine the correct register . Refinement of the bpe - s7 model was carried out in refmac542,43 against the highest resolution dataset for these crystals, 3.6, which came from one of the hg - derivatised crystals used for phasing (extended data table 1). No prior phase information was used during the refinement, however refinement was improved following anisotropic truncation of the structure factors . To avoid biasing the model, ncs the ec2-s9 model was built directly into the experimental maps, using se sites to ensure the correct register, and then monobodies were placed by molecular replacement using phaser with a homology model based on s7 . The bpe - l2 model was built into the electron density maps calculated from phaser following iterative rounds of structure refinement in phenix45 and refmac5 . The asymmetric unit is shown in green and red (channel and monobody, respectively), and symmetry mates are shown in black and blue . Left panel: right panel: single channel recording of bpe in the presence of 200 nm l2 . Channels were recorded in the presence of 300 mm n - methyl - glucamine - fluoride, from which all small cations were rigorously excluded . Left panel: cartoon schematic of ec2 with s9 monobodies bound, coloured as bpe in figure 1b . Right panel: cartoon view of tm4 from ec2, with the solvent flattened electron density map calculated from sharp contoured at 1.8 sigma (blue), and anomalous difference density from seleno - l - methionine contoured at 5 sigma (magenta). Upper three panels: f- transport from liposomes by bpe mutants f82i, f85i, and n43d, in the presence and absence of 6 um blocking monobody . F- efflux from proteoliposomes (0.2 g protein / mg lipid for phe mutants; 1 g protein / mg lipid for n43d) was monitored with a f electrode and normalized against total trapped f. lower panel: f dump by f85i measured at ph 7 and ph 9 . Highly conserved residues are shaded in grey . For the eukaryotic sequences, residues expected to line pore 2, the pore mostly encompassed by the c - terminal domain, are colored red . For details on derivatisation see supplementary information mn (i) half - set correlation as reported by aimless phasing power = rms (|fh| / ((fh + fp)-(fph))) analogous experiments in which cl efflux was measured gave no detectable activity in any samples . Estimated based on single channel currents.
Ependymomas are relatively rare neuroepithelial tumors and account for 3 to 7% of all central nervous system tumors . The incidence of ependymomas is more frequent in children, and 50% occur in children <5 years of age . Infratentorial locations of ependymomas are more frequent in infants and childhood, whereas supratentorial ependymomas are more often seen in adults.1 ependymal tumors are closely related to the ventricular system and central canal . They can be observed extradurally in the sacral region and in the subarachnoidal space of the hemispheres . The most common location for infratentorial ependymomas is inside the fourth ventricle.2 the clinical signs and symptoms of intracranial ependymomas depend on the location, size of the tumor, and the age of the patient . The symptoms in posterior fossa ependymomas are related to increased intracranial pressure from hydrocephalus caused by obstruction of the fourth ventricle . Ataxia, dizziness, hemiparesis, and visual disturbance may add to the clinical picture.1 2 the current imaging protocol for the diagnosis is magnetic resonance imaging (mri). The most characteristic finding on mri is a downward extrusion of the tumor through the foramen of magendie into the cervical subarachnoid cervical space or through the foramen of luschka into the cerebellopontine cistern.3 4 this presentation highlights the requirement for close follow - up of grade ii ependymomas for anaplastic transformation . His eyes were open spontaneously; however, his left eye was looking at medial and downside, and his left eye gaze was limited to upside and lateral . An infratentorial brain tumor in the median and right cerebellar area was found on contrast mri . Axial initial magnetic resonance imaging scans show posterior fossa mass filled in fourth ventricle (a) with nonhomogeneous slight contrast enhancement (b). Severe hydrocephalus can be seen with temporal horn filling secondary to the obstruction of the fourth ventricle . Postoperative axial (c) and coronal contrasted images (d) show complete resection of the mass with opening of the fourth ventricle and relaxation of the temporal horns . The patient presented with vomiting and visual disturbance to the pediatric emergency department 12 months later . On the second operation, the tumor was hard to aspirate with the cavitron ultrasonic surgical aspirator (sonoca 400, sring gmbh, quickborn, germany) and was adherent to the brainstem and lower cranial nerves . Only subtotal extirpation could be achieved (fig . The recurrent tumor showed anaplastic features such as nuclear pleomorphisms and necrosis with pseudopalisading (fig . 3). Postcontrast axial (a) and coronal (b) images show regrowth of the mass lesion with strong contrast uptake . (a) moderately cellular tumor composed of monomorphic cells with round to oval nuclei containing salt and pepper pattern of chromatin . Radially arranged ependymal cell processes become thinner toward the vascular wall leaving an acellular zone around the blood vessel, called perivascular pseudorosette, a key histologic feature for ependymoma (hematoxylin and eosin [h&e] 100). After the second operation (b) abundant endothelial proliferation, microvascular proliferation, hypercellularity with nuclear hyperchromasia, pleomorphism, numerous mitoses, and pseudopalisading necrosis warrants a diagnosis of anaplastic ependymoma when seen throughout the lesion (h&e 200). Moreover (c), focus of coagulative necrosis, nuclear pseudopalisading was prominent around the necrotic areas, tumor cells oriented closer to viable areas emphasizing anaplastic changes (h&e 200). Ki-67 immunolabeling index is an independent prognostic factor and accurate predictor of outcome in patients with intracranial ependymoma (d). The index was 10% in the first operation that increased to 35% for our case in this image (ki-67 200). Bailey and cushing recognized ependymomas as an independent entity in their first brain tumor classification in 1926 . Variants were subsequently established . The most recent world health organization (who) classification identified four variants of ependymal tumors in addition to three grades of malignancy.5 6 these four variants are myxopapillary ependymoma, subependymoma, tanycytic ependymoma, and clear cell ependymoma.3 6 7 myxopapillary ependymomas and subependymomas are slow - growing tumors classified as grade i. both lesions are easily recognizable lesions; grade iii ependymomas have increased cellularity and brisk mitotic activity, often associated with microvascular proliferation and pseudo palisading necrosis . Their results showed that poor clinical results paralleled histopathologic grade.8 the outcome of children with intracranial ependymomas has improved significantly during the last few years . Recent reports demonstrate a 5-year overall survival rate not more than 40 to 65% in children with intracranial ependymomas.9 10 11 12 pediatric oncology group findings suggest that the poor survival estimates frequently reported for infants are most likely related to the higher incidence of infratentorial tumors, the lower rate of complete resection, and the delay of the administration of radiation therapy.13 the extent of surgical resection appears to be the other important prognostic factor in outcome for children with intracranial ependymomas . In patients with complete removal, 5-year survival is 67 to 80%; 5-year progression - free survival is 51 to 75%.14 15 16 studies have shown that patients with ependymoma who receive radiation therapy have a better outcome than who are not treated with irradiation.17 18 however, there is no standard protocol for optimal management for children with intracranial ependymomas . Total / near - total surgical resection with an acceptable neurologic outcome combined with postoperative radiation therapy is the current treatment modality . Immediate postoperative irradiation is not widely accepted in the treatment of children <3 years of age . Stereotactic radiosurgery has been applied to manage recurrent or residual intracranial tumor in some institutions . Some reports described that adjuvant chemotherapy did not influence survival of patient with anaplastic ependymomas.18 19 20 the most common location for infratentorial ependymoma is within the fourth ventricle . The selected surgical approach may be a suboccipital craniotomy with or without c1 laminectomy depending on the extension of the tumor in the cervical region . Surgical resection appears to the most important prognostic factor; therefore the best effort to perform total or near - total resection should be made.21 22 in conclusion, the ependymomas of the children are difficult to control, and surgical removal remains the mainstay of the treatment . Despite a gross total resection, the correct grading of intracranial ependymomas may be difficult for the anaplastic variant because the common criteria for anaplasia are not completely reliable for all cases.13 22 ependymomas in young infants have a worse prognosis than older children, so we need a grading scheme with a proven general ability to distinguish grades and to predict the evolution of individual cases.23 also new radiation therapy techniques and chemotherapeutic agents need to be developed . Postoperative irradiation is not recommended in the treatment of grade ii ependymomas for children <3 years of age.
Frontotemporal dementia (ftd) is the second most common type of presenile dementia, and a clinically, genetically and pathologically heterogeneous disorder [1, 2]. Four clinical subtypes can be distinguished: the behavioural variant of ftd (bvftd), semantic dementia (sd), progressive non - fluent aphasia (pnfa), and ftd with motor neuron disease (ftd - mnd). Frontotemporal lobar degeneration (ftld) is the common underlying pathology of all four clinical variants, and can be divided into ftld with tau - positive immunoreactive inclusions (ftld - tau) and ftld with ubiquitin - positive immunoreactive inclusions (ftld - u). After the tdp-43 protein was found to be the major constituent of ubiquitin - positive inclusions, the latter term was changed to ftld - tdp . However, the identification of tdp-43-negative inclusions in some ftld - u cases has resulted in the designation of a new neuropathological subtype, atypical ftld - u [46]. Very recently, the name of this subtype has been changed into ftld - fused in sarcoma (ftld - fus) by the observation of positive staining of these inclusions with antibody against fus protein . The characteristic features of ftld - fus are an early - onset ftd with severe progressive psychobehavioural changes, a negative family history and striking atrophy of the striatum at neuropathological examination [47]. Its exact frequency is yet unknown, and neuroimaging features may differentiate it from other subtypes during life . The aim of this study was to determine the frequency of ftld - fus in our ftld - u cases and to describe the clinical, neuroimaging and neuropathological features of ftld - fus . Furthermore, we estimated the prevalence of ftld - fus in our clinical cohort of ftd on the basis of a combination of specific clinical features . Patients with ftd were ascertained in an ongoing genetic - epidemiologic study conducted in the netherlands since 1994 [1, 8, 9], after referral to the out - clinic department of the erasmus medical center, or after a visit in nursing homes and psychogeriatric hospitals by the research physician . Detailed clinical history was obtained from the spouses and first - degree relatives using a checklist of behavioural and cognitive changes, and motor neuron signs . The age at onset was defined as the age at which the first symptom compatible with ftd diagnosis was observed by a close relative or caretaker [1, 9]. During the neurological examination carried out in all patients, special attention was paid to the presence of extrapyramidal and motor neuron disease signs . Data on family history were provided by a spouse or first - degree relative using a structured questionnaire . Family history was defined as positive if patients had at least one - first - degree relative with dementia, parkinsonism, or mnd, irrespective of their age of onset . Neuropsychological evaluation consisted of tests for memory functions (rey figure, 15-word test), attention and concentration, executive functions (stroop, trailmaking a and b, wisconsin card sorting test, wais subtest substitution), language (boston naming test, the dutch revised version of the semantic association test), and visuoconstructive and visuospatial skills (clock drawing, block design of the wais), and was performed in a subset of patients at our out - clinic department . Due to the variation in test batteries, a detailed comparison between subgroups was not possible . Mri scans performed between 1990 and 2008 were available for evaluation in 136 out of 387 patients . Available t1-weighted mr, t2-weighted mr, proton - density (pd) weighted mr, and fluid attenuated inversion recovery (flair) mr images were used for evaluation . The severity of cortical and caudate atrophy on mri was evaluated and semi - quantitatively rated according to a three - point scale: (0) normal caudate nucleus; (1) mild or moderate atrophy of the caudate nucleus, either still bulging into the lateral ventricle or with a flat contour; (2) severe atrophy with no visible caudate nucleus . The presence of caudate atrophy was evaluated by a radiologist and neurologist blinded to clinical and pathological findings . Mutation screening of all exons and exon intron regions of mapt, grn and chmp2b genes was performed in all patients with a positive family history, and in a subset of patients with sporadic ftd (n = 72) as previously described [1, 9]. Two hundred thirty - two patients died during a follow up period of 14 years, of which 74 patients underwent brain autopsy . Brain autopsy was carried out within four hours of death according to the legal and ethical code of conduct of the netherlands brain bank . Macroscopic inspection of the brain included the frontal, temporal, parietal, and occipital lobes, cerebellum, hippocampus, basal ganglia and substantia nigra . Tissue blocks were taken from all cortical areas, hippocampus, amygdala, basal ganglia, substantia nigra, pons, medulla oblongata, cerebellum, and cervical spinal cord . They were embedded in paraffin blocks and subjected to routine staining with haematoxylin - eosin, bodian, methenamine - silver, and congo red . The severity of neuron loss was scored as absent, mild, or moderate - severe . Immunohistochemistry was performed with antibodies directed against: hyperphosphorylated tau (at-8, innogenetics, ghent, belgium; 1:400); ubiquitin (anti - ubiquitin, dako, glostrup, denmark; 1:500, following 80c antigen retrieval); -amyloid protein (anti - beta amyloid, dako, glostrup, denmark; 1:100, following formic acid pre - treatment); -synuclein (anti--synuclein; zymed laboratories, san francisco, california, usa; undiluted, following formic acid pre - treatment); poli - ubiquitin - binding protein p62 (bd biosciences pharmingen, san diego, ca, usa; 1:200, following pressure cooking); tdp-43 (biotech, chicago, il, usa; 1:100, following pressure cooking); and internexin (anti - alpha - internexin, invitrogen, camarillo, ca, usa, 1:100, following pressure - cooking), fus (sigma - aldrich anti - fus; 1:251:200 with initial overnight incubation at room temperature, following pressure cooking). Antigen retrieval was done either for 30 min in 0.1 m sodium citrate buffer at 80c and ph 7.7 or using pressure cooking in 0.1 m sodium citrate buffer (ph 6) for 5 min . Pre - treatment with 70% formic acid was done for 5 min (-synuclein and -amyloid). Endogenous peroxidase activity was inhibited by incubation for 30 min in pbs - hydrogen peroxide - sodiumazide solution (100 ml 0,1 m pbs + 2 ml 30% h2o2 + 1 ml natriumazide). The histostain - plus broad - spectrum kit dab (zymed, san francisco, california, usa) was used and slides were counterstained with mayer s haematoxylin and mounted in entellan . Neuropathological examination of brains from the 74 autopsied patients with clinical ftd revealed 70 brains with ftld (ftld - u in 37, ftld - tau in 32 and ftld with no inclusions (ftld - ni) in one), whereas familial creutzfeldt - jakob disease (fcjd) was diagnosed in two brains, and alzheimer s disease (ad) in the remaining two . The study was approved by the medical ethical committee at the erasmus mc - university medical center rotterdam . For each patient, a spouse or first - degree relative of the patient gave written informed consent . Thirty - three out of 37 ftld - u cases (0.89; 95% ci: 0.791.00) showed positive staining with the tdp-43 antibody and were reclassified as ftld - tdp, whereas four cases had ubiquitin - positive, tdp-43-negative inclusions . All four ftld - u patients with tdp-43 negative inclusions showed positive staining with the fus antibody and were designated as ftld - fus . Ftld - fus was present in 4 out of all 70 ftld brains (0.06; 95% ci: 0.000.11), and in four out of 37 ftld - u cases (0.11; 95% ci: 0.000.21). Demographic and clinical data of the four patients with ftld - fus are presented in table 1 . All four patients had clinical bvftd and a negative family history, and three out of four patients had an age at onset before the age of 40 . The presenting symptoms varied among these four cases . Two patients presented with obsessive compulsive behaviour, in particular showing extremely parsimonious behaviour . Case 1 and case 3 showed sexually disinhibited behaviour (case 1 frequently visited prostitutes, while married). Three out of four patients shoplifted several shops, especially the two patients who presented with obsessive compulsive behaviour . Hyperorality has developed in all four patients, and was the presenting symptom in three patients . Visual hallucinations of deformed paintings were mentioned in the case of one patient, and persecution delusions in another . All patients developed language problems later in the course of the disease, with economy of utterances in all, perseverations (n = 3), echolalia (n = 2), stereotypy (n = 2) and eventually mutism in all . Neurological examination was unremarkable without signs of motor neuron disease, pyramidal or extrapyramidal dysfunction, except for mild left - sided cogwheeling in one patient.table 1demographic, clinical and mri features of ftld - fus casescase 1case 2case 3case 4gendermalefemalefemalefemaleonset (years)49303235death (years)59464145family historynegativenegativenegativenegativeftd subtypebvftdbvftdbvftdbvftdprominent symptomssexual disinhibitionvisual hallucinations hyperoralityobsessive compulsivepersecution delusionsextreme parsimonyshopliftinghyperoralityapathysexual disinhibition shopliftinghyperoralityobsessive compulsiveparsimonyshopliftingneurological examinationno abnormalitymild cogwheeling leftno abnormalityno abnormalityneuropsychological evaluationattention and concentration executive functions memory perseverationsattention and concentration executive functions perseverations impulsive stereotypicalattention and concentration executive functions mild memory attention and concentration executive functions impulsivecdr3323mrift++f+ t++f+ft++cau++cau++cau+cau++clinical dementia rating scale at ascertainment; f frontal, t temporal, cau caudate, + mild - moderate atrophy, + + severe atrophy demographic, clinical and mri features of ftld - fus cases clinical dementia rating scale at ascertainment; f frontal, t temporal, cau caudate, + mild - moderate atrophy, + + severe atrophy neuropsychological testing revealed impaired attention and concentration, and executive deficits, with normal orientation, memory and visuoconstructive functions in all four patients, except for evident memory problems in one . Mri showed severe frontal and/or temporal atrophy in three patients, and mild to moderate frontal atrophy in one . All four patients had mild - moderate (n = 1), or severe caudate atrophy (n = 3), at a mean duration of illness of 63 months (range 16119 months) (figure 1). Genetic screening revealed no mutations in mapt or grn in all four patients, and in chmp2b genes in three patients . Dna was not available anymore in case 1 to screen for chmp2b gene mutations.fig . D patient 4 with severe atrophy (t1-weighted mr image) mri scans of ftld - fus cases . D patient 4 with severe atrophy (t1-weighted mr image) the frequency of ftld - fus in our clinical cohort was estimated by using negative family history, age at onset 40 years and bvftd as distinctive features for ftld - fus patients . We selected patients with a negative family history and bvftd (n = 126). We stratified our patients according to age at onset and made three subgroups: age at onset 40 years (n = 11),> 40 to 50 years (n = 23), and> 50 years (n = 92). Ftld - fus was found in three out of 11 patients (0.27) in the group with age at onset 40 years, one out of 23 (0.04) in the group of patients with age at onset> 40 to 50 years, and was absent in the group of 92 patients with age at onset> 50 years . Ftld - fus is not more frequently found in patients with an age at onset 40, than in patients with an age at onset> 40 to 50 years (fisher s exact test, p = 0.089). However, ftld - fus is more frequently found in patients with an age at onset 40 years than in patients with an age at onset> 50 years (fisher s exact test, p = 0.001). The estimated prevalence of ftld - fus for the total clinical ftd group based on family history, age at onset 40 years and bvftd as clinical subtype, is 11 out of 387 patients (0.03; 95% ci: 0.010.05). We reviewed all available mris of all clinical ftd patients (n = 136) for the presence of caudate atrophy . Caudate atrophy was present in 10 out of 136 mris (0.07; 95% ci: 0.030.12). Seven of these 10 patients had a negative family history, onset 40 years and bvftd, of whom three had pathological proven ftld - fus . Of the remaining three cases with caudate atrophy, two had a grn mutation and had an age at onset> 40 years, and the third patient had ftld - fus with an age at onset of 49 years (case 1). The interval between onset and time of mri scanning between cases with and without caudate atrophy did not differ (36 months in cases with caudate atrophy as well as in cases without caudate atrophy). Seven of the eleven patients with a negative family history, onset 40 years and bvftd had caudate atrophy . Brain weight, gross atrophy and depigmentation of the substantia nigra are summarized in table 2 . The most characteristic feature was the striking atrophy of the caudate in all four cases.table 2anatomical distribution and severity of degeneration in ftld - fus casescase 1case 2case 3case 4brain weight (g)1,1718681,040870gross atrophy / depigmentationft++ft++ft++ft++hipp++hipp++hipp++hipp++str++str++str++str++sn+sn++sn+frontal degeneration+++++++ nci / dn++++ nii+temporal degeneration++++++++ nci / dn+++ niihippocampus degeneration++++++++ nci+++++++ nii++++striatum degeneration++++++++ nci / dn++++ niisubstantia nigra degeneration++++++++ ncinci and dns stained positive for ubiquitin, p62, and fus immunohistochemistry only . Nii stained positive for ubiquitin, and fus immunohistochemistry onlyf frontal, t temporal, hipp hippocampus, str striatum, sn substantia nigra, nci neuronal cytoplasmatic inclusions, nii neuronal intranuclear inclusions, dn dystrophic neurites, absent, + mild, + + moderate - severe anatomical distribution and severity of degeneration in ftld - fus cases nci and dns stained positive for ubiquitin, p62, and fus immunohistochemistry only . Nii stained positive for ubiquitin, and fus immunohistochemistry only f frontal, t temporal, hipp hippocampus, str striatum, sn substantia nigra, nci neuronal cytoplasmatic inclusions, nii neuronal intranuclear inclusions, dn dystrophic neurites, absent, + mild, + + moderate - severe all four brains showed severe neuronal loss of ca1 and subiculum consistent with hippocampal sclerosis, as well as severe neuronal loss of the caudate nucleus . The frontal and/or temporal cortices showed moderate - to - severe neuronal loss in all, whereas the parietal cortex was mildly affected in only one brain . There was no involvement of the pons, medulla oblongata, cerebellum, or spinal cord . Immunohistochemistry revealed many ubiquitin, p62, and fus - positive, tdp-43-negative neuronal cytoplasmatic inclusions (nci) in the granular cells of the dentate gyrus of the hippocampus, whereas the number of nci and dystrophic neurites (dn) in the frontotemporal cortex and caudate nucleus was low . Several ubiquitin and fus - positive, p62 and tdp-43-negative neuronal intranuclear inclusions (nii) of variable shapes (straight, worm - like, c - shaped, or ring - like) were found in the granular cells of the dentate gyrus in all four brains (fig . 2a, c, d); two brains also had nii in the ca4 pyramidal neurons, including one with nii in ca3 (case 1). The antibody against the ubiquitin - binding protein p62 gave positive staining of nci and dn, but not with nii (fig . There were no inclusions found in the substantia nigra, pons, medulla, or cerebellum of any of the four brains . Ubiquitin - positive neuronal intranuclear inclusions (nii) in the granular cells of the dentate gyrus, which are worm - like (a). Only the ubiquitin - positive neuronal cytoplasmatic inclusions (nci) stained positive with p62 (b); nii did not . Tdp-43-immunohistochemistry stained only normal nuclei, and stained neither ubiquitin - positive nci nor nii (c). Ubiquitin - positive neuronal intranuclear inclusions (nii) in the granular cells of the dentate gyrus, which are worm - like (a). Only the ubiquitin - positive neuronal cytoplasmatic inclusions (nci) stained positive with p62 (b); nii did not . Tdp-43-immunohistochemistry stained only normal nuclei, and stained neither ubiquitin - positive nci nor nii (c). Demographic and clinical data of the four patients with ftld - fus are presented in table 1 . All four patients had clinical bvftd and a negative family history, and three out of four patients had an age at onset before the age of 40 . The presenting symptoms varied among these four cases . Two patients presented with obsessive compulsive behaviour, in particular showing extremely parsimonious behaviour . Case 1 and case 3 showed sexually disinhibited behaviour (case 1 frequently visited prostitutes, while married). Three out of four patients shoplifted several shops, especially the two patients who presented with obsessive compulsive behaviour . Hyperorality has developed in all four patients, and was the presenting symptom in three patients . Visual hallucinations of deformed paintings were mentioned in the case of one patient, and persecution delusions in another . All patients developed language problems later in the course of the disease, with economy of utterances in all, perseverations (n = 3), echolalia (n = 2), stereotypy (n = 2) and eventually mutism in all . Neurological examination was unremarkable without signs of motor neuron disease, pyramidal or extrapyramidal dysfunction, except for mild left - sided cogwheeling in one patient.table 1demographic, clinical and mri features of ftld - fus casescase 1case 2case 3case 4gendermalefemalefemalefemaleonset (years)49303235death (years)59464145family historynegativenegativenegativenegativeftd subtypebvftdbvftdbvftdbvftdprominent symptomssexual disinhibitionvisual hallucinations hyperoralityobsessive compulsivepersecution delusionsextreme parsimonyshopliftinghyperoralityapathysexual disinhibition shopliftinghyperoralityobsessive compulsiveparsimonyshopliftingneurological examinationno abnormalitymild cogwheeling leftno abnormalityno abnormalityneuropsychological evaluationattention and concentration executive functions memory perseverationsattention and concentration executive functions perseverations impulsive stereotypicalattention and concentration executive functions mild memory attention and concentration executive functions impulsivecdr3323mrift++f+ t++f+ft++cau++cau++cau+cau++clinical dementia rating scale at ascertainment; f frontal, t temporal, cau caudate, + mild - moderate atrophy, + + severe atrophy demographic, clinical and mri features of ftld - fus cases clinical dementia rating scale at ascertainment; f frontal, t temporal, cau caudate, + mild - moderate atrophy, + + severe atrophy neuropsychological testing revealed impaired attention and concentration, and executive deficits, with normal orientation, memory and visuoconstructive functions in all four patients, except for evident memory problems in one . Mri showed severe frontal and/or temporal atrophy in three patients, and mild to moderate frontal atrophy in one . All four patients had mild - moderate (n = 1), or severe caudate atrophy (n = 3), at a mean duration of illness of 63 months (range 16119 months) (figure 1). Genetic screening revealed no mutations in mapt or grn in all four patients, and in chmp2b genes in three patients . Dna was not available anymore in case 1 to screen for chmp2b gene mutations.fig . D patient 4 with severe atrophy (t1-weighted mr image) mri scans of ftld - fus cases . The frequency of ftld - fus in our clinical cohort was estimated by using negative family history, age at onset 40 years and bvftd as distinctive features for ftld - fus patients . We selected patients with a negative family history and bvftd (n = 126). We stratified our patients according to age at onset and made three subgroups: age at onset 40 years (n = 11),> 40 to 50 years (n = 23), and> 50 years (n = 92). Ftld - fus was found in three out of 11 patients (0.27) in the group with age at onset 40 years, one out of 23 (0.04) in the group of patients with age at onset> 40 to 50 years, and was absent in the group of 92 patients with age at onset> 50 years . Ftld - fus is not more frequently found in patients with an age at onset 40, than in patients with an age at onset> 40 to 50 years (fisher s exact test, p = 0.089). However, ftld - fus is more frequently found in patients with an age at onset 40 years than in patients with an age at onset> 50 years (fisher s exact test, p = 0.001). The estimated prevalence of ftld - fus for the total clinical ftd group based on family history, age at onset 40 years and bvftd as clinical subtype, is 11 out of 387 patients (0.03; 95% ci: 0.010.05). We reviewed all available mris of all clinical ftd patients (n = 136) for the presence of caudate atrophy . Caudate atrophy was present in 10 out of 136 mris (0.07; 95% ci: 0.030.12). Seven of these 10 patients had a negative family history, onset 40 years and bvftd, of whom three had pathological proven ftld - fus . Of the remaining three cases with caudate atrophy, two had a grn mutation and had an age at onset> 40 years, and the third patient had ftld - fus with an age at onset of 49 years (case 1). The interval between onset and time of mri scanning between cases with and without caudate atrophy did not differ (36 months in cases with caudate atrophy as well as in cases without caudate atrophy). Seven of the eleven patients with a negative family history, onset 40 years and bvftd had caudate atrophy . Brain weight, gross atrophy and depigmentation of the substantia nigra are summarized in table 2 . The most characteristic feature was the striking atrophy of the caudate in all four cases.table 2anatomical distribution and severity of degeneration in ftld - fus casescase 1case 2case 3case 4brain weight (g)1,1718681,040870gross atrophy / depigmentationft++ft++ft++ft++hipp++hipp++hipp++hipp++str++str++str++str++sn+sn++sn+frontal degeneration+++++++ nci / dn++++ nii+temporal degeneration++++++++ nci / dn+++ niihippocampus degeneration++++++++ nci+++++++ nii++++striatum degeneration++++++++ nci / dn++++ niisubstantia nigra degeneration++++++++ ncinci and dns stained positive for ubiquitin, p62, and fus immunohistochemistry only . Nii stained positive for ubiquitin, and fus immunohistochemistry onlyf frontal, t temporal, hipp hippocampus, str striatum, sn substantia nigra, nci neuronal cytoplasmatic inclusions, nii neuronal intranuclear inclusions, dn dystrophic neurites, absent, + mild, + + moderate - severe anatomical distribution and severity of degeneration in ftld - fus cases nci and dns stained positive for ubiquitin, p62, and fus immunohistochemistry only . Nii stained positive for ubiquitin, and fus immunohistochemistry only f frontal, t temporal, hipp hippocampus, str striatum, sn substantia nigra, nci neuronal cytoplasmatic inclusions, nii neuronal intranuclear inclusions, dn dystrophic neurites, absent, + mild, + + moderate - severe all four brains showed severe neuronal loss of ca1 and subiculum consistent with hippocampal sclerosis, as well as severe neuronal loss of the caudate nucleus . The frontal and/or temporal cortices showed moderate - to - severe neuronal loss in all, whereas the parietal cortex was mildly affected in only one brain . There was no involvement of the pons, medulla oblongata, cerebellum, or spinal cord . Immunohistochemistry revealed many ubiquitin, p62, and fus - positive, tdp-43-negative neuronal cytoplasmatic inclusions (nci) in the granular cells of the dentate gyrus of the hippocampus, whereas the number of nci and dystrophic neurites (dn) in the frontotemporal cortex and caudate nucleus was low . Several ubiquitin and fus - positive, p62 and tdp-43-negative neuronal intranuclear inclusions (nii) of variable shapes (straight, worm - like, c - shaped, or ring - like) were found in the granular cells of the dentate gyrus in all four brains (fig . 2a, c, d); two brains also had nii in the ca4 pyramidal neurons, including one with nii in ca3 (case 1). The antibody against the ubiquitin - binding protein p62 gave positive staining of nci and dn, but not with nii (fig . There were no inclusions found in the substantia nigra, pons, medulla, or cerebellum of any of the four brains . Ubiquitin - positive neuronal intranuclear inclusions (nii) in the granular cells of the dentate gyrus, which are worm - like (a). Only the ubiquitin - positive neuronal cytoplasmatic inclusions (nci) stained positive with p62 (b); nii did not . Tdp-43-immunohistochemistry stained only normal nuclei, and stained neither ubiquitin - positive nci nor nii (c). Ubiquitin - positive neuronal intranuclear inclusions (nii) in the granular cells of the dentate gyrus, which are worm - like (a). Only the ubiquitin - positive neuronal cytoplasmatic inclusions (nci) stained positive with p62 (b); nii did not . Tdp-43-immunohistochemistry stained only normal nuclei, and stained neither ubiquitin - positive nci nor nii (c). This study showed a frequency of ftld - fus of six percent of all our pathologically proven ftld cases, and 11 percent of the ftld - u cases . We estimated a frequency of ftld - fus of three percent in the total series of patients with clinical ftd, based on the clinical variables age at onset, family history, and clinical subtype . All four ftld - fus cases presented with severe behavioural changes, young age at onset, negative family history, and caudate atrophy on mri . Ftld - fus cases were pathologically characterized by striking atrophy of the caudate nucleus, ubiquitin and fus - positive, p62 and tdp-43-negative nii with remarkable morphology . The present observation of three percent of ftld - fus in a large clinical cohort of ftd patients gives a frequency estimation of this subtype for the first time . Of the four ftld - fus patients, three had an age at onset 40 years, negative family history, and clinical presentation of bvftd . As 11 patients within the age group 40 years of our cohort meet the combination of these features, this suggests an even higher frequency in this age group . Our observed age distribution is in line with that of the other reported series of ftld with tdp-43 negative inclusions (28 to 63 years) [46]. Delusions and hallucinations in the present cases may be discriminative features of this type of ftld, as their occurrence is uncommon for the total ftd group . The initial diagnosis of a primary psychiatric disorder has been considered in one of the present patients, as well as in several other recently reported cases [4, 5]. The occurrence of disinhibition and obsessive compulsive behaviour was reported in the present cases, while aggressive behaviour was reported in others . Although we did not have pathological verification of four other patients, the combination of age at onset 40 years, negative family history, presence of severe behavioural changes and caudate atrophy is highly suggestive of ftld - fus . Our suggested prevalence of three percent could be an underestimate, as ~30 percent of all cases described so far had an age at onset above 40 years, and not all patients in our cohort had an available mri to semi - quantitatively score the caudate atrophy [46]. The observation of caudate atrophy on mri in our ftld - fus cases during life has not been reported so far, but is in line with the presence of caudate atrophy and severe neuron loss at neuropathological examination . Neuroimaging features during life were not explicitly mentioned in three pathological studies on tdp-43-negative ftld - u cases (ftld - fus in the new nomenclature) [1517]. Although smaller caudate volumes may be seen in the end - stage of ftd [18, 19], severe caudate atrophy was already detectable in the early disease stage of the present ftld - fus cases . Prominent caudate atrophy is characteristic for huntington s disease, but chorea or other extrapyramidal signs were absent in the present cases . The occurrence of ftld - fus in 11% of our ftld - u cases lies between the frequencies reported in other series [46], and emphasizes the idea that alternative pathophysiological mechanisms exist in the clinicopathological spectrum of ftld and motor neuron disease . The fus protein containing 526 amino - acids has structural similarities with tdp-43 and is involved in dna repair and the regulation of transcription, rna splicing, and export to cytoplasm [7, 20, 21]. Mutations in the fus gene located on chromosome 16 have recently been identified in familial als with ubiquitin and fus - positive, tdp-43-negative inclusions [20, 21]. The tdp-43-negative, fus - positive cytoplasmatic inclusions have also been found in neuronal intermediate filament inclusion disease (nifid) cases, whereas their presence has yet to be investigated in other related disorders: ftld caused by chmp2b mutations, basophilic inclusion body disease (bibd), and als due to sod1 mutations [2326]. The remarkable vermiform or c - shaped morphology of the nii reported in all cases seems to be pathognomic for ftld - fus and differs from the lentiform or cat - eye shaped nii in grn mutations [46, 2729]. Moreover, nii of grn mutations shows a different immunohistochemical pattern with tdp-43 positive and fus negative staining . The relevance of exclusive p62-positive staining of the cytoplasmatic inclusions (and not of nii) still has to be determined . The question is whether the p62 protein is merely entrapped in these inclusions or plays a pathophysiological role in these disorders . The recent finding of accumulation of hyperphosphorylated tau and neurodegeneration in mice with genetic inactivation of the p62 gene supports the latter hypothesis . A major drawback of the present study is the absence of a quantitative assessment of caudate atrophy on mri . Future prospective follow - up studies with voxel - based morphometry of the caudate nucleus on mri are needed to determine the progression of caudate atrophy over time in ftld - fus . In conclusion, ftld - fus age at onset 40 years, negative family history, bvftd and caudate atrophy on mri could be useful clinical predictors of ftld - fus as an underlying pathology in patients with clinical ftd . Larger samples of ftld - fus cases are needed to verify and to add new predictors for this clinicopathological subtype.
Although radical cystectomy with urinary diversion has been regarded as the standard treatment for muscle invasive bladder cancer (mibc), it is associated with high postoperative complication and mortality as well as decreased quality of life . As a result, different kinds of bladder sparing approaches have been proposed for mibc treatment . Partial cystectomy (pc) with pelvic lymph node dissection (plnd) combined with chemotherapy or radiotherapy, which offers complete tumor resection, accurate staging and good quality of life, is regarded as a good bladder sparing treatment modality . Even though, pc is still criticized for an unacceptable high recurrence rate . Recurrent bladder carcinoma after pc is usually correctly diagnosed by urologists, because of the appearance of typical papillary in ultrasonography or cystoscopy, and can be easily confirmed by tumor biopsy . However, in this case series, we presented 3 patients with rare deceptive benign appearance of recurrent mibc after pc, which delayed timely diagnosis and treatment for 2 of them . From january 2010 to december 2014, 93 consecutive patients underwent pc in our institution . Of these patients, 56 cases of pc with plnd were performed for mibc . With a median follow - up of 21 months (range 452 months), 16 patients (28.6%) of the 16 patients who had bladder tumor recurrence, 2 men were diagnosed as deceptive mibc recurrence after pc . During the same period of time, one another patient, who was referred to our hospital, presented the same characteristics of tumor recurrence in the course of disease . All the patients declined cystectomy after transurethral resection of bladder tumors (turbt) confirmed mibc, and pc with plnd was thus performed instead . As lesions of the 3 patients were within 2 cm to ureteral orifice, ureteral reimplantation was performed at the same time . All patients recovered from pc surgery uneventfully and received 6 cycles of gemcitabine and cisplatinchemotherapy after surgery . All interventions given were part of normal health care and ethicalapproval was thus not necessary needed . Lesions, measuring 2.5 1 cm, with cystitis glandularis appearance were found at the right lateral wall of bladder when the patient underwent cystoscopy 9 months after cystectomy . The pathology result of random biopsy at 3 different sites of the lesion showed cystitis glandularis with von brunn's nests proliferation . Two months later, the patient presented gross hematuria, and contrast - enhanced pelvic computed tomography (ct) revealed irregular thickening and significantly enhanced bladder wall . The size of the lesion was found slightly increased in cystoscopy; however, the pathology of random biopsy still showed cystitis glandularis . Turbt was then performed, and high - grade muscle invasive urothelial carcinoma with urothelialcystitis glandularis was diagnosed by pathological examination . Cystoscopic evaluation revealed polypoidlesion, measuring 2 1 cm, on the left bladder wall 6 months after pc . Turbt was carried out and the pathology showed high - grade muscle invasive urothelial bladder cancer . Cystectomy with orthotopicneo bladder diversion was thus performed, and the patient was now still alive without bladder tumor recurrence for 48 months . Polypoid lesions, measuring 1 1 cm, on the right bladder wall near the internal urethral orifice were found at cystoscopy 3 months after pc in another hospital . Pathologic examination of biopsy showed chronic bladder inflammation with proliferation of von brunn's nests . He was referred into our hospital 2 months later because of right renal area dull pain . However, computed tomography urography (ctu) revealed right - sided hydroureteronephrosis and thicken bladder wall with unclear boundary to the surrounding tissue (figure 1b, figure 1c). Comparison between the ct scan after tumor recurrence and before pc were made in figure 1 . Turbt was performed and the pathological evaluation revealed high - grade muscle invasive bladder urothelial carcinoma . The patient underwent cystectomy with ileal conduit diversion, and the gross pathologic examination showed that the bladder cancer had infiltrated the surrounding tissue with one lymph node metastasis . A. cystoscopy displayed cystitis glandularis appearance lesion (solid asterisk) on the right bladder wall near the internal urethral orifice; b. ctu confirmed hydroureteronephrosis (hollow asterisk) caused by mass on the right lateral bladder wall (black arrow); c. transverse ct image showed an irregular right lateral bladder wall thickened with unclear boundary to the surrounding tissue (black arrow); d. ct confirmed bladder mass on the right lateral bladder wall before bladder sparing treatment (white arrow). Bladder sparing treatment is considered as an important alternative treatment approach for mibc . Nowadays, various modalities of bladder - sparing methods have been reported and investigated, among which pc with plnd after completeness of turbt plus chemotherapy or radiotherapy is regarded as a rational one . It was reported that the 5-year cancer specific survival rate after pc bladder sparing treatment ranges from 67% to 69% . Although the 5-year survival rate of pc is comparable to radical cystectomy, and the quality of life for mibc patients have been greatly improved, this therapeutic approach has not yet been regarded as a standard treatment option for mibc because of lack of randomizedtrials . Critics of pc also argued that the tumor recurrence rate after pc was relatively high, which ranged from 19% to 58%, and two - thirds of tumor recurrence appeared during the first 2 years . As a result, one important component of bladder sparing treatment modality was vigilant surveillance after surgery, because early detection of tumor recurrence resulted in excellent outcome of salvage radical cystectomy . However, the window to salvage cystectomy was short, and the disease carried a poor prognosis once patients developed extravesical disease caused by delayed diagnosis . Regular cystoscopy and random biopsy of suspected lesion played a pivotal role in detecting early recurrence . However, in the present study, 3 patients showed deceptive early mibc recurrence with a cystitis glandularis crust covered on the surface after bladder sparing treatment, escaping random multiple biopsies . As a consequence, 2 patients missed the optimal opportunity for early diagnosis and delayed timely cystectomy . Enhanced ct and ctu were also the preferred method for bladder surveillance, which showed high accuracy for detecting and staging urinary tract cancer . Although biopsy revealed negative results in the present cases, ct or ctu showed enhanced and thickened bladder wall, which suggested highly suspicious of bladder cancer recurrence . Therefore, patients showed suspicious lesions in cystoscopy with negative biopsy, enhanced ct or ctu should be recommended for further evaluation rather than watchful waiting . Someinvasive variants, such as nested variant and microcystic carcinoma, might even mimic benign lesions, which may cause difficulties for pathologists in the differential diagnosis . However, in the present study, the pathological sections of the biopsy tissue obtained at cystoscopy of the 3 patients were blindly sent to 2 different pathologists for further evaluation after turbt confirmed mibc, the results were also suggestive of benign tissue, excluding the possibility of nested variant or microcysticurothelial carcinoma . The relationship between the formation of cystitis glandularis and mibc recurrence was unknown, but several factors might contribute to the deceptive appearance formation . First, such situation potentially reflected a response to bladder injury or chronic bladder inflammation caused by bladder surgery . In addition, ureteral reimplantation was reported to be associated with high recurrence and poor prognosis after pc . It was interesting that all patients with deceptive mibc recurrence had undergone ureteral reimplantation, which suggested that ureteral reimplantation might be a risk factor for such kind of recurrence . Early mibc recurrence after bladder sparing therapy could simultaneously occurred with cystitis glandularis caused by bladder surgery; this rare situation might lead to diagnosis of cystitis glandularis without realizing bladder cancer recurrence and missed the best treatment opportunity . The present cases served to remind and alert the urologists to be aware of the possibility of bladder cancer recurrence even when the biopsy of the bladder lesion was benign . As a result, timely pelvic enhanced ct and turbt were necessary when bladder lesion occurred after pc, avoiding the possibility of missing mibc recurrence and delaying timely cystectomy.
The success of radiotherapy (rt) depends not upon the expense and complexity involved, but upon the correctness of techniques . Correct portal - design calls for correct knowledge regarding the location of the target volumes to be treated . Traditional bony - landmarks may have been used as a surrogate, but they do not always correlate with the actual location of the soft - tissue target - volumes . The four - field - box (4fb) technique for cervical carcinoma is often utilized to improve dose homogeneity . The exact placement of the posterior border on the lateral portals of this technique is unfortunately not supported by stone - hard consensus; placing it at the s2-s3 junction may increase the chance of sparing rectum but at the risk of target - miss . We intend to demonstrate the potential benefits with the use of sectional imaging in safely delineating target - volumes . A lady on evaluation and referral from her gynecologist, presented to us with the diagnosis of stage - ib2 cervical - carcinoma staged as per the figo (federation of international gynaecologists and obstetricians) system . As we were preparing to initiate this patient on a course of concurrent chemo - rt, we had the opportunity to review her magnetic - resonance imaging (mri) films obtained earlier by her gynecologist . We noticed a stark retroversion of the uterus, which almost abutted the sacrum [figure 1]. This finding made us ponder over the potential perils associated with the conventional 4fb technique, which is widely utilized worldwide for portal design for cervical - carcinomas . Given that the uterine and cervical lymphatics are interconnected, and that disease extension from the cervix to the uterus is highly probable, the current consensus state that the entire uterine - corpus should be a part of the clinical - target - volume (ctv) for every patient of cervical - carcinoma . The uterus, being a mobile organ may manifest various positions, which cannot be taken into account during bony - landmark based planning . Unless the true position of the uterus can be determined with imaging, it would be risky to place the posterior - margin of lateral fields at the s2-s3 junction . Magnetic resonance imaging showing a retroverted uterine corpus extending well beyond the posterior border of the s2-s3 junction concurrent chemo - rt is a standard of care in the curative approach for stage - ib2 cervical - carcinoma . Though there has been a recent emergence of the use of 3d - imaging based techniques, however, a considerable majority of patients across the world are treated with traditional rt techniques even to this day, mainly owing to the fact that cervical - cancer is mainly a disease of the developing world which suffers shortages with regards to advanced planning and treatment systems . Conventional techniques may involve either the opposed anteroposterior - posteroanterior (ap / pa) two - field technique, or the 4fb technique - planned using radiologically determined bony - landmarks . In the 4fb technique, lateral portals are added with an intention to reduce the dose to the bowel anteriorly and to the rectum posteriorly . Conventional techniques have been found to provide equivalent results in comparison to 3d - rt, which is more expensive and complex . However, inadequate coverage with improper portal - design can preclude chances of cure . The ap and pa field definitions are similar with the two - field and the 4fb technique . The caveat with the implementation of the 4fb technique has always been (and still continues to be) the fact that are no unanimous guidelines regarding the margin definitions for the lateral portals . The controversy lies in the definition of the posterior - margin of the lateral - portal . Some authorities recommend its placement at or 0.5 cm posterior to the anterior - border of the s2-s3 interspace . With particular reference to the treatment of stage - ib carcinomas, one definition suggests that the posterior border be placed in such a way as to cover atleast 50% of the rectum . However, our point of contention would be that such a definition would be oblivious to the status of the uterine - position [figure 1] and rectal - distension . Placing the posterior - margin of the lateral - portals at s2-s3 junction using bony references from radiographs was found to be inadequate to cover the ctv in patients with bulky - disease . An evaluation of the ctv coverage by using the s2-s3 junction for the posterior border of the lateral fields revealed an inability to cover the optimal target - volumes in about half of the stage - ib patients. [57] the consequent effects on local - control were also quantified . Among stage - ib patients, the local - control at 3-years was 100% for patients who had adequate margins, compared to a drastically reduced value of 71% for patients of the same stage with inadequate margins . Since cervical carcinoma is staged clinically with the figo - system (which gives no regard to the utility of imaging to describe uterine - corpus involvement), it would be potentially dangerous to apply a one definition fits all philosophy in designing portals for patients with staged ib2 with the figo system . The current consensus recommends the inclusion of the entire uterine - corpus into the ctv mainly since the uterine and cervical lymphatics are interconnected . Retroverted uterus (after all, a normal variation of the uterine - position) may extend well beyond the line falling from the s2-s3 junction [figure 1]. The presence of uterine - retroversion is unlikely to be detected unless use is made of ct or mri . Given that the ctv would be incomplete without the inclusion of the entire uterus, the design of lateral portals of the 4fb technique should never be based on bony references . It should be individualized to the patient's soft - tissue imaging (with ct / mri) obtained in the treatment position . Usage of bony - landmarks for portal definition is insensitive to uterine flexion / version, which would be influenced by bladder and rectal filling . Mri, if used in treatment planning provides a very accurate definition of the individual morbid anatomy . Lateral portals designed using sagittal mri would help in a safe and confident placement of posterior margins . Ct would be a reasonable alternative if mri based planning is unavailable, given that vivid soft - tissue detail and accurate reconstructions can be had with helical ct - scanners . In concluding, we remind the reader that as per current consensus, the ctv for cervical - carcinoma would be incomplete without the inclusion of the entire uterus . The uterus is not a fixed organ, and has many possible variations in its position, which cannot be encompassed by bony - landmark based planning . Ct / mri based target delineation provides an opportunity to take the uterine position and bulk into account.
Visceral leishmaniasis (vl) is a fatal protozoan disease caused by leishmania donovani complex in the old and new worlds . Domestic dogs (canis familiaris) are the main reservoir hosts for zoonotic vl in mediterranean region (1,2). Hence, the most important approaches for interrupting domestic cycle of the disease are effective prevention and treatment protocols in endemic areas (3, 4). Over 50 years, pentavalent antimonials were remained the mainstay compounds used to treat both human and canine vl (5). Poor results, relapse following treatment, toxicity and resistance against some of the most conventional treatments, such as the pentavalent antimonials, aminosidine and allopurinol provide great effort for identifying new agents for treatment of human and canine leishmaniasis (6 - 8). The host immune response plays a very decisive role in the efficacy of drugs used against leishmaniasis (9, 10). Therefore, immunotherapy for treatment of cvl has represented a new approach to control this infection (10,11). Data on the mechanisms of immune response to cvl is lesser than experimental data on murine models and/or on human leishmaniasis (12). Recent studies of cell mediated immunity in cvl, suggest that resistance / susceptibility to the infection depends on the presence or absence of a specific proliferative response to leishmania antigen (10). Despite the scientific basis for biological activity of most herbal medicinal products is obscure, traditional medicine has been used for thousands of years with great contributions made by practitioners to human health in many countries (13, 14). Extracts of several plants have shown impressive spectrum of biological activities such as immunomodulatory and antiprotozoal effects (13,15,16).these potential activities have been attributed to compounds belonging to diverse chemical groups including alkaloids, flavonoids, steroids and terpenoids . Herbal extracts have long been considered as suitable candidates for novel interventions due to their safety, low cost, availability and their potential functional activity as immunomodulators (13, 15, 16, 17). In this regard, imod is herbal mixture of rosa canina (rosaceae), urtica dioica (urticaceae), and tanacetum vulgare (asteraceae) comprising selenium . The mechanism of action of imod and its immune cell target are being investigated (17, 18). Imod has been patented in usa and europe for its anti - oxidative stress potential, improving t helper lymphocytes and reduction of tumor necrosis factor alpha . The herbs used in this complex have strong anti - oxidative potential that is useful in many oxidant - related diseases (19). The safety of imod has already been approved by in vitro and in vivo studies (20, 21). Due to increasing understanding of immunological mechanisms involved in leishmania infection control, studies on anti - leishmania agents have advanced in recent years (22). On the other hand, more awareness in cvl will help open new concepts for treating infected dogs and develop new medical protocol for human leishmaniasis (22, 23). Therefore in this preliminary investigation in 2011, twelve mongrel dogs (males and females) aging from 1 to 3 yr old were used in this study . Dogs were kept in individual cages in small animal hospital, faculty of veterinary medicine, university of tehran . After one month adaption period, all dogs were examined, vaccinated against common diseases (dh2ppil and rabvac-1, fort dodge animal health, usa) and treated with anti helmintic drug . All dogs were analyzed to be free of anti - leishmania antibody by direct agglutination test (dat) (24). For inducing experimental infection, we injected 310 amastigotes of l. infantum (29) obtained from a naturally infected dog s spleen to 8/12 dogs by i.v . Three months after establishment of the infection, these dogs were randomly divided into three groups with four animals each . Group 1: negative control which did not receive any injection and/or medicine; group 2: treatment group received both amastigotes and imod infusion 2 mg / kg with 100 ml dw 5% over 1 h, every other day for one month (according to manufacturer recommendation) and group 3: positive control received both amastigotes and phosphate - buffered saline (pbs) intramuscularl with no drugs . Animals were monitored regularly after inoculation . For confirmation of parasite establishment and subsequent leishmania infection, bone marrow aspiration followed by light macroscopic observation clinical signs associated with leishmaniasis, complete blood cell count and biochemistry profile were evaluated and monitored for all dogs at monthly interval up to 60 days after the end of treatment . Plasma and pbmc were also isolated from each dog to determine antibody, cell proliferation and cytokine responses . At the end of experiment, all animals were anesthetized and spleen biopsy was carried out for parasitological evaluation (6, 23, 26). Briefly, pbmcs were obtained from heparinized blood samples collected from jugular vein of all dogs and then separated using ficoll - hypaque gradient (histopaque, sigma, usa). The cells were washed three times with pbs and after overnight storage at -80 c, frozen cell samples were transferred to liquid nitrogen for long - term storage . At the end of study, thawed cells were washed twice and resuspended in rpmi 1640 (sigma, usa) containing fetal calf serum (fcs) 20% . Cells viability was determined by trypane blue dye exclusion that was more than 95% . In this stage, we used cell proliferation kit i (mtt), a colorimetric method for non - radioactive quantification of cell proliferation (roche diagnostic gmbh, roche applied science, germany). Pbmcs cultured at a density 510 cells in 200 l r-10 medium (rpmi-1640 containing 10% heat - inactivated fcs, 2 mm l - glutamine, 25 mm hepes, 100 u / ml penicillin and 100 g / ml streptomycin), in the presence or absence of imod (based on manufacturer recommendation) and phytohemagglutinin a (pha; 20 g / ml) as stimulator, in 96 wells flat - bottom cell culture specialized microplates (nunc, denmark) for 4 days at 37c and 5% co2 . Based on manufacturer s instructions, after the incubation period, 20 l mtt labeling reagent (with a final concentration of 0.5 mg / ml) was added to each well and incubated for 4 h at 37 c and 5% co2 . Then 100 l of the solubilization solution was added to each well and incubated overnight at 37c and 5% co2 . Finally, the absorbance of the formazan product was measured at 550 nm by elisa reader (awareness tech . Proliferative responses were expressed as stimulation index (si), which represents the ratio between mean of the count per minute (cpm) obtained for stimulated cultures and cpm of unstimulated cultures . Elispot kits (r&d systems, minneapolis, usa) were used in this study for the detection of canine ifn- (el781), il-2 (el1815), il-4 (el754) and il-10 (el735) from pbmcs of all dogs . The assays were optimized according to r&d system s guidelines and performed as recommended by the manufacturer . In brief, plates were saturated with 200 l of rpmi-1640 and incubated for 20 min at room temperature . Culture media was aspirated and 510 pbmcs per 100 l r-10 medium were added to triplicate wells . Cells were stimulated as described before for 48 h at 37 c in the presence of 5% co2 . The ideal time and concentration for imod were established based a dose response curve in preliminary experiments (data not shown). Recombinant canine ifn- il-2, il-4 and il-10 were used in triplicate wells as positive control whereas unstimulated cells and r-10 medium without cell were used as negative and background controls, respectively . Following incubation, the cells were removed and the wells were washed and incubated with 100 l diluted detection antibody overnight followed by the addition of 100 l diluted streptavidin - ap into each well and incubated in room temperature for 2 h. unbound enzyme was removed with 3 successive washes and 100 l of bcip / nbt chromogen solution was added to each well . Subsequently, the plates were air dried and spots were manually counted using a dissection microscope . Responses were considered to be positive if number of sfc were greater than double the number in negative control wells . This randomized, open labeled trial was reviewed and approved by the ethical committee of university of tehran and conducted according to the principles of laboratory animal care . All data were analyzed with t - test and repeated measure one - way anova . The influence of treatment protocol on clinical signs was evaluated using mcnemar and fisher s exact tests . All the analyses were performed by spss ver.17 for windows (chicago, il, usa). In 2011, twelve mongrel dogs (males and females) aging from 1 to 3 yr old were used in this study . Dogs were kept in individual cages in small animal hospital, faculty of veterinary medicine, university of tehran . After one month adaption period, all dogs were examined, vaccinated against common diseases (dh2ppil and rabvac-1, fort dodge animal health, usa) and treated with anti helmintic drug . All dogs were analyzed to be free of anti - leishmania antibody by direct agglutination test (dat) (24). For inducing experimental infection, we injected 310 amastigotes of l. infantum (29) obtained from a naturally infected dog s spleen to 8/12 dogs by i.v . Three months after establishment of the infection, these dogs were randomly divided into three groups with four animals each . Group 1: negative control which did not receive any injection and/or medicine; group 2: treatment group received both amastigotes and imod infusion 2 mg / kg with 100 ml dw 5% over 1 h, every other day for one month (according to manufacturer recommendation) and group 3: positive control received both amastigotes and phosphate - buffered saline (pbs) intramuscularl with no drugs . Animals were monitored regularly after inoculation . For confirmation of parasite establishment and subsequent leishmania infection, bone marrow aspiration followed by light macroscopic observation clinical signs associated with leishmaniasis, complete blood cell count and biochemistry profile were evaluated and monitored for all dogs at monthly interval up to 60 days after the end of treatment . Plasma and pbmc were also isolated from each dog to determine antibody, cell proliferation and cytokine responses . At the end of experiment, all animals were anesthetized and spleen biopsy was carried out for parasitological evaluation (6, 23, 26). Briefly, pbmcs were obtained from heparinized blood samples collected from jugular vein of all dogs and then separated using ficoll - hypaque gradient (histopaque, sigma, usa). The cells were washed three times with pbs and after overnight storage at -80 c, frozen cell samples were transferred to liquid nitrogen for long - term storage . At the end of study, thawed cells were washed twice and resuspended in rpmi 1640 (sigma, usa) containing fetal calf serum (fcs) 20% . Cells viability was determined by trypane blue dye exclusion that was more than 95% . In this stage, we used cell proliferation kit i (mtt), a colorimetric method for non - radioactive quantification of cell proliferation (roche diagnostic gmbh, roche applied science, germany). Pbmcs cultured at a density 510 cells in 200 l r-10 medium (rpmi-1640 containing 10% heat - inactivated fcs, 2 mm l - glutamine, 25 mm hepes, 100 u / ml penicillin and 100 g / ml streptomycin), in the presence or absence of imod (based on manufacturer recommendation) and phytohemagglutinin a (pha; 20 g / ml) as stimulator, in 96 wells flat - bottom cell culture specialized microplates (nunc, denmark) for 4 days at 37c and 5% co2 . Based on manufacturer s instructions, after the incubation period, 20 l mtt labeling reagent (with a final concentration of 0.5 mg / ml) was added to each well and incubated for 4 h at 37 c and 5% co2 . Then 100 l of the solubilization solution was added to each well and incubated overnight at 37c and 5% co2 . Finally, the absorbance of the formazan product was measured at 550 nm by elisa reader (awareness tech . Proliferative responses were expressed as stimulation index (si), which represents the ratio between mean of the count per minute (cpm) obtained for stimulated cultures and cpm of unstimulated cultures . Elispot kits (r&d systems, minneapolis, usa) were used in this study for the detection of canine ifn- (el781), il-2 (el1815), il-4 (el754) and il-10 (el735) from pbmcs of all dogs . The assays were optimized according to r&d system s guidelines and performed as recommended by the manufacturer . In brief, plates were saturated with 200 l of rpmi-1640 and incubated for 20 min at room temperature . Culture media was aspirated and 510 pbmcs per 100 l r-10 medium were added to triplicate wells . Cells were stimulated as described before for 48 h at 37 c in the presence of 5% co2 . The ideal time and concentration for imod were established based a dose response curve in preliminary experiments (data not shown). Recombinant canine ifn- il-2, il-4 and il-10 were used in triplicate wells as positive control whereas unstimulated cells and r-10 medium without cell were used as negative and background controls, respectively . Following incubation, the cells were removed and the wells were washed and incubated with 100 l diluted detection antibody overnight followed by the addition of 100 l diluted streptavidin - ap into each well and incubated in room temperature for 2 h. unbound enzyme was removed with 3 successive washes and 100 l of bcip / nbt chromogen solution was added to each well . Subsequently, the plates were air dried and spots were manually counted using a dissection microscope . Responses were considered to be positive if number of sfc were greater than double the number in negative control wells . This randomized, open labeled trial was reviewed and approved by the ethical committee of university of tehran and conducted according to the principles of laboratory animal care . All data were analyzed with t - test and repeated measure one - way anova . The influence of treatment protocol on clinical signs was evaluated using mcnemar and fisher s exact tests . All the analyses were performed by spss ver.17 for windows (chicago, il, usa). Based on staging of cvl by leish - vet group (4), all infected dogs in this experiment were categorized in stages ii (moderate disease) and iii (severe disease). The most detected clinical signs were weight loss (7/8 or 87.5%) and lymphadenopathy (6/8 or 75%). At the end of study, clinical signs remission was not detected in imod group . In post - inoculation period, normocytic / nor - mochromic anemia was the significant hematological changes in all infected animals . Thirty days after treatment, hematologic changes such as neutropenia showed significant difference (p = 0.019) between group ii and group iii . These differences were not significant in mentioned groups (ii&iii) 60 days after treatment . Based on biochemical analyses, significant elevation of triglyceride were detected after inoculation . In imod group, significant differences were noticeable for cholesterol & ldl (p = 0.01, 0.02 respectively) 30 days after treatment but these findings did not remain until the end of study . Serological results by direct agglutination test (dat) showed that all infected dogs had positive titers (1:320) 60 days following inoculation . In this experiment 60 days after treatment, 2/4 (50%) dogs in imod group showed reduction of anti - leishmania antibody titers but seronegtive results (<1:320) were not obtained . The spleen biopsies remained positive in all treated dogs at the end of this experiment . Proliferation of pbmc stimulated with imod and pha was used to investigate t cells proliferation of all dogs enrolled in the study . At the end of study (day 60), pbmc from dogs treated with imod had better response to stimulation with this herbal agent than other groups (fig 1). In this assay, animals that received imod presented higher si than that observed in the positive control group (p=0.022). Regarding elispot results for th1- and th2-type cytokines; unlike decreasing frequencies of ifn- sfc in control groups (groups i & iii), the mean number of ifn- sfc was fairly constant (about 6000/10 pbmc) for imod group until 30 days post - treatment and reduced at the end of study (day 60) (fig 2). For il-2, the mean number of sfc decreased during the experiment, having 24199/10 pbmc at inoculation, about 10000/10 pbmc 30 days post - treatment and about 7500/10 pbmc at the end of study for positive control group and for imod group having 13148/10 pbmc at inoculation, about 8318/10 pbmc 30 days post - treatment and about 3022/10 pbmc at 60 days post - treatment . In negative control group, the mean number of il-2 sfc increased 30 days post - treatment due to in vitro imod stimulation and then decreased 60 days post - treatment (fig 2). In positive control group, production of il-4 sfc decreased over time . Like negative control group, the peak of il-4 sfc was detected 30 days post - treatment in imod group and reduced at the end of study (fig 3). Thus the mean number of il-10 sfc decreased from 29898/10 pbmc at inoculation to 11000/10 pbmc 30 days post - treatment and then increased to 17200/10 pbmc at the end of study . Like mean number of il-2 and il-4 sfcs, il-10 spot density enhanced 30 days post - treatment in negative control group due to in vitro imod stimulation (fig 3). Combining the results of ifn- & il-4 sfcs for evaluating an approximation of th1/th2 ratio showed significant differences between imod group and control groups at inoculation period by in vitro stimulation (p = 0.003, 0.009). In post - treatment period, th1/th2 ratio changed during the evaluation and showed increasing trend for imod and negative control groups but decreasing trend for positive control group (table 1). Based on staging of cvl by leish - vet group (4), all infected dogs in this experiment were categorized in stages ii (moderate disease) and iii (severe disease). The most detected clinical signs were weight loss (7/8 or 87.5%) and lymphadenopathy (6/8 or 75%). At the end of study, clinical signs remission was not detected in imod group . In post - inoculation period, normocytic / nor - mochromic anemia was the significant hematological changes in all infected animals . Thirty days after treatment, hematologic changes such as neutropenia showed significant difference (p = 0.019) between group ii and group iii . These differences were not significant in mentioned groups (ii&iii) 60 days after treatment . Based on biochemical analyses, significant elevation of triglyceride were detected after inoculation . In imod group, significant differences were noticeable for cholesterol & ldl (p = 0.01, 0.02 respectively) 30 days after treatment but these findings did not remain until the end of study . Serological results by direct agglutination test (dat) showed that all infected dogs had positive titers (1:320) 60 days following inoculation . In this experiment 60 days after treatment, 2/4 (50%) dogs in imod group showed reduction of anti - leishmania antibody titers but seronegtive results (<1:320) were not obtained . The spleen biopsies remained positive in all treated dogs at the end of this experiment . Proliferation of pbmc stimulated with imod and pha was used to investigate t cells proliferation of all dogs enrolled in the study . At the end of study (day 60), pbmc from dogs treated with imod had better response to stimulation with this herbal agent than other groups (fig 1). In this assay, animals that received imod presented higher si than that observed in the positive control group (p=0.022). Regarding elispot results for th1- and th2-type cytokines; unlike decreasing frequencies of ifn- sfc in control groups (groups i & iii), the mean number of ifn- sfc was fairly constant (about 6000/10 pbmc) for imod group until 30 days post - treatment and reduced at the end of study (day 60) (fig 2). For il-2, the mean number of sfc decreased during the experiment, having 24199/10 pbmc at inoculation, about 10000/10 pbmc 30 days post - treatment and about 7500/10 pbmc at the end of study for positive control group and for imod group having 13148/10 pbmc at inoculation, about 8318/10 pbmc 30 days post - treatment and about 3022/10 pbmc at 60 days post - treatment . In negative control group, the mean number of il-2 sfc increased 30 days post - treatment due to in vitro imod stimulation and then decreased 60 days post - treatment (fig 2). In positive control group, production of il-4 sfc decreased over time . Like negative control group, the peak of il-4 sfc was detected 30 days post - treatment in imod group and reduced at the end of study (fig 3). Thus the mean number of il-10 sfc decreased from 29898/10 pbmc at inoculation to 11000/10 pbmc 30 days post - treatment and then increased to 17200/10 pbmc at the end of study . Like mean number of il-2 and il-4 sfcs, il-10 spot density enhanced 30 days post - treatment in negative control group due to in vitro imod stimulation (fig 3). Combining the results of ifn- & il-4 sfcs for evaluating an approximation of th1/th2 ratio showed significant differences between imod group and control groups at inoculation period by in vitro stimulation (p = 0.003, 0.009). In post - treatment period, th1/th2 ratio changed during the evaluation and showed increasing trend for imod and negative control groups but decreasing trend for positive control group (table 1). Conventional treatments such as glucantime and amphotericine are not effective in cvl, as reported . In fact, high rate of failures have reported using these agents as a result of disease progression, relapse or parasites drug resistance (27). Furthermore, experimental and clinical data from the reviewed studies indicate that full protection from cvl or complete parasite eradication is difficult . This is why an effective treatment such as immunotherapy would represent a vital alternative (9, 12). Protective and therapeutic responses in dogs have been related with the remission of clinical symptoms, low levels of anti - leishmania antibodies and reduce the parasite load (4, 28). In this study, although imod administration was not associated with clinical adverse effects and the evaluation of renal and hepatic functions revealed no remarkable changes, signs of clinical remission were not detected in treatment group . On the other hand, serological improvement (titers lower than 1:320) for anti - leishmania antibody titers (24) were not obtained and parasitological evaluation showed no total parasite elimination . Cytokines play a fundamental role in the regulation of immune response for leishmaniasis remission and/or relapsing (10). In comparison with experimental data on murine models of leishmania and human leishmaniasis, scientific advances on the mechanisms of the immune response to cvl this is mainly due to the slower progression in development of laboratory products for the evaluation of canine immune system and few published works (12, 28, 29). However, using of elispot assay has been scarce in veterinary immunology because of the inadequate monoclonal antibodies; it is a powerful and sensitive method for the quantitation of cytokine responses (30). The elispot assay preferred for basic research projects, clinical studies and vaccine trials and offers several advantages over other immunoassays (31,32). It is approximately 10 - 200 times more sensitive than elisa and displays similar sensitivity to rt - pcr analysis (32, 33), less expensive to perform and better suited to the analysis of frozen samples (31). Therefore, we analyzed th1- & th2-type cytokines by this method for evaluating the potential immunogenicity of imod against experimental model of cvl . Early studies, particularly on the murine model of cutaneous leishmaniasis, largely defined the balance of th1/th2 = resistance / susceptibility to infection (28, 34). Ifn- is considered to be one of the key cytokines in th1 profiles, whereas il-4 participates in the th2 polarization and its secretion suggests a predominance of humoral responses . Regarding il-10, it is thought that can be a contributor in both types of immune responses having a regulatory effect (30). There are several studies indicating that a th2-type response predominates during acute leishmaniasis, such as increase the production of il-4 to ifn- ratio and polyclonal b - cell activation (7, 12). Because of the few published data, understanding the profile of cytokine expression in cvl is a difficult task . It was described that cellular immune response in cvl is associated with producing ifn- & il-2 and active disease is characterized by marked humoral response (35, 36). Based on other literatures, the role of il-4 as a cytokine related to susceptibility remained controversial and il-10 does not seem to have a predominant immunoregulatory pattern (28). Recent advances in experimental model of cvl have allowed defining the mechanisms of cellular responses against leishmania, similar to that investigated in the murine model of leishmaniasis (12, 28, 29). As it is believed control of vl in mice requires enhancement of ifn-/il-4 ratio (37), we also considered this ratio in the present study . Before initiating therapeutic protocol, the results of elispot assay showed all the symptomatic dogs had higher frequencies of il-2 & il-10 than un - infected dogs . On the other hand, higher levels of ifn- and il-4 the ifn-/il-4 ratio at the end of study, while reduced by disease progression in positive control dogs, was increased in imod group . In general, lymphocytes from healthy dogs responded more vigorously to in vitro stimulation with imod and furthermore, the treated dogs with imod showed higher proliferation than did cells for control groups . The hypothesis of present study was that imod as an immunomudolator agent could probably improve cvl . Imod has been patented with the code of wo/2007/087825 for its immunomodulatory potential in europe (19) and has usa - patent application with the code of p30280us . It is a combination of three herbal extracts treated with chemical trace elements and a special electromagnetic field which dispensed into sterile ampoules for research use under the trademark imod (rose pharmed biotechnology co., tehran, iran). It was invented briefly by preparing ethanolic herbal extract from rosa canina, urtica dioica and tanacetum vulgare with adding selenium and urea and having been exposed to a pulsed electromagnetic field (19). Urtica dioica leaf extract contains active blends that reduce tnf- il-1 and other inflammatory cytokines (38). Rosa canina extract possesses abundant antioxidant agents containing flavonoids and some bioactive compounds which cause this plant to have anti - inflammatory and radical scavenging properties . The results of this experiment, however support the hypothesis indicating modulatory effects of imod most probably due to various effects of this herbal mixture, but did not show strong immunologic response for cvl as a model for an immune - mediated infectious disease; final outcome of imod as expected and not supposed to was not accompanied by total parasitological cure due to th1/th2 harmony . The poor response to therapy observed in dogs may be either due to serious immunosuppression induced by experimental cvl or due to short time for evaluating the medication which extending its period was beyond our planned program . Understanding the cytokines expression in cvl is a difficult task and in comparison to the murine model, studies in cvl show more heterogeneity . Hence, it is essential matter to improve the knowledge of the protective cellular immune response in cvl for an immunomodulatory therapy and vaccine development . Interestingly, cd4+t cells enhancement in dogs, by in vitro imod stimulation, was the major result obtained in this preliminary study . Therefore, it is important to confirm this assumption by more studies with more animals in each studied groups and longer follow - up period whether imod monotherapy or combination therapy represent reasonable effects in leishmaniasis prevention and/or treatment as a model for improving cell - mediated immunity in a immunocompromised animal or human.
