Split (1)

train · 133k rows

text stringlengths 0 868k
Psoriasis is a chronic immunologically - based inflammatory skin disease which affects approximately 2% of the general population [1, 2]. The presence of an unknown antigen causes the generation of effector t cells that infiltrate the skin and initiate a pathogenetic process by producing different types of cytokines . Tumor necrosis factor- (tnf-) is considered the most important cytokine involved in the pathogenesis of psoriasis [3, 4]. Indeed, tnf- plays an important physiological role in host defense, inflammation and cell differentiation, and a pathological role in many conditions such as fever, rheumatoid arthritis and some malignant neoplasms, e.g. B - chronic lymphocytic leukemia (b - cll). B - cll is the most common form of leukemia in the western world, characterized by the slow and progressive accumulation of monoclonal cd5 + b lymphocytes in peripheral blood, bone marrow, lymph nodes and other organs . B - cll is the first example of an indolent cancer characterized by abnormally low apoptosis rather than increased mitosis . Although multiple apoptosis inhibiting factors other than tnf- have been identified in b - cll, several data indicate that tnf- is a central mediator in apoptosis resistance of malignant lymphocytes in b - cll . A 41-year - old white woman, suffering from plaque psoriasis since she was 23 years old, was referred to our outpatient clinic . She was not affected by psoriatic arthropathy and was known to be in good health with no other illnesses, no history of major surgical procedures and was receiving no concomitant medications . She was administered two 8-month cycles of cyclosporine treatment with moderate results in 2005 and 2006 . In 2007, she started phototherapy with ultraviolet b narrowband; she did not experience good results because of a scarce compliance to this kind of treatment . In order to start a new therapy based on biologic drugs, all routine laboratory tests (serum chemistry, hematology, and urinalysis) were performed . The results were normal except for a moderate lymphocytosis (63%, normal range 2045%; 6.32 10/l, normal range 1.23.5 10/l) with a normal white blood cell count . Afterwards, laboratory tests were repeated and moderate lymphocytosis was present again; according to this evidence, a hematologic counseling was required, and the diagnosis of b - cll was made . Since tnf- is reported as a common link between psoriasis and b - cll, two cycles of etanercept were administered (1 cycle = 12 weeks) from january to june 2008 . Lymphocyte levels remained stable (61%; 6.1 10/l), indicating no progression of the leukemia, but after 24 weeks of treatment, the patient did not achieve psoriasis area and severity index (pasi) 50 (a 50% reduction in pasi score). Therefore, in december 2008, she was started on a course of treatment with infliximab (5 mg / kg intravenous). After the 3rd infusion of infliximab, a significant improvement of clinical manifestations was observed (fig . Pasi and body surface area decreased from 12.4 to 5.5 and from 18.8 to 9.0%, respectively . After 18 months of infliximab treatment, lymphocyte levels remained stable and psoriatic manifestations were under control . Here, we have described the case of a patient suffering from plaque psoriasis and b - cll . The patient had suffered from psoriasis for 18 years and, like many other subjects with moderate - to - severe psoriasis, had received a series of different treatments (topical and systemic) in an attempt to control symptoms . Laboratory tests showed a moderate lymphocytosis so that a hematologic counseling was required and a diagnosis of b - cll was made . A t - helper 1 cytokine - mediated pathway is involved in these disorders in which tnf- plays a central role . Tnf- involvement in psoriasis has been well validated by the clinical success of anti - tnf- therapy . On the other hand, tnf- is constitutively produced by b - cll cells, and it may act as an autocrine factor for their growth and survival . Moreover, in b - cll patients, tnf- serum levels and soluble tnf- receptor (stnfr) levels are increased, and a correlation with disease progression has been demonstrated, associated with an adverse prognosis; it has been hypothesized that high levels of tnf- and stnfr can predict outcome in lymphoma patients . Confirmed the relationship between tnf- plasma levels and the severity of b - cll, suggesting that they should be monitored together with other disease markers . The first drug chosen was etanercept, a dimeric fusion protein consisting of the extracellular ligand - binding portions of two soluble tnf- receptors fused to a fc fragment of an immunoglobulin g1 molecule . Two cycles of etanercept were administered (50 mg twice a week for 12 weeks followed by 50 mg every week until 24 weeks) with poor effects on psoriatic disease and no b - cll progression . Therefore, the patient was started on a course of treatment with infliximab (5 mg / kg intravenous). Infliximab is a chimeric murine / human immunoglobulin g1 monoclonal antibody that binds specifically to human tnf-. In our case, psoriatic lesions improved and b - cll showed a lack of progression during infliximab therapy . During 3 years of anti - tnf- therapy, the patient did not show significant modifications of lymphocyte levels . On the basis of this evidence, tnf- could represent a therapeutic target in patients affected by both psoriasis and b - cll; specific inhibition of tnf-, either with dimeric fusion protein etanercept or the monoclonal antibody infliximab, could potentially result in the control of proliferation of the leukemic clone . We report this case to highlight the possibility to administer anti tnf- treatment in psoriatic patients affected by concomitant b - cll.