A 45-year - old male patient was admitted to an outpatient clinic with blunt thoracic trauma after falling from height (work - related accident) and was referred to kocaeli university faculty of medicine after the detection of ischemia on his electrocardiogram . In the physical examination, the vital signs were stable, but pain and tenderness was detected on his ribs in the thoracal examination . However, it was worth noting the patient had a history of hypertension . A t inversion was detected in d1, avl, and v3, v4, v5, v6 derivations in the electrocardiogram (ecg). Further, there were no additional pathologic findings in the blood tests and the serological tests echocardiography showed minimal mitral insufficiency and a cystic lesion (size: 2527 mm) next to the left ventricle anterolateral wall (fig . Cardiac magnetic resonance imaging (mri) documented a cystic lesion on the lateral wall of the left ventricle, approximately 3.52.5 cm in size; this lesion was initially considered to be similar to a hydatid cyst (fig . 1b). There were no additional cyst hydatid lesions found in the computerized tomography scan of the abdomen and the thorax . Median sternotomy was performed under general anesthesia, and cardiopulmonary bypass was initiated after standard aorta and bicaval cannulation . The cyst was opened up; cyst fluid was aspirated; and the remaining contents, including the germinative membrane and the daughter vesicules, were removed (fig . We paid maximum attention to the prevention of the dissemination of the aspiration fluid to the pericardial sac . The cyst cavity was irrigated with a highly concentrated sodium chloride solution, and then, the empty sac was closed with primary sutures . A therapy with albendazole was initiated immediately with a 10-mg / kg / day dose and maintained for three months . Echocardiography and thorax computed tomography (ct) were repeated in the outpatient clinic control at 6 months postoperatively and showed no pathological findings . Median sternotomy was performed under general anesthesia, and cardiopulmonary bypass was initiated after standard aorta and bicaval cannulation . The cyst was opened up; cyst fluid was aspirated; and the remaining contents, including the germinative membrane and the daughter vesicules, were removed (fig . We paid maximum attention to the prevention of the dissemination of the aspiration fluid to the pericardial sac . The cyst cavity was irrigated with a highly concentrated sodium chloride solution, and then, the empty sac was closed with primary sutures . A therapy with albendazole was initiated immediately with a 10-mg / kg / day dose and maintained for three months . Echocardiography and thorax computed tomography (ct) were repeated in the outpatient clinic control at 6 months postoperatively and showed no pathological findings . Hydatid disease is endemic in farming areas but occurs worldwide . In particular, the incidence is greater in the cattleor sheep - raising areas of the world, such as australia, south america, south africa, and panama, the mediterranean countries, and the middle east . The most common site of the disease is the liver, followed by the lungs, kidney, bones, and brain . . Any race can be affected, and this disease is common in both men and women . Its symptoms depend on the affected organ; for example, liver cysts cause jaundice and abdominal discomfort, while lung cysts cause cough, chest pain, and hemoptysis (coughing up blood). Hydatid cyst is a human parasitic disease in which multiple - visceral involvement is generally caused by the metacestode of the tapeworm or larva of the species of the genus echinococcus . However, the most frequently involved cardiac region is the left ventricle; the right ventricle and the interventricular septum are the less affected regions, respectively . The age of the cyst, size of the cyst, and the extent of calcification are decisive for clinical presentation in patients . Patients generally present at outpatient clinics with complaints of subjective symptoms such as palpitation, dyspnea, and atypical angina pectoris . Diagnosis is performed using imaging techniques, examination of the cyst fluid, and serological tests . A cardiac cyst can lead to life - threatening consequences such as myocardial infarction caused by the compression of a coronary artery, pulmonary edema caused by a disturbance in the valvular mechanisms, or outflow tract obstruction and sudden cardiac arrest caused by a variety of conduction defects . A cardiac cyst is a diagnostic and therapeutic challenge due to the variability of signs and symptoms at its presentation, its numerous and often unpredictable preoperative complications, and the risk of complications associated with cardiac surgery . Our patient was asymptomatic for years and did not have any complaints associated with hydatid disease before the accident when a cardiac hydatid cyst was diagnosed by the thorax ct . Arrhythmia, electrical conduction system defects and bundle branch blocks, myocardial infarction, and non - specific st segment and t - wave changes can be seen in the ecg in the cases of cardiac hydatid cysts . A t inversion was detected in d1, avl, and v3-v6 in the ecg of our patient; however, the patient's coronary angiography was normal . Cardiac cyst hydatid involves many septums and occasionally, daughter cysts . Because of the thin membrane surrounding the cyst it can be distinguished from other intracardiac masses by echocardiography . A hydatid cyst can be in the form of a solid mass or have a multiloculated cystic formation in some cases . Cardiac mri and thoracic ct have been utilized in the diagnosis of hydatid disease . In our case, the cardiac mri revealed normal intensities, sizes, and wall thicknesses of the right ventricle, left atrium, and right atrium . Further, a hypodense mass (size: 3.52.5 cm) was observed in the t1-weighted sequence; the t1- and t2-weighted sequences of the cyst rim revealed hypointensity . The most common treatment strategy of echinococcosis is 6 months of medical treatment with albendazole or mebendazole or a combination of albendazole and praziquantel after surgical treatment . We chose surgical excision under cardiopulmonary bypass, and the albendazole treatment was pursued after surgical cyst excision in this patient . The patient is still being followed in the outpatient clinic of infectious diseases . In conclusion, the possibility of cardiac hydatid disease should be kept in mind, particularly in the endemic zones . Due to the high risk of their associated complications,
The first n - terminal acetylation is catalyzed a variety of n - terminal acetyltransferases (nats), which co - translationally transfer acetyl moieties from acetyl - coenzyme a (acetyl - coa) to the -amino although n - terminal acetylation is rare in prokaryotes, it was estimated that 85% of eukaryotic proteins are n - terminally modified (1,2). The second type is n - lysine acetylation, which specifically modifies -amino group of protein lysine residues (38). Although n - lysine acetylation is less common, it s one of the most important and ubiquitous post - translational modifications (ptms) conserved in prokaryotes and eukaryotes (1,2). Moreover, the acetylation and deacetylation are dynamically and temporally regulated by histone acetyltransferases (hats) and histone deacetylases (hdacs), respectively (48). In 1964, allfrey et al . (9) first observed that lysine acetylation of histones plays an essential role in regulation of gene expression . Later and recent studies in epigenetics solidified this seminal discovery, and proposed acetylation as a key component of the histone code (6). Beyond histones, a wide - range of non - histone proteins can also be lysine acetylated, and involved in a variety of biological processes, such as transcription regulation (10), dna replication (11), cellular signaling (12), stress response (13) and so on . Aberrance of lysine acetylation and deacetylation is associated with various diseases and cancers (5,7,14). In particular, acetylation was demonstrated to be implicated in cellular metabolism and aging (1517), while one class of nad dependent hdacs of sirtuins might be potent drug target for promoting longevity (13,17). Although a great number of efforts have been carried out during the past four decades, the functional contents of lysine acetylation are still far from fully understood . In this regard, identification of acetylated substrates with their sites is fundamental for understanding the molecular mechanisms and regulatory roles of acetylation . In contrast with labor - intensive and time - consuming conventional experimental approaches, recent progresses in acetylome with high - throughput mass spectrometry (ms) have detected thousands of acetylation sites . In 2006, kim et al . (14) performed a large - scale identification of acetylome with an anti - acetyllysine antibody . There were 195 acetylated proteins with 388 sites detected in hela cells and mouse liver mitochondria (14). With a similar strategy, choudhary et al . (11) experimentally identified 3600 acetylation sites in human . In 2010, zhao et al . (16) discovered 1047 acetylated substrates in human liver, and demonstrated acetylation playing a major role in metabolic regulation . Furthermore, two acetylomic studies revealed that the functions of lysine acetylation are conserved in escherichia coli (18) and salmonella enterica (15). Since the number of known acetylation sites has rapidly increased, it is an urgent topic to collect the experimental data and provide an integrated resource for the community . Recently, several public databases, such as phosphositeplus (19), hprd (20), sysptm (21) and dbptm (22), have already contained protein acetylation information . In these databases, both of n - terminal and n - lysine acetylation data were curated, while lysine acetylation sites are usually only a limited part of total sites . For example, sysptm 1.1 contains 3001 acetylation sites in 2000 proteins, with only 345 lysine sites (11.5%) in 397 substrates (21). In dbptm 2.0, 2071 experimentally verified acetylation sites were collected in 1525 proteins, with only 792 lysine sites (38.2%) in 299 targets (22). Interestingly, hprd release 9 contains 4691 total sites in 1987 proteins, with 4420 lysine sites (94.2%) in 1821 substrates (20). However, hprd database only focuses on human protein information (20), while thousands of lysine acetylation sites in other species still remain to be collected . With the motivation to meet the desire for complete acetylomes, here we developed a novel database of compendium of protein lysine acetylation (cpla). From the scientific literature in pubmed, we manually curated 3311 acetylated proteins with 7151 lysine sites (table 1). In cpla database, the primary references and other annotations of these substrates were provided, while the protein protein interaction (ppi) information was also integrated . Based on the gene ontology (go) and interpro annotations, we carried out an analysis of functional diversities and regulatory roles of lysine acetylation . As 75.64% of total lysine acetylation sites are taken from homo sapiens, a potential human lysine acetylation network (hlan) among hats, substrates and hdacs was constructed, with 1019 ppis among 199 proteins . Interestingly, we revealed 1862 potential triplet relationships of hat - substrate - hdac, while at lease 13 were previously experimentally verified . Taken together, the cpla database might be an integrated resource for protein lysine acetylation and provide useful information for further experimental or computational considerations . (%) homo sapiens2585540975.64salmonella typhimurium1902603.64mus musculus1875527.72escherichia coli1492593.62saccharomyces cerevisiae44851.19others1565868.20total33117151100sub ., number of substrates; site, number of acetylation sites; per ., percentiles of acetylation sites . To ensure the quality of cpla database, we searched the pubmed with a major keyword acetylation and collected experimentally identified lysine acetylated proteins with their sites from more than 18 500 published articles (before 1 march 2010). To avoid missing data after all substrates with unambiguous acetylation lysines were collected, we searched the uniprot knowledgebase (23) to obtain the corresponding protein sequences and associated annotation information . The theoretical pi (isoelectric point) and mw (molecular weight) were calculated for each protein (http://www.expasy.org/tools/pi_tool.html) (24,25). In cpla database, we took experimental ppis from several major public databases (on 10 april 2010), such as hprd (20), biogrid (26), dip (27), mint (28) and intact (29). In addition, a well - known pre - predicted database of string (30) was also used . All proteins were mapped to the uniprot sequences by blast . For human, we collected a total of 59 481 experimental ppis in 12 221 proteins and 1 212 607 predicted ppis in 16 523 proteins, respectively . The cpla 1.0 database contains 7151 lysine acetylation sites in 3311 substrates (table 1). Particularly, 1742 (24.4%) acetylation sites in 726 proteins are collected from non - human species (table 1). The online service and local packages were implemented in php + mysql + javascript and java 1.5 (j2se 5.0), separately . Moreover, the search option (http://cpla.biocuckoo.org/search.php) provides an interface for querying the cpla 1.0 database with one or several keywords such as gene / protein names, uniprot i d or cpla i d, etc . For example, if the keyword stat3 is inputted and submitted (figure 1a), the result will be shown in a tabular format, with the features of cpla i d, uniprot accession and protein / gene names / aliases (figure 1b). By clicking on the cpla i d (cpla-000136), the detailed information for human stat3 will be shown (figure 1c). The acetylation information, including acetylated positions, flanking peptides, experimental reagents or upstream hats, and primary references are provided . The protein sequence, go annotation, domain organization, molecular weight, computed/ theoretical ip and ppi information are also presented . Users could click on the cpla i d (cpla-000025) to visualize the detailed information . Users could click on the cpla i d (cpla-000025) to visualize the detailed information . Furthermore, we provided three additional advance options, including (i) advance search, (ii) browse and (iii) blast search (supplementary figure s1). (i) advance search: in this option, users could use relatively complex and combined keywords to locate the precise information, with up to two search terms . The interface of search - engine permits the querying by different database fields and the linking of queries through three operators of and, (ii) browse: instead of searching for a specific protein, all entries of cpla database could be listed by species name (supplementary figure s1b). (iii) blast search: this option was designed for finding related information in cpla database quickly . The blastall program of ncbi blast packages (31) was included in cpla 1.0 database (supplementary figure s1c). Users can input a protein sequence in fasta format for searching identical or homologous proteins . Recent progresses toward understanding the full functional content of acetylome have experimentally revealed several thousands of lysine acetylated substrates with their sites . Besides experimental efforts, the current available computational resources were summarized and listed in supplementary table s2 . Among these researches, database development is particularly important for integrating experimental data from heterogeneous sources, and providing a high quality benchmark for further experimental or computational designs . Although several public databases (1922) have already maintained the acetylation information, the lysine acetylation is usually collected together with another less controlled n - terminal acetylation . In this work, we only focused on protein lysine acetylation and manually curated 7151 lysine acetylation sites in 3311 proteins . Since a large proportion of acetylation sites were taken from homo sapiens, we had the opportunity to analyze abundance and functional diversity of lysine acetylation in an acetylomic level . We surveyed the go terms of 2585 acetylated proteins from uniprot annotations . Using the human proteome as the background, we statistically calculated over - represented biological processes, molecular functions and cellular components in acetylome with the hypergeometric distribution (p <0.01). The top five most enriched go entries in each category were shown in table 2 . For example, the three most abundant biological processes such as translational elongation, rna splicing and mrna processing suggest that acetylation predominantly regulates gene expression in a post - transcriptional manner (table 2). Also, four most over - represented molecular functions such as atp binding, protein binding, rna binding and nucleotide binding suggest that acetylation modulates enzyme activity and protein interaction ability (table 2). In addition, the statistical analysis of cellular components revealed acetylated proteins to be highly enriched in distinct cellular compartments . For instance, 30 and 62% of cytosol and mitochondrial matrix proteins are acetylated, respectively (table 2). For more detailed information, the top 15 most over - represented go terms and interpro domains were shown in supplementary tables s3 and s4 . Table 2.the top five most enriched go terms of biological processes, molecular functions and cellular components in human acetylomedescription of go termacetylomeproteomee - ratiop - valuen (%) n (%) the top five most enriched biological processes translational elongation (go:0006414)69 (2.80)93 (0.52)5.443.35e-40 nucleosome assembly (go:0006334)43 (1.75)79 (0.44)3.991.17e-17 rna splicing (go:0008380)70 (2.84)188 (1.04)2.733.50e-16 interspecies interaction between organisms (go:0044419)100 (4.06)333 (1.85)2.203.97e-15 mrna processing (go:0006397)65 (2.64)193 (1.07)2.479.06e-13the top five most enriched molecular functions atp binding (go:0005524)398 (16.17)1473 (8.17)1.984.67e-46 protein binding (go:0005515)798 (32.06)3996 (22.16)1.459.00e-35 rna binding (go:0003723)186 (7.56)557 (3.09)2.459.49e-34 structural constituent of ribosome (go:0003735)71 (2.89)155 (0.86)3.361.99e-22 nucleotide binding (go:0000166)85 (3.45)255 (1.41)2.445.75e-16the top five most enriched cellular components cytosol (go:0005829)298 (12.11)1009 (5.60)2.164.71e-42 mitochondrial matrix (go:0005759)83 (3.37)139 (0.77)4.386.33e-37 nucleoplasm (go:0005654)124 (5.04)333 (1.85)2.731.12e-27 nucleolus (go:0005730)133 (5.40)425 (2.36)2.291.84e-21 cytosolic small ribosomal subunit (go:0022627)29 (1.18)36 (0.20)5.902.24e-19num ., number of proteins annotated; per . The top five most enriched go terms of biological processes, molecular functions and cellular components in human acetylome num . The acetylation and deacetylation of proteins are carried out by hats and hdacs, which antagonistically and dynamically control protein function . Combined with experimental and predicted ppis, we constructed a potential hlan among hats, substrates and hdacs, with 1019 ppis of 199 proteins (supplementary table s5). If only experimental ppis are considered, the core hlan contained 369 ppis among 77 proteins, including 12 hats and 12 hdacs (figure 2). From the whole hlan if a substrate is a hat or hdac, it should be acetylated or deacetylated by a different hat or hdac . We carefully surveyed scientific literature and found that at least 13 triplet interactions were experimentally identified (supplementary table s6). For example, gaughan et al . (32) observed that tip60 (kat5) and histone deacetylase 1 (hdac1) regulate the transcriptional activity of androgen receptor (ar) through changing its acetylation status, and form a kat5-ar - hdac1 relation (supplementary table s6). For instance, ep300 acetylates bcl6 at k379 and inhibits its function, while deacetylases were not clearly identified (33). In our results, the ep300-bcl6-hdac5, ep300-bcl6-sirt2, ep300-bcl6-hdac11, ep300-bcl6-hdac3, ep300-bcl6-hdac2 and ep300-bcl6-hdac8 suggested that bcl6 might be deacetylated by multiple hdacs (supplementary table s6). Moreover, human gcma / gcm1 was reported to be acetylated by cbp / crebbp at k367, k406 and k409 (34). In our results, the relations of crebbp - gcm1-hdac3, crebbp - gcm1-hdac3, crebbp - gcm1-hdac1 and crebbp - gcm1-hdac4 proposed that at least four hdacs might deacetylate gcm1 (supplementary table s6). Green node: hat; blue node: hdac; yellow node: hat that is acetylated; purple node: hdac that is acetylated; pink node: substrate . A core hlan identified from experimentally identified ppi data . Green node: hat; blue node: hdac; yellow node: hat that is acetylated; purple node: hdac that is acetylated; pink node: substrate . Taken together the statistical analyses revealed functional diversity and enrichment of acetylation, while network studies generated a large number of potentially useful results for further experimental or computational researches . The cpla database will be routinely updated if new acetylated substrates are reported . Funding for open access charge: national basic research program (973 project) (2010cb945400, 2007cb947401); national natural science foundation of china (90919001, 30700138, 30900835, 30830036, 31071154); chinese academy of sciences (info-115-c01-sdb4 - 36).
Posttraumatic cerebral edema leading to refractory intracranial hypertension is the main prognostic factor in brain - injured patients . Morbidity and mortality occur as a result of transtentorial herniation caused by mass effect due to cerebral swelling . The combined medical and surgical objective during the acute phase is to prevent raised intracranial pressure (icp) and maintain cerebral perfusion pressure in order to limit the development of secondary lesions . Early decompressive craniotomy (dc) is a method for decreasing raised icp and has been associated with better outcomes . In neonates, as the cranial sutures are open, any associated fracture may relieve the raised icp due to craniotomy flap - elevation like effect . An 8-day - old male child was brought to the emergency room with a history of fall from a cradle of about 3 feet height followed by loss of consciousness for half an hour . There was no history of convulsions, vomiting or ear, nose, and throat bleed . On examination, the neonate was vitally stable, alert, conscious, moving all four limbs with no focal neurological deficit . The physical examination showed a large swelling in the left temporal region behind the ear (battle's sign) [figure 1]. Photograph on the day of admission showing a swelling in the left temporoparietal region with battle's sign computed tomography (ct) of the brain showed a large left sided frontoparietal contusion with brain herniation through the fracture segment [figure 2]. Plain axial computed tomography scan brain shows a large hyperdense area in the left frontoparietal region suggestive of a contusion (black arrow), as well as brain herniation, with underlying sutural widening based on the clinical examination and ct findings, a decision was taken to medically manage the patient with anti - epileptic medications and monitor for any signs of raised icp . The child showed progressive improvement in the neurological condition and was discharged after 8 days and asked to follow - up for dural repair and cranioplasty after 3 weeks . The child was lost to follow - up and presented 2 months later with a cystic, nonpulsatile 5 cm 4 cm swelling in the left temporal region . Ct scan showed a large cystic lesion in the left temporoparietal region with underlying bone defect [figure 3]. A diagnosis of growing fracture skull (posttraumatic leptomeningeal cyst) was established, and surgical intervention planned . The neonate underwent duraplasty with pericranial graft and cranioplasty with titanium mesh plate 70 days after the head injury insult [figure 4]. The infant tolerated the procedure well and was discharged after suture removal . On 6 months follow - up, the infant was doing well with no neurological deficits or wound - related complications . Plain axial computed tomography scan showing a large 6 cm 3.2 cm 5.3 cm cystic lesion in the left temporoparietal region with underlying bone defect in the temporal bone (black arrow) intraoperative photograph showing titanium mesh plate with underlying pericranial dural graft head injury is likely to occur in children and adolescents ranging from 0 to 19 years in approximately 200 per 100,000 populations with a mortality rate of 29%, according to the national center for health statistic . Different components, such as vasogenic and cytotoxic edema and possibly cerebral vasocongestion contribute to posttraumatic brain swelling . This brain swelling is associated with an exponential rise in the icp and eventually leads to brain herniation syndromes . In infants with open sutures, the relative increases in the icp and their tolerance remain unknown though there is a concern with regards to susceptibility to ischemic injury . Any fracture extending across the cranial suture in an infant can cause bony separation leading to an open cranial vault . Linear skull fracture in association with open sutures can lead to a condition wherein an effect similar to dc is achieved . In adults with a thick solid skull, the linear undisplaced fracture cannot expand and therefore probably will not tolerate an increase in icp as well . The 2012 pediatric head injury guidelines state that decompressive craniectomy with duraplasty, leaving the bone flap out, may be considered for pediatric patients with traumatic brain injuries (tbi) who are showing early signs of neurological deterioration or herniation . Hypothesized that early craniotomy (within 6 h of injury) in pediatric patients with refractory raised icp would result in better outcomes than following the historic standard of care, which reserved surgery as a final intervention in these patients . Similar studies by kan et al . Demonstrated good results with an early craniotomy . In our patient, we believe that the early dc achieved by linear undisplaced fracture and sutural diastasis prevented the development of raised icp leading to quick clinical improvement . Adelson et al . Has recommended the following criteria for selecting favorable patients for craniotomy in children: (1) diffuse cerebral swelling on cranial ct imaging; (2) within 48 h of injury; (3) no episodes of sustained icp> 40 mm hg before surgery; (4) glasgow coma scale score> 3 at some point subsequent to injury; (5) secondary clinical deterioration; and (6) evolving cerebral herniation syndrome . While, our patient initially presented with diffuse cerebral swelling on ct, the infant was otherwise neurologically intact and showed no signs of raised icp . Thus, an emergency surgery was not warranted, and early dural repair was planned . . Found high rates of bone resorption following autologous bone grafting in pediatric tbi patients similar to our previous experience . Due to this and the size of the cranial defect in our patient, we performed the cranioplasty using the titanium mesh plate . Linear undisplaced fracture in neonates along with open sutures may act as a dc relieving the raised icp almost immediately . Such infants in whom there are no signs of raised intracranial tension can be managed conservatively if the decompression effect achieved is adequate . Hence, a close clinical and radiological follow - up is essential . As the effect of decompression
Cardiac implantable electronic devices (cieds) have become increasingly important in cardiac disease management worldwide . In fact, pacemakers, implantable cardioverter defibrillators (icds), and cardiac resynchronization therapy (crt) have been used and developed since the 1960s . With the increase in the number of patients with cieds, the number of the cied - related complications, including infection, has also been increasing . From 1996 to 2003, the rates of hospitalization for cied infection reportedly increased faster than the rates of cied implantation . In patients with cied infection, complete removal of all hardware, regardless of location (subcutaneous, transvenous, or epicardial), is the recommended treatment . Various tools (traction devices, mechanical sheaths, laser sheaths, electrosurgical sheaths, rotating threaded tip sheath, and telescoping sheaths) and methods (femoral approach, internal jugular approach, and a hybrid method with both, transvenous and surgical methods) have been developed for lead removal, and favorable results have been reported, . However, data to determine the optimal duration of antimicrobial therapy for cied infection are limited . Further, data on appropriate management after cied removal are also not available, although management of arrhythmic support after cied removal is needed until a new cied is implanted . In the present review, before a cied can be removed, the consequences of removal need to be ascertained . Patients dependence on pacemakers, the risk of tachyarrhythmia, and requirement of crt must be determined, and the strategy for antiarrhythmic management should be determined on the basis of these investigations . Second, until the new cied is implanted, temporary pacing should be set up, especially in patients completely dependent on a pacemaker, using tools such as passive fixation leads, active fixation leads, and epicardial leads . In their prospective, controlled study, braun et al . Reported that transvenous pacing with active fixation is safe and is associated with a significantly lower rate of pacing - related adverse events than the standard technique of transvenous pacing using a passive external pacing catheter . Forty - nine patients with systemic infection and hemodynamic - relevant bradyarrhythmia were temporarily paced using either a conventional pacing wire / catheter (n=26, reference group) or a permanent bipolar active pacing lead, which was placed transcutaneously in the right ventricle and connected to an external pacing generator (n=23, external lead group). The sensing values in the two groups were almost identical, but the median pacing threshold was significantly higher in the reference group (1.0 v vs. 0.6 v, p<0.05). Within comparable durations of pacing (median: 8.2 vs. 7.7 days), there were 24 pacing - related adverse events (including dislocation, resuscitation due to severe bradycardia, and local infection) in the reference group but only one in the external lead group (p<0.01). Active fixation of temporary leads was only introduced in japan in 2013 . Moreover, a 2-week gap is generally observed between cied removal and new cied implantation in patients with pocket infection and a 46-week gap in patients with systemic infection . Therefore, especially in patients completely dependent on pacing, permanent active fixation of leads permitting bipolar stimulation has been used for temporary pacing (fig . These leads carry a very low risk of percutaneous infection and lead dysfunction for a couple of weeks . No clinical trial data are available for determining the optimal duration of antimicrobial therapy for cied infection . However, therapy for 1014 days after device removal is considered reasonable when cied infection is limited to the pocket site, while at least 24 weeks of parenteral therapy after extraction of the infected device is recommended for patients with bloodstream infection . Only one study has reported simultaneous contralateral (side - to - side) replacement of an infected cied . A one - stage exchange was performed in 68 consecutive patients over a 14-year period by a single cardiologist, and dual - chamber devices were used in two - thirds of these patients . Clinical presentations included device erosion (41%), cellulitis or abscess (35%), and endocarditis (24%). Fifty - nine patients (87%) were followed up for more than 1 year, and 9 patients were lost to follow - up at 110 months after the one - stage contralateral device exchange, with no newly identified cied infections . Additional experience with one - stage contralateral device exchange is needed before it can be recommended for routine use . The patient had cied infection on both sides, and open chest surgery was needed to remove all cieds . No re - infection was noted in the 2year follow - up period . In the other case, early re - implantation was performed because the patient experienced dementia and restlessness 3 days after cied removal . In this case as well, no re - infection was noted in the 2-year follow - up period . Patients with high - energy cieds are more likely to develop an infection than patients with a pacemaker . Patients with a high risk of tachyarrhythmia should be temporarily managed using tools such as wearable cardioverter defibrillators (wcds) and catheter ablation . Healy et al . Reported on the cost effectiveness of using wcds (fig . The incremental cost effectiveness of wcds was $20,300 per life - year or $26,436 per quality - adjusted life - year (qaly) as compared to discharge to home without a wcd . Discharge to a skilled nursing facility and in - hospital monitoring resulted in higher costs and poorer clinical outcomes . The incremental cost - effectiveness ratio was as low as $15,392/qaly if the wcds successfully terminated 95% of sudden cardiac arrest (sca) events and exceeded the $50,000/qaly willingness - to - pay threshold if their efficacy was <69% . Use of wcds remained cost effective, assuming a 2-month sca risk of 5.6%, as long as the time to reimplantation was at least 2 weeks . Conducted a retrospective study on all wcd patients who underwent icd removal because of cardiac device infections at two referral centers . The median daily wcd use was 20 h / day and the median duration of use was 21 days . Two patients had four episodes of sustained ventricular tachycardia (vt), which were successfully terminated by the wcd . This previous study concluded that the wcd can prevent sudden cardiac death until icd reimplantation is possible in patients from whom the cied has been removed because of cied infection . In japan, because most patients with cied infection are not discharged until a new cied is implanted and are monitored by a telemetry device, the rate of sudden death during the waiting period is low . However, wcd seems to be safer than only monitoring, even when the patients are hospitalized . S - icds are beneficial because they carry no risk of vascular injury, have a low risk of systemic infection, and have no need for fluoroscopy . Although s - icds are not a temporary system, they may be suitable for early reimplantation in patients at a high risk of tachyarrhythmia . We encountered one case of successful ablation before removal of an infected crt - d . The patient was a 72-year - old woman with complete av block, sustained vt, and cardiac sarcoidosis . The vt was controlled using amiodarone and pilsicainide, but a vt storm occurred after pilsicainide was withdrawn . Because the lv ejection fraction was less than 30% the vt was finally eliminated by catheter ablation, and it did not recur after implantation of a new cied . Thus, catheter ablation may be another useful method for managing tachyarrhythmia during the waiting period . In patients dependent on crt, it is very difficult to maintain hemodynamics by using temporary vvi pacing after cied removal . To our knowledge, we encountered two cases in which temporary sequential pacing was used during the waiting period . The first was that of a 77-year - old man who suffered from a complete av block, sustained vt, and cardiac sarcoidosis . Vvi pacing instead of crt aggravated the hemodynamic state (cardiac index [ci]=2.27 l min m in ddd with biv pacing; 1.76 l min m in vvi with rv pacing). The hemodynamic state was maintained for 2 weeks, and a new crt - d was successfully implanted after the infection disappeared . The other case was that of a 72-year - old woman with complete av block, sustained vt, and cardiac sarcoidosis . Her pacemaker was upgraded to crt - d at the time of mitral valve replacement, and the lv lead was an epicardial lead (fig . Vvi pacing instead of crt aggravated the hemodynamic state (ci=1.95 l min m in ddd with biv pacing; 1.74 l min m in ddd with only rv pacing; 1.45 l min m in vvi with rv pacing). The lateral chest wall was opened to remove the lv epicardial lead, but because of adhesion of the left lung, the lv lead was only partially removed . Temporary epicardial atrial and lv leads were implanted . A temporary rv lead (with a permanent active fixation lead) the hemodynamic state was maintained for 2 weeks, and a new crt - d was successfully implanted after infection disappeared . We have never used a temporary transvenous lv lead, which may be required in some cases . Various methods can be used for arrhythmic management during the waiting period before new cied implantation . The aim should be to use an appropriate method to prevent the occurrence of arrhythmic events.
Epithelial - myoepithelial carcinoma (emc) is a rare biphasic low grade malignancy accounting for only 0.5% of all salivary gland tumors . There have been reports suggesting co - existence of another malignancy, like adenoid cystic carcinoma (ad cc) with emc, in the same tumor . If emc develops in a long standing case of pleomorphic adenoma (pa), it is called emc - ex pa . Ours is a case of a tumor in the submandibular and sublingual salivary glands diagnosed as emc, having clinical and histological resemblance to cellular pa . The present case report is about a 61-year - old woman who reported to us with a growth in the floor of mouth that gradually increased in size since last 3 years, without pain . On examination, a 3 cm 2.5 cm ovoid swelling was palpated lingual to the edentulous alveolar ridge, extending from midline (lingual frenum) to the right premolars [figure 1]. It was a firm, non - tender, non - compressible, non - reducible, did not move with deglutition and showed no change in size with meals . Complete hemogram, serum electrolyte levels, kidney function test and liver function test had all values within the normal range, but for a raised erythrocyte sedimentation rate (50 mm / h). Magnetic resonance imaging revealed a 20 mm 18 mm 15 mm well defined well - marginated lesion in right sublingual space in the region of anterior aspect of sublingual gland [figure 2]. It indented the inferior surface of tongue and right genioglossus muscle and did not cross midline . Multiple mildly enlarged bilateral level ib, ii and iii lymph nodes were noted . A provisional diagnosis of pa of sublingual gland was made and local excision of the lesion along with the gland was planned under l.a . Incision was placed from midline extending posteriorly near the alveolar ridge in order to protect the wharton's duct . With careful dissection,, it was found that the mass involved the deep part of submandibular gland and duct with the sublingual gland being compressed by the mass . It was difficult to delineate the exact origin of the pathology (sublingual or submandibular gland); hence it was decided to sacrifice the sublingual gland, deep part of submandibular gland and its duct on the affected side [figure 1]. Initial histopathological examination, revealed a solid tumor tissue composed of myoepithelial and ductal cells presenting as double layered duct like structures with hyalinization of stroma . The epithelial component showed diversity in the form of sheets, nests and cords with different patterns of ductal arrangements and large areas of secretory material in the intervening areas, suggestive of cellular pa [figure 3]. However since most of the tumors of submandibular and sublingual gland are malignant, a second examination of the specimen was undertaken . It showed that the entire tumor mass was covered by dense band of fibrous connective tissue . Tumor cells were arranged in a background of predominantly mucous acini, as small tubules lined by cuboidal to oval cells containing prominent nuclei and eosinophilic cytoplasm and surrounded by clear cells and increased hyalinization [figure 4]. On the basis of this dual cell population, a provisional diagnosis of emc was suggested . Some focal areas were also observed with cells arranged in a cribriform pattern with pseudocystic spaces that pointed toward ad cc . Immunohistochemistry showed p-63 reactivity in outer clear cells, s-100 and smooth muscle actin were focally positive and c - kit for ad cc was negative . Hence, a diagnosis of hybrid carcinoma was ruled out and a final diagnosis of epi - myoepithelial carcinoma was made . There is a chance that being a long - standing tumor; initial pa may have turned into emc . Patient denied adjuvant radiotherapy; is being followed - up since last 1 year and has no fresh complains or signs of recurrence until now [figure 5]. Magnetic resonance imaging of the lesion h and e section suggestive of cellular pleomorphic adenoma h and e section suggestive of epithelial - myoepithelial carcinoma post - operative clinical picture emc was first described by donath et al ., in 1972 and officially defined as a salivary gland tumor by who in 1991 . It commonly affects parotid gland (70%), sino - nasal glands, palatal and submandibular gland and rarer sites like lungs, breasts etc ., (no reports on sublingual gland origin were found). It is a low - grade carcinoma of ductal origin characterized by its dual cell population of ductal epithelial cells and clear myoepithelial cells . Apart from this characteristic picture, there are many histological variants such as oncocytic emc, double clear emc, emc ex pa, high grade or dedifferentiated emc, emc with myoepithelial anaplasia etc . Many times, it is found that pre - operative fnac points toward a benign pathology (pa). A diagnosis of pa would be incorrect due to the excessive hyalinization seen in the tissue, in spite of the pleomorphic picture of cells . Differential diagnosis includes other clear cell tumors such as muco - epidermoid carcinoma, acinic cell carcinoma and sebaceous carcinoma, with immunohistochemical presence of myoepithelial markers, similar to those seen in emc . Furthermore, there have been reports describing emc ex pa in parotid gland with the histological picture similar to ours . Within the characteristic dual cell picture of emc, arrangements of cells in cribriform pattern with pseudocystic spaces reminiscent of ad cc were observed focally ., the tumor could have been a primary onset emc or an emc - ex - pa . There have been cases of recurrence of tumor by simple excision alone, hence we chose wider margins of healthy mucosa . The prognosis of emc is fairly good as the median disease free survival rate is reported to be 11.34 years . Long - term follow - up is needed for detection of early signs of recurrence and proper management.
Double - balloon enteroscopy (dbe), first described by yamamoto et al 1, allows examination of the small intestine, and retrograde dbe (rdbe) permits access to the distal small intestine . Mehdizadeh et al 2 found a 79% success rate, defining success as intubation of the ic valve, in their review . May et al 3, however, failed to reach the terminal ileum (ti) in 7% of patients while ell et al 4 and heine et al 5 reported 14% and 58% failure rates, respectively . The highest success rate was achieved by the group with the most experience, yamamoto et al 6, who successfully intubated the ic valve in all of their 89 patients who underwent rdbe . Mehidizadeh et al 7 found no significant improvement in the endoscopist s performance with increased experience, and found only a significant decline in overall procedure and fluoroscopy times . While dbe has been shown to facilitate difficult colonoscopies 8, we noted that performing a pre - dbe colonoscopy using a pediatric colonoscope improved rdbe ic intubation rates . The rationale for such a procedure is that conventional colonoscopy is quick and the more rigid colonoscope facilitates the initial ic valve intubation . We therefore examined the ic intubation rates, procedure duration, and maximal depth of enteroscope insertion among those patients who received a pre - colonoscopy followed by rdbe and compared the results with those who received a conventional rdbe . This study was approved by the institution s committee for the protection of human subjects in research . A computer program randomly chose 45 patients from a pool of all patients who underwent rdbe procedures during 2011 2013 . All procedures were performed by either of two experienced endoscopists, who had both performed approximately 50 rdbes prior to the study period, and a gastroenterology fellow . Consent was obtained for all procedures and all patients underwent a bowel - cleansing regimen consisting of four liters of polyethylene glycol and overnight fasting . The fujinon double - balloon enteroscopy system (fujinon en-450t5 enteroscope; jujifilm medical systems, wayne, new jersey, usa) was used in all procedures and the pediatric colonoscope (olympus pcf 160 or 180; olympus america, inc ., melville, new york, usa) was utilized in those procedures involving a pre - rdbe colonoscopy . Sedation was achieved by either conscious sedation with fentanyl and midazolam or with general anesthesia at the discretion of the endoscopist in conjunction with the anesthesiologist, depending on the cardiovascular and respiratory status of the patient . In patients who received a pre - rdbe colonoscopy, the colonoscope allowed easy cleaning of the cecum, and dilation and orientation of the ileo - cecal (ic) valve . After advancing approximately 20 cm into the ileum, which took 5 15 minutes, the colonoscope was removed and the standard rdbe method was followed as described by yamamoto et al 1 . Deeper intubation of the ileum by colonoscopy or by rdbe was facilitated by placing the patient supine . Stability of enteroscope intubation was deemed as reaching 15 20 cm proximal to the ic valve . The duration of the procedure was defined as the time of endoscope insertion (including the pre - rdbe colonoscope) to the time of removal of the enteroscope . The maximal depth of insertion was defined as the distance encompassed by the enteroscope until advancement was no longer possible . Demographic data, including age, gender, height, weight, indications for rdbe, sedation method, procedure duration, interventions, and immediate adverse effects were electronically documented at the time of the procedure . The mean, standard deviation (sd), and range were calculated for the continuous data obtained for each patient . Comparisons between the two groups were carried out using the mann - whitney u test . A p value of <0.05 was considered to be statistically significant . The mean, standard deviation (sd), and range were calculated for the continuous data obtained for each patient . Comparisons between the two groups were carried out using the mann - whitney u test . A p value of <0.05 was considered to be statistically significant . Twenty - three of the patients were women (51.1%) and twenty - two of them were men (48.9%). The mean (sd) patient age was 59.7 (16.0) years (range 22 84). The mean (sd) patient body mass index (bmi) was 30.1 (7.33) kg / m(range 16.2 52.4) and 12 of 45 patients (26.7%) had a bmi over 30 . The main indications for the procedure were occult gastrointestinal bleeding (50%), masses (26%), video capsule endoscopies with abnormal findings (11%), and iron - deficiency anemia (8%). In comparing the results of the group that received the pre - rdbe colonoscopy with those of the group that received the traditional method, the only statistically significant difference was within the gender . The group that underwent the novel procedure had fifteen men and eight women, while the group that underwent the traditional procedure had seven men and fifteen women (p <0.0004). The pre - rdbe colonoscopy method was used in 23 patients (51.1%) and the standard dbe method was used in 22 patients (48.9%). Among the patients who received the pre - rdbe colonoscopy, successful, stable intubation of the ic valve was achieved in all 23 patients (100%), compared to only 16 /22 (72.7%) of those who underwent the traditional procedure (p <0.003). The mean (sd) of maximal depth of insertion was 78.2 (18.1) cm and 67.2 (17.1) cm in the novel procedure group and the traditional procedure group, respectively, which were not significantly different (p <0.65). In addition, the mean (sd) for the duration of the procedure in the novel and the traditional procedure groups were 81.6 (8.9) minutes and 95 (13.2) minutes, respectively . These results were not significantly different (p <0.53). Successful diagnosis and intervention (identification and treatment of bleeding source or lesion) was performed in 13 /23 (56.5%) in the novel procedure group and 7 /22 (32%) in the traditional procedure group, and these results were not significantly different (p <0.09). The novel procedure group and the traditional procedure group had 3 /23 patients (13.0%) and 3 /22 patients (13.6%) with poor bowel preparation, respectively . The two endoscopists performed 25 and 20 rdbes, and the failure rates when they used the traditional method were 3 /13 (23.1%) and 3 /9 (33.3%), respectively (p <0.01). Intubation rates for men (90.9%) and women (82.6%) were not significantly different (p <0.41). Twenty - three of the patients were women (51.1%) and twenty - two of them were men (48.9%). The mean (sd) patient age was 59.7 (16.0) years (range 22 84). The mean (sd) patient body mass index (bmi) was 30.1 (7.33) kg / m(range 16.2 52.4) and 12 of 45 patients (26.7%) had a bmi over 30 . The main indications for the procedure were occult gastrointestinal bleeding (50%), masses (26%), video capsule endoscopies with abnormal findings (11%), and iron - deficiency anemia (8%). In comparing the results of the group that received the pre - rdbe colonoscopy with those of the group that received the traditional method, the only statistically significant difference was within the gender . The group that underwent the novel procedure had fifteen men and eight women, while the group that underwent the traditional procedure had seven men and fifteen women (p <0.0004). The pre - rdbe colonoscopy method was used in 23 patients (51.1%) and the standard dbe method was used in 22 patients (48.9%). Among the patients who received the pre - rdbe colonoscopy, successful, stable intubation of the ic valve was achieved in all 23 patients (100%), compared to only 16 /22 (72.7%) of those who underwent the traditional procedure (p <0.003). The mean (sd) of maximal depth of insertion was 78.2 (18.1) cm and 67.2 (17.1) cm in the novel procedure group and the traditional procedure group, respectively, which were not significantly different (p <0.65). In addition, the mean (sd) for the duration of the procedure in the novel and the traditional procedure groups were 81.6 (8.9) minutes and 95 (13.2) minutes, respectively . These results were not significantly different (p <0.53). Successful diagnosis and intervention (identification and treatment of bleeding source or lesion) was performed in 13 /23 (56.5%) in the novel procedure group and 7 /22 (32%) in the traditional procedure group, and these results were not significantly different (p <0.09). The novel procedure group and the traditional procedure group had 3 /23 patients (13.0%) and 3 /22 patients (13.6%) with poor bowel preparation, respectively . The two endoscopists performed 25 and 20 rdbes, and the failure rates when they used the traditional method were 3 /13 (23.1%) and 3 /9 (33.3%), respectively (p <0.01). Intubation rates for men (90.9%) and women (82.6%) were not significantly different (p <0.41). Retrograde dbe poses a technical challenge to the endoscopist and requires a significant learning curve 7 . Thorough and consistent training under thoughtful mentorship is crucial to not only intubate the ic valve, but also to avoid non - spiral looping and enteroscope withdrawal upon engagement of the ileum . Consistent with this challenge, various groups have reported unsuccessful ic valve intubation rates ranging from 7% 58% . The difficulty in successful intubation occurs when the valve orifice cannot be oriented appropriately or the valve itself cannot be intubated 10 . By performing a pre - rdbe colonoscopy, which is usually a quick procedure, the more rigid pediatric colonoscope allowed for easier intubation by dilating and orienting the valve to later facilitate ic intubation with the more flexible dbe . In addition, although not quantified, using the colonoscope allowed easier cleaning of the residual luminal contents from the cecum due to its suction channel, which is larger than that of the dbe . Rapid withdrawal of the colonoscope left a straightened colon that facilitated rapid insertion of the dbe . Retrograde dbe utilizing this novel method of performing a colonoscopy before the rdbe had a significantly higher ic intubation success rate, compared to rdbes using the traditional method . Within the traditional method group, a similar success rate to that of the mehdizadeh et al 2 group was found (72.7% vs 79%). However, with the novel method, we achieved successful intubation in 100% of our patients . While not statistically significant, the mean procedure time was shorter on average, despite the additional colonoscopy . The main limitation of this study is that it is a small, retrospective, single - center study . Multi - center prospective studies are needed to compare the results of this novel method with those obtained with the traditional method . The gender disparity between the two groups does present a potential confounding variable; there were fifteen women in the traditional procedure group and only eight women in the novel procedure group . Alternative techniques to improve ic valve intubation have been described, including a study by ross et al 11 in which a balloon was inflated over a guidewire passed through the ic valve, and despott et al 10 in which the enteroscope balloon was inflated in the ti while the enteroscope and overtube were pulled back to straighten the ileo - colonic angle . The study reported herein offers another option the endoscopist may use when confronted with a difficult rdbe intubation.
Since couinaud's segment viii is the largest segment of the liver and patients with hepatocellular carcinoma (hcc) often have impaired liver function, reduced anatomical resection of the ventral part of segment viii (s8vent) has been used as an alternative to full anatomical resection of segment viii in its entirety in actual clinical settings . Anatomical resection of s8vent is generally considered a demanding procedure due to its anterosuperior location, its boundaries marked by tributaries of the middle or right veins and their tributaries, and the complete absence of anatomical landmarks on the liver surface, particularly in the cirrhotic liver . Several techniques of anatomical resection have been proposed, including the technique involving puncture of the portal branch as proposed by makuuchi et al . That technique remains the most precise and practical method for anatomical demarcation on the liver surface . However, there are no accurate methods to identify the demarcation line inside the liver and divide the liver parenchyma along the intersegmental or intersubsegmental plane, which is not a straight line but rugged and irregular . The current authors have proposed a method of identifying the intersegmental and intersubsegmental border inside the liver to facilitate more precise anatomical subsegmentectomy . His liver function was normal, and his indocyanine green retention rate at 15 min was 6.5% . The tumor was located in the ventral part of segment viii (s8vent) (fig . According to three - dimensional images (iqqa - liver, edda technology, princeton, nj, usa), one tributary of the middle hepatic vein (mhv), designated v8i, was running between s8vent and the dorsal part of segment viii (s8dor). Another tributary of the mhv, designated v8 - 5i, was running between s8vent and the ventral part of s5 (s5vent) (fig . Volumetric analysis indicated that the volume of the sviii was 297 cm (22.1% of the total liver volume) and that the volume of s8vent was 165 cm (12.3%). After laparotomy and thoracotomy along the ninth intercostal space with a j - shaped incision, intraoperative ultrasonography was used to scan the entire liver to determine access to the vascular architecture and the tumor . Thoracophrenolaparotomy facilitated mobilization of the right liver and provided excellent views of the insertion of the hepatic veins into the vena cava . Guided by ultrasound, about 5 ml of indigo carmine dye (indigocarmine injection 20 mg/5 ml; daiichi sankyo, tokyo, japan) was injected into the proximal part of portal branch of s8vent (p8vent) after clamping of the hepatic artery . The border of stained surface of the liver was marked using electrocautery and the tumor was located within the resection line (fig . The locations of the aforementioned p8 vent, v8i, and v8 - 5i were then ascertained and marked on the surface (fig . Flow was intermittently occluded by clamping of the hepatoduodenal ligament, and the parenchyma was dissected using the clamp and crush method . The sequence of liver parenchymal transection is shown in fig . After the small tributary of v8 - 5i was exposed, it was followed all the way to the main trunk of the mhv . The portal pedicle of s8vent, which lay near the v8 - 5i, was then ligated and divided . After anatomical resection of s8vent, v8i and v8 - 5i were clearly exposed in almost their entirety and then preserved . The main trunk of the mhv between the two tributaries was also exposed (fig . The operating time was 240 min and intraoperative blood loss was 50 ml . Drains were inserted in the transected surface of the liver and right subphrenic space, and these drains were removed on day 6 postoperatively . An intercostal drain was left in the pleural space and removed on day 2 postoperatively . According to the oncological principle, it is reasonable to radically remove hcc by inclusion of the feeding portal area since the portal vein is the main gate for intrahepatic tumor spread . Meanwhile, the volume to be resected is limited since patients with hcc often have background liver disease . Anatomic segmental or subsegmental resection, taking into consideration both preservation, to the maximal extent possible, of liver functional parenchyma and eradication of intrahepatic metastasis, would be a theoretically reasonable procedure . Several studies have demonstrated the superiority of anatomic resection in comparison to non - anatomic resection, showing better disease - free or overall survival . As for this patient, the tumor was located in the ventral part of s8vent, so the anatomical subsegmentectomy of s8vent was decided . However, anatomical segmentectomy, and especially s8vent resection, is technically demanding and two main difficulties exist . One relates to the demarcation of s8vent on the liver surface and the other relates to the direction of transection along the intersubsegmental planes inside the liver . Several studies have described techniques for demarcation of s8vent on the liver surface . Of these, the intraoperative ultrasound - guided portal branch puncture technique proposed by makuuchi et al . In the mid-1980s is still the most precise method . In relation to the direction of transection along the intersubsegmental planes inside the liver, sakairi and makuuchi proposed a method in which the portal pedicle is clasped and dye is injected . With this method, staining of the portal unit persists even after resection is complete, and the margin of the portal unit within the parenchyma is easily followed during transection . However, if a small branch of the portal vein is injured in an actual clinical setting, the dye spreads to the dividing planes and also stains the counter plane . Moreover, a recent study showed that the subsegmental border visualized between the ventral and dorsal region always coincided with the plane of the v8i according to computer simulations, so the subsegmental plane can reasonably be divided along with v8i by preserving the very small tributaries near the liver surface and following them to determine where they meet as they run into v8i . The small venous tributaries meet along the way, gradually becoming a larger vessel that eventually joins the main three hepatic veins . The method is time - consuming but may be the only method to accurately divide the liver parenchyma along the intersegmental or intersubsegmental plane demarcation . In the current case, a tributary of the mhv (v8 - 5i) was found to be running on the segment border of s8vent and s5vent in three - dimensional images and it was detected and exposed during transection . The landmark vein of v8 - 5i in the transverse s8s5 intersegmental plane was determined for the first time since it had not been described in the literature . In recent practice, these subsegmental venous tributaries have been exposed as they are in anatomical studies . Anatomical s8vent resection is technically demanding, and previously reported techniques for anatomical resection are not without their drawbacks . Proposed here is a more accurate method of dividing the liver parenchyma along the intersubsegmental and intersegmental demarcation to facilitate more precise anatomical s8vent resection . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . Xiang, dong, and makuuchi had done the study conception and design and drafted the manuscript . The acquisition of data was done by xiang, liu, dong, and sano.
Patients with cervical radiculopathy due to single - level degenerative disc disease who fail to improve with nonoperative therapy are candidates for anterior decompression and reconstruction with either an arthrodesis or arthroplasty . Both procedures require minimal hospitalization and are highly effective in relieving pain and improving neurological function . The ability to return to work and the speed with which this occurs are important to the individual being treated and also to society . Arthrodesis and arthroplasty differ in that one treatment eliminates motion at a cervical spinal segment while the other preserves it . This fundamental difference may impact postoperative function in terms of activity level, which ultimately could facilitate or hinder the ability to return to work . In patients with degenerative disease of the cervical spine, does cervical artificial disc replacement lead to better work - related outcomes than fusion? Does return to work after surgery differ based on gender, age, smoking, litigation status, workers compensation status, or other sociodemographic factors? Study design: systematic review . Inclusion criteria: studies (coe i - ii) directly comparing cervical artificial disc replacement (c - adr) with discectomy and fusion (anterior cervical discectomy and fusion [acdf]) in patients with degenerative cervical disc disease; us food and drug administration (fda)-approved or unapproved devices in phase iii trials with 1 year of follow - up data in a peer - reviewed journal; subanalysis data from fda investigational device exemption (ide) trials . Exclusion criteria: studies in patients with disc replacement or fusion in the thoracic or lumbar spine . Outcomes: proportion of patients working at follow - up; time to return to work following surgery . Analysis: proportion of patients working and mean or median number of days until return to work were abstracted from the reports as available . Pooling of data was not done due to concerns regarding heterogeneity and the lack of well - defined measures of return to work . Inclusion criteria: studies (coe i - ii) directly comparing cervical artificial disc replacement (c - adr) with discectomy and fusion (anterior cervical discectomy and fusion [acdf]) in patients with degenerative cervical disc disease; us food and drug administration (fda)-approved or unapproved devices in phase iii trials with 1 year of follow - up data in a peer - reviewed journal; subanalysis data from fda investigational device exemption (ide) trials . Exclusion criteria: studies in patients with disc replacement or fusion in the thoracic or lumbar spine . Outcomes: proportion of patients working at follow - up; time to return to work following surgery . Analysis: proportion of patients working and mean or median number of days until return to work were abstracted from the reports as available . Pooling of data was not done due to concerns regarding heterogeneity and the lack of well - defined measures of return to work . We identified eight reports that met our inclusion criteria, which included information on return to work . From a total of 295 citations retrieved, 1). Of these, eight met the inclusion criteria, four of which described the same study at different follow - up points (table 1). Seven article representing four randomized controlled trials (coe ii) and four artificial discs are critically summarized: bryan cervical disc: us1,2 and china,3 prestige st,4,5 prodisc - c,6 and kineflex|c.7 in addition, we summarized a secondary analysis of data from the u. bryan and prestige rcts that focused on a subset of patients who were covered by workers compensation.8 further details on the class of evidence rating and additional data for these studies can be found in the web appendix at www.aospine.org/ebsj . Percentage of patients working at follow - up (tables 2,3) in two studies,2,4 the overall proportion of patients who were working increased postoperatively approximately 10%12% (from 65% preoperatively to 75% at 24 months). Larger improvements were evident among workers compensation patients (from 36%63%),8 and a third study6 reported no preoperative or postoperative differences in work status . At 24 months postoperatively, there was no significant difference in work status between disc replacement and fusion patients across three trials . Work status less than 24 months after surgery was reported in only one study,2 and suggested that disc replacement patients were more likely than fusion patients to be working 6 weeks after surgery . This difference was more pronounced in workers compensation patients.8 patients covered by workers compensation appeared to be less likely to be working at all time points; however, no direct statistical comparisons of these patients - to - patients with other insurance were reported . 2) patients who received disc replacement began working sooner after surgery than patients who received fusion with statistical significance reported in two studies . After controlling for gender, study, and preoperative work status, the difference between treatments for median time to work return among worker s compensation participants did not reach statistical significance . Among patients who were covered by workers compensation, those who were working at the time of surgery returned to work sooner than did patients in the full sample of the worker s compensation patients . No direct comparison of workmen s compensation patients - to - other patients was reported . Differential effects of c - adr / acdf on return to work no studies examined differential work - related outcomes by gender, smoking status, litigation, or any characteristic other than workers compensation . No direct comparisons of worker s compensation patients - to - patients with other insurance were possible . The pattern of findings for workers compensation patients, however, was similar to that of patients in general: earlier return to work with disc replacement compared with fusion and no significant group differences in work status after 6 months . One study 7 reported that the proportion of patients who rated their activity level as rct indicates randomized controlled trial; nr, not reported; and n / a, not applicable . C - adr indicates total disc replacement; acdf, anterior cervical discectomy and fusion; wc, workers compensation; and nr, not reported . C - adr indicates total disc replacement; acdf, anterior cervical discectomy and fusion . * workers compensation patients only; controlling for gender, study, and preoperative work status . This analysis of the data demonstrated that patients treated with disc replacement tended to return to work more quickly than those receiving fusion, but that overall return to work in the two groups was equivalent at 2 years . Both therapies have been shown to be safe and effective; therefore, it is expected that most patients will be able to resume normal productive lives . The c - adr patients tended to return to work sooner than fusion patients and the reasons for this are unclear . The first is either patient or surgeon bias since neither group was blinded . At the time of enrollment for each of the studies, c - adr had not been approved in the united states, and it could be presumed that the primary patient motivation to enter one of the studies was to obtain a c - adr . This high level of interest could have led to a placebo effect in those receiving the c - adr . Additionally, surgeons may have been more willing to release patients to work if they received a c - adr . Finally, it may be that there is period during which the patient adjusts to the loss of a motion segment which is associated with increased discomfort, particularly with activity . Such an adjustment would not occur with c - adr and if real, could account for the difference in early return to work . Conclusions from this review are limited by the following: follow - up rates in the prestige study were low; however, these low rates were due to the publication of articles before all patients had reached the follow - up window . Follow - up rates at 4 years were also fairly low (75%) in the fda bryan trial; however, in both of these studies loss to follow - up was equivalent across treatment groups . Questions about return to work were assessed with patient self - report and apparently not validated with work records . No definition was provided of self - reported return to work (eg, how the question was asked, whether part - time work was included). The measures do not reflect return to work per se, as return to work assumes that patients were working before surgery . The proportions of people who are working do not reflect individual change from preoperative to postoperative, only group percentages at the various time points . These percentages were not broken down by the work status of the patient before surgery, and included patients who were working postoperatively as well as those who were not working . Therefore, this measure does not accurately reflect return to work but rather work status at the time of follow - up in the study population . No direct comparison of patients with workers compensation versus patients with other kinds of insurance was reported in a secondary analysis of the bryan and prestige trials . Workers compensation patients comprised only about 10% of patients in those two trials, so that it is likely that the percentages reported in table 2 for the full sample would be close to the percentages for the nonworkers compensation sample . If that is the case, then indirect comparisons of the workers compensation patients with the full sample would approximate differences between patients with and without workers compensation . Only the published articles from the bryan trial1,2 provided data on working status less than 2 years after surgery . Measures from earlier time points were collected in the prestige trial and analyzed by steinmetz et al,8 but they are not reported in the main articles from the prestige study.4,5 disc replacement patients were more likely than fusion patients to be working at 6 weeks postoperatively in one study no significant differences between treatment groups in proportion of patients working after 6 months of follow - up in three rcts earlier return to work following surgery for disc replacement than for fusion across three rcts; statistically significant differences were seen in two studies one study reported equivalent activity levels at 24 months in both treatment groups
The age - standardized incidence rate of thyroid cancer in 2012 was 62.5 per 100,000 persons (23.0 per 100,000 men and 102.4 per 100,000 women), and was the most common cancer (sixth most common cancer in men and the most common cancer in women) among koreans . The average annual percentage change in thyroid cancer incidence for 1999 - 2012 was 22.3% (23.6% in men and 22.1% in women), the most rapid among all cancers in korea . Nevertheless, despite an increase in incidence, mortality rates have remained nearly constant over the past three decades . Increases in thyroid cancer incidence have been reported not only in korea but also in many other parts of the world . The rate of thyroid cancer diagnosis has more than doubled from 4.9 per 100,000 persons in 1975 to 10.6 per 100,000 persons in 2005; meanwhile, thyroid cancer mortality rates in the united states have remained among the most stable . Although the reasons for the rapid rise in thyroid cancer diagnosis have yet to be determined, several groups have argued that the apparent increases in thyroid cancer do not represent a true increase in disease, but rather the results of a large reservoir of undiagnosed thyroid cancers combined with overdiagnosis of small tumors that will never become clinically significant . In korea, the national cancer screening program (ncsp), which was implemented in 1999, provides nationwide screening services free - of - charge or with a small copayment for gastric, liver, colorectal, breast, and cervical cancers . Although thyroid cancer screening is not covered under the ncsp, healthcare providers typically offer ultrasonographic screening for thyroid cancer as an inexpensive add - on at around 30 to 50 usd . Nevertheless, the offering of thyroid cancer screening with ultrasonography as part of routine health checkups is controversial due to the lack of consensus among experts and intrinsic difficulties in accurately estimating rates of overdiagnosis . Generating morbidity that adds to the societal burden of cancer, in terms of medical, psychological, and economic expense, overdiagnosis and overtreatment of inconsequential disease are the most serious harms associated with early detection of cancer through unwarranted screening . An overdiagnosed person is unlikely to benefit from and may be harmed physically and emotionally by diagnostic procedures and treatments . Despite the harms of overdiagnosis, only a few studies have been conducted to assess the public s understanding of overdiagnosis and how information on overdiagnosis might affect one s decision to undergo screening . For breast cancer, information on screening typically emphasizes the benefits thereof without mentioning overdiagnosis [7 - 12]. Recent qualitative studies have found that information on overdiagnosis in breast cancer screening can be difficult for screening - eligible women to understand; in addition, it was often found by women to be surprising and counterintuitive . Nevertheless, once women are informed of the harms, their intentions or actual uptake of breast cancer screening reportedly decrease . Thus, informing individuals on the harms of cancer screening has become critically important and necessary . Indeed, the united kingdom has since released breast cancer leaflets describing overdiagnosis as the main risk of screening . Optimal strategies for communicating information on overdiagnosis in thyroid cancer screening might be more important than breast cancer screening, because it is yet unclear whether increased screening for early detection of thyroid cancer reduces mortality and evidence on the benefits of thyroid cancer screening is limited . Notwithstanding, among women who had previously undergone cancer screening, many had no knowledge regarding overdiagnosis and had little knowledge regarding the harms of overdiagnosis . Thus, the aim of this study was to assess changes in screening intention after learning about overdiagnosis among women who had prior experiences with cancer screening and to determine factors with the greatest influence thereon . Intention to undergo thyroid cancer screening was assessed before and after subjects had received information . Data were acquired from subjects included in the 2013 korean national cancer screening survey (kncss), an annual cross - sectional survey conducted to examine screening rates among koreans for five common cancers (gastric, liver, colorectal, breast, and cervix) through nationally representative random sampling . Men ages 40 to 74 years and women ages 30 to 74 years were selected based on resident of registration population data for july 2013 compiled by statistics korea, using multistage random sampling according to sex, age, geographic area, and size of the population per area . Interviewers from a professional research agency went door - to - door to recruit residents, and at least three attempts were made to contact individual residents between september 26 and october 18, 2013 . From the 4,100 participants in the 2013 kncss, 1,816 women who had previously undergone cancer screening within the past 2 years were selected . An additional face - to - face interview was conducted to examine how women integrated information on overdiagnosis with their existing understanding of thyroid cancer screening and how they might use such information when deciding on screening in the future . Finally, 586 women who completed the kncss interview and the additional face - to - face interview were included in this study (32.3%). Descriptive data for the 586 women included in the study and 1,230 women who were not showed no difference in age, education level, monthly household income, and type of health insurance . The study was approved by the institutional review board of national cancer center, korea, and written informed consent was obtained from all study participants . The main outcome measure was change in intention to undergo future thyroid screening, which was assessed before and after subjects had received information on overdiagnosis . Before discussing information on overdiagnosis, we briefly described thyroid cancer screening as ultrasonographic tests can be used to detect thyroid cancer at early stages in asymptomatic women, the cost of which is around 30 to 50 usd, and assessed the participants intentions to undergo thyroid cancer screening via a face - to - face interview and in writing in the form of a questionnaire . Thereafter, we gave a brief explanation of overdiagnosis, including a statement on the harms of thyroid cancer screening: early stage thyroid cancers detected through screening are usually tiny papillary thyroid tumors, which are very slow - growing, highly unlikely to go on to cause symptoms, much less death . However, thyroid cancer screening could lead to unnecessary thyroidectomy upon diagnosis of thyroid cancer that may not go on to cause symptoms or death in your lifetime . Participants were then asked to respond to this statement to elucidate changes in their intentions to undergo future thyroid cancer screening . To avoid misunderstanding of overdiagnosis among the interviewees, each word in the explanation was chosen carefully by experts in light of previous research . No estimated numbers, such as overdiagnosis rates, were used, since these have not yet been definitively agreed upon . I will probably not undergo screening; and i definitely will not undergo screening . The first two answers were considered as positive intentions to undergo screening, while the last two answers were considered as reflecting negative intentions . Changes in intention were coded as a decrease or no decrease . Characteristics of the study population, including age, household income, insurance coverage, education level, marital status, private cancer insurance, prior awareness of overdiagnosis, thyroid screening history, beliefs on cancer screening efficacy, and family history of cancer (first - degree relatives with any cancer) were also assessed . Insurance coverage was categorized as either national health insurance (nhi) or medical aid program (map) coverage . Prior awareness of overdiagnosis was measured with the question, have you ever heard about the possibility for adverse effects related to overdiagnosis from cancer screening? And answers of yes or no . Thyroid screening history was restricted to ultrasonography for cancer screening purposes . To measure beliefs on the efficacy of cancer screening, participants were asked to respond to the question, how effective do you believe cancer screening is in early cancer detection? On a five - point likert scale, with one being not effective at all and five being extremely effective . Family history of cancer was limited to that in only blood relatives, including half - siblings . Univariate and multivariate logistic regression analyses were performed after adjusting for other variables to determine characteristics associated with thyroid cancer screening intention and change therein after receiving information on overdiagnosis ., college station, tx), and p <0.05 was considered statistically significant . Data were acquired from subjects included in the 2013 korean national cancer screening survey (kncss), an annual cross - sectional survey conducted to examine screening rates among koreans for five common cancers (gastric, liver, colorectal, breast, and cervix) through nationally representative random sampling . Men ages 40 to 74 years and women ages 30 to 74 years were selected based on resident of registration population data for july 2013 compiled by statistics korea, using multistage random sampling according to sex, age, geographic area, and size of the population per area . Interviewers from a professional research agency went door - to - door to recruit residents, and at least three attempts were made to contact individual residents between september 26 and october 18, 2013 . From the 4,100 participants in the 2013 kncss, 1,816 women who had previously undergone cancer screening within the past 2 years were selected . An additional face - to - face interview was conducted to examine how women integrated information on overdiagnosis with their existing understanding of thyroid cancer screening and how they might use such information when deciding on screening in the future . Finally, 586 women who completed the kncss interview and the additional face - to - face interview were included in this study (32.3%). Descriptive data for the 586 women included in the study and 1,230 women who were not showed no difference in age, education level, monthly household income, and type of health insurance . The study was approved by the institutional review board of national cancer center, korea, and written informed consent was obtained from all study participants . The main outcome measure was change in intention to undergo future thyroid screening, which was assessed before and after subjects had received information on overdiagnosis . Before discussing information on overdiagnosis, we briefly described thyroid cancer screening as ultrasonographic tests can be used to detect thyroid cancer at early stages in asymptomatic women, the cost of which is around 30 to 50 usd, and assessed the participants intentions to undergo thyroid cancer screening via a face - to - face interview and in writing in the form of a questionnaire . Thereafter, we gave a brief explanation of overdiagnosis, including a statement on the harms of thyroid cancer screening: early stage thyroid cancers detected through screening are usually tiny papillary thyroid tumors, which are very slow - growing, highly unlikely to go on to cause symptoms, much less death . However, thyroid cancer screening could lead to unnecessary thyroidectomy upon diagnosis of thyroid cancer that may not go on to cause symptoms or death in your lifetime . Participants were then asked to respond to this statement to elucidate changes in their intentions to undergo future thyroid cancer screening . To avoid misunderstanding of overdiagnosis among the interviewees, each word in the explanation was chosen carefully by experts in light of previous research . No estimated numbers, such as overdiagnosis rates, were used, since these have not yet been definitively agreed upon . I definitely will not undergo screening . The first two answers were considered as positive intentions to undergo screening, while the last two answers were considered as reflecting negative intentions . Characteristics of the study population, including age, household income, insurance coverage, education level, marital status, private cancer insurance, prior awareness of overdiagnosis, thyroid screening history, beliefs on cancer screening efficacy, and family history of cancer (first - degree relatives with any cancer) were also assessed . Insurance coverage was categorized as either national health insurance (nhi) or medical aid program (map) coverage . Prior awareness of overdiagnosis was measured with the question, have you ever heard about the possibility for adverse effects related to overdiagnosis from cancer screening? And answers of yes or no . Thyroid screening history was restricted to ultrasonography for cancer screening purposes . To measure beliefs on the efficacy of cancer screening, participants were asked to respond to the question, how effective do you believe cancer screening is in early cancer detection? On a five - point likert scale, with one being not effective at all and five being extremely effective . Family history of cancer was limited to that in only blood relatives, including half - siblings . Univariate and multivariate logistic regression analyses were performed after adjusting for other variables to determine characteristics associated with thyroid cancer screening intention and change therein after receiving information on overdiagnosis ., college station, tx), and p <0.05 was considered statistically significant . The baseline characteristics of the study sample (n=586) are shown in table 1 . The current survey was conducted in women ages 30- to 74-year - old who were invited by the ncsp to undergo cancer screening . Of the 586 respondents, 96% were nhi beneficiaries, 91% were married, 86% were educated to a high - school level or above, and 84% had private cancer insurance . At baseline, approximately 72% of subjects had no knowledge regarding overdiagnosis due to cancer screening, and 11% of subjects had undergone thyroid cancer screening within the past 2 years . Approximately 84% of subjects thought that cancer screening is effective for early cancer detection, and 27% had a family history of cancer . Prior to learning about overdiagnosis, 509 subjects (86.9%) reported positive intentions (definitely or probably) for undergoing thyroid cancer screening . Simple and multivariate logistic regression analysis was performed to examine predictors of screening intentions before receiving information on overdiagnosis (table 2). At baseline, subjects with private cancer insurance were more likely to have higher intentions to undergo thyroid cancer screening than those who did not (adjusted odds ratio [aor], 2.00; 95% confidence interval [ci], 1.10 to 3.62); none of the other variables were statistically significant . After receiving information about overdiagnosis, 434 subjects (74.1%) reported positive intentions (definitely or probably) to undergo thyroid cancer screening (fig . 1); 428 subjects did not change their positive intentions and six subjects changed their intentions from negative to positive . Among 586 respondents, 505 respondents (86%) reported no decrease in their intentions: 428 respondents did not change their positive intentions, 71 respondents did not change their negative intentions, and six respondents changed their intentions from negative to positive . Only 13.8% of respondents who showed positive intentions changed their intentions to negative after receiving information about overdiagnosis; this decrease in the percent of women with positive intentions to undergo thyroid cancer screening was statistically significant (p <0.001). 1). Finally, logistic regression analysis was performed to determine predictors of decreases in screening intention among the 81 women in the decrease group and the 505 women in the no decrease group (table 3). A decrease in intention to undergo screening was more likely in women who graduated high school (aor, 2.82; 95% ci, 1.09 to 7.35) and map recipients (aor, 4.29; 95% ci, 1.58 to 11.63). Women with stronger beliefs on the efficacy of cancer screening were less likely to change their intentions (aor, 0.37; 95% ci, 0.21 to 0.65). Interestingly, prior awareness of overdiagnosis and previous history of thyroid cancer screening was not significantly associated with change in intention . Among study participants, prior awareness of overdiagnosis in thyroid cancer screening was 27.8%, even though all subjects had undergone at least one cancer screening within the past 2 years . Prior to receiving information on overdiagnosis, 87% of the subjects intended to undergo thyroid cancer screening, and even after receiving information about overdiagnosis, the majority of women still intended to undergo thyroid cancer screening (74%). This finding suggests that women would be willing to undergo screening for thyroid cancer regardless of the risk of overdiagnosis . Only a small number of subjects changed their intentions to undergo thyroid cancer screening from positive to negative after receiving information on overdiagnosis (14%). Although only 14% of subjects lowered their intentions to undergo thyroid cancer screening after learning about overdiagnosis, the percentage of women with negative intentions (probably not or definitely not) thereafter was almost double that at baseline (26% vs. 13%). These results suggest that information on overdiagnosis would have an impact on women in the general public, whereas those in the nationwide cancer screening program may have already formed stable beliefs and intentions . This is consistent with previous studies reporting that women who were provided with decision aids were more knowledgeable about screening and demonstrated decreased intentions to undergo screening or were less likely to undergo mammography . In the current study, most of the sociodemographic characteristics, including age and income level, were not associated with screening intention, regardless of receiving information on overdiagnosis . However, women who graduated from at least high school were more likely to decrease their intentions to undergo screening . This suggests that the concept of overdiagnosis in itself may have been difficult for the less educated women to understand and that the brief explanation provided to participants in this study may not have been adequate for them to make an informed choice . This result suggests the need for better ways to communicate the importance and risks of overdiagnosis . A recent study reported that expressing information as a ratio of lives saved to overdiagnosis (1:3) was associated with a greater decrease in intentions to undergo screening than other information formats . In addition, an australian study also reported that women sometimes confused overdiagnosis with overtreatment, and they were more likely to use overtreatment than overdiagnosis, one study proposed that some pre - malignant conditions should not be labeled as cancers or neoplasia . Thus, further research is needed to determine methods that would be most helpful to lay individuals in conceptualizing overdiagnosis in korean women . In addition, we found that map recipients were 4.3 times more likely to lower their intentions to undergo screening after receiving information on overdiagnosis . This might be explained by hesitation to spend money on screening that could ultimately prove unnecessary . In other words, nhi beneficiaries may not have much concern about negative aspects of screening including health care cost due to unnecessary cancer diagnosis and subsequent procedures . This result suggests that an individual s values and priorities may affect their decision, particularly when the benefits of an intervention do not apparently outweigh the harms or when evidence supporting an intervention is not clear with scientific certainty . Obviously, accurate information on the benefits and harms of any procedure is important to making an informed decision . However, sometimes, one s beliefs and values regarding their health could be a stronger decisive factor than factual knowledge in informed decision making for cancer screening . In the current study, women who strongly believed that cancer screening is effective in facilitating early detection were less likely to change their intentions to under screening for thyroid cancer . In a recent study on breast cancer screening, women eligible for breast cancer screening via a nationwide screening program reported less of a decrease in their intentions to undergo continued screening after receiving information on overdiagnosis, compared to women not eligible for screening due to younger age . According to another study conducted in korea, women with strong beliefs on the efficacy of cancer screening underwent thyroid cancer screening 1.55 times more than those who did not . These results were explained by the possibility that eligible women in the screening program might have held strong, stable beliefs on the efficacy of the cancer screening program . Many women seem to believe that screening is extremely important for early detection and treatment of cancer, regardless of its likelihood of becoming malignant . In general, women s attitudes toward cancer screening are shaped through the information presented to them directly by screening service providers, as well as their broader experiences with public health campaigns that promote the benefits of screening without explaining the harms of overdiagnosis . Thus, one would expect that new information confounding this message (i.e., information about overdiagnosis) would not be immediately accepted and understood, as seen in our study . Subjects were provided only a short amount of time to process the information provided, thus our findings demonstrate only the immediate impact of exposure to information on overdiagnosis . As well, the little amount of information that was written on the questionnaire form and verbally explained by a professional interviewer may not have been adequate to facilitate making an informed choice, and therefore, may have had an impact on our findings . According to previous studies on both written and verbal information, probabilistic information presented as numbers rather than words may provide a more accurate understanding of risk . In a breast cancer study, nevertheless, there is no research on overdiagnosis in thyroid cancer, and no agreement has been reached on estimates of overdiagnosis in thyroid cancer . Thus, we could not provide subjects with probabilistic information presented as numbers, concerning overdiagnosis in thyroid cancer . In addition, we only planned to assess screening intentions rather than actual screening uptake . Future research is needed to assess how information on overdiagnosis works on actual screening uptake . Finally, this study only included women who had previous experiences with cancer screening within the past 2 years, and only 32.3% of women (586/1,816) who completed the kncss interview and the additional face - to - face interview were included in this study . Although there were no significant differences in sociodemographic characteristics between women included in the study and those who were not, there remains the possibility of selection bias . That is, women with lower intention to undergo thyroid cancer screening might have been less likely to participate in this study . Thus, future studies are needed to investigate thyroid cancer screening intention and awareness of overdiagnosis within the entire general population . Early detection of cancer is proven to save lives; however, in some instances it can be harmful, such as those related to overdiagnosis . While women in korea appeared to be less concerned about overdiagnosis, information on overdiagnosis in thyroid cancer screening in korea should be provided to individuals so that they can make an informed choice . Herein, the briefest of information resulted in small reductions in intentions to undergo screening for thyroid cancer . Nevertheless, providing written information alone may not be helpful to individuals in reaching a full understanding of the harms or benefits of thyroid cancer screening and thereby counteract the korean public s largely positive attitudes on cancer screening in general . Further research on the relationships between sociodemographic factors and attitudes on cancer screening may be helpful in development of materials for educating the general public on the harms and benefits of thyroid cancer screening.
Conventionally, calculated daily dose of levothyroxine (lt4) is recommended for otherwise healthy and middle - aged patients for initiating treatment for primary hypothyroidism . The recommended initiating dose of lt4 is 1.6 g / kg body weight in overt primary hypothyroidism of autoimmune etiology . Lower dose of lt4 is required in the elderly and has been suggested to be related to the decline in the lean body mass (lbm). However, fixed dose of lt4 has been suggested as starting dose for overt hypothyroidism . Hashimoto's thyroiditis is the most common cause of primary hypothyroidism in iodine - sufficient areas and may have indolent course as suggested by studies in individuals of autoimmune subclinical hypothyroidism . The usual course of progression in hashimoto's thyroiditis is gradual loss of thyroid function . Follow - up studies of the individuals with subclinical hypothyroidism in the elderly showed that a significant proportion of subclinical hypothyroidism cases with elevated or normal thyroid peroxidase antibody had normalization of serum thyrotropin (thyroid - stimulating hormone [tsh]), while others progressed to overt hypothyroidism . Similar study in children showed a variable rate of progression of subclinical hypothyroidism to either overt hypothyroidism or normalization of thyroid profile . Hence, it can be presumed that in overt autoimmune primary hypothyroidism cases, the degree of thyroid damage may be variable . Studies have evaluated the magnitude of replacement doses in primary hypothyroidism based on body weight . Although the average replacement dose of lt4 is approximately 1.6 g / kg body weight in autoimmune hypothyroidism, the range of required dose is wide and varies from 2550 to 200225 g / kg body weight . The recommended dose of 1.6 g / kg is based on the assumption of minimal residual thyroid function . In addition, studies have shown that lt4 requirement in autoimmune thyroiditis is lesser when compared to complete athyrotic individuals . Hence, it can be presumed that the lt4 requirement to maintain euthyroidism in autoimmune hypothyroidism cases depends on the residual functional thyroid tissue, and the current recommended dose of lt4 in autoimmune hypothyroidism, i.e., 1.6 g / kg body weight, may not be required by all the individuals of primary hypothyroidism . The aim of this study was to find the range of lt4 dose based on body weight (d / w) and lt4 dose based on ideal body weight (d / ibw), and to find the determinants of lt4 requirement needed to maintain euthyroidism in individuals of primary autoimmune hypothyroidism . Adults were enrolled prospectively from the follow - up cohort of the outpatient endocrinology department of the hospital visiting between may 2015 and january 2016 . Individuals enrolled included men and women between ages 18 and 85 years with primary autoimmune hypothyroidism and on treatment for at least 1 year and on minimum dose of at least 25 g of lt4 daily . Hashimoto's thyroiditis was defined as clinically presence of firm diffuse goiter or positive thyroid peroxidase antibody . The inclusion criteria included stable ambulatory patients with primary hypothyroidism, currently biochemically euthyroid based on the latest tsh report from the central laboratory with reference range serum tsh (0.44.5 miu / l), lt4 dose administration in the morning and empty stomach dosing, and maintenance of food and beverages gap of at least 1 h with the lt4 . Exclusion criteria included noncompliant individuals, other than morning empty stomach administration of lt4, food gap with lt4 of <1 h, being on medication known to hamper lt4 absorption within 4 h of lt4, hypothyroidism other than of autoimmune etiology like postradioiodine, thyroid cancer postsurgery, posttotal thyroidectomy, pregnancy, and central hypothyroidism . Historical values of serum tsh was not taken, and a recent value from the central laboratory was compulsory for enrollment . Institutional review board approval was taken for the study and written informed consent was obtained from all the participants before enrollment . All consecutive patients willing for enrollment and meeting the inclusion and exclusion criteria were enrolled in the study . The data collected included age, gender, height, body weight, menopausal status for women, compliance with medication, co - prescription within 4 h of lt4, and food gap with lt4 . Body weight was recorded with electronic weighing scales . Ideal body weight (ibw) was calculated based on devine formula as follows: women over 152 cm, 45 kg + 2.3 kg for each additional 2.5 cm; for women under 152 cm, 45 kg 2.3 kg for each additional 2.5 cm; for men over 152 cm, 48 kg + 2.7 kg for each additional 2.5 cm the latest tsh done in the central laboratory of the institute and the current lt4 dose were noted . Serum tsh analysis was performed by chemiluminescence immunoassay method (roche cobas e411) with functional sensitivity of 0.005 miu / l, and normal range 0.44.5 lyophilized quality control material (bio - rad) was used with mean values of three levels of controls 0.46, 5.52, and 34.2 miu / l . The inter- and intra - assay variability levels were 2.9 and 3 miu / l, respectively . Continuous variables were summarized as means and standard deviations and range as minimum and maximum values . The percentile of lt4 absolute dose, d / w, and dose based on ideal body weight (d / ibw) was calculated at 25, 50, and 75 percentile . Anova was used to compare the groups, and bonferroni correction was used as post hoc test . Correlation was assessed by pearson's method and all the correlation analyses were two tailed . Initially, all the variables were entered with stepwise, forward, and backward method of variable entry to find the best predictive independent variables and finally enter method was used with all the best predictive variables . Adults were enrolled prospectively from the follow - up cohort of the outpatient endocrinology department of the hospital visiting between may 2015 and january 2016 . Individuals enrolled included men and women between ages 18 and 85 years with primary autoimmune hypothyroidism and on treatment for at least 1 year and on minimum dose of at least 25 g of lt4 daily . Hashimoto's thyroiditis was defined as clinically presence of firm diffuse goiter or positive thyroid peroxidase antibody . The inclusion criteria included stable ambulatory patients with primary hypothyroidism, currently biochemically euthyroid based on the latest tsh report from the central laboratory with reference range serum tsh (0.44.5 miu / l), lt4 dose administration in the morning and empty stomach dosing, and maintenance of food and beverages gap of at least 1 h with the lt4 . Exclusion criteria included noncompliant individuals, other than morning empty stomach administration of lt4, food gap with lt4 of <1 h, being on medication known to hamper lt4 absorption within 4 h of lt4, hypothyroidism other than of autoimmune etiology like postradioiodine, thyroid cancer postsurgery, posttotal thyroidectomy, pregnancy, and central hypothyroidism . Historical values of serum tsh was not taken, and a recent value from the central laboratory was compulsory for enrollment . Institutional review board approval was taken for the study and written informed consent was obtained from all the participants before enrollment . All consecutive patients willing for enrollment and meeting the inclusion and exclusion criteria were enrolled in the study . The data collected included age, gender, height, body weight, menopausal status for women, compliance with medication, co - prescription within 4 h of lt4, and food gap with lt4 . Body weight was recorded with electronic weighing scales . Ideal body weight (ibw) was calculated based on devine formula as follows: women over 152 cm, 45 kg + 2.3 kg for each additional 2.5 cm; for women under 152 cm, 45 kg 2.3 kg for each additional 2.5 cm; for men over 152 cm, 48 kg + 2.7 kg for each additional 2.5 cm the latest tsh done in the central laboratory of the institute and the current lt4 dose were noted . Serum tsh analysis was performed by chemiluminescence immunoassay method (roche cobas e411) with functional sensitivity of 0.005 miu / l, and normal range 0.44.5 miu / l . Lyophilized quality control material (bio - rad) was used with mean values of three levels of controls 0.46, 5.52, and 34.2 miu / l . The inter- and intra - assay variability levels were 2.9 and 3 miu / l, respectively . Continuous variables were summarized as means and standard deviations and range as minimum and maximum values . The percentile of lt4 absolute dose, d / w, and dose based on ideal body weight (d / ibw) was calculated at 25, 50, and 75 percentile . Anova was used to compare the groups, and bonferroni correction was used as post hoc test . Correlation was assessed by pearson's method and all the correlation analyses were two tailed . Initially, all the variables were entered with stepwise, forward, and backward method of variable entry to find the best predictive independent variables and finally enter method was used with all the best predictive variables . A total of 346 individuals (a total of 290 women; 214 premenopausal and 76 postmenopausal women, and 56 men) meeting the inclusion and exclusion criteria were enrolled in the study consecutively . The median duration of hypothyroidism and mean age of individuals were 4 years and 42.1 years, respectively . The duration of hypothyroidism ranged from 1 to 25 years, and age ranged from 18 years to 76 years . During the study, all individuals had their serum tsh in the target range (0.45 miu / l) as per protocol, and the mean serum tsh was 2.56 group comparison was done using one - way anova with bonferroni correction as post hoc test . The descriptive clinical and biochemical data of the enrolled individuals in both the genders separately the absolute lt4 daily dose (add) ranged from minimum of 25 g to maximum of 200 g with mean of 77.1 30 g . The dose at 25 percentile, 50 percentile, and 75 percentile was 50, 75, and 100 g, respectively . The mean lt4 daily d / w was 1.21 0.50 g / kg and dose ranged from 0.3 to 2.82 g / kg; dose at 25 percentile, 50 percentile, and 75 percentile was 0.84, 1.16, and 1.5 g / kg, respectively . The mean daily lt4 daily d / ibw was 1.58 0.63 g / kg of ibw and dose ranged from 0.42 g / kg to 3.5 g / kg of ibw; dose at 25 percentile, 50 percentile, and 75 percentile was 1.13, 1.53, and 1.97 g / kg, respectively . The parameters of individuals were compared between men, premenopausal women, and postmenopausal women as shown in table 1 . There was no significant difference in mean add or d / w between men, postmenopausal women, and premenopausal women, although premenopausal women required significantly higher d / ibw compared to men . The add, d / w, and d / ibw at 25 percentile, 50 percentile, and 75 percentile for men, premenopausal women, and postmenopausal women are shown in table 2 . Among the anthropometric measures, weight correlated positively and significantly with add (r = 0.2, p <0.001) and significantly and negatively with d / w (0.36, p <0.001), although no correlation was found with ibw . Similarly, height correlated significantly and positively with add (r = 0.17, p <0.001) and significantly and negatively with d / ibw (0.23, p = 0.001), although no correlation was found with d / w . The percentile of age of individuals, doses of levothyroxine, and duration of hypothyroidism in both genders separately age correlated significantly with d / w (r = 0.2, p <0.001) but not with add or d / ibw . On comparing age quartiles for d / w, a significant difference was found between 1 quartile versus 2, 3, and 4 quartile . The mean d / w in 1 age quartile was 1.4 g / kg, 2 quartile was 1.15 g / kg, 3 quartile was 1.13 g / kg, and 4 quartile was 1.13 g / kg . The correlation of age with body mass index (bmi) was also statistically significant (r = 0.29, p <0.001), suggesting a potential role of change in body composition affecting the correlation of age with d / w . The partial correlation of age with d / w showed a significant trend (p = 0.05) even after adjusted for bmi . Duration of hypothyroidism correlated significantly with add (r = 0.2, p = 0.001), d / w (r = 0.2, p <0.001), and d / ibw (r = 0.2, p <0.001). On comparing the mean d / w, d / ibw, or absolute lt4 daily dose between the groups based on duration of hypothyroidism, 1 quartile was significantly different from 3 and 4 and between 2 and 4 for d / w . There was a significant correlation between bmi and add (r = 0.12, p <0.02), d / w (r = 0.13, p = 0.01), and d / ibw (r 0.38, p = 0.001). Kg / m, group 2 bmi 18.523 kg / m, group 3 bmi> 2330 kg / m, and group 4> 30 kg / m). On comparing the groups by repeated - measures anova with post hoc bonferroni correction, no significant difference was found between the bmi groups in add and d / ibw, but a significant difference in d / w was found between bmi groups 1 and 3, 1 and 4, 2 and 3, 2 and 4, and 3 and 4 . The mean d / w was as follows: group 1: 1.6 g / kg, group 2: 1.5 g / kg, group 3: 1.2 g / kg, and group 4: 1.0 g / kg . The correlation coefficient of d / w and d / ibw with independent variables is adjusted for covariates [table 3]. In univariate regression model, gender, for d / w, age, duration of hypothyroidism, weight, and bmi were significant predictors, and gender, duration of hypothyroidism, height, ibw, and bmi were significant predictors for d / ibw by univariate regression model . The partial correlation of exploratory variables after adjusting for covariates for levothyroxine daily doses the multivariate regression by linear regression model was used to find the determinants of add, d / w, and d / ibw, and the result is shown in table 4 . Multivariate model predicting levothyroxine dose / kg body weight, age, duration of hypothyroidism, and body mass index as independent variables^ the p - p plot of regression standardized residuals . (a) model for levothyroxine dose based on daily dose, (b) model for absolute levothyroxine daily dose, and (c) model for levothyroxine daily dose based on ideal body weight lt4 is given as a replacement therapy for hypothyroidism, and the dose depends on the demand which in turn dependent on endogenous thyroid hormone production . The level of thyroid hormones in the blood circulation is determined by the endogenous secretion of thyroid hormones, their metabolism, and exogenous replacement therapy . To maintain euthyroid range of serum tsh and t4, conventionally, the recommended starting dose of lt4 in autoimmune hypothyroidism cases is 1.6 g / kg d / w . Patients with minimal residual thyroid function due to autoimmune etiology require 1.61.8 g / kg of actual body weight, although some studies suggest a higher dose of 2.02.1 g / kg . The etiology of a patient's hypothyroidism affects the d / w and may reflect degree of residual function as suggested by higher d / w requirement in athyreotic patients posttotal thyroidectomy versus patients with hashimoto's thyroiditis . This study showed age - related decline in d / w as shown by significant negative correlation between age and d / w, and significantly higher d / w requirement in individuals in 1 age quartile versus 2, 3, and 4 quartile, although no similar difference was for add and d / ibw . Showed that age - based difference in lt4 dose is due to difference in body weight and gender, while study by santini et al . Showed a significant negative correlation (p <0.03) of age with d / w which disappeared when adjusted for lbm and hence suggested that the age - related decrease in lbm is responsible for decrease in lt4 dose . The findings of this study are similar to the above - mentioned studies that the significance of age for d / w decreased when adjusted for bmi, but a trend of significance was still seen although lean muscle mass was not analyzed in this study . This study enrolled long - standing cases of spontaneous onset primary hypothyroidism for which hashimoto's thyroiditis is the most common cause . At least 75% of cases in this study required dose 1.5 g / kg of lt4 d / w that is lesser than recommended starting dose of 1.6 g / kg of lt4 . A study of long - term follow - up of adults with subclinical hypothyroidism for more than 9 years showed that on an average, 28% of patients progressed to overt hypothyroidism, while 68% patients remained in the subclinical state, suggesting a variable course in each patient . In the same study, it was shown that residual thyroid reserve and high titer of thyroid peroxidase antibody were significant predictors for development of overt hypothyroidism on follow - up . This study showed that duration of hypothyroidism was predictors of add, d / w, and d / ibw . In addition, individuals in the lowest quartile of duration of hypothyroidism (12.3 years) had significantly lower mean either add, d / w, or d / ibw compared to 3 and 4 quartile, and 2 quartile from 4 quartile . The findings of this study suggest progressive decrease in residual thyroid function and that not all cases have minimal residual thyroid function at the onset . The gender - based significant difference in the mean add and d / ibw was seen in this study, although no gender difference was seen in mean d / w . The significantly higher d / ibw in premenopausal compared to male became insignificant when adjusted for height, suggesting that the difference in the gender - based difference in d / ibw is mainly due to difference in anthropometry . Similar gender - based difference was found in other studies . Although bmi was not significantly different between male and female, ibw was significantly higher in men compared to postmenopausal or premenopausal women due to greater height in men . D / w was similar between male and female, but d / ibw was lower in men compared to premenopausal or post- menopausal women . The lower d / ibw requirement in males, and almost similar dose requirement for d / w in both gender suggests that lt4 requirement of fat mass exists, although much lower than that of lbm . Hence, this study suggests that the d / w or d / ibw requirement is variable and not one size and varies between individuals probably depending on the residual thyroid function reserve . This study has strengths such as large population size, confirmed compliance with medication, and recently confirmed euthyroidism, although it has many limitations as being cross - sectional, and functional reserve and lbm were not evaluated . Primary autoimmune hypothyroidism patients require a variable dose of lt4, and the dose progressively increases with duration of hypothyroidism . Gender has no direct effect on lt4 dose, and the difference in dose is based on difference in anthropometry between both the genders.
Primary infection involves eyes, ears, larynx, lungs, and sinuses, followed by liver, spleen, bone, and meninges . Worldwide, aspergillus fumigatus is the most common species, followed by aspergillus niger and aspergillus flavus, whereas a. flavus is the most common species in india . Predisposing factors that promote fungal infections in the sinuses include polyps and stagnant secretions besides other factors like neutropenia, inappropriate use of antibiotics, immunosuppressive drugs, corticosteroids, uncontrolled diabetes mellitus (dm), human immunodeficiency virus (hiv) infection, trauma, burns, and radiation therapy . In immunocompromised patients, aspergillus leads to highly destructive lesions; however, literature search shows invasive aspergillosis in non - neutropenic patients also . Clinico - radiological findings can be misleading as the lesions are locally destructive and mimic a neoplasm . Invasive fungal sinusitis (ifs) responds to conservative medical management and debridement; hence, an early diagnosis by fine needle aspiration cytology (fnac) is mandatory to prevent undue surgery . We report two patients presenting with swelling and pain in the maxillary region who were clinico - radiologically suspected of malignancy; however, fnac in both the cases revealed fungal sinusitis (fs). Fnac was performed in both cases using 22-gauge needle; aspirate was whitish fluid (case 1) and blood mixed (case 2). The aspirates were processed as air - dried giemsa - stained smears; cytomorphological features were suggestive of aspergillosis . Periodic - acid - schiff (pas) and silver methanamine (sm) stains were performed on the aspirate smears for further typing of fungus . However, considering the clinico - radiological suspicion of neoplasm, a biopsy was advised that confirmed fungus in both the cases . A 45-year - old female presented to the ear, nose and throat (ent) department with complaints of a painful swelling in the left maxillary region for 6 months . There was no history suggestive of nasal obstruction, fever, recurrent infections or diabetes . Clinically, there was a tender swelling in the left maxillary region near the medial canthus . Computed tomography (ct) scan showed expansion of the maxillary sinus with bone erosion, suggestive of a malignancy . A 42-year - old male presented with complaints of headache, nasal discharge and swelling in right maxillary region for 8 months . A bony hard swelling measuring 8 8 cm was palpated in the right maxilla reaching up to the infraorbital region . Ct scan showed an enhancing soft tissue density in the right maxillary sinus, suggestive of a proliferative lesion . Microscopic examination of aspirate smears revealed predominantly hemorrhagic background with many multinucleated foreign body giant cells (gcs), and few inflammatory cells comprising eosinophils, plasma cells and lymphocytes . Interspersed amongst these and within the gcs, based on the ct and cytological features, a diagnosis of ifs caused by aspergillus was suggested . (a) smear shows septate, fungal hyphae branching at acute angle in an acute inflammatory background (giemsa, 250) and (b) a hyphae within the giant cell (giemsa, 400) histopathological examination of biopsies from the maxillary sinus in both the cases showed abundant septate fungal hyphae, granulomatous inflammation, gcs and eosinophils; pas and sm stains confirmed the type of fungus as aspergillus [figure 2]. Culture from the serous material from sinusitis showed greenish white cotton wool growth at 37c on sabouraud's dextrose agar (sda), thus confirming the species as a. flavus . Sections show (a) aspergillus in necrotic background (h and e, 250), (b) fungal hyphae in giant cell (h and e, 400), (c) many eosinophils and hyphae (h and e, 250), special stains highlighting the fungal morphology (d; pas, 250) and (e; silver methanamine, 250) the former patient was treated initially with intravenous amphotericin - b and endoscopic debridement, followed by oral itraconazole; further, she had to undergo partial maxillectomy in view of frequent recurrences and bone involvement . A 45-year - old female presented to the ear, nose and throat (ent) department with complaints of a painful swelling in the left maxillary region for 6 months . There was no history suggestive of nasal obstruction, fever, recurrent infections or diabetes . Clinically, there was a tender swelling in the left maxillary region near the medial canthus . Computed tomography (ct) scan showed expansion of the maxillary sinus with bone erosion, suggestive of a malignancy . A 42-year - old male presented with complaints of headache, nasal discharge and swelling in right maxillary region for 8 months . A bony hard swelling measuring 8 8 cm was palpated in the right maxilla reaching up to the infraorbital region . Ct scan showed an enhancing soft tissue density in the right maxillary sinus, suggestive of a proliferative lesion . Microscopic examination of aspirate smears revealed predominantly hemorrhagic background with many multinucleated foreign body giant cells (gcs), and few inflammatory cells comprising eosinophils, plasma cells and lymphocytes . Interspersed amongst these and within the gcs, based on the ct and cytological features, a diagnosis of ifs caused by aspergillus was suggested . (a) smear shows septate, fungal hyphae branching at acute angle in an acute inflammatory background (giemsa, 250) and (b) a hyphae within the giant cell (giemsa, 400) histopathological examination of biopsies from the maxillary sinus in both the cases showed abundant septate fungal hyphae, granulomatous inflammation, gcs and eosinophils; pas and sm stains confirmed the type of fungus as aspergillus [figure 2]. Culture from the serous material from sinusitis showed greenish white cotton wool growth at 37c on sabouraud's dextrose agar (sda), thus confirming the species as a. flavus . Sections show (a) aspergillus in necrotic background (h and e, 250), (b) fungal hyphae in giant cell (h and e, 400), (c) many eosinophils and hyphae (h and e, 250), special stains highlighting the fungal morphology (d; pas, 250) and (e; silver methanamine, 250) the former patient was treated initially with intravenous amphotericin - b and endoscopic debridement, followed by oral itraconazole; further, she had to undergo partial maxillectomy in view of frequent recurrences and bone involvement . Fungal sinusitis constitutes 69% of all the rhinosinusitis. [68] clinically, it presents as either an acute fulminant sinusitis or chronic invasive sinusitis . The former is largely attributed to mucor and the latter is mainly due to aspergillus . The acute form is a life - threatening condition, usually seen in immunocompromised patients with severe neutropenia or dm, and is associated with significant visual and neurological impairments in survivors, and sometimes mortality . Clinically, these patients may present with rhinorrhea, headache, nasal obstruction, proptosis, facial and periorbital pain mimicking infections (mucor, tuberculosis, osteomyelitis), inflammatory lesions (rhinoscleroma, wegener's granulomatosis) and malignant tumors of the nose and paranasal sinuses . Non - invasive fs includes allergic and fungal ball and does not need extensive surgery, while most of the ifs patients are unresponsive to conservative management and require appropriate antifungals with local debridement . Early and definitive diagnosis of ifs is mandatory that will rule out other differential diagnoses, especially neoplasm, and will help clinicians for appropriate management and in the follow - up of patients . Both magnetic resonance imaging (mri) and ct can help establish a diagnosis of ifs . Bone involvement and erosion is more delineated on ct, while soft tissue extensions, vascular invasion and cavernous sinus involvement are more appreciated on mri . Both the imaging techniques, however, are not definitive and often fail to differentiate an infectious process from a neoplastic one . Definite diagnosis of fs depends upon the demonstration of the fungus on aspirate smears or a biopsy . Fungal culture is complimentary to morphology and required for species identification; but samples submitted for culture may not be representative, and not all the fungi grow on culture media . Aspergillus can be easily differentiated from mucor on morphology, as the latter is characterised by broad, non - septate hyphae branching at right angle . In the present cases, both the patients were immunocompetent, middle aged and clinico - radiologically suspected of malignancy; however, they were diagnosed on fnac as fungal sinusitis and prevented from undue surgery . Species identification is not much relevant in patients management, but is of epidemiogical significance, since it depends upon various geographical locations, thus aiding diagnosis in difficult cases . This report emphasizes on the early diagnosis of ifs, which can be managed conservatively preventing the morbidity and mortality in these patients . Cytology, being an easily available, minimally invasive and inexpensive procedure, can be used as initial diagnostic modality in cases of ifs.
The efforts made to comprehend the essence of disease and its causes have shaped the history of medicine . Even today we are unable to grasp why a particular person suffers from this or that affliction, and despite the advances made in deciphering the genetic code which in any case explains only how the basic mechanism works, not why the only recourse left seems to be to place our faith in a higher power . Here we can discern a cause and effect chain, which in particular offers the practicable perspectives of prophylaxis and treatment . Up till the time that robert koch discovered more than a hundred years ago that anthrax was caused by a bacterium, raging epidemics were seen as an expression of god s curse . While it was possible to control plague and cholera, in addition to new epidemics such as hiv / aids and sars long - forgotten scourges like but such spectacular pathogens account for only part of our problems; the advances made in clinical medicine mean that today not only are we seeing patients with compromised immune systems, who in earlier times would have long succumbed to their underlying disease, but that now such forms of immunosuppression induced, for instance, as a result of major surgery and organ transplants have become a serious problem in intensive care units . This means that it is not only the classic pathogens that are in the spotlight but also a plethora of ubiquitous microorganisms, which as saprophytes have hitherto elicited little attention but are found on all surfaces in a hospital and on the hands of staff . Bereft of these insights, ignaz phillip semmelweis made the ingenious observation in vienna during the 19th century that primitive hand disinfection was able to reduce considerably the incidence of fatal puerperal fever . Today many of these epidemics and infections have been brought under control, but in intensive care medicine sepsis continues to be the chief nemesis and while we cannot exactly define the situation, an infection is implicated in the case of the vast majority of patients who die here, or has indeed been the cause of death . And here we come upon a fortuitous confluence of all the factors that facilitate microbial invasion of the human body . The body s natural barriers have been breached through medical interventions, with the common integument sporting myriad large - lumened indwelling catheters, waldeyer s tonsilar ring breached by plastic tubes and probes, and even the longer male urethral tract is fitted with a catheter all the more to facilitate retrograde passage of bacteria . On the other hand, immunocompromising therapeutic agents such as cytostacis and glucocorticoids, which in addition to the inability to ingest nutrition in a natural and efficient manner ensure that invading microorganisms will be able to multiply . Drugs administered as stress ulcus prophylaxis give rise to a shift in the bacterial flora of the throat, thus laying the foundation for a lower respiratory tract infection . With regard to bacterial resistance, antibiotic therapy, especially when used as prophylaxis, results in the bacteria becoming less sensitive to the drugs, while reinforcing selective pressures . Disinfectants can be deployed not only against all potential microbial reservoirs outside the body, but also on the skin and mucous membranes . In the inanimate environment they can be used with essentially more potent effects than antibiotics, whose use must be governed by considerations of not unduly taxing the body . The hands of personnel as well as the therapeutic devices ranging from the respirator to the catheter are the chief sources of infection in intensive care units . If one disregards the endogenous gut flora and their antibiotic - induced alteration, we can target all microbes giving rise to nosocomial infections with disinfectants before their inoculation . Disinfection is the cornerstone of any well - organized and hence effective infection control policy . Only recently has a european study reported on the impressive reduction in the incidence of infections brought about by iodine - based products on the skin or at vascular access points as well as by antiseptic hand disinfection . An international study, which was launched in the usa, underlined the importance of oral decontamination in ventilation pneumonia, which is a key player among the nosocomial infections . Disinfection, antibiotic therapy and possibly extracorporeal elimination methods can be contemplated for direct prevention of the establishment and multiplication of microorganisms . The latter are still in the incipient stages, while antibiotic treatment represents a double - edged sword since it acts selectively and the entire organism has to be taken into consideration . Only disinfectants are able to unleash their full destructive might against microbes, especially when used on treatment devices that are not amenable to sterilization, but subsequent removal and, possibly, ensuring hand protection, can be a problem . Discussions postulate the merits of using quaternary ammonium vs alcohol - based solutions, but what is decisive is optimal use to assure effective infection control tailored to the respective site of use . An objective evaluation of the suitability of such measures against the background of high costs is possible only through documentation of the clinical effects . Already before the large outcome studies conducted during the past 20 years in the field of intensive care medicine attempts were made to analyze infection control on a large scale in central europe . While it is not easy to furnish proof of a direct link between efficient control and prevention methods and the incidence of infection, there is by now a consensus on the role of hand hygiene and of disinfection of the human body and of surfaces . But an international study that would be conducted only a decade later was not able to gain any further insights and could only emphatically advocate that european standards be introduced . However, this study spanning 14 countries and more than 1000 intensive care units cast light on the importance of antiseptics . For disinfection of puncture sites before insertion of vascular catheters mainly alcoholic solutions were used; the solution used for the urethral opening was not specified, and most disappointing aspect of this comprehensive survey was the fact that hand hygiene was assigned only a peripheral role . In an age when medicine, in particular intensive care medicine, is risking becoming impaled on its own sword, with nosocomial infections being seen as one of the most critical aspects of high tech medicine, disinfection can serve as a bulwark against rising infection rates . Emeritus assistant clinical director of the clinic for anaesthetics and general intensive medicine, vienna, austria . Clinical investigator and legally sworn expert . He received a doctor s degree in 1963 and started a specialist training which he finished in 1969 as a specialist for anaesthetics . Later he moved as austrian un - soldier to cyprus, afterwards to the albert einstein college of medicine, new york . In 1979 but he did not stay there: he became head of anaesthetics and intensive care department of the children hospital modid in tehran, iran . After his return he is named assistant medical director of the ahk vienna and finally assistant board director for the clinic for anaesthetics and general intensive care medicine vienna . He engages himself to a high degree in different ethics committees (vice director of the inter - faculty institute for ethics in medicine, vice director of the ethics committee of the vienna medical faculty, chairman of the ethics committee and board - member of eurotransplant leiden, president of the austrian medical society of vienna, and member of the ethics committee of the austrian medical association). Emeritus assistant clinical director of the clinic for anaesthetics and general intensive medicine, vienna, austria . Clinical investigator and legally sworn expert . He received a doctor s degree in 1963 and started a specialist training which he finished in 1969 as a specialist for anaesthetics . Later he moved as austrian un - soldier to cyprus, afterwards to the albert einstein college of medicine, new york . In 1979 but he did not stay there: he became head of anaesthetics and intensive care department of the children hospital modid in tehran, iran . After his return he is named assistant medical director of the ahk vienna and finally assistant board director for the clinic for anaesthetics and general intensive care medicine vienna . He engages himself to a high degree in different ethics committees (vice director of the inter - faculty institute for ethics in medicine, vice director of the ethics committee of the vienna medical faculty, chairman of the ethics committee and board - member of eurotransplant leiden, president of the austrian medical society of vienna, and member of the ethics committee of the austrian medical association).
Idiopathic hypereosinophilic syndrome (he s) is characterized by persistent or recurrent hypereosinophilia of unknown origin . Currently, we recognize that he s consists of the myeloproliferative form and the lymphocytic form (t - cell - mediated disorders).1 recent identification of fip1l1-pdgfra fusion gene - positive he s, as a subgroup, has opened a door to innovative treatment using imatinib mesylate in patients with a subset of hes.2,3 however, treatment of other patients with a heterogeneous subgroup of gleich syndrome (periodic angioedema and eosinophilia) and other types of he s without known pathogenesis remains to be explored in future . The causes of periodic oscillating hypereosinophilia411 are often obscure and need to be precisely diagnosed clinically and/or molecularly for the most effective therapy . The patient reported here has shown significant periodic oscillating hypereosinophilia, which was shown to be fip1l1-pdgfra fusion gene - negative, and was suspected to have gleich syndrome, but not a version compatible with cases previously described . Our patient is considered to have a distinct subtype of he s in which we documented (a) the pattern of seasonal oscillation of eosinophilia over 6 years and (b) effective control of eosinophilia with a combination of cyclosporin a, suplatast tosilate, and a small dose of prednisolone . A 29-year - old male patient with periodic oscillating hypereosinophilia was first diagnosed to have he s (absolute eosinophil counts (aec)> 1500/l) at age 21 . From age 21 to 26 years, he was treated for he s at a local hospital on and off with oral prednisolone, but details of the oscillating pattern were unknown . Since he was referred to us, his he s was found to be characterized by high levels of serum soluble il-2r (up to 2700 u / ml; normal <518 u / ml), igm (up to 1140 mg / dl; normal <190 mg / dl), tryptase (14.4 g / l, normal 2.19.0 g / l), and vitamin b12 (1400 pg / ml; normal 233924 pg / ml). Serum levels of il-5 were elevated to 46.7 u / ml (normal <7.8 u / ml), but serum ige levels remained consistently within the normal range . At the time of referral, he was initially treated with prednisolone (30 mg / day) alone, but did not attain a remission . The patient was found to have fip1l1-pdgfra fusion gene - negative; however because there was no useful therapy available, he was treated with imatinib mesylate (100200 mg / day) at age 26, which was effective in reducing the aec and negating the oscillating pattern of he s temporarily for about 30 weeks.12 thereafter, the patient s oscillating hypereosinophilia became uncontrollable again . In order to determine the pathogenesis of his he s and improve therapeutic measures, we performed flow cytometry analysis on his lymphocytes, which showed that the cd3cd4 + population, a subset described in cases of gleich syndrome,9 was increased, accounting for 5.7% of the total (normal <1.0%), but clonality studies on t cell receptors (tcr) showed no rearrangement bands for tcr - c - beta, -j - gamma, and j - delta1 genes (data not shown). Thus, we assumed that his he s could be defined as gleich syndrome9; however it was not clear if the seasonal periodic oscillation of aec was compatible with this syndrome . In addition, we were aware that aec showed a good correlation with some serum biomarkers, which was not previously noted in patients with gleich syndrome . As first noted, such cyclic episodes were temporarily suppressed during the imatinib therapy.12 after the patient became refractory to imatinib, we were able to document the exact oscillating pattern closely over the past 6 years . 10,000/l) two to three times a year, one in early spring (february march), another in fall (september october) and another in between (june) in two of the 3 years from 2005 to 2007 (figure 1a). Among various biological markers, soluble il-2r (r = 0.857, p <0.001) and serum igm (r = 0.685, p <0.0025) values were closely associated with this eosinophilic oscillation (figure 2); however, none of hemoglobin, platelet counts, igg, or iga levels were correlated with the oscillation in eosinophil levels . During the peak hypereosinophilic episodes, the patient showed soft tissue swellings on the face, forearms, and the lower legs, which could be a kind of angioedematous presentation, but we searched for alternative therapeutic measures; anti - il-5 therapy using humanized anti - il-5 monoclonal antibody13,14 was not available in japan . Since cyclosporine a was proven beneficial in the treatment of hes15 and the suplatast tosilate, the th2 cytokine inhibitor, was reported effective for a patient with hypereosinophilia with a high level of serum il-516 as well as for a patient with eosinophilic gastroenteritis associated with elevated serum il-5 and sil-2r,17 we employed a combination of oral suplatast tosilate (300 mg / day) combined with cyclosporine a (150 mg / day) and prednisolone (1015 mg / day) over the past 6 years . As seen in figure 1, peak heights of aec reduced from 2005 to 2007 (figure 1a), and further reduced yearly to 2010 in association with reduced incidence of the episodes (figure 1b). Since july 2010, however, it was found that the cd3cd4 + population remained at a level similar to that prior to the initiation of treatment (6.7% of the total). Our observation explains the effectiveness of the combined therapy for this type of he s . As of october 2011, in he s, xiao et al described a 54-year - old man who had periodic oscillations in eosinophils, wbc, platelet counts, and hb.4 cyclic oscillations in blood cell counts were also reported for an he s case by malcovati et al.5 in the case of xiao et al, the oscillatory cycle lasted approximately 2 months.4 in cases of gleich syndrome, eosinophilic cycles are known to occur every 35 weeks, ie, almost every month,8,9,11 and are related to the menstrual cycle in female patients.18 as shown in figure 1, our case showed cyclic episodes occurring two to three times a year from 2005 to 2007; thereafter this cycle gradually became blunted over the next 3 years . It seems that the episodic cycles in our case are distinct from previously described patients with he s . In gleich syndrome, episodic angioedema with eosinophilia is associated with high serum il-5.611 although our case shows angioedematous soft tissue swelling at the peak heights of hypereosinophilic episodes, his clinical features are not associated with the high ige levels described by several authors,6,7,10 or with the itchy urticarial rash described by schiavino et al.7 in addition, the patient did not respond to prednisolone alone as previously reported.7,9,10 clonally proliferated helper t lymphocytes were also shown by several authors in cases of gleich syndrome.10,11 although we identified some increase in the cd3cd4 + subset in peripheral blood, no t cell clonality was shown in our case . The hematopoietic abnormalities in the cases of xiao et al and malcovati et al are thought to originate at the pluripotent stem cell levels.4,5 by contrast, periodic oscillations of eosinophils in gleich syndrome are thought to be regulated by t - cell expansion - associated il-5 release.10,11,19 distinct oscillations in the aec of our case, particularly in association with serum igm levels, appear to occur via a varied pathogenesis, which may represent a variant of gleich syndrome, although precise mechanism(s) remain unknown . So far no triggering factors have been identified to explain the seasonal hypereosinophilic episodes in our case . In a situation where no anti - il-5 antibody is available, we have found that a combination of cyclosporin a, suplatast tosilate, and prednisolone is a good alternative approach in controlling the hypereosinophilic episodes, although suplatast tosilate is said to suppress ige, but not igg or igm production in vivo.20 over the past 6 years, the three drug combination slowly abolished aec oscillations in our case . How these drug combinations have acted to slowly alleviate his oscillating he s is unknown . Since we found no decrease of cd3cd4 + subset with treatment, it was assumed that the inhibitory effect of the treatment including cyclosporin a was not through an effect on the cd3cd4 + subset . The fact that the precise pathogenesis of oscillating hypereosinophilia is still unknown underscores that there is considerable heterogeneity in he s and/or in gleich syndrome.
Commercially pure titanium has been employed as the best material for dental implants due to its biocompatibility and excellent mechanical properties . Healing of peri - implant tissue can be influenced by the physicochemical and mechanical properties of the implant material, microstructures, macrostructures, and surface chemistry of the implant . The surface topography and chemistry of an implant material can have beneficial or disadvantageous influence on cell adhesion and proliferation, thereby controlling the osseointegration process . Studies on the effects of surface modified materials on the adherence and spreading of cells have recently been reported or are in progress.1,2,3,4,5 one of the handicaps of titanium from an esthetic point of view, as a dental implant material, is that the dark gray color of titanium can shine through the thin soft tissues . Soft tissue shrinkage leading to gingival recession or peri - implantitis may leave the cervical titanium component visible . Implants or transgingival abutments from tooth - colored materials such as zirconia ceramic may be one possible solution to these problems with the dark color of titanium . Zirconia has tooth - like ivory color and somewhat translucency, making it sufficient material for esthetic restorations . Zirconia ceramic is a biocompatible material that has optimal esthetic and mechanical properties for dental implants . The biomaterial - related properties of zirconia are as advantageous as those of titanium.6 tissue reaction and stability of zirconia, which are important factors in maintaining zirconia restorations free of periodontal problems, proved to be satisfactory.7,8 bacterial coverage and accumulation on zirconia was reported to be lower than on titanium.9,10 inflammation associated processes in peri - implant soft tissues were found to be higher around titanium than around zirconia.11 the material composition and profile of transgingival implant components seems to influence cell behavior and growth . The macrostructures of the zirconia ceramic are able to provide contact guidance and gingival contouring to provide biological seal.1,12 zirconia ceramic can be suitable for transgingival implant components13 resulting in final esthetic results, but more clinical and mechanical trials are necessary for a complete understanding of the behavior of zirconia abutments and implants over a long time period . In hard tissue engineering, calcium phosphate (cap) ceramics, such as hydroxyapatite [ha; ca10(po4)6(oh)2] and tricalcium phosphate [tcp, ca3(po4)2], have attracted attention due to their excellent biocompatibility and osteoconductivity.14 clinical reports on the cap ceramics proved their direct bonding to bone and complete osseointegration . However, their poor mechanical properties, such as low strength and fracture toughness, limited wide application in hard tissue implants . Calcium phosphate was accumulated on zirconia surfaces by ion beam assisted deposition (ibad) and hydroxyapatite by aerosol deposition . The compositional degradation of calcium phosphate coatings is caused by the deposition process involving very high temperatures, low binding strength, and thick coatings . The binding strength between the coating and the implant material is one of the critical characteristics which affect the long - term stability of the bone - implant interface . The cell culture system used in this study was rat bone marrow - derived osteoblasts . After implantation, the surface properties of biomaterials can affect the osteogenic and differentiation potentials of mesenchymal cells . This study was performed to characterize the attachment and growth behavior of bone marrow - derived osteoblasts cultured on zirconia surfaces with calcium phosphate coatings and hydroxyapatite coatings compared to smooth surfaced zirconia . Paul, mn, usa) of y - tzp (yttrium - stabilized tetragonal zirconia polycrystal) with a diameter of 10 mm and a thickness of 2 mm were prepared by pressing and sintering at 1500 for 2 hours . One type was y - tzp with a smooth surface (zs group), another was y - tzp with ibad (ion beam assisted deposition) ca - p coating (cap group), the third was y - tzp with ha deposition (ha group). Twenty discs of each group were fabricated and tested for proliferation, differentiation, osteogenic potential, and gene expression . Disc samples were cleaned ultrasonically in acetone, ethanol, and de - ionized water . Calcium phosphate film (up to 500 nm) was deposited on zirconia disk by the electron - beam deposition system . Mixed powder of hydroxyapatite (alfa aesar, johnson matthey, london, uk) and calcium oxide (sigma, st . An electron beam evaporator (telemark, battle ground, wa, usa) at 7.5 kv and 0.13 a, and an end - hall type ion gun (ionbeam scientific, berks, uk) at 90 v and 2.0 a were employed for deposition . Heat treatment after the deposition was conducted at 400 in the vacuum of 3 mm torr . The raw ha powder (alfar aesar, ward hill, ma, usa) used in this study was subjected to the pre - deposition treatment consisting of heating to 1100 for 1 hour . The fine particles were carried by oxygen gas and sprayed onto the zirconia disk in the deposition chamber . Bone marrow - derived osteoblasts were harvested and cultured following the methods described by maniatopoulos et al.15 femurs of two six - week - old male sprague - dawley rats were removed . The bones were washed with 70% alcohol and immersed twice in alpha - mem (sigma, st . Louis, mo, usa) culture medium containing 100 units / ml penicillin - g, 100 g / ml streptomycin (gibco brl, life technologies bv, bleiswijk, the netherlands). The condyles were removed and the bone marrow flushed out using complete cell culture medium (alpha - mem) with 15% fetal bovine serum (gibco, invitrogen ltd ., paisley, uk) and supplemented with 50 g / ml ascorbic acid (sigma, st . Louis, mo, usa), 7 mm na - beta - glycerophosphate (sigma, st . After seven days of primary culture, cells were trypsinized and resuspended in complete culture medium . Cells culture on disks placed in a 24-well plate was carried out for all experiments . Cells were collected and seeded at a density of 1 10 cells / ml by using 0.1% trypsin and 0.02% edta in ca and mg - free eagle's buffer for cell release . Each set of wells contained 24 sterile zirconia disks at 37 in 5% co2 for 24 hours . The samples were then moved to new dishes, fresh media were added, and the plated disks were cultured at 37 in 5% co2 for an additional 24 hours . All cell culture media were supplemented with 100 units / ml penicillin - g, 100 g / ml streptomycin, and 0.25 g / ml fungizone (gemini bio - products inc ., woodland, ca, usa). The cellular viability and proliferation of cells were examined with an mtt based cell growth determination kit (cgd1; sigma, st . Louis, mo, usa). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl - tetrazoliumsalt (mtt), which turns into a blue formazan product due to the viable mitochondria in active cells was used . The osteoblasts were seeded at a density of 2 10 cells / ml and incubated at 37 in 5% co2 for 24 hours and 48 hours . After 24 hours and 48 hours of incubation, the discs were moved to well plates and new media were added . Then, diluted mtt (5 mg / ml) solution was added, and the incubation was continued at 37 in 5% co2 for 4 hours . The incubation medium was then removed, 400 l of isopropanol with 0.04 n hcl was added to each well, and the resulting formazan crystals were dissolved . The absorbance of the formazan product at 490 nm was measured with a microplate reader (bio - kinetics reader, el312e, winooski, vt, usa). Cells were seeded at a density of 2 10 cells / ml . The cultured cells were incubated for 24 and 48 hours at 37 in 5% co2 . The loosely - adherent or unbound cells were removed from the wells by aspiration . Wells were washed twice with a 0.1 m phosphate buffered saline (pbs) buffer (ph 7.4), and the remaining bound cells were fixed with 2.5% glutaraldehyde in 0.1 m sodium cacodylate buffer, ph 7.3, for more than 1 hour . The excess glutaraldehyde solution was removed and the cells were rinsed once more in pbs before being dehydrated in ethanol baths of progressively higher concentrations (50, 60, 70, 80, 90, 95, and 100%, 10 min in each bath). After the cells were dried to a critical point, the samples were sputtered with a 100 nm thick layer of gold using an ion coater (ib-3, eiko co., tokyo, japan). Attachment and morphology of the cells on the discs were observed by vega sem (tescan, brno, czech republic). Osteoblast differentiation generally implies expression of alkaline phosphatase (alp), specific protein and mineralization capacity . Alp is a widely used osteoblast marker, and increased alp activity is associated with elevated osteoblastic activity . The cells were seeded on the substrate at a density of 5 10 cells per well . Cells were washed twice in cold tris - buffered saline (tbs), lysed with tbs - triton and centrifuged, and the supernatant was analysed for alp activity using 1 mg / ml p - nitrophenylphosphate (pnpp; sigma, st louis, mo, usa). The absorbance at 409 nm was measured using the microplate reader (bio - rad, hercules, ca, usa). X - ray photoelectron spectroscopy (xps) is a surface - sensitive quantitative spectroscopic technique that measures the elemental composition of the surface (top 0 - 10 nm usually). Surface chemistry of the substrates was analyzed by x - ray photoelectron spectroscopy (xps, k - alpha; thermo fisher scientific, ma, usa). The xps spectra were recorded using normal al k (1486.6 ev) with a probing beam size of 125 m . The recorded spectra were calibrated to the binding energy of c 1s (284.6 ev) owing to the charge effect . Xps spectra were obtained at zr 3d, y 3d, c 1s, o 1s, p 2p, ca 2p, and al 2p . The osteoblastic differentiation was evaluated by rt - pcr for examination of type i collagen, glyceraldehyde 3-phosphate dehydrogenase (gapdh), osteocalcin, and osteonectin . Total rna extraction was performed with the rneasy mini kit (qiagen, chatsworth, ca, usa). Amplitaq dnapolymerase (amersham pharmacia biotech, piscataway, nj, usa) was used to amplify the cdna . The pcr products were fractionated by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining . The intensity of the bands was quantified under uv transillumination (eagle eye ii, stratagene, la jolla, ca, usa). Dissolution behavior of ca and p ions from the coatings were evaluated by immersion of cap and ha group specimens in physiological saline solution (0.9%) nacl . At the predetermined time periods (4, 8, 12, 16, and 20 hours), the concentration of the ca and p ions released from the coated substrate was calculated with inductively coupled plasma - atomic emission spectrophotometer (icp - aes; icps-1001v, shimadzu, tokyo, japan) analysis . The mean values (mv) and standard deviations (sd) will be computed for the mtt test and alp analysis, and an analysis of variance (anova) and scheffe post hoc tests for multiple comparisons were conducted to assess the statistical significance of the differences between the groups . All statistical analyses were performed using spss 18.0 for windows (spss inc ., chicago, il, usa). The optical densities of the formazan produced by osteoblasts in the zs, cap, and ha groups were measured after 4, 24 and 48 hours via a mtt assay (fig . After 48 hours of cell culture, all three groups showed increased cellular activity and proliferation, however, no significant differences were observed among the groups (p>.05). Overall, the osteoblasts seeded onto the three groups of zirconia specimens showed similar degrees of vitality and proliferation . The general morphology and growth pattern of the osteoblasts for each group were observed using sem for each group (fig . 2 and fig . Sem images after 24 and 48 hours of culture show that the cells were triangular or elongated in shape and spread or irregularly with some long filopodia attached to the substrate . After 48 hours of culture, cells on all discs showed increased contact to each other and firm adhesion to the substrate with increased formation of filopodia compared to 24 hours of culture . Overall, the osteoblasts cultured on smooth zirconia group showed comparative initial adhesion properties and growth pattern, compared to the surface treated groups . Alp assays were performed to compare the differentiation rate of osteoblasts on each group and the following results were obtained (fig . 4). After 14 days of incubation, alp was highest in the cap group and then the zs group with ha group the lowest . Xps was used to determine the surface composition of the substrates of each group (fig . The zirconia surface was oxidized as zirconium oxide and polluted by carbon contaminants in all groups . However, the zs samples exhibited zirconia, yttrium, and aluminum peaks . Samples with surface treatment showed peaks with calcium and phosphorous due to the different substances of the coating . The cells were incubated for 24 h and the mrna levels of type i collagen, osteocalcin, and osteonectin were analysed by rt - pcr . The levels of mrna for type i collagen, osteocalcin, and osteonectin on the zs, ha, and cap groups were comparable and showed no significant differences (fig . . The dissolution rate of ca and p was higher with cap group than ha group (fig . 7). Also, the ca and p concentration increased with time for the cap group . However, it decreased with time and became generally stable at 20 hours for the ha group . Research for new bioactive coatings for dental implants to improve tissue integration and stability are still in progress.16,17 the topography and the surface chemistry are of great importance.18,19 recently, surface - modified zirconia implants have been studied for long - term stability and strong bone tissue response.20 monoclinic zirconia coated on titanium has been proved to have positive osteoblastic behavior and is potentially useful in hard tissue replacements.21 calcium phosphate has been used as surface coatings on implants due to its bioactivity, which enables earlier stabilization of implants to the surrounding bone.22 coatings with high dissolution behavior have high concentration of ca which enhances osteoblast responses and improves bone formation around the implant.23 however, the dissolution behavior and the low adhesion strength of the coating layer have raised concerns on the stability of the implants.24 in the present study, the concentration of ca and p released from the coatings was higher with the cap group than the ha group . Also, the ca and p concentrations increased with time on the cap group . The xps results show that the ion compositions of the cap and ha group are very similar . Thus, the different coating methods of the cap or ha may explain the improved chemical stability of the ha group . This implies that aerosol deposition method can produce more stable coatings with implants and transgingival components . To verify the long - term stability of the zirconia coated with bioactive ceramics, evaluation of the adhesion strength between the coating and the substrate alp activity is an important parameter that allows for the assessment of the differentiation level of the mineralization of osteoblasts, and is considered as a marker of the early stage of osteogenic differentiation.25 in this study, alp activity of the cap coated group was shown to be the highest . Although no significant differences were observed among the groups, it can be speculated that calcium phosphate coating may have positive effects on the early stage of osteogenic differentiation . Type i collagens are major extracellular matrix components of osteoblasts and involved in adhesion . As osteocalcin is produced by osteoblasts, it is known as a marker for the bone formation process . Also, osteonectin is an extracellular matrix glycoprotein which is secreted by osteoblasts during bone mineralization and modulates cell proliferation . No significant differences were found in the level of mrna for type i collagen, osteocalcin, and osteonectin during the 24 hours cell culture period . Surface texture of machined zirconia is known to enhance bone apposition and has benefits on the removal torque values.6 however, in this study, smooth zirconia and surface coated zirconia showed overall comparable cellular viability which implies that surface chemistry affects osteoblast attachment and spreading . More in vivo and in vitro investigations are needed to establish the ideal surface roughness and biochemical coating for the zirconia implants . From the semi - quantitative xps analyses, it can be speculated that surface treatment affected the surface chemical composition of the zirconia surface . Although sandblasting with al2o3 was not performed, xps results documented the presence of al on the smooth zirconia surface group which might have been incorporated for increasing the toughness of the zirconia.26 these al2o3 particles would not affect the osseointegration pattern as shown by animal studies.27 however, the role of residual al2o3 on implant surfaces is still a matter of controversy28 and it is difficult to conclude whether there is a positive or negative effect because of the low content of residual al on the smooth zirconia surface group . Fluoride incorporation into the coating layer is known to bring about lower dissolution and greater chemical stability.29 therefore, further studies on the incorporation of other ions and coating techniques for the best resistance to dissolution and higher positive cell stimulating effects are needed . Thus, we need to focus on the control of the in vivo degradation behavior and the mechanical properties of the coatings on the zirconia . The attachment and growth behavior of bone marrowderived osteoblasts cultured on smooth zirconia and surface coated zirconia showed comparable results . However, considering the dissolution behavior of the surface coatings of the zirconia, the ha coating was more stable compared to the cap coating . More in vitro and in vivo researches are necessary to identify a stable surface with controlled and standardized chemistry.
In the last decade, a rapid growth of the prevalence of obesity was experienced worldwide, the importance of which can be best illustrated with the forecast that this phenomenon could reverse the increase in life expectancy having been observed in the past decades . Similar trends of obesity epidemic were also observed in the child population, which made it a worldwide public health crisis . Later consequences of childhood obesity put a significant burden on, both, the individual's health and quality of life as well as on the health care system on a societal level . Recently, the so - called obesity epidemic in children showed a flattening trend in several countries, probably due to preventive and intervention efforts . Even if long - term observation will reinforce this favourable trend, obesity will still remain a major public health concern for the next decades to be managed by targeted interventions . The idefics (identification and prevention of dietary- and lifestyle - induced health effects in children and infants) study was designed to (1) investigate the aetiology of childhood obesity, by assessing the contributing role of potential risk factors, that is, the effects of diet, lifestyle, psychosocial and genetic factors, and to describe their causal pathways . (2) the idefics study also launched an intervention programme which was developed according to the intervention mapping protocol, a methodological framework for the elaboration of public health promotion programmes and community interventions . Relevant behaviours and their determinants were dissected and integrated into matrices for operational interventional actions, chosen on the basis of existing evidence and/or supporting theoretical models for behaviour change . Lifestyle behaviours known as most relevant lifestyle - related risk factors for obesity were selected as intervention targets: (1) diet, (2) physical activity and (3) stress . Each of these three areas was addressed by two so - called key messages: 1a . Enhancing daily consumption of water1b . Enhancing daily consumption of fruits and vegetables2a . Reducing tv viewing2b . Enhancing daily physical activity3a . Improving the quality of family life3b . Ensuring adequate sleep duration . 1a . Enhancing daily consumption of water 1b . Enhancing daily consumption of fruits and vegetables 2a . Reducing tv viewing 2b . Enhancing daily physical activity 3a . Improving the quality of family life 3b . Ensuring adequate sleep duration . The aim of this paper is to describe the adherence to the recommendations related to these six key messages in the study sample, that is, at baseline before the intervention started and in newly recruited children at follow - up, stratified by country, sex and age . A cohort of 16 228 children aged 29 years was examined in a population - based baseline survey in eight european countries ranging from north to south and from east to west (estonia, sweden, germany, belgium, hungary, italy, spain, cyprus) from autumn 2007 to spring 2008 . Rather, this baseline survey (t0) was the starting point of a prospective study with the largest european children's cohort established to date . This cohort and additional 2517 children aged 210.9 years who were newly recruited during a second survey (t1) 2 years later comprise the study sample of the present analysis . Exactly the same survey modules were deployed at baseline (t0) and at follow - up (t1). The actual age of school enrolment varied in the survey countries, so the school - aged subgroup was defined according to the most frequent date, that is, being 6 years or older . All children in the defined age group who resided in the defined regions and who attended the selected primary schools (grades 1 and 2), pre - schools or kindergartens were eligible for participation . Children were enroled via schools and kindergartens to facilitate equal enrolment of all social groups . In addition to the signed informed consent given by parents, each child was asked to give verbal assent immediately before examination . All examination modules were offered to each participant, except accelerometry where the number of available devices limited the participation . Participants were free to opt out for specific modules, which resulted in varying numbers of response . In the following, we briefly describe how each of the lifestyle behaviours was measured in the idefics study . Questionnaires provided information for the indicator variables of five from the six key messages . Children's eating habits questionnaire (cehq) was completed by parents, recording dietary habits and food frequency referring to the previous four weeks . Indicators for diet - related key messages, that is, the frequency of water consumption and fruit and vegetable consumption were obtained from ceqh . The fruit and/or vegetable consumption was derived by summarising the daily consumption of the following food types: fruits with or without added sugar, including freshly pressed smoothies (while excluding juices), and cooked or raw vegetables . Cehq was complemented by a computer - based 24-h dietary recall, including an interview where, among other questions, parents reported what time their child went to bed the previous day and what time he / she got up in the morning, from which the nocturnal sleep duration was calculated for the previous day . Parents completed a self - completion set of questionnaires to assess gestational, socio - demographic and behavioural factors, being the source also for proxy - reported daily screen time of the child separately for weekdays and weekend days with the help of the question: how long does your child usually watch tv / video / dvd per day? The parental core questionnaire included questions from the kindl questionnaire designed to assess health - related quality of life in children and adolescents independently of the current health status . As it was assumed that high quality of life indicates more balanced family life, a health - related quality of life score was used as an indicator of the key message referring to improved quality of family life, though the score itself covers a broader range of information than the family life . This health - related quality of life score comprised four of the six original kindl dimensions: emotional self - being, self - esteem, family relations and social contacts . The range of the score was 1248, the higher values indicating better quality of life . To monitor the physical activity, children wore a uniaxial accelerometer (actigraph or actitrainer, actigraph, pensacola, fl, usa) on a hip belt over at least three consecutive days including one weekend day . A minimum duration of 6 h monitoring time per day was required to achieve proper reliability, whereas the epoch of sampling was set on 15 s, where non - wear time was defined as at least 20 min of consecutive zeroes . The duration of moderate - to - vigorous physical activity (mvpa) was determined according to the cut - offs of evenson (see konstabel et al . ; this issue). Internationally recommended target values regarding the six lifestyle behaviours are based on a report on existing guidelines . As water consumption is subject to relevant seasonal and climate influences and water content of the diet can also contribute to hydration; we have not considered the international recommendation for this key message but used the highest category of intake frequency in cehq, that is, four or more times per day as the target to be met . Regarding daily consumption of fruits and vegetables, the national recommended target values proved to be so diverse that we decided to use the recommendation from the who cindi nutritional guidelines, that is, a daily intake of five or more portions of fruits and/or vegetables . Among the various recommendations for sleep duration, we considered 11 h or more for pre - school children and 10 h or more for school children as target values . The most generally accepted recommendation restricts tv viewing time to 12 h per day where the lower threshold applies to pre - school children, combining all screen - based activities . The evaluation of the original kindl questionnaire does not provide an established target value in all the survey countries, so we decided to use the 85th percentile of the scale range (that is, 44 points) as threshold of an indicator for a good quality of life, which itself is considered as proxy for a balanced family life . The recommended target value of mvpa for children ranges from 15 to 20 min in the mediterranean countries, for example, cyprus and italy, to 90 min in canada . The most widely accepted target value of 60 min mvpa was applied in our analysis . On the basis of the internationally recommended target values described above, a compliance score was calculated adding up the number of those key messages for which the recommended target values were met . Hence, the values of the compliance score range from zero (no compliance at all) to six (fulfilling the recommendation for all six key messages). Achieving at least five points was considered as good compliance . All survey elements followed detailed standard operation procedures that were laid down in the general survey manual and finalised after the pre - test of all survey modules . To check and improve the quality of data, the reliability of questionnaires was checked by re - administering the cehq and selected questions of the parental questionnaire in a convenience sample of study participants confirming an acceptable reproducibility even by more than 4 months between the first and second administration, without any systematic differences in reproducibility by sex and age . Food consumption assessed by the cehq was validated against selected nutrients measured in blood and urine, which revealed a significant positive correlation between reported intake and excretion . A methodological study was carried out to compare uniaxial and triaxial accelerometers in children and to validate them using doubly labelled water as the gold standard . On the basis of the above described variables and pre - defined cut - off points, we assessed country - specific means and s.d . And prevalences of compliance with each of the six key messages as well as country - specific distributions regarding the compliance score, stratified by pre - school / school and sex . All analyses were performed using sas 9.2 (sas institute inc ., cary, nc, usa). A cohort of 16 228 children aged 29 years was examined in a population - based baseline survey in eight european countries ranging from north to south and from east to west (estonia, sweden, germany, belgium, hungary, italy, spain, cyprus) from autumn 2007 to spring 2008 . Rather, this baseline survey (t0) was the starting point of a prospective study with the largest european children's cohort established to date . This cohort and additional 2517 children aged 210.9 years who were newly recruited during a second survey (t1) 2 years later comprise the study sample of the present analysis . Exactly the same survey modules were deployed at baseline (t0) and at follow - up (t1). The actual age of school enrolment varied in the survey countries, so the school - aged subgroup was defined according to the most frequent date, that is, being 6 years or older . All children in the defined age group who resided in the defined regions and who attended the selected primary schools (grades 1 and 2), pre - schools or kindergartens were eligible for participation . Children were enroled via schools and kindergartens to facilitate equal enrolment of all social groups . In addition to the signed informed consent given by parents, each child was asked to give verbal assent immediately before examination . All examination modules were offered to each participant, except accelerometry where the number of available devices limited the participation . Participants were free to opt out for specific modules, which resulted in varying numbers of response . In the following, we briefly describe how each of the lifestyle behaviours was measured in the idefics study . Questionnaires provided information for the indicator variables of five from the six key messages . Children's eating habits questionnaire (cehq) was completed by parents, recording dietary habits and food frequency referring to the previous four weeks . Indicators for diet - related key messages, that is, the frequency of water consumption and fruit and vegetable consumption were obtained from ceqh . The fruit and/or vegetable consumption was derived by summarising the daily consumption of the following food types: fruits with or without added sugar, including freshly pressed smoothies (while excluding juices), and cooked or raw vegetables . Cehq was complemented by a computer - based 24-h dietary recall, including an interview where, among other questions, parents reported what time their child went to bed the previous day and what time he / she got up in the morning, from which the nocturnal sleep duration was calculated for the previous day . Parents completed a self - completion set of questionnaires to assess gestational, socio - demographic and behavioural factors, being the source also for proxy - reported daily screen time of the child separately for weekdays and weekend days with the help of the question: how long does your child usually watch tv / video / dvd per day? The parental core questionnaire included questions from the kindl questionnaire designed to assess health - related quality of life in children and adolescents independently of the current health status . As it was assumed that high quality of life indicates more balanced family life, a health - related quality of life score was used as an indicator of the key message referring to improved quality of family life, though the score itself covers a broader range of information than the family life . This health - related quality of life score comprised four of the six original kindl dimensions: emotional self - being, self - esteem, family relations and social contacts . The range of the score was 1248, the higher values indicating better quality of life . To monitor the physical activity, children wore a uniaxial accelerometer (actigraph or actitrainer, actigraph, pensacola, fl, usa) on a hip belt over at least three consecutive days including one weekend day . A minimum duration of 6 h monitoring time per day was required to achieve proper reliability, whereas the epoch of sampling was set on 15 s, where non - wear time was defined as at least 20 min of consecutive zeroes . The duration of moderate - to - vigorous physical activity (mvpa) was determined according to the cut - offs of evenson (see konstabel et al . ; internationally recommended target values regarding the six lifestyle behaviours are based on a report on existing guidelines . As water consumption is subject to relevant seasonal and climate influences and water content of the diet can also contribute to hydration; we have not considered the international recommendation for this key message but used the highest category of intake frequency in cehq, that is, four or more times per day as the target to be met . Regarding daily consumption of fruits and vegetables, the national recommended target values proved to be so diverse that we decided to use the recommendation from the who cindi nutritional guidelines, that is, a daily intake of five or more portions of fruits and/or vegetables . Among the various recommendations for sleep duration, we considered 11 h or more for pre - school children and 10 h or more for school children as target values . The most generally accepted recommendation restricts tv viewing time to 12 h per day where the lower threshold applies to pre - school children, combining all screen - based activities . The evaluation of the original kindl questionnaire does not provide an established target value in all the survey countries, so we decided to use the 85th percentile of the scale range (that is, 44 points) as threshold of an indicator for a good quality of life, which itself is considered as proxy for a balanced family life . The recommended target value of mvpa for children ranges from 15 to 20 min in the mediterranean countries, for example, cyprus and italy, to 90 min in canada . The most widely accepted target value of 60 min mvpa was applied in our analysis . On the basis of the internationally recommended target values described above, a compliance score was calculated adding up the number of those key messages for which the recommended target values were met . Hence, the values of the compliance score range from zero (no compliance at all) to six (fulfilling the recommendation for all six key messages). Achieving at least five points was considered as good compliance . All survey elements followed detailed standard operation procedures that were laid down in the general survey manual and finalised after the pre - test of all survey modules . To check and improve the quality of data, the reliability of questionnaires was checked by re - administering the cehq and selected questions of the parental questionnaire in a convenience sample of study participants confirming an acceptable reproducibility even by more than 4 months between the first and second administration, without any systematic differences in reproducibility by sex and age . Food consumption assessed by the cehq was validated against selected nutrients measured in blood and urine, which revealed a significant positive correlation between reported intake and excretion . A methodological study was carried out to compare uniaxial and triaxial accelerometers in children and to validate them using doubly labelled water as the gold standard . On the basis of the above described variables and pre - defined cut - off points, we assessed country - specific means and s.d . And prevalences of compliance with each of the six key messages as well as country - specific distributions regarding the compliance score, stratified by pre - school / school and sex . All analyses were performed using sas 9.2 (sas institute inc ., cary, nc, usa). The data were obtained from 8302 (physical activity) to 17 212 (screen time) children, according to the varying proportions of participation in the various modules . No noteworthy differences were found regarding the socio - demographic characteristics between the total sample and the various subpopulations according to the availability of data on the various key messages (table 1). Table 2 shows the sample size with respect to the key messages and summarises the observed behaviours . A positive trend with age can be observed for total screen time in the sense that older children spent more time in front of the tv or computer and for physical activity, whereas there is negative trend for fruit and vegetable intake, sleep time and the health - related quality of life score . In all countries, the total screen time was higher for boys than girls (in pre - school age: 1.53 vs 1.36 h per week; in school age 2.06 vs 1.76 h per week). Also, the mean daily duration of mvpa was higher for boys than for girls (in pre - school age: 38.2 vs 30.6 min; in school age 47.9 vs 36.2 min). The water consumption in southern countries was much higher than in central and northern european countries . Fruit and vegetable consumption was far below the recommended target value in all countries and age groups: the proportion of children who achieved the 5 a day' recommendation was only 8.8% . None of the diet - related key behaviours showed major differences by sex or age . Total screen - based activities were below the recommended target value in 51.5% of all children with no major regional differences, girls having better compliance than boys (56.4% vs 46.6%). The recommended target value of mvpa was achieved in only 15.2% of the children, with threefold difference in the prevalence between countries (8.8% in cyprus vs 25.7% in sweden). The same order of magnitude in difference was observed according to sex: the proportion of children achieving the recommended target value of mvpa was higher among boys than among girls (in pre - school children 15.0% vs 4.5% in school children 26.8% vs 10.5%). Key messages promoting lifestyle changes to cope with stress indicate far better results in the northern region than in the southern region, especially among girls (see table 3). In addition, we observed a negative trend with age for the health - related quality of life score . The recommendation on sleep duration was fulfilled in 37.9% of our study sample . In both age groups and in all countries except estonia, the prevalence of adherence to recommendation was better in girls . Regarding the compliance score, the two extremes of the scale showed a sharp contrast: 0 and 1 points, that is, poor compliance, were observed for 37.6% in our study sample, whereas a good compliance with this set of lifestyle recommendations was observed in only 1.1% of the children . Figures 2 and 3 depict the distribution of the compliance score according to age, sex and country . The score showed a similar pattern as most of the key messages, that is, a better adherence of children to the six key messages in the northern countries and among younger age groups . The present paper investigated the adherence of european children to selected health behaviours known to be associated with childhood obesity and being essential for children's optimal and healthy development . The results demonstrate that surprisingly low proportions of these children meet the recommended target values of the investigated health behaviours (8.852.5%). The consumption of sugar - sweetened beverages is an important contributor to childhood obesity confirmed even by longitudinal studies . In spite of this the review of libuda and kersting also underlined that the most reasonable preventive measure is replacing soft drinks by non - caloric beverages, for example, tap water and mineral water . In our study, half of the children showed a satisfactory water intake reflected by the highest category of intake frequency reported in the cehq . However, this also implies that almost half of the children do not drink enough water . A low level of fruit and vegetable consumption among children the position paper of the american dietetic association on dietary guidance for healthy children ages 2 to 11 years reported that 63 and 78% of children 2 to 9 years do not consume the recommended number of servings of fruits and vegetables . They found an average daily intake of two servings of fruits and 2.2 of vegetables . A recent review confirmed this observation, demonstrating low intakes of fruits and vegetables in most american, european and australian studies, between 2 and 3 portions per day which are well below the recommended five portions . This target value of five portions should consider the age of the child, that is, the appropriate amount of fruits and vegetables depends on the energy needs, where for example, a young child should eat more than 200 g per day . In the netherlands, more children complied with the world health organisation recommendation of 400 g fruits and vegetables per day (17.0%) in 2009 than in 2003 (11.8%, p=0.004). Two german studies reported a fruit intake of 110 and 114 g in boys and girls, respectively, and a vegetable intake of 104 and 115 g; in total, 2.62.8 portions according to the who cindi conversion . A british study revealed that the daily consumption of at least one portion of fruit and of vegetables in 910-year - old children was 56.8 and 49.9%, respectively . Results on the association of fruit and vegetable consumption and obesity are controversial in spite of their low energy density . Nevertheless, high fruit and vegetable consumption contributes to a well - balanced nutrient - containing diet . The data gained from the idefics survey correspond to the results demonstrated by the studies discussed above . Fruit and vegetable consumption is very low in the participating european children, not even approaching the widely accepted internationally recommended target value of five times per day, where the proportion of adherers ranged from 2.5% in belgium to 14.5% in sweden, while in total 91.2% of the children have an intake lower than optimal . It is worth mentioning that fruit / vegetable intake is relatively low even in the mediterranean countries . On the basis of these data, we can state that plant food consumption should be highly promoted among european children . Reviews concerning the relationship between tv time, sedentary time and obesity are equivocal; however, the majority of them confirm a positive association . Possible explanations are multifold, involving direct and indirect mechanisms contributing to the childhood obesity epidemic . Food proved to be the most frequently advertised product category on children's tv, the majority of these products being energy dense and nutrient poor . This facilitates adverse dietary patterns: energy - dense snack consumption, fast - food consumption, energy - dense drink intake, higher total energy intake and higher percentage energy from fat . Watching tv redirects attention from conscious eating and provides opportunity for unnoticed and unrestricted snacking . These arguments support the american academy of pediatrics policy statement suggesting that daily screen time should be restricted to 12 h, the lower limit applying for younger children . There is a positive trend with age for total screen time, but due to the duplication of permitted screen time, this does not cause an increase in non - compliance with the guidelines . The majority of studies reported a significant relationship between television viewing time and adverse dietary outcomes with as little as 1 h of daily television exposure . According to the present data the recommendation of<1 h of total screen time per day for pre - school children and<2 h per day for school children not exclusively tv viewing these thresholds were reached by 51.5% of the idefics population that was the second best compliance in the present study after compliance to water consumption . It improves metabolic and mental health, besides, it is also positively associated with academic performance . There is a positive trend with age for compliance to physical activity recommendations in the idefics population, but even school children's physical activity levels are far below the recommended target value . The prevalence of spending more than 1 h per day in mvpa is overall very low, ranging from 6.8% in italy to 25.7% in sweden . Boys were more physically active than girls, which confirms previous findings where it is repeatedly stressed from an overall european perspective that girls are less likely to be suffciently physically active than boys . Currently, there is a growing interest on how different aspects of family life affect children's health . Although we did not explicitly measure, for instance, the stress level of the family, but various other indicators of the quality of family life instead, it is interesting to note that the stress level of the family can be an important contributor to childhood obesity, and the other way round, obesity may increase the stress level . Our cross - sectional study cannot identify causal relationships, though literature suggests that impaired mother child relationship, reduced social support and parenting care may have a role in establishing adverse diet patterns . This puts in focus the relationships within the family confirming the results of our intervention mapping approach, which addressed stress management as one of the intervention targets for the idefics study . The strengthening of a supportive family environment may have beneficial effects on stress coping and consequently on obesity . A negative trend with age was observed for the health - related quality of life score in the idefics population, with lower values in the southern countries at all ages . An increasing body of evidence suggests that shorter sleep duration is independently associated with weight gain, particularly in younger age groups . Investigation of sleep patterns in the idefics study confirmed the association of sleep duration with obesity: a dose - dependant association between sleep duration and overweight was observed . A clear gradient in sleep duration could also be seen between regions: children from northern europe sleep longer than children in southern europe . Sleep duration has shown a decreasing trend in the past century, reflecting changing lifestyles . In our study, the age - specific recommendations were met by 7.5% of estonian children up to 82.2% of belgian children . On the basis of these results, we can conclude that striving for longer sleep duration among european children would be essential, and this should be promoted especially in the southern countries . Please note that we only recorded nocturnal sleep duration although sleep during the daytime might be relevant in mediterranean countries where for instance napping after lunch is common, but this was not recorded in the idefics study . Several lifestyle factors are described as behavioural contributors to childhood obesity, which are often associated with each other . The advantage of combining the most important lifestyle factors in a compliance score may provide a more holistic view: complying with certain aspects of lifestyle recommendations can vary even within an individual, but these aspects can compensate each other, creating a final common effect on the outcome of obesity . The score can express the fulfilment of a comprehensive set of recommended behavioural factors, such as in the present study the compliance with the six key messages of the idefics intervention . Our data revealed that an almost complete compliance (that is, five or six messages) with recommendations is rare among european youth: the range is 0 (cyprus) to 2.8% (germany) with 1.1% prevalence in the total idefics population . The distribution of the compliance score was different between countries and compliance increased with age . The strength of the present study is its large sample size with wide geographical coverage of europe . The study was carefully planned and performed a standardised and quality - controlled data collection . One limitation of the present analysis may be that the children participating in the various modules were not a random sample of the overall study population . However, there were no apparent differences in the socio - demographic profile between the responders and non - responders to the various modules . Another limitation is the reliance on self - reports with respect to variables where an objective assessment or a direct measurement was not feasible in such a large population - based study . Furthermore, the relationship of our key message to improve the quality of family life and the newly developed quality of life score has not been directly shown . But as the quality of life score used in this paper contains a module characterising the quality of family relations (taken from the original kindl questionnaire), we are quite confident that its use is valid for indicating the key message with respect to an improved quality of family life . The compliance of young children to health - behaviour recommendations was very low and should therefore be improved, preferably via those actors who can serve as a role model, mediator for the different lifestyle aspects or nutritional gatekeeper for the children . The present paper directs the attention to the gap between the present and the required situation . Further studies are needed to define evidence - based target values for a healthy development of children.