Congenital causes of intestinal obstruction include duodenal atresia, malrotation, duodenal obstruction from ladd bands, other congenital bands, superior mesentery artery syndrome, enteric duplications as well as several other entities . Congenital anomalous bands resulting in proximal jejunal obstruction are a rare entity that should be considered in the differential in patients with clinical signs of obstruction and no prior history of abdominal surgery . We present a case of an 8 year - old girl with a nine - month history of intermittent vomiting and no history of prior surgery and review the embryology and radiologic findings of this entity using different imaging modalities . An 8 year - old girl with a past medical history of constipation presented with a history of vomiting for nine months . The vomiting was intermittent, non - bloody, at times bilious, and occasionally contained food particles . An abdominal ultrasound was performed which demonstrated debris within a dilated proximal duodenum . The superior mesenteric artery (sma) and superior mesenteric vein (smv) were visualized with the sma lying to the left of the smv with normal anatomic alignment [figure 1]. (a) ultrasound of mid abdomen shows superior mesentery vein (arrow) and superior mesentery artery to the left (b) the doppler flow study confirms arterial flow in the superior mesentery artery (arrowhead) and the venous flow in the uncompressed superior mesenteric vein (arrow). A standard barium single contrast upper gastrointestinal (ugi) series was performed with the contrast entering the antrum and duodenal bulb . The proximal duodenum and descending duodenum were markedly dilated in caliber with apparent tapering of the third part of the duodenum . There was an abrupt cutoff with no contrast extending beyond approximately the mid abdomen [figure 2]. Delayed images were obtained while the patient was supine with contrast never extending beyond the third portion of the duodenum [figure 3]. Single contrast upper gastrointestinal series shows on a single view plain radiograph the contrast abruptly cutting off approximately at the mid abdomen (arrow). Single contrast upper gastrointestinal series shows on delayed images with patient laying supine, contrast never extending beyond third portion of duodenum with persistent cutoff (arrow). Contrast is seen in antrum of stomach (star), proximal duodenum, and descending duodenum . Patient was subsequently placed prone for several minutes with eventual slight transit of contrast [figure 4]. Thirty minute delayed prone images demonstrated contrast in the proximal small bowel, however proximal duodenum remained markedly dilated and contrast / debris filled [figure 5]. Additionally delayed overhead images demonstrated contrast extending to the distal small bowel after patient had been upright for greater than 30 minutes [figure 6]. Markedly dilated proximal duodenum with abrupt cutoff in the third portion of the duodenum raised concern for a questionable mass like positionally dependent extrinsic compression of the third portion of the duodenum . Delayed prone images demonstrated contrast in the proximal small bowel with persistent dilatation of the proximal duodenum . Additional delayed image following several minutes of prone position demonstrates a small amount of contrast progressing to the jejunum (arrow). Delayed abdominal radiograph following the upper gastrointestinal series after patient had been upright for greater than 30mins demonstrates further progression of contrast into the jejunum and ileum (star). Distal most extent of contrast near the cecum (arrow). A subsequent computed tomography (ct) of the abdomen and pelvis the duodenum was distended with the third part of the duodenum tented downward [figure 7]. The duodenal / jejunal junction was severely narrowed and coursed distally anterior to the right common femoral artery below the bifurcation [figure 7]. Computed