Local anesthetic compounds, such as lidocaine, suppress the ionic current through na channels . By attenuating central and peripheral neuronal excitability, these compounds enjoy widespread use in the treatment of epilepsy and the relief of pain . In addition, local anesthetic compounds block na channels in skeletal and cardiac muscle, and are used to treat neuromuscular diseases and cardiac arrhythmias . An essential characteristic of the local anesthetic action is use dependence, which is the sustained loss of excitability lasting many hundreds of milliseconds that is induced only when the drug - exposed channel is depolarized (courtney 1975). Although studies have identified amino acid residues in the cytoplasmic end of the pore that, when mutagenized, attenuate the action of local anesthetic compounds (ragsdale et al . 1994; nau et al . 1999), the structural basis of the sustained, depolarization - dependent loss of excitability associated with use dependence is not understood . When briefly depolarized, na channels inactivate rapidly within a few milliseconds (fast inactivation), a process mediated by residues situated near the cytoplasmic face of the channel (west et al . These nonconducting states have diverse lifetimes ranging from tens of milliseconds (kambouris et al . 1999) to many seconds (cummins and sigworth 1996; featherstone et al . 1996; hayward et al . 1997), and are distinct from fast inactivation that typically recovers within 10 ms between stimuli . Importantly, slow inactivation influences cellular excitability, particularly in the pathophysiological conditions associated with prolonged membrane depolarization such as epilepsy (fleidervish et al . 1995), arrhythmias (veldkamp et al . 2000), and neuromuscular diseases (cannon 1996). Amino acid residues from the p - segments (s5-s6 linkers), donated from each of the four homologous domains, line the extracellular aspect of the na channel pore (see fig . 1). Although the structural basis of slow inactivation gating is not defined, site - directed mutations and chimeric studies suggest a role for the p - segments (balser et al . 1996a; benitah et al . 1999; todt et al . 1999; vilin et al . 1999). In addition, p - segment mutations and extracellular cation substitutions that reduce slow inactivation (townsend and horn 1997) seem to inhibit use - dependent lidocaine action (zilberter et al . 2000), suggesting a potential mechanistic linkage between these phenomena . Investigating the structural basis of slow inactivation is hampered by its electrical silence, and requires a means to detect relatively slow changes in the conformational architecture of a nonconducting channel . Cysteine substitution of a p - segment residue in domain iii (see fig . 1, f1236c) yields a na channel reactive with the positively charged methanethiosulfonate (mts) reagent mts - ethylammonium (mtsea) applied from outside the cell, yet the residue is entirely resistant to mtsea applied from inside the cell (yamagishi et al . Adjacent to the domain iii lysine that contributes to the na channel selectivity filter (see fig . 1, k1237; heinemann et al . 1992), this cysteine cannot be modified by larger (mts - ethyltrimethylammonium [mtset]) or negatively charged (mts - ethylsulfonate, mtses) reagents (yamagishi et al . We postulated that sulfhydryl modification of a residue harboring such restrictive access might be sensitive to the voltage - gated conformational state of the ion channel . The results show that modification of f1236c is greatly enhanced by brief depolarizations, but is inhibited by more sustained depolarizations that induce slow inactivation . Moreover, lidocaine inhibited depolarization - induced mtsea modification during sustained, but not brief, depolarizations . We propose that na channel slow inactivation and use - dependent lidocaine action are linked to a common structural rearrangement involving the outer pore . For heterologous expression, the wild - type rat skeletal muscle nachannel (1) subunit was subcloned into the hindiii - xbai site of the vector gfp - irs for bicistronic expression of the channel protein and gfp reporter as previously described (johns et al . The rat skeletal muscle mutant na channel f1236c was prepared (yamagishi et al . 1997) using a pcr - based method (quickchange site - directed mutagenesis kit; stratagene). In brief, sense and antisense oligonucleotides (3034 mer) containing the desired mutation were used as primers for amplification with pfu dna polymerase . The pcr product was treated with dpni to select for the mutant plasmid and transformed into escherichia coli for subsequent isolation and purification . Wild - type and mutant na channels subunits were transiently transfected into hek 293 (human embryonic kidney cell line) cells using lipofectamine (gibco brl), and were cultured in mem medium supplemented with 10% fetal bovine serum and 1% pen - strep in a 5% co2 incubator at 37c for 13 d. in all cases, the hek cells were cotransfected with the na channel 1 subunit (provided by dr . Alfred george, vanderbilt university). Whole - cell na currents (ina) were recorded (axopatch 200b; axon instruments) using electrodes with resistances of 13 m when filled with a pipet solution containing (in mm): 140 naf, 10 nacl, 5 egta, 10 hepes, ph 7.40 . Replacing the intracellular k with na eliminated the time - dependent k currents in our hek cell recordings . Current magnitudes were 12 na, and 85% of the series resistance was compensated, yielding a maximum voltage error of 1 mv . The bath solution contained (in mm): 150 nacl, 4.5 kcl, 1.5 cacl2, 1 mgcl2, 10 hepes (titrated to ph 7.40 with naoh). Mtsea, mtses, and mtset (toronto research chemicals) were kept at 4c as high concentration stock solutions and were diluted to 25100 in the appropriate bath solution immediately before use . The disulfide reducing agents dithiothreitol (dtt) and glutathione were dissolved directly in the extracellular solution at a concentration of 5 mm (titrated to ph 7.4 with naoh). Lidocaine hcl (sigma - aldrich) or qx-314 (almone labs) were diluted from stock solutions to the bath concentrations indicated in the text . Cells were dialyzed for a 15-min equilibration period before recording data . To avoid junction potentials with solution changes, inactivation gating kinetics and use - dependent block were assessed using the voltage - clamp protocols described in the text and figure legends . Whole - cell currents were sampled at 20 khz (digidata 1200 a / d converter; axon instruments) and low pass filtered at 5 khz . The results are expressed as mean sem, and statistical comparisons were made using one - way anova (microcal origin) with p <0.05 indicating significance . Multiexponential functions were fitted to the data using nonlinear least - squares methods (origin). For heterologous expression, the wild - type rat skeletal muscle nachannel (1) subunit was subcloned into the hindiii - xbai site of the vector gfp - irs for bicistronic expression of the channel protein and gfp reporter as previously described (johns et al . The rat skeletal muscle mutant na channel f1236c was prepared (yamagishi et al . 1997) using a pcr - based method (quickchange site - directed mutagenesis kit; stratagene). In brief, sense and antisense oligonucleotides (3034 mer) containing the desired mutation were used as primers for amplification with pfu dna polymerase . The pcr product was treated with dpni to select for the mutant plasmid and transformed into escherichia coli for subsequent isolation and purification . Wild - type and mutant na channels subunits were transiently transfected into hek 293 (human embryonic kidney cell line) cells using lipofectamine (gibco brl), and were cultured in mem medium supplemented with 10% fetal bovine serum and 1% pen - strep in a 5% co2 incubator at 37c for 13 d. in all cases, the hek cells were cotransfected with the na channel 1 subunit (provided by dr . Alfred george, vanderbilt university). Whole - cell na currents (ina) were recorded (axopatch 200b; axon instruments) using electrodes with resistances of 13 m when filled with a pipet solution containing (in mm): 140 naf, 10 nacl, 5 egta, 10 hepes, ph 7.40 . Replacing the intracellular k with na eliminated the time - dependent k currents in our hek cell recordings . Current magnitudes were 12 na, and 85% of the series resistance was compensated, yielding a maximum voltage error of 1 mv . The bath solution contained (in mm): 150 nacl, 4.5 kcl, 1.5 cacl2, 1 mgcl2, 10 hepes (titrated to ph 7.40 with naoh). Mtsea, mtses, and mtset (toronto research chemicals) were kept at 4c as high concentration stock solutions and were diluted to 25100 in the appropriate bath solution immediately before use . The disulfide reducing agents dithiothreitol (dtt) and glutathione were dissolved directly in the extracellular solution at a concentration of 5 mm (titrated to ph 7.4 with naoh). Lidocaine hcl (sigma - aldrich) or qx-314 (almone labs) were diluted from stock solutions to the bath concentrations indicated in the text . Cells were dialyzed for a 15-min equilibration period before recording data . To avoid junction potentials with solution changes, inactivation gating kinetics and use - dependent block were assessed using the voltage - clamp protocols described in the text and figure legends . Whole - cell currents were sampled at 20 khz (digidata 1200 a / d converter; axon instruments) and low pass filtered at 5 khz . The results are expressed as mean sem, and statistical comparisons were made using one - way anova (microcal origin) with p <0.05 indicating significance . Multiexponential functions were fitted to the data using nonlinear least - squares methods (origin). 1) cysteine side chain to sulfhydryl modification using 100 m mtsea . A 3-min exposure to mtsea during hyperpolarization (100 mv; fig . 2 a, protocol i) reduced f1236c peak ina by 31 3% (after mtsea washout; summary data fig . This exceeded wild - type modification (13 3%, p <0.05; fig . B), but was less than that previously seen with f1236c using a much higher concentration of mtsea (49 15%, 2.5 mm; yamagishi et al . However, modification was substantially increased by clamping to 20 mv during mtsea exposure for f1236c (73 5%, p <0.0001; fig . Identical experiments using the larger, positively charged reagent mtset, or the negatively charged analogue mtses, produced reactivity indistinguishable from the wild type, even with sustained (protocol ii) depolarization (fig . B indicates that after 3 min of depolarization - induced mtsea modification, the fractional reduction in peak ina (relative to pre - mtsea) after an additional 20 min of dtt exposure is reduced to 49 5% (p <0.005 versus the 73% pre - dtt value), indicating the ina reduction associated with mtsea exposure results from formation of a reducible disulfide bond . The prolonged time (20 min) required for only partial dtt reversal suggests the reducing agent accesses the disulfide bond with some difficulty, perhaps through a hydrophobic pathway . We could not achieve reversal using glutathione, a larger, more hydrophilic, and generally less reactive reducing agent (fig . 2) suggest that although depolarization increases the accessibility of the f1236c side chain (allowing enhanced modification by mtsea), the residue still lies at a relatively inaccessible position in the outer pore, limiting the effects of the larger sulfhydryl modification compounds or reducing agents . The rate of f1236c ina decay during the depolarizing pulse did not differ from wild type (fig . 2 a), suggesting the mutant had no marked effect on the fast inactivation gating process . To examine the kinetics of slow inactivation, wild - type and f1236c peak ina were measured after prepulses of incremental duration (fig . Each pair of depolarizations was separated by a brief, 20-ms hyperpolarization that allowed channels to recover fully from fast, but not slow, inactivation . Wild - type and f1236c slow inactivation were described by biexponential functions with similar time constants (parameters given in legend), corresponding to intermediate (i m, 30 ms) and slower (is, 2 s) kinetic components of slow inactivation described in previous studies of 1 expressed in xenopus oocytes (kambouris et al . 1999). However, the rate of slow inactivation increased in wild - type channels as the membrane potential increased from 20 to + 20 mv (fig . 3 a) because of an increase in the amplitude of the i m component (from 0.2 to 8%) and a shorter is time constant (2, from 2,519 to 1,255 ms; see fig . 3 legend). Conversely, the rate of development of slow inactivation in f1236c was similar at 20 mv and + 20 mv (fig hence, consistent with previous evidence that p - segment substitutions alter slow inactivation gating processes in na channels (balser et al . 1996a; todt et al . 1999), the f1236c mutation did modify (increase) the propensity of the na channels to slow inactivate . A meaningful analysis of the depolarization - dependent rate of mtsea modification of the f1236c side chain must recognize the distinctive kinetic features of slow inactivation, including the biexponential characteristics noted in fig . 3 . Therefore, we used parameters derived from the kinetic analysis of f1236c slow inactivation (20 mv; fig . 3 legend) to select depolarization pulse widths that would maximize the intermediate and slow kinetic components, i m (100 ms; 3 m) and is (6 s; 3 s). In addition, a brief, 5-ms pulse width was used to examine depolarization - induced mtsea modification in the complete absence of slow inactivation (fig . Notably, while the pulse widths are selected to bias the channel toward distinct kinetic components of slow inactivation, caution is needed when relating these components to occupancy of individual gated states . The inactivated state dwell - times depend on many factors, including the detailed connectivity of the kinetic states involved . 4 (a and b) shows the time - dependent reduction of ina due to mtsea modification during trains of either 5- or 100-ms pulses (20 mv). In all experiments, mtsea was allowed to equilibrate in the bath for at least 1 min before application of the first depolarization pulse . For these studies, 2) to minimize tonic, depolarization - independent modification; as such, the reduction in ina during the first pulse after mtsea addition was consistently 5% (fig . 4, currents are plotted from every hundredth pulse (a) or every fifth pulse (b), and the currents shown in the two panels are aligned to reflect matching cumulative depolarization time . A comparison of a and b in fig . 4 reveals that extending the depolarization duration from 5 to 100 ms markedly reduced the rate of modification . The time - dependent reduction in ina, due to mtsea modification for a number of cells, as a function of matching (cumulative) depolarization time, allowing direct visual comparison of the mtsea modification rates for the three pulse widths (5 ms, 100 ms, and 6 s). The repolarization intervals between pulses (200 ms, 4 s, and 240 s, respectively) were sufficiently long to prevent cumulative reduction in the current because of slow inactivation, and also were chosen such that the cumulative depolarization time increased as a function of total experimental time at the same rate for all three pulse widths . At the 6-s pulse width, the total (18 s) depolarization period was generated by only three pulses (fig . In contrast to the 100-ms pulse train, channels transiently occupy the i m component, but spend a much higher percentage of their total depolarized time in the is kinetic component . Nonetheless, the rate of depolarization - dependent mtsea modification is still reduced compared with the brief, 5-s depolarizations (fig . 4 c), indicating that pulses recruiting is (like i m) 4 c were fitted to an exponential function (solid line) to determine reaction rates (kon; fig . 4 d, see legend) for each depolarization pulse width; increasing the pulse width to either 100 ms or 6 s significantly reduced kon . Fig . 4 d also indicates that the effects of pulse width (5 and 100 ms) were insensitive to changing the depolarization voltage from 20 to + 20 mv, which is consistent with the similar rate of slow inactivation for f1236c (in contrast to wild type) at these two membrane potentials (fig . The rate of mtsea modification changes with the depolarization pulse width; the extent of modification also appears to change . Incomplete elimination of the current could partly result from residual current flow through mtsea - modified channels . Even under conditions where slow inactivation is prevented (i.e., brief 5-ms pulses), the rate of depolarization - dependent modification is still 100-fold slower than in previous studies examining mts modification of freely accessible cysteinyl groups (i.e., iii 1996; vedantham and cannon 1998), which is consistent with restricted access of mtsea to the 1236c intrapore cysteinyl . Given the even slower rate of mtsea modification at the longer pulse widths, we may speculate that a slow, competing side reaction may gradually oxidize the 1236 cysteine (while the channel remains na permeable), as proposed in previous studies of intrapore cysteine disulfide formation (benitah et al . Moreover, the modification rate, with long pulses at a low mtsea concentration (25 m, fig . 4 c), is quite slow (relative to the practical limitations on experimental time), making it difficult to determine precisely when modification saturates . Hence, the modification rates for 100-ms and 6-s pulses may be even slower than estimated from the fitting procedure . We next considered whether accessibility of f1236c to sulfhydryl modification was modified by use - dependent lidocaine block . Since the f1236c mutation alone modifies slow inactivation under control conditions (fig . 3), we first established whether lidocaine would induce significant depolarization - dependent ina suppression in this mutant . 5 a) reduced ina availability mainly by increasing the amplitude of an intermediate (= 68 ms) kinetic component (see fig . Hence, the mutant channel retains use - dependent lidocaine sensitivity typical for skeletal muscle na channels expressed in hek cells (wang et al . 1996). To determine whether the effects of lidocaine on use - dependent loss of ina availability could be linked to a structural change in the outer pore, we examined voltage - dependent mtsea modification during lidocaine exposure . B shows the rate of mtsea modification induced by 100- ms depolarizing pulses to 20 mv during mtsea exposure, alone and with lidocaine superfusion . For these experiments, we raised the mtsea concentration from 25 to 50 m to allow significant modification of the cysteinyl side chain using a 100-ms pulse width in lidocaine - free conditions (note, for comparison, only minimal modification using a 100-ms pulse width in fig . Notably, in lidocaine - free solutions, the rate of mtsea modification (kon, 10 ms) using 100-ms pulses (fig . 5 b, 4.4 0.6) was slower than with 5-ms pulses (fig . 5 c, 9.6 1.4, p = 0.004 vs. 100-ms pulses) even though the mtsea concentration was raised in fig 4, indicating a slower rate of depolarization - dependent modification when the pulse duration is lengthened . The data also reveal a marked reduction in mtsea modification with lidocaine exposure; in fig . 5 b (100-ms pulse width), kon in lidocaine was as decreased to 0.7 0.3 (p = 0.0002). In contrast, lidocaine exposure had no effect on the rate of mtsea modification when a brief pulse width was used (fig . Hence, the protection from sulfhydryl modification afforded by lidocaine is use - dependent and requires a sustained depolarization . This pulse width sensitivity suggests the observed lidocaine effect on mtsea modification was not a nonspecific, gating - unrelated antagonism between the local anesthetic the mts reagent . Based on evidence that enzymes (cahalan 1978; yeh 1978) and mutations (bennett et al . 1995; balser et al . 1996b) that remove fast inactivation also attenuate use - dependent suppression of ina by lidocaine and other na channel blockers, a high affinity interaction between lidocaine and the fast - inactivated state has been a candidate structural motif for the sustained inactivation induced by these compounds . However, a recent study suggests that amino acid residues critically involved in fast inactivation (west et al . 1992) are not trapped in the fast - inactivated conformational state by lidocaine (vedantham and cannon 1999), raising the possibility that this conformational state may not form a high affinity drug receptor as previously proposed . P - segment mutations that reduce an intermediate kinetic component of slow inactivation (termed i m) also attenuate use - dependent lidocaine block (kambouris et al . 1998), as do cation substitutions that inhibit this component of slow inactivation (zilberter et al . 1991 although these and earlier studies (khodorov et al . 1976) postulated a linkage between slow inactivation gating and a use - dependent local anesthetic block, unambiguous interpretation of these data has not been possible because the interventions themselves (mutations and cation substitutions) could alter drug binding through gating - independent mechanisms (hille 1992). Here, we show that slow inactivation alters the accessibility of an outer pore cysteine to sulfhydryl modification (fig . 3 and fig . 4). Moreover, lidocaine attenuates mtsea modification of the same cysteine when exposed to sustained (100 ms) depolarizations (fig . 5 b), but not brief, 5-ms depolarizations (fig . 5 c), suggesting the lidocaine effect to suppress mtsea modification is specifically linked to gated state(s) associated with sustained depolarization . The findings suggest that the use - dependent lidocaine block and slow inactivation share a common, outer pore structural rearrangement that reduces mts accessibility . These results do not resolve whether the impeded sulfhydryl modification rate during slow inactivation results from movement of the domain iii p - segment to a less accessible position, or rather from movement of other pore structures into positions that somehow protect the f1236c side chain from mtsea . Nonetheless, a conceptual model based upon recent studies of the na channel pore demonstrating exceptional mobility of the p - segments (benitah et al . 6 . Whereas the 1236 cysteine side chain is largely inaccessible in the hyperpolarized channel (fig . 6, left), upon depolarization, we postulate that the p - segments assume positions that increase mtsea accessibility of the cysteine residue . As the depolarization is prolonged, the accessibility of the 1236c residue is once again compromised (fig . 6, right, kb <ka), which is consistent with our results (fig . Na channel gating during sustained depolarization (i.e., slow inactivation) might involve a constriction of the outer pore, analogous to that envisioned for c - type inactivation of potassium channels (baukrowitz and yellen 1996; liu et al . Our results show that pulse widths sufficient to recruit either the intermediate (i m) or slower (is) inactivated state kinetic components (fig . 3) are both effective in reducing depolarization - dependent modification (fig . 4c and fig . D), which is consistent with studies linking the p - segments to slow - inactivated states spanning a wide kinetic range (kambouris et al . 1998; todt et al . 1999; vilin et al . 1999). Nonetheless, the marked reduction in mtsea modification at the 100-ms pulse width is substantial, given the relatively small amplitude of intermediate (i m) inactivation developing by 100 ms (fig . We speculate that a gating motion involving the pore may develop with intermediate kinetics closely related to i m (recognizing 5-ms pulses do not inhibit modification, whereas 100-ms pulses do), which reduces 1236c accessibility but does not suppress na permeation (or else, recovers more rapidly than 20 ms upon hyperpolarization and, therefore, is not visible in fig . The 1236 cysteine side chain is accessible only to modification from outside the cell (yamagishi et al . 1997), while lidocaine binds to a site in the aqueous pore on the cytoplasmic side (ragsdale et al . 1) of the skeletal muscle na channel act as electrostatic barriers, preventing extracellular access and escape of the local anesthetic (sunami et al . Although mutations in the na channel domain iv - s6 segment may create an extracellular access pathway for charged lidocaine derivatives (ragsdale et al . 1995), we find that the p - segment f1236c mutation does not make the skeletal muscle na channel sensitive to extracellular qx-314 (1 mm, n = 4, data not shown). Hence, it is unlikely that lidocaine directly inhibits extracellular mtsea modification of the cysteine residue . At the same time, electrostatic interactions between residue k1237 in domain iii (fig . 1) and lidocaine suggest that drug receptor in domain iv, s6 lies near the p - segment selectivity filter residues (sunami et al . 6, right) we postulate that the structural rearrangements associated with slow inactivation may move the na channel p - segments into positions that stabilize the interaction between lidocaine and the pore.
The patient was a 33-year - old, 156 cm, and 62.5 kg primipara on the sixth day of the 40th week of pregnancy, and she was hospitalized on the day before the operation for vaginal delivery . The patient had not undergone any specific disease or operation according to her history, and the vital signs were normal at the time of hospitalization . The results of the blood test and urinalysis performed one month before the hospitalization were all normal . There was no cardiomegaly and abnormal finding in the pulmonary parenchyma by the chest radiography, and the electrocardiography results were all normal . The fetal heart rate measured at the time of hospitalization was 154 bpm, and the fetus showed normal reactivity . Although induced labor was carried out by injecting oxytocin during the afternoon on the day of hospitalization, the fetal heart rate was reduced, and thus, the oxytocin injection was stopped . Then, the fetal heart rate returned to normality and natural labor began . When oxytocin was injected again on the day of the operation, the fetal heart rate was reduced . Since meconium staining was found following the amniotic membrane rupture, an emergent cesarean section was decided . The vital signs that were measured by the electrocardiography, pulse oximetry, and the automated blood pressure device at the operation room were 150 mmhg of systolic blood pressure, 100 mmhg of diastolic blood pressure, 90 of heart rate, and 94% of oxygen saturation . Because there was no specific finding by the inquiry and auscultation, the low oxygen saturation was considered as an error by the low body temperature since the hands and feet of the parturient woman were cold . Spinal anesthesia was decided because a little dry cough was found . After having the parturient woman take the right lateral decubitus position, 0.5% hyperbaric bupivacaine 10 mg mixed with fentanyl 20 ug was injected with a 26 g spinal needle between the l3 and l4 spines . The cold sense check was performed with an alcohol swab to verify the sensory block level to the fourth thoracic spinal segment . Five minutes after the spinal anesthesia, blood pressure was decreased to 90/50 mmhg, and the pulse oxygen saturation to 88% . The parturient woman complained of severe dyspnea and a continued cough and a large amount of sputum mixed with pink bubbles were observed . After ephedrine was immediately injected 3 times, 8 mg each, the blood pressure was recovered to 110/80 mmhg, the heart rate to 90/min, and the oxygen saturation to 92%, and then the operation was initiated . The results of the arterial blood gas study at that moment were ph 7.39, oxygen partial pressure (pao2) 77.7 mmhg, carbon dioxide partial pressure (paco2) 34.5 mmhg, and oxygen saturation 95% . Just after the start of the operation, the spontaneous breathing seemed no longer impossible due to the severe dyspnea and excessive airway secretion . Thus, after injecting propofol 60 mg and succunycholine 70 mg, endotracheal intubation was carried out with the endotracheal tube of the inner diameter 7.0 mm . After the endotracheal intubation, a large amount of pink discharge was continuously aspirated through the tube to the extent that it blocked the tube, and the oxygen saturation of the patient was decreased down to 70% . After the fetus was delivered, the blood pressure was decreased to 60/40 mmhg, the oxygen saturation to 65%, and the heart rate to 60/min . Although dobutamine and norepinephrine were injected since heart failure was suspected, pulseless electrical activity (pea) was found and the operation was suspended temporarily to carry out cardiopulmonary resuscitation . After the injection of epinephrine 1 mg and atropine 0.5 mg with continued thoracic compression, the sinus rhythm was recovered and the vital signs were increased to the blood pressure of 150/80 mmhg, oxygen saturation of 95%, and heart rate of 120/min . With the continuous intravenous injection of norepinephrine, as well as dopamine and dobutamine, a central vein catheter was inserted through the right internal jugular vein and an arterial catheter through the left femoral artery . Although the operation was then resumed, a severe hemorrhage was found and the blood pressure was reduced to 60/40 mmhg and the oxygen saturation to 80% at the end of the operation . The results of the arterial blood gas study at that moment were ph 7.154, pao2 63.5 mmhg, paco2 57.5 mmhg, bicarbonate 19.8 mmol / l, and oxygen saturation 85.1%, which indicated a serious respiratory and metabolic acidosis and hypoxia . Bicarbonate was injected to correct the acidosis and the 50% dextrose in water (d / w) solution to which cacl2 600 mg and insulin were added was also injected . Since the possibility of hemorrhage by coagulation disorder, not the surgical hemorrhage, could not be excluded, the packed red blood cells and the fresh frozen plasma were transfused, too . Although the blood test related with disseminated intravascular coagulation (dic) was carried out during the operation (bleeding time, prothrombin time, activated prothromin time, antithrombin iii, fibrinogen, d - dimer, and fibrinogen degradation product), the results could not be obtained because of coagulation of the blood sample . Even after the finish of the operation, the low blood pressure was maintained and the patient returned to the pea state . Cardiopulmonary resuscitation was performed and epinephrine 1 mg and atropine 0.5 mg were injected 2 times for each . After the patient was recovered to the sinus rhythm, she was moved to the intensive care unit . The total operation duration was 1 hour; the urination was 150 ml; the blood loss was 1,500 ml; the injected fluid was 1,850 ml; and the transfused blood was 1,250 ml . More than 3,000 ml of secretion was discharged through the endotracheal tube and it spouted out continuously even in the intensive care unit . However, the blood pressure was dropped to 53/30 - 40/20 mmhg, the heart rate to 20 - 30/min, and the oxygen saturation to 50 - 60% . The complete heart failure was continued as the patient's status did not become any better, and the patient showed no response to the medications . Though the cardiac compression was continually carried out, the patient died after 3 hours . The autopsy was performed by the national institute of scientific investigation and the cause of death was proved to be amniotic fluid embolism . Amniotic fluid embolism is a fatal syndrome that takes place during pregnancy or during or after delivery . Amniotic fluid embolism was firstly described in 1926, and it was recognized as a syndrome by steiner and lushburgh as fetal debris were found within the pulmonary blood vessels of the parturient women who died during labor by similar clinical characteristics . Although it was reported that the incident rate was 1 out of 8,000 - 15,200 live births and the mortality was in the range of 61 - 86%, the mortality was decreased to 13.3 - 44.0% according to a recent study . It is thought that this trend may be because the diagnosis and treatment have been advanced and only fatal cases were reported selectively . Amniotic fluid embolism holds 5 - 15% of the overall causes of maternity deaths, and it leaves permanent neurological damage to 61% of the parturient women and 50% of the newborn children . Many have been known as the risk factors of amniotic fluid embolism, but parturient women over the age of 35, cesarean section, forceps and fetal suction, placenta previa, abruptio placentae, eclampsia, and fetal distress syndrome were verified as the risk factors by a large scale research that was carried out recently although the correlation among them has not been understood clearly . The major clinical characteristics include cardiovascular collapse accompanied by severe hypotension and arrhythmia, cyanosis, respiratory distress, pulmonary edema or acute respiratory failure syndrome, respiratory arrest, consciousness fluctuation, and massive hemorrhage by dic . Among these, the major causes of maternal death are cardiac arrest, massive hemorrhage by dic, acute respiratory failure syndrome, and multiple organs dysfunction . According to the report by lewis, 11 of the 17 parturient women who had experienced amniotic fluid embolism complained of prodromal symptoms such as dyspnea, chest pain, chilliness, restlessness, the feeling of being pierced by a pin, nausea and vomiting . The time interval between the observations of these symptoms to the women's collapse varied, ranging from several minutes to 4 hours . In this case report, even though the parturient woman showed the symptom of dry coughing from the morning of the operation day onwards, it was not very severe and no other specific symptom was observed . The causes of the prophase hypoxia, which is the most representative clinical characteristic of amniotic fluid embolism, are severe ventilation - perfusion mismatch by pulmonary vasoconstriction and bronchospasm, and those of the anaphase hypoxia include pulmonary edema by left ventricular failure and nonpsychogenic pulmonary edema that is related to the increase of the capillary permeability . The parturient woman in this case report showed an oxygen saturation of 94% at the time of entering the operation room, which might have been the indication of hypoxia that occurred already, rather than the error by hypothermia . In addition, from the chest radiograph taken in the operation room after the fetus was delivered (fig . 1), severe pulmonary edema at both lungs and normal central venous pressure were found, though the pulmonary arterial pressure was not measured . Thus, it is assumed that the hypoxia might have been caused by pulmonary edema due to the left ventricular failure or the increase of the pulmonary capillary permeability, rather than by the pulmonary vasoconstriction at the initial stage . Right ventricular failure can take place at the initial stage by the pulmonary vasoconstriction and pulmonary hypertension due to the secretion of endogenous mediators, which was proved in a number of reports . Reported that acute right ventricular failure accompanied by severe pulmonary hypertension, left deviation of the atrial, and ventricular septum was found from the transesophageal echocardiography performed within 30 minutes after the occurrence of amniotic fluid embolism . A large amount of ascites was also found after the laparotomy in our case, which is thought to be the secondary result of the right ventricular failure . As the operation moved on to the anaphase, the pulmonary hypertension did not continue, but it was shifted to left ventricular failure, which might have been caused mainly by the decreased filling of the left ventricle following the enlargement of the right ventricular enlargement . Other causes of myocardial failure that are known include myocardial ischemia due to hypoxia, decreased blood flow in coronary artery due to decreased cardiac output, and direct myocardial depression by the substances in amniotic fluid such as endothelin . The blood pressure of the parturient woman in our report was decreased after the spinal anesthesia, which could have resulted from the high level of sensory block to the t4 spine, but it could be probably because of the decrease of the general vascular resistance following the left ventricular failure . Dic is also one of the factors that can cause hypovolemic shock, and it is found in 50% of the parturient women with amniotic fluid embolism . The mechanism of dic is not clear, but it is known by a previous animal experiment that amniotic fluid is related to the thromboplastin - like effect, platelet aggregation, and the activation of complement reaction . In addition, lockwood et al . Discovered a large amount of tissue factors in amniotic fluid and explained the triggering of blood coagulation and consumptive coagulopathy caused by the activation of extrinsic pathway and factor x. dic, which is clinically characterized by continuous blood loss, can take place in any stage of amniotic fluid embolism, from the initial stage to the terminal stage . In this case report, the heart was temporarily recovered by the cardiopulmonary resuscitation after the cardiac arrest, but the prognosis could become worse as hypovolemic shock took place due to the dic afterward . In conclusion, the main causes of the maternal death of the parturient woman are thought to be the hypotension by the combined effect of the left ventricular failure, the decrease of the general vascular resistance due to the spinal anesthesia and continued blood loss by dic, and pulmonary failure by the severe pulmonary edema . The pathway of amniotic fluid influx to the maternal circulatory system includes the uterine cervical vein, damaged uterine site, and placental site . In early studies, pulmonary vascular occlusion was considered as the main etiology of amniotic fluid embolism, but various clinical characteristics of amniotic fluid embolism were hardly explained by the mechanism and it was not verified by animal experiment, implying that there might be another mechanism rather than the mechanical occlusion . Now, the secretion of primary or secondary endogenous mediators following the amniotic fluid inflow to the maternal circulatory system is considered as the major etiology of amniotic fluid embolism based on several reports . The known mediators include histamine, bradykinin, endothelin, leukotriene, and arachidonic acid metabolites . These immunological factors can be supported by the fact that amniotic fluid embolism is found more frequently among the parturient women who have conceived a male fetus and with the history of drug allergy . In other words, amniotic fluid embolism can be strongly suspected in a pregnant woman or a puerperal woman, immediately after the delivery, with cardiovascular collapse as well as respiratory failure, dic, and convulsion, excluding anaphylaxis, septisemia, pulmonary embolism, myocardial infarction, perinatal cardiomyopathy, and hemorrhagic shock (atony, uterine rupture, and abruptio placentae). Although in many studies amniotic fluid tissue was found in the blood aspirated at the terminal of the pulmonary artery catheter installed in parturient women who were diagnosed as having amniotic fluid embolism, the amniotic fluid tissue was found in only about 50% of the parturient women in the study of clark et al ., as well as in other studies . Moreover, the component of amniotic fluid is also found among the women who do not have amniotic fluid embolism or the women who are not pregnant . Hence, that a component of amniotic fluid is found in a maternal circulatory system does not necessarily mean that amniotic fluid embolism has occurred . However, the probability of amniotic fluid embolism is increased in the case where there are the clinical characteristics that suggest amniotic fluid embolism . Also, in the parturient woman in this case, the diagnosability was increased since a great amount of amniotic fluid component was found in the pulmonary blood vessels, as well as the clinical characteristics of amniotic fluid embolism . Beside this, another known method of amniotic fluid embolism diagnosis is to measure zinc coproporphrin, sialyl tn antigen, tryptase, and complement factors in the peripheral blood of a parturient woman, but more research is required for it . The treatment is performed symptomatically depending on the symptoms of the patient and the basic direction of the treatment is maintenance of the appropriate oxygenation level and blood pressure, and correction of the coagulopathy . Firstly, for the hypoxia, tracheal intubation should be immediately carried out and positive - pressure ventilation with oxygen of high concentration should be performed so as to maintain the oxygen saturation higher than 90% . For the hypotension and the shock, since an overdose of fluid can worsen the heart failure at this time, it is helpful to monitor by means of pulmonary catheter or electrocardiography . In the case of a serious hypotension which does not respond to a fluid treatment, vasopressors such as norepinephrine or cardiac inotropic agents such as dopamine, dobutamine, and milrinone can be used . When a large amount of hemorrhage occurs due to dic, packed red blood cells should be primarily transfused to supply oxygen to the tissue appropriately . Platelets, fresh frozen plasma, and cryoprecipitate also need to be transfused . Among them, cryoprecipitate has been known to help the patient to recover the cardiopulmonary and hematological state rapidly by enhancing the removal of antigenic and toxic substances such as amniotic fluid since it contains fibronectin . When cardiopulmonary arrest takes places during the clinical course, cardiopulmonary resuscitation should be immediately carried out and cesarean section should be performed as early as possible in order to improve the prognosis of the parturient woman and the fetus . Since the gravid uterus represses the venous return by the aortocaval compression, quick delivery of the fetus makes the cardiopulmonary resuscitation more effective . In addition to these, other treatments are available including aprotinin, serine proteinase inhibitor, cardiopulmonary bypass, pulmonary embolectomy, hemofiltration, and inhalation of nitric oxide gas, etc . Recently, a case where extracorporeal membrane oxygenation showed a good result in a parturient woman with amniotic fluid embolism who had a cardiac arrest was reported, and it was newly suggested as a treatment . In conclusion, as experienced in this case, amniotic fluid embolism is rare, but it is a rapidly developing, fatal disease . However, this disease is hard to diagnose in its onset, and the treatment is still difficult . Thus, a prompt and positive treatment should be carried out if there is a parturient woman in whom a sudden cardiopulmonary collapse, respiratory failure, and hemorrhage are found . Particularly when cardiac arrest takes place, cardiopulmonary resuscitation should be carried out immediately and the fetus should be delivered at the same time in order to improve the prognosis of the parturient woman and the fetus . It must be noted that even after the parturient woman has recovered from the cardiac arrest, neurologic damage caused by hypoxia can still take place.
Since the international symptomatic aneurysm trial was published, endovascular treatment of intracranial aneurysms has become the first treatment option in many centers.17) recent advances in endovascular techniques and devices such as stent - assisted coiling, balloon remodeling, neck bridges, waffle cones, and so on have allowed treatment of more challenging aneurysms, such as wide - necked or complex aneurysms.13)16)18)20) however, wide - necked intracranial aneurysms in arterial bifurcations that are treated by single stent still remain challenging owing to the difficulty in holding the coils inside the aneurysm sac and the high risk of recanalization.9)10) a double - stent technique in the y configuration was first introduced by chow et al . In 2004.8) since then, many reports have demonstrated low morbidity and mortality rates associated with y - stenting.11)30) these reports dealt with open - open or open - closed stent combinations.11)28) herein, we report the efficacy and safety of y configuration stent - assisted coiling with closed - closed stents for wide - necked intracranial aneurysms located at arterial bifurcations . We also perform a literature review . Three centers provided retrospective data for all consecutive patients with intracranial aneurysms treated with y configuration - assisted stents using close - cell stents (enterprise, codman, raynham, ma, usa). A retrospective chart review was conducted for all patients who underwent endovascular treatment of aneurysms with y configuration - assisted stents in three centers from august 2011 to march 2014 . Patients for whom preprocedural evaluation was done using a stent - assisted coiling technique in the y - stent configuration were included . Patients for whom an open - cell type stent was used for preprocedural evaluation were excluded from the analysis . All aneurysms were wide - necked and located in an arterial bifurcation of basilar artery, anterior communicating artery or pericallosal artery . Aneurysms were classified as small (2 - 6 mm), medium (7 - 12 mm), large (13 - 24 mm), and giant (25 mm). Wide - necked aneurysms were defined as having a large neck (> 4 mm) and/or a dome - to - neck ratio of <2 . Patients with unruptured aneurysms were treated with a daily dual antiplatelet drug regimen consisting of clopidogel (75 mg) and aspirin (100 mg) for at least 5 days . Platelet - aggregation inhibition was tested in all patients with unruptured aneurysms (verifynow p2y12 assay) one day before the procedure . Further loading doses of aspirin and/or clopidogrel were administrated when necessary . During the procedure, a bolus injection of 3,000 iu heparin was given and a further 1,000 iu of heparin was administered per hour . Anticoagulation levels were monitored to maintain an activated clotting time 2 - 3 times of the baseline value . Patients with acutely ruptured aneurysms were treated with intravenous tirofiban soon after stents were deployed without heparinization . Coiling was performed before and after delivery of stents . For the y - stent configuration technique, a 6f or 7f guiding catheter was first navigated into the distal internal carotid artery for anterior circulation aneurysms or the distal vertebral artery for posterior circulation aneurysms . After angiographic images were acquired in the anteroposterior, lateral, working, and 3d rotational views, the sequence of stent placement was determined . Before deployment of the first stent, an enterprise transport microcatheter (prowler select plus, codman, miami lakes, fl, usa) was placed at the aneurysm neck and the distal tip of the transport microcatheter was placed in the efferent artery . After positioning, the enterprise stent was slowly inserted through the transport microcatheter . The second stent was navigated through the stent cell of the first stent into the contralateral branch vessel and proximal half while overlapping with the first stent . In case of need to flow diversion, stents was deployed in a parallel fashion from each other distal artery to the proximal artery, forming a kissing y configuration . The degree of aneurysmal occlusion was assessed using the raymond scale,21) and was classified into complete occlusion, residual neck, and residual aneurysm . Clinical outcomes were assessed before operation, at discharge, and at the last follow - up visit using the glasgow outcome scale (gos). Angiographic images were obtained in the anteroposterior, lateral, and working projections before treatment and immediately after treatment . The imaging follow - up modalities used were conventional angiography and magnetic resonance (mr) angiography . The raymond scale (total occlusion, residual neck, and residual aneurysm) was used to assess the results of the procedure . A retrospective chart review was conducted for all patients who underwent endovascular treatment of aneurysms with y configuration - assisted stents in three centers from august 2011 to march 2014 . Patients for whom preprocedural evaluation was done using a stent - assisted coiling technique in the y - stent configuration were included . Patients for whom an open - cell type stent was used for preprocedural evaluation were excluded from the analysis . All aneurysms were wide - necked and located in an arterial bifurcation of basilar artery, anterior communicating artery or pericallosal artery . Aneurysms were classified as small (2 - 6 mm), medium (7 - 12 mm), large (13 - 24 mm), and giant (25 mm). Wide - necked aneurysms were defined as having a large neck (> 4 mm) and/or a dome - to - neck ratio of <2 . Patients with unruptured aneurysms were treated with a daily dual antiplatelet drug regimen consisting of clopidogel (75 mg) and aspirin (100 mg) for at least 5 days . Platelet - aggregation inhibition was tested in all patients with unruptured aneurysms (verifynow p2y12 assay) one day before the procedure . Further loading doses of aspirin and/or clopidogrel were administrated when necessary . During the procedure, a bolus injection of 3,000 iu heparin was given and a further 1,000 iu of heparin was administered per hour . Anticoagulation levels were monitored to maintain an activated clotting time 2 - 3 times of the baseline value . Patients with acutely ruptured aneurysms were treated with intravenous tirofiban soon after stents were deployed without heparinization . Coiling was performed before and after delivery of stents . For the y - stent configuration technique, a 6f or 7f guiding catheter was first navigated into the distal internal carotid artery for anterior circulation aneurysms or the distal vertebral artery for posterior circulation aneurysms . After angiographic images were acquired in the anteroposterior, lateral, working, and 3d rotational views, the sequence of stent placement was determined . Before deployment of the first stent, an enterprise transport microcatheter (prowler select plus, codman, miami lakes, fl, usa) was placed at the aneurysm neck and the distal tip of the transport microcatheter was placed in the efferent artery . After positioning, the enterprise stent was slowly inserted through the transport microcatheter . The second stent was navigated through the stent cell of the first stent into the contralateral branch vessel and proximal half while overlapping with the first stent . In case of need to flow diversion, stents was deployed in a parallel fashion from each other distal artery to the proximal artery, forming a kissing y configuration . The degree of aneurysmal occlusion was assessed using the raymond scale,21) and was classified into complete occlusion, residual neck, and residual aneurysm . Clinical outcomes were assessed before operation, at discharge, and at the last follow - up visit using the glasgow outcome scale (gos). Angiographic images were obtained in the anteroposterior, lateral, and working projections before treatment and immediately after treatment . The imaging follow - up modalities used were conventional angiography and magnetic resonance (mr) angiography . The raymond scale (total occlusion, residual neck, and residual aneurysm) was used to assess the results of the procedure . A total of 10 patients underwent treatment with closed cell type y configuration stents for 10 wide - necked bifurcation cerebral aneurysms at the three participating centers from 2011 to 2014 . The patients included 6 females and 4 males with a mean age of 58.6 years (range, 41 - 77 years). All aneurysms were wide - necked at a bifurcation, including 5 aneurysms located at the basilar artery bifurcation, 4 aneurysms in the anterior communicating artery, and 1 aneurysm in the pericallosal artery (fig . 1). Of the 10 aneurysms (mean 9.7 mm, range 5 - 12 mm), one was large, six were medium, and the remaining 3 were small in size . All aneurysms had a dome - to - neck ratio of <1.5 (mean ratio, 0.89, range: 0.65 - 1.13). A 45-year - old female was admitted for endovascular treatment of an unruptured aneurysm located in the anterior communicating artery . The aneurysm was incidentally found on mr angiography performed for dizziness . On conventional angiography, the aneurysm was wide - necked (11.3 mm in size) with a 1.12 dome - to - neck ratio . The microcatheter (excelsior sl-10, stryker, fremont, ca, usa) was inserted into the aneurysm sac with a microwire (synchro-14, stryker, fremont, ca, usa). After the first coil was inserted into the aneurysm, deployment of closed - cell stent was done from left a2 to left a1 . The in - stent thrombosis was completely resolved with intra - arterial infusion of 100,000 iu urokinase and 200 mcg tirofiban . The transport microcatheter was navigated into the other distal a2 segment through the stent cell of the initial stent . Coiling was completed and occlusion was satisfactory . However, the patient experienced mental deterioration the next day . We found recurrent in - stent thrombus formation in the same area and performed thrombolysis . Infarctions in the bilateral fornix and corpus callosum genu body were evident on magnetic resonance angiography . Successful y - configuration stent - assisted coil embolization was achieved for all 10 aneurysms . One aneurysm of basilar apex was performed by kissing y configuration, because it needed to flow diversion . An immediate posttreatment angiogram showed complete occlusion in 1 aneurysm and a residual neck in 9 aneurysms . In the follow - up period, follow - up results of the 10 aneurysms showed 8 complete occlusions and 2 residual necks . Post - operative follow - up angiograms were obtained at a mean of 17.10 months . Overall, the 9 patients had a gos score of 5 and only one patient at discharge . No delayed complications were found at follow - up (mean, 20.20 months, range: 13 - 43 months). Advances in endovascular techniques have allowed more challenging aneurysms to be treated with coil embolization . The advent of self - expanding stents has greatly improved the ability to treat intracranial aneurysms . Additionally, stent - assisted coil embolization has allowed increased packing density with enhanced endothelialization.5) despite the introduction of a variety of techniques, such as balloon remodeling,3) the waffle - cone technique,13) and so on, wide - necked and complex aneurysms are still challenging even when a single stent is deployed . In 2004, chow et al.8) first described double open - cell neuroform (boston scientific, fremont, ca, usa) stents in a y configuration . Because an open - cell stent can allow for easier passing of the other stent, y the transport microcatheters of enterprise stents are more flexible and navigable than are neuroform stents.29) therefore, we used enterprise stents in the current study . The y configuration stent - assisted technique was originally used in the peripheral vasculature to treat bifurcations.26) this technique was applied to treat intracranial aneurysms . Y configuration stent - assisted technique using two open cell - type stents was first performed because open cell - type stents allow for relatively easy passage through the stent cells of the deployed stent . However, open cell stents may cause migration of the initial stent during deployment of the second stent.15) in our cases, y - configuration stent - assisted coil embolization was performed using closed cell - type stents in all cases without any technical difficulties . The problem that we encountered involved navigation of the microcatheter in the acutely angled branch for deployment of the first stent . When it was difficult to pass the acutely angled branch, we accessed the distal artery with an sl-10 microcatheter (excelsior sl-10, stryker, fremont, ca, usa) and changed the transport microcatheter . They reduce the risk of stent migration during the passage of the microcatheter for deployment of the second stent . Y - configuration stent - assisted coil embolization using two closed - type stents is technically feasible . Several concerns about the use of two closed cell - type y stents were raised . First, the closed cell - type stent is technically more difficult to navigate through stent cells than open cell - type stent . However, other reports have demonstrated a success rate of approximately 100%, except in 1 case.1)7)23) in our study, all cases of y - stenting were successful completed . Second, the y - stent technique using double closed cell stents may cause narrowing of the second stent because of the small stent cells of the initial stent . Reported an incidence of in - stent stenosis in y - stent - assisted coiling in a large multicenter retrospective study.11) in - stent stenosis <50% was seen in 5 of 30 (17%) patients upon angiographic follow - up . However, none of those patients required treatment for stenosis.11) there was no case of in - stent stenosis treated with closed cell - type stents . In addition, the percentage of delayed thromboembolic events was only 3.1%.11) in our study, in - stent stenosis or delayed complications at follow - up were not found . Only one case of in - stent thrombus formation was experienced during the procedure . The most important advantage of y configuration stent - assisted coiling is that it can prevent coil prolapse and occlusion of a branching artery by allowing for adequate vascular reconstruction of the parent artery and distal branch artery . Use of a single stent carries a risk of occlusion branch artery and coil prolapse at arterial bifurcations . The other advantage of y configuration stents is that they have an effect on flow diversion . Post - procedural hemodynamic alteration is likely to be an important factor in determining the long - term morbidity and mortality of endovascular intervention.4) in 2009, tateshima et al . Demonstrated significant alteration of flow direction, velocity, and pattern before and after stent placement in a silicone aneurysm model.27) in another in vitro study, rhee et al . Reported that stent placement can reduce the magnitude and pulsatility of the wall shear rate.22) y configuration stent placement reduces cross - neck flow in computational fluid dynamic simulations of wide - necked aneurysms and shear stresses inside the aneurysm sac by> 40% at the end of the cardiac cycle.2)6) in another in vitro study using a silicone block model of a bifurcation, k. kono and terada demonstrated that the cycle - averaged velocity and wall shear stress in an aneurysm are reduced by 48 - 54% when using closed cell - type y configuration stents.14) some procedures resulted in complete occlusion or a reduction in filling of aneurysms without additional coiling by using closed cell - type y configuration stents.7) in the current study, the initial immediate angiographic occlusion rate was 1 complete occlusion and 9 residual necks out of the 10 cases . Upon angiographic follow - up, we observed improvement in 7 aneurysms and stability of 2 aneurysms . Although 9 aneurysms displayed small residual filling upon initial treatment, 7 aneurysms were developed spontaneous thrombosis on angiographic follow - up . Reported similar results.25) spontaneous thrombosis in the aneurysmal sac could be due to the effect of flow diversion when using closed cell stents . A literature search revealed a recanalization rate of 14% after single stent - assisted coiling.24) with conventional coiling, the recanalization rate is reported to be 20% and 35.3% for wide - neck small aneurysms and large aneurysms, retrospectively.19) aneurysms with a neck width greater than 4 mm and a maximum diameter greater than 10 mm carry a three - fold higher risk of recurrence following treatment.12) yavuz et al . Reported that the recanalization rate was only 2.2% (4 recanalizations/186 follow - up aneurysms) in 193 aneurysms treated by y configuration stent - assisted coiling.30) in the current study, no recanalization occurred . . This result could be due to the fact that y configuration - assisted double stents using closed cell type stents may affect flow diversion . Y configuration stenting using double closed cell stent - assisted coiling is feasible and safe for selected patients in the management of complex wide - necked bifurcations . However, further study using this technique in a prospective study with a large population and a long follow - up period is merited.
Germ cell tumors (gcts) represent a well - recognized group of heterogeneous neoplasms with diverse clinical, histopathological, diagnostic, and prognostic characteristics . Being the most common solid tumor in the 3rd and 4th decades, gcts assume a particular significance among young adult males . Gonads are the most common primary site of gcts, although a very small proportion is extragonadal in origin . The most common site of the scarcer extragonadal gcts is the mediastinum, with retroperitoneum being the close runner - up . Immature teratomas, a subtype of gcts, are particularly rare in the mediastinum . In a review of 322 primary mediastinal gcts, only 6 immature teratoma cases were identified, which represented 1.8% of all mediastinal gcts and 4% of mediastinal teratomas . Even rarer is a gct with somatic malignant transformation, occurring in around 2% of all male gcts and in 10% to 20% of mediastinal teratomas . We report herein a case of an aggressive, chemotherapy - resistant immature teratoma harboring foci of sarcoma, melanoma, adenocarcinoma, and squamous cell carcinoma . A 21-year - old man was referred to our service from a local hospital for further management of a right hemithoracic extra - pleural mass with a provisional diagnosis of immature teratoma . The patient previously healthy presented to the referring hospital with a 3-week history of productive cough with blood - tinged sputum, right - sided intermittent pleuritic chest pain, and mild shortness of breath . He also experienced intermittent fever (38.5 c), nausea, vomiting, anorexia, and significant weight loss . His past medical, family, travel, contact, and occupational histories are unremarkable . Physical examination revealed a thin - built man with normal vital signs . Respiratory examination suggested a reduction of air entry on the right side with no rhonchi, wheezing, or crepitation . General, cardiac, abdominal, testicular, and lymph - node examinations were unremarkable . G / l, normal = 135180; mean corpuscular volume = 71 fl, normal = 7595; mean corpuscular hemoglobin = 23.3 pg, normal = 2430), mild leukocytosis (total leukocyte count = 12.49 10/l, normal = 3.911.0), thrombocytosis (platelets = 1061 10/l, normal = 155435), and an elevated lactate dehydrogenase (ldh) level (ldh = 567 u / l increased to 727 notably, -fetoprotein (afp) and cancer antigen 199 were elevated (afp = 9.13 g / l increased to 19.3 g / l in few weeks, normal <7; cancer antigen 199 = 38.5 u / ml, normal <27), while carcinoembryonic antigen and -human chorionic gonadotropin levels were within normal limits . A chest radiograph showed a large, well - defined substernal mass obscuring the right cardiac border . Contrast - enhanced computed tomography (ct) at presentation revealed a large (approximately 4 4 5 cm) noncalcified, heterogeneous mediastinal mass extending to the right upper lobe and pleura (fig . Several mediastinal and cardiophrenic lymph nodes were noted, with the largest measuring 1.2 cm in its widest diameter . No focal lesions in the liver, spleen, pancreas, adrenals, or kidneys were identified . Whole - body combined 18f - fluorodeoxyglucose positron emission tomography / computed tomography (fdg - pet / ct) showed an fdg - avid mediastinal mass with a single fdg - avid superior mediastinal lymph node (fig . (a, b) a contrast - enhanced computed tomography scan, using the mediastinal (a) and lung (b) windows, showing a mediastinal mass that is extending into the adjacent lung . (a, b) microscopic examination of needle core biopsy from the mediastinal mass showing predominant immature neuroectodermal elements forming glands and tubules lined by columnar embryonal cells with stratified hyperchromatic nuclei (a) and focal areas of a more mature neural tissue (b). A whole - body combined 18f - fluorodeoxyglucose (fdg) positron emission tomography / computed tomography scan showing an fdg - avid mediastinal mass with an intense peripheral hypermetabolic activity . Combination chemotherapy with bleomycin (30 units iv on days 1, 8, and 15), etoposide (100 mg / m iv on days 15), and cisplatin (20 mg / m iv on days 15) was subsequently initiated . However, notwithstanding the mild improvement initially, the patient showed steady symptomatic deterioration; after completing two 3-week chemotherapy cycles, he presented to the emergency room with chest pain, cough, and hemoptysis . Although no evidence of pulmonary embolism (pe) was found, the study showed an interval progression of the tumor size, reaching around 12 13 12 cm . The ill - bordered mass appeared to have invaded the lung parenchyma, superior vena cava, and pericardium (fig . 4a and b), while abutting on the carina, right main bronchus, right pulmonary artery, as well as the anterior, inferior, and superior pulmonary veins . (a, b) axial (a) and coronal (b) contrast - enhanced computed tomography scans obtained after receiving 2 chemotherapeutic cycles showing interval progression of size, reaching around 12 13 12 cm in its maximum dimensions . The case was thoroughly reviewed and discussed in a multidisciplinary team meeting, whose recommendation was to proceed with surgical resection . The patient underwent clamshell thoracotomy with an r0 resection of the mass along with the right middle and lower lung lobes . However, he presented 2 months later with extensive liver and bone metastasis, for which he received 1 cycle of palliative radiation . Therefore, the decision was taken to treat him as a case of metastatic melanoma . One 5-day cycle temozolomide (150 mg / m po qday for 5 days) was administered . Unfortunately, the patient passed away5 and a half months after the initial diagnosis was made . Macroscopic examination of the resected mediastinal mass revealed solid and mucoid - filled cystic components with hemorrhagic cut surface measuring 18 14 13 cm in its maximum dimensions . Microscopically, the tumor consisted of a mixture of various ectodermal, endodermal, and mesodermal elements, of which immature neuroectodermal tissue areas were predominant . Anaplastic, pleomorphic glial tissues with marked nuclear atypia, and brisk mitosis were noted . These areas stained positive for glial fibrillary acidic protein and represented a glioblastoma component (fig . C). (a c) neural tissue with pleomorphic atypical cells and high nuclear - to - cytoplasmic ratio consistent with glioblastoma (a, b). Immunohistochemical staining of the tissue with glial fibrillary acidic protein (gfap) showing positive reaction (c). Other areas of the tumor contained pleomorphic spindle - to - round cells with large hyperchromatic nuclei, prominent nucleoli, and frequent atypical mitosis suggestive of malignant, undifferentiated spindle - cell sarcoma (fig . Extensive immunohistochemical staining for relevant markers (smooth muscle actin, desmin, myogenic differentiation 1, cluster of differentiation [cd]34, cd31, and synaptophysin) were negative . Atypical, large pleomorphic cells with melanin pigment staining positive for s100, human melanoma black (hmb) 45, melan a, and microphthalmia - associated transcription factor-1 were present in other areas indicating a melanocytic differentiation consistent with transformation to malignant melanoma (fig . Areas of endodermal differentiation with glandular structures, some of which showed malignant features consistent with adenocarcinoma, were also noted (fig . Besides, mature and immature cartilaginous tissues were seen in areas of the tumor (fig . Regional lymph nodes adjacent to the tumor were positive for metastatic squamous cell carcinoma (fig . (a h) somatic - type malignancies: pleomorphic spindle to round cells and frequent atypical mitosis suggestive of sarcomatous differentiation (a). Malignant spindle cells with melanin pigment (b d) which were positive for melan - a (e). Cartilage with numerous lacunae containing small chondrocytes, surrounded by immature mesenchymal cells (g). A 21-year - old man was referred to our service from a local hospital for further management of a right hemithoracic extra - pleural mass with a provisional diagnosis of immature teratoma . The patient previously healthy presented to the referring hospital with a 3-week history of productive cough with blood - tinged sputum, right - sided intermittent pleuritic chest pain, and mild shortness of breath . He also experienced intermittent fever (38.5 c), nausea, vomiting, anorexia, and significant weight loss . His past medical, family, travel, contact, and occupational histories are unremarkable . Physical examination revealed a thin - built man with normal vital signs . Respiratory examination suggested a reduction of air entry on the right side with no rhonchi, wheezing, or crepitation . General, cardiac, abdominal, testicular, and lymph - node examinations were unremarkable . G / l, normal = 135180; mean corpuscular volume = 71 fl, normal = 7595; mean corpuscular hemoglobin = 23.3 pg, normal = 2430), mild leukocytosis (total leukocyte count = 12.49 10/l, normal = 3.911.0), thrombocytosis (platelets = 1061 10/l, normal = 155435), and an elevated lactate dehydrogenase (ldh) level (ldh = 567 u / l increased to 727 notably, -fetoprotein (afp) and cancer antigen 199 were elevated (afp = 9.13 g / l increased to 19.3 g / l in few weeks, normal <7; cancer antigen 199 = 38.5 u / ml, normal <27), while carcinoembryonic antigen and -human chorionic gonadotropin levels were within normal limits . A chest radiograph showed a large, well - defined substernal mass obscuring the right cardiac border . Contrast - enhanced computed tomography (ct) at presentation revealed a large (approximately 4 4 5 cm) noncalcified, heterogeneous mediastinal mass extending to the right upper lobe and pleura (fig . Several mediastinal and cardiophrenic lymph nodes were noted, with the largest measuring 1.2 cm in its widest diameter . No focal lesions in the liver, spleen, pancreas, adrenals, or kidneys were identified . A ct - guided core needle biopsy was suggestive of immature teratoma (fig . 2a and b). Whole - body combined 18f - fluorodeoxyglucose positron emission tomography / computed tomography (fdg - pet / ct) showed an fdg - avid mediastinal mass with a single fdg - avid superior mediastinal lymph node (fig . (a, b) a contrast - enhanced computed tomography scan, using the mediastinal (a) and lung (b) windows, showing a mediastinal mass that is extending into the adjacent lung . (a, b) microscopic examination of needle core biopsy from the mediastinal mass showing predominant immature neuroectodermal elements forming glands and tubules lined by columnar embryonal cells with stratified hyperchromatic nuclei (a) and focal areas of a more mature neural tissue (b). A whole - body combined 18f - fluorodeoxyglucose (fdg) positron emission tomography / computed tomography scan showing an fdg - avid mediastinal mass with an intense peripheral hypermetabolic activity . Combination chemotherapy with bleomycin (30 units iv on days 1, 8, and 15), etoposide (100 mg / m iv on days 15), and cisplatin (20 mg / m iv on days 15) was subsequently initiated . However, notwithstanding the mild improvement initially, the patient showed steady symptomatic deterioration; after completing two 3-week chemotherapy cycles, he presented to the emergency room with chest pain, cough, and hemoptysis . Although no evidence of pulmonary embolism (pe) was found, the study showed an interval progression of the tumor size, reaching around 12 13 12 cm . The ill - bordered mass appeared to have invaded the lung parenchyma, superior vena cava, and pericardium (fig . 4a and b), while abutting on the carina, right main bronchus, right pulmonary artery, as well as the anterior, inferior, and superior pulmonary veins . (a, b) axial (a) and coronal (b) contrast - enhanced computed tomography scans obtained after receiving 2 chemotherapeutic cycles showing interval progression of size, reaching around 12 13 12 cm in its maximum dimensions . The case was thoroughly reviewed and discussed in a multidisciplinary team meeting, whose recommendation was to proceed with surgical resection . The patient underwent clamshell thoracotomy with an r0 resection of the mass along with the right middle and lower lung lobes . However, he presented 2 months later with extensive liver and bone metastasis, for which he received 1 cycle of palliative radiation . Therefore, the decision was taken to treat him as a case of metastatic melanoma . One 5-day cycle temozolomide (150 mg / m po qday for 5 days) was administered . Unfortunately, the patient passed away5 and a half months after the initial diagnosis was made . Macroscopic examination of the resected mediastinal mass revealed solid and mucoid - filled cystic components with hemorrhagic cut surface measuring 18 14 13 cm in its maximum dimensions . Microscopically, the tumor consisted of a mixture of various ectodermal, endodermal, and mesodermal elements, of which immature neuroectodermal tissue areas were predominant . Anaplastic, pleomorphic glial tissues with marked nuclear atypia, and brisk mitosis were noted . These areas stained positive for glial fibrillary acidic protein and represented a glioblastoma component (fig . C). (a c) neural tissue with pleomorphic atypical cells and high nuclear - to - cytoplasmic ratio consistent with glioblastoma (a, b). Immunohistochemical staining of the tissue with glial fibrillary acidic protein (gfap) showing positive reaction (c). Other areas of the tumor contained pleomorphic spindle - to - round cells with large hyperchromatic nuclei, prominent nucleoli, and frequent atypical mitosis suggestive of malignant, undifferentiated spindle - cell sarcoma (fig . Extensive immunohistochemical staining for relevant markers (smooth muscle actin, desmin, myogenic differentiation 1, cluster of differentiation [cd]34, cd31, and synaptophysin) were negative . Atypical, large pleomorphic cells with melanin pigment staining positive for s100, human melanoma black (hmb) 45, melan a, and microphthalmia - associated transcription factor-1 were present in other areas indicating a melanocytic differentiation consistent with transformation to malignant melanoma (fig . E). Areas of endodermal differentiation with glandular structures, some of which showed malignant features consistent with adenocarcinoma, were also noted (fig . Besides, mature and immature cartilaginous tissues were seen in areas of the tumor (fig . Regional lymph nodes adjacent to the tumor were positive for metastatic squamous cell carcinoma (fig . (a h) somatic - type malignancies: pleomorphic spindle to round cells and frequent atypical mitosis suggestive of sarcomatous differentiation (a). Malignant spindle cells with melanin pigment (b d) which were positive for melan - a (e). Cartilage with numerous lacunae containing small chondrocytes, surrounded by immature mesenchymal cells (g). A 40-year, population - based review of finland cancer registry suggested an incidence of 1.8 and 1.0 per 1,000,000 person - years among males and females, respectively . Despite the increasing incidence of gonadal gcts, no temporal change was observed in the incidence of its extragonadal counterpart a finding that is consistent across the studied populations . Several reports suggested the mediastinum to be the most common site of origin of extragonadal gcts in males, while others found the central nervous system to be more common . Teratomas account for 40% to 60% of all mediastinal gcts, with the overwhelming majority being histologically mature . Mediastinal teratomas are more common in males than females, except during the first few years of life . An uncommon but well - recognized phenomenon that may accompany gcts is the somatic - type malignant transformation, in which a non - gct malignant component is found within the bulk of a cgt or in its metastatic foci . Somatic - type malignancy arising specifically in a teratoma setting remains an exceptionally rare event . Given the remarkable chemo - sensitivity of gcts, chemotherapy is thought to eliminate the bulk of gcts exposing the non - gct, chemo - resistant malignant components when present . Possibly due to the pluripotency of gct components the most common histological subtype of malignant transformation is sarcoma (predominantly rahbdomyosarcoma), followed by adenocarcinoma and primitive neuroectodermal tumors . Squamous cell transformation is rare but may be relatively more common in ovarian teratomas, especially in the mature cystic variants . An international, multicentric review of 635 patients with extragonadal gcts identified secondary melanoma in 2 cases, which occurred few years later after the primary diagnosis . Few other cases of melanoma either occurring as secondary tumors or in conjugation with the primary mediastinal gct have been reported (table 1). To our knowledge, this is the first report of combined sarcomatous, carcinomatous, and melanomatous malignant transformation arising in the setting of immature mediastinal teratoma . Clinicopathological characteristics of primary medistinal gcts cases reported in the literature with an associated melanomatous degeneration . Clinically, gcts with somatic - type malignancy tend to be more symptomatic than pure gcts, although symptoms are clinically indistinguishable when present . Symptoms may arise from compression, invasion, or rupture and include chest pain, dyspnea, and cough . Patients may also experience weight loss, fever, malaise, night sweats, nausea, hemoptysis, postobstructive pneumonia, dysphagia, hoarseness, and superior vena cava syndrome . Radiologically, attenuation heterogeneity is a common characteristic of the mass, due to the presence of somatic malignancy (i.e., a solid mass) along with areas of teratomatous, necrotic, or hemorrhagic zones . Invasion to adjacent structures, such as the great vessels, lung, and heart can also be seen . Metastasis to regional lymph nodes, lung, brain, liver, and spleen may be evident at the time of diagnosis or as a recurrence . Since no evidence of testicular involvement was found on physical examination or ultrasonography, testicular biopsy was deemed unnecessary in this case . The patient's clinical presentation featured postchemotherapy disease progression that is, tumor growth and symptomatic deterioration . Syndrome and teratoma rupture, respectively, which are infrequently but characteristically seen in mature mediastinal teratomas . However, the rapid tumor progression in this case is likely due to the aggressive nature of the underlying non - gct malignant transformation, especially sarcoma . In fact, it is likely that the tumor's poor response to cisplatin - based therapy was due to the presence of sarcomatous component . Elevation of afp or -human chorionic gonadotropin is not uncommon in gcts with malignant transformation . Busmanis and tay suggested the lack of immunohistochemical correlation with the afp serum levels in a pure immature ovarian teratoma with extra - ovarian implants . The possibility of yolk sac component being present in our case (given the elevation of afp) could not be ruled out . Although chemotherapy might have accounted for the eradication of yolk - sac components, the absence of histological evidence led to the designation of this case as an immature teratoma . Given the significant resistance to cisplatin - based chemotherapy, motzer et al suggested using chemotherapeutic agents based on the transformed histology as the strategy of choice for regimen selection . Others advocated initiating gct - standard cisplatin - based regiment and reserving chemotherapeutics of the specific somatic - type transformed malignancy for relapses . Although the rarity of gcts with malignant transformation have not permitted the generation of a strong body of evidence, it is agreed that an aggressive surgical approach with complete resection may be beneficial whenever deemed feasible, since it appears to afford the best survival . As demonstrated by the case presented herein, the radiologic evidence of postchemotherapeutic interval growth in the context of a known immature teratoma may serve as a useful clue as to the presence of somatic - type transformation, favoring urgent surgical intervention over other treatment modalities (e.g., salvage chemotherapy). In fact, it was shown that such a tumor may harbor hematopoietic stem cells within its bulk, providing a possible explanation for the source of the hematologic derangements . With the exception of thrombocytosis, there were no overly aberrant blood indices in our case that would warrant further investigation . It is worth mentioning that gcts may predispose to thrombotic events especially during chemotherapy treatment, and a sudden occurrence of hemoptysis raises the suspicion of pe . Ct pulmonary angiogram may be deemed optimal in an emergency setting, it aids in pe diagnosis and, if pe is ruled out, delineation of any structural alterations of the underlying pathology . Favorable factors include younger age, limited disease extent at diagnosis, feasibility of complete resection, the absence of somatic - type malignancy (especially metastatic sarcoma - type histological transformation), and the response to standard chemotherapeutic regimens . Teratomas with malignant transformation have an aggressive course, high recurrence rate, and poor survival when present in the mediastinum . Nonetheless, when confined to primary site, such tumors tend to carry mortality risk that is comparable to its teratomatous counterpart with no malignant transformation . For gcts with somatic - type malignancy, the survival - determining factor may be the histopathological component that is most aggressive . The patient had an overall survival of around 6 and 2 months from the initial diagnosis and metastasis, respectively . This seems to mirror the survival of melanoma with metastasis to the liver, brain, or bone, whose median survival was found to be 4.4 months . The patient also had several of the poor prognostic indicators, including an elevated ldh and leukocytosis . However, what determines the metastatic potential in gct - associated melanomas remains largely unknown . Although our patient presented with metastatic disease 4 months after the diagnosis, 13 months elapsed before metastatic disease occurred in a previously reported gct - associated melanoma . Somatic - type malignant degeneration is a rare but well - recognized phenomenon that occurs in the settings of gcts . Due to its rarity, distinct nature, and remarkable heterogeneity, this disease warrants comprehensive reporting of the clinical, radiological, and pathological features . In case of more - than - single transformation, the clinical outcomes and overall survival may well correlate with that of the most aggressive and poorest prognosis tissue type . The presence of melanomatous transformation, as illustrated by this case, likely confers aggressive biological behavior . As the literature is enriched with additional studies, understanding the clinical implications of the distinct malignant transformations will expectedly aid in clarifying the optimal, possibly tailored, management lines.
Gels have been described as materials that are easier to recognize than define . Most of the times this problem comes from industry, which develops products with a gel name, just to be attractive to consumers . However, gels have been accepted as semisolid materials comprising low concentrations (<15%) of gelator molecules to form a network self - assembly that entraps the solvent (in organogels both nonpolar components), preventing flow due to surface tension . Gels can be defined both from a rheological behavior and from a structural feature . In a rheological point of view, a gel is a system that does not flow and has the presence of a plateau region of storage modulus and a low tan (<0.1) at an angular frequency from 10 to 10 rad / s . The structural definition is based on the connectivity of the system . Gel is a system consisting of molecules, particles, and chains, which are partially connected to each other in a fluid medium by crosslinks to the macroscopic dimensions . Organogels have been attracting much attention in biomedical and pharmaceutical fields, where the erosion of gels in stomach and intestines is important for drug delivery [4, 5]; therefore gels erosion has been applied for this purpose . As oils are safe materials and are suitable for lipophilic components, they are considered a good option for organogels elaboration . That is why food industry is very interested in this type of systems as a replacement of hydrogenated fats . Thus, understanding organogels, definition is closely related to their characteristics and their crucial potential to develop new applications . The case of fat oils is very important due to their applications in food industry . The study of crystal nucleation, dissolution, and agglomeration in the overall precipitation scheme implies practical difficulties . Nucleation and crystal growth are spontaneous processes, which diminish the energy of the growing particle and nucleation process in order to overcome activation energy; that is, the critical cluster (critical size) is the cluster with maximum gibbs free energy . The activation barrier may be represented by three parameters: supersaturation ratio, reaction temperature, and interfacial energy . Following crystal formation in organogels can give detailed information on how their preparation is affecting their final structure . The crystallization behavior is related to concentration of gelator, cooling rate [11, 12], and shear rate on fat crystals [13, 14]. Depending on the system, gels are formed by different forces and interactions and there are some parameters that affect, such as ph, ionic force, and mechanical forces . The plastic fat gels are formed due to the aggregation of fat crystals by several forces as van der waals, dipole - dipole, hydrophobic, and hydrogen bond interactions between crystals . Fractal is a geometric pattern that is repeated at every smaller scale to produce irregular shapes and surfaces . Hence, since the study of organogels is very complex, it must include structural analysis and rheological and thermal behaviors in order to have a clear understanding on how preparation parameters are affecting the final product . Thus, our objective was to evaluate the influence of gelator (type and concentration), type of vegetable oil, stirring speed, and temperature preparation on the physical properties of obtained organogels . Three different vegetable oils (soybean, canola, and corn oil) were used . They have important differences in composition of saturated fatty acids (sfa), monounsaturated fatty acids (mufa), and polyunsaturated fatty acids (pufa). The approximate compositions of soybean (sfa 15.65%, mufa 22.78%, and pufa 57.74%, wesson brand), canola (sfa 7.36%, mufa 63.27%, and pufa 28.14%, wesson brand), and corn (sfa 12.94%, mufa 27.57%, and pufa 54.67%, mazola brand) were considered . These oils were bought at a local supermarket in new brunswick (new jersey, usa). Myverol (mainly monoglycerides glyceryl monostearate 49%, glyceryl monopalmitate 48%, and calcium silicate 3%) and myvatex (mixture of monoglycerides and diglycerides, soy monoglycerides 3545%, stearic acid monoester with propane-1 - 2-diol 4050%, sodium 2-stearoyl lactate 1015%, and calcium silicate 3%) were provided by kerry, mexico / usa, and used as gelator agents . Gelators myverol (mv) and myvatex (mx) at three different concentrations (8, 9, and 10%) were heated (70, 80, and 90c) on glass containers until complete melting, and then either vegetable oil (soy (sy), canola (ca), or corn (cn)) was added . Samples were stirred (t 25 digital ultra - turrax, ika, north carolina, usa) for five minutes at three independent speeds (3600, 7200, and 12000 rpm) to homogenize them; then, samples were cooled to room temperature and stored in refrigerator for 24 hours . Dynamic frequency sweep tests were performed in a rheometer (ares rheometer 902 - 30004, ta instruments, new castle, de, usa) using parallel plates geometry (25 mm diameter) under the following experimental settings: strain 0.1%, temperature 20c, frequency sweep 0.1100 rad s, and a gap of 1 mm . The g and g modules, complex viscosity, and delta tangent for each experimental sample were obtained . Polarized light microphotographs of organogels were obtained using a polarized light microscope linkam brand (t95 system controller; t95 linksys 32 soft, 2009, tadworth, uk). It was equipped with a q imaging camera (color rtv 10 bit) using an olympus th4 - 100 halogen lamp power supply unit (lts120 temp . Controlled stage). Images were taken at 20c, and video was taken using the camtasia studio v 7.0 (build 1426, 2010, techsmith corporation, okemos, mn, usa). Thermal behavior of samples was studied using a differential scanning calorimeter (dsc q2000 ta instruments, schaumburg, ill, usa) equipped with refrigerated cooling system (rcs 40 ta instruments, schaumburg, ill, usa). Samples were heated at 120c (30 min) for deleting fat thermal memory . X - ray diffraction experiment was developed by the use of a pxrd conduced with a d / m-2200 t automated system (ultima rigaku, tokyo, japan) with cu k radiation = 1.5406 a. patterns were collected at 2 angles of 3 to 50 at a scan rate of 2/min . A graphite monochromator was used and the generator power settings were fixed at 40 kv and 40 ma . 2010.01.30, woburn, massachusetts, usa) for clarifying peaks, applying a single functional filter smoothing and five cycles of fourier deconvolution . The fractal dimension of the samples was calculated using (1) according to a described method, which is based on the avrami relationship . Consider (1)ln(1xcr)=ktd, where xcr is the crystallinity of the system; t is time; k is a constant; and d denotes the dimension of growing . D and k were calculated by nonlinear estimation using levenberg - marquardt algorithm (statistica v 7.0, tulsa, ok, usa). Crystalline fraction of samples was calculated adjusting values from complex viscosity of the system removing complex viscosity of the solvent: (2)xcr=(t)(). A universal relation has been developed, but in the present work a previous relationship was used, supported by earlier theoretical work in order to evaluate structural parameters . In this experimental work, a three - dimensional colloidal network was considered as being composed of interconnected flocs and the fractal dimension was used to quantify the relationship between the average floc size and the particle concentration of the colloidal network . The fractal nature of fat crystal networks has been already presented and explained the power - law relationship followed by g and the solid fat content (sfc) data for fat samples with low solid fat content (<10%). Rheological data from experimental work can lead us to obtain a parameter related to elastic modulus (the solid fraction previously obtained by xcr),, and m, obtained by nonlinear estimations (statistica v 7.0, levenberg - marquardt algorithm, tulsa, ok, usa). The hamaker constant was determined following reported methodology [18, 22] where a is the hamaker constant, a is the diameter of the particles within a floc, and d is the average distance between clusters . 14.0.0.567, menlo park, ca, usa) applying channel separation (cmyk) in order to obtain floc and distance parameters as clearly as possible . Consider (4)~a3ad2 . Comparisons and calculations of parameters were obtained by nonlinear estimation with statistica software (ver . 7.0, 2007, tulsa, ok, usa) using levenberg - marquardt algorithm . Mean effects on interactions between processing parameters and fractal dimensions and microstructural parameters were determined by screening design (jmp ver . Higher values of g were observed for mv gels at higher frequencies used at 10% gelator concentration, 70c, and 12000 rpm . The elastic module (g) thus, this value may indicate that, at higher shear rates, structural order produced by lipid chains (i.e., acylglycerides) is organized in a more stable configuration, as a function of more contact between molecules that lower the necessary energy for self - organization and structure building . Theoretical analysis of gels indicated that small particles could be aggregated to form large clusters with tenuous, chain - like, and self - similar structures that eventually span the entire enclosing space . This behavior not only was influenced by shear rate, but also seems to be influenced by the type of gelator used as can be seen in figures 1, 2, and 3 . From these figures it can be observed that at the same conditions mv organogels always give higher elastic modules in comparison with the mx . The mechanisms of aggregation of gelators in organogels occur primarily through van der waals forces, specific intermolecular hydrogen bonding, electrostatic forces, - stacking, or london dispersion forces . Thus, in function of the solvent and the gelator molecule, which type of intermolecular force predominates to stabilize the self - assembly primary structure, the growth mode, and finally the organogel microstructure and its thermomechanical properties is determined . However, the relationship between gelator chemical structure and its gelling capability is not evident a priori in most cases . However, it is desirable for gel modules to maintain a stable behavior during the complete frequency range . Solid behavior is predominant in all samples at the experimental shear range used, so it can be considered suitable for an excipient . Similar behavior was observed in the organogels prepared with different oils (figure 3), except for soy oil (sy), which seems to have a different effect, producing more elastic gels at the same conditions . Sy seems to be favored by its higher solid fatty acids content, which gives more elastic modules to myvatex gelator samples . An explanation of this behavior has been already reported . In there, candelilla wax and amides derived from (r)-12-hydroxystearic acid were tested as gelators of safflower oil, observing that the increase in the hydrocarbon chain length raises both the organogel resistance to deformation and its instant recovery capacity . However, the extended recovery capacity of the gel decreased . As can be seen in figure 3, the behavior of each sample made with different oil at the same conditions changes significantly . This may be related to the different composition of vegetable oil and how each component is reacting at different preparation conditions . Although the higher elastic modules are obtained with canola (ca) and corn (cn) oil samples, in general ca gave the higher elasticity samples in comparison with those made with cn and sy . This behavior could be related to the monounsaturated fatty acids (msfa) and polyunsaturated fatty acids (pufa) contents . Obtained micrographs (figure 4) showed that myvatex tends to crystallize as spherulitic forms, some of them with larges spaces between these spherulites, while samples prepared with myverol crystallized as fibrillar networks . It was reported that the higher number of hydroxyl groups related to the diacylglycerides was correlated with a lack of gelation into the organogels . This gives further evidence to the fact that hydrogen bonding is critical to the organogelation . Statistical analysis of enthalpy data showed that gelator type and its concentration (p <0.05) were the most important factors that influence enthalpy (table 1). The statistical analysis showed a very complex phenomenon influenced by the following interactions: oil oil, concentration gelator, and gelator temperature . Organogels obtained with myvatex gelator showed two different nucleation stages related to the presence of two main types of molecules (mono- and diacylglycerides); so probably distributed free energy makes gels tend to crystallize as spherulites rather than as a needle shaped network . However, not only the gelator is important, but also its concentration and several interactions including vegetable oil type and temperature are important . At this point, it is interesting to highlight that the temperature factor does not have influence on the enthalpy of organogels . Thus during cooling, both components might develop a mixed molecular packing with vegetable oils . On the other hand, myvatex gelator (mx) does not seem to be affected significantly by any preparation conditions . Finally, it is clear that the use of myverol at higher concentrations produces organogels with higher values of gelation enthalpies, indicating more stable structures . A comparison of d spacing data was done in order to elucidate not only possible arrangements in packing, but also the most probable polymorphic forms in batches . Since they were complex mixtures of components (nonpure components), at least two different packings and polymorphs were selected . It can be noticed that most of the structures obtained are mainly polymorphs, because most of them are amorphous materials and b crystals are present only in part . Although mx also gave a good structure, it was only possible under the highest energy conditions . In order to compare different samples behaviors with a representative value, samples fractal dimensions (table 3) were obtained from rheological behavior according to others, on which we should obtain crystalline fraction of each sample based on complex viscosity behavior and then get fractal parameter from nonlinear estimation . Once fractal data was obtained, anova test was developed looking for some important influence . The model obtained was too complex and t - student was not sensitive enough to detect means without a significant error . Even in general no means were detected; some interesting effects were found when gelators and oils were blocked . Also, several works on formation of organogels studied and correlated by avrami exponent (n) with fractal dimensionality have been reported [17, 28]. However, it was indicated that it may be inappropriate to compare avrami derived fractal dimensionalities from several systems in which different nucleation mechanisms for gelators are involved . Thus, there are reports on homogeneous nucleation with a fractal dimensionality near 2, while others found a fractal dimensionality near 1 in a heterogeneous nucleation system . Thus in the present experimental work, fractal dimensionality was in that range (lower than 2), particularly when using mono- and diacylglyceride blends, indicating a possible heterogeneous nucleation process . As an example, when the variable gelator (myvatex) was blocked on canola oil (p = 0.047), the fractal dimension (d) was affected by the gelator concentration . Also, when corn oil temperature was blocked, the results indicated that higher temperatures render higher fractal dimensions . The fractal dimensions (d) determined by the particle counting method are sensitive to the spatial distribution of particles in the crystal network . Higher fractal dimensions occur in networks that are more ordered, whereas networks that arise from a more disordered nucleation and growth process result in lower fractal dimensions . The fractal dimension value found in the present work was lower, similar, and higher than other reports . Even though we did not find any significant mean on rpm versus d parameters, independently of the gelator, d fractal dimension tends to decrease as rpm increases . This could mean that as the shear rises there is an increase in disorder of the structure, which is contrary to reports from others [13, 14]. This could also indicate that different conditions are affecting gels structure and there is not necessarily a codependence on shear rate and order of the structure . The highest value of was found for myverol (mainly monounsaturated fatty acids) in comparison with myvatex . The gelator molecules are related to the nature of the short - range weak forces and the strong solvent dependence on the molecular self - assembling capabilities, so that molecules with higher molecular weight could affect crystal growth and its consequence on fiber interpenetration among vicinal spherulites . However, not only gelator molecule is important, but solvent nature and interaction solvent - gelator are important too . In this way, experimental data was blocked for the two gelators in separated assessments . Results showed that myverol is affected by the type of oil used for the sample (p = 0.0085), by the oil - concentration interaction (p = 0.04), and the concentration quadratic effect as well (p = 0.0072). Meanwhile for myvatex, the oil effect was also important (p = 0.0766), but contrary to myverol, it was affected by the oil quadratic (p = 0.43) and the temperature quadratic effects (p = 0.032). Thermal parameters could be helpful to explain this behavior, because they are associated with the molecules polarity and the energy of the molecular interactions that are established with the crystal structure of gelators in their neat and organogel states . Thus, the energy related to the organogel depends on the energy of the noncovalent interactions involved during the molecular self - assembly . As can be seen, higher enthalpies were observed for myverol in comparison to myvatex, like a structural parameter . Monoglycerides are known to be good initiators of fat crystallization and the matching in saturation and carbon chain length of both the gelator fatty acids and the oil phase are important in the particular lipid - lipid interactions . For the hamaker constant (table 3), gelator appears as a main effect (p 0.0001), followed by the stirring speed (p = 0.052), as well as the interaction gelator - stirring speed (p = 0.088). Also the bilayer packing seems to be favored by the particularities on ca oil composition of mainly the high mufa and low pufa contents . Also the first gelator tends to form needle shaped network structures with better intermolecular forces according to their hamaker constant and xrd analysis . The stirring speed should be an important parameter to take into account, as well as the gelator and its concentration . It was found that temperature does not seem to be an important parameter in gels preparation . Finally, it is important to point out that most of the influence of the stirring speed conditions is apparently related to the oils higher mufa and low pufa contents.
The high incidence of fractures of the angle of the mandible is attributed to a thinner cross - sectional area relative to the neighboring segments of the mandible, the curvature of trajectories in the angle region, and the presence of third molars, particularly those that are impacted, which weakens the region2 . It is therefore not uncommon for an oral and maxillofacial surgeon to encounter fractures of the angle of the mandible in their day - to - day practice . The oral and maxillofacial surgeon's preference for the approach to a fracture site depends on accessibility, ease of procedure, aesthetic demands by the patient, and surgical expertise . Various approaches are used for the fixation of fractures of the angle region of the mandible . This technique had certain disadvantages such as an unaesthetic scar and the risk of facial nerve injury, although exposure and direct application of the plate was better with this approach3 . To counteract these disadvantages, this approach involves operating entirely through an incision made in the oral mucosa / gingiva and is frequently used by surgeons . The disadvantages included placement of the plate in an anatomically unfavorable position, thin soft tissue coverage leading to an increase in dehiscence and exposure of the plate, and breakage of the plate due to a greater degree of intraoperative plate bending, which required to adapt to the complex contours of the superior border of the mandible . Other disadvantages include placement of plate closer to the dentition, allowing an easier and shorter path for bacterial pathogens to move from the periodontal sulcus to the fixation hardware and more prevalent loosening of the screw, as there is less bone density on the superior aspect of the mandible and the alveolus4 . The disadvantages of the transoral approach prompted surgeons to find an alternative method, namely the transbuccal approach . This approach involves an intraoral incision plus a small incision on the facial skin, which permits the use of a transbuccal trocar to allow instruments such as a drill or screwdriver to pass through . Advantages include no external scarring, fixation of the plates on the thicker lateral cortical plate of the mandible in a sagittal plane, greater soft tissue coverage, less chance of plate fracture as weakening of plates by over - bending is avoided, lower infection rate due to less movement of pathogens from the third molar region, and direct visualization and confirmation of desired occlusion during fixation45 . Since the miniplate fixation differs for the transoral and transbuccal approaches, we decided to compare the two approaches in the management of angle fractures of the mandible . A total of 60 patients reporting to goa dental college and hospital from march 2013 to december 2014 were included in this prospective study and were randomly divided into 2 equal groups based on the type of approach employed for fracture fixation (group a, transoral approach; group b, transbuccal approach). The study was ethically approved by the goa dental college and hospital's review committee and written informed consent was obtained from all patients participating in the study . We included patients with an age between 15 to 60 years, unilateral / bilateral mandibular angle fractures or fractures associated with other facial bone fractures with radiographic preoperative displacement of the fracture segments ranging from 1 to 5 mm, patients with controlled systemic conditions, and those willing to follow - up . We excluded patients who refused to follow - up or had a medically compromised status and patients with infections or pathologic or comminuted fractures . The degree of anatomical displacement was studied with digital orthopantomogram (opg) and posteroanterior (pa) mandible radiographs . Complete hematological investigations were performed and all patients were started on intravenous antibiotics that were continued for 5 days postoperatively in all patients . Erich arch bars were applied to the maxillary and mandibular dentition a day prior to surgery . All patients were operated under general anesthesia with nasotracheal intubation following a standard surgical protocol by a single oral and maxillofacial surgeon . In group a, following local infiltration of the intraoral site with 2% lignocaine with 1:80,000 adrenaline, an incision was planned extending from the anterior border of the ascending ramus at the level of maxillary occlusal plane . The incision was then carried down just along the lateral portion of the anterior ramus and continued forward approximately 5 mm from the junction of the attached mucosa and vestibule to extend anteriorly to the level of the mandibular first molar . B) fractured segments were stabilized and fixed with a 2.5 mm 4-hole titanium miniplate with a gap, and were secured with monocortical screws that were 2.5-mm in diameter and 6 to 8 mm in length . General anesthesia was reversed and the patient was extubated and shifted to the recovery room . In group b, in addition to the transoral incision, a small extraoral stab incision was given to permit the insertion of the transbuccal cannula. (fig . B) the location of the extraoral stab incision was guided by the location of the fracture line and the position of the facial vessels . The trocar was advanced into the operative site with blunt dissection through the stab incision, perforating the periosteum in the area planned for plate fixation. (fig . C) the cheek retractor was applied to stabilize the trocar assembly during movement towards and away from the fracture site . A drill bit that was 11.5 cm in length and 2.3 mm in diameter the procedure followed for fracture reduction was similar to that of the transoral approach, except that after fracture reduction, the trocar assembly was removed and the extraoral skin incision was sutured with 5.0 ethilon (johnson & johnson, new brunswick, nj, usa) suture. (fig . D - h) all patients were hospitalized for 5 days and were placed on a liquid diet for 2 weeks, followed by a soft diet for another 4 weeks . Intraoperatively, patients were evaluated for the ease of surgical access for fixation and the surgical time (time from incision to closure). The ease of surgical access for fixation in either approach was evaluated by the operating surgeon and graded as 1, good; 2, fair; and 3, poor, based on the visual analogue scale6 . Radiographic evaluation of fracture reduction between the two groups was done by measuring the gap between the fractured segments of the mandible in postoperative opg radiographs . All radiographs were performed using the orthophos xg machine (sirona dental systems, bensheim, germany) with similar exposure parameters . On the radiographs measurements of the fracture gap were conducted on these 4 defined points with a digital caliper6. (fig . 3, 4) postoperative complications such as scarring (in group b), occlusal discrepancy, infection, nonunion, and malunion were evaluated at each regular follow - up period . Evaluation of scarring in group b was done with photographs at the 6th month postoperatively . The scoring for the scar was as follows: 1, hypertrophic scar; 2, invisible scar; and 3, barely visible scar7 . Postoperative occlusion was evaluated using the following scoring system: 1, pre trauma; 2, minor discrepancy; and 3, major discrepancy8 . The data was tabulated and subjected to statistical analysis (spss version 13; spss inc ., the mean age in this study was 26.73 years (range, 17 - 53 years), with a peak incidence in the second and third decades of life (n=46, 76.7%) which showed male predominance (n=58, 96.7%). Road traffic accidents accounted for the majority of the cases (n=52, 86.7%). Isolated mandibular angle fracture was seen in 20 patients (33.3%), with a higher incidence of right sided fracture (n=36, 60.0%) when compared to the left (n=24, 40.0%). The ease of surgical access for fixation revealed no statistical significance when compared between the two groups . (table 1) the mean surgical time for each group was 37 minutes and did not vary between groups. (table 2) postoperative radiographic tracing for both groups was done on the opg . It was noted that the reduction in the gap in group b was uniform from points a to d, whereas in group a, there was gradual increase in the distance between the fractured segments. (table 3) there was no statistical difference at point a for both groups . However, points b (p=0.030), c (p=0.016), and d (p=0.004) were statistically different between groups. (table 4) with regard to postoperative complications, scar evaluation in group b at 6 months revealed 1 patient (3.3%) with a hypertrophic scar, 6 patients (20.0%) with barely visible scars, and 23 patients (76.7%) with invisible scars . Infection was noted in 2 patients (6.7%) in group b, compared to 6 patients (20.0%) in group a at 3 months postoperatively . The cause of the infection could be traced to the infected plates that were removed under local anesthesia, and patients were prescribed a course of oral antibiotics for 5 days . No cases of malunion or non - union were noted in the two groups . With regard to postoperative occlusion, 28 patients in group b had a score of 1 (pre - trauma occlusion), compared to 16 patients in group a (p=0.027, significant). Twelve patients in group a had a score of 2 (mild discrepancy), compared to 2 patients in group b (p=0.016, significant). Two patients in group a had a score of 3 (major discrepancy), compared to no patients in group b. (table 5) the occlusal discrepancy was noted only in the first week postsurgery in either group and was corrected using elastic traction in all patients . The mandibular angle is subjected to forces between the muscles of mastication and the supra - hyoid group of muscles, resulting in unstable rotation of distal and proximal fragments . The presence of an impacted third molar tooth in the line of fracture may result in the fracture being compounded intraorally, which may distract away from bone or interfere in ideal fracture reduction9 . Although the management of mandibular angle fractures is still a topic of debate, the treatment is dictated by the principles of fixation and aesthetic demand by the patient . As treatments and equipment have evolved, miniplate fixation can now be carried out in an anatomically favorable position using a transbuccal approach . However, some surgeons do not prefer the transbuccal technique due to the theoretical risk of damage to the facial nerve and an unfavorable facial scar1011 . In this study of 60 patients, the incidence of mandibular angle fractures was seen in ages ranging from 17 to 53 years, with a mean age of 26.73 years . The peak incidence of fractures was seen in the second and third decades of life (n=46, 76.7%) with a definite predilection in males (n=58). Road traffic accidents was the most common etiological factor, (n=52, 86.7%) followed by assault (n=8, 13.3%). The findings were in unison with a study conducted by kumar et al.12, which reported the pattern of maxillofacial fractures in 2,731 patients . The highest incidence of fractures in this study was found in the second and third decades of life (n=1,535, 56%). Road traffic accidents were the most frequent cause (n=2,086, 76%), followed by assault (n=260, 12%). Another similar study13 looked at 214 patients and stated that the incidence of angle fractures was higher in the male population and was most common in the third decade of life . Although we report that surgical access is facilitated with the transbuccal approach, we did not observe any statistically significant differences between the two approaches for this parameter . Surgical time is defined as the time taken from incision and exposure of the fractured site to closure . This finding contradicted studies in the literature that have shown increased surgical time with the transbuccal approach when compared to the transoral approach1011 . Radiographic evaluation of fracture reduction was performed by studying the gap using tracings done on the opg . However, points b (p=0.030), c (p=0.016), and d (p=0.004) were statistically different between groups . The reduction obtained in group b was uniform from points a to d, whereas in group a, there was a gradual increase in the distance between the fractured segments . We believe that the favorable position of the miniplate in the transbuccal approach brings about better control of the tensile and compressive forces, resulting in more uniform reduction in the fracture gap from points b to d. this observation was in accordance with a study on three - dimensional models by kroon et al.14 and choi et al.15, who observed bony gaps along the inferior fracture border and found that this fracture movement was a contributory factor for subsequent complications, including infection . A study by wan et al.4 states that in transbuccal approach, no patients developed facial nerve palsy, whereas 1 patient out of 227 (45%) developed a hypertrophic scar from the 6-mm facial skin incision . Another study by sugar et al.10 reported similar findings in a population of 84 patients . No incidence of unsatisfactory facial scarring and facial nerve palsy from the transbuccal approach was noted . This is in accordance with our study, which reported 1 case (3.3%) of hypertrophic scarring and no incidence of facial nerve palsy in group b. three months after surgery, only two patients in group b had an infection, as compared to six patients in group a. this was due to the infected plate, which was retrieved under local anesthesia . A course of oral antibiotics for 5 days was subsequently prescribed and the healing was uneventful . A study by barry and kearns9 reported infection in 4 out of 50 patients in which the plate was retrieved at an out - patient department . Another study by ellis and walker16 reported infection occurring within two weeks of surgery in 2 out of 81 patients; this infection was treated initially with oral antibiotics, which resulted in normal fracture healing . The gold standard in management of mandibular fracture is to establish the pre - trauma occlusion with minimal postoperative complications . When postoperative occlusion was assessed, the transoral group had significantly more occlusal discrepancy than the transbuccal group . The discrepancy in occlusion was observed only in the first week postsurgery and was managed using light guiding elastics in all patients, with no re - surgical intervention required in any patient . Malocclusion may be due to the presence of concomitant fractures which may contribute to instability at the mandibular angle fracture site10 . This is in concordance with our study, which showed concomitant fractures in 11 patients (73.3%) in group a and 9 patients (60%) in group b. the rate of postoperative malocclusion reported in the literature ranges from 0% to as high as 7.5% . Sugar et al.10 presented a study showing a strong preference of surgeons for fixation using a transbuccal approach . The principal reasons given were ease of use, minimal requirement for plate bending, and facilitation of plate placement in the neutral mid - point area of the mandible . Our experience with the transbuccal approach was somewhat similar . A meta - analysis by al - moraissi and ellis17 states that the use of one miniplate is superior to the use of two miniplates in the management of mandibular angle fractures, as the incidence of postoperative complications was considerably lower . This is concordant with the present study, which showed better results when a single miniplate was used either transorally or transbuccally . In conclusion, although both approaches have inherent advantages and disadvantages, the transbuccal approach was superior to the transoral approach with regard to radiographic reduction in the fracture gap, inconspicuous external scarring, and fewer postoperative complications . We did not find increased operating time or damage to the facial nerve, which was observed by other authors when the transbuccal approach was employed . We preferred the transbuccal approach over the transoral approach due to ease of use, minimal requirement for plate bending, and facilitation of plate placement in the neutral mid - point area of the mandible . A study employing a larger sample size and without any confounding variables is ongoing to define our results even more precisely.
We conducted a prospective cohort study in 951 young people aged 1220 years with type 1 diabetes of minimum 2 years duration at a tertiary hospital in australia between 1990 and 2007 as previously described (14). All were free of retinopathy at baseline and had a minimum of two diabetes complication assessments . The number of people with baseline photographs suitable for grading was 736 (77%). No baseline urine samples were available for 70 (10%) who were excluded from the study . A1c in those without urine samples at baseline was higher (8.9 vs. 8.5%; p = 0.04) but no other baseline differences were observed . 511 had normal aer at baseline (aer 7.5 g / min) and 155 had elevated aer . Baseline characteristics are described for all 666 participants (table 1). Participants were prospectively followed using standardized interviews, examinations, and laboratory investigations at each visit as previously described (15). The study was approved by the children s hospital at westmead ethics committee, and written informed consent was obtained from all participants . Baseline characteristics by renal function status (aer> 7.5 g / min) through the study period incident renal dysfunction was defined as an aer> 7.5 g / min from three overnight, timed urine collections . This cutoff is above the 95th percentile of the normal adolescent population and predictive of microalbuminuria (3,4). Urinary albumin was measured using a polyclonal radioimmunoassay (pharmacia ria, uppsala, sweden) from 1997 to march 2000, changed to nephelemetry (immage analyzer; beckman coulter, sydney, australia) until 2003, and then changed to immulite analyzer (siemans, los angeles, ca) from 2004 onwards . A cross - validation analysis found no significant differences or systematic bias between methods in the estimation of urinary albumin concentration . The slope of the fitted regression between the values obtained from each of the assays did not differ significantly from unity, nor did an intercept term differ significantly from zero . Mydriatic seven - field stereoscopic fundal photography was performed using a topcon fundus camera (trc50-vt; tokyo - optical, tokyo, japan) using film and, subsequently, digital photography (16). Camera settings, including angle of retinal photography, remained unchanged . All film images prior to september 2004 were individually scanned in a high - resolution scanner (3071 2048 pixels) in raw format to avoid pixel and color compression (canoscan fs2710; canon, tokyo, japan). Each image was selected and deemed appropriate for retinal vascular geometry grading by a single grader (m.b.s . ). Retinopathy was assessed by a single ophthalmologist masked to participants clinical characteristics, according to the modified airlie house classification (12). Incident retinopathy was defined as at least one microaneurysm / hemorrhage in either eye (early treatment of diabetic retinopathy study [etdrs] level 21, minimal nonproliferative diabetic retinopathy or greater). Right - eye, digitized retinal photographs of each patient were analyzed by a single grader (m.b.s . ), masked to participants characteristics, using a semiautomated, computer - assisted image program (singapore i vessel assessment or siva) as previously described (14,15). The software then combined the individual measurements into summary indices: ldr was calculated as the length from the midpoint of the first branch to the midpoint of the second branch, divided by the diameter of the parent vessel at the first branch . St was calculated as the ratio between the actual path length of the vessel segment (measured by tracking) and the straight - line length of the same segment . Retinal vessel caliber measurements, represented by the central retinal arteriolar equivalent (crae) and the central retinal venular equivalent (crve), were calculated as previously described (17). Branching angle in degrees () represented the angle between two daughter vessels (18). For quality control of retinal vascular measures, we performed intragrader reliability analysis on 120 randomly selected images to which the grader was masked . The intragrader correlation coefficients (iccs) for each parameter were as follows: ldrv 0.80, arteriolar ldr 0.84, stv 0.81, arteriolar st 0.96, crae 0.79, crve 0.89, arteriolar branching angle 0.65, and venular branching angle 0.4 . The population was classified into three groups: 1) normal renal function throughout the study (n = 337); 2) incident renal dysfunction (n = 174), and 3) renal dysfunction at baseline (n = 155). The latter group was excluded from multivariate analyses exploring predictors of incident nephropathy, leaving 511 participants . Descriptive statistics are presented as mean and sd for normally distributed data or median and iqr for skewed distributions . Anova was used to determine differences between renal function groups with tukey test for post hoc analysis for normally distributed variables . The kruskal - wallis test was used to examine between group differences for skewed data, and differences in categorical variables were compared using the test (table 1). The effect of diabetes duration on retinal vascular measures was explored by comparing groups with shorter (5 years) and longer (> 5 years) diabetes duration using independent sample student t tests (table 2). Cox proportional hazard regression analysis was used to study threshold effects for ldr and st using quartiles as predictors of time to development of early renal dysfunction and retinopathy . Predictive gee univariate and multivariate models longitudinal analysis was performed using generalized estimating equations (gees) with presence of renal dysfunction at the respective visit as the outcome variable . Predictive models were fitted to explore the association between retinal vascular geometry and development of renal dysfunction (aer> 7.5 g / min) for those with normal renal function at baseline (n = 511). The use of gee allowed all visits to be included in the analysis and accounted for correlations between repeated observations for a given patient . Age, sex, diabetes duration, a1c, systolic blood pressure (sbp) sds, diastolic blood pressure (dbp) sds, bmi sds, total cholesterol, and insulin therapy intensity (as a binary variable multiple daily injections (mdis) greater than or equal to four insulin injections per day versus less than four) were included in the models as explanatory variables . Baseline arteriolar and venular st and ldr were log transformed for analysis as continuous variables and categorized into quartiles to examine for threshold effects . Results of significant variables in gee models are reported as odds ratio (or) and 95% cis, and results of cox regression are reported as hazard ratio (hr) and 95% ci . Statistical procedures were performed using pasw version 18.0 (2009 spss inc ., chicago, il). Incident renal dysfunction was defined as an aer> 7.5 g / min from three overnight, timed urine collections . This cutoff is above the 95th percentile of the normal adolescent population and predictive of microalbuminuria (3,4). Urinary albumin was measured using a polyclonal radioimmunoassay (pharmacia ria, uppsala, sweden) from 1997 to march 2000, changed to nephelemetry (immage analyzer; beckman coulter, sydney, australia) until 2003, and then changed to immulite analyzer (siemans, los angeles, ca) from 2004 onwards . A cross - validation analysis found no significant differences or systematic bias between methods in the estimation of urinary albumin concentration . The slope of the fitted regression between the values obtained from each of the assays did not differ significantly from unity, nor did an intercept term differ significantly from zero . Mydriatic seven - field stereoscopic fundal photography was performed using a topcon fundus camera (trc50-vt; tokyo - optical, tokyo, japan) using film and, subsequently, digital photography (16). All film images prior to september 2004 were individually scanned in a high - resolution scanner (3071 2048 pixels) in raw format to avoid pixel and color compression (canoscan fs2710; canon, tokyo, japan). Each image was selected and deemed appropriate for retinal vascular geometry grading by a single grader (m.b.s . ). Retinopathy was assessed by a single ophthalmologist masked to participants clinical characteristics, according to the modified airlie house classification (12). Incident retinopathy was defined as at least one microaneurysm / hemorrhage in either eye (early treatment of diabetic retinopathy study [etdrs] level 21, minimal nonproliferative diabetic retinopathy or greater). Right - eye, digitized retinal photographs of each patient were analyzed by a single grader (m.b.s . ), masked to participants characteristics, using a semiautomated, computer - assisted image program (singapore i vessel assessment or siva) as previously described (14,15). The software then combined the individual measurements into summary indices: ldr was calculated as the length from the midpoint of the first branch to the midpoint of the second branch, divided by the diameter of the parent vessel at the first branch . St was calculated as the ratio between the actual path length of the vessel segment (measured by tracking) and the straight - line length of the same segment . Retinal vessel caliber measurements, represented by the central retinal arteriolar equivalent (crae) and the central retinal venular equivalent (crve), were calculated as previously described (17). Branching angle in degrees () represented the angle between two daughter vessels (18). For quality control of retinal vascular measures, we performed intragrader reliability analysis on 120 randomly selected images to which the grader was masked . The intragrader correlation coefficients (iccs) for each parameter were as follows: ldrv 0.80, arteriolar ldr 0.84, stv 0.81, arteriolar st 0.96, crae 0.79, crve 0.89, arteriolar branching angle 0.65, and venular branching angle 0.4 . The population was classified into three groups: 1) normal renal function throughout the study (n = 337); 2) incident renal dysfunction (n = 174), and 3) renal dysfunction at baseline (n = 155). The latter group was excluded from multivariate analyses exploring predictors of incident nephropathy, leaving 511 participants . Descriptive statistics are presented as mean and sd for normally distributed data or median and iqr for skewed distributions . Anova was used to determine differences between renal function groups with tukey test for post hoc analysis for normally distributed variables . The kruskal - wallis test was used to examine between group differences for skewed data, and differences in categorical variables were compared using the test (table 1). The effect of diabetes duration on retinal vascular measures was explored by comparing groups with shorter (5 years) and longer (> 5 years) diabetes duration using independent sample student t tests (table 2). Cox proportional hazard regression analysis was used to study threshold effects for ldr and st using quartiles as predictors of time to development of early renal dysfunction and retinopathy . Predictive gee univariate and multivariate models longitudinal analysis was performed using generalized estimating equations (gees) with presence of renal dysfunction at the respective visit as the outcome variable . Predictive models were fitted to explore the association between retinal vascular geometry and development of renal dysfunction (aer> 7.5 g / min) for those with normal renal function at baseline (n = 511). The use of gee allowed all visits to be included in the analysis and accounted for correlations between repeated observations for a given patient . Age, sex, diabetes duration, a1c, systolic blood pressure (sbp) sds, diastolic blood pressure (dbp) sds, bmi sds, total cholesterol, and insulin therapy intensity (as a binary variable multiple daily injections (mdis) greater than or equal to four insulin injections per day versus less than four) were included in the models as explanatory variables . Baseline arteriolar and venular st and ldr were log transformed for analysis as continuous variables and categorized into quartiles to examine for threshold effects . Results of significant variables in gee models are reported as odds ratio (or) and 95% cis, and results of cox regression are reported as hazard ratio (hr) and 95% ci . Statistical procedures were performed using pasw version 18.0 (2009 spss inc ., chicago, il). At baseline, median age was 13.5 (iqr 12.814.9) years and diabetes duration 4.8 (3.37.5) years . Those with renal dysfunction at baseline were older and had higher aer, a1c, sbp, and dbp than the other groups (table 1). Overall baseline crae was smaller in those who had renal dysfunction at baseline, whereas crve was not significantly different . In the incident renal dysfunction group, arteriolar branching angle was significantly greater among those with longer diabetes duration, whereas venular branching angles did not differ (table 1). Of the 511 participants with normal aer at baseline, median follow - up was 3.7 (iqr 2.35.7) years, with 3.0 (2.04.0) visits per participant and 1,898 clinical assessments . Incident renal dysfunction was evident in 34%; those who developed incident renal dysfunction had higher mean baseline aer (p <0.001) and were generally younger (p = 0.02) than those who had normal aer throughout follow - up . No significant differences were observed with respect to sex distribution, diabetes duration, bp sds, bmi sds, insulin therapy intensity, or glycemic control (a1c) between these groups (table 1). A greater proportion of those who developed incident renal dysfunction also developed incident retinopathy (p <0.001). There was no significant correlation between ldrv and stv (pearson correlation 0.04, p = 0.4). In cox proportional hazard regression analysis (n = 511), ldrv in the highest quartile (hr 2.0 [95% ci 1.32.9]), stv in the lowest quartile (1.5 [1.12.1]), and higher dbp sds and a1c were associated with a higher cumulative risk of early renal dysfunction (fig . 1). There were no significant differences in risk between quartiles 13 for ldrv and quartiles 24 for stv . A: cumulative hazard curves for risk of early renal dysfunction by ldrv quartiles: quartile 4 vs. quartiles 13 (hr 2.0 [95% ci 1.32.9]) adjusted for sex, a1c, and dbp sds . B: cumulative hazard curves for risk of early renal dysfunction by stv: quartile 1 vs. quartiles 24 (1.5 [1.12.1]) adjusted for sex, a1c, and dbp sds . In univariate gee analysis (n = 511), log - ldrv, as a continuous variable, predicted incident renal dysfunction (or 1.9), whereas log - stv as a continuous variable, was not statistically significant (or 1.00 [95% ci 0.981.01]; p = 0.4). When analyzing for a threshold effect, those in the highest ldrv quartile (or 1.5) and lowest stv quartile (or 1.5) were at greater risk of incident renal dysfunction . Other significant risk factors for incident renal dysfunction included longer diabetes duration, higher a1c, and male sex (table 2). In multivariate gee analysis, log - ldrv predicted incident renal dysfunction (or 2.4) after adjusting for age, sex, diabetes duration, a1c, dbp sds, bmi, and total cholesterol . When analyzing for a threshold effect, those in the highest ldrv quartile (or 1.7) and lowest stv quartile (or 1.6) were at greater risk of incident renal dysfunction (table 2). In this longitudinal study of young people with type 1 diabetes, normal aer, and no retinopathy at baseline, greater retinal venular ldr and lower venular tortuosity predicted incident renal dysfunction independent of established risk factors including diabetes duration, glycemic control, bp, and total cholesterol . We also confirmed our recent findings that lower arteriolar ldr and greater arteriolar tortuosity were associated with incident retinopathy (data not shown) (14). We recently proposed that, in the diabetic milieu, neuroretinal hypoxia leads to a compensatory increase in afferent blood flow through increased vessel density (earlier arteriolar branching resulting in lower arteriolar ldr) and a corresponding increase in arteriolar tortuosity (14). Although this described the afferent changes in blood flow, it is important to understand the adaptations at the efferent (venular) end and their significance . Whereas arteriolar changes may best represent localized organ tissue changes (14,15) determinants of resistance to blood flow within a vascular network include the individual blood vessel size (caliber and length), the organization of the vascular network (series and parallel), and the flow characteristics (laminar versus turbulent). Although the microcirculation provides most of the systemic vascular resistance, it has low reynolds numbers and therefore turbulence at this level is unlikely to occur . In this setting, hydrostatic and oncotic pressures, viscosity, and wall shear stress would be most influential . Hyperglycemia causes significant hemodynamic and rheological changes (19), including increased retinal blood flow (20) and blood viscosity (19). Furthermore, changes to particulate components of blood include greater platelet aggregation (19) and increased leukocyte numbers with higher integrin - mediated adhesion properties promoting leukostasis (11). We propose that decreased venular network complexity together with early vascular tone dysregulation and non - newtonian influences contribute to increased capillary hydrostatic pressure, greater wall shear stress, and vessel damage . Thus, individuals with a simplified venular network may be at greater risk of microvascular complications such as renal dysfunction . Baseline characteristics (table 1) demonstrated overall narrower arteriolar calibers in those with renal dysfunction . However, longer diabetes duration was associated with wider vessel calibers (both arteriolar and venular). This may describe the natural history of microvascular changes in diabetes: 1) early impairment of microvascular autoregulation with inappropriate vasoconstriction, 2) subsequent compensatory dilation, 3) loss of smooth muscle cells and pericytes (or podocytes in the kidney), and 4) loss of wall structural integrity and, finally, irreversible dilation . Early hyperglycemia results in a downregulation of large - conductance, calcium - activated potassium channels necessary for vascular smooth muscle cell relaxation, leading to early vasoconstriction and neuroretinal hypoxia (21). Diabetic rat models demonstrated a similar dysregulation in the renal microvasculature early in diabetes with severe insulin deficiency . It has been speculated that tissue hypoxia beyond a certain threshold may override the vasoconstrictive effect of diabetes (12). Finally, large population - based studies associated wider retinal venules with proteinuria in adults with type 1 diabetes of longer duration (13). Changes in vessel caliber are most influential in the acute regulation of blood flow . According to the poiseuille equation, vessel resistance is inversely proportional to the vessel radius to the fourth power (r). Thus, even small changes in the diameter of arterioles and venules can lead to significant changes in blood flow and capillary pressures . Capillary hypertension has been associated with both retinopathy (12) and nephropathy (22). Classical renal micropuncture studies demonstrated that glomerular hypertension ensued in diabetes models even in the setting of normal bp (23). Diabetes led to an impairment of glomerular circulatory autoregulation, with greater vasodilatation of the afferent arteriole than the efferent arteriole, which resulted in greater intraglomerular capillary pressure (23). Ultimately, this exposes the glomeruli to increased intracapillary pressure, increased shear stress, and mechanical stretch . Mechanical stretch has been observed to favor an accumulation of extracellular matrix (24) and a decrease in podocyte number through effects on cell proliferation, apoptosis, and cell adhesion to the basement membrane (22). In this setting, even minor increments in systemic bp would exacerbate glomerular hypertension in a self - perpetuating cycle of ongoing hypertensive injury with impaired microvascular autoregulation . The efficacy of ace inhibitors in retarding the progression of dn may in part be due to their vasodilatory effect on the efferent glomerular arteriole, thus decreasing glomerular capillary pressure (25). Although we observed higher bp in those with baseline renal dysfunction (table 1), bp measured at each visit did not predict renal dysfunction in gee longitudinal analysis (table 2). A longer follow - up period may be required to examine this relationship with adequate statistical power . In our study, a1c was an independent predictor of early renal dysfunction in keeping with previous reports (26). Loss of capillary autoregulation, higher glomerular capillary pressure, and decrease in podocytes are related to the severity and chronicity of hyperglycemia (22). This study of normotensive young people with no intercurrent medications provides an insight into the preclinical renal dysfunction associated with diabetes and may assist in identifying those at greatest risk where early intervention may yield greatest benefit . The lack of a statistically significant association between bp and incident renal dysfunction in our multivariate models contrasts with previous findings regarding retinopathy (27). It is noteworthy that a significantly greater proportion of those who developed incident renal dysfunction also developed incident retinopathy . Thus, changes in bp may only become apparent later in the course of renal disease where capillary bed autoregulation may no longer be able to compensate for metabolic demands . This also suggests that retinal hypoxic demands may have a greater influence in bp autoregulation than changes in renal microvasculature . This is consistent with our previous observations between bp and retinopathy in young people with type 1 diabetes (27). Our findings suggest that a simplified venular network (i.e., greater ldrv and lower stv) results in a greater risk of early renal dysfunction . As previously described, lower ldr can result from shorter axial length due to earlier branching points and/or wider vessel calibers (14). Our current software does not report vessel length; however, our results suggest venular axial length was increased in view of the wider venules observed with longer diabetes duration . These early venular differences may represent greater tissue metabolic demands, mechanical stress, and an increased propensity for early nephropathy . Our measures of tortuosity and ldr had good reproducibility; however, branching angles are particularly vulnerable to parallax error as reflected in the relatively low intraobserver correlation . Not unexpectedly, therefore, there were no significant associations in gee models between branching angles and renal dysfunction . The strengths of this study include the longitudinal design, a large patient cohort with multiple visits per individual, and standardized, quantitative evaluation of retinal vascular measures by a single grader masked to participants clinical status . Our young cohort without comorbidities avoids confounders present in older groups with established complications and medical therapy . The use of gees allowed inclusion of every available patient visit in the analysis and accounts for uneven follow - up and missing data . The reproducibility of ldr and st measures (iccs ranging from 0.80 to 0.96) was comparable with retinal vascular caliber measurements in the atherosclerosis risk on community study (iccs ranging from 0.79 to 0.83) (28). This cohort from a tertiary referral center may be biased toward closer monitoring, tighter metabolic control, and, thus, underrepresentation of early renal dysfunction; conversely, this underscores the robust nature of the measures studied . Limitations of our measurements include the use of the central retinal field only and the lack of reporting absolute values for vessel length . Therefore, we cannot generalize our findings to the whole microvascular bed involving peripheral retinal areas that need further study both structurally and functionally . The spherical nature of the retinal surface cannot be accurately assessed in two - dimensional photographs and has an inherent degree of parallax error when evaluating branching angles . Nevertheless, our results demonstrate the potential utility of novel quantitative measurements of retinal vascular geometry from this central field, which is practical and reproducible, in people with diabetes . In summary, retinal vascular geometry parameters, specifically retinal venular ldr and tortuosity, are independent predictors of incident renal dysfunction in young people with type 1 diabetes . These noninvasive retinal measures may further our understanding of early mechanistic pathways for microvascular complications . Our study highlights the role of venular ldr and tortuosity as tools for risk stratification of individuals at high risk for microvascular complications, and in monitoring of disease progression and therapeutic benefits.
Human islets were obtained from donors of both sexes, of ages ranging from 5 to 70 years and with a majority being in the 2050 year range, and with purity ranging from 5095%, through the islet cell resource centers (icrs) and juvenile diabetes research foundation basic science islet distribution programs . Human kidney cell lines, hkc8, and 293 with or without human pth1r cdna were used as controls for pth1r expression . Adenovirus (ad) constructs with cdnas were generated (8) including those for -galactosidase (lacz), cre recombinase, and green fluorescent protein, which were used as controls . For cell - cycle analysis, human islets transduced with ad constructs for 72 h were dispersed into single cells and 10,000 cells were analyzed on a bd lsr ii flow cytometer (becton dickinson biosciences, san jose, ca). Data analysis was performed using modfit lt 3.0 software (verity software house, topsham, me). -cell proliferation was analyzed on either ad - transduced or peptide - treated dispersed human islet cultures stained for dapi, bromodeoxyuridine (brdu), and insulin using olympus fluoview confocal or olympus provis fluorescence microscopes (8). Insulin release from uninfected, pthrp(1 - 36) treated, and ad - transduced islets was measured in triplicate from human islets either transduced with ad constructs for 24 h or treated with 100 nmol / l of pthrp(1 - 36) for 24 h for insulin content or 30 min for gsis (8). Briefly, uninfected or islets transduced with ad for 24 h were preincubated in krebs - ringer bicarbonate buffer supplemented with 10 mmol / l hepes, 1% bsa, and 5 mmol / l glucose for 1 h at 37c in a 5% co2 incubator . After washing the islets once with the same solution, groups of 15 islet equivalents (ieqs) for each condition were incubated in 1 ml fresh krebs - ringer bicarbonate buffer plus 1% bsa and 5.5 or 22 mmol / l glucose . Pthrp peptide or vehicle was added to the islets at the same time as the glucose and incubated for 30 min, after which buffer was removed and frozen at 20c until insulin measurement by radioimmunoissay (ria) (linco research, st . Islets were then digested overnight in naoh at 37c, and protein was measured by the bradford method after neutralization with hcl . Results are expressed as a percentage of insulin concentration obtained with uninfected islets incubated at 5.5 mmol / l glucose . Insulin content was measured by radioimmunoassay on acid ethanol extracts of human islets either transduced with ad - control or ad - pthrp or treated with vehicle or 100 nmol / l of pthrp(1 - 36) peptide for 24h (8,17). Gene expression in whole islets was analyzed by real - time pcr performed on an abi 7300 system and western blot analysis on 2050 g extracts using the image j program (nih) for quantitative densitometry (8). Pthrp(1 - 36) was quantitated using an immunoradiometric assay or an enzyme immunoassay (peninsula laboratories, san carlos, ca). Statistical significance considered at p <0.05 was determined by an unpaired two - tailed student's t test or a one - way anova with tukey's honestly significant difference post hoc test . Additional details regarding research design and methods are available in an online appendix (http://diabetes.diabetesjournals.org/cgi/content/full/db09-1796/dc1). Human islets were obtained from donors of both sexes, of ages ranging from 5 to 70 years and with a majority being in the 2050 year range, and with purity ranging from 5095%, through the islet cell resource centers (icrs) and juvenile diabetes research foundation basic science islet distribution programs . Human kidney cell lines, hkc8, and 293 with or without human pth1r cdna were used as controls for pth1r expression . Adenovirus (ad) constructs with cdnas were generated (8) including those for -galactosidase (lacz), cre recombinase, and green fluorescent protein, which were used as controls . For cell - cycle analysis, human islets transduced with ad constructs for 72 h were dispersed into single cells and 10,000 cells were analyzed on a bd lsr ii flow cytometer (becton dickinson biosciences, san jose, ca). Data analysis was performed using modfit lt 3.0 software (verity software house, topsham, me). -cell proliferation was analyzed on either ad - transduced or peptide - treated dispersed human islet cultures stained for dapi, bromodeoxyuridine (brdu), and insulin using olympus fluoview confocal or olympus provis fluorescence microscopes (8). Insulin release from uninfected, pthrp(1 - 36) treated, and ad - transduced islets was measured in triplicate from human islets either transduced with ad constructs for 24 h or treated with 100 nmol / l of pthrp(1 - 36) for 24 h for insulin content or 30 min for gsis (8). Briefly, uninfected or islets transduced with ad for 24 h were preincubated in krebs - ringer bicarbonate buffer supplemented with 10 mmol / l hepes, 1% bsa, and 5 mmol / l glucose for 1 h at 37c in a 5% co2 incubator . After washing the islets once with the same solution, groups of 15 islet equivalents (ieqs) for each condition were incubated in 1 ml fresh krebs - ringer bicarbonate buffer plus 1% bsa and 5.5 or 22 mmol / l glucose . Pthrp peptide or vehicle was added to the islets at the same time as the glucose and incubated for 30 min, after which buffer was removed and frozen at 20c until insulin measurement by radioimmunoissay (ria) (linco research, st . Islets were then digested overnight in naoh at 37c, and protein was measured by the bradford method after neutralization with hcl . Results are expressed as a percentage of insulin concentration obtained with uninfected islets incubated at 5.5 mmol / l glucose . Insulin content was measured by radioimmunoassay on acid ethanol extracts of human islets either transduced with ad - control or ad - pthrp or treated with vehicle or 100 nmol / l of pthrp(1 - 36) peptide for 24h (8,17). Gene expression in whole islets was analyzed by real - time pcr performed on an abi 7300 system and western blot analysis on 2050 g extracts using the image j program (nih) for quantitative densitometry (8). Pthrp(1 - 36) was quantitated using an immunoradiometric assay or an enzyme immunoassay (peninsula laboratories, san carlos, ca). <0.05 was determined by an unpaired two - tailed student's t test or a one - way anova with tukey's honestly significant difference post hoc test . Additional details regarding research design and methods are available in an online appendix (http://diabetes.diabetesjournals.org/cgi/content/full/db09-1796/dc1). Pthrp mrna and protein are expressed in human islets and insulinomas (5,13,14). However, whether the receptor for pthrp, pth1r, is expressed in human islets is unknown . We analyzed the expression of pth1r mrna by real - time pcr in human islets using hkc8, a human kidney cell line with high pth1r expression, as a positive control and 293 cells that lack pth1r expression as a negative control . Importantly, pth1r is expressed in human -cells, demonstrated by costaining of human islet cell cultures for pth1r and insulin (fig . Pth1r and pthrp expression in human islets . A: pth1r mrna expression measured by real - time pcr in three human islet preps (h1h3); hkc8, a human kidney proximal tubule cell line, used as positive control; and the human embryonic kidney cell line 293, used as negative control . B: western blot analysis of pth1r and actin expression in a positive (+) control line (293 cells stably transfected with human pth1r cdna) and two human islet preps (h1 and h2) uninfected (u) or transduced with ad - lacz (l) or ad - pthrp (p). The line divides samples run on two different gels . C: photomicrograph of human islet cell cultures costained for nuclear dapi (blue), pth1r (green), and insulin (red). D: representative western blot analysis of pthrp and actin in human islets either uninfected (u) or transduced with ad - lacz (l), ad - pthrp (p), or ad-sp mutant (s). The line divides samples from different regions run on the same gel . E: quantitation of pthrp(1 - 36) by immunoradiometric assay in medium collected after 48 h of transduction of human islets with adenoviral constructs containing lacz, pthrp, or sp sequences (n = 2 islet preparations). F: representative images of human islet cell cultures transduced with ad - lacz, ad - pthrp, or ad-sp and costained for dapi (blue), insulin (green), and ha (red). (a high - quality digital representation of this figure is available in the online issue .) To overexpress pthrp in human islets, an ad construct containing hemagglutinin (ha)-tagged human pthrp cdna was transduced into islets . Ad - pthrp transduced human islets display increased pthrp expression relative to uninfected and ad - lacz transduced islets as demonstrated by western blot using pthrp antibody (fig . Furthermore, pthrp overexpression did not result in downregulation of pth1r expression in human islets (fig . 1b). Since pthrp is a secreted protein, we measured its concentration in medium from human islets transduced with ad - pthrp or ad - lacz . Pmol / l, in medium from ad - pthrp infected islets versus ad - lacz infected islets (4 pmol / l) (fig . Finally, pthrp is expressed in -cells of ad - pthrp transduced human islet cell cultures demonstrated by coimmunostaining with ha and insulin antibodies (fig . We examined the effect of pthrp overexpression on human -cell proliferation by costaining human islet cell cultures transduced with ad - pthrp or ad - control with brdu and insulin antibodies (fig . There was a significant, approximately threefold, increase in human -cell proliferation induced by pthrp compared with ad - control transduced or uninfected human islet cell cultures (fig . A: representative confocal images of human islet cell cultures transduced with ad - control (i) or ad - pthrp (ii iv) and costained for insulin (green, panel b), brdu (red, panel c), and dapi (blue, panel d). The merged images of all three stainings are shown in panel a, merge for dapi and brdu in panel e, and merge for insulin and brdu in panel f. b: quantitation of the percentage of brdu - positive -cells from human islet cell cultures uninfected (ui) or transduced with the adenovirus (adv) constructs control (ctrl), pthrp, or sp for 72 h or treated with 100 nmol / l of either 1 - 36 or 38 - 94 pthrp peptides for 24 h. there was a significant two- to threefold increase in -cell proliferation in pthrp - transduced and 1 - 36treated vs. ad - control transduced or uninfected control islet cells . Basal rate of -cell proliferation in uninfected controls was 0.08 0.03% (n = 411 individual human islet preps at least in duplicate). * p <0.05 vs. uninfected or ad - control by student's t test; #p <0.001 vs. ad - control or ad-sp and & p <0.01 vs. ui or 38 - 94 by one - way anova . C: expression of differentiation markers by real - time pcr from human islets treated for 24 h with vehicle control (ctrl) or pthrp(1 - 36) peptide (gray bars). Pcr cycles for each gene were compared, with actin used as an internal control . The graph is depicted as fold over control, with values from vehicle - treated islets taken as 1 (n = 47 human islet preparations in duplicate). D: insulin content per ieq in extracts of human islets treated with vehicle (veh) or 100 nmol / l pthrp(1 - 36) peptide or transduced with ad - control (ctrl) or ad - pthrp for 24 h (n = 5 human islet preparations in triplicate). E and f: insulin secretion measured at 5.5 and 22 mmol / l glucose from human islets transduced with ad - control or ad - pthrp for 24 h (e) and treated with vehicle or 100 nmol / l pthrp(1 - 36) peptide for 30 min (f). Insulin secretion is depicted as percentage of vehicle - treated control at 5.5 mmol / l glucose, which was 455.4 109.3 pg/g protein in 30 min . N = 78 human islet preparations in triplicate . * p <0.05 vs. insulin secretion at 5.5 mmol / l glucose with the same treatment; #p <0.05 vs. insulin secretion at equivalent glucose concentrations of control . (a high - quality digital representation of this figure is available in the online issue .) Based on studies in rodent -cells, we evaluated whether secreted pthrp is required for human -cell proliferation by transducing human islets with ad-sp, a ha - tagged nonsecretory pthrp mutant that lacks the sp . As expected, secreted pthrp levels in the medium were much lower in ad-sp (22 pmol / l) versus ad - pthrp transduced (600 pmol / l) human islets (fig . However, pthrp levels in islet extracts from ad-sp were at least comparable with ad - pthrp transduced human islets (fig . Moreover, pthrp was expressed in the -cells of ad-sp transduced human islet cultures as shown by ha and insulin costaining (fig . Despite abundant intracellular pthrp, ad-sp did not stimulate proliferation of human -cells relative to uninfected and ad - control infected islet cells (fig . 2b), demonstrating that secreted pthrp is important for mediating human -cell proliferation . To determine which specific secretory form of pthrp induces human -cell proliferation, human islet cultures were treated for 24 h with 100 nmol / l of either amino - terminal pthrp(1 - 36) or mid - region pthrp(38 - 94) peptide . There was a significant twofold increase in human -cell proliferation only with pthrp(1 - 36) and not with pthrp (3894) (fig . The concentration of pthrp(1 - 36) remaining in the culture medium of ad - transduced and peptide - treated human islet cell cultures was measured at the end of the experiments . Cells treated with vehicle or ad - control had undetectable pthrp(1 - 36), whereas ad - pthrp transduced cells had 469.8 57.4 pg / ml (117.5 pmol / l) and pthrp(1 - 36)treated cells had 245.1 20.6 ng / ml (61.25 nmol / l) of pthrp(1 - 36) in the culture media (n = 45 human islet cultures). Since induction of proliferation of human -cells can lead to their dedifferentiation (17), we examined mrna transcripts encoding differentiation markers in human islets treated with vehicle or pthrp(1 - 36). There was no change in transcripts encoding islet hormones (insulin, glucagon, and somatostatin), glucose sensors (glut-2 and glucokinase), or transcription factors important for -cell differentiation and function (pdx1, mafa, mafb, nkx6.1, nkx2.2, neurod, and isl1) with pthrp(1 - 36) treatment (fig . Either transduction with ad - pthrp or treatment with pthrp(1 - 36) for 24 h did not affect the insulin content in islets (fig . Whether pthrp affects human -cell function was evaluated by measuring insulin secretion from human islets transduced for 24 h with ad - pthrp or treated for 30 min with pthrp(1 - 36) peptide . There was no change in basal insulin secretion at 5.5 mmol / l glucose, and there was a small (27%) but not significant increase in insulin secretion at 22 mmol / l glucose from ad - pthrp versus ad - control transduced islets (fig . 2e), suggesting that ad - pthrp does not negatively impact human -cell function . On the other hand, pthrp(1 - 36) peptide caused a significant increase in insulin secretion at 5.5 mmol / l glucose (36%), with a further enhancement at 22 mmol thus, pthrp(1 - 36) enhances insulin secretion in human islets at both physiological and pathophysiological glucose concentrations . To begin to assess the molecular mechanisms of pthrp - induced human -cell proliferation, we measured expression of the g1/s cell cycle regulators . There was no significant change in the level of mrna expression of any of the cyclins (cyclin d13, e12, and a12), cyclin - dependent kinases (cdks) (1,2,4,6), cyclin inhibitory proteins / kinase inhibitory proteins (cip / kip) (p21, p27, and p57) or the inhibitor of kinase (ink) (p16, p18, and p19) family of inhibitors examined with pthrp(1 - 36) treatment (fig . Pthrp increases expression of cyclin (cyc) e and cdk2 proteins but not mrna in human islets . A: expression of g1/s cell cycle regulators by real - time pcr from human islets treated for 24 h with vehicle control (ctrl) or pthrp(1 - 36) peptide (gray bars). Pcr cycles for each gene were compared, with actin used as an internal control . The graph is depicted as fold over control, with values from vehicle - treated islets taken as 1 (n = 47 human islet preparations in duplicate). B: representative western blot analysis of the g1/s cell cycle activators and inhibitors from human islets treated for 24 h with vehicle (veh) or pthrp(1 - 36) using actin or tubulin as the internal housekeeping (hk) gene control . Quantitation of the ratio of cyclin e / hk (c) and cdk2/hk protein (d) shows a significant increase in both these proteins in pthrp(1 - 36)treated islets vs. control (veh), depicted as 100% . However, given that cell cycle molecules could be regulated posttranscriptionally, we examined the effect of pthrp(1 - 36) on the expression of g1/s cell - cycle proteins by western blot . There was no change in expression of the early g1/s cell - cycle activators cyclins d1/3 or cdk4/6 or in the ink and cip / kip inhibitors p16, p18, p21, p27, and p57 (fig ., the late g1/s cell cycle activator proteins cyclin e (fig . 3b and c) and cdk2 (fig . 3b and d) were significantly increased, by twofold, in pthrp - treated human islets . To ascertain whether expression of cyclin e and/or cdk2 per se can drive human -cell proliferation, these proteins were overexpressed in human islets by transduction with ad - cdk2/ad - cyclin e, relative to uninfected and ad - control transduced islets (fig . 4b) revealed a significant 2.5-fold increase in the percentage of cells in the s - phase of the cell cycle in ad - cdk2/ad cyclin e transduced whole human islets compared with uninfected or ad - control transduced human islets (fig . A: western blot analysis of human islets uninfected (ui) or transduced with ad - control (ad - ctrl) or a combination of ad - cdk2/ad - cyclin e for expression of cdk2, cyclin e, and actin as an internal control . Representative cell cycle phase distribution profiles (b) and percentage of cells in s - phase (c) of the cell cycle of uninfected, ad - control, or ad - cdk2/ad - cyclin e transduced human islet cells analyzed using flow cytometry . The percentage of cells in the g1-phase was reduced, although not significantly, in ad - cdk2/ad - cyclin e transduced (g1: 91.1 1.0%, g2/m: 5.4 1.2%) vs. uninfected (g1: 93.0 1.3%, g2/m: 5.4 1.2%) and ad - control transduced (g1: 94.0 1.0%, g2/m: 4.6 0.9%) human islets, whereas the percentage of cells in s - phase of the cell cycle in ad - cdk2/ad - cyclin e transduced human islets was significantly greater compared with uninfected or ad - control transduced human islets (n = 10 human islet preparations). D: representative images of human islet cell cultures transduced with 100 moi of ad - control, 50 moi of ad - control plus 50 moi of ad - cdk2, or 50 moi of ad - cyclin e and 50 moi each of ad - cdk2 and ad - cyclin e and costained for dapi (blue), insulin (green), and brdu (red). E: quantitation of the percentage of brdu - positive -cells from human islet cell cultures transduced with the ad constructs described for c. there was a significant 5-fold and 16-fold increase in -cell proliferation in cyclin e and cdk2/cyclin e vs. ad - control transduced islet cells, respectively . Basal rate of -cell proliferation in controls was 0.17 0.06%, taken as 100% . N = 9; 3 human islet preparations in triplicate . * p <0.01 vs. control by student's t test; #p <0.001 vs. the other three groups by one - way anova . (a high - quality digital representation of this figure is available in the online issue .) To independently confirm these observations and to demonstrate whether human -cell proliferation was induced by cyclin e and/or cdk2, staining for insulin, brdu, and dapi was performed on human islet cultures (fig . However, expression of cyclin e alone caused a significant fivefold increase in human -cell proliferation compared with control cells . Cyclin e and cdk2 together caused a substantive synergistic 16-fold increase in human -cell proliferation over cells transduced with equivalent multiplicity of infection (moi) of control virus and also a significant increase over cells transduced with ad - cdk2 or ad - cyclin e alone (fig . Pthrp mrna and protein are expressed in human islets and insulinomas (5,13,14). However, whether the receptor for pthrp, pth1r, is expressed in human islets is unknown . We analyzed the expression of pth1r mrna by real - time pcr in human islets using hkc8, a human kidney cell line with high pth1r expression, as a positive control and 293 cells that lack pth1r expression as a negative control . Importantly, pth1r is expressed in human -cells, demonstrated by costaining of human islet cell cultures for pth1r and insulin (fig . Pth1r and pthrp expression in human islets . A: pth1r mrna expression measured by real - time pcr in three human islet preps (h1h3); hkc8, a human kidney proximal tubule cell line, used as positive control; and the human embryonic kidney cell line 293, used as negative control . B: western blot analysis of pth1r and actin expression in a positive (+) control line (293 cells stably transfected with human pth1r cdna) and two human islet preps (h1 and h2) uninfected (u) or transduced with ad - lacz (l) or ad - pthrp (p). The line divides samples run on two different gels . C: photomicrograph of human islet cell cultures costained for nuclear dapi (blue), pth1r (green), and insulin (red). D: representative western blot analysis of pthrp and actin in human islets either uninfected (u) or transduced with ad - lacz (l), ad - pthrp (p), or ad-sp mutant (s). The line divides samples from different regions run on the same gel . E: quantitation of pthrp(1 - 36) by immunoradiometric assay in medium collected after 48 h of transduction of human islets with adenoviral constructs containing lacz, pthrp, or sp sequences (n = 2 islet preparations). F: representative images of human islet cell cultures transduced with ad - lacz, ad - pthrp, or ad-sp and costained for dapi (blue), insulin (green), and ha (red). (a high - quality digital representation of this figure is available in the online issue .) To overexpress pthrp in human islets, an ad construct containing hemagglutinin (ha)-tagged human pthrp cdna was transduced into islets . Ad - pthrp transduced human islets display increased pthrp expression relative to uninfected and ad - lacz transduced islets as demonstrated by western blot using pthrp antibody (fig . Furthermore, pthrp overexpression did not result in downregulation of pth1r expression in human islets (fig . 1b). Since pthrp is a secreted protein, we measured its concentration in medium from human islets transduced with ad - pthrp or ad - lacz . Pmol / l, in medium from ad - pthrp infected islets versus ad - lacz infected islets (4 pmol / l) (fig . Finally, pthrp is expressed in -cells of ad - pthrp transduced human islet cell cultures demonstrated by coimmunostaining with ha and insulin antibodies (fig . We examined the effect of pthrp overexpression on human -cell proliferation by costaining human islet cell cultures transduced with ad - pthrp or ad - control with brdu and insulin antibodies (fig . 2a). There was a significant, approximately threefold, increase in human -cell proliferation induced by pthrp compared with ad - control transduced or uninfected human islet cell cultures (fig . Pthrp increases human -cell proliferation and function without causing dedifferentiation . A: representative confocal images of human islet cell cultures transduced with ad - control (i) or ad - pthrp (ii iv) and costained for insulin (green, panel b), brdu (red, panel c), and dapi (blue, panel d). The merged images of all three stainings are shown in panel a, merge for dapi and brdu in panel e, and merge for insulin and brdu in panel f. b: quantitation of the percentage of brdu - positive -cells from human islet cell cultures uninfected (ui) or transduced with the adenovirus (adv) constructs control (ctrl), pthrp, or sp for 72 h or treated with 100 nmol / l of either 1 - 36 or 38 - 94 pthrp peptides for 24 h. there was a significant two- to threefold increase in -cell proliferation in pthrp - transduced and 1 - 36treated vs. ad - control transduced or uninfected control islet cells . Basal rate of -cell proliferation in uninfected controls was 0.08 0.03% (n = 411 individual human islet preps at least in duplicate). * p <0.05 vs. uninfected or ad - control by student's t test; #p <0.001 vs. ad - control or ad-sp and & p <0.01 vs. ui or 38 - 94 by one - way anova . C: expression of differentiation markers by real - time pcr from human islets treated for 24 h with vehicle control (ctrl) or pthrp(1 - 36) peptide (gray bars). Pcr cycles for each gene were compared, with actin used as an internal control . The graph is depicted as fold over control, with values from vehicle - treated islets taken as 1 (n = 47 human islet preparations in duplicate). D: insulin content per ieq in extracts of human islets treated with vehicle (veh) or 100 nmol / l pthrp(1 - 36) peptide or transduced with ad - control (ctrl) or ad - pthrp for 24 h (n = 5 human islet preparations in triplicate). E and f: insulin secretion measured at 5.5 and 22 mmol / l glucose from human islets transduced with ad - control or ad - pthrp for 24 h (e) and treated with vehicle or 100 nmol / l pthrp(1 - 36) peptide for 30 min (f). Insulin secretion is depicted as percentage of vehicle - treated control at 5.5 mmol / l glucose, which was 455.4 109.3 pg/g protein in 30 min . N = 78 human islet preparations in triplicate . * p <0.05 vs. insulin secretion at 5.5 mmol / l glucose with the same treatment; #p <0.05 vs. insulin secretion at equivalent glucose concentrations of control . (a high - quality digital representation of this figure is available in the online issue .) Based on studies in rodent -cells, we evaluated whether secreted pthrp is required for human -cell proliferation by transducing human islets with ad-sp, a ha - tagged nonsecretory pthrp mutant that lacks the sp . As expected, secreted pthrp levels in the medium were much lower in ad-sp (22 pmol / l) versus ad - pthrp transduced (600 pmol / l) human islets (fig . However, pthrp levels in islet extracts from ad-sp were at least comparable with ad - pthrp transduced human islets (fig . Moreover, pthrp was expressed in the -cells of ad-sp transduced human islet cultures as shown by ha and insulin costaining (fig . Despite abundant intracellular pthrp, ad-sp did not stimulate proliferation of human -cells relative to uninfected and ad - control infected islet cells (fig . 2b), demonstrating that secreted pthrp is important for mediating human -cell proliferation . To determine which specific secretory form of pthrp induces human -cell proliferation, human islet cultures were treated for 24 h with 100 nmol / l of either amino - terminal pthrp(1 - 36) or mid - region pthrp(38 - 94) peptide . There was a significant twofold increase in human -cell proliferation only with pthrp(1 - 36) and not with pthrp (3894) (fig . The concentration of pthrp(1 - 36) remaining in the culture medium of ad - transduced and peptide - treated human islet cell cultures was measured at the end of the experiments . Cells treated with vehicle or ad - control had undetectable pthrp(1 - 36), whereas ad - pthrp transduced cells had 469.8 57.4 pg / ml (117.5 pmol / l) and pthrp(1 - 36)treated cells had 245.1 20.6 ng / ml (61.25 nmol / l) of pthrp(1 - 36) in the culture media (n = 45 human islet cultures). Since induction of proliferation of human -cells can lead to their dedifferentiation (17), we examined mrna transcripts encoding differentiation markers in human islets treated with vehicle or pthrp(1 - 36). There was no change in transcripts encoding islet hormones (insulin, glucagon, and somatostatin), glucose sensors (glut-2 and glucokinase), or transcription factors important for -cell differentiation and function (pdx1, mafa, mafb, nkx6.1, nkx2.2, neurod, and isl1) with pthrp(1 - 36) treatment (fig . Either transduction with ad - pthrp or treatment with pthrp(1 - 36) for 24 h did not affect the insulin content in islets (fig . Whether pthrp affects human -cell function was evaluated by measuring insulin secretion from human islets transduced for 24 h with ad - pthrp or treated for 30 min with pthrp(1 - 36) peptide . There was no change in basal insulin secretion at 5.5 mmol / l glucose, and there was a small (27%) but not significant increase in insulin secretion at 22 mmol / l glucose from ad - pthrp versus ad - control transduced islets (fig . 2e), suggesting that ad - pthrp does not negatively impact human -cell function . On the other hand, pthrp(1 - 36) peptide caused a significant increase in insulin secretion at 5.5 mmol / l glucose (36%), with a further enhancement at 22 mmol thus, pthrp(1 - 36) enhances insulin secretion in human islets at both physiological and pathophysiological glucose concentrations . To begin to assess the molecular mechanisms of pthrp - induced human -cell proliferation, we measured expression of the g1/s cell cycle regulators . There was no significant change in the level of mrna expression of any of the cyclins (cyclin d13, e12, and a12), cyclin - dependent kinases (cdks) (1,2,4,6), cyclin inhibitory proteins / kinase inhibitory proteins (cip / kip) (p21, p27, and p57) or the inhibitor of kinase (ink) (p16, p18, and p19) family of inhibitors examined with pthrp(1 - 36) treatment (fig . 3a). Pthrp increases expression of cyclin (cyc) e and cdk2 proteins but not mrna in human islets . A: expression of g1/s cell cycle regulators by real - time pcr from human islets treated for 24 h with vehicle control (ctrl) or pthrp(1 - 36) peptide (gray bars). Pcr cycles for each gene were compared, with actin used as an internal control . The graph is depicted as fold over control, with values from vehicle - treated islets taken as 1 (n = 47 human islet preparations in duplicate). B: representative western blot analysis of the g1/s cell cycle activators and inhibitors from human islets treated for 24 h with vehicle (veh) or pthrp(1 - 36) using actin or tubulin as the internal housekeeping (hk) gene control . Quantitation of the ratio of cyclin e / hk (c) and cdk2/hk protein (d) shows a significant increase in both these proteins in pthrp(1 - 36)treated islets vs. control (veh), depicted as 100% . * p <0.05 (n = 49 human islet preparations). However, given that cell cycle molecules could be regulated posttranscriptionally, we examined the effect of pthrp(1 - 36) on the expression of g1/s cell - cycle proteins by western blot . There was no change in expression of the early g1/s cell - cycle activators cyclins d1/3 or cdk4/6 or in the ink and cip / kip inhibitors p16, p18, p21, p27, and p57 (fig ., the late g1/s cell cycle activator proteins cyclin e (fig . 3b and c) and cdk2 (fig . 3b and d) were significantly increased, by twofold, in pthrp - treated human islets . To ascertain whether expression of cyclin e and/or cdk2 per se can drive human -cell proliferation, these proteins were overexpressed in human islets by transduction with ad - cdk2/ad - cyclin e, relative to uninfected and ad - control transduced islets (fig . 4b) revealed a significant 2.5-fold increase in the percentage of cells in the s - phase of the cell cycle in ad - cdk2/ad cyclin e transduced whole human islets compared with uninfected or ad - control transduced human islets (fig . A: western blot analysis of human islets uninfected (ui) or transduced with ad - control (ad - ctrl) or a combination of ad - cdk2/ad - cyclin e for expression of cdk2, cyclin e, and actin as an internal control . The line divides samples from different regions on the same gel . Representative cell cycle phase distribution profiles (b) and percentage of cells in s - phase (c) of the cell cycle of uninfected, ad - control, or ad - cdk2/ad - cyclin e transduced human islet cells analyzed using flow cytometry . The percentage of cells in the g1-phase was reduced, although not significantly, in ad - cdk2/ad - cyclin e transduced (g1: 91.1 1.0%, g2/m: 5.4 1.2%) vs. uninfected (g1: 93.0 1.3%, g2/m: 5.4 1.2%) and ad - control transduced (g1: 94.0 1.0%, g2/m: 4.6 0.9%) human islets, whereas the percentage of cells in s - phase of the cell cycle in ad - cdk2/ad - cyclin e transduced human islets was significantly greater compared with uninfected or ad - control transduced human islets (n = 10 human islet preparations). D: representative images of human islet cell cultures transduced with 100 moi of ad - control, 50 moi of ad - control plus 50 moi of ad - cdk2, or 50 moi of ad - cyclin e and 50 moi each of ad - cdk2 and ad - cyclin e and costained for dapi (blue), insulin (green), and brdu (red). E: quantitation of the percentage of brdu - positive -cells from human islet cell cultures transduced with the ad constructs described for c. there was a significant 5-fold and 16-fold increase in -cell proliferation in cyclin e and cdk2/cyclin e vs. ad - control transduced islet cells, respectively . Basal rate of -cell proliferation in controls was 0.17 0.06%, taken as 100% . N = 9; 3 human islet preparations in triplicate . * p <0.01 vs. control by student's t test; #p <0.001 vs. the other three groups by one - way anova . (a high - quality digital representation of this figure is available in the online issue .) To independently confirm these observations and to demonstrate whether human -cell proliferation was induced by cyclin e and/or cdk2, staining for insulin, brdu, and dapi was performed on human islet cultures (fig . However, expression of cyclin e alone caused a significant fivefold increase in human -cell proliferation compared with control cells . Cyclin e and cdk2 together caused a substantive synergistic 16-fold increase in human -cell proliferation over cells transduced with equivalent multiplicity of infection (moi) of control virus and also a significant increase over cells transduced with ad - cdk2 or ad - cyclin e alone (fig . This study documents for the first time that pthrp can enhance human -cell growth and function . The major novel findings of this study are as follows: 1) the pthrp receptor is present in human -cells . 2) overexpression of pthrp causes a significant threefold increase in human -cell proliferation without negatively impacting function . 3) the secreted amino terminus 1 - 36 peptide of pthrp is sufficient to induce replication without causing significant dedifferentiation of human -cells . 4) pthrp(1 - 36) not only increases proliferation but simultaneously enhances human -cell function, as evidenced by a significant increase in insulin secretion at both physiological (5.5 mmol / l) and pathophysiological (22 5) pthrp(1 - 36) specifically increases expression of the late g1/s cell cycle activators cyclin e and cdk2 at the posttranscriptional level in human islets . 7) more importantly, the combination of these two molecules has a substantive synergistic effect on human -cell proliferation . The current study, together with previous work (68,1012), establishes pthrp as a factor that enhances proliferation and function in primary -cells from both rodent and human islets . Whereas in some instances activation of human -cell replication may induce dedifferentiation (17), in others e.g ., in this study and with overexpression of cdk6/cyclin d1 or constitutively active akt (18,19)induction of human -cell proliferation maintains or even augments -cell function . Based on studies in rodent islets (12), it is likely that pthrp(1 - 36) may enhance insulin secretion in human islets through activation of the camp pathway . This mitogenic activity is associated with changes in cyclin d1 transcription, activation of cyclin e / cdk2 kinase activity, or reduction of p57 or p27 inhibitors (2022). In human -cells, we found that pthrp(1 - 36) is sufficient to induce proliferation, causing an increase in expression at the posttrancriptional level of two activators of the late phase of the g1/s cell - cycle check point, cdk2 and cyclin e. pthrp regulates the stability of p27 in smooth - muscle cells, as well as the androgen receptor in prostate cancer cells, through the proteosomal degradation pathway (21,23). Cyclin e protein is also tightly regulated through proteasome - mediated degradation by the e3 ubiquitin ligases (24). Whether pthrp affects cyclin e stability through this pathway in human -cells requires further investigation . There is ample evidence that activators of the early phase of the cell cycle, cyclin ds and cdk4/cdk6, regulate rodent -cell proliferation and can induce human -cell proliferation (18,25). However, whether activators of the late phase of the cell cycle, cyclin e and cdk2, are important for and can induce human -cell proliferation is not known . Now, we demonstrate for the first time that cyclin e, both alone and together with cdk2, significantly enhances human -cell proliferation, suggesting that cyclin e may be one of the limiting factors in proliferation of human -cells . Understanding the regulation of, and elucidating therapeutic mechanisms to enhance, human -cell proliferation and function is critical for the long - term treatment of diabetes . This study shows that a small amino terminus peptide of pthrp is capable of enhancing both proliferation and function in human -cells in vitro . Further, it identifies two cell - cycle activators as likely downstream targets of pthrp . Cyclin e and cdk2 together have pronounced effects on human -cell proliferation and, therefore, have the potential to be harnessed to enhance human -cell growth ex vivo . The promise for pthrp(1 - 36) as a therapeutic agent for diabetes is especially attractive, given that this peptide has been shown to be both safe and effective for the treatment of osteoporosis (15,16) and that pthrp(1 - 36) in the 100 pmol / l range, a concentration that is likely transiently induced in humans treated with tolerable doses of pthrp(1 - 36) (15,16), is sufficient to enhance human -cell proliferation in vitro . Future studies will determine whether this peptide can be used either ex vivo or in vivo to improve human islet growth and function.