tomography (ct) of the abdomen and pelvis shows dilated fluid filled duodenum (asterisk, a). Duodenum tented medially (black arrow, b) and downward (white arrow, c, black arrow, e). Duodenum severely narrowed as it crosses anterior to right femoral vein below the bifurcation (white arrow, d). The patient was taken for an exploratory laparotomy and found to have dense vascularized bands without intestinal malrotation . Upon entering the abdomen, . Further exploration in the abdomen revealed the proximal jejunum tethered by dense vascularized bands running from approximately five inches distal to the ligament of treitz down into the pelvis . The cecum was incidentally noted to be folded back on itself and adherent to this tented portion of the jejunum . After these adhesions were ligated, the bowel was examined and no other anatomical abnormalities were discovered . The patient experienced a normal post - operative course with subsequent complete resolution of symptoms . The congenital causes of intestinal obstruction in infants and children are intestinal atresia and stenosis, congenital bands, remnants of embryologic structures such as vitelline arteries or veins, omphalomesenteric ducts or a mesourachus . In addition intestinal obstructions caused by other anomalous congenital bands have only been described sporadically in the literature and are otherwise rare. [57] an example of anomalous congenital bands is ladd bands . They arise from the cecum and extend to the sub - hepatic region, posterior peritoneum or abdominal wall . Ladd bands result in compression of the 2 or 3 duodenal portions, which lead to intestinal obstruction . However, the location of these bands is different from embryonic remnants such as vitelline vessels or omphalomesenteric ducts . Akgur et al ., cited a few series of cases to suggest that these bands are the result of a mesenteric developmental anomaly . Mesenteric anomalies have not been well documented aside from cases of malrotation and anomalous intestinal fixation . In our patient, upper gastrointestinal (ugi) barium examination showed a dilated duodenum near the ligament of treitz with sharp obstruction . Most duodenal obstructions by external compression are caused by abnormal duodenal rotation with internal herniation or ladd bands . In our patient our case is particularly rare as abnormal dense vascularized bands were seen distal to the ligament of treitz, which is not characteristic of ladd bands . This resulted in dilatation of the proximal jejunum which was not readily identified on the ugi barium examination . Though imaging demonstrated a high grade obstruction, the patient's symptoms were chronic and mild . Furthermore prone positioning partially alleviated the degree of obstruction presumably by altering the position of the anomalous bands and relieving the obstruction . Finding an anomalous band tethering the proximal jejunum to the pelvis and adhering the jejunum and cecum is unique and unlike previously described congenital peritoneal bands . As no previous operation had been performed on this patient and operative findings did not show any other abnormal post inflammatory adhesions between the small and large intestines, the etiology of these bands was determined to be congenital ., discovered a band running from the antimesenteric wall of the proximal jejunum just distal to the treitz's ligament to the root of the mesentery . The anomalous congenital band in that case was considered to be the remnant of ventral mesentery that failed to resorb completely . In both our case and the case described by liu et al . External compression of the proximal jejunum by an anomalous band should be included in the differential diagnosis of obstruction of the distal duodenum or duodeno - jejunal junction for patients without previous history of surgery, especially when ugi barium examination shows normal duodenal rotation and duodeno - jejunal fixation.