Postero - lateral thoracotomy incision is a relatively common surgical approach for thoracic procedures in infants and children . This approach results in division of the latissimus - dorsi and serratus - anterior muscles . Division of these muscles can result in significant post - operative pain, diminished pulmonary function, and marked impairment of motion . Chest - wall deformities are less common in patients who have undergone only one thoracotomy and have had no rib resection . Damage to the innervations of serratus anterior muscle may contribute to the chest wall deformity . The incidence of scapular winging could be diminished by careful preservation of long thoracic nerve during thoracotomy . In addition to chest wall asymmetry, female patients may develop significant breast asymmetry that may require later plastic surgical repair . Scoliosis may occur after thoracotomy for esophageal atresia but is more common and more severe in patients with associated vertebral anomalies . Scoliosis that is associated with thoracotomy is usually mild and does not cause symptoms . In patients with vertebral anomalies, scoliosis may need surgical intervention . To study the incidence, type of musculoskeletal and aesthetic abnormalities after thoracotomy in children . To study the incidence, type of musculoskeletal and aesthetic abnormalities after thoracotomy in children . Children below 12 years of age who had undergone thoracotomy for any condition and had at least 2-year follow - up were included in the study . Children having pre - existing spinal and chest - wall deformities, congenital myopathy disorders, excision of chest wall tumors and whose parents refused to give consent were excluded from the study . Patients were called on phone or with post cards for completion of missing data and further investigations as required . Patients coming for follow - up between july 2010 and june 2011 were included in the analysis . All the investigations done in this study were routine investigations performed during follow - up after thoracotomy requiring no specific safety measures . Detailed assessment of the patients included: history and general examination, clinical examination of chest and musculoskeletal system, investigations like x - ray chest including bilateral shoulders (ap, lateral, oblique) and x - ray whole spine (ap, lateral, right, and left side bending ap view). Examination of musculoskeletal system was done and parameters assessed were limitation of arm abduction (in degrees), shoulder elevation, deformity of chest (including asymmetry of chest wall), thumb excursion test, deformity of spine, winging of scapula, tenderness over scar, fixation of skin cicatrix to bony thorax limiting shoulder mobility, pectoral muscle maldevelopment . Examination of breast was done by index method i.e., index 0 (symmetrical breast development), index i (asymmetry at the level of nipples), and index ii (asymmetry at the level of the lower part of breast). X - ray chest including bilateral shoulders (ap, lateral, and oblique view) were done and deformities assessed were elevation of shoulder, chest - wall deformities like asymmetry of chest and pectus deformity, rib changes like rib fusion, rib crowding and irregularity, mediastinal shift, space available for lung (sal), condition of lungs, its vasculature and pleura . X - ray whole spine (ap, lateral, right, and left side bending ap view) was done and spinal deformities like scoliosis (cobb's angle), kyphosis, lordosis, and other abnormal curvatures of spine were measured . The scoliosis research society (srs) definitions of different spinal curve deformities were used during measurement . Detailed assessment of the patients included: history and general examination, clinical examination of chest and musculoskeletal system, investigations like x - ray chest including bilateral shoulders (ap, lateral, oblique) and x - ray whole spine (ap, lateral, right, and left side bending ap view). Examination of musculoskeletal system was done and parameters assessed were limitation of arm abduction (in degrees), shoulder elevation, deformity of chest (including asymmetry of chest wall), thumb excursion test, deformity of spine, winging of scapula, tenderness over scar, fixation of skin cicatrix to bony thorax limiting shoulder mobility, pectoral muscle maldevelopment . Examination of breast was done by index method i.e., index 0 (symmetrical breast development), index i (asymmetry at the level of nipples), and index ii (asymmetry at the level of the lower part of breast). X - ray chest including bilateral shoulders (ap, lateral, and oblique view) were done and deformities assessed were elevation of shoulder, chest - wall deformities like asymmetry of chest and pectus deformity, rib changes like rib fusion, rib crowding and irregularity, mediastinal shift, space available for lung (sal), condition of lungs, its vasculature and pleura . X - ray whole spine (ap, lateral, right, and left side bending ap view) was done and spinal deformities like scoliosis (cobb's angle), kyphosis, lordosis, and other abnormal curvatures of spine were measured . The scoliosis research society (srs) definitions of different spinal curve deformities were used during measurement . The study included total of 52 patients and they were stratified into three groups according to the diseases for which thoracotomies were done [figure 1]. Out of 52 patients, 29 (55.8%) were male and 23 (44.2%) were female . The age at the time of evaluation ranged from 2 to 18 years (mean 6.3 years) [table 1]. Thirty - nine patients had undergone right - sided thoracotomy and 11 patients had undergone left - sided thoracotomy while two patients had undergone bilateral thoracotomy . Out of 50 unilateral thoracotomies, 46 were done once and in two patients unilateral thoracotomy was done twice . Out of two bilateral thoracotomies, one patient had once on each side and the other patient had twice on right side [table 1]. Distribution of cases within each group in group i, out of 31 thoracic cases, 27 (87.1%) were cases of esophageal atresia with trachea - esophageal fistula (ea - tef), 2 (6.5%) were eventration of diaphragm, 1 (3.3%) each of h - type tef and congenital esophageal stenosis [figure 2]. In group ii, out of 15 pulmonary cases, 9 (60%) were lung metastasis from abdominal solid tumors, 3 (20%) were hydatid cyst, 2 (13.3%) were bronchiectasis, and 1 (6.6%) was eventration of diaphragm . This patient of eventration had undergone second thoracotomy for decortication and lingulectomy . In group iii, out of 6 mediastinal cases, 4 (66.7%) were mediastinal tumors like neuroblastoma and germ cell tumor and 2 (33.3%) were cases of lymphangioma [figure 2]. (eatef- esophageal atresia with tracheo - esophageal fistula; ces congenital esophageal stenosis; h - tef- h type tracheo - esophageal fistula; lung mets - lung metastasis) in thoracic group, all patients had undergone unilateral thoracotomy . In two patients one neonate of congenital short esophagus had developed a major leak after resection and end - to - end anastomosis for which decortications and diversion was done in newborn period and later reverse gastric tube for esophageal replacement was done . Second case was persistent anastomotic stricture following primary repair of ea - tef for which resection of stricture and end - to - end anastomosis of esophagus was done . One case was left eventration of diaphragm who had undergone plication of diaphragm and developed persistent lower respiratory tract infection and thickening of pleura with collapse of lingula for which decortication and lingulectomy was done . The other was a follow - up case of wilms tumor with bilateral lung metastasis for which left thoracotomy was done twice for removal of recurrent metastatic nodule within one year interval and right lung metastatic nodule disappeared after chemotherapy . Out of two bilateral thoracotomies in the group ii one patient had left thoracotomy done twice . The other bilateral thoracotomy was a case of osteosarcoma of right tibia with bilateral lung metastasis . All the patients in mediastinal group had undergone unilateral thoracotomy once . Out of 52 patients, four patients had undergone lobectomy and one patient lingulectomy . Out of four lobectomies, three patients (two right lower lobes and one left lower lobe) had lung metastasis from abdominal solid tumors . One patient of complicated hydatid cyst had undergone left upper lobectomy for complete removal of cyst . One lingulectomy was done in a patient of left eventration of diaphragm as has been mentioned earlier . Two pneumonectomies (one left and one right) were done for bronchiectasis of lung . Out of six wedge excision of lung parenchyma five were done for removal of metastatic lesions (2 from left lung lower lobe, 2 from right lung lower lobe, and 1 from right lung upper and middle lobe) and one from right lung middle lobe with complete excision of germ cell tumor of mediastinum . All 52 patients underwent musculoskeletal system examination [table 2]. Only 1 (1.9%) patient had scoliosis, 3 (5.7%) patients had winging of scapula, 3 (5.7%) patients had shoulder elevation on thoracotomy side, 4 (7.7%) had skin cicatrix fixed to bony thorax, and 6 (11.5%) patients had pectoral muscle maldevelopment . In thoracic group out of 31 patients, 1 (3.2%) patient had winging of scapula, 3 (9.7%) patients had shoulder elevation, 3 (9.7%) patients had skin cicatrix fixed to bony thorax and 2 (6.4%) patients had pectoral muscle maldevelopment . In pulmonary group 1 (6.6%) patient had scoliosis at upper thoracic region (t3 level) and 1 (6.6%) each had winging of scapula, skin cicatrix fixed to bone and 4 (26.6%) patients had pectoral muscle maldevelopment . In mediastinal group only 1 (16.6%) patient had winging of scapula [table 2]. Musculoskeletal system examination findings figure 3a depicts a follow - up case of tef operated 18 years back showing skin cicatrix fixed to bony thorax but not limiting arm movement . (a) cicatrix fixed to bony thorax (b) same patient showing right pectoral muscle maldevelopment out of 52 patients, only 1 patient had breast asymmetry at level of nipple who was 11-year - old male and had undergone left upper lobectomy for hydatid cyst excision at age of 5 years . Out of 52 patients, 3 (5.7%) patients had rib fusion, 5 (9.6%) patients had crowding of ribs, 2 (3.8%) patients had mediastinal shift, 2 (3.8%) patients had decreased space available for lung and 1 (1.9%) patient had scoliosis (cobbs angle> 10 degree) [table 3]. In thoracic group out of 31 patients, 3 (9.6%) patients had rib fusion and 4 (12.9%) had rib crowding (all were cases of ea / tef). A follow - up case of tef operated 4 years back showing rib fusion in x - ray chest in right hemithorax is depicted in figure 4a . In pulmonary group, 1 (6.6%) patient had rib crowding who had undergone lobectomy for hydatid cyst excision, 2 (13.3%) patients had mediastinal shift (both following pneumonectomy), 2 (13.3%) patients had decreased space available for lung (sal)-92% and 98%, who had undergone right and left pneumonectomy at the age of 10 years and 7 years, respectively, for bronchiectasis and assessed two and half years after surgery . Only one patient had scoliosis [table 3] of left side at upper thoracic level (t3 vertebra) with cobb's angle of 15 degree [figure 4b]. This patient had undergone right pneumonectomy by postero - lateral thoracotomy through the bed of 4 rib, for bronchiectasis at the age of 10 years and scoliosis was noticed 52 months after surgery . Shoulder elevation, kyphosis, lordosis, and other spinal curvatures were not seen in any of our patients . Findings on x - ray chest, shoulder and whole spine (a) rib fusion on x - ray chest (white arrow) (b) x - ray chest showing mediastinal shift, rib crowding, ends of excised rib, and space available for lung (sal) 92% . X - ray thoracic spine showing scoliosis with cobb's angle of 150, with convexity toward left at t3 level (white arrow) the study included total of 52 patients and they were stratified into three groups according to the diseases for which thoracotomies were done [figure 1]. Out of 52 patients, 29 (55.8%) were male and 23 (44.2%) were female . The age at the time of evaluation ranged from 2 to 18 years (mean 6.3 years) [table 1]. Thirty - nine patients had undergone right - sided thoracotomy and 11 patients had undergone left - sided thoracotomy while two patients had undergone bilateral thoracotomy . Out of 50 unilateral thoracotomies, 46 were done once and in two patients unilateral thoracotomy was done twice . Out of two bilateral thoracotomies, one patient had once on each side and the other patient had twice on right side [table 1]. Distribution of cases within each group in group i, out of 31 thoracic cases, 27 (87.1%) were cases of esophageal atresia with trachea - esophageal fistula (ea - tef), 2 (6.5%) were eventration of diaphragm, 1 (3.3%) each of h - type tef and congenital esophageal stenosis [figure 2]. In group ii, out of 15 pulmonary cases, 9 (60%) were lung metastasis from abdominal solid tumors, 3 (20%) were hydatid cyst, 2 (13.3%) were bronchiectasis, and 1 (6.6%) was eventration of diaphragm . This patient of eventration had undergone second thoracotomy for decortication and lingulectomy . In group iii, out of 6 mediastinal cases, 4 (66.7%) were mediastinal tumors like neuroblastoma and germ cell tumor and 2 (33.3%) were cases of lymphangioma [figure 2]. (eatef- esophageal atresia with tracheo - esophageal fistula; ces congenital esophageal stenosis; h - tef- h type tracheo - esophageal fistula; lung mets - lung metastasis) in thoracic group, all patients had undergone unilateral thoracotomy . In two patients one neonate of congenital short esophagus had developed a major leak after resection and end - to - end anastomosis for which decortications and diversion was done in newborn period and later reverse gastric tube for esophageal replacement was done . Second case was persistent anastomotic stricture following primary repair of ea - tef for which resection of stricture and end - to - end anastomosis of esophagus was done . One case was left eventration of diaphragm who had undergone plication of diaphragm and developed persistent lower respiratory tract infection and thickening of pleura with collapse of lingula for which decortication and lingulectomy was done . The other was a follow - up case of wilms tumor with bilateral lung metastasis for which left thoracotomy was done twice for removal of recurrent metastatic nodule within one year interval and right lung metastatic nodule disappeared after chemotherapy . Out of two bilateral thoracotomies in the group ii one patient had left thoracotomy done twice . The other bilateral thoracotomy was a case of osteosarcoma of right tibia with bilateral lung metastasis . All the patients in mediastinal group had undergone unilateral thoracotomy once . Out of 52 patients, four patients had undergone lobectomy and one patient lingulectomy . Out of four lobectomies, three patients (two right lower lobes and one left lower lobe) had lung metastasis from abdominal solid tumors . One patient of complicated hydatid cyst had undergone left upper lobectomy for complete removal of cyst . One lingulectomy was done in a patient of left eventration of diaphragm as has been mentioned earlier . Two pneumonectomies (one left and one right) were done for bronchiectasis of lung . Out of six wedge excision of lung parenchyma five were done for removal of metastatic lesions (2 from left lung lower lobe, 2 from right lung lower lobe, and 1 from right lung upper and middle lobe) and one from right lung middle lobe with complete excision of germ cell tumor of mediastinum . All 52 patients underwent musculoskeletal system examination [table 2]. Only 1 (1.9%) patient had scoliosis, 3 (5.7%) patients had winging of scapula, 3 (5.7%) patients had shoulder elevation on thoracotomy side, 4 (7.7%) had skin cicatrix fixed to bony thorax, and 6 (11.5%) patients had pectoral muscle maldevelopment . In thoracic group out of 31 patients, 1 (3.2%) patient had winging of scapula, 3 (9.7%) patients had shoulder elevation, 3 (9.7%) patients had skin cicatrix fixed to bony thorax and 2 (6.4%) patients had pectoral muscle maldevelopment . In pulmonary group 1 (6.6%) patient had scoliosis at upper thoracic region (t3 level) and 1 (6.6%) each had winging of scapula, skin cicatrix fixed to bone and 4 (26.6%) patients had pectoral muscle maldevelopment . In mediastinal group only 1 (16.6%) musculoskeletal system examination findings figure 3a depicts a follow - up case of tef operated 18 years back showing skin cicatrix fixed to bony thorax but not limiting arm movement . (a) cicatrix fixed to bony thorax (b) same patient showing right pectoral muscle maldevelopment out of 52 patients, only 1 patient had breast asymmetry at level of nipple who was 11-year - old male and had undergone left upper lobectomy for hydatid cyst excision at age of 5 years . Out of 52 patients, 3 (5.7%) patients had rib fusion, 5 (9.6%) patients had crowding of ribs, 2 (3.8%) patients had mediastinal shift, 2 (3.8%) patients had decreased space available for lung and 1 (1.9%) patient had scoliosis (cobbs angle> 10 degree) [table 3]. In thoracic group out of 31 patients, 3 (9.6%) patients had rib fusion and 4 (12.9%) had rib crowding (all were cases of ea / tef). A follow - up case of tef operated 4 years back showing rib fusion in x - ray chest in right hemithorax is depicted in figure 4a . In pulmonary group, 1 (6.6%) patient had rib crowding who had undergone lobectomy for hydatid cyst excision, 2 (13.3%) patients had mediastinal shift (both following pneumonectomy), 2 (13.3%) patients had decreased space available for lung (sal)-92% and 98%, who had undergone right and left pneumonectomy at the age of 10 years and 7 years, respectively, for bronchiectasis and assessed two and half years after surgery . Only one patient had scoliosis [table 3] of left side at upper thoracic level (t3 vertebra) with cobb's angle of 15 degree [figure 4b]. This patient had undergone right pneumonectomy by postero - lateral thoracotomy through the bed of 4 rib, for bronchiectasis at the age of 10 years and scoliosis was noticed 52 months after surgery . Shoulder elevation, kyphosis, lordosis, and other spinal curvatures were not seen in any of our patients . Findings on x - ray chest, shoulder and whole spine (a) rib fusion on x - ray chest (white arrow) (b) x - ray chest showing mediastinal shift, rib crowding, ends of excised rib, and space available for lung (sal) 92% . X - ray thoracic spine showing scoliosis with cobb's angle of 150, with convexity toward left at t3 level (white arrow) two larger series of chest - wall deformities after surgery for ea - tef have been reported . In first series of 232 patients with esophageal atresia but no congenital vertebral anomaly; 77 (33%) patients developed chest - wall deformities . Anterior chest wall deformities were found in 47, scoliosis in 18 and a combination of both in 12 patients . Chest - wall deformity appeared to be more common in patients after 25 years of age and scoliosis in patients who had undergone numerous thoracotomies . Another series of similar experience in 89 patients operated on for esophageal atresia, via a right dorso - lateral thoracotomy and followed up for 3 - 16 years . Twenty - nine of the patients had significant musculoskeletal deformities: 21 (24%) had a winged scapula from partial paralysis of the latissimus - dorsi muscle; 18 (20%) had marked asymmetry of the thoracic wall from atrophy of the serratus anterior muscle; 9 (10%) had rib fusion (with major respiratory dysfunction in one patient); and 7 (8%) had severe thoracic scoliosis . Orthopedic surgeons subsequently described severe scoliosis in 18 patients followed up for more than 10 years after repair of tracheo - esophagealfistula . A spinal curvature of more than 10 degrees had developed in nine patients and in eight of these cases the curves were convex away from the side of the incision . The scoliosis had appeared at any time from early childhood to skeletal maturity but was more likely to be progressive in those in whom it had developed before the adolescent growth spurt . Similar sequelae have been described after thoracotomy for congenital cardiac disease . In a prospective study of 36 premature infants after left thoracotomy for patent ductus arteriosus, one developed thoracic scoliosis and 20 of 27 (74%) had minor radiologic skeletal abnormalities in the form of rib deformation or fusion; the latter carries a risk of long - term scoliosis . Bal et al ., confirmed this high prevalence of musculoskeletal problems in a series of 49 children who had required postero - lateral thoracotomy for cardiac surgery . After a mean follow - up period of 6 years, 94% had various deformities: 31% had scoliosis, with a severe curve exceeding 25 degrees in two; 61% had shoulder elevation; 77% had a winged scapula; and 14% had asymmetry of the thoracic wall due to the atrophy of the serratus anterior muscle . Primary esophageal atresia repair through the postero - lateral thoracotomy frequently (30%) resulted in rib fusions, and these were major contributors to the later scoliosis . Thoracotomy in infancy for various reasons has been reported to cause scoliosis in 4 - 50% of cases . In 1969, freeman and walkden first reported right shoulder deformities after repair of esophageal atresia by right thoracotomy . Severe scoliosis was more likely in patients who had experienced postoperative infectious complications such as mediastinitis and empyema secondary to esophageal dehiscence; in these cases it was often accompanied by marked scarring and rib fusion . In the current study out of 52 patients, 1 (1.9%) patient had scoliosis, 3 (5.7%) patients had winging of scapula, 3 (5.7%) patients had shoulder elevation on thoracotomy side, 4 (7.7%) had skin cicatrix fixed to bony thorax, 6 (11.5%) patients had pectoral muscle maldevelopment, 3 (5.7%) patients had rib fusion, 5 (9.6%)patients had crowding of ribs, 2 (3.8%) patients had mediastinal shift and 2 (3.8%) patient had decreased space available for lung [tables 2 and 3]. In comparison to other studies incidence of musculoskeletal abnormalities were low, this observation might be due to more number of patients with shorter duration (2 years) of follow - up . In this study, rib fusion, rib crowding were more frequently seen after neonatal thoracotomies due to decreased rib space and increased chance of injury to rib periosteum . Similarly, skin cicatrix fixed to bony thorax and shoulder elevation abnormalities were also more commonly seen after neonatal thoracotomies due to increased likelihood of damaging nerve to serratus and latissimus - dorsi muscles and poor physiotherapy of these muscles in post - operative period . Out of 52 patients, only one patient had scoliosis [table 3] who was a 14-year - old female, follow - up case of right lung bronchiectasis undergone right pneumonectomy four and half years back . X - ray chest showing mediastinal shift, rib crowding, ends of excised rib, and space available for lung (sal) 92% . X - ray thoracic spine showing scoliosis with cobb's angle of 15 degree, with convexity toward left at t3 level [figure 4b]. Rest all patients had cobb's angle <10 degree which is not significant . Very low incidence of scoliosis in this study might be due to exclusion of congenital vertebral anomalies from the study and also shorter duration of follow - up (2 years) after thoracotomy . Patients with rib fusion may be expected to develop some degree of scoliosis at a later date and so need to be followed up for longer period of time . Postoperative wound infection is uncommon after lung resection, thereby increasing the chance of a satisfactory scar . Postero - lateral thoracotomy through an axillary skin incision has been described, allowing for access through the third or fourth intercostal space . Deformities caused by atrophy of chest wall muscles from nerve injuries during thoracotomy have been reported . A series of 58 adult computed tomography (ct) scans in patients who had had a previous thoracotomy were compared with muscle thickness on the side of surgery with that on the contralateral chest wall . Muscle atrophy was found in 42 patients but in two cases this was confined to the serratus anterior muscle only . Signs of atrophy of the latissimus - dorsi muscle and the inferior portion of the serratus anterior muscle were seen in all patients after postero - lateral thoracotomy, whereas this pattern of atrophy was present in only two of 18 patients after antero - lateral thoracotomy . A muscle - sparing thoracotomy is an alternative and may be particularly important if rotational muscle flaps might be necessary . The only specific morbidity described using this technique rather than the classical approach was the occurrence of seroma . A more serious aesthetic complication of thoracotomy concerns breast development . One study reported scar disfiguration of the right breast in 3.3% of patients after right postero - lateral thoracotomy for esophageal atresia; one patient had mammary maldevelopment . Nipple asymmetry has been described in 63% of patients after thoracotomy for congenital cardiac disease . After cardiac surgery via an antero - lateral thoracotomy, reported disturbance in breast development were in 55% of women (left breast volume at least 20% greater than right breast), with an asymmetry of the lower part of the right breast in 61% . These authors concluded that antero - lateral thoracotomy can significantly interfere with ipsilateral breast development . In the current study out of 52 patients, only 1 patient had breast asymmetry at level of nipple who was a 11-year - old male and had undergone left upper lobectomy for hydatid cyst excision at age of 5 years . No female patient in this study had breast disfigurement . Four (7.7%) patients had skin cicatrix fixed to bony thorax [figure 3a] and 6 (11.5%) patients had pectoral muscle mal - development [figure 3b]. Low incidence of aesthetic complications including breast asymmetry were due to inclusion of only postero - lateral thoracotomies and incision far away from nipple and also decreased incidence of thoracic wound infection . More abnormalities were likely to be detected if these patients are studied later in adolescence / early adulthood . Most of the female patients in this study had not reached adolescence, so long - term follow - up of these patients need to be done to look for their aesthetic morbidities and treatment if required . Two larger series of chest - wall deformities after surgery for ea - tef have been reported . In first series of 232 patients with esophageal atresia but no congenital vertebral anomaly; 77 (33%) patients developed chest - wall deformities . Anterior chest wall deformities were found in 47, scoliosis in 18 and a combination of both in 12 patients . Chest - wall deformity appeared to be more common in patients after 25 years of age and scoliosis in patients who had undergone numerous thoracotomies . Another series of similar experience in 89 patients operated on for esophageal atresia, via a right dorso - lateral thoracotomy and followed up for 3 - 16 years . Twenty - nine of the patients had significant musculoskeletal deformities: 21 (24%) had a winged scapula from partial paralysis of the latissimus - dorsi muscle; 18 (20%) had marked asymmetry of the thoracic wall from atrophy of the serratus anterior muscle; 9 (10%) had rib fusion (with major respiratory dysfunction in one patient); and 7 (8%) had severe thoracic scoliosis . Orthopedic surgeons subsequently described severe scoliosis in 18 patients followed up for more than 10 years after repair of tracheo - esophagealfistula . A spinal curvature of more than 10 degrees had developed in nine patients and in eight of these cases the curves were convex away from the side of the incision . The scoliosis had appeared at any time from early childhood to skeletal maturity but was more likely to be progressive in those in whom it had developed before the adolescent growth spurt . Similar sequelae have been described after thoracotomy for congenital cardiac disease . In a prospective study of 36 premature infants after left thoracotomy for patent ductus arteriosus, one developed thoracic scoliosis and 20 of 27 (74%) had minor radiologic skeletal abnormalities in the form of rib deformation or fusion; the latter carries a risk of long - term scoliosis . Bal et al ., confirmed this high prevalence of musculoskeletal problems in a series of 49 children who had required postero - lateral thoracotomy for cardiac surgery . After a mean follow - up period of 6 years, 94% had various deformities: 31% had scoliosis, with a severe curve exceeding 25 degrees in two; 61% had shoulder elevation; 77% had a winged scapula; and 14% had asymmetry of the thoracic wall due to the atrophy of the serratus anterior muscle . Primary esophageal atresia repair through the postero - lateral thoracotomy frequently (30%) resulted in rib fusions, and these were major contributors to the later scoliosis . Thoracotomy in infancy for various reasons has been reported to cause scoliosis in 4 - 50% of cases . In 1969, freeman and walkden first reported right shoulder deformities after repair of esophageal atresia by right thoracotomy . Severe scoliosis was more likely in patients who had experienced postoperative infectious complications such as mediastinitis and empyema secondary to esophageal dehiscence; in these cases it was often accompanied by marked scarring and rib fusion . In the current study out of 52 patients, 1 (1.9%) patient had scoliosis, 3 (5.7%) patients had winging of scapula, 3 (5.7%) patients had shoulder elevation on thoracotomy side, 4 (7.7%) had skin cicatrix fixed to bony thorax, 6 (11.5%) patients had pectoral muscle maldevelopment, 3 (5.7%) patients had rib fusion, 5 (9.6%)patients had crowding of ribs, 2 (3.8%) patients had mediastinal shift and 2 (3.8%) patient had decreased space available for lung [tables 2 and 3]. In comparison to other studies incidence of musculoskeletal abnormalities were low, this observation might be due to more number of patients with shorter duration (2 years) of follow - up . In this study, rib fusion, rib crowding were more frequently seen after neonatal thoracotomies due to decreased rib space and increased chance of injury to rib periosteum . Similarly, skin cicatrix fixed to bony thorax and shoulder elevation abnormalities were also more commonly seen after neonatal thoracotomies due to increased likelihood of damaging nerve to serratus and latissimus - dorsi muscles and poor physiotherapy of these muscles in post - operative period . Out of 52 patients, only one patient had scoliosis [table 3] who was a 14-year - old female, follow - up case of right lung bronchiectasis undergone right pneumonectomy four and half years back . X - ray chest showing mediastinal shift, rib crowding, ends of excised rib, and space available for lung (sal) 92% . X - ray thoracic spine showing scoliosis with cobb's angle of 15 degree, with convexity toward left at t3 level [figure 4b]. Rest all patients had cobb's angle <10 degree which is not significant . Very low incidence of scoliosis in this study might be due to exclusion of congenital vertebral anomalies from the study and also shorter duration of follow - up (2 years) after thoracotomy . Patients with rib fusion may be expected to develop some degree of scoliosis at a later date and so need to be followed up for longer period of time . Postoperative wound infection is uncommon after lung resection, thereby increasing the chance of a satisfactory scar . Postero - lateral thoracotomy through an axillary skin incision has been described, allowing for access through the third or fourth intercostal space . Deformities caused by atrophy of chest wall muscles from nerve injuries during thoracotomy have been reported . A series of 58 adult computed tomography (ct) scans in patients who had had a previous thoracotomy were compared with muscle thickness on the side of surgery with that on the contralateral chest wall . Muscle atrophy was found in 42 patients but in two cases this was confined to the serratus anterior muscle only . Signs of atrophy of the latissimus - dorsi muscle and the inferior portion of the serratus anterior muscle were seen in all patients after postero - lateral thoracotomy, whereas this pattern of atrophy was present in only two of 18 patients after antero - lateral thoracotomy . A muscle - sparing thoracotomy is an alternative and may be particularly important if rotational muscle flaps might be necessary . The only specific morbidity described using this technique rather than the classical approach was the occurrence of seroma . A more serious aesthetic complication of thoracotomy concerns breast development . One study reported scar disfiguration of the right breast in 3.3% of patients after right postero - lateral thoracotomy for esophageal atresia; one patient had mammary maldevelopment . Nipple asymmetry has been described in 63% of patients after thoracotomy for congenital cardiac disease . After cardiac surgery via an antero - lateral thoracotomy, reported disturbance in breast development were in 55% of women (left breast volume at least 20% greater than right breast), with an asymmetry of the lower part of the right breast in 61% . These authors concluded that antero - lateral thoracotomy can significantly interfere with ipsilateral breast development . In the current study out of 52 patients, only 1 patient had breast asymmetry at level of nipple who was a 11-year - old male and had undergone left upper lobectomy for hydatid cyst excision at age of 5 years . No female patient in this study had breast disfigurement . Four (7.7%) patients had skin cicatrix fixed to bony thorax [figure 3a] and 6 (11.5%) patients had pectoral muscle mal - development [figure 3b]. Low incidence of aesthetic complications including breast asymmetry were due to inclusion of only postero - lateral thoracotomies and incision far away from nipple and also decreased incidence of thoracic wound infection . More abnormalities were likely to be detected if these patients are studied later in adolescence / early adulthood . Most of the female patients in this study had not reached adolescence, so long - term follow - up of these patients need to be done to look for their aesthetic morbidities and treatment if required . So close follow - up of patients after thoracotomy is needed for longer periods of time to pick up these abnormalities.
Amputation is a complex procedure with physical, social, and psychological components . In developing countries, amputation rates have increased because of accidents, trauma, and various systemic diseases . A study in 2008 estimates nearly 2 million people are living with limb loss in the united states and it is projected that the number will more than double by 20501 . A recent study that demonstrated the impact of limb loss in the us, showed that more than 57,000 (40%) of all amputation procedures were related to diagnose of diabetes2 . Unfortunately there is insufficient data about causes, procedures, and team - work for limb loss, and trauma - related amputation is more frequent in turkey3, 4 . Both traumatic and non - traumatic limb loss is often associated with multiple systemic conditions or complications like diabetes, obesity, cardiovascular disease, musculoskeletal problems, depression, and emotional stress2, 5 . Studies also estimate that 50% to 74% of people with limb loss have 5-year mortality rate higher than many cancers, especially due to vascular disease, diabetes, and some chronic conditions based on obesity2, 3, 6,7,8 . Therefore, the amputee requires multi - perspective expertise in coping with these systemic problems9,10,11 . As a critical part of the rehabilitation program, physiotherapy has an important role in ensuring ideal functional outcome . In 1979, malone et al.12 suggested that significant financial and therapeutic benefits accrue from the application of an accelerated rehabilitation approach . Additionally, recent studies indicated that amputees who were accepted into multi - disciplinary rehabilitation programs reached their highest functional level, and achieved or improved independent mobility and self - care with a significant reduction in time9,10,11, 13,14,15 . Therefore, in accordance with this literature, the aim of our study is to demonstrate the frequency of prosthetic applications and to appraise the importance of amputee rehabilitation in turkey . Questionnaires were administered to owners or employees of 36 institutions and the obtained data were evaluated . The questionnaire consisted of 3 subsections including information about the corporation, prosthesis, and rehabilitation . Descriptive information about corporation, number and profession of employees and frequency of professional training and scientific research were questioned in the first subscale . Amputation levels, types of applied prosthesis and the frequency of patient control were questioned in the prosthesis section . The study protocol was approved by the non - interventional clinical researches ethics board of hacettepe university faculty of medicine . Four hundred prosthetics application centers were contacted by e - mails or interviews . Questionnaires that we created were administered to owners or employees of 36 institutions . While 75% of institutions had no physiotherapist, 22.2% had 1 physiotherapist, 2.8% had 2 physiotherapists . There were 4 or fewer technician in 86.1% of the institutions and the majority of employees were out of profession in almost all institutions (table 1table 1.frequencies of physiotherapists and technicians employed by institutionsn=360123 or morephysiotherapist27 (75)8 (22.2)1 (2.8)0 (0)technician0 (0)17 (47.2)10 (27.8)9 (25)values in parentheses are percentages . ); 55.6%, 75%, 16.7%, and 25% of the institutions frequently encountered above - knee, below - knee, above elbow, and below elbow amputees respectively (table 2table 2.frequencies of different levels of amputees admitted to these institutions and different types of prosthetics manufactured in these institutionsn=36frequentlyoccasionallyrarelyneverbelow knee27 (75)5 (13.9)3 (8.3)1 (2.8)above knee20 (55.6)10 (27.8)5 (13.9)1 (2.8)below elbow9 (25)13 (36.1)12 (33.3)2 (5.6)above elbow6 (16.7)10 (27.8)17 (47.2)3 (8.3)classical3 (8.3)7 (19.4)20 (55.6)6 (16.7)technological23 (63.9)12 (33.3)1 (2.8)0 (0)advanced technological11 (30.6)13 (36.1)9 (25)3 (8.3)values in parentheses are percentages . ). The frequency of manufacturing and application of classical prosthetics was 8.3%, that of technological prosthetics was 63.9%, and that of advanced technological prosthetics was 30.6% (table 2). Falls and complications were reported in 83.3% and 75% of the institutions, respectively, and 58.3% of them reported occasionally encountering cases with need of repair; 55.6% of institutions performed preprosthetic evaluations, 63.9% used gait analysis, and 50% performed prosthetic rehabilitation frequently (table 3table 3.frequencies of preprosthetic evaluation and prosthetic rehabilitation made by these institutionsn=36frequentlyoccasionallyrarelyneverpreprosthetic evaluation20 (55.6)0 (0)0 (0)16 (44.4)prosthetic rehabilitation18 (50)10 (27.8)7 (19.4)1 (2.8)values in parentheses are percentages . ). The reported evaluation methods were non - standardized, usually comprising measurement of stump and information about patient and amputation . Subjective methods, like observational gait analysis, were often used as a method of gait analysis . Rehabilitation process consisted of basic activities like wearing and removing prosthesis, transfers, stair climbing, and walking on uneven ground . The results of this study revealed that many of the institutions in turkey do not employ physiotherapists specializing in prosthetics and orthotics, observational and subjective evaluation methods are used by the institutions, and rehabilitation program consists of only teaching basic activities of daily living with prosthesis . Amputation is not only an aesthetic loss but also a permanent disability that affects functional independence16, 17 . Appropriate prosthetic design, rehabilitation programs, and education are important to regain lost functions and improve the quality of life for amputees17,18,19,20 . At present, new prosthetic designs, technologically advanced, and expensive prosthetic components are available . Some of the prosthesis component manufacturers argue that new components create advantages to learn how to use these devices . However, technological progress and new expensive components do not trivialize the rehabilitation, and make it even more important21 . Selection of the appropriate prosthetic components and rehabilitation are important for patient s daily life, occupational, and recreational activities22 . Deficiencies related to physiotherapist employment, evaluation and rehabilitation processes in prosthetic application centers that were interviewed in this study can lead to errors in the choice of prosthesis, inability to sustain daily living and occupational activities and additional problems (wound on the stump, problems arising from gait disturbance, falls, etc . ). The patient s health may be impaired due to these factors and patients may be affected socially and economically . Consequently, quality of life can be reduced . Amputee rehabilitation is a long process and an experienced multidisciplinary rehabilitation team is necessary in order to achieve successful outcomes for upper / lower extremity amputees23 . Experienced physiotherapists, physicians and technicians should be involved in the amputee rehabilitation process . Twenty - seven of the institutions participating in this study do not employ physiotherapists, 8 employ one physiotherapist and 1 employs 2 physiotherapists . These results indicate that the number of physiotherapists employed in prosthetic application centers is very inadequate . This number should be increased for more success in prosthetic application and amputee rehabilitation in turkey . As known, physiotherapists contribute to improve balance and functional activities like walking, turning, walking uphill and on uneven grounds independently with or without prosthesis after lower limb amputation24,25,26 . They provide training to perform activities of daily living and self - care after upper limb amputation26 . Twenty institutions reported they often perform assessments before prosthetic application; 23 reported they often perform gait analysis; and 18 reported they often performed prosthetic rehabilitation . The indicated assessment methods were non - standardized, usually including knowledge of patient and amputation, stump measurements, and observational gait analysis . The indicated rehabilitation process included basic activities like donning prosthesis, transfers, climbing stairs, and walking on uneven ground . However, amputation is a permanent disability; therefore, amputee rehabilitation is essential not only in early prosthetic stage but also lifelong23 . Deathe et al.27 found that there was no consensus regarding rehabilitation program or patient outcome measurement tools and the common outcome measures and rehabilitation methods were nonstandardized, informal methods in canada, with their same study . A limitation of this study was the small number of centers participating in the research . Four hundred prosthetic application centers were contacted but only 36 participated in this study . This indicates that awareness of these institutions about the rehabilitation process is insufficient . To our knowledge, the majority of prosthetic application centers do not employ physiotherapists and information about rehabilitation of the other staff in these centers is limited . In addition, some of the participants may not have answered all questions correctly with commercial concerns . This study offers data about prosthetic applications, prosthetic application centers, and the status of the rehabilitation process in these centers in turkey . The results of this study reveal the requirement for more physiotherapists working in these centers, the utilization of standardized - objective assessment methods, and the development of the rehabilitation process for successful prosthetic applications and amputee rehabilitation in turkey . This study can create awareness to develop appropriate recommendations in order to maintain prosthetic applications and ensure healthier amputee rehabilitation . Amputee rehabilitation should be considered in a broader context and physiotherapist employment should be increased for sufficient rehabilitation process in prosthetic application centers.
Ulcerative colitis is a chronic inflammatory disease of the large intestine . Its exact cause is unknown, but it appears to be multifactorial, with a proposed interaction between genetic and environmental factors that results in continuous activation of the intestinal mucosal immune system . The inflammation affects the mucosa of the rectum, with different degrees of involvement of the colon.1 the management of ulcerative colitis is based on the extent of colon involvement, the activity, and the behavior of disease . The classification of the disease is defined according to the montreal classification, which describes the maximal macroscopic extent of the disease at colonscopy.2 this has important prognostic and management implications because patients with extensive ulcerative colitis bear a higher risk of colectomy and cancer,3 and patients with proctitis and left - sided colitis obtain much more benefit from topical therapies . However, the extent of colon involvement may change over time, such that about 20% of patients who are diagnosed with proctitis or left - sided ulcerative colitis are found to have proximal extension of the inflammation at follow - up . The clinical course of ulcerative colitis is characterized by different disease onsets and a remitting a recent population - based, inception cohort study identified four different patterns: (1) initial high activity that decreases to remission or mild severity (55% of patients); (2) initial low activity that changes to increased severity (1% of patients); (3) continuous symptoms (6% of patients); and (4) chronic intermittent symptoms (37% of patients). Moreover, an initial presentation with extensive colitis, high systemic inflammation burden, and a younger age has been associated with higher subsequent colectomy rates.4 disease activity is commonly classified as: remission, mild, moderate, or severe . Over the years, several different scoring systems have been developed as measures of disease activity, but most of these have only been used in clinical trials and have not been validated . In clinical practice, the combination of clinical features, laboratory findings, and the endoscopic appearance, forms the basis of patient management.5 the main treatment goals for ulcerative colitis are the induction and maintenance of clinical and endoscopic remission . As far as mild - to - moderate disease is concerned, the oral and topical aminosalicylates represent the standard therapy for achieving this outcome.6 in the event of inadequate response to aminosalicylates and in patients with moderate - to - severe disease, systemic corticosteroids are the best option for inducing remission.7 patients with active ulcerative colitis who do not have significant clinical improvement after 24 weeks of an appropriate course of corticosteroids are classified as corticosteroid - refractory . Anti - tumor necrosis factor - alpha (tnf) monoclonal antibodies represent the best available option for this group of patients, achieving clinical and endoscopic remission without prolonged steroid exposure.8 after achieving a response with corticosteroid treatment, aminosalicylates are usually continued as maintenance therapy . However, patients relapsing within 3 months of stopping corticosteroids or who are not able to reduce the dose to below 10 mg / day of prednisolone within 3 months of starting are classified as corticosteroid dependent.1 in this specific disease setting, azathioprine has been shown to be significantly more effective than mesalazine for inducing corticosteroid - free clinical and endoscopic remission at 6 months and has a corticosteroid - sparing effect.9 treatment algorithms for patients with corticosteroid - dependent ulcerative colitis suggest starting concomitant thiopurine therapy and slowly withdrawing corticosteroids over 34 months, timed to coincide with the expected onset of action of the thiopurines.10 if symptoms persist or patients are unable to stop steroids after 12 weeks of starting thiopurines, anti - tnf agents should be started.10 finally, induction and scheduled maintenance treatment with infliximab has been recently reported to be effective for inducing steroid - free clinical remission and mucosal healing at 1 year, in both thiopurine - nave and experienced, corticosteroid - dependent, ulcerative colitis patients.11 patients with acute, severe ulcerative colitis need to be hospitalized and treated with intensive intravenous corticosteroids (methylprednisolone, 60 mg/24 h, or hydrocortisone, 100 mg, four times daily). A lack of improvement within 35 days of intensive treatment is an indication for rescue therapy or surgery . A recent open - label trial involving 115 patients with acute, severe ulcerative colitis who were refractory to intravenous corticosteroids and randomized to receive either intravenous cyclosporine or infliximab has shown no significant differences in treatment failure (primary efficacy outcome: 60% cyclosporine group vs 54% infliximab group; absolute risk difference, 6%; 95% confidence interval [ci], 7 to 19 [p = 0.52]).12 therefore, the decisions of physicians are often determined on a case - by - case basis . These decisions are usually made based on personal experiences with this specific therapy and the physician s confidence for the management of adverse events, taking into account the long - term strategy . Cyclosporine, in fact, has been shown to be effective only over the short - to - medium term . Therefore, all patients should be bridged to thiopurines, although it has been shown that patients without previous thiopurine exposure have better outcomes.13 adalimumab is a human monoclonal immunoglobulin (ig) g1 antibody to tnf that is subcutaneously administered at a standard induction dose of 160 mg, followed by 80 mg after 2 weeks . Maintenance doses are then scheduled at 40 mg every other week (eow).14 this drug has been shown to be effective for inducing and maintaining remission in patients with active, moderate - to - severe luminal or perianal crohn s disease; patients nave to anti - tnf; or patients with previous loss of response or intolerance to infliximab.1519 as far as ulcerative colitis is concerned after the publication of the results of the two pivotal, randomized placebo - controlled double - blind trials (ultra 1 and 2) (table 1),20,21 adalimumab was approved for use in patients with moderate - to - severe active disease and in those who were nonresponders or intolerant to conventional therapy . In these trials, involving more than 1000 patients with moderate - to - severe active ulcerative colitis, adalimumab was compared with placebo with regard to the efficacy of induction and as a maintenance treatment, assessed after 8 and 52 weeks, respectively . In the ultra 1 trial,20 patients with ulcerative colitis were initially randomized to adalimumab (160 mg/80 mg) or placebo at weeks 0 and 2, respectively . Subsequently, after an amendment of the protocol, a third arm, with adalimumab at 80 mg/40 mg, was included . All patients enrolled were nave to anti - tnf therapy and had active disease (defined by a full mayo score of 612 and an endoscopic subscore of 23), despite stable doses of concomitant steroids, immunomodulators, or both . The primary endpoint, assessed in 390 patients with ulcerative colitis who were studied after the above amendment, was defined as the proportion of patients achieving clinical remission (full mayo score 2, with no individual subscore> 1) by week 8 in each treatment arm . Week 8 clinical remission was achieved in 18.5% of patients in the adalimumab 160/80 mg group and in 9.2% of patients in the placebo arm (p = 0.031), showing a 9.3% of therapeutic gain . The week 8 clinical remission rate in the adalimumab 80/40 mg group was similar to that of the placebo group (10% vs 9.2%) (p = 0.833). The clinical response and mucosal healing among the three groups (secondary endpoints) were not significantly different . A post hoc analysis identified baseline clinical variables, such as extensive disease, high disease activity (mayo score 10) and high levels of systemic inflammation (c - reactive protein = 10 mg / l), that were associated with a low proportion of patients in clinical remission, which might reflect a lesser efficacy of adalimumab in patients with more severe disease . Thereafter, 390 patients entered an open - label extension study after week 8 and were maintained on adalimumab 40 mg eow for 52 weeks, with the possibility of dose - escalation to 40 mg weekly . A clinical remission at week 52 was reported in 25.6% of patients maintained with 40 mg of adalimumab eow . A post hoc analysis, which included the patients who dose - escalated to 40 mg weekly, showed that 29.5% of patients were in remission at week 52.22 in the ultra 2 trial, 494 active ulcerative colitis patients were randomized to receive adalimumab 160 mg at week 0, 80 mg at week 2, and 40 mg eow, or placebo, through to 52 weeks . The clinical and endoscopic eligibility characteristics were similar to those associated with the ultra 1 study, with the exception of the inclusion of ulcerative colitis patients (40% of the population studied) who had already experienced anti - tnf agents, but with a discontinuation period of at least 8 weeks . The two co - primary endpoints were defined as the proportion of patients achieving clinical remission (defined as full mayo score 2, with no individual subscore> 1) at week 8 and the proportion of patients achieving clinical remission at week 52 . Clinical remission at week 8 was achieved in 16.5% of patients in the adalimumab arm and in 9.3% of patients in the placebo arm (p = 0.019) (7.2% therapeutic gain). The corresponding values at week 52 were 17.3% and 8.5% (p = 0.004), respectively, with an absolute difference of adalimumab versus placebo of 8.8% . Moreover, a clinical response was achieved in 50.4% of patients receiving adalimumab and 34.6% on placebo (p <0.001) at week 8 and in 30.2% and 18.3%, respectively (p = 0.002) at week 52 . The benefit over placebo was also significant by endoscopic remission, evaluated at week 8 (41.1%, adalimumab vs 31.7%, placebo) (p = 0.032) and at week 52 (25% vs 15.4%, respectively) (p = 0.009). A subgroup analysis, stratifying patients based on prior exposure to anti - tnf, was also performed . Among nave patients, a week 8 clinical remission was achieved in 21.3% of patients in the adalimumab group and in 11% in the placebo group (p = 0.017); the corresponding values at week 52 were 22% and 12.4%, respectively (p = 0.029). A significant difference in clinical remission was found only at week 52 (10.2%, adalimumab and 3%, placebo) (p = 0.039) in the anti - tnf-exposed group.21 a post hoc intention - to - treat analysis of ultra 2, including all patients randomized to adalimumab who achieved a clinical response, as per their partial mayo score at week 8, was performed to investigate week 52 clinical remission, response, mucosal healing, corticosteroid - free remission, and corticosteroid discontinuation rates . Among the 248 patients originally randomized to adalimumab, 123 (49.6%) had achieved clinical response . Of these, 30.9%, 49.6%, and 43.1% achieved clinical remission, clinical response, and mucosal healing at week 52, respectively . Of the 150 adalimumab - treated patients taking corticosteroids at enrollment, 90 (60%) responded, as per their partial mayo score at week 8 . Of these, 21.1% achieved corticosteroid - free remission and 37.8% were corticosteroid - free at week 52, without significant differences among the anti - tnf-nave and exposed patients . These results were similar whether or not week 8 responses were assessed using the full mayo score.23 further analysis showed that patients who received the 160 mg/80 mg adalimumab induction dose had a significantly lower risk of all - cause hospitalizations and ulcerative colitis - related hospitalizations, compared with placebo, during the first 8 weeks of therapy.24 this benefit over placebo was also significant for adalimumab early - responders, during the follow - up.25 at 52 weeks, 588 patients who completed the ultra 12 trials entered an extension, open - label study . Patients who entered the open - label, weekly adalimumab study continued at the same dose . Patients who entered the study from any blinded arm or from an open - label cohort receiving adalimumab (40 mg eow) received adalimumab at a dose of 40 mg eow . At week 60 of the open - label extension study, 351 (59.7%) of the patients who had entered the extension study achieved clinical remission, per their partial mayo score.26 although adalimumab has been recently licensed, multiple lines of evidence from open - label and retrospective studies on adalimumab, administered for compassionate use in ulcerative colitis patients, have been available for several years (table 1). Oussalah et al27 first presented data on 13 ulcerative colitis patients treated with adalimumab in 2008 . All of the patients had been previously treated with infliximab, and most of them (90.31%) had been previously treated with thiopurines . Patients were treated with adalimumab, with an induction dose of 160/80 mg at weeks 0 and 2, and then maintained with 40 mg eow . The primary endpoint was defined as the proportion of patients on adalimumab therapy during the study . After a median follow - up of 41 weeks eight patients discontinued adalimumab: six due to colectomy, one due to lack of response, and one due to an exacerbation of psoriasis . No significant differences were found in adalimumab withdrawal and colectomy rates between the patients who lost response to infliximab and those who became intolerant . From this small cohort of difficult - to - treat patients who had already been treated with all of the main available therapies, adalimumab treatment potentially avoided colectomy in about half of them . One year later, the mayo clinic group published the results of an uncontrolled, open - label study on adalimumab in 20 patients with ulcerative colitis, of whom 35% were nave to infliximab . All patients had active disease (defined as a mayo score of 612 points, with an endoscopic subscore of at least 2) despite concurrent treatment (steroids, and/or thiopurines, and/or aminosalicylates). Patients were treated with adalimumab at an induction dose of 160/80 mg at weeks 0 and 2, respectively, and maintained with 40 mg eow . The primary endpoint was defined as the proportion of patients achieving a clinical response at week 8 . The percentages of patients who had a clinical remission or response were 5% and 25% at week 8, respectively and 25% and 50% at week 24, respectively . No significant differences were found between infliximab - nave and infliximab - exposed patients . Among the patients who entered the trial on corticosteroids, 58% were able to withdraw by week 24, showing the potential effectiveness of adalimumab as a steroid - sparing agent.28 hudis et al29 retrospectively reported data on nine patients, with active ulcerative colitis (mean mayo score of 6 1.66 at baseline) and secondary infliximab failure, who were treated with adalimumab (induction, 160/80 mg at weeks 0/2; maintenance, 40 mg eow). During the follow - up, adalimumab was found to be effective at inducing a clinical response (mean mayo score, 2.5 1) (p <0.0005), with a steroid - sparing effect (p <0.003). Data, from a single referral center, involving 53 ulcerative colitis outpatients treated with biologic drugs, following a structured protocol for a step - up approach . All patients were intolerant and/or nonresponders to conventional therapy, including aminosalicylates, steroids, and thiopurines . Among them, 25 patients were treated with adalimumab (160/80 mg at weeks 0 and 2, then 40 mg eow) and 28 with infliximab (5 mg / kg at weeks 0, 2, and 6, then every 8 weeks). Most of patients had extensive colitis (96% in the adalimumab group and 90% in the infliximab group). Concomitant immunosuppressive therapy (azathioprine or methotrexate) was taken by significantly fewer patients in the adalimumab group (20% vs 53.4%) (p = 0.0118). The primary endpoint was defined as the proportion of patients treated with adalimumab or infliximab achieving and maintaining a clinical response . At 14 weeks, 47 of the 53 (88.7%) patients had a clinical response to anti - tnf therapy, without a significant difference between the adalimumab (20/25 patients, 80%) and infliximab (27/28 patients, 96%) groups (p = 0.0889). Among the patients who entered the maintenance treatment phase, 1420 adalimumab (70.0%) and 1418 (77.8%) infliximab patients had a response up to the end of follow - up (p = 0.7190). The median duration for the maintenance phase was 54.5 weeks (range, 3108 weeks) for the adalimumab group and 64.5 weeks (range, 8180 weeks) for the infliximab group . Of the six adalimumab patients who lost response, two underwent colectomy, one switched to infliximab, and three were treated with another course of steroids . About 92% of the patients who were initially taking steroids were able to stop over the course of the maintenance period, with similar results observed in both groups . Cohort, adalimumab seemed to be as effective as infliximab at achieving induction and maintenance responses in ulcerative colitis patients . The effectiveness of adalimumab in a real - life setting has also been reported in a spanish retrospective multicenter study that enrolled 30 ulcerative colitis patients after the failure of other therapies . All patients were infliximab experienced: 53.3% had lost responsiveness, 40% had become intolerant, and 6.7% were primary nonresponders . Adalimumab was administered to 26 patients because of moderate - to - severe, refractory ulcerative colitis, and four patients received adalimumab because of a severe attack that was refractory to intravenous corticosteroids . All patients received a loading dose of 160/80 mg of adalimumab at weeks 0 and 2, respectively and were maintained with 40 mg eow . Patients were assessed at weeks 4 and 12, and then every 4 weeks in order to evaluate the short- and long - term outcomes . The primary endpoint was defined as the induction of a clinical response at week 12 . Sixteen (53.3%) and 18 (60%) patients achieved a clinical response at week 4 and 12, respectively . Three (10%) and eight (26.7%) patients achieved a clinical remission at week 4 and 12, respectively . Fifteen (50%) patients discontinued adalimumab during the median follow - up of 48 weeks (interquartile range [iqr], 16104), and 13 (86.6%) of them discontinued because of a lack or loss of response, including four inpatients with severe intravenous corticosteroid - refractory disease . All patients who were under corticosteroid treatment at baseline and entered the maintenance adalimumab treatment were able to discontinue the steroids . The rate of colectomy was 20%, with a median time to colectomy of 16 weeks (iqr, 5.240.5 weeks). A lack of response at week 12 was associated with an increased probability of withdrawal (p = 0.001) and a higher rate of colectomy (p = 0.001). Thus, adalimumab induced a durable clinical response in a good percentage of patients with medically refractory ulcerative colitis, especially in those who achieved short - term clinical response.31 the same issue was also addressed by mcdermott et al,32 who collected data on 23 patients with ulcerative colitis treated with adalimumab (standard induction and maintenance treatment). Twenty - two of the patients (96%) had received prior immunomodulatory therapy and 20 (86%) had previously been treated with infliximab (three primary nonresponders, eleven secondary failures, and six who experienced side effects). The primary endpoint was defined as treatment failure . During a median follow - up period of 22 months (iqr, 832 months), 16 patients (69.5%) discontinued adalimumab . The reasons for discontinuation were primary nonresponse in six patients (37%), secondary nonresponse in eight (50%), and side effects in one (6%). Nine patients underwent colectomy, and three refused surgery; the colectomy - free survival was estimated to be 78% at 6 months, 70% at 12 months, and 59% at 2 years . No significant predictors of colectomy were identified, but 55% of patients who underwent surgery had failed adalimumab treatment within 3 months of starting treatment.32 further findings by ferrante et al33 confirmed that adalimumab is effective in inducing a durable clinical remission in patients who have already been treated with infliximab . Fifty patients with moderate - to - severe ulcerative colitis received adalimumab induction treatment (160/80 mg at weeks 0 and 2, followed by 40 mg eow). The primary endpoint was the long - term efficacy of adalimumab . At week 4, 68% patients showed a short - term clinical response . In particular, 22% of the patients achieved a complete clinical response, defined as the absence of diarrhea and bloody stools, and 46% of the patients achieved a partial response, defined as a marked clinical improvement, with persisting rectal blood loss . After a median follow - up of 23 months, 52% achieved a durable response to adalimumab, defined as a lasting clinical response . Dose escalation was necessary in 76% of patients and was associated with significantly increased serum adalimumab levels (from 4.75 to 7.95 g / ml) (p = 0.023). Short - term clinical response and response to dose escalation were associated with colectomy - free survival (p = 0.030 and p <0.001, respectively). Data from the spanish eneida (estudio nacional en enfermedad inflamatoria intestinal sobre determinantes genticos y ambientales) registry of 48 patients with ulcerative colitis treated with adalimumab (induction dose, 160/80 mg at weeks 0 and 2, in 93.7% of patients; maintenance dose, 40 mg eow) have been recently reported.31 among these patients, 39 (81.3%) had previously received infliximab and were categorized into one of three categories: remission, 51.3%; response, 33.3%; and primary nonresponse, 15.4% . The primary endpoint was defined as the proportion of patients achieving a clinical response during the follow - up period . The clinical response rates were assessed at weeks 12, 28, and 54 and were 70.8% (34/48), 43.2% (19/44), and 35% (14/40), respectively . A response to prior treatment with infliximab was the only factor predictive of a response to adalimumab at week 12, which was obtained in 90% of infliximab remitters, 53.8% of responders, and 33.3% of primary nonresponders a lack of response to adalimumab at week 12 was shown to be an independent predictor of colectomy: five of the 34 (14.7%) responders and six of the 14 (42.9%) nonresponders (p = 0.035) required a colectomy, with a colectomy - free time that was significantly reduced among the nonresponding patients (p = 0.01).34 the last real - life experience comes from an italian multicenter study that represents the largest case series of active ulcerative colitis treated with adalimumab . Eighty - eight patients were treated with adalimumab (induction dose of 160 mg/80 mg in 77 patients [87.5%] and 80 mg/40 mg in eleven patients [12.5%], at weeks 0 and 2, respectively). After induction, the patients were maintained with adalimumab 40 mg eow; a dose escalation was allowed at the physician s discretion . All patients had active disease (medium partial mayo score, 6) (iqr, 48), and 57 (64.8%) had extensive colitis . Sixty - nine patients (78.4%) had been previously treated with infliximab, and 65 (73.9%) had been exposed to immunomodulators (azathioprine, methotrexate, and cyclosporine). The indications for adalimumab treatment were corticosteroid dependence in 41 patients (46.6%), corticosteroid resistance in 23 patients (26.1%), extraintestinal manifestations in 14 patients (15.9%), and a combination of corticosteroid dependence and extraintestinal manifestations in ten patients (11.4%). The median duration of adalimumab therapy was 13 months (iqr, 621 months), with a median follow - up duration of 15.5 months (iqr, 1224 months). The co - primary endpoints were defined as the proportion of patients achieving clinical remission (partial mayo score 1) at 4, 12, 24, and 54 weeks . The clinical remission rates were 17%, 28.4%, 36.4%, and 43.2% at 4, 12, 24, and 54 weeks, respectively, with no significant differences between the infliximab - nave and infliximab - exposed patients . Fifteen patients (17%) achieved sustained clinical remission, defined as a lasting clinical remission from week 12 up to 24 and 54 weeks . Among the 60 patients who were taking steroids at baseline, 56.7% were able to discontinue steroids, and a steroid - free remission was achieved in 24 of 60 patients (40.0%) at week 54 . Fifty - seven patients underwent baseline and follow - up endoscopy after a median of 11 months (iqr, 5.113.2 months). An endoscopic remission was achieved in 28 (49.1%) of 57 patients, and 15 (26.3%) of the 57 achieved complete mucosal healing . Overall, 25% (22 of 88) of the patients required colectomy, with a median time to colectomy of 5.5 months (iqr, 313 months). The rate of colectomy was higher in the infliximab - exposed group than in the infliximab - nave group (28.9% vs 10.5%), but this result did not achieve statistical significance, probably because of the small number of patients who ultimately required surgery and the small number of infliximab - nave patients enrolled in the study . In conclusion, in this large, real - life cohort of refractory and difficult - to - treat ulcerative colitis patients, adalimumab was shown to be effective at inducing and maintaining a durable clinical remission and to have a steroid - sparing effect.35 the subcutaneous administration is associated with generally mild injection site reactions that do not necessitate drug discontinuation . The overall safety profile in the clinical trials in patients with ulcerative colitis was comparable to that of placebo, and the rates of adverse events were similar to the ones that emerged for the other approved indications for adalimumab.36 no relevant warnings have emerged from the real - life studies . However, in two studies, a worsening of preexisting psoriasis, leading to drug withdrawal, was recorded.24,28 lastly, the fully human - designed features of adalimumab reduce, but do not eliminate, the risk of antidrug antibody development.22 the presence of human anti - human antibodies (haha) and low trough serum adalimumab levels have been reported to influence the long - term outcome of adalimumab therapy in patients with crohn s disease . Increased adalimumab discontinuation rates have also been reported in crohn s disease patients with low trough serum adalimumab concentrations . Furthermore, haha were detected in 92% of crohn s disease patients with low trough serum adalimumab levels during follow - up, probably reflecting the increased clearance of the drug and the subsequent loss of response . Finally, concomitant immunosuppressive agents did not affect treatment outcomes, adalimumab trough levels, or haha development.37 the treatment of ulcerative colitis depends largely on the extension, severity, and behavior of the disease, and the traditional step - up approach with conventional drugs remains the standard management approach . However, there are subsets of patients who do not respond to conventional therapies or in whom conventional therapies are contraindicated . In these difficult - to - treat patients, the current guidelines recommend the use of biological drugs . In the recent past, infliximab was the only biological drug approved for the treatment of patients with ulcerative colitis . Recently, after the publication of the results of the two pivotal, randomized ultra 12 trials, adalimumab was approved for use in patients with moderately - to - severely active disease, nonresponders, and those intolerant to conventional therapy . As often happens, the results of a clinical trial should be incorporated into real - life clinical practice, where patients have already experienced several therapies before, and may be intolerant or not fully adherent to treatments . Therefore, the goal is to select the candidates who will best benefit from the drug . The emerging concept is that the ideal candidates for adalimumab therapy are anti - tnf-nave outpatients with moderate - to - severe corticosteroid- or immunosuppressive - refractory ulcerative colitis . Short - term clinical responses, evaluated after 812 weeks, seem to influence the long - term outcomes and are associated with more durable clinical responses and colectomy - free survival . Adalimumab also demonstrated a steroid - sparing effect and a mucosal healing capacity, and it may be a valid option for steroid - dependent patients . As has now been demonstrated in pivotal trials and in several real - life experiences, adalimumab is effective and safe for treating patients with different types of ulcerative colitis, including difficult - to - treat individuals.
The landmark veterans administration laryngeal cooperative study published in 1991 initiated the era of organ preservation . Today, many patients are advised to choose chemoradiation as their primary treatment for advanced oropharyngeal carcinomas (stages iii, this typically results in high doses to the parotids, submandibular glands, and the mandible (> 60 gy). The resulting long - term complications of xerostomia and osteoradionecrosis are well known and negatively impact patients quality of life (qol). Recent advances in computational power have allowed radiation therapy to be directed more specifically to the tumor bed . The goal of using imrt is to limit the radiation dose to radiosensitive structures, such as the parotids and the mandible . Within the literature, the literature has demonstrated that imrt protocols provide equivalent control rates and overall survival when compared to more traditional opposed port therapy . However, it is unclear how the improved dosimetry impacts qol of long - term head and neck cancer survivors . The protocols for this treatment are still being perfected, but the mainstay of chemotherapy for head and neck carcinomas involves 5-flurouracil, a nucleotide analog, and cisplatin a dna chelating agent . The side effects of these agents can be severe and include neutropenia, mucositis, renal toxicity, neuropathy, and hearing loss . Terrell et al . Demonstrated that the addition of chemotherapy to treatment negatively impacts qol of patients . Qol is a subjective perception by the patient that includes physical, emotional, and social well being . It is well established that different subsites within the head and neck have different perceived qol following treatment; patients with oropharyngeal carcinoma tend to report worse qol than do other head and neck cancer patients and have poorer functional outcomes [8, 9]. The need for gastrostomy and tracheostomy tubes, comorbid medical conditions, and need for a neck dissection all negatively affect qol outcomes . A previous study demonstrated no difference in qol outcomes between patients who had undergone chemoradiation versus surgery and radiation for advanced oropharyngeal carcinoma . In the current study a comparison between qol outcomes between patients who received chemotherapy and imrt (cimrt) versus standard chemoradiation with opposed port therapy (crt) was undertaken . The hypothesis of this study is that cimrt patients experience improved qol compared to those undergoing crt . Patients were recruited from a tertiary referral center from a registry of patients who had undergone radiation therapy of all types from 2001 to 2006 . Patients had biopsy - proven squamous cell carcinoma of the oropharynx (including tonsil, base of tongue, or pharynx). These tumors were clinically staged as stage ii through iv based on criteria described by the american joint committee on cancer (ajcc). All patients involved in the study had undergone either primary concurrent chemoradiation (crt) or concurrent chemotherapy with imrt (table 1). Patients were excluded if they required surgical salvage after crt / cimrt or had metastatic disease at the time of diagnosis.table 1chemotherapy and radiation protocol for study participantsid no.tnmxrt typetotal xrt dosechemo1t4n1conventional7,020cisplatin / etoposide2t3n2bconventional7,0202 cisplatin/5fu3t3n2cconventional7,0002 cisplatin/5fu4t1n1conventional7,2001 cisplatin/5fu5t2n0conventional7,0002 carbo/5fu6t3n2conventional7,0202 cisplatin/5fu7t3n2bconventional5,4002 cisplatin/5fu8t1n2bconventional7,2002 cisplatin/5fu9t4n1conventional7,3802 cisplatin/5fu10t2n1conventional7,0002 cisplatin/5fu11t4n1conventional7,0202 cisplatin/5fu12t4n3conventional7,0202 cisplatin/5fu13t4n1conventional7,5603 cisplatin14t3n3conventionalnana15t4n0conventionalnana16t4n0conventional7,0202 cisplatin/5fu17t4n3imrt7,0002 cisplatin18t2n0imrt7,0002 cisplatin19t2n2aimrt7,0003 cisplatin/5fu20t1n2bimrt7,0002 cisplatin/5fu21t2n1imrt7,0002 cisplatin22t2n2imrt6,8003 cisplatin23t2n0imrt7,0002 cisplatin24t2n2bimrt7,0004 cisplatin25t4n3imrt7,0002 cisplatin26t3n2imrt6,800erbitux27t1n2bimrt7,0002 cisplatin28t3n2bimrt7,0002 cisplatin29t2n0imrt6,800none30t3n1imrt6,8002 cisplatinna records not available, 5fu 5 fluorouracil, carbo carboplatinpatient moved from area before finishing treatment chemotherapy and radiation protocol for study participants na records not available, 5fu 5 fluorouracil, carbo carboplatin patient moved from area before finishing treatment a total of 50 patients identified from institutional databases met eligibility requirements for the study . All eligible patients were mailed copies of the university of washington quality of life questionnaire, version four (uw - qolv4). Patients voluntarily filled out the questionnaire at home and mailed their responses to the study organizers . Questionnaires were identified by a nondescript number, and data were entered into a confidential database . The uw - qolv4 instrument is scored on a scale of 0100 for the first and third segments . The first section consists of 12 domains pertaining to the degree of qol in the categories of pain, appearance, activity, recreation, swallowing, chewing, speech, shoulder function, taste, saliva, mood, and anxiety . A score of 0 indicates very poor or no functional capacity with regard to that domain while a score of 100 indicates no disability in that domain . The second segment of the questionnaire asks patients to choose three of the above domains that have been the most important to them in the past 7 days . In the final part of the instrument, patients are given three general questions comparing their (1) current health - related quality of life (hr - qol) to 1 month before developing cancer, (2) hr - qol during the past 7 days, and (3) overall qol during the past 7 days . The final segment is scored with 0 indicating very poor qol and 100 indicating outstanding qol, with a range of scores between . Statistical analysis of the responses was conducted using the wilcoxon rank sum test and the chi - square test . Results were adjusted to control for time from treatment to questionnaire and for tumor stage . Twenty - nine questionnaires were returned (58% return rate), with 16/30 patients in the crt cohort and 13/20 in the cimrt cohort . Eleven of 16 patients in the crt cohort and 9 of 14 patients in the cimrt group had stage iv tumors . Table 1 shows the various radiation doses and chemotherapy regimens for the responding patients . The average time between the completion of treatment and questionnaire for the cimrt group was 13 months (range 422 months) while that for the crt group was 25 months (range 453 months). Patients who received cimrt reported statistically significantly better qol with regard to appearance (p = 0.05), chewing (p = 0.02), and mood (p = 0.01). There was a trend toward significance in favor of cimrt with regard to anxiety (p = 0.08), recreation (p = 0.07), and activity (p = 0.07). No statistically significant difference was reported between the two cohorts with respect to saliva (p = 0.34), pain (p = 0.47), swallowing (p = 0.29), speech (p = 0.50), shoulder (p = 0.24), and taste (p = 0.32). With regard to overall qol and hr - qol, there was no difference between the two groups (p = 0.31 and 0.09, respectively). However, when asked about qol compared to 1 month before the development of cancer, cimrt patients reported improved qol (p = 0.06). Primary chemotherapy with radiation is a popular treatment option for patients with advanced oropharyngeal carcinoma . Recent advances have allowed for conformal radiation treatment strategies in order to minimize complications in radiosensitive structures . Qol in long - term survivors is an important outcome measure and is currently an active area of research . In this study, qol outcomes were compared in a cohort study between traditional opposed port radiotherapy and imrt; both groups received concomitant chemotherapy . Overall qol was not different in the cimrt patients; however, several domains did demonstrate improved qol as measured by the uw - qolv4 . No difference was detected for all other domains, including saliva, taste, and swallowing . Specific evaluation of the global and hr - qol in patients treated for oropharyngeal carcinoma with imrt is limited . The majority of studies available evaluate xerostomia and xerostomia - related qol [11, 12]. Of the studies that evaluate global qol, it has been demonstrated that imrt patients experience improved qol [13, 14]. Yao et al . Recently published the only study focused on oropharyngeal cancer survivors specifically . They evaluated 56 patients with the head and neck cancer inventory which measures hr - qol and questions about their diet . They found that eating and dysphagia scores were significantly improved in the imrt group of patients . Other domains demonstrated improved qol scores for imrt patients but did not reach statistical significance . Furthermore, 1 year after treatment the imrt patients scores continued to improve while the crt patients scores had reached a plateau . In the current study, a different head and neck specific instrument was used, specifically the uw - qolv4; thus it is somewhat difficult to compare the data . However, it is apparent there were differences between the findings of the iowa group and our cohort . In the present study, only 3 of 12 domains demonstrated significance although several domains approached significance . Specifically, patients did not report improved saliva or swallowing in our study while yao et al . Did report improvement for these domains . Other studies in the literature have looked primarily at either xerostomia - related qol or dysphagia - related qol . Studied the dosimetry to the constrictor muscles in oropharyngeal carcinoma patients and determined that higher doses delivered to these muscles resulted in higher rates of severe dysphagia and gastrostomy dependence . Their study is somewhat difficult to interpret because not all patients received chemotherapy, which may lead to increased scarring in the pharyngeal musculature . In our study, patients received relatively uniform chemotherapy regimens and similar dosimetry to tumor . The patients in our cohorts did not report improved swallowing or saliva, but cimrt patients did report better chewing . The noted improvement in chewing may be explained by the sparing of the intrinsic musculature of the tongue and other oral structures with imrt . The ability to manipulate the bolus within the oral cavity is an integral part of the oral phase of chewing . The results for saliva are somewhat surprising based on the radiation protocol in effect at our institution . All patients with oropharyngeal primary tumors who undergo imrt receive 70 gy to the gross tumor . Sites within the oropharynx or neck with likely microscopic disease receive 63 gy and sites with potential or remote disease receive 56 gy . The parotid glands are carefully identified and mapped so that 50% of each gland received only 20 gy . The rest of the gland receives doses from 56 to 70 gy (see fig . 1). With approximately half of the gland spared from high dose radiation, recovery of salivary function is expected within several months after the completion of treatment . Conversely, patients treated with conventional (opposed port) radiation do not have sparing of the parotid glands . For treatment of the oropharynx, minimal salivary function is expected to return in these patients . Given the differences between the radiation protocols, the lack of difference regarding salivary qol is surprising . Perhaps those undergoing imrt have decreased perception of salivary flow when compared to pre - therapy flow rates and thus report decreased salivary qol.fig . 1radiation planning diagram for t4 carcinoma of the right tonsil . The primary tumor volume receives 70 gy (marked t and shaded in red). The radiation plan is designed to spare 50% of each parotid gland (blue - shaded area identified by the arrowhead). The dose distribution lines show rapid falloff in the radiation dose between the tumor and the majority of the parotid gland . A small amount of the gland receives high dose radiation where the tumor approaches the gland radiation planning diagram for t4 carcinoma of the right tonsil . The primary tumor volume receives 70 gy (marked t and shaded in red). The radiation plan is designed to spare 50% of each parotid gland (blue - shaded area identified by the arrowhead). The dose distribution lines show rapid falloff in the radiation dose between the tumor and the majority of the parotid gland . A small amount of the gland receives high dose radiation where the tumor approaches the gland patients receiving cimrt did report significantly better mood and appearance than their crt counterparts . Perhaps there is less woody induration in imrt patients, which results in a more supple appearance to the neck contour and hence an improved perception of appearance . The results with regard to mood were unexpected and cannot be explained by a difference either in final xrt dose or in chemotherapy regimens, as these were similar between the groups . These results are inherently biased and dependent on the patient s expectations of their treatment and its outcomes . Perhaps, the cimrt patients reported better mood because they expected to feel better after treatment . Other differences in the perceived qol of these patients may be elucidated with a different qol instrument . There are a number of head and neck specific questionnaires available which have been validated in the literature including the hr - qol, eortc - c30 with the eortc - h&n35, and uw - qol . A recent review by tschiesner et al . Compared these instruments using the international classification of function, disability, and health (icf) schema . Using this schema, the content of the instruments can be more easily compared as the instrument content was correlated with specific icf concepts . The eortc questionnaires cover a broader range of icf categories when compared to the uw - qol . The eortc instrument includes questions regarding memory and attention functions; sexual functions; respiratory functions; a variety of activities of daily living such as toileting and dressing; and smell . This instrument is used widely in europe but less commonly in the united states . However, both instruments have approximately 70% of their content that can be correlated to an icf category; the eortc instrument covers 43 categories while the uw - qol covers 23 categories . Two of the major benefits of the uw - qol, and the reason it was chosen for this study, are its broad range of questions and the relative ease of completion . In order to encourage participation in the veteran population from which this cohort was drawn, an instrument which could be completed quickly but covered a broad range of topics was required . The uw - qol can be completed in a quarter of the time needed to complete the eortc instruments . The differences between the two radiation groups may be helpful when deciding which radiation modality to use for specific patients . Those patients with comorbid conditions report having significantly worse qol prior to beginning therapy than those without these conditions . In these patients, all other factors being equal, cimrt may be a better option to try to minimize the negative impact of therapy on their already diminished qol . Other treatment options for advanced oropharyngeal carcinoma include surgery with adjuvant radiation (or chemoradiation). Surgical therapy is associated with late toxicity, including scarring, fibrosis, laryngeal, and esophageal stenoses, all of which also affect qol for head and neck cancer patients . As both appearance and chewing can be significantly impacted by surgery, it is possible that patients who undergo primary cimrt may have improved qol compared with patients who undergo surgery and radiation . Although there were no differences noted between the two chemoradiation groups in the aforementioned study, the impact of cimrt on qol when compared to surgery and radiation is yet to be explored . While none of the patients in this study received induction chemotherapy, it is known that chemotherapy, in general, negatively impacts on qol . How the timing of chemotherapy, induction, or concomitant, impacts qol has not been explored . It seems likely that although early toxicity of therapy may be diminished in those patients undergoing induction chemotherapy, the long - term effects on qol would be similar to those receiving concomitant chemoradiation . One limitation to this study was that our sample size was small, and there may not have been sufficient power to find significant differences between the two groups . A larger number of patients may demonstrate subtle differences between the groups and may result in statistically significant differences for anxiety, recreation, and activity . An ideal study would be a prospective longitudinal one involving a larger number of patients, and in future such studies are planned . However, we believe that this current study is a valuable pilot study which yields important information about what oropharyngeal cancer patients should expect from crt and cimrt, especially when discussing the benefits of a given treatment . It is important not to overstate the benefits of that treatment and ensure that patients have realistic expectations for their post treatment qol . Patients who receive chemotherapy and imrt do have improvement in certain domains of qol, specifically appearance, mood, and chewing . However, with regard to overall qol, cimrt and crt patients have similar perceptions of qol . Surprisingly, in our study cimrt patients did not report better saliva or swallowing when compared to crt patients . Although studies in the literature demonstrate improved salivary flow rates with parotid sparing radiation regimens, this does not appear to have improved the patients perceptions of dry mouth following treatment.
As rising health care costs continue to draw attention, the rate of increase in medicare expenditures, which significantly exceeded those of the overall u.s . Health care system (9.3 versus 6.9 percent in 2005), is of particular concern to policymakers . The escalation in medicare part a spending is consuming a greater share of federal revenue, and current projections suggest that medicare outlays will exceed dedicated revenues by 45 percent of total expenditures in 2012 with the hospital insurance trust fund remaining solvent until 2018 . Underlying chronic conditions are a leading cause of illness, disability, and death among medicare beneficiaries and account for a disproportionate share of health care expenditures . While approximately 14 percent of medicare beneficiaries have heart failure, they account for 43 percent of medicare spending . Approximately 18 percent of medicare beneficiaries have diabetes, yet they account for 32 percent of medicare spending . Thus, to limit increases in overall program expenditures, congress is actively pursuing strategies to contain costs of the chronically ill subset of beneficiaries . With many approaches to chronic dm and little agreement on the most effective approach, the 2003 medicare modernization act included several demonstration projects to assess the various approaches and inform medicare's chronic dm strategy . Section 721 of the act, known as mhs, tests one approach in which commercial vendors provide dm interventions to fee - for - service beneficiaries with chronic illnesses . These 3-year demonstration projects were awarded to eight companies, with the first programs becoming operational in august 2005, and the eighth and final program becoming operational in january 2006 . The pilots follow a randomized - controlled design and require that vendors reimburse the medicare program in full if they are unable to achieve budget neutrality (inclusive of vendor fees). While official results of phase i are not due for over a year, three vendors have withdrawn early (lifemasters, mckesson, and cigna as subcontractor to healthways) and, in the preliminary evaluation of the first 6 months, the remaining projects have failed to achieve medical cost savings in excess of vendor fees (mccall, cromwell, and bernard, 2007). These early results lend support to a growing body of literature concluding that commercial dm programs do not generate medical cost savings.the u.s . Congressional budget office (2004) review of the dm literature concluded that there is insufficient evidence to conclude that disease management programs can generally reduce the overall cost of health care services . The most recent review by mattke and colleagues, which included 317 individual studies, reported that when the costs of the intervention were appropriately accounted for and subtracted from any savings, there was no conclusive evidence that disease management leads to a net reduction of direct medical costs . At the end of phase i, cms will face the decision of whether to expand mhs to a second phase . If the early trends are indicative of the final phase i results, policymakers should consider the changes that must be made to the commercial dm model to improve the likelihood of achieving cost savings and then assess whether the model is sufficiently compelling, when compared to other chronic care management strategies, to justify pursuing it . This article contributes to this process by describing the characteristics of the current commercial dm model that limit its ability to attain short - term medical cost savings and then discussing the changes required to overcome them . Prior to the initiation of a dm program, three questions should be answered to inform dm program design and set realistic expectations for the outcomes that will be realized: (1) what is the timeframe over which medical cost savings are expected to be achieved? (2) given this timeframe, which categories of medical costs have the potential to be reduced? (3) is there sufficient opportunity in a given population to achieve this targeted reduction in medical costs? The current commercial dm model suffers from a mismatch between the expectation of a short - run return on investment and an intervention that targets medium to long - term medical cost savings . Thus, the first step toward fixing the current dm model is to develop an internally consistent approach . The answer to the first question should be guided by the financial requirements of the stakeholder seeking to pursue dm for their population . Although savings can be realized in the short, medium, and long term from altering the course of disease progression, most payers seek a short - term return on their investments . For - profit organizations strive to maximize shareholder value and, along with nonprofit organizations, are hesitant to invest in long - term interventions when their population has significant turnover and they are not confident that the program will reduce medical costs . The 3-year timeframe of the first phase of mhs reflects this focus on short - term medical cost savings . In the short term, reductions may be more easily achieved for certain types of costs incurred by chronically ill populations . In the commercially insured, medicare and medicaid populations, the single largest health expenditure is in patient utilization (nearly 33 percent in 2005) with 13.3 percent of all emergency department visits associated with a hospital admission (mccaig and newar, 2006). Diagnoses for which timely and effective outpatient care reduces the risk of hospitalization (billings et al ., 1993). The second and third largest health expenditures, physician and clinical services and prescription drugs, typically increase as part of successful interventions targeting chronic illness (u.s . Congressional budget office, 2004; linden, 2006; ofman et al . . Therefore, the primary opportunity for commercial dm programs to realize short - term medical cost savings is via reductions in costly avoidable hospitalizations and the emergency department visits that often lead to them (linden, 2006). Further, a focus on avoiding the first admission during the intervention period is critical given that hospitalizations for chronic illnesses are relatively rare events and individuals may only experience one hospitalization over the entire course of a program . If the first admission is missed, the dm program may not have another opportunity to reduce the participant's medical costs . Before initiating a dm program in a given population, a numbers needed to decrease (nnd) analysis should be conducted to assess whether there is sufficient opportunity for an intervention to achieve medical cost savings . An nnd factors in variables including population - specific hospitalization rates, average cost per hospitalization, and the fees that will be charged by the vendor to project the percent of hospital admissions that need to be prevented to achieve a given savings target . Two recent studies using this analysis (linden, 2006; linden and biuso, 2006) calculated that between 11 and 74 percent of hospitalizations needed to be reduced for a dm program to break even on fees . An nnd for the mhs projects estimates a 15-percent reduction in all cause hospitalizations and an 82-percent reduction in disease - specific admissions (congestive heart failure and diabetes) to break even on fees alone (table 1). An nnd also informs the size of the population that should be included in a dm intervention and the fees that should be paid to vendors . The disease - specific hospitalization rate and the percent of hospitalizations required to break even will vary in relation to the disease severity of the population; in a sicker population with a higher attendant admissions rate, a lower percent of hospitalizations will need to be decreased to break even . However, a narrowly focused program targeting only the sickest patients addresses only a small fraction of the total disease burden and is unlikely to achieve the goals of dm at the population level . To determine a reasonable fee schedule, the percent of hospitalizations the vendor expects to decrease in the specific population should be estimated and then, given the client's average cost of a hospitalization, fees should be set below the expected savings . Under these two considerations, both dm vendors and their clients are best served by a program that is able to reduce the greatest percent of hospitalizations in the largest chronically ill population . To achieve this, each of the three components of the typical commercial dm model must be successfully executed . First, individuals within the target population at risk for a near - term hospitalization must be accurately identified . Second, they must be enrolled and actively participate in the program for a meaningful period of time . Third, the program must include interventions that modify or close deficits in participant and/or provider behavior (i.e., self - care and care - seeking behaviors and medical treatment or management) that lead to near - term hospital admissions . As currently structured, the commercial dm model is not optimally executing any of the three components . The typical approach, the barriers to realizing short - term cost savings, and recommendations to address the shortcomings are discussed for each component in the following section and summarized in table 2 . Dm programs typically use medical claims to identify patients with a specific chronic condition who were hospitalized in the prior year and then target them to receive an intensive intervention of regularly scheduled outbound calls from clinical staff . Participants with no medical claims for a hospitalization or emergency department visit in the prior year are classified as low risk and typically receive only quarterly mailings . A recent study conducted in a large managed care population reveals the problem with this approach (linden and goldberg, 2007). Members hospitalized for a chronic illness in a given year were categorized by prior year hospitalization status . The claims - based identification and stratification methodology, identical to that typically employed by dm companies, showed that only 6.4 percent of patients hospitalized in the current year had been hospitalized in the prior year . Thus, the vast majority of current year hospitalizations came from members who would have been misclassified by a dm company as low risk, unidentified due to lack of claims data, or newly enrolled in the health plan . Had these members been enrolled in a dm program that targeted only high risk patients based on prior hospitalizations they would have received either a minimal intervention or no intervention at all, making it highly improbable that the program could have prevented their hospitalizations . Dm programs are increasingly using predictive modeling to improve claims - based identification of individuals at risk for high medical costs . These statistical models use past medical claims and other basic demographic data to predict future costs . However, it requires past claims history in order to achieve any reasonable degree of accuracy, and it still fails to incorporate many factors that explain health care utilization that are not reflected in administrative data, such as predisposing and enabling factors and perceived need . A recent study comparing the accuracy of several commercial models to predict high - cost participants based on their past claims history found that all models significantly underpredicted high - cost individuals and overpredicted low - cost individuals (winkelman and mehmud, 2007). The best fitting model underpredicted costs by 73 percent in the highest cost percentile (99 - 100) and underpredicted costs by 52 percent in the 96 - 99th percentile of costs . These models fared worse when no past claims history was available and therefore would be uninformative for new entrants to a population . Given the importance for dm programs to prospectively identify individuals who will incur high costs in the near future, such low predictive ability can lead dm vendors to miss the patients most likely to have an acute episode in the near term . In light of these shortcomings, dm programs should look beyond claims data to other sources of patient data . Psychometrically validated health risk assessments (hras) developed to predict future hospitalizations should be used in conjunction with claims - based models and they offer a compelling alternative when no claims history is available . Several instruments have been developed specifically for the senior population (boult et al ., 1993) and achieve reasonably good predictive accuracy; the sensitivity - specificity tradeoff measured by an area under the curve is consistently around 70 percent (wagner et al ., 2006). At program initiation these surveys can be distributed at the population level to improve identification, and then readministered quarterly to find incident cases as well as track changes in risk status of previously surveyed participants . Many dm programs have such tools available but use them on a very limited basis; thus, increasing their use would not require a fundamental overhaul of the identification approach and, if administered electronically, would minimize the incremental cost . There are two other potential approaches to identify patients at risk for a near - term hospitalization . A direct referral from the patient's physician is the most accurate means of identifying suitable candidates for a dm program . Despite the fact that many dm programs have a channel for such direct referrals, physicians rarely use them . Physicians may not be aware of patient eligibility for dm or may not support the program . The broader issue of how to engage physicians in dm is discussed at the end of this section . Electronic medical records (emr) and other repositories of clinical data that include medication lists and laboratory values are rich sources of up - to - date patient information . Health systems such as kaiser permanente rely heavily on their emr for such purposes (hyatt, taylor, and budge, 2004), but outside of integrated delivery systems, third - party access to emr data would have to be negotiated . Thus, while both of these strategies are promising, under the current health care delivery system supplementing claims - based identification with hras is the most compelling approach to improve identification of high risk patients . This process is labor intensive and time consuming, limiting the number of eligible persons that can be contacted in a timely fashion . Further, people are often wary of discussing health - related issues with strangers over the telephone and potential participants must be convinced that the program is legitimate . In commercial dm programs, enrollment rates are quite low and vary by disease, with asthma program enrollment rates averaging 10 percent and congestive heart failure program enrollment rates averaging 30 percent of the eligible population (lewis, 2007). Vendors in the mhs project are strongly incentivized to maximize enrollment within the required opt - in approach and have achieved high enrollment rates in the first 6 months of the mhs projects ranging from 65 to 92.3 percent (mccall, cromwell, and bernard, 2007). However, mean time - to - agreement ranged from 37 to 100 days, revealing that in the best case it took over a month to enroll beneficiaries in the program . Further, those agreeing to participate were considerably healthier compared to non - participants, indicating that the beneficiaries who could most benefit from dm require even greater effort to enroll . An hra is also helpful in the enrollment process as it identifies individuals who are ready to consider changing their health behaviors and as a result are more likely to enroll in the program . The percentage of individuals in any given population that are ready to change their behavior is not easily quantified as it is highly dependent on how readiness to change is defined and differs by the particular behaviors that are targeted . Most survey instruments include questions based on prochaska's (1979) stages of change psychosocial model for determining the level of readiness to change . Participants who are at least contemplating change, once identified, should be contacted by program representatives trained in behavior change methods, such as motivational interviewing . Such techniques help participants overcome ambivalence and increase likelihood of enrollment (miller and rollnick, 1991). Representatives who are not trained in these methods may be too directive or confrontational, which can reverse a prior commitment to change (amrhein et al ., 2003) and discourage participation . Given the expense associated with telephonic enrollment, programs implemented in large populations should consider the use of interactive voice recognition (ivr) or web - enabled technologies to maximize the outreach to eligible participants . A tradeoff exists between the narrow - and - deep telephonic approach and the wide - and - shallow approach that ivr technologies facilitate . An optimal enrollment model would include a technologically - based outreach process that draws on motivational interviewing methods . However, this combination is not currently mature enough to be widely available . Thus, the choice of approach should be driven by the broader decision on the size of the population targeted to receive the intervention . For example, one employer - based program achieved a 90-percent hra response rate when a $500 rebate on medical premiums was offered, compared to a 20-percent response rate with no incentive (finkelstein and kosa, 2003). A recent study demonstrated that even modest incentives were effective in motivating overweight employees to lose weight . After 3 months, individuals who received $14 for their participation lost 4.7 pounds on average compared to only 2 pounds in the control group (finkelstein et al ., 2007). Physician incentives can further bolster enrollment by sharing the cost savings associated with the program or by providing a pay - for - performance initiative in which they are paid for enrolling and supporting their patients in the program . While incentives increase program costs, at the right level they may be offset by a concomitant increase in enrollment and active engagement assuming that the sub sequent intervention reduces medical costs . For participants classified as high risk, most commercial dm programs share a common intervention approach focused on improving process measures (e.g., increasing regular testing of glycosylated hemoglobin [hba1c] in diabetics) in order to avoid costly complications in the future . Since most process measures are performed periodically (i.e., diabetics should receive an hba1c test between two and four times per year), the core dm intervention is comprised of patient calls around the time that these tests should occur . A recent study conducted by healthways, inc . Reported that program participants with diabetes (245,668 unique members with diabetes from 25 different health plans across the united states) received no more than four calls in their first 12 months of the program (coberley et al ., 2007). While periodic calls to participants have proven adequate to elicit improvements in screening rates (coberley et al ., 2007), they are insufficient to pick up on signs that patients are at risk for a near - term emergency department visit or hospitalization . Further, there is evidence to suggest that most clinical practice guidelines for chronic illnesses are not modified to consider the needs of older patients with multiple and complex comorbidities (boyd et al ., 2005). Thus, it is possible that this emphasis on adherence to practice guidelines focuses on the wrong aspects of care for this population and may have a detrimental effect on outcomes . Several interventions have been shown to be successful at reducing avoidable admissions, but they require a greater frequency of patient contact than is currently the norm . Most participants at highest risk of a near - term hospitalization need to be assessed daily . One strategy is to use outbound calls conducted by individuals proficient in behavior change methodologies . Remote telemonitoring (rtm) technology offers an alternative strategy for assessing patient status and is typically less costly than daily outbound calls . Via rtm, the signs or symptoms of an impending acute exacerbation triggers an alert to a nurse who can respond immediately and triage the patient to the appropriate ambulatory care setting . For example, daily monitoring of congestive heart failure patients catches symptoms including weight gain, lower extremity edema, and increasing dyspnea that are typically present in the 8 to 12 days prior to hospitalization (schiff et al ., a recent systematic review of rtm reported that, in the majority of studies of chronic obstructive pulmonary disease and cardiac diseases, rtm led to significant decreases in hospitalizations, emergency department visits, and length of stay; studies of diabetes and hypertension had mixed results (pare, jaana, and sicotte, 2007). However, rtm is expensive and, in diabetes, it is estimated to cost between $300 and $400 per patient per year when sponsored by a physician practice (adler - milstein et al ., 2007). Other interventions shown to reduce near - term avoidable admissions include the provision of seasonal influenza vaccinations (nichol, baken, and nelson, 1999) and a monthly pharmacist review of a patient's medication profile (hepler and strand, 1990). The latter may substantially reduce avoidable hospitalizations caused by drug - related problems such as untreated indications, use of the medication without indication, improper drug selection, subtherapeutic dosage, overdose, adverse re actions, interactions, and failure to receive the drug (strand, morley, and cipolle, 1990). One of the biggest challenges in commercial dm is engaging physicians to support the program . These programs have little ability to collaborate with physicians, many of whom are skeptical of dm initiatives and view them as disruptive to the physician - patient relationship (leider, 1999). Without explicit endorsement from their physician, many patients will not enroll or adhere to the intervention provided by the dm program (leider, 1999). This is problematic as physicians are well positioned to identify potential participants and persuade them to participate in a dm program . Further, when physicians are actively involved in the intervention process, it is more likely that a dm program will be able to effectuate sufficient change in a patient's clinical condition to avoid an acute exacerbation . A recent article on the role of physicians in dm reports several barriers to physician engagement including a lack of financial incentive, a lack of technology to facilitate communication, and the need for a trusted practice - based program champion (kuraitis, 2007). Leider (1999) suggests five core strategies to achieve physician buy - in for disease management programs . These include (1) educating physicians on the goals of the dm program, (2) identifying champions with positive views of the program, (3) setting clear goals and expectations for physicians who participate in the program, (4) demonstrating that a relatively easy program works before attempting a more complex or controversial program, and (5) sharing the gains by rewarding physicians for their time and effort supporting the program . While such strategies are likely to strengthen physician support of commercial dm, they raise the broader question of the appropriate role for each player in supporting chronic dm . Some view commercial dm companies as filling a gap in our acute care focused delivery system that has consistently failed to deliver high - quality care to those with chronic illnesses . However, the flaws of a third - party work - around are evident in the increased fragmentation of care that results from a lack of coordination between dm vendors and traditional care delivery settings . A compelling alternative is wagner's chronic care model that includes a primary care - based medical home . Proponents of this model believe that the primary care team is the entity best suited to deliver chronic care management (geyman, 2007). In this model, the primary care physician leads a team of specialists, nurses, dieticians, pharmacists, and health educators to provide and coordinate all the care for a chronically ill population . With evidence of cost reduction and quality improvement from group health cooperative and kaiser permanente, primary case - based dm enjoys empirical support (mcculloch et al ., 2000). Recent pay - for - performance programs that attempt to align payment incentives with high - quality chronic care also reflect a belief that chronic care is the responsibility of physicians and the systems in which they operate (rosenthal et al ., 2007). Dm programs typically use medical claims to identify patients with a specific chronic condition who were hospitalized in the prior year and then target them to receive an intensive intervention of regularly scheduled outbound calls from clinical staff . Participants with no medical claims for a hospitalization or emergency department visit in the prior year are classified as low risk and typically receive only quarterly mailings . A recent study conducted in a large managed care population reveals the problem with this approach (linden and goldberg, 2007). Members hospitalized for a chronic illness in a given year were categorized by prior year hospitalization status . The claims - based identification and stratification methodology, identical to that typically employed by dm companies, showed that only 6.4 percent of patients hospitalized in the current year had been hospitalized in the prior year . Thus, the vast majority of current year hospitalizations came from members who would have been misclassified by a dm company as low risk, unidentified due to lack of claims data, or newly enrolled in the health plan . Had these members been enrolled in a dm program that targeted only high risk patients based on prior hospitalizations they would have received either a minimal intervention or no intervention at all, making it highly improbable that the program could have prevented their hospitalizations . Dm programs are increasingly using predictive modeling to improve claims - based identification of individuals at risk for high medical costs . These statistical models use past medical claims and other basic demographic data to predict future costs . However, it requires past claims history in order to achieve any reasonable degree of accuracy, and it still fails to incorporate many factors that explain health care utilization that are not reflected in administrative data, such as predisposing and enabling factors and perceived need . A recent study comparing the accuracy of several commercial models to predict high - cost participants based on their past claims history found that all models significantly underpredicted high - cost individuals and overpredicted low - cost individuals (winkelman and mehmud, 2007). The best fitting model underpredicted costs by 73 percent in the highest cost percentile (99 - 100) and underpredicted costs by 52 percent in the 96 - 99th percentile of costs . These models fared worse when no past claims history was available and therefore would be uninformative for new entrants to a population . Given the importance for dm programs to prospectively identify individuals who will incur high costs in the near future, such low predictive ability can lead dm vendors to miss the patients most likely to have an acute episode in the near term . In light of these shortcomings, dm programs should look beyond claims data to other sources of patient data . Psychometrically validated health risk assessments (hras) developed to predict future hospitalizations should be used in conjunction with claims - based models and they offer a compelling alternative when no claims history is available . Several instruments have been developed specifically for the senior population (boult et al ., 1993) and achieve reasonably good predictive accuracy; the sensitivity - specificity tradeoff measured by an area under the curve is consistently around 70 percent (wagner et al ., 2006). At program initiation these surveys can be distributed at the population level to improve identification, and then readministered quarterly to find incident cases as well as track changes in risk status of previously surveyed participants . Many dm programs have such tools available but use them on a very limited basis; thus, increasing their use would not require a fundamental overhaul of the identification approach and, if administered electronically, would minimize the incremental cost . There are two other potential approaches to identify patients at risk for a near - term hospitalization . A direct referral from the patient's physician is the most accurate means of identifying suitable candidates for a dm program . Despite the fact that many dm programs have a channel for such direct referrals, physicians rarely use them . Physicians may not be aware of patient eligibility for dm or may not support the program . The broader issue of how to engage physicians in dm is discussed at the end of this section . Electronic medical records (emr) and other repositories of clinical data that include medication lists and laboratory values are rich sources of up - to - date patient information . Health systems such as kaiser permanente rely heavily on their emr for such purposes (hyatt, taylor, and budge, 2004), but outside of integrated delivery systems, third - party access to emr data would have to be negotiated . Thus, while both of these strategies are promising, under the current health care delivery system supplementing claims - based identification with hras is the most compelling approach to improve identification of high risk patients . This process is labor intensive and time consuming, limiting the number of eligible persons that can be contacted in a timely fashion . Further, people are often wary of discussing health - related issues with strangers over the telephone and potential participants must be convinced that the program is legitimate . In commercial dm programs, enrollment rates are quite low and vary by disease, with asthma program enrollment rates averaging 10 percent and congestive heart failure program enrollment rates averaging 30 percent of the eligible population (lewis, 2007). Vendors in the mhs project are strongly incentivized to maximize enrollment within the required opt - in approach and have achieved high enrollment rates in the first 6 months of the mhs projects ranging from 65 to 92.3 percent (mccall, cromwell, and bernard, 2007). However, mean time - to - agreement ranged from 37 to 100 days, revealing that in the best case it took over a month to enroll beneficiaries in the program . Further, those agreeing to participate were considerably healthier compared to non - participants, indicating that the beneficiaries who could most benefit from dm require even greater effort to enroll . An hra is also helpful in the enrollment process as it identifies individuals who are ready to consider changing their health behaviors and as a result are more likely to enroll in the program . The percentage of individuals in any given population that are ready to change their behavior is not easily quantified as it is highly dependent on how readiness to change is defined and differs by the particular behaviors that are targeted . Most survey instruments include questions based on prochaska's (1979) stages of change psychosocial model for determining the level of readiness to change . Participants who are at least contemplating change, once identified, should be contacted by program representatives trained in behavior change methods, such as motivational interviewing . Such techniques help participants overcome ambivalence and increase likelihood of enrollment (miller and rollnick, 1991). Representatives who are not trained in these methods may be too directive or confrontational, which can reverse a prior commitment to change (amrhein et al ., 2003) and discourage participation . Given the expense associated with telephonic enrollment, programs implemented in large populations should consider the use of interactive voice recognition (ivr) or web - enabled technologies to maximize the outreach to eligible participants . A tradeoff exists between the narrow - and - deep telephonic approach and the wide - and - shallow approach that ivr technologies facilitate . An optimal enrollment model would include a technologically - based outreach process that draws on motivational interviewing methods . However, this combination is not currently mature enough to be widely available . Thus, the choice of approach should be driven by the broader decision on the size of the population targeted to receive the intervention . For example, one employer - based program achieved a 90-percent hra response rate when a $500 rebate on medical premiums was offered, compared to a 20-percent response rate with no incentive (finkelstein and kosa, 2003). A recent study demonstrated that even modest incentives were effective in motivating overweight employees to lose weight . After 3 months, individuals who received $14 for their participation lost 4.7 pounds on average compared to only 2 pounds in the control group (finkelstein et al ., 2007). Physician incentives can further bolster enrollment by sharing the cost savings associated with the program or by providing a pay - for - performance initiative in which they are paid for enrolling and supporting their patients in the program . While incentives increase program costs, at the right level they may be offset by a concomitant increase in enrollment and active engagement assuming that the sub sequent intervention reduces medical costs . For participants classified as high risk, most commercial dm programs share a common intervention approach focused on improving process measures (e.g., increasing regular testing of glycosylated hemoglobin [hba1c] in diabetics) in order to avoid costly complications in the future . Since most process measures are performed periodically (i.e., diabetics should receive an hba1c test between two and four times per year), the core dm intervention is comprised of patient calls around the time that these tests should occur . A recent study conducted by healthways, inc . Reported that program participants with diabetes (245,668 unique members with diabetes from 25 different health plans across the united states) received no more than four calls in their first 12 months of the program (coberley et al ., 2007). While periodic calls to participants have proven adequate to elicit improvements in screening rates (coberley et al ., 2007), they are insufficient to pick up on signs that patients are at risk for a near - term emergency department visit or hospitalization . Further, there is evidence to suggest that most clinical practice guidelines for chronic illnesses are not modified to consider the needs of older patients with multiple and complex comorbidities (boyd et al ., 2005). Thus, it is possible that this emphasis on adherence to practice guidelines focuses on the wrong aspects of care for this population and may have a detrimental effect on outcomes . Several interventions have been shown to be successful at reducing avoidable admissions, but they require a greater frequency of patient contact than is currently the norm . Most participants at highest risk of a near - term hospitalization need to be assessed daily . One strategy is to use outbound calls conducted by individuals proficient in behavior change methodologies . Remote telemonitoring (rtm) technology offers an alternative strategy for assessing patient status and is typically less costly than daily outbound calls . Via rtm, the signs or symptoms of an impending acute exacerbation triggers an alert to a nurse who can respond immediately and triage the patient to the appropriate ambulatory care setting . For example, daily monitoring of congestive heart failure patients catches symptoms including weight gain, lower extremity edema, and increasing dyspnea that are typically present in the 8 to 12 days prior to hospitalization (schiff et al ., a recent systematic review of rtm reported that, in the majority of studies of chronic obstructive pulmonary disease and cardiac diseases, rtm led to significant decreases in hospitalizations, emergency department visits, and length of stay; studies of diabetes and hypertension had mixed results (pare, jaana, and sicotte, 2007). However, rtm is expensive and, in diabetes, it is estimated to cost between $300 and $400 per patient per year when sponsored by a physician practice (adler - milstein et al ., 2007). Other interventions shown to reduce near - term avoidable admissions include the provision of seasonal influenza vaccinations (nichol, baken, and nelson, 1999) and a monthly pharmacist review of a patient's medication profile (hepler and strand, 1990). The latter may substantially reduce avoidable hospitalizations caused by drug - related problems such as untreated indications, use of the medication without indication, improper drug selection, subtherapeutic dosage, overdose, adverse re actions, interactions, and failure to receive the drug (strand, morley, and cipolle, 1990). One of the biggest challenges in commercial dm is engaging physicians to support the program . These programs have little ability to collaborate with physicians, many of whom are skeptical of dm initiatives and view them as disruptive to the physician - patient relationship (leider, 1999). Without explicit endorsement from their physician, many patients will not enroll or adhere to the intervention provided by the dm program (leider, 1999). This is problematic as physicians are well positioned to identify potential participants and persuade them to participate in a dm program . Further, when physicians are actively involved in the intervention process, it is more likely that a dm program will be able to effectuate sufficient change in a patient's clinical condition to avoid an acute exacerbation . A recent article on the role of physicians in dm reports several barriers to physician engagement including a lack of financial incentive, a lack of technology to facilitate communication, and the need for a trusted practice - based program champion (kuraitis, 2007). Leider (1999) suggests five core strategies to achieve physician buy - in for disease management programs . These include (1) educating physicians on the goals of the dm program, (2) identifying champions with positive views of the program, (3) setting clear goals and expectations for physicians who participate in the program, (4) demonstrating that a relatively easy program works before attempting a more complex or controversial program, and (5) sharing the gains by rewarding physicians for their time and effort supporting the program . While such strategies are likely to strengthen physician support of commercial dm, they raise the broader question of the appropriate role for each player in supporting chronic dm some view commercial dm companies as filling a gap in our acute care focused delivery system that has consistently failed to deliver high - quality care to those with chronic illnesses . However, the flaws of a third - party work - around are evident in the increased fragmentation of care that results from a lack of coordination between dm vendors and traditional care delivery settings . A compelling alternative is wagner's chronic care model that includes a primary care - based medical home . Proponents of this model believe that the primary care team is the entity best suited to deliver chronic care management (geyman, 2007). In this model, the primary care physician leads a team of specialists, nurses, dieticians, pharmacists, and health educators to provide and coordinate all the care for a chronically ill population . With evidence of cost reduction and quality improvement from group health cooperative and kaiser permanente, primary case - based dm enjoys empirical support (mcculloch et al ., 2000). Recent pay - for - performance programs that attempt to align payment incentives with high - quality chronic care also reflect a belief that chronic care is the responsibility of physicians and the systems in which they operate (rosenthal et al ., 2007). The current commercial dm model has shortcomings within each program component that severely limit the short - term medical cost savings that can be achieved . By relying on claims data, individuals at risk for a near - term hospitalization cannot be accurately identified . Behavior change specialists and physicians are not actively engaged to support recruitment and intervention efforts . Finally, participants are contacted too infrequently to detect impending acute episodes . While there are few easy solutions to address the flaws in this model, there are several evidence - based changes that could be implemented to increase the likelihood of achieving short - term medical cost savings . These include: (1) drawing on clinical data and health risk assessments for patient identification and risk stratification; (2) using behavior change experts in conjunction with patient and physician incentives for enrollment, participation, and retention; and (3) tailoring the intervention to the risk level of the participant with the participants at highest risk for a near - term admission receiving daily monitoring via rtm as well as monthly medication reviews, quarterly process reminders, and seasonal interventions . It is critical that changes be made to all dm program components as they are interdependent; improving identification will only lead to medical cost savings if the enrollment process and interventions are properly designed . However, making the model more robust could substantially increase the cost of implementing the program, increasing the medical cost savings required to deliver net savings . Placing this discussion in the context of mhs, at the conclusion of phase i cms will have to determine whether to authorize a second phase . Along with an assessment of beneficiary and provider satisfaction, process improvements, and health outcomes, cms will assess the financial outcomes . The results of a simple nnd calculation suggest that, on average, a dm vendor participating in the mhs demonstration would have to reduce all - cause hospitalizations by about 15 percent to break even on fees alone . If dm can only impact congestive heart failure and diabetes (the primary and secondary conditions targeted by mhs), the percentage decrease in hospitalizations needed to achieve the cost savings target lies closer to the 82-percent reduction estimate . The mhs interim report reflected few statistical or substantive differences in the rate of hospitalizations, 30-day readmissions, and emergency room visits between the intervention and control group after 6 months . Thus, in light of the dm model flaws, achieving a 15-percent reduction in all - cause admissions or an 82-percent reduction in disease - specific admissions is unlikely for the current programs . If vendors implement the changes previously discussed, a sufficient reduction in hospitalizations may be achieved before the final mhs evaluation is conducted . However, this will require further investment in the interventions on top of the current monthly fees that range from $74 to $159 per beneficiary (mccall, cromwell, and bernard, 2007). Thus the question remains as to whether commercial dm can achieve net cost savings in the chronically ill population . Ultimately cms will have to assess the potential for commercial dm to be more cost effective than alternative approaches currently under study in other demonstration projects in deciding how to proceed with managing the chronically ill.
A 10-year - old asian indian male child was brought to the emergency services of our tertiary care hospital with progressive bulging of the left eye for the past 7 days . It was associated with deep constant periorbital pain, inability to close the eye, fever with no rigors or chills, discharge, and decreased vision . The patient gave a history of scratching of boil over the left upper eyelid 3 days before start of symptoms . There was no history of upper respiratory tract infection, toothache, ear discharge, insect bite, or trauma . The patient had received oral penicillins before presentation at our center, but there was no relief . Examination of the affected eye revealed visual acuity of 6/24, hypoglobus, mechanical ptosis, restriction of ocular movements in all directions; swelling of lids with overlying redness of skin with raised temperature and tenderness on palpation . Anterior segment examination showed conjunctival chemosis and diffuse descemet folds while posterior segment examination was unremarkable . Investigation showed hemoglobin of 13.6 g / dl, total leukocyte count of 12,500/mm, erythrocyte sedimentation rate of 45 mm in 1 h, and no pus cells in urine . Noncontrast computerized tomography (ncct) scan showed ill - defined hypodense collection in the extraconal department of the left orbit, extending up to orbital septum and causing proptosis suggestive of orbital abscess . There was associated with thickening of superior rectus - levator palpebrae superioris (sr - lps) complex but no evidence of sinusitis [fig . 1]. At presentation . (a) clinical picture, (b) ill - defined hypodense collection in the extraconal department of the orbit suggestive of orbital abscess, (c) thickening of superior rectus - levator palpebrae superioris complex, (d) clear sinuses on left a straightforward diagnosis of orbital cellulitis with abscess formation was made; and intravenous amoxicillin (25 mg / kg / day in three divided doses) and clavulanic acid and metronidazole (7.5 mg / kg / day in three divided doses) and amikacin (15 mg / kg / day in three divided doses) were started empirically . Abscess was drained and pus samples were sent for microbiological examination . We were left in a fix when there was no improvement even after 3 days of treatment . Microbiology report unveiled the mystery behind this odd behavior and guided us toward the correct path for further management . Culture on blood agar showed greenish discoloration suggestive of alpha (complete) hemolysis while macconkey agar showed magenta - colored colonies . Microscopy shows gram - positive spectacle - shaped cocci arranged at an angle to each other and in lines . The organism was catalase negative, grew on 6.5% sodium chloride, and produced black colonies on blood tellurite agar . Sensitivity as per the clinical and laboratory standards institute revealed resistance to ciprofloxacin, penicillins, and cotrimoxazole and sensitivity to clindamycin, teicoplanin, linezolid, gentamicin, and doxycycline . After pediatric consultation, intravenous clindamycin (20 mg / kg / day in three divided doses) and gentamicin (1.5 mg / kg / day in three divided doses) were started . Swelling and proptosis started reducing by day 2 of revised therapy . On day 10, best - corrected visual acuity improved to 6/6, swelling and proptosis disappeared, and extraocular movements became full and free . Repeat ncct showed thickened lps - sr complex, with involvement of tendons suggestive of myositis [fig . After 1 month of steroid treatment, there was improvement in the amount of ptosis [fig . (a) greenish colonies on blood agar, (b) magenta colonies on macconkey agar, (c) black colonies on blood tellurite agar, (d) microscopy showing spectacle - shaped gram - positive cocci arranged at an angle to each other two weeks after treatment . (a) left persistent ptosis, (b) superior rectus - levator palpebrae superioris complex thickened with involvement of tendons . One month after treatment, (c) improving ptosis, (d) decreased thickness of superior rectus - levator palpebrae superioris complex after a thorough search of scientific literature, we could find only one case of orbital cellulitis caused by s. faecalis, reported by biedner et al . In 1986 . They reported a 2.5-month - old female who was hospitalized with septicemia, ethmoiditis, and orbital cellulitis and was managed with intravenous ampicillin . Unlike the earlier reported case, our patient was healthy with no history of admission to a hospital . Gamble suggested three routes for spread of infection: (1) extension from an adjacent tissue, (2) septicemia, or (3) a wound . In pediatric population, 90% of patients with orbital cellulitis have existing sinusitis while our patient had clear sinuses on ct scan . Enterococcus is an emerging agent of upper and lower airway diseases, including paranasal sinuses . Therefore, possibility of cases associated with e. faecalis which remained undiagnosed cannot be ruled out . The undiagnosed cases may have simply responded to the therapy given, and no abscess formation may have taken place . Enterococcus group was originally classified with streptococci as group d. lancefield classified hemolytic streptococci on the basis of nature of carbohydrate antigen on cell wall into twenty lancefield groups . On blood agar, they are usually nonhemolytic but may show alpha (complete) or beta (incomplete) hemolysis . On microscopy, they appear as oval cocci, arranged at an angle to each other or in lines . They can be distinguished from other streptococci as they grow in the presence of 40% bile, 6.5% nacl, 9.6 ph, at 45c, in 0.1% methylene blue and survive at 60c for 45 min . E. faecalis can be identified by its ability to produce black colonies on tellurite agar and ferment mannitol, sucrose, sorbitol, and esculin . Chaudhry et al . In their review of 218 patients of orbital cellulitis reported 4 patients with persistent ptosis after resolution of orbital cellulitis and found delayed intervention to be the common factor . In our case, precise treatment was delayed for about 10 days pending the microbiological confirmation of the causative agent . Thickening of lps - sr complex in our case suggests myositis of lps, which was responsible for persistence of ptosis . The material obtained from abscess drainage should be handled properly and sent for microbiological examination to identify the causative organism and sensitivity . This is especially important, like in our case, where the causative agent was an unusual one and would not have responded to the empirical therapy . An accurate diagnosis and early intervention are required to prevent the deadly complications of orbital cellulitis . We must understand that antibiotics need to be used judiciously to restrict the resistance being developed by the microbes.
A positive family history of prostate cancer (pca) is an established risk factor for pca . First - degree relatives of affected men have a 23 fold increased risk of pca . When 3 or more first - degree relatives are affected (or at least 2 first - degree relatives before the age of 55 years), the family is considered a hereditary prostate cancer (hpc) family according to the so - called johns hopkins or carter criteria . Yet, only a few very rare high - penetrance gene mutations have been identified to cause hpc . In recent years, genome - wide association studies have added approximately 40 low - penetrance genetic polymorphisms that are associated with an increased risk of pca [4, 5]. Several polymorphisms have also been identified that are associated with serum prostate - specific antigen (psa), the most commonly used marker for early detection of pca [6, 7]. An ongoing matter of debate is whether psa testing should be used for population - wide screening . In a population - based setting, the european randomized study of screening for prostate cancer (erspc) showed a decrease in pca mortality of 31% in the screening arm after correction for non - attendance and contamination . By contrast, the prostate, lung, colorectal and ovarian cancer screening trial (plco), found no effect of psa screening on mortality, but suffered from methodological problems which severely hamper interpretation of the results . Previous studies into the effectiveness of psa sceening in men with an increased risk due to family history have yielded largely inconsistent results . These range from a marked benefit for men in high - risk pca families (particularly for families with early onset pcas) to a decreased risk of pca for non - affected men in hpc families [13, 14]. The increasing use of psa testing in the general population has also had an important influence on men with a family history of pca . Men with a positive family history are relatively more active in pursuing psa testing than men in the general population . This has led to an increased detection of mainly of small localized tumors . To guide the public and physicians in translating the results of the erspc and plco into clinical practice, the dutch association of urology (nvu) and the dutch college of general practitioners (nhg) concurrently released a policy statement in march 2009 . This statement referred men to a website (http://www.prostaatwijzer.nl/) with information about pca and psa testing and advised them to consult their gp for further counseling . It did, however, not discuss dealing with a family history of pca or hpc . To date, in absence of official internationally accepted guidelines, the advice is to attempt to distinguish genetic predisposition - based families with multiple pca cases from ascertainment - based multiple - case families and offer pca screening only to the former . This study assessed the knowledge of dutch urologists, general practitioners (gps) and clinical geneticists (cgs) about hpc and pca as a phenotype in hereditary syndromes . Furthermore, their post - erspc attitude towards pca testing and the role of family history in clinical decision - making about pca testing were assessed . To our knowledge, this is the first study to investigate this in different professions that counsel men about pca testing . After publication of the results of the erspc and plco and the statements of the nvu and nhg, an online survey was developed . This survey, targeted at dutch urologists, gps and cgs, contained questions about hpc and assessed the participants general attitude towards pca testing . In addition to this, it inquired into the role that family history played in the physician s daily clinical practice regarding pca testing . The survey also included case descriptions of a man requesting to be tested for pca . This fictitious man presented at different ages, in absence of family history and physical complaints . The survey could be completed anonymously . In january 2010, all dutch urologists (n = 351), clinical oncogeneticists (n = 32), cgs in training (n = 50) and genetic counselors (n = 68) were invited by e - mail from their respective professional associations . Gps in the region of the comprehensive cancer centre east (ccce) who were enlisted to receive the ccce s e - newsletter (n = 300) were invited by e - mail . For statistical analysis because of small numbers, clinical oncogeneticists, cgs in training and genetic counselors were pooled into one stratum (cgs). These were submitted by 109 urologists (31%), 69 gps (23%) and 46 cgs (31%). One pediatric urologist and two cgs were excluded from analyses because they never counseled men for pca testing . Occasionally, participants did not complete all questions, causing small differences in the subtotals for different questions . Of the urologists, 66% (71/107) counseled men about pca testing at least once a week and 93% (100/107) did this at least once a month . In comparison, 85% of the gps (59/69) did this at least once a month, as opposed to only 2% (1/44) of the cgs . By contrast, the cgs had the most accurate knowledge of the hpc criteria: 72% (31/43) correctly selected the minimum of three affected first - degree relatives for the criterion that is most frequently fulfilled (table 1). In comparison, only 36% (38/105) of the urologists and 18% (12/66) of the gps correctly selected this criterion (p <0.001). Cgs were also best informed about the number of affected first - degree relatives with a pca diagnosis before 55 years of age to meet the definition of hpc, although the differences between the groups were smaller . The third definition of hpc, i.e., three consecutive generations with pca, was known to only a few participants.table 1responses to the question what is the minimum number of relatives with prostate cancer to meet the carter criteria for hereditary prostate cancer (hpc)?urologistsgpscgsnumber of affected first - degree relatives (all ages) two35 (33%)9 (14%)1 (2%) three38 (36%)12 (18%)31 (72%) four1 (1%)2 (3%)2 (5%)> four3 (3%)0 (0%)1 (2%) do nt know15 (14%)39 (59%)7 (16%) not a criterion13 (12%)4 (6%)1 (2%) total1056643number of affected first - degree relatives (diagnosis <55 years of age) two72 (68%)33 (48%)34 (76%) three6 (6%)0 (0%)3 (7%) four1 (1%)1 (1%)0 (0%)> four5 (5%)2 (3%)0 (0%) do nt know12 (11%)32 (46%)7 (16%) not a criterion10 (9%)1 (1%)1 (2%) total1066945number of consecutive generaties with prostate cancer two10 (10%)10 (15%)9 (21%) three15 (15%)6 (9%)5 (11%) four3 (3%)1 (2%)1 (2%)> four2 (2%)1 (2%)0 (0%) do nt know25 (25%)39 (58%)10 (23%) not a criterion44 (44%)10 (15%)19 (43%) total996744p 0.001 for differences between the physician groupscorrect answers are italicized responses to the question what is the minimum number of relatives with prostate cancer to meet the carter criteria for hereditary prostate cancer (hpc)? P 0.001 for differences between the physician groups correct answers are italicized almost all cgs (41/42, 98%) listed at least one inherited trait with pca as part of the phenotype, compared to only 24% (25/103) of the urologists and 9% (6/66) of the gps . The most frequently mentioned traits were the brca2 gene mutation (n = 60), the brca1 gene mutation (n = 40) and lynch syndrome (n = 10). The rare hpc1, hpcx, msr1, rnasel and hpc2/elac2 mutations were sporadically mentioned . Urologists had the least reservations towards pca testing in a man with no physical complaints and no family history of pca: 46% (32/69) of the gps and 49% (22/45) of the cgs preferred to refrain from testing unless there were strong reasons to test (table 2), as compared to 31% (33/108) of the urologists . For a man presenting at 55 and 75 years of age, cgs were more inclined not to test for pca . At 45 years of age, more physicians in all groups would not test for pca.table 2responses to the question would you test this man for pca? Regarding a man with no physical complaints / no family history of pca, requesting to be tested for pcaage at presentationtest for prostate cancerurologistsgpscgsgeneral attitudewill test, unless 35 (32%)13 (19%)3 (7%)will not test, unless 33 (31%)32 (46%)22 (49%)leave choice to patient37 (34%)22 (32%)9 (20%)other*3 (3%)2 (3%)11 (25%)45 years of ageyes20 (19%)5 (7%)1 (2%)no12 (11%)18 (26%)28 (64%)first discuss pros and cons of prostate cancer testing75 (70%)46 (67%)15 (34%)55 years of ageyes29 (27%)16 (23%)1 (2%)no0 (0%)1 (1%)16 (36%)first discuss pros and cons of prostate cancer testing79 (73%)52 (75%)27 (61%)75 years of ageyes21 (19%)10 (15%)9 (21%)no8 (7%)3 (4%)14 (33%)first discuss pros and cons of prostate cancer testing79 (73%)56 (81%)20 (47%) * answers under other: most often (8/11) cgs indicated not to perform this kind of testing themselves, but would refer the man to their gpp <0.001 for differences between the physician groupsno significant difference between urologists and gps; p = 0.40no significant difference between urologists and gps; p = 0.45 responses to the question would you test this man for pca? Regarding a man with no physical complaints / no family history of pca, requesting to be tested for pca * answers under other: most often (8/11) cgs indicated not to perform this kind of testing themselves, but would refer the man to their gp p <0.001 for differences between the physician groups no significant difference between urologists and gps; p = 0.40 no significant difference between urologists and gps; p = 0.45 age played a role when considering pca testing . Of the urologists, 70% reported to use age limits, with 45 years as the mean and median lower age limit . This lower age limit was higher for gps (60% reported age limits) and cgs (30% reported age limits), with 50 years of age being the median lower age limit . The median maximum age limit was 80 years (mean 77) for urologists and gps, compared to 75 years (mean 74) for cgs . Cgs always took family history into consideration when deciding whether or not to test for pca . By contrast, 3540% of urologists and gps answered that family history would not influence the decision whether or not to test for pca (table 3). This did not vary between physicians with different general attitudes towards psa testing (p = 0.47 for the urologists and p = 0.78 for the gps), as was assessed in a previous question.table 3responses to the question (a) does family history play a role in the decision whether or not to test a man for pca? And the follow - up question (b) how extensively do you inquire about the family history?urologistsgpscgsa . Does family history play a role? Yes67 (62%)44 (65%)40 (98%) no41 (38%)24 (35%)1 (2%) total1086841b only pca29 (43%)16 (37%)0 (0%) pca and other malignancies38 (57%)27 (63%)40 (100%) total674340 responses to the question (a) does family history play a role in the decision whether or not to test a man for pca? And the follow - up question (b) how extensively do you inquire about the family history? A majority of the urologists (76%) knew the erspc and plco results, compared to only 14 and 8% of cgs and gps, respectively . Ninety - two percent (75/82) of the urologists who knew the studies found the erspc results more valuable . The statements of nvu and nhg, advising men to visit the website and consult the gp if further counseling was needed, were better known than the results of the trials: 85% (92/108) of the urologists and 59% (41/69) of the gps was familiar with the statements . Of them, 12% (11/91) of the urologists and 24% (10/41) of the gps did not agree with the statements . A positive family history of pca is an important risk factor for pca and the balance between pros and cons of psa testing may be different in men with affected relatives . Only one in three urologists and one in five gps is familiar with the criteria for hpc . The brca1 gene mutation was frequently selected as an inherited trait with pca as part of the phenotype . The evidence for an increased risk of pca due to a brca1 gene mutation is quite weak, though . By contrast, for brca2 gene mutations (selected by 14 urologists and all 42 cgs) there is fairly solid evidence of familial clustering of aggressive pca [18, 19]. Recently, an elevated risk of pca for carriers of a mismatch - repair gene mutation was indeed found . This has, however, not been confirmed in other studies, so it remains unclear whether the physicians who selected lynch syndrome are correct . It should be noted that urologists and gps hardly ever counsel patients with an elevated pca risk based on these inherited traits . In general, urologists reported the least reservations towards pca testing and would test at a younger age than gps and cgs . However, the majority of urologists and gps stated to first discuss the risks and benefits of psa testing and only test if a man would still want to be tested . So, even though 41% of gps was not familiar with the statements regarding pca testing and 92% of them did not know the erspc and plco results, they adhered just as well to the guidelines as the urologists . Participants who disagreed with the nvu / nhg statements, mostly indicated that the statements lacked attention for patients preferences . In contrast with the urologists and gps, cgs would more often not test for pca . This might be explained by the fact that the cgs mainly have an advisory role and refer their patients to a gp or urologist for pca testing . Cgs hardly ever counsel men about pca testing, as there is no frequently occurring genetic defect known to cause pca . This may change, however, when more data become available about the risk of pca among brca2 carriers . One of the most striking observations might be that more than one in three urologists and gps would not take family history into account when deciding whether or not to test a man for pca . Intuitively, one would think that men with a positive family history, and thus a higher a priori risk of pca, would benefit more from psa screening . Arguing against this is that hpc cases do not seem to differ from sporadic cases with respect to gleason scores and pca - specific survival [21, 22]. Even more so, screening programs amongst non - affected men in hpc families have shown that the chance of finding pca in non - affected men in hpc families is low . Although we did not address this in our study, when a man requesting pca testing does have, e.g., an affected brother, he will very likely be tested, not in the least for reasons of anxiety management . However, whether this is beneficial, is doubtful . To better guide physicians in this matter, an addendum to pca guidelines should be developed in a multidisciplinary collaborative effort, describing how to deal with pca testing in case of a positive family history and hpc . The conclusion from a previous study to assess the extent and nature of the family history (predisposition - based vs. ascertainment - based) might well serve as a starting point for such a guideline . In addition to this, the use of decision aids, e.g., the swop - pri should be promoted, as they already include the effect of family history in the risk estimates . The results of this study should be interpreted with some caution . Although the responder groups were reasonably large in absolute numbers, the response rate was only 31% at best (for urologists and cgs). Hence, it is difficult to extrapolate the results to all dutch physicians providing pca counseling . Even more so, if physicians with more interest in this topic completed the survey more often, the results regarding knowledge about hpc and adherence to guidelines might be overoptimistic . On the other hand, intuitively physicians who take care of most of the counseling are most eager to complete the survey . It is also important to bear in mind that the results may not easily be extrapolated to other countries as they may be influenced by the health care system . In the netherlands, e.g., men cannot visit a urologist without a referral from their gp . In conclusion, however, these guidelines do not include family history and many physicians indicated not to consider family history . Hence, pca counseling might not be optimal for men with a positive family history . We propose that additional guidelines on this topic are developed in a multidisciplinary effort to optimize counseling.
The influenza virus neuraminidase (na, aaabbreviations: fu, fluorescent unit; munana, 4-methylumbelliferyl - n - acetylneuraminic acid; na, neuraminidase; kdn, 2,3-difluoro-2-keto-3-deoxy - d - glycero - d - galactononulosonic acid . Ec 3.2.1.18) functions in virus infection to remove sialic acid from receptors present on the surface of host cells . In the absence of na activity, the structure of the catalytic headgroup of influenza a na has been known since 1983, consisting of individual subunits of six - bladed -propellers that form a boxlike tetramer with dimensions 100 100 60 . Structures of the influenza b / beijing/1/87 and b / lee nas showed that the tetrameric head/-propeller topology of the influenza - a nas was conserved in influenza b nas . Abbreviations: fu, fluorescent unit; munana, 4-methylumbelliferyl - n - acetylneuraminic acid; na, neuraminidase; kdn, 2,3-difluoro-2-keto-3-deoxy - d - glycero - d - galactononulosonic acid . Analysis of na crystal structures in complex with the substrate sialic acid resulted in the development of zanamivir (1) and oseltamivir (oseltamivir carboxylate is the active ingredient used here (2)). A further inhibitor, these compounds are active against all influenza a and b viruses . While previously there have been reports of resistance from both influenza a and b viruses isolated from both immunocompromised and immunocompetent patients after treatment with 2, more recently the global spread of seasonal influenza a h1n1 strains resistant to 2(15,16) has been observed, although this appears to be unrelated to the use of 2 . Furthermore, resistance to 2 is emerging in strains of the pandemic h1n1/09 viruses either with or without treatment or prophylaxis . In contrast, resistance after 1 treatment has only been reported in an immunocompromised patient infected with an influenza b strain . Influenza b viruses with a d197n mutation (d198 n2 numbering) have been isolated from an immunocompromised patient treated with 2(10) and arisen either spontaneously or by possible transmission from a treated patient . The d197n mutant na shows decreased binding to both 1 and 2, thus demonstrating the importance of d197 in the influenza b nas for tight binding of the na inhibitors . Unlike other residues that confer resistance, d197 is not absolutely conserved across influenza a and b nas, as analyses of na sequences in the databases show that wild type influenza a n7 and n9 subtype nas have n197 . Residue d197 does not interact directly with substrate or inhibitor in the na but engages in a salt bridge interaction with r150 (r152 n2 numbering), which forms a hydrogen bond with the n - acetyl group of sialic acid and the na inhibitors . An influenza b virus with an r150k na mutation was isolated after prolonged treatment of an immunocompromised child with 1(19) with a significant impact on enzyme activity and cross - resistance to other na inhibitors, clearly demonstrating the importance of interactions of the r150 with the substrate and inhibitors . The b / perth/211/2001 (b / perth) virus was isolated from an infant with no history of treatment with or contact with na inhibitors . The sample contained both wild type and mutant viruses with a d197e mutation in the na . The mutant na had reduced sensitivity to 1, 2,and 3 . When expressed in insect cells, recombinant b / perth wild type and mutant nas had properties similar to those of the virus associated nas . As we were unable to culture these viruses in eggs, we describe here the use of this recombinant na for structural studies . The clinical effectiveness of 2 against influenza b infection in children is reported to be less than against influenza a. however, until now, data on the structure of an influenza b na with oseltamivir bound have not been available . We present here structures of b / perth/211/2001 nas with d (b / perth d) or e (b / perth e) at position 197 in the apo form and in complex with 3 and provide an insight into the mechanism of resistance of mutations at d197 . Furthermore, the structure of the b / perth e complex with 2 is presented, and from these data we propose the mechanism of reduced binding of 2 in wild type influenza b nas . We wished to determine the impacts that the mutations at d197 had on the structure and function of the mutant proteins in order to understand the mechanisms of resistance to all na inhibitors . We previously reported that the native b / perth wild type d197 and mutant e197 nas expressed in insect cells had similar resistance profiles as the influenza virus associated nas . Hence, we developed conditions for cleavage of the membrane anchor and stalk regions and for purification of the na from the insect cells . Acetone fixation of the cells enabled us to store them with no effect on the enzyme function . Digestion with either pronase or trypsin showed that optimal cleavage was obtained with trypsin at 2 mg / ml, between residues k69 and g70 in the stalk, comparable to cleavage of na heads from other influenza b viruses . After separation of the digests by superose-12 and lentil lectin affinity chromatography, page analysis showed a single band corresponding to the na (figure 2). Purification of recombinant b / perth na heads by trypsin digestion of sf21 cells expressing the full length b / perth na: (a) gel filtration profile of crude extract; (b) silver stained page of gel filtration fractions; (c) samples after lentil lectin affinity chromatography . Since this was the first time we had attempted to use recombinant na for structural studies, we used electron microscopy, as previously reported, to examine the integrity of na heads . The b / perth d heads were clearly tetrameric but interestingly spontaneously formed two - dimensional arrays on the carbon substrate . The most common was a simple square tessellation, and the second form consisted also of orthogonal rows and columns but with the square na heads rotated through 45, forming a hounds - tooth pattern . The third and least common form had na heads oriented on their sides or edges, arranged in an open square lattice . These first two forms are a rare example of actually seeing how the protein packs in crystalline arrays, corresponding to crystallographic arrangements subsequently detected by x - ray crystallography . Samples were negatively stained with uranyl acetate and show two - dimensional arrays of na heads: (a) simple square tessellation; (b) hounds - tooth pattern of orthogonal rows and columns but with the square na heads rotated through 45; (c) an open square lattice with na heads oriented on their sides or edges . We have previously shown that the b / perth e197 na and the b / yamagata n197 na demonstrate cross - resistance to the na inhibitors 1, 2, and 3 . Some influenza nas demonstrate time dependent binding of the na inhibitors often called slow binding . Many nas with a mutation in the active site are reported to have lost this property, binding the inhibitors rapidly . Since d197 does not directly interact with substrate or inhibitor, we therefore were interested in whether the d197e or d197n mutations affected the enzyme function or the rate of binding of the inhibitors . Comparisons of the activity of the purified recombinant b / perth d197 and e197 na proteins demonstrated that the specific activity of the mutant e197 na was approximately 70% of that of the wild type d197 enzyme . For comparing values for the km, ki, and ic50, we used detergent extracts of each of the four influenza viruses grown in cell culture, since we did not have recombinant na from either the b / gifu or b / yamagata viruses . The b / perth wild type d197, mutant e197, and the wild type d197 b / gifu nas had similar km values for munana of 12.4 4.2, 12.1 3.7, and 10.5 1.4 m, respectively . Although the d197n mutation has less impact on ic50 than the e197 (table 1), it had a slightly higher km of 18.8 4.5 m . No pre or pre is the fold differences in the final ic50 values with no preincubation with inhibitor compared to 30 min of preincubation . We carried out two different experiments for each virus / drug combination to study the rate of inhibitor binding . The first experiment had no preincubation with the inhibitors, which enabled us to examine the rate of association of the drug with the na, and the second assay had a 30 min preincubation, which enabled us to examine whether any further association or dissociation of the nainhibitor complex occurred upon addition of substrate . Others have used preincubation times from 10 min to 2 h, and it is not clear what impact these preincubation times, or the subsequent reaction times with substrate, may have on the calculated ic50 . Since the ic50 is also known to vary with substrate concentration, others have calculated ki values in addition to the ic50, since ki values are meant to be a more invariant measure of affinity for an inhibitor independent of substrate concentration . We therefore compared ic50 and ki values at each 10 min interval between 10 and 60 min either with no preincubation or after preincubation with the inhibitors . When the curves for the total fu versus elapsed time were compared, there were three types of curves . The first type of curve (figure 4a) seen after preincubation with 1 or 3 in the wild type d197 nas showed a gradual increase in the rate of reaction, indicating slow dissociation of inhibitor . The second type of curve where there was no preincubation of inhibitor, with 1 and 3 in the wild type nas, showed a gradually decreasing rate of reaction (figure 4b), indicating slow association of the inhibitor . The third type of curve reached a constant rate during the reaction (figure 4c) and was seen with 2 in the d197 nas and with all inhibitors with the mutant nas, indicating that rapid equilibrium had been reached . Munana was added to detergent treated wild type and mutant viruses either after a 30 min preincubation or without incubation with inhibitors ranging from 10 000 to 0.1 nm . Activity was monitored for 60 min after addition of substrate: (a) b / perth d activity in 1 after 30 min of preincubation showing an increase in rate with time, corresponding to slow dissociation; (b) b / perth d activity in 1 without preincubation, showing a decrease in rate with time, corresponding to slow association of 1; (c) b / yamagata (d197n) activity in 1 without preincubation, showing a constant rate, corresponding to a rapid association of 1 . The effects these changing rates have on the ic50 and ki values are shown in figure 5 . For both wild type d197 nas without preincubation there was a gradual decrease in ic50 corresponding to a slow association of both 1 and 3 . After preincubation with these inhibitors there was a gradual increase in ic50, indicating slow dissociation . In contrast there was rapid association of 2 without preincubation with little change in ic50 after the first 20 min . Although the initial ic50 values were not that much higher than for 1, there was more than a 10-fold change over the 60 min reaction time . Because of the slow association of 3 and 1 in the wild type nas, the final 60 min ic50 values with no preincubation were still 6- to 19-fold higher than with preincubation (table 1), demonstrating that the inhibitor binding had not yet reached equilibrium . In contrast, there was less than a 2-fold difference between the 60 min no preincubation and preincubation ic50 values for 2 in both wild type nas . Effect of incubation times after addition of substrate and inhibitor on (a) ic50 and (b) ki values . Ic50 values were calculated after each 10 min interval as the drug concentration causing 50% inhibition compared to the uninhibited control . Final ic50 values after 60 min for 1 and 2 in wild type b / perth and b / gifu nas were much higher without preincubation compared to 30 min preincubation, reflecting the slow binding of these two inhibitors . There was much less change in ic50 values for the binding of 2 in the wild type and 1, 2, and 3 in the mutant nas, demonstrating loss of slow binding . Conversely 2 dissociated rapidly from the wild type na, in contrast to slow dissociation of 1 and 3, and 1, 2, and 3 all dissociated more rapidly from the mutant b / perth e and b / yamagata nas . (b) ki values also changed with time, reflecting the differences in the slow or fast binding or dissociation of the inhibitors, with less change seen with 2 in the wild type and 1, 2, and 3 in the mutant nas . When the ic50 values are compared without preincubation for all inhibitors for both mutant nas, the graphs show there is much less change in ic50 after the first 10 min . 2 also appears to bind even more rapidly to both mutant nas than to the wild type d197 nas . There is also faster dissociation of 1 and 3 after the nas are preincubated with inhibitor, compared to the wild type nas . For all inhibitors for both mutant nas the ratios after 60 min of the no preincubation to preincubation are all within 2-fold, indicating much more rapid equilibration of all inhibitors compared to the wild type nas . The slow binding of the 1 and 3 in the wild type d197 nas also resulted in the ki values continuing to change over the 60 min period, whereas for 2 in the wild type and all the inhibitors with the mutant nas the ki values stabilized much more quickly after the first 1020 min period, as seen in figure 5 and tables 1 and 2 . This means that the fold resistance, often used to describe how resistant the isolates are, will vary significantly during the course of the reaction, depending on whether the inhibitors are faster or slower binding or dissociating compared to the wild type . The apo form of b / perth d crystallized in space group i4 and was solved by molecular replacement using a / tern / australia / g7oc/75 n9 na (pdb code 7nn9) followed by automatic rebuilding using phenix; the r and rfree were 33% and 39%, respectively . Several cycles of model building and refinement gave a high quality final model (table 3). Crystal contacts between subunits in the c - direction are formed entirely by carbohydrate - mediated interactions . A carbohydrate chain composed of glcnac and mannoside residues was appended to residue n284, consistent with known patterns of n - linked oligosaccharides in insect cell lines . The packing of tetramers in layers observed in this crystal form appears similar to that observed in electron microscopy (figure 3a). The b / perth d structure superimposes with a rmsd of 0.32 (over 388 c atoms) and 0.28 (over 385 c atoms) with b / lee/40 (pdb 1inv) and b / beijing/1/87 (pdb code 1nsb) nas, respectively, illustrating the high degree of structural conservation in influenza b nas . The active site of b / perth d contained water molecules and a sulfate group bound between the guanidinium moieties of r116, r292, and r374 . R = hkl|fo(hkl) fc(hkl)|/hkl|fo(hkl)|, where fo and fc are the observed and calculated structure factors, respectively . For the b / perth e crystals, although the unit cell suggested tetragonal symmetry, good merging statistics were obtained only in space group p1 . The b / perth e structure was solved by molecular replacement using tetramers of b / perth d as a search model . Molrep selected a radius of integration of 61, and four tetramers were found with peak heights of 21.4, 18.9, 18.0, and 15.3 . Solutions for all four monomers were found in the translation function, resulting in an initial model with r and rfree factors of 31.2% and 31.1% . The structure of b / perth e is highly similar to the b / perth d structure in spite of the different crystal form . A sulfate group is bound between the guanidinium moieties of r116, r292, and r374, and a yttrium ion of partial occupancy is bound adjacent to the sulfate group . These groups are displaced by 2 or 3 upon soaking with those inhibitors (see below). Crystals of b / perth d soaked with 3 adopted similar packing to the apoenzyme . 3 was included in the model at a late stage of refinement, and the final model is of high quality (table 3). Soaking inhibitors into crystals of b / perth e proved challenging, with relatively weak data being obtained for crystals of this isozyme in the presence of 3 and 2 (table 3). Nevertheless, the structure refinement and map interpretation were aided by 15 noncrystallographic symmetry (ncs) restraints . Averaged electron density maps allowed for clear and unambiguous interpretation of the structures including, where present refinement of the b / perth e complex with 3 commenced using the apo - form of this mutant as the starting model (r = 40.5%, rfree = 40.4%). Similarly, refinement of the b / perth e 2 complex commenced using b / perth e apo structure as the starting model (r = 34.1%, rfree = 35.3%). For both complexes 3 binds in a similar fashion to related inhibitors observed in previously determined b / beijing and b / lee structures . The carboxylic acid group lies in the pocket formed by r292, r374, and r116 . The sec - pentyl moiety is stacked against the e275-c group (e276 n2 numbering) (figure 6b). Upon inhibitor binding, e275 must rotate away from the inhibitor in a manner analogous to that described previously for b / beijing na in complex with dihydropyranphenethylpropylcarboxamide . This inhibitor has an ethyl moiety that corresponds to part of the sec - pentyl group of 3 . Comparisons of the active sites of b / perth wild type and mutant nas uncomplexed and with bound inhibitors (a, b) b / perth wild type d and (c, d, e) b / perth mutant e structures . Apo (a, c) and 3-bound (b, d) forms are shown . (f) a model of the d197n mutant based on the wild - type b / perth structure is shown . Active - site residues are shown in stick form and the backbone in cartoon form . Surprisingly, rotation of e275 is not observed in the b / perth e complex with 2, which does not form any hydrophobic contacts with e275 . Instead, the sec - pentyl group makes less favorable contacts with the charged portions of r223, e275, and r292 (figure 6e). In this structure, there is only partial rotation of e275 away from the active site and hence only partial insertion of one arm of the sec - pentyl moiety into the resulting hydrophobic cleft (figure 6d). The d197e mutation in b / perth affects the way the carboxylic acid group of this residue engages with r150 . In the structure of b / perth d determined in the absence of inhibitor, the carboxylic acid group of d197 engages side - on with the guanidinium group of r150 as seen in most influenza b na structures . In the b / perth e apo structure, the guanidinium group of r150 is rotated to engage in a stacking interaction with the carboxylic acid moiety of e197 . Furthermore, the guanidinium group has rotated 180 so that the n1-atom is now pointing away from the active site (figure 6c). In the structure of b / perth e with 3, r150 has rotated toward the active site relative to its position in the apo structure and engages in a hydrogen bond with the n - acetyl oxygen atom via the n-atom . The distances of the r150 to n - acetyl hydrogen bonds are longer in b / perth e compared with p / perth d: 3.4 versus 2.7, respectively . In the complex of b / perth e with 2, r150 is in the conformation observed in b / perth d, with atom n1 engaging in a hydrogen bond with the inhibitor n - acetyl oxygen atom (2.6). While the distance is not significantly different from the equivalent distance in the 3 complex, the r150 guanidinium group and n - acetyl group are no longer coplanar, indicating a geometrically less favorable and hence weakened interaction . As an additional way of demonstrating that the reduced binding of the inhibitors in the d197e and d197n nas was due to altered interactions with the n - acetyl group of the sugar ring, we compared inhibition of all four nas with 2,3-difluoro-2-keto-3-deoxy - d - glycero - d - galactononulosonic acid 4 . Although it is only a weak inhibitor, it has no n - acetyl group; hence, values should be similar for wild type and mutant nas if this interaction can no longer occur . There was no resistance to 4 with the mutant nas compared to the d197 wild type na . In fact the ic50 for each mutant was less than for the wild type pair, b / perth e197 na 19.4 1.7 m compared to the wild type 37.7 1.7 m and the b / yamagata n197 na 41.6 0.4 m compared to the b / gifu wild type of 134 17 m, respectively . This confirmed that decreased sensitivity was due solely to altered interactions with the n - acetyl group . We have used structural and functional studies here to gain an understanding of the mechanism of resistance to the na inhibitors of influenza b viruses with mutations at residue 197 . Equally important, our studies provide insights into why influenza b wild type nas have reduced binding of 2 compared to influenza a nas . We demonstrate that although d197 does not interact directly with substrate or inhibitors, mutations of d197e and d197n in influenza b alter binding of substrate and all three na inhibitors 1, 2, and 3, as shown by decreased specific activity and increased ki and ic50 values . We also demonstrate using a modified approach to the enzyme inhibition assay that the reaction time can significantly affect both the ki and ic50 differently for wild type and mutant nas, depending on whether the inhibitor is fast or slow binding . Others have also reported variation in ki over time, due to the time dependent slow binding of 1 . They observed a 10-fold decrease in ki over the course of their reaction, with a 10 min preincubation and 15 min reaction time after addition of substrate . Because of the shorter preincubation time in their case, 1 was obviously still binding, rather than in our case where after a 30 min preincubation we start to see dissociation . Thus, despite ki values being thought to be more consistent, because of the variation in the methods used by different laboratories and the impact of fast and slow binding with time of incubation, the ki values would appear to be more suitable as relative values within a laboratory for comparing enzyme properties of wild type and mutant nas rather than as absolute values that different laboratories can directly compare . Experiments by simply monitoring changes in ic50 with time without the addition of stop solution . Comparison of the changes in ic50 with preincubation or no preincubation with inhibitor shows that this approach can provide additional information about impacts of mutations on the rates of inhibitor binding and dissociation, compared to just a single end point ic50 . This is an assay that can be carried out in any laboratory with a modern fluorimeter, without the need for any additional equipment . Laboratories globally compare ic50 values, and we are striving to understand parameters that can affect the ic50 values to enable a better comparison of ic50 values from different laboratories . Clearly both the preincubation and incubation times are critical . Structural analysis indicates that the effect of the d to e mutation at position 197 was to destabilize the interaction with r150 and to reduce the stability of this crucial inhibitor - binding residue . It appears that the d197 to e mutant prefers a conformation in which the guanidinium group of r150 is rotated and moved slightly out of the active site but can rotate back so as to engage with an inhibitor . All clinically approved inhibitors possess an n - acetyl group that interacts with r150 or its equivalent and are potentially susceptible to this mechanism of drug resistance . This is consistent with the cross - resistance seen to 1, 2, and 3 . Lack of resistance to another inhibitor without the n - acetyl group, 4, also confirmed that resistance was due to altered binding to the n - acetyl group . The mechanism of resistance in b / perth e is different from that observed in n1 and n9 nas to date . In both the n1 na with an h274y mutation and the n9 na with an r292k mutation the altered binding is due to altered interactions of the e276 (n2 numbering) with the isopentyl ether group on 2 . The influence of these mutations on the binding of 1 is less pronounced, as the side chain of e276 is able to maintain favorable interactions with the glycerol side chain . In contrast, reduced binding of 1 with an e119 g mutant na is partly due to reduced interactions with the guanidinium group at the 4 position on the sugar ring . The reduced binding in the d197 mutant nas is due to altered interactions with yet another part of the ring, the n - acetyl group, which is common to all inhibitors and substrate . The viability of the d197n mutation demonstrates that a salt bridge between this residue and r150 is not essential for function . We anticipate that the effect of the d197n mutation in b nas is to weaken the interaction of this residue with the r150 guanidinium group through the elimination of the salt bridge interaction of d197 and r150 . N197 could still interact through a hydrogen bond between the o1 atom and the n or n2 groups of r150 . This will have a similar effect to the d197e mutation in that it affords more flexibility to the r150 side chain and weakens the interaction with the n - acetyl group of the inhibitors (modeled in figure 6f). While nais are described as time dependent slow binding inhibitors, we have shown here that both d197e and d197n lead to loss of slow binding of 1, 2, and 3 . Loss of slow binding is generally associated with mutations in the na active site, leading to na inhibitor resistance . One proposed mechanism of slow binding is due to the need for the rotation of the e275 in inhibitors with the modified glycerol side chain . A proposed mechanism for the slow binding of 1 is the slow release of a water molecule by the guanidinium group . However, we see here a loss of slow binding in the nas with mutations at d197, remote from the position occupied by the guanidinium groups in both 3 and 1, and rotation of the e275 still occurs upon binding 3 . Thus, slow binding of the na inhibitors is clearly affected by more than interactions in either the vicinity of the 4-guanidino group or the rotation of the e275 . Although in the e197 mutant na the binding of 1 was reduced by nearly 30-fold compared to about 7-fold reduction for 2, the overall ic50 for 2 was higher . This is due to the lower sensitivity, or higher ic50, of the wild type b / perth na for 2(40) before the additional mutation . As the levels of 1 delivered to the upper respiratory tract after 10 mg doses nmol / l, this would still be more than 50-fold higher than the ic50 of the e197 enzyme . In contrast the plasma levels of 2 are estimated to range from 400 to 1200 nmol / l, and levels in saliva are estimated to be less than 5% of plasma levels . Thus, with a potential level in the upper respiratory tract of only 2060 nm, efficacy of 2 against a similar d197e mutant strain could be significantly reduced . In addition to loss of slow binding of the mutant nas to 1, 2, and 3, our enzyme analyses show here that there is a loss of slow binding of 2 to the wild type b / perth and b / gifu d197 enzymes compared to binding of 1 and 3, as well as faster dissociation of 2 . This is consistent with the lower sensitivity or partial resistance of wild type influenza b strains to 2 in enzyme assays compared to influenza a strains, especially in the munana assay where the ic50 values are around 1270 nm (compared to the na - star assay, 211 nm) and compared to an ic50 of around 0.52 nm for influenza a strains in both assays . The loss of slow binding is consistent with the observations of baum and colleagues, although kati et al . Had described 2 to be also slow binding in influenza b viruses . Consistent with our enzyme observations, we also importantly present structural evidence to explain the partial resistance of influenza b nas to 2 . Upon binding 2, residue e275 of b / perth na fails to rotate to allow binding of the sec - pentyl moiety to the aliphatic portion of this residue as observed in the equivalent residue (e276) in n1 and n9 nas . Rotation of this residue is necessary for high affinity binding of 2, and failure to occur is consistent with resistance to 2, seen in other mutant nas . While we were unable to obtain the structure of b / perth d with 2, a previous publication also describes lack of full rotation of the e275 in the b / lee wild type na . It may be a general feature of type b nas that this part of the active site is more rigid and e275 is less able to rotate to accommodate hydrophobic groups, although rotation does occur upon binding 3 . The floor of the active site of b - type nas has been described as being more sterically crowded than for a - type enzymes, indicating that residues in type - b na might be tightly constrained to the observed positions in the uncomplexed enzyme . We conclude that the rotation of residue e275 needed for high affinity binding of 2 does not occur in the current strains of influenza b wild type nas, and this would correlate with the loss of slowing binding of 2, the higher ic50 values seen especially in the munana assay, and possible decreased clinical efficacy of 2 in children . Isolation of the b / perth viruses with wild type d197 na and mutant e197 na has been previously described . For this purpose we obtained the b / yamagata/186/05 virus with a d197n mutation in the na, but as this has several other na sequence differences compared to the b / perth, we obtained a control for this virus na which only had a single amino acid difference in the stalk region, b / gifu/11/2005 . All virus stocks were serially plaque purified in mdck cells . 1, 2, and 3 were synthesized by gsk, (stevenage, u.k . ). 2-keto-3-deoxy - d - glycero - d - galactononulosonic acid (4) (2,3, difluoro kdn) was provided by dr . Serial log10 dilutions of inhibitors were prepared in water for inhibition assays ranging from 0.01 to 10 000 nm for 1, 2, and 3 and from 0.01 to 10 000 m for 4 . The full length b / perth wild type d197 and mutant e197 nas were expressed in sf21 insect cells as previously described . An amount of 4 l of cells at (12) 10 cells / ml was infected with a multiplicity of infection of 1.5 plaque forming units per cell and were harvested at day 4, when about 30% cell death had occurred . An equal volume of acetone was added to fix the cells, and these were stored on ice until required . After removal of the acetone and being washed three times, the cells were resuspended in tris - buffered saline to a density of 1 10 cells / ml . Cells were digested with trypsin (worthington, tpck) or pronase (calbiochem) at concentrations from 0.1 to 2 mg / ml for 2 h at 37 c to remove the na . Na was recovered in the supernatant, and the cell pellet was resuspended in tbs and redigested . The pooled supernatants were concentrated in an amicon 8050 stirred cell concentrator using a pall 30k mwco polysulfone filter . The concentrated na was separated from other proteins in the trypsin digest by gel filtration using superose 12 in tbs . Activity of the fractions was determined by the 4-methylumbelliferyl - n - acetylneuraminic acid (munana, sigma - aldrich) fluorescent enzyme assay . The active fractions were collected, analyzed by sdspage, and concentrated down again . These were further purified by running several times over a lentil lectin sepharose 4b column (amersham biosciences) and eluting with 100 mm methyl--d - mannopyranoside in 20 mm tris - cl, ph 7.4, 0.5 m nacl (lancaster). The activity of the fractions was again checked by the munana assay, and the purity was checked by sdspage and silver staining . The purest active fractions of both nas were concentrated to 4.5 mg / ml for crystallization trials . Then 300-mesh copper grids were coated with a thin carbon film and glow - discharged in nitrogen for 30 s. the 510 l aliquots of the sample were pipetted onto the grids, and after 1 min of adsorption time, excess solution was drawn off using whatman 541 filter paper . The grids were washed with 5 l of tbs, and the grid was then stained with 2% uranyl acetate and was air - dried . The grids were examined in a tecnai 12 transmission electron microscope (fei, eindhoven, the netherlands) at an operating voltage of 120 kv, and images were recorded using a megaview iii ccd camera and analysis camera control software (olympus). Activities of purified samples of recombinant b / perth d197 and e197 nas were titrated in the munana based na enzyme assay . (ii) km and ki.km and ki values were calculated using viruses solubilized by the addition of chaps (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) to a final volume of 1% . Each of the extracts was titrated in the munana based enzyme assay to determine similar final values of fluorescent units without the addition of stop solution, since this enabled continual monitoring of the reactions . The rate of hydrolysis of munana was measured at substrate concentrations ranging from 6.25 to 200 m, with readings taken every minute in a victor 2 (wallac) or bmg fluostar optima reader . The maximum slope for each reaction was determined by comparing the slopes over different overlapping time intervals . Initial velocities of the reactions were then calculated by measuring the maximum slopes plotted as a function of substrate concentrations . The michaelis menten constant, km, which represents the affinity of the enzyme for substrate, was calculated using a nonlinear regression function in graphpad prism . While the na inhibitors are competitive inhibitors, some wild type influenza nas are described as time dependent or slow binders of the inhibitors, and some mutant nas have lost this slow binding property . We followed the kinetics of inhibitor binding two ways, with preincubation of inhibitor for 30 min or without any preincubation, followed by 60 min of incubation with the munana substrate for both assays . We used a constant substrate concentration of 100 m munana and inhibitor concentrations ranging from 10000 to 0.01 nm . Fluorescent readings were taken every minute in a bmg fluostar optima reader for 60 min . Graphs of concentration of inhibitor versus% enzyme inhibition compared to the control were plotted for each 10 min data set . The ic50 was calculated as the concentration of inhibitor resulting in a 50% reduction in enzyme activity compared to the control for each 10 min time point . By use of the km and the substrate concentration, the ki can also be calculated using nonlinear regression and one - site competitive binding, using the equation of cheng and prusoffki = ic50/(1 + [substrate]/km). As we had calculated the km, we then calculated ki values in graph pad prism using this method for each 10 min interval . All crystals were grown at the bio21 collaborative crystallization centre (www.csiro.au/c3). Either a phoenix (art robbins industries) or a mosquito (ttp) dispensing robot was used to set up sitting drops in 96-well sd-2 plates (idex corp . ). Plates were stored at 281 k in a gallery 700 incubator and imaged with a minstrel ht imaging system (rigaku). A single commercial screen (the jcsg+ suite from qiagen) was set up initially to determine if the b / perth d protein concentration was appropriate for crystallization trials, using 0.2 l droplets consisting of 50% protein solution mixed with 50% reservoir solution, and equilibrated against a reservoir of 50 l . Small (<50 m) crystals grew from peg - based conditions in the jcsg+ suite trials, and subsequent crystallization trials were set up using the pact suites (qiagen), as well as from screens designed around the hits in these two commercial screens . X - ray data for flash - cooled crystals were collected at the australian synchrotron beamline mx-1 using the blu - ice software or photon factory beamline 17a . B / perth d protein (4.5 mg / ml) was mixed with reservoir solution in a 1:1 ratio (drop volume 0.2 l). X - ray data were measured from crystals grown at 8 c in 0.2 m na2so4, 20% w / v peg 3350, 0.1 m bis - tris propane, ph 6.5 . These crystals were transferred to mother liquor with 10% v / v ethylene glycol and 10% v / v glycerol added just prior to flash - cooling to 100 k. remaining crystals were used for soaking inhibitors (1, 2, and 3). A successful soak of 3 was performed by seeding some solid compound into a drop containing crystals and allowing the sample to equilibrate for 10 days prior to flash - cooling to 100 k. the well solution in this case was 0.2 m nano3, 20% w / v peg3350, 0.1 m bis - tris propane, ph 6.5 . We were not able to obtain crystals containing either 1 or 2 with the d197 protein . B / perth e (4.5 mg / ml) was used to grow crystals under conditions similar to those described above . The best crystals for diffraction experiments were grown in 1217% w / v peg 3350, 0.20.3 m na2so4, and 5 mm ycl3 . The complex of b / perth e with 3 was obtained by placement of the compound directly into the drop as described above for b / perth d. the complex of b / perth e with 2 was obtained by adding the compound (5 mm) to the cryoprotectant (the same as for b / perth d) prior to flash cooling . The weighting of x - ray and geometric parameters in refinement and the type of ncs restraints were based on their effects on rfree cross - validation.