In generalized ligamentous laxity, the range of motion across various joints in an individual is increased compared to the mean range of motion in the general population (1). Although this could occur as a result of genetic disorders affecting the connective tissue, in most individuals there is no genetic aberrancy and it exists in isolation (2). The prevalence of generalized ligamentous laxity varies among different races from 5% to 57% of the general population (3). It is well known that generalized ligamentous laxity is implicated in various musculoskeletal injuries, especially in the lower extremities, such as cruciate ligament injuries, patellar instability, and ankle injuries (4, 5). Although generalized ligamentous laxity is a predisposing factor for shoulder instability (6), to the best of the authors knowledge no study has investigated the role of generalized ligamentous laxity in acute and chronic shoulder injuries in athletes . This study aimed to determine whether generalized ligamentous laxity can be a predisposing factor for acute and chronic shoulder injuries in athletes . This cross - sectional study was conducted from april to october 2015 . To obtain a representative sample of athletes with shoulder injuries, we sought all athletes who had sustained shoulder injuries in hamadan province in iran over the previous three years according to the documents of the local branch of the iranian federation of sports medicine in hamadan province . All the relevant data were recorded, including demographic information, type of sport, duration of sporting activity, and the beighton score for generalized ligamentous laxity (table 1). Our inclusion criteria were being 17 - 37 years old and having a history of sports activity for at least six months (if there was a shoulder injury, then the requirement was at least six months of sports activity before the injury). The exclusion criteria were having any deformity or disorder that interfered with the beighton score assessment and a lack of documents proving at least six months of regular sports activity . Several athletes were excluded, mainly because of a lack of documentation proving sports participation . Using a sampling formula for cross - sectional studies where = 0.05, d = 0.065, and p (ligament laxity prevalence according to other studies) = 0.15, all the volunteers signed a consent form to confirm their participation in the study, and the study was approved by the ethics committee of hamadan university of medical sciences (no . : ir.umsha.rec.1395.101) we considered generalized ligamentous laxity as point 4 or more of the beighton score and divided all the participants into two groups: the participants in group a had ligamentous laxity (with ligamentous laxity) and those in group b did not (without ligamentous laxity). Any acute or chronic shoulder injuries and functional issues among the participants were also assessed according to the standard farsi (contemporary persian) translation of the quickdash measure . A total of 118 volunteer athletes participated in our study, which included 32 athletes with shoulder injuries and 86 athletes without shoulder injuries . They were divided into two groups according to the beighton score: group a (with ligamentous laxity) consisted of 43 participants and group b (without ligamentous laxity) consisted of 75 participants . We then compared the following factors between the two groups: acute shoulder injury, chronic shoulder injury, shoulder instability, chronic shoulder pain, and dash scores (table 2). A statistical analysis was carried out using the statistical package for social sciences (spss) version 20 software (spss inc ., chicago, il). The chi - squared test was used to analyze the effect of the generalized ligamentous laxity on the nominal scale values, namely chronic shoulder pain, and chronic and acute shoulder injuries . Spearman s test was used to analyze the generalized ligamentous laxity effect on the last value, successful return to sports activities, for which the dash score was ordinal . First, we evaluated the relationship between ligamentous laxity and chronic shoulder pain (table 3). Sixteen participants (37.2%) in group a and 13 participants (17.3%) in group b suffered from chronic shoulder pain (p = 0.016). We then evaluated the number of chronic shoulder injuries in both groups (table 4). Thirteen participants in group a (30.2%) and 11 participants in group b (14.6%) had chronic shoulder injuries, which was statistically significant (p = 0.032). With respect to acute shoulder injuries, 11 participants in group a (25.5%) and 19 participants in group b (25.3%) had chronic shoulder injuries (table 5). We then assessed upper limb function using the quickdash measure (table 6) and found that there was a significant difference between the functional status of the two groups (p = 0.030). Finally, we compared the history of acute and chronic instability between the two groups based on dislocation documentation or a history of shoulder pain with at least two positive clinical tests for instability (table 7). Eleven participants in group a (25.5%) and five participants in group b (6.6%) had instability, which was significant (p = 0.004). The shoulder joint gets injured frequently in sports like volleyball, handball, swimming, basketball, and overhead sports, and an abnormal increase or decrease in range of motion is an important factor in sports injuries involving the shoulder (7). Generalized ligamentous laxity refers to an increased range of joint motion compared to that of the general population . Its prevalence is 5% - 15% but varies among different race groups, with an incidence as high as 57.3% among africans (1, 6). Although there is no standard for defining ligamentous laxity, there are several clinical scoring systems for measuring joint laxity in individuals and populations . The beighton score is considered an excellent method for screening generalized ligamentous laxity (8, 9). Bin abd razak et al . Evaluated generalized ligamentous laxity in the musculoskeletal injuries of 100 young