Between april and august 1999, 22 consecutive patients underwent ferumoxides - enhanced mr imaging to assess known or suspected focal liver lesions . The criteria for inclusion in this study were as follows: hcc was depicted at contrast - enhanced ct, lesions were distributed in such a way that they were resectable, and the patient was considered suitable for curative hepatic resection . On this basis, five patients were excluded because hccs were absent (metastatic adenocarcinoma was found in two, and each of cholangiocarcinoma, hepatic adenoma, and hemangioma in one), and one other because hccs were distributed diffusely . The remaining 16 patients, 14 men and 2 women ranging in age from 35 to 66 (mean, 51) years, with 25 hccs (diameter, 3 - 140 [mean, 41] mm) in 24 hepatic segments comprised our final study group . Ferumoxides - enhanced mr imaging was not performed where patients were pregnant, showed severe renal failure, or were allergic to dextran - based drugs . The study was approved by the institutional review board, and written informed consent was obtained from all patients . For 19 hccs in 11 patients, diagnosis was based on the histopathological findings of surgery; for two, on those of us - guided percutaneous needle biopsy; and for the remaining four, the basis of confirmation was an elevated serum -fetoprotein level (over 200 ng / ml) and characteristic helical ct findings . Thirteen patients in the study had liver cirrhosis as a result of hepatitis b (n=12), or hepatitis c (n=1), while the remaining three had hepatitis b without cirrhosis . In order to evaluate hepatic segments which according to the findings of ferumoxides - enhanced mr imaging were hcc - free, follow - up radiologic examinations (contrast - enhanced ct or gadolinium - enhanced mr imaging) were performed no less than 12 months later . All mr examinations were performed on a 1.5-t mr imager (horizon, ge medical systems, milwaukee, wis . Two respiratory - triggered fse sequences (tr3333 - 8571/te18 and 90 - 117/etl12/nex2/fat sat . ), four breath - hold sequences (proton density ssfse [tr/te39/nex0.5], t2-weighted ssfse [tr/te98/nex0.5], fmpgr [tr130/te8.4 - 9.5/flip angle 30], and fmpspgr [tr130/te8.4 - 9.5/flip angle 30]), and the grass sequence (tr216/te20/flip angle 60) were performed using the parameters shown in table 1 . Transverse sections were obtained with a rectangular field of view (six - eight), a slice thickness of 6 - 8 mm, and an interslice gap of 2 mm . To minimize motion artifact during gradient - echo sequences, the patients underwent respiratory - triggered proton density and t2-weighted fse imaging, with repetition times varying between 3,333 and 8,571, and between 3,240 and 8,620 msec, according to the period of the respiratory cycle . At t2 * -weighted fmpspgr and fmpgr, multiple sections were obtained in an interleaved fashion, and the whole liver was covered with 20 sections using two breath - holds . Cambrige, mass ., u.s.a .) At a dose of 15 mol fe / kg was diluted in 100 ml of 5% glucose solution and administrated intravenously through an in - line 5-m specific filter over a 30-minute period . The images obtained during each of the seven pulse sequences were quantitatively analysed using operator - defined region - of - interest (roi) measurements of the mean signal intensity of liver parenchyma, lesions, and background noise . For the measurement of liver signal, rois were set in areas devoid of focal changes in signal intensity, large vessels, and prominent artifact . If more than one hcc was present, the largest representative lesion was identified and measured at all sequences . For liver lesions, circular or ovoid rois noise was measured on each image using rois positioned just ventral to the right anterior abdominal wall; areas with the most prominent ghost were not included . Rois were drawn electrically, and were larger than 256 mm in the liver, 45 mm in lesions, and 846 mm2 in the noise area; they were drawn three times in each place and mean values were obtained . The lesion - to - liver contrast - to - noise ratio (cnr) was calculated using the following formula: (signal intensity lesion - signal intensity liver)/standard deviation of background noise . Lesion - to - liver cnr was compared statistically using wilcoxon's signed ranks test . Two readers unaware of the patients' clinical data assessed the image quality obtained during each of the seven mr sequences . Each reader graded image quality as unacceptable, poor, fair, good, or excellent (with numerical scores of 1, 2, 3, 4, or 5, respectively) with regard to lesion conspicuity and image artifacts (5 = absent). Inter - reader agreement was assessed using a statistic: a score of more than 0.60 was taken to indicate substantial to excellent agreement (27). Discrepancies were resolved by consensus between the readers, and the final ranking data based on consensual interpretations were compared by means of wilcoxon's signed ranks test . All mr images of the 16 patients were randomized and reviewed independently by three readers experienced in mr imaging of the liver . For each pulse sequence, they recorded the number, size, and segmental location of hccs . The name, age, identification number and imaging parameters of each patient were masked to minimize learning bias, and mr images of each pulse sequence were reviewed on a segment - by - segment basis during sessions separated by two weeks . To prevent mislocation of the lesion by the readers, hepatic segments were drawn directly by the study coordinator according to couinaud's numbering system . A total of 128 hepatic segments were reviewed, including 24 segments with 25 hccs . The readers scored each image for the presence or absence of hccs and assigned one of five confidence levels, as follows: 1 = definitely or almost definitely absent, 2 = probably absent, 3 = possibly present, 4 = probably present, 5 = definitely or almost definitely present . When a lesion was located in two or more segments, the readers were asked to consider only the segment mainly involved and to assess the possibility of another lesion in the other segment . A binomial roc curve was fitted to each reader's confidence rating using a maximum - likelihood estimation . The diagnostic accuracy of each mr sequence determined by each reader was evaluated by calculating the area under the roc curve (az). Composite roc curves that combined the performance of all readers into a single curve were obtained for each mr sequence, using the maximum - likelihood curve - fitting algorithm to rate the pooled data of the three readers (28, 29). The differences between mr sequences in terms of mean az were statistically analyzed using the two - tailed student t test . The relative sensitivity of each sequence was calculated according to the percentage of segments assigned a score of 3 or greater (' possibly present' to' definitely present') among a total of 24 segments with hcc . Relative specificity calculations were based on the percentage of segments assigned a score of 1 or 2 among 93 segments without hcc . Using a statistic, inter - reader agreement regarding the detection of segments with hcc ten hepatic cysts were diagnosed by sonography and ct, and excluded from analysis after the review was complete . Between april and august 1999, 22 consecutive patients underwent ferumoxides - enhanced mr imaging to assess known or suspected focal liver lesions . The criteria for inclusion in this study were as follows: hcc was depicted at contrast - enhanced ct, lesions were distributed in such a way that they were resectable, and the patient was considered suitable for curative hepatic resection . On this basis, five patients were excluded because hccs were absent (metastatic adenocarcinoma was found in two, and each of cholangiocarcinoma, hepatic adenoma, and hemangioma in one), and one other because hccs were distributed diffusely . The remaining 16 patients, 14 men and 2 women ranging in age from 35 to 66 (mean, 51) years, with 25 hccs (diameter, 3 - 140 [mean, 41] mm) in 24 hepatic segments comprised our final study group . Ferumoxides - enhanced mr imaging was not performed where patients were pregnant, showed severe renal failure, or were allergic to dextran - based drugs . The study was approved by the institutional review board, and written informed consent was obtained from all patients . For 19 hccs in 11 patients, diagnosis was based on the histopathological findings of surgery; for two, on those of us - guided percutaneous needle biopsy; and for the remaining four, the basis of confirmation was an elevated serum -fetoprotein level (over 200 ng / ml) and characteristic helical ct findings . Thirteen patients in the study had liver cirrhosis as a result of hepatitis b (n=12), or hepatitis c (n=1), while the remaining three had hepatitis b without cirrhosis . In order to evaluate hepatic segments which according to the findings of ferumoxides - enhanced mr imaging were hcc - free, follow - up radiologic examinations (contrast - enhanced ct or gadolinium - enhanced mr imaging) were performed no less than 12 months later . All mr examinations were performed on a 1.5-t mr imager (horizon, ge medical systems, milwaukee, wis . Two respiratory - triggered fse sequences (tr3333 - 8571/te18 and 90 - 117/etl12/nex2/fat sat . ), four breath - hold sequences (proton density ssfse [tr/te39/nex0.5], t2-weighted ssfse [tr/te98/nex0.5], fmpgr [tr130/te8.4 - 9.5/flip angle 30], and fmpspgr [tr130/te8.4 - 9.5/flip angle 30]), and the grass sequence (tr216/te20/flip angle 60) were performed using the parameters shown in table 1 . Transverse sections were obtained with a rectangular field of view (six - eight), a slice thickness of 6 - 8 mm, and an interslice gap of 2 mm . To minimize motion artifact during gradient - echo sequences, the patients underwent respiratory - triggered proton density and t2-weighted fse imaging, with repetition times varying between 3,333 and 8,571, and between 3,240 and 8,620 msec, according to the period of the respiratory cycle . At t2 * -weighted fmpspgr and fmpgr, multiple sections were obtained in an interleaved fashion, and the whole liver was covered with 20 sections using two breath - holds . Cambrige, mass ., u.s.a .) At a dose of 15 mol fe / kg was diluted in 100 ml of 5% glucose solution and administrated intravenously through an in - line 5-m specific filter over a 30-minute period . The images obtained during each of the seven pulse sequences were quantitatively analysed using operator - defined region - of - interest (roi) measurements of the mean signal intensity of liver parenchyma, lesions, and background noise . For the measurement of liver signal, rois were set in areas devoid of focal changes in signal intensity, large vessels, and prominent artifact . If more than one hcc was present, the largest representative lesion was identified and measured at all sequences . For liver lesions, circular or ovoid rois noise was measured on each image using rois positioned just ventral to the right anterior abdominal wall; areas with the most prominent ghost were not included . Rois were drawn electrically, and were larger than 256 mm in the liver, 45 mm in lesions, and 846 mm2 in the noise area; they were drawn three times in each place and mean values were obtained . The lesion - to - liver contrast - to - noise ratio (cnr) was calculated using the following formula: (signal intensity lesion - signal intensity liver)/standard deviation of background noise . Lesion - to - liver cnr was compared statistically using wilcoxon's signed ranks test . Two readers unaware of the patients' clinical data assessed the image quality obtained during each of the seven mr sequences . Each reader graded image quality as unacceptable, poor, fair, good, or excellent (with numerical scores of 1, 2, 3, 4, or 5, respectively) with regard to lesion conspicuity and image artifacts (5 = absent). Inter - reader agreement was assessed using a statistic: a score of more than 0.60 was taken to indicate substantial to excellent agreement (27). Discrepancies were resolved by consensus between the readers, and the final ranking data based on consensual interpretations were compared by means of wilcoxon's signed ranks test . All mr images of the 16 patients were randomized and reviewed independently by three readers experienced in mr imaging of the liver . For each pulse sequence, they recorded the number, size, and segmental location of hccs . The name, age, identification number and imaging parameters of each patient were masked to minimize learning bias, and mr images of each pulse sequence were reviewed on a segment - by - segment basis during sessions separated by two weeks . To prevent mislocation of the lesion by the readers, hepatic segments were drawn directly by the study coordinator according to couinaud's numbering system . A total of 128 hepatic segments were reviewed, including 24 segments with 25 hccs . The readers scored each image for the presence or absence of hccs and assigned one of five confidence levels, as follows: 1 = definitely or almost definitely absent, 2 = probably absent, 3 = possibly present, 4 = probably present, 5 = definitely or almost definitely present . When a lesion was located in two or more segments, the readers were asked to consider only the segment mainly involved and to assess the possibility of another lesion in the other segment . A binomial roc curve was fitted to each reader's confidence rating using a maximum - likelihood estimation . The diagnostic accuracy of each mr sequence determined by each reader was evaluated by calculating the area under the roc curve (az). Composite roc curves that combined the performance of all readers into a single curve were obtained for each mr sequence, using the maximum - likelihood curve - fitting algorithm to rate the pooled data of the three readers (28, 29). The differences between mr sequences in terms of mean az were statistically analyzed using the two - tailed student t test . The relative sensitivity of each sequence was calculated according to the percentage of segments assigned a score of 3 or greater (' possibly present' to' definitely present') among a total of 24 segments with hcc . Relative specificity calculations were based on the percentage of segments assigned a score of 1 or 2 among 93 segments without hcc . Using a statistic, inter - reader agreement regarding the detection of segments with hcc ten hepatic cysts were diagnosed by sonography and ct, and excluded from analysis after the review was complete . The quantitative results of assessment of mean hcc - to - liver cnr obtained during each pulse sequence are shown in table 2 . The highest cnr was achieved with breath - hold t2 * -weighted fmpgr sequences (68.9 25.0); this ratio was statistically significantly higher than those obtained during all other sequences except breath - hold t2 * -weighted fmpspgr (p <1). The ratio obtained during this sequence was the second highest and was statistically significantly higher than those recorded during the sequences ranked 4 to 7 (p <.05). Hccs were statistically significantly clearer at proton density and t2-weighted fse, and at all three types of gradient - echo imaging than at the two ssfse sequences (fig . * -weighted grass imaging depicted imaging artifacts more prominently than did the other six sequences, and image interpretation was interfered with in 63% of cases (10/16) (table 3). T2 * -weighted grass imaging demonstrated pulsation artifacts due to heartbeat in all 16 patients (fig . 3), motion - related artifacts were evident at proton density and t2-weighted fse imaging in 63% (10/16) and 50% (8/16), respectively . All t2 * -weighted fmpgr and fmpspgr imaging showed ghost artifacts due to aortic pulsation in the phase - encoding direction, but proton density and t2-weighted ssfse imaging revealed no such artifacts . Overall, the imaging artifacts of the six sequences other than t2 * -weighted grass were comparable . The lowest score for interobserver agreement between readers was 0.712, and was for proton density ssfse imaging which depicted lesion conspicuity . Hence, agreement regarding lesion conspicuity and imaging artifacts was considered substantial to excellent for all sequences . Table 4 shows the calculated areas under the roc curves and the mean area determined by the three readers for each of the seven sequences . Roc curves drawn on the basis of pooled data from the three readers for each of these sequences are shown in figure 4 . With regard to lesion detection, two readers performed significantly better with the t2 * -weighted fmpgr, t2 * -weighted fmpspgr, and proton density fse sequences than the other four . One reader's interpretation of the seven sequences demonstrated no statistically significant differences in lesion detection . In terms of integrated lesion detectability on the basis of the pooled data reviewed by all observers, t2 * -weighted fmpgr, t2 * -weighted fmpspgr, and proton density fse imaging were statistically superior to those obtained using the other sequences (fig . The mean areas under the composite roc curves of the three readers were 0.965 0.015 for t2 * -weighted fmpgr sequences, 0.964 0.016 for t2 * -weighted fmpspgr, and 0.958 0.017 for proton density fse . The relative sensitivities of t2 * -weighted fmpgr, t2 * -weighted fmpspgr, and proton density fse imaging were superior to those obtained using the other sequences (table 5). Expressed as a percentage, the relative specificity of all sequences was 93 or more (table 6). The lowest score for interobserver agreement was 0.690, and involved t2-weighted fse imaging between reader 2 and reader 3 . The quantitative results of assessment of mean hcc - to - liver cnr obtained during each pulse sequence are shown in table 2 . The highest cnr was achieved with breath - hold t2 * -weighted fmpgr sequences (68.9 25.0); this ratio was statistically significantly higher than those obtained during all other sequences except breath - hold t2 * -weighted fmpspgr (p <1). The ratio obtained during this sequence was the second highest and was statistically significantly higher than those recorded during the sequences ranked 4 to 7 (p <.05). Hccs were statistically significantly clearer at proton density and t2-weighted fse, and at all three types of gradient - echo imaging than at the two ssfse sequences (fig . * -weighted grass imaging depicted imaging artifacts more prominently than did the other six sequences, and image interpretation was interfered with in 63% of cases (10/16) (table 3). T2 * -weighted grass imaging demonstrated pulsation artifacts due to heartbeat in all 16 patients (fig . 3), motion - related artifacts were evident at proton density and t2-weighted fse imaging in 63% (10/16) and 50% (8/16), respectively . All t2 * -weighted fmpgr and fmpspgr imaging showed ghost artifacts due to aortic pulsation in the phase - encoding direction, but proton density and t2-weighted ssfse imaging revealed no such artifacts . Overall, the imaging artifacts of the six sequences other than t2 * -weighted grass were comparable . The lowest score for interobserver agreement between readers was 0.712, and was for proton density ssfse imaging which depicted lesion conspicuity . Hence, agreement regarding lesion conspicuity and imaging artifacts was considered substantial to excellent for all sequences . Table 4 shows the calculated areas under the roc curves and the mean area determined by the three readers for each of the seven sequences . Roc curves drawn on the basis of pooled data from the three readers for each of these sequences are shown in figure 4 . With regard to lesion detection, two readers performed significantly better with the t2 * -weighted fmpgr, t2 * -weighted fmpspgr, and proton density fse sequences than the other four . One reader's interpretation of the seven sequences demonstrated no statistically significant differences in lesion detection . In terms of integrated lesion detectability on the basis of the pooled data reviewed by all observers, t2 * -weighted fmpgr, t2 * -weighted fmpspgr, and proton density fse imaging were statistically superior to those obtained using the other sequences (fig . The mean areas under the composite roc curves of the three readers were 0.965 0.015 for t2 * -weighted fmpgr sequences, 0.964 0.016 for t2 * -weighted fmpspgr, and 0.958 0.017 for proton density fse . The relative sensitivities of t2 * -weighted fmpgr, t2 * -weighted fmpspgr, and proton density fse imaging were superior to those obtained using the other sequences (table 5). Expressed as a percentage, the relative specificity of all sequences was 93 or more (table 6). The lowest score for interobserver agreement was 0.690, and involved t2-weighted fse imaging between reader 2 and reader 3 . The acquisition of high - quality images in the shortest possible time has been a major field of investigation in mr imaging of the liver . According to recent reports, ferumoxides - enhanced mr imaging is useful for the detection of hepatic tumors, including metastasis (5, 12, 15, 22) and hccs (3 - 5, 24), and investigators have also claimed that it is as accurate as ctap for detecting hepatic metastasis (12) or hcc (11). T2-weighted se and t2 * -weighted gre are accepted ferumoxides - enhanced mr imaging sequences (13, 24, 30, 31). At gre imaging after intravenous ferumoxides administration, signal loss of liver parenchyma is increased by the presence of iron oxide particles because of its greater susceptibility resulting from local field inhomogeneity (intravoxel dephasing) (21, 32). (21) found that gre imaging with long te and a narrow flip angle was an ideal t2 * -weighted sequence . Yamamoto et al . (24) reported that hcc detection was similar at ferumoxides - enhanced t2-weighted se and gre imaging . In a study by schwarz et al . (32), conventional se was found to be superior to fse due to the absence of a 180 refocusing pulse . However, because fse sequences are less sensitive to motion artifacts, and the decrease in liver signal noted at fse is comparable to that observed at conventional se, fse sequences are, according to a recent report (33), clinically useful for ferumoxides imaging . (23) claimed that ferumoxides - enhanced gre imaging was as accurate as t2-weighted se imaging for the detection of malignant hepatic tumors and was superior for determining their segmental location . However, the optimal imaging sequence for lesion detection with ferumoxides enhancement is still open to debate . Our results indicate that hcc - to - liver cnr was best at t2 * -weighted fmpgr sequence, for which the ratio was statistically significantly higher than for all other sequences except t2 * -weighted fmpspgr . One possible reason for the lower cnr found with fse and ssfse imaging is that a larger matrix is used for these sequences; this contributes to the sharpness of lesion contour, but leads to low lesion - to - liver cnr . The predominance of t2 * -weighted imaging is, however, thought to be caused mainly by local field inhomogeneity and the lack of a refocusing pulse (21, 32). Low cnr at t2 * -weighted grass results from the high noise level of this sequence . Because of poor soft - tissue resolution due to the t2 filtering effect, lesion conspicuity at ssfse imaging was statistically significantly less clear than at other sequences . Motion - related artifacts were significantly less severe with t2-weighted and proton density ssfse, t2 * -weighted fmpgr, and t2 * -weighted fmpspgr imaging, mainly because of their short acquisition time, which allows successful breath - holding (34). In terms of lesion - to - liver cnr, lesion conspicuity and artifacts, t2 * -weighted imaging was the best sequence, though vascular structures and hccs were similarly demonstrated with a (bright) high signal . At fse, on the other hand, vascular structures were less bright than hccs (figs . 1, 2, 5). In roc analysis, the area under the composite roc curve indicates performance . With regard to integrated lesion detectability, t2 * -weighted fmpgr, t2 * -weighted fmpspgr, and proton density fse imaging were statistically superior to other sequences . The difference in performance among mr sequences was more prominent for small hccs because these can demonstrate active uptake of ferumoxides particles, which results in slight hyperintensity, isointensity, or even hypointensity at ferumoxides - enhanced imaging (6). Ferumoxides - enhanced mr imaging does not always facilitate differentiation between malignant tumors and benign lesions . (13) recommended t1-weighted gre (short te) imaging after ferumoxides enhancement in order to detect and characterize focal liver lesions . Cysts can demonstrate low signal intensity at t1-weighted imaging, and at ferumoxides - enhanced imaging, t1-weighted sequences may permit good differentiation between malignancy and cysts . Due to the t2 effect, however, cysts can show high signal intensity at gradient - recalled echo sequences with long te . According to grangier et al ., hemangiomas can be enhanced by shortening the t1 relaxation time at t1-weighted imaging after ferumoxides administration (35). First, while the standard of reference is the findings of histopathological analysis of 41 resected hepatic segments in 11 patients, follow - up imaging findings were used as the standard of reference for 87 unresected segments . Second, in the segments containing two hepatocelluar carcinomas or a hepatocelluar carcinoma and a benign lesion (13%, n=3), segment - by - segment analysis meant that comparisons for these particular lesions could not be made . Third, it was only in the detection of hccs that optimal pulse sequences for ferumoxides - enhanced mr imaging were evaluated: optimal sequences for the characterization of focal hepatic lesions could not be determined . Finally, unenhanced mr imaging was reported to be necessary in order to decrease the number of false - positive findings attributed to vascular structures . However, " biphasic " unenhanced and ferumoxides - enhanced mr imaging is time consuming and such unenhanced imaging is thus not obtained (36). Without unenhanced imaging, we recorded few false - positive findings . In conclusion, our results suggest that t2 * -weighted fmpgr, t2 * -weighted fmpspgr, and proton density fse sequences after intravenous ferumoxides administration provide higher diagnostic accuracy than the other four sequences (t2-weighted ssfse, t2 * -weighted grass, t2-weighted fse, and proton density ssfse), and show higher cnrs, fewer image artifacts and better lesion conspicuity . For the detection of hccs at ferumoxides
Musculoskeletal disorders of the upper back, shoulders, and neck are common in many occupations that require physical exertion, repetitive movements, static muscle contraction, prolonged sitting before a computer, or maintaining fixed or extreme postures.16 in some instances, muscle fatigue subsequent to overwork or to poor posture results in tension or overactivation of the muscles of the neck.2,5,7,8 work - related neck, shoulder, and upper back musculoskeletal disorders include tension neck syndrome, rotator cuff syndrome, upper back pain, and shoulder tendonitis or tenosynovitis.912 these conditions may cause deterioration of joints, muscles, and soft tissue, persistent pain in related body areas, and disability.6 workplace interventions (eg, resistance training, stretching exercise programs) may help to prevent and manage mus - culoskeletal disorders.13 in addition, pharmacologic options, such as acetaminophen and nonsteroidal anti - inflammatory drugs (nsaids), are used to manage musculoskeletal pain, and muscle relaxants may be used to manage muscle pain, stiffness, and spasm.1417 although there are many skeletal muscle relaxants, systemically active products are generally available with prescription and are associated with well - documented adverse effects such as somnolence, dizziness, weakness, and dry mouth.17 guaifenesin, an over - the - counter (otc) expectorant, has exhibited a muscle relaxant effect in preclinical studies and in patients with cerebral palsy when used in doses higher than those currently available for otc use.18,19 in other preclinical investigations, guaifenesin has shown modest but significant analgesic and anti - inflammatory effects.20 little is known about the potential mechanism by which guaifenesin produces these effects, but a chemically similar muscle relaxant, mephenesin, has been found to be an antagonist of the excitatory amino acids n - methyl - d - aspartate (nmda) and -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (ampa).18,21 whether a true muscle relaxant effect occurs at otc doses of guaifenesin has not been studied previously . The primary objective of this proof - of - principle study was to explore the efficacy and safety of 2 otc dose strengths of guaifenesin compared with matched placebos for symptom relief in subjects with acute upper back, neck, or shoulder muscle spasm and pain . This multicenter, randomized, placebo - controlled, repeat - dose, 4-arm, parallel study was conducted at 4 investigational sites in the united states (clinicaltrials.gov identifier: nct01562548). Eligible subjects with upper back, neck, or shoulder muscle spasm and pain were randomly assigned in a 2:2:1:1 ratio to receive guaifenesin 600 mg (a single 600 mg mucinex extended release bi - layer tablet; reckitt benckiser, parsippany, nj, usa), guaifenesin 1200 mg (two 600 mg mucinex extended release tablets), placebo matched to guaifenesin 600 mg (ie, 1 placebo tablet, hereafter referred to as placebo-600), or placebo matched to guaifenesin 1200 mg (ie, 2 placebo tablets, hereafter referred to as placebo-1200). The randomization schedule was generated by the biostatistics department of glaxo - smithkline consumer healthcare (parsippany, nj, usa). All doses were self - administered twice daily (bid) for 7 consecutive days . Subjects recorded the intensity of upper back, neck, or shoulder muscle spasm, stiffness, tension, pain, and discomfort twice daily (8 am and 8 pm) on a diary card, using an 11-point numeric rating scale (nrs) for each symptom, with anchors of 0=symptom not present and 10=unbearable symptoms . On days 4 and 7, investigators telephoned subjects to evaluate muscle relaxation and to perform a global assessment of treatment helpfulness (gath), sleep disturbance (gasd), and headache frequency / intensity (gahf / gahi). At that time muscle relaxation was scored on a 5-point categorical scale of 0=no relaxation, 1=a little relaxation, 2= fair relaxation, 3=good relaxation, and 4=complete relaxation . The gath was scored on a scale of 0=poor, 1=fair, 2=good, 3=very good, and 4=excellent . The gasd, gahf, and gahi recorded whether the symptom had increased, decreased, or remained the same . The vernon mior disability questionnaire was originally designed to assess how neck pain affects everyday life with regard to pain intensity, personal care, lifting, reading, headaches, concentration, work, driving, sleeping, and recreation, with each item rated on a 6-point scale, with 1 being no disability and 6 being complete disability . Here, the same questionnaire was used to measure disability resulting from neck, upper back, and shoulder pain . This study, which was conducted from february 2012 through may 2013, conformed to the principles of the declaration of helsinki and was approved by an institutional review board (quorum review, inc, seattle, wa, usa). Subjects enrolled in the study were healthy men and women aged 1865 years with a new episode of acute upper back, neck, or shoulder muscle spasm and pain . Inclusion criteria were muscle pain and/or spasm with an onset within 48 hours of randomization and at least 30 days since a previous episode; symptoms consistent with a clinical diagnosis; and subject - rated muscle spasm and pain scores of at least 40 mm on a 100 mm visual analog scale . Subjects had to have a normal neurologic evaluation, physical examination, and clinical laboratory test results . Exclusion criteria were current or recent history of neck, back, and/or shoulder injuries; spinal disk disease; osteoporosis; liver and/or kidney disease; myocardial infarction within 12 months of randomization; history of upper back pain with active hypersensitive spots; history of other chronic pain (eg, headache, osteoarthritis, or lower back pain); and known or suspected intolerance or hypersensitivity to guaifenesin or methocarbamol (or closely related compounds) or any other study medication ingredient . Individuals who had used muscle relaxants, narcotics, monoamine oxidase inhibitors, or selegiline within 2 weeks of randomization or who were currently using tricyclic antidepressants, lithium, anticoagulants, or tramadol were ineligible . Additional exclusion criteria were current pregnancy or breastfeeding, drug or alcohol abuse within the previous 2 years, use of an investigational drug or participation in another clinical trial within 30 days prior to randomization, and involvement in a worker s compensation case . Subjects had to agree to refrain from use of analgesics (including nsaids, with the exception of aspirin 325 mg / day), muscle relaxants, physical or massage therapy, acupuncture, and heat and spa treatments for the duration of the study . The primary efficacy end point was the change in muscle spasm over the 7-day study period, measured as mean change from baseline for both morning and evening spasms in the 11-point nrs scores recorded in the subjects diary cards and averaged over the 7-day treatment period . Secondary efficacy end points included change from baseline in muscle stiffness, tension, pain, discomfort, and relaxation over the 7-day period, measured as mean change from baseline for both morning and evening symptoms on the 11-point nrs scores . Other secondary end points included muscle relaxation scores, as well as scores for gath and the individual vernon mior disability questionnaire components on days 4 and 7 . Safety assessments included treatment - emergent adverse events (teaes) and serious adverse events (saes). Safety was monitored from the start of treatment until 7 days after the last treatment administration, and treatment - related saes were reported from the time of informed consent through all follow - up contact . Severity and relationship to treatment were assessed for all teaes . Given the proof - of - concept objective, no formal sample size calculations were performed . A total of 78 subjects (26 in each active treatment randomization group and 13 in each placebo randomization group) were considered sufficient to visualize any directional change in increased efficacy from placebo to lower- and upper - dose guaifenesin groups for muscle spasm, stiffness, tension, pain, discomfort, and relaxation scores . Directional changes in efficacy were based primarily on comparisons of absolute values of means of guaifenesin 1200 mg bid with placebo-1200 and with guaifenesin 600 mg bid . Placebo-600 was not included in these comparisons, as its only purpose was to test the effect of guaifenesin 600 mg bid . Statistical testing to detect significant differences between treatments was exploratory, as no formal sample size calculations were done for this study . Efficacy analyses were conducted on the intent - to - treat (itt) population, which was defined as subjects who had received at least 1 dose of study medication and who had at least 1 post - baseline efficacy assessment . All primary and secondary end points were summarized using descriptive statistics (mean, standard deviation [sd], minimum, maximum) in order to provide an absolute comparison between treatments for the purpose of identifying a directional change in efficacy . In addition, a mixed - model analysis of covariance (ancova; proc mixed of sas) was used to analyze changes from baseline in subject nrs ratings over the 7-day period (ie, mean of each morning s and evening s changes from baseline on days 17). A similar mixed model was used to assess mean muscle relaxation and gath scores on days 4 and 7 (incorporating morning and evening scores). Both ancova models included factors for treatment (fixed effect), site (random effect), and baseline assessment of the end point being analyzed as a covariate . Treatment differences were presented with 95% confidence intervals and associated p - values . Global assessments (gasd, gahf, and gahi) were summarized by percentage of subjects recording that symptoms had increased, decreased, or stayed the same . No imputation was performed for missing values for any of the assessments, and subjects who dropped out or were excluded were included in all analyses for which they were evaluable . Adverse events were classified using the medical dictionary for drug regulatory activities version 15.1 and summarized using descriptive statistics . This multicenter, randomized, placebo - controlled, repeat - dose, 4-arm, parallel study was conducted at 4 investigational sites in the united states (clinicaltrials.gov identifier: nct01562548). Eligible subjects with upper back, neck, or shoulder muscle spasm and pain were randomly assigned in a 2:2:1:1 ratio to receive guaifenesin 600 mg (a single 600 mg mucinex extended release bi - layer tablet; reckitt benckiser, parsippany, nj, usa), guaifenesin 1200 mg (two 600 mg mucinex extended release tablets), placebo matched to guaifenesin 600 mg (ie, 1 placebo tablet, hereafter referred to as placebo-600), or placebo matched to guaifenesin 1200 mg (ie, 2 placebo tablets, hereafter referred to as placebo-1200). The randomization schedule was generated by the biostatistics department of glaxo - smithkline consumer healthcare (parsippany, nj, usa). All doses were self - administered twice daily (bid) for 7 consecutive days . Subjects recorded the intensity of upper back, neck, or shoulder muscle spasm, stiffness, tension, pain, and discomfort twice daily (8 am and 8 pm) on a diary card, using an 11-point numeric rating scale (nrs) for each symptom, with anchors of 0=symptom not present and 10=unbearable symptoms . On days 4 and 7, investigators telephoned subjects to evaluate muscle relaxation and to perform a global assessment of treatment helpfulness (gath), sleep disturbance (gasd), and headache frequency / intensity (gahf / gahi). At that time muscle relaxation was scored on a 5-point categorical scale of 0=no relaxation, 1=a little relaxation, 2= fair relaxation, 3=good relaxation, and 4=complete relaxation . The gath was scored on a scale of 0=poor, 1=fair, 2=good, 3=very good, and 4=excellent . The gasd, gahf, and gahi recorded whether the symptom had increased, decreased, or remained the same . The vernon mior disability questionnaire was originally designed to assess how neck pain affects everyday life with regard to pain intensity, personal care, lifting, reading, headaches, concentration, work, driving, sleeping, and recreation, with each item rated on a 6-point scale, with 1 being no disability and 6 being complete disability . Here, the same questionnaire was used to measure disability resulting from neck, upper back, and shoulder pain . This study, which was conducted from february 2012 through may 2013, conformed to the principles of the declaration of helsinki and was approved by an institutional review board (quorum review, inc, seattle, wa, usa). Subjects enrolled in the study were healthy men and women aged 1865 years with a new episode of acute upper back, neck, or shoulder muscle spasm and pain . Inclusion criteria were muscle pain and/or spasm with an onset within 48 hours of randomization and at least 30 days since a previous episode; symptoms consistent with a clinical diagnosis; and subject - rated muscle spasm and pain scores of at least 40 mm on a 100 mm visual analog scale . Subjects had to have a normal neurologic evaluation, physical examination, and clinical laboratory test results . Exclusion criteria were current or recent history of neck, back, and/or shoulder injuries; spinal disk disease; osteoporosis; liver and/or kidney disease; myocardial infarction within 12 months of randomization; history of upper back pain with active hypersensitive spots; history of other chronic pain (eg, headache, osteoarthritis, or lower back pain); and known or suspected intolerance or hypersensitivity to guaifenesin or methocarbamol (or closely related compounds) or any other study medication ingredient . Individuals who had used muscle relaxants, narcotics, monoamine oxidase inhibitors, or selegiline within 2 weeks of randomization or who were currently using tricyclic antidepressants, lithium, anticoagulants, or tramadol were ineligible . Additional exclusion criteria were current pregnancy or breastfeeding, drug or alcohol abuse within the previous 2 years, use of an investigational drug or participation in another clinical trial within 30 days prior to randomization, and involvement in a worker s compensation case . Subjects had to agree to refrain from use of analgesics (including nsaids, with the exception of aspirin 325 mg / day), muscle relaxants, physical or massage therapy, acupuncture, and heat and spa treatments for the duration of the study . The primary efficacy end point was the change in muscle spasm over the 7-day study period, measured as mean change from baseline for both morning and evening spasms in the 11-point nrs scores recorded in the subjects diary cards and averaged over the 7-day treatment period . Secondary efficacy end points included change from baseline in muscle stiffness, tension, pain, discomfort, and relaxation over the 7-day period, measured as mean change from baseline for both morning and evening symptoms on the 11-point nrs scores . Other secondary end points included muscle relaxation scores, as well as scores for gath and the individual vernon mior disability questionnaire components on days 4 and 7 . Safety assessments included treatment - emergent adverse events (teaes) and serious adverse events (saes). Safety was monitored from the start of treatment until 7 days after the last treatment administration, and treatment - related saes were reported from the time of informed consent through all follow - up contact . Severity and relationship to treatment were assessed for all teaes . Given the proof - of - concept objective, no formal sample size calculations were performed . A total of 78 subjects (26 in each active treatment randomization group and 13 in each placebo randomization group) were considered sufficient to visualize any directional change in increased efficacy from placebo to lower- and upper - dose guaifenesin groups for muscle spasm, stiffness, tension, pain, discomfort, and relaxation scores . Directional changes in efficacy were based primarily on comparisons of absolute values of means of guaifenesin 1200 mg bid with placebo-1200 and with guaifenesin 600 mg bid . Placebo-600 was not included in these comparisons, as its only purpose was to test the effect of guaifenesin 600 mg bid . Statistical testing to detect significant differences between treatments was exploratory, as no formal sample size calculations were done for this study . Efficacy analyses were conducted on the intent - to - treat (itt) population, which was defined as subjects who had received at least 1 dose of study medication and who had at least 1 post - baseline efficacy assessment . All primary and secondary end points were summarized using descriptive statistics (mean, standard deviation [sd], minimum, maximum) in order to provide an absolute comparison between treatments for the purpose of identifying a directional change in efficacy . In addition, a mixed - model analysis of covariance (ancova; proc mixed of sas) was used to analyze changes from baseline in subject nrs ratings over the 7-day period (ie, mean of each morning s and evening s changes from baseline on days 17). A similar mixed model was used to assess mean muscle relaxation and gath scores on days 4 and 7 (incorporating morning and evening scores). Both ancova models included factors for treatment (fixed effect), site (random effect), and baseline assessment of the end point being analyzed as a covariate . Global assessments (gasd, gahf, and gahi) were summarized by percentage of subjects recording that symptoms had increased, decreased, or stayed the same . No imputation was performed for missing values for any of the assessments, and subjects who dropped out or were excluded were included in all analyses for which they were evaluable . Adverse events were classified using the medical dictionary for drug regulatory activities version 15.1 and summarized using descriptive statistics . Ninety - five people were screened, of whom 79 met the enrollment criteria and were randomly assigned to receive guaifenesin 600 mg bid (n=25), guaifenesin 1200 mg bid (n=25), placebo-600 (n=15), and placebo-1200 (n=14). One subject in the guaifenesin 1200 mg bid group was lost to follow - up and did not receive treatment and was excluded from the safety and itt populations . One subject in the placebo-1200 group was excluded from the itt population because the number of pills returned at the end of the study indicated a much lower adherence to study procedures than that indicated in the subject s diary records . Thus, 78 subjects were included in the safety population and 77 in the itt population . The overall mean (sd) age of randomized subjects was 45.9 (11.5) years, and slightly more than half of all subjects were males (55.1%). Most study subjects were white (66.7%); the remaining subjects were primarily black (32.1%). The demographics of the subjects in the individual treatment arms are shown in table 1 . Over the 7-day study period, the guaifenesin 1200 mg bid group showed a potential directional change for a greater effect on decreasing muscle spasm compared with its matched placebo and guaifenesin 600 mg bid (figure 1a). Reduction of muscle spasm in subjects treated with guaifenesin 1200 mg bid was 25% greater than that of subjects in the placebo-1200 group and 16% greater than that of subjects in the guaifenesin 600 mg bid group . Guaifenesin 600 mg bid did not show a clear effect on decreasing muscle spasm compared with its matched placebo (mean change score, 1.53 vs 1.74; table 2). Over the 7-day study period, treatment with guaifenesin 1200 mg bid provided numerically greater improvements than its matched placebo and guaifenesin 600 mg bid on most other subject - reported symptoms, including pain (figure 1b), tension (figure 1c), and discomfort . Subjects in the guaifenesin 1200 mg bid group experienced greater mean reductions of 52% and 31% in pain, 28% and 13% in tension, and 108% and 20% in discomfort compared with subjects in the placebo-1200 and guaifenesin 600 mg bid groups, respectively (table 2). Guaifenesin 600 mg bid did not show a clear effect toward improvement on these outcomes compared with its matched placebo . Improvement in muscle discomfort with guaifenesin 1200 mg bid was significantly greater than placebo-1200 (p=0.0358). All other differences among treatments for the above - mentioned end points were not significant (p>0.05; table 2). There was a directional change suggesting increasing effects on muscle relaxation from placebo-1200 to guaifenesin 600 mg bid to guaifenesin 1200 mg bid (table 3). Mean muscle relaxation on day 4 for subjects in the guaifenesin 1200 mg bid group was 39% and 3% greater than mean muscle relaxation for subjects in the placebo-1200 and guaifenesin 600 mg bid groups, respectively . On day 7, this directional change continued with a 28% and 17% greater effect of guaifenesin 1200 mg bid over placebo-1200 and guaifenesin 600 mg bid groups, respectively . Guaifenesin 600 mg bid did not produce greater muscle relaxation compared with its matched placebo on both days 4 and 7 (table 3). Similar results to muscle relaxation were observed for gath (table 3). On day 4, subjects rated guaifenesin 1200 mg bid 94% and 10% higher than subjects in the placebo-1200 and guaifenesin 600 mg bid groups, respectively . On day 7, these values were 23% and 10%, respectively . The greatest treatment effect for gath and muscle relaxation was observed on day 4 (table 3). There was a significant difference between guaifenesin 1200 mg bid and placebo-1200 (p=0.0211) for gath and a borderline significant difference between these 2 groups for muscle relaxation (p=0.0523). For example, the effect of guaifenesin 1200 mg bid on muscle relaxation on day 7 was 22% higher than on day 4 . There were no directional changes in effect with regard to effects on sleep disturbance, headache frequency, or headache intensity based on gasd, gahf, and gahi scores, respectively (table s1 for day 7 data). On day 4, subjects in the guaifenesin 1200 mg bid group had overall better (lower) mean vernon mior index scores than subjects in the guaifenesin 600 mg bid group, and subjects in the guaifenesin 600 mg bid group had overall better (lower) scores than subjects in the placebo-1200 group (figure 2). There was a directional change on day 4 of placebo-1200 (2.39)> guaifenesin 600 mg bid (2.31)> guaifenesin 1200 mg bid (2.01). There was a reduction of 16% and 13% in the overall mean vernon mior index for subjects in the guaifenesin 1200 mg bid group compared with subjects in the placebo-1200 and guaifenesin 600 mg bid groups . A similar directional change was observed on day 7, where there was a reduction of 10% and 20% in the overall vernon mior index of subjects in the guaifenesin 1200 mg bid group compared with the placebo-1200 and guaifenesin 600 mg bid groups, respectively . Within each treatment group, vernon mior disability scores improved noticeably from day 4 to day 7 (figure 2). A summary of results for upper back / neck / shoulder pain disability end points is presented in table 4 . Twenty - one teaes were reported by 17 (21.8%) subjects in the study . Eight teaes occurred in 6 subjects (25.0%) in the guaifenesin 1200 mg bid group, 4 teaes in 3 subjects (21.4%) in the placebo-1200 group, 8 teaes in 7 subjects (28.0%) in the guaifenesin 600 mg bid group, and 1 teae in 1 subject (6.7%) in the placebo-600 group . The most common categories of teaes were nervous system disorders (eg, headache, dizziness, dysgeusia, and somnolence) and infections (eg, upper respiratory infections and nasopharyngitis). Nearly all teaes were mild; there were 2 moderate teaes (upper respiratory tract infection and hyperhidrosis) in the guaifenesin 1200 mg bid group, 3 moderate teaes (headache, sinusitis, and sleep disorder) in the placebo-1200 group, 2 moderate teaes (headache and arthralgia) in the guaifenesin 600 mg bid group, and no moderate teaes in the placebo-600 group . Seven teaes in 7 subjects were considered to be treatment - related, including 1 case of moderate hyperhidrosis in the guaifenesin 1200 mg bid group, 1 moderate headache and 1 moderate sleep disorder in the placebo-1200 group, 1 mild case each of dizziness, dysgeusia, and fatigue in the guaifenesin 600 mg bid group, and 1 case of mild abdominal discomfort in the placebo-600 group . Ninety - five people were screened, of whom 79 met the enrollment criteria and were randomly assigned to receive guaifenesin 600 mg bid (n=25), guaifenesin 1200 mg bid (n=25), placebo-600 (n=15), and placebo-1200 (n=14). One subject in the guaifenesin 1200 mg bid group was lost to follow - up and did not receive treatment and was excluded from the safety and itt populations . One subject in the placebo-1200 group was excluded from the itt population because the number of pills returned at the end of the study indicated a much lower adherence to study procedures than that indicated in the subject s diary records . Thus, 78 subjects were included in the safety population and 77 in the itt population . The overall mean (sd) age of randomized subjects was 45.9 (11.5) years, and slightly more than half of all subjects were males (55.1%). Most study subjects were white (66.7%); the remaining subjects were primarily black (32.1%). The demographics of the subjects in the individual treatment arms are shown in table 1 . Over the 7-day study period, the guaifenesin 1200 mg bid group showed a potential directional change for a greater effect on decreasing muscle spasm compared with its matched placebo and guaifenesin 600 mg bid (figure 1a). Reduction of muscle spasm in subjects treated with guaifenesin 1200 mg bid was 25% greater than that of subjects in the placebo-1200 group and 16% greater than that of subjects in the guaifenesin 600 mg bid group . Guaifenesin 600 mg bid did not show a clear effect on decreasing muscle spasm compared with its matched placebo (mean change score, 1.53 vs 1.74; table 2). Over the 7-day study period, treatment with guaifenesin 1200 mg bid provided numerically greater improvements than its matched placebo and guaifenesin 600 mg bid on most other subject - reported symptoms, including pain (figure 1b), tension (figure 1c), and discomfort . Subjects in the guaifenesin 1200 mg bid group experienced greater mean reductions of 52% and 31% in pain, 28% and 13% in tension, and 108% and 20% in discomfort compared with subjects in the placebo-1200 and guaifenesin 600 mg bid groups, respectively (table 2). Guaifenesin 600 mg bid did not show a clear effect toward improvement on these outcomes compared with its matched placebo . Improvement in muscle discomfort with guaifenesin 1200 mg bid was significantly greater than placebo-1200 (p=0.0358). All other differences among treatments for the above - mentioned end points were not significant (p>0.05; table 2). There was a directional change suggesting increasing effects on muscle relaxation from placebo-1200 to guaifenesin 600 mg bid to guaifenesin 1200 mg bid (table 3). Mean muscle relaxation on day 4 for subjects in the guaifenesin 1200 mg bid group was 39% and 3% greater than mean muscle relaxation for subjects in the placebo-1200 and guaifenesin 600 mg bid groups, respectively . On day 7, this directional change continued with a 28% and 17% greater effect of guaifenesin 1200 mg bid over placebo-1200 and guaifenesin 600 mg bid groups, respectively . Guaifenesin 600 mg bid did not produce greater muscle relaxation compared with its matched placebo on both days 4 and 7 (table 3). Similar results to muscle relaxation were observed for gath (table 3). On day 4, subjects rated guaifenesin 1200 mg bid 94% and 10% higher than subjects in the placebo-1200 and guaifenesin 600 mg bid groups, respectively . On day 7, these values were 23% and 10%, respectively . The greatest treatment effect for gath and muscle relaxation there was a significant difference between guaifenesin 1200 mg bid and placebo-1200 (p=0.0211) for gath and a borderline significant difference between these 2 groups for muscle relaxation (p=0.0523). On day 7, treatment effect increased compared with day 4 . For example, the effect of guaifenesin 1200 mg bid on muscle relaxation on day 7 was 22% higher than on day 4 . There were no directional changes in effect with regard to effects on sleep disturbance, headache frequency, or headache intensity based on gasd, gahf, and gahi scores, respectively (table s1 for day 7 data). On day 4, subjects in the guaifenesin 1200 mg bid group had overall better (lower) mean vernon mior index scores than subjects in the guaifenesin 600 mg bid group, and subjects in the guaifenesin 600 mg bid group had overall better (lower) scores than subjects in the placebo-1200 group (figure 2). There was a directional change on day 4 of placebo-1200 (2.39)> guaifenesin 600 mg bid (2.31)> guaifenesin 1200 mg bid (2.01). There was a reduction of 16% and 13% in the overall mean vernon mior index for subjects in the guaifenesin 1200 mg bid group compared with subjects in the placebo-1200 and guaifenesin 600 mg bid groups . A similar directional change was observed on day 7, where there was a reduction of 10% and 20% in the overall vernon mior index of subjects in the guaifenesin 1200 mg bid group compared with the placebo-1200 and guaifenesin 600 mg bid groups, respectively . Within each treatment group, vernon mior disability scores improved noticeably from day 4 to day 7 (figure 2). A summary of results for upper back / neck / shoulder pain disability end points is presented in table 4 . Twenty - one teaes were reported by 17 (21.8%) subjects in the study . Eight teaes occurred in 6 subjects (25.0%) in the guaifenesin 1200 mg bid group, 4 teaes in 3 subjects (21.4%) in the placebo-1200 group, 8 teaes in 7 subjects (28.0%) in the guaifenesin 600 mg bid group, and 1 teae in 1 subject (6.7%) in the placebo-600 group . The most common categories of teaes were nervous system disorders (eg, headache, dizziness, dysgeusia, and somnolence) and infections (eg, upper respiratory infections and nasopharyngitis). Nearly all teaes were mild; there were 2 moderate teaes (upper respiratory tract infection and hyperhidrosis) in the guaifenesin 1200 mg bid group, 3 moderate teaes (headache, sinusitis, and sleep disorder) in the placebo-1200 group, 2 moderate teaes (headache and arthralgia) in the guaifenesin 600 mg bid group, and no moderate teaes in the placebo-600 group . Seven teaes in 7 subjects were considered to be treatment - related, including 1 case of moderate hyperhidrosis in the guaifenesin 1200 mg bid group, 1 moderate headache and 1 moderate sleep disorder in the placebo-1200 group, 1 mild case each of dizziness, dysgeusia, and fatigue in the guaifenesin 600 mg bid group, and 1 case of mild abdominal discomfort in the placebo-600 group . This is the first study to evaluate guaifenesin for managing symptoms of upper back, neck, and shoulder pain . The results suggest further investigation of the potential of guaifenesin 1200 mg bid to provide some relief in muscle spasm, pain, tension, and discomfort of the upper back, neck, and shoulders is warranted . The reduction in muscle discomfort with guaifenesin 1200 mg compared with placebo-1200 was statistically significant (p=0.0358); the rest of these improvements were not significant (p>0.05); it is noted that in this small proof - of - principle study, analyses were not powered for pre - specified statistical testing between treatments . The 1200 mg bid dose of guaifenesin suggested a potential for therapeutic muscle relaxant effect . However, any observed differences between treatments diminished over the course of the study, possibly due to the natural course of upper back pain / muscle spasm, which is generally a self - limiting disorder such that patients may have recovered at day 7 . This suggests that future studies should focus on earlier (eg, day 4) outcomes . The directional change in effect observed for upper back / neck / shoulder pain disability on the vernon mior questionnaire end points was consistent with that of most of the other end points in the study . Subjects in the guaifenesin 1200 mg bid group had better (lower) overall scores than subjects in the guaifenesin 600 mg bid group, and subjects in the guaifenesin 600 mg bid group had better (lower) scores than subjects in the placebo-1200 group . This study adds support to the limited evidence suggesting that guaifenesin has muscle relaxant activity.19 in an earlier small, exploratory clinical study, guaifenesin at doses up to 220.5 mg / kg (100 mg / lb) of body weight showed muscle relaxant and antispasmodic effects in children with athetoid or tonic spasticity (n=18).19 methocarbamol, a car - bamate derivative of guaifenesin, also has muscle relaxant properties22,23 and is prescribed for the relief of discomfort associated with acute, painful musculoskeletal conditions.24 based on these prior studies, muscle spasm was selected as the primary outcome for our investigation; however, results of the secondary end points showed the largest treatment effect for guaifenesin 1200 mg bid vs placebo-1200 on muscle pain and discomfort . Therefore, pain and discomfort may be more appropriate primary end points in future studies . Acute, non - traumatic back, shoulder, and neck pain may be self - limiting and, for most patients, may improve or resolve within several days of onset without intervention; however, the pain sometimes persists or recurs and converts to a chronic condition lasting months or even years.2527 the availability of an otc muscle relaxant may provide timely access to an effective remedy for relief of acute symptoms . While none of the directional changes in effect observed in the primary and secondary outcomes achieved statistical significance, it should be noted that this was a small, proof - of - principle study for which sample size was not powered to show statistical difference between active treatments and their matched placebos . Furthermore, the 2:2:1:1 randomization ratio led to only 15 subjects assigned to placebo-600 and 14 assigned to placebo-1200; the small numbers of subjects may have contributed to the higher than expected placebo response in the placebo-600 group due to sampling bias and the possibility that the subjects were not representative of the general population experiencing upper back, neck, and shoulder pain . Nonetheless, this study has provided interesting preliminary evidence on another potential therapeutic use for otc guaifen - esin . Therefore, a larger, adequately powered study is warranted to further investigate the potential muscle relaxant and pain reduction effects of guaifenesin 1200 mg bid . Results from this proof - of - principle study showed a directional change in benefit from placebo to lower and upper doses of guaifenesin for muscle spasm, pain, tension, discomfort, and relaxation, suggesting that the otc dose of guaifenesin 1200 mg bid may potentially provide symptom relief from upper back, neck, and shoulder musculoskeletal pain and discomfort . Gasd, gahf, and gahi at day 7 (itt population) notes: bid, twice daily; placebo-600, placebo matched to guaifenesin 600 mg bid; placebo-1200, placebo matched to guaifenesin 1200 mg bid . Abbreviations: gasd, global assessment of sleep disturbance; gahf, global assessment of headache frequency; gahi, global assessment of headache intensity; itt, intent - to - treat.
Age - related macular degeneration (amd) is the most common cause of legal blindness in the elderly population of developed countries with over 300,000 newly diagnosed patients per year in europe and north america [1, 2]. It is widely believed that amd starts with the insidious, slowly progressing dry form (dry amd) and can later develop into the more severe wet amd, which advances very rapidly and is characterized by abnormal development of blood vessels, a process called choroidal neovascularization (cnv) [3, 4] that affects the macular region of the retina and leads to loss of central vision . In turn, dry amd without cnv can proceed to focal loss of the retinal pigment epithelium (rpe), termed geographic atrophy (ga), which is accompanied by loss of vision over these slowly expanding areas of rpe atrophy . Rpe loss or dysfunction renders the surrounding tissue vulnerable to damage by reactive oxygen species and loss of photoreceptor density ensues . It has been recognized that accumulation of debris below the rpe in the macula, also known as drusen, is a risk factor for amd . Identification of complement factor proteins in drusen from amd eyes, coupled with genetic variation in several complement factor genes in amd patients [813], collectively implicates inflammation as an important component in the pathophysiology of this disease [14, 15]. For instance, it was recently demonstrated that complement factor h (cfh) serves a protective role in amd by binding and inhibiting the inflammatory effects of the lipid peroxidation product malondialdehyde (mda). Therefore, dissecting the initiating events of outer retinal inflammation during the early stages of amd can lead to a better understanding of its pathogenesis . Such findings will enable the development of innovative immunotherapies that can prevent inflammatory damage to retinal tissue and loss of vision in a disease process that is estimated to increase in prevalence by 50% by the year 2020 . In the past decade, several novel therapeutic agents have been identified as effective drugs to treat wet amd, which delay new blood vessel formation and improve vision . However, there is no effective treatment for dry amd to date . In the pursuit of identifying the signals from the outer retina that initiate inflammation and possibly involve the immune system in amd pathogenesis, we have evaluated immune responses to carboxyethylpyrrole (cep), a protein modification that forms from an oxidation fragment of docosahexaenoic acid (dha), the most oxidizable of all long chain polyunsaturated fatty acids . Studies have shown that amd donor eyes contain more cep - modified proteins in the outer retina and drusen than in age - matched controls . Cep - modified proteins and cep autoantibodies are also more abundant in amd plasma than in control samples [19, 20]. Since dha is abundant in the outer retina, where the amalgamation of high oxygen tension and light provides an environment suitable for oxidative damage, our lab has previously developed a murine model in which mice immunized with cep - modified mouse serum albumin (cep - msa) develop a cep - specific immune response which correlates with dry amd - like pathology when compared to age - matched controls, including cep autoantibodies, complement deposition in the bruch's membrane, and rpe damage [22, 23]. To our knowledge, this is the first immune - mediated mouse model of dry amd in genetically unmanipulated animals and stems directly from observations in human patients . Another component of the immune system that has been implicated in amd is the macrophage lineage [24, 25], although the specific role of these innate immune cells at different stages of amd disease progression is still controversial . Within the retina, there are two sources of macrophages: (1) microglia, bone marrow - derived resident macrophages that are recruited to neural tissue during retinal development and provide immunosurveillance in the inner retina, and (2) circulating monocytes that can be recruited from the blood vessels to sites of inflammation when needed by specific chemokines and cytokines . Independent of the source, these cells can undergo a diverse program of differentiation depending on the microenvironment that ultimately dictates their effector functions [26, 27]. Macrophages activated in the presence of interferon - gamma (ifn-) become proinflammatory m1 macrophages, characterized by their production of tumor necrosis factor alpha (tnf-) and interleukin-12 (il-12) and are associated with tissue damage . On the other hand, macrophages activated in the presence of il-4 differentiate into m2-type, marked by production of the immunosuppressive cytokine il-10 and involved in tissue remodeling . The cep - msa - induced changes in the outer retina that provide a model for amd afford the unique opportunity to directly test the role of these cells in the disease process . Our current study aims to characterize both the magnitude and kinetics of development of retinal lesions and macrophage involvement in the balb / c and c57bl/6 (b6) mouse strains at various intervals postimmunization (p.i .) In young mice compared to age - matched controls, before extensive retinal lesions are observed . Here we extend our original study by showing that cep - msa immunization leads, in aged (old) balb / c mice, to the end stage cardinal feature of human dry amd: loss of photoreceptor cells . This major damage is the result of a low - grade but significant inflammatory response in the retina prior to overt tissue damage, which can be quantified in young mice . We have identified m1 macrophages localized to the interphotoreceptor matrix (ipm) surrounding the photoreceptor outer segments in close proximity to the rpe . These changes occur in both balb / c and b6 strains, but the kinetics are different; balb / c mice are more susceptible at a younger age . We also detected elevated levels of the monocyte chemoattractant ccl2 in the retinas of cep - immunized mice . Moreover, ccr2 b6 mice immunized with cep - msa lack macrophage recruitment, and retinal lesion development is reduced or prevented . Since amd is an age - related disease, defining the progression of inflammatory cell recruitment and development of amd - like lesions at earlier stages of the disease is essential in order to map the character and timing of immune mechanisms that take place in our model and correlate with development of pathology . This work clarifies a long - standing question by defining a clear mechanistic path that explains the role of inflammation in amd: m1 macrophages are key factors in dry amd pathogenesis . We also provide experimental demonstration for the idea that regulation of immune responses (in this case, inhibition of macrophage recruitment) can be a target of therapy to prevent the development of amd . We have previously described amd - like lesions in wild - type (wt) b6 mice immunized with cep - msa . We now describe in detail lesions in cep - msa - immunized mice on the balb / c background, which are inherently albino . Importantly, but also technically challenging, the severity of lesions increases with time after immunization, and it can take for up to 1224 months to observe signs of geographic atrophy and photoreceptor cell loss, cardinal features of amd (figure 1, supplemental figure s1 available online at http://dx.doi.org/10.1155/2013/503725). The main purpose of the current study was to determine the earliest time at which significant differences between cep - immunized and control mice could be detected . The reasoning behind this approach is to define the molecular and cellular mechanisms that take place at the initial stages of disease, before there are gross changes to the retina that could alter its function . Eyes harvested at 4090 days p.i . Were defined as of early recovery times, those harvested at 100200 days p.i . Focal lesions in the rpe and ipm consisting of vacuolization of individual or groups of cells, pyknotic rpe cells, hypertrophic rpe cells, and melanin engulfment by macrophages (only possible in b6 mice), as well as darkly stained nuclei of inflammatory (macrophage - like) cells in the rpe and ipm were counted (refer to methods for detailed scoring parameters) (figure 1). While significant damage can be observed in the retina of aged (1224 months old) control mice (mainly thinning of the photoreceptor layer, figure 1, supplementary figure 1), no ga pathology is seen in mice that did not receive cep immunization or in younger cep - immunized mice . Our data was analyzed with a three - factor analysis of variance; the factors are (1) strain of mice (balb / c versus b6), (2) immunization status (nave versus immunized), and (3) time of recovery of tissue (early versus intermediate) (figure 2). Pathology scores (defined as the summation of retinal lesions and cellular infiltration) were higher in balb / c cep - immunized mice at both early and intermediate recovery times but only higher in b6 cep - immunized mice at the intermediate recovery time (figure 2(a)). To have a representative and objective pathological score throughout the retina, we focused on the number of ipm - infiltrating cells present in close proximity to the rpe . Using routine histopathology, it is not possible to distinguish different types of monocyte lineage cells present in the outer retina (for example, resident microglia versus macrophages recruited from the circulation). For this reason in the description of the results to follow, we will simply refer to the nonneural cells in the ipm as macrophages, since microglia are distinguished mainly for their location within the central nervous system . Careful examination of the lesions at these early and intermediate recovery times demonstrated that a distinct population of macrophages is present in the ipm compartment near the rpe in these animals . Quantification in plastic sections showed that cep - immunized balb / c mice have a significantly higher number of macrophages than age - matched nave animals harvested at 40100 days p.i . The same cellular quantification is observed with h&e staining of frozen sections (figure 2(c)). When comparing ipm macrophages between the two time points, balb / c mice showed an increase in the number of these cells in the early to intermediate recovery times in both immunized and nave mice, but the magnitude was significantly higher in immunized mice (p = 0.012). While cep - immunized b6 mice harvested at early recovery times showed no significant differences in ipm macrophages when compared to nave b6 mice, immunized mice harvested at intermediate time points had more ipm macrophages than age - matched b6 nave controls (p = 0.023). Therefore, the number of monocyte - lineage cells present in the ipm increases over time in cep - immunized b6 mice to reach significant numbers by the intermediate recovery times . Nave balb / c mice contained more macrophages in the ipm than age - matched nave b6 mice (p <0.01), and immunized balb / c mice show higher number of ipm macrophages than immunized b6 mice as well (p <0.01). This difference is also evident in the number of rpe lesions, which are higher in balb / c mice than in b6 mice, regardless of immunization status . To test the possibility that photosensitivity in the balb / c albino mice could be responsible for the differences in outer retinal lesion development and macrophage presence when compared to b6 mice, we immunized albino b6 mice (b6(cg)-tyr / j or tyr mice, which lack the tyrosinase enzyme) and compared them to age - matched nave tyr mice as well as to corresponding balb / c and wt - b6-immunized and nave mice at 4090 days p.i . The results from these comparisons showed that both macrophages in the outer retina and development of retinal lesions observed in tyr mice are comparable to wt b6 and do not show the enhanced cellular recruitment, rpe hypertrophy, and ros vacuolization present in balb / c mice at the early time points, regardless of immunization status (figure 3(a)). Quantification analysis of pathological changes per section supports these observations (figure 3(b)). This suggests that the differences in inflammatory cells present in the outer retina and amd - like pathology observed between the balb / c and the b6 strains are not due to photosensitivity in the albino mice because of lack of pigmentation, but instead they are specific to genetic background, possibly due to differences in the immune responses against cep - msa between the mice or to inherent differences in rpe function and/or local oxidative damage responses in the retina . Because inflammation associated with macrophages present in the ipm seems to play a role in the retinal pathology observed in cep - msa - immunized mice, we performed immunohistochemical (ihc) analysis using cell surface immune markers for the identification of the specific macrophages present in the retina, generally, and to the ipm region, specifically . A large number of cd45 + (a pan - leukocyte marker) cells were observed in the choroid of immunized mice compared to controls (supplementary figure 2), indicating that cep immunization leads to increased ocular inflammation . In terms of specific cell subsets, we observed only a few cd3 + and cd19 + cells in the outer retina, suggesting that both t cells and b cells are largely absent from the site of retinal lesions (data not shown). In contrast, there were substantial numbers of choroidal cd11b+, f4/80 +, and cd68 + cells surrounding the retinas of balb / c cep - msa - immunized mice and not of nave controls (data not shown). Similar findings were observed in b6 immunized animals at late recovery times when lesions are present . Immunofluorescence staining identified retinal cd11b+, f4/80 +, and cd68 + cells in mice immunized with cep - msa, suggesting the potential role of macrophages in the development of disease in this model . We were able to localize a significant number of these macrophages in the rpe and ipm using nuclear counterstaining with dapi (figure 4(a), supplementary figure 3). This correlates with the location of the macrophages identified by histopathology using toluidine blue and h&e staining that are mostly observed in proximity with vacuolization and lesions of rpe and photoreceptors . In order to determine the specific class and activation status of these macrophages, we performed intracellular stains for tumor necrosis factor - alpha (tnf-) and interleukin-12 (il-12) production, which identify m1 macrophages, versus il-10 production, a hallmark of m2 macrophage differentiation . We observed both tnf+ and il-12 + cells within the ipm of cep - msa - immunized mice, but il-10 staining was negative, indicating the presence of activated m1 macrophages in the pathological regions of immunized mice only (figure 4(b)). To substantiate the ihc results, we performed mrna quantification on ipm - infiltrating macrophages isolated by laser capture . These data confirmed that detectable levels of m1 marker genes (il-6, tnf-, and il-1) were observed only in cep - immunized mice, whereas il-10 expression was not detected (figure 4(c)). Expression of arg1, another m2 marker, was not elevated in cep - immunized mice . Interestingly, we also observed cep - associated increased expression of ccl2, a monocyte chemoattractant that has been implicated in amd, suggesting that the ccl2/ccr2 axis may play a role in cep - induced pathology . These data strongly suggest that m1 macrophages are primarily associated with the lesions we observe in the outer retina and may be the main effectors of the inflammatory response observed in this model . To directly test the role of macrophage recruitment into the ipm and development of outer retinal lesions we immunized ccr2-deficient mice on the b6 background . These mice have a defect in chemokine signaling and show poor recruitment of inflammatory cells into sites of inflammation . In addition, it has been previously shown that disruption of chemokine signaling to macrophages in these ccr2 knockout mice can have a deleterious effect on the integrity of the retina in aged mice (2 years and older). While ccr2 deficiency did not affect the levels of anti - cep antibody titers in young immunized mice (figure 5(a)), ccr2 animals showed no increase of ipm - infiltrating macrophages or outer retinal lesions in immunized mice compared to those in naive age - matched controls at late recovery times (figure 5(b)). This observation strongly suggests that macrophages, mainly recruited by ccl2, play a causative role in the induction of tissue damage in this model . Immunization of mice with cep - msa provides a valuable model to study dry amd from an immunological perspective, helping to dissect the immune system's role in the development of disease . Studies presented here link the amd - like histopathological changes with the presence of macrophages in the outer retina during early stages of disease, suggesting that macrophages are involved in the underlying pathology . Notably, our data suggest that balb / c mice tend to be more sensitive to immunization with cep - msa than b6 mice by having a greater magnitude and earlier significant difference of inflammatory cells in the ipm when compared to age - matched controls . In addition, dry amd - like pathology, such as rpe cell hypertrophy, vacuolization of rpe and ros, and rpe cell pyknosis, is also found at greater magnitude and arises earlier following immunization in the balb / c mice . We also show that old cep - immunized balb / c mice develop photoreceptor cell loss . This suggests that future studies using this model would benefit from a more rapid and amplified immunopathological effect in balb / c mice than in b6 mice, yielding results as early as 40100 days postimmunization . Even if balb / c mice show an earlier significant response to immunization with cep - msa than age - matched b6 mice, it is important to stress that cep - immunized mice contain larger numbers of macrophages in the ipm and amd - like pathology than nave controls in both strains . Furthermore, our data showed no statistically significant differences between the two strains through time . This suggests that any age - related changes seen in immunized mice observed during the early stages of disease are of comparable magnitude regardless of strain, but that the higher number of macrophages present in the ipm of balb / c mice makes it technically easier for quantification of disease onset . In other words, the reason that there seems to be no early differences in nave versus cep - msa mice on the b6 background is because the actual number of ipm - infiltrating cells is too low at that point to achieve statistical significance . Differences between these two strains could also be attributed to background - specific (genetic and/or immune) mechanisms or to the reduced melanin levels in balb / c mice . B6 mice are prone to develop t helper type 1 (th1) responses, whereas balb / c are th2-prone . On the other hand, it has been shown that melanin in the rpe provides protection from light damage . By showing that albino b6 (tyr) mice have comparable inflammatory cell numbers in the ipm and amd - like pathology with wt b6 mice in a much less robust form than balb / c mice, the possibility that light damage largely contributes to pathology is less likely . Indeed, it has been previously shown that b6 (tyr) are not vulnerable to light damage . Therefore, we believe that at least one major reason for the observed kinetic and quantitative differences is the number of inflammatory cells in the outer retinas of balb / c mice . Whether there are significant differences in endogenous cep levels in the retinas of these mice, inherent differences in rpe function and/or local oxidative damage responses in the retina, or the particular contribution of specific adaptive immunity pathways, is an aspect under current investigation in our laboratory . This work also describes in detail the differences in subretinal macrophages between these two widely used mouse strains . While many macrophage - like cells are present in the subretinal space of young nave balb / c mice, we have not been able to successfully identify these cells based on surface marker expression . The true nature of these baseline retinal macrophages in balb / c mice remains unknown . Importantly, we only found subretinal cd11b+/f4/80+/cd68 + macrophages in cep - msa - immunized but not naive mice of either strain . A previous study has shown the presence of these macrophage - like cells in wt b6 mice but only after 20 months of age . Because cep - msa immunization leads to the presence of these macrophages in younger mice, we believe that this is additional confirmation of the validity of our model in accelerating an endogenous aging - related process . Thus, the cep model provides an ideal setting to study different subpopulations of retinal macrophages . The controversial role suggested for macrophages in amd stems primarily from the use of gene knockout mice as well as an acute model for choroidal neovascularization (cnv) that has been widely (and successfully) used to mimic wet amd . For instance, the assertion that macrophages are antiangiogenic comes mostly from studies using laser - induced cnv, which is actually an acute wound healing response, not a chronic pathological state progressing from a previously established disease state, such as human wet amd . A further complication involves the two different forms of amd: macrophages could have different roles in dry versus wet amd . It is important to stress that the laser - induced cnv model is a completely different system from our cep model of dry amd, and findings in one model will not necessarily be directly comparable to the other . The initial evidence linking macrophages with amd came from the analysis of mice deficient in macrophage chemokine signaling components (ccl2 and ccr2 mice) which show retinal defects similar to amd with advanced age (2-year - old mice or older), including spontaneous cnv and drusen formation . (2009) revealed that these findings were in fact an artifact due subretinal macrophage accumulation and that any amd - like pathology in ccl2 mice was most likely due to aging alone . An additional problem with the knockout mice mentioned previously and their use as amd models is the fact that these strains were found to include a known mutation (rd8) that by itself results in retinal degeneration [34, 35]. Therefore most, if not all, the previously published papers using these strains must be reevaluated in that context . However, there is still acceptable evidence associating macrophages with amd . For example, young macrophages inhibit cnv in the laser - induced model of wet amd, but their antiangiogenic potential is reduced with age as they switch to an m2 phenotype . More recently, it has been shown that microglia can induce rpe cells to produce proinflammatory cytokines and chemokines . However, information is lacking to clarify the pathological role of macrophages at different stages of the amd disease process, particularly at the time of onset of dry amd before the transition to cnv . The presence of subretinal cd11b+/f4/80+/cd68 + macrophages in cep - msa immunized mice we show here is similarly reported in a recent paper by a different group . This suggests a strong causal link between the m1 macrophages and outer retinal lesions . In the original publication of our model, it was suggested that macrophages were present as a result of tissue damage and were not likely to cause disease . The rationale for this conclusion was the fact that many lesions occurred in the absence of these cells . However, that original paper did not go into detail on the characterization of these cells . Missing from the first study and addressed in this paper are three key parameters that now lead to the interpretation that there is a causal relationship between m1 macrophages and dry amd - like pathology: (i) kinetics and magnitude (quantification) of macrophage infiltration into the ipm relative to lesion development; (ii) activation status of the observed macrophages; (iii) how are the cells being recruited? This current study provides evidence for the first time that the early involvement of m1 macrophages occurs in animals that are predisposed to develop retinal lesions . We also provide the mechanism for recruitment of these cells, as ccl2 is elevated in retinas of cep - immunized mice, and its receptor, ccr2, is required for macrophage infiltration into the ipm . While we cannot completely rule out at this time that the m1 macrophages present in the ipm of cep immunized mice are actually microglia migrating from the inner retina, it is likely that these cells come from the blood because of the systemic nature of our immunization protocol; retinal microglia are present at their normal inner retina location in rag - deficient mice that do not develop lesions upon cep - msa immunization . Furthermore, this model relies on the endogenous accumulation of cep adducts in the outer retina, which should occur at equivalent rates in immunized versus nave mice, allowing resident microglia an equal access to the cep antigen . A more definitive distinction of the original source of these cells awaits the development of microglia - specific and/or macrophage - specific markers . Regardless, our work confirms the critical role of bone - marrow - derived macrophages in the development of retinal degeneration and provides an excellent platform to further characterize this process . As mentioned previously, we are aware that both ccr2 and ccl2 mice develop amd - like pathology with age, even though the recent work by luhmann et al . [32, 34] has challenged this notion, at least for ccl2 mice . A major difference between these other studies and ours is that our model allows us to focus on the evaluation of relatively young animals following immunization with cep - msa, in contrast to the retinal lesions described previously that develop in the older knockout animals; we analyzed mice before 12 months of age, the nave ccr2 mice develop retinal pathology after 1820 months . Therefore, it would be difficult to make a direct comparison with our study, but it provides the opportunity to explore new mechanisms that link immunity to amd . Ccr2 mice do not lack ocular macrophages, just defective (or delayed) age - related recruitment (to the choroid). 2009, old ccl2 mice (which closely resemble the ccr2 macrophage phenotype) have increased macrophage recruitment to the subretinal space (the same area in which we observe macrophage infiltration in cep - msa mice) when compared to wild type, showing that a defective ccl2/ccr2 axis does not necessarily, by itself, preclude retinal infiltration of macrophages . While there is certainly a possibility that the observed pathology in cep - immunized wt mice may not be due to macrophages, we think the ccr2 data in this paper answers that question: if macrophages did not play a detrimental role in our model (if the retinal lesions in cep - msa mice were macrophage independent) then we should have observed some pathology in the immunized ccr2 mice, which we did not . Because the ccr2 mice still develop cep antibodies similar to wt (indicative of an effective adaptive immune response), the m1 phenotype of subretinal macrophages as well as the temporal relationship between macrophage infiltration and retinal lesions (macrophage recruitment precedes lesion development), we believe that our interpretation that macrophages are detrimental in our model is justified . It is tempting to hypothesize that there could be two different populations of macrophages involved in the amd disease process: one being early harmful m1 and the other being the protective late m2, which in turn may contribute to cnv (once disease has progressed sufficiently). We believe that our data is representative of the role of early m1 macrophages and provides a nice platform to study early events in the development of amd . This does not exclude the idea that later cellular involvement may include m2 macrophages that could be important for resolution of disease, suggested in the published studies looking at aged ccr2/ccl2 knockout mice [29, 32]. In fact, it was recently shown in a retinal neuropathy injury model that il-10-producing (m2) macrophages have a protective role . The balance between m1 and m2 at different ages may actually dictate the damaged versus repaired tissue status of the retina . To support this notion, a recent paper analyzing human amd eyes showed that amd correlated with increased m1/m2 ratios, whereas normal aging eyes had more m2 macrophages . In the context of the retina, cep tilts the balance toward the m1 pathway for its role in inflammation - induced ga . The enhanced presence of proinflammatory macrophages in our model offers new opportunities to investigate their role and function in amd pathogenesis, as well as the immunological signals and inflammatory agents behind their activation and recruitment to the outer retina, a tissue historically thought of as an immunosuppressive environment . We believe that innovative immunotherapies that target the low - grade inflammatory responses at the early stages of our model can yield further promising information on the immune mechanisms that take place in response to oxidative damage in the retina . Current understanding of amd recognizes oxidative stress and chronic retinal inflammation as possible causative factors . Retinal macrophages have been recognized to have a role in amd, but their precise role (whether protective, damaging, or incidental) remains controversial . Using our amd mouse model, we observed significant macrophage retinal infiltration that temporally preceded the onset of overt retinal pathology, suggesting a causative role for macrophages in retinal degeneration . Interestingly, mice with defective macrophage recruitment (ccr2-deficient mice) lack macrophage retinal infiltrates and are devoid of amd - like retinal pathology . This work uncovers an important and detrimental role for macrophages in the development of amd . Such an understanding raises the possibility of exploring immune - modulating therapy for the treatment or prevention of retinal degeneration, especially in patients exhibiting early signs of disease . Balb / c wild - type mice, c57bl/6 wild - type mice, and ccr2 and b6(cg)-tyr / j (b6-albino) mice were obtained from the jackson laboratory . All mice were housed in a room exposed to 300 lux (outside the cage) in a 12 hr dark / light cycle . Protocols for use of experimental animals in this study adhered to the arvo statement for the use of animals in ophthalmic and vision research and were approved by the institutional animal care and use committee of the university of miami miller school of medicine . Cep - msa was prepared from commercially available mouse serum albumin (sigma - aldrich), which was converted to cep - modified msa following previously published procedures . The cep - msa immunization protocol has been described previously . In summary, mice were primed by hind leg injections of 200 g cep - msa in complete freund's adjuvant (cfa; from difco) at 610 weeks of age . At day 10 postimmunization (p.i . ), the mice were challenged in the neck with 100 g cep - msa in incomplete freund's adjuvant (ifa; from difco), followed by a final boost with 100 g cep - msa in cfa in the neck seven days before harvest . Anti - cep antibody titers at days 4060 p.i . Were quantified by elisa as previously described and used to determine efficiency of immunization . All immunized mice were compared with age - matched nave, sham - msa, or cfa controls . There are no significant differences among the control mice (with low to undetectable anti - cep titers) in terms of retinal pathology and are therefore used interchangeably, depending on experimental setup . Eyes were harvested at early (4090 days), intermediate (100200 days), and late (over 200 days) recovery times postimmunization (p.i . ). Right eyes were used for histology and were fixed in 2% paraformaldehyde and 2.5% glutaraldehyde in 0.1 m po4 buffer (ph = 7.4) overnight and dehydrated in graded ethanol and propylene oxide . After polymerization in a resin mixture containing polybed 812 (polysciences) and araldite 502 (polysciences), semithin (0.7 m) sagittal sections of each eye were stained with toluidine blue and analyzed for histopathology with light microscopy using a zeiss microscope (equipped with an axiocam digital camera) using a 63x oil - immersion lens . Each individual mouse in this study was scored for retinal pathology on a masked fashion, using 10 sections of the right eye with at least 2530 m intervals between each section . Scoring was divided in 2 subclasses: (1) the retinal lesion count represents the sum of rpe areas showing abnormal vesiculation, swelling, thinning, pyknosis, and cell lysis; (2) inflammatory cells were defined as dark nuclear stains of macrophage - like cells observed and counted only within the interphotoreceptor matrix compartment at the level of the photoreceptor outer segments and the apical border of the rpe . The data is always presented as pathology (cells or lesions or combined) per section . Our data was analyzed in the biostatistics department at the bascom palmer eye institute with a three factor analysis of variance; the factors are: (1) strain of mice (balb / c versus b6), (2) immunization status (nave versus immunized), and (3) recovery time (early versus intermediate). A total of 35 mice were used in the analysis at each recovery time . Repeat experiments with similar results were analyzed separately because of the use of independent batches of cep - msa . Identification of inflammatory cells in the ipm was done by immunostaining of frozen sagittal sections from the corresponding left eye for each animal . Following enucleation, eyes were embedded in oct compound (sakura finetek usa), frozen on dry ice, and 8 m sections were cut using a cryostat (20c). The sections were fixed with 3% formaldehyde for 25 min then pretreated with a blocking solution containing 0.05% tween 20 and 3% bovine serum albumin in pbs for 1 h at room temperature to saturate nonspecific binding sites . The sections were then incubated 1 h at room temperature with the primary antibody diluted in pbs tween and 1% bsa . The following antibodies were used for surface stains: rat anti - mouse cd11b, f4/80, cd68, and cd45 (all from ebioscience). For intracellular staining, we diluted the primary antibodies in saponin buffer . The following antibodies were used for intracellular stains: rat anti - mouse tnf- (bd bioscience), il-12p70 (endogen), and il-10 (bd bioscience). Sections were then rinsed for 10 min in pbs tween and incubated with 1: 2000 goat anti - rat alexa fluor 594 (invitrogen) for 1 h at room temperature . The sections were washed three times for 10 min in pbs tween and for 10 min in pbs, coverslipped with vectashield with dapi for nuclear counterstaining (vector laboratory) and photographed in a zeiss universal microscope (carl zeiss, oberkochen, germany) equipped for incident - light fluorescence and confocal microscopy . Cfa or cep - msa - immunized mice were euthanized in a co2 chamber, and their eyes were harvested for tissue processing . Eyes were cryoprotected in 1.5% sucrose, embedded in tissue - tek oct compound (sakura finetek, usa), and frozen . Cryostat sections, 12 m thick, were mounted on pen - membrane slides (leica). Single infiltrating macrophages in interphotoreceptor matrix were collected using laser microdissection system lmd6000 (leica). Total rna was extracted using the rneasy mini kit (qiagen) and reversely transcribed with high - capacity cdna archive kit (applied biosystems). Cdna was preamplified with taqman preamp master mix kit followed by pcr amplifications of cdna, using taqman probe - based gene expression assay (applied biosystems). Relative mrna (in arbitrary units) was calculated using the comparative quantitation method of relative quantity (2), with actin as the calibrator for each gene of interest . Primer and probe sets were as follows: actb, mm00607939_s1, il-1, and mm01336189_m1; tnf-, mm00443258_m1; il-6, mm00446190_m1; ccl2, mm00441242_m1; il-10, mm99999062_m1; arg1, mm00475988_m1.