patients in a primary care center for comparison with a healthy control group (1). They found that the individuals who had musculoskeletal injuries were 3.35 times more likely to have generalized ligamentous laxity compared to healthy people . Several studies have demonstrated the relationship between generalized ligamentous laxity and sports injuries in the lower extremities, including cruciate ligament injuries (4) and patellar dislocation (5). Found a significantly increased risk of knee joint injury among hypermobile participants who played contact sports (10). Notwithstanding, little evidence exists regarding the relationship between generalized ligamentous laxity and shoulder injuries . Studied generalized ligamentous laxity and increased external rotation of the shoulder as a predisposing factor for primary shoulder dislocation in young, healthy individuals . They found that men with shoulder dislocation were 6.8 times more likely to have generalized ligamentous laxity (6). To the best of our knowledge, no study has investigated a range of shoulder injuries in athletes with or without ligamentous laxity . Hence, we evaluated the relationship between generalized ligamentous laxity and various shoulder injuries in athletes who had participated in sports activities for at least six months . The athletes with generalized ligamentous laxity had more chronic shoulder pain, chronic shoulder injuries, shoulder instability (acute and chronic), and less functionality according to their dash scores compared to the athletes without generalized ligamentous laxity . Interestingly, there was no difference in the number of acute shoulder injuries between the two groups . This was because we considered fractures around the shoulder to be acute injuries in the study . If we had omitted fractures in both groups, the difference in acute injuries would have been significant . The strength of our study was the evaluation of all the volunteer professional athletes in our province who had participated in at least six months of regular sports activity, including professional athletes with shoulder injuries . Since the treatment of injured athletes is the responsibility of the federation of sports medicine in iran, this federation had a complete list of all the injured athletes in the province . The limitation of our study was that we only evaluated athletes in one province of iran . Although hamadan province is ethnically diverse and includes most iranian ethnic groups (azeri, kurd, lur, and fars), and parallel research results will thus be quite compatible with the current research findings, it is suggested that the same study be conducted in different provinces of iran with a greater number of athletes . A sports injury can be influenced by the athlete s level of professionalism . Although we excluded athletes who had participated in professional sports activities for less than six months, it is not clear if their knowledge and ability to prevent sports injuries would be the same as those with more experience . This study highlights the importance of having screening programs in athletic clinics, sports clubs, and sports offices at high schools and universities to identify individuals with generalized ligamentous laxity, and emphasizes the need for physicians and surgeons to practice prophylactic measures . There may be a role for shoulder - specific proprioceptive and strength training protocols for shoulder injuries in individuals with generalized ligamentous laxity who participate in high - risk sports, especially contact sports.
Data types and tools evolve, predictive approaches developed for such work can also be directed at a number of closely connected issues . Some of these include taking advantage in motif discovery of increasing numbers of genomes, including low - coverage sequences; quantifying the contributions to motif discovery of different genomes or sets of genomes; improving the predictive reliability of motifs by genome - scale clustering and co - occurrence; determining a best minimal set of motif discovery methods, probably in a discovery approach that uses multiple methods (6); and using coexpression and other functional data types . In this report, we describe a new cisred database that contains predictions for whole - genome discovery of regulatory elements in mammals and other eukaryotes . We also describe the predictive system behind the database, which uses genome - scale approaches to predict deeply conserved ab initio motifs and identifies groups of similar motifs and co - occurring patterns of motifs . The system is designed to be readily maintained and extended in the context of rapidly evolving resources, data types and tools . The upstream section of the pipeline loads the database with significant discovered atomic motifs, and the section downstream of the database identifies groups of similar atomic motifs and co - occurring patterns of motifs . An atomic motif consists of a set of sequences, typically with a common length between 6 and 12 bp, members of which are present in a sequence region on the target species and in corresponding regions on other genomes . The system uses genome resources that are a combination of directly downloaded and processed sequences, annotations and relationships (e.g. Orthology, coexpression and interactions). These are stored in an automatically updated local resource that holds a wide range of public and commercial databases . Motif discovery was carried out in a search region based on a single major transcript for each gene . An input target sequence set consisted of a sequence from the target species, and corresponding sequences from homologous vertebrate genes . The following rules were used to assemble target sequence sets for cisred 1.2e . We identified homologous genes by combining data from compara (7), homologene (8), inparanoid (9) and kegg (10). For each target human gene and each of its orthologues, we took the major ensembl (7) transcript if its protein sequence was n - terminal complete . We further required that the human gene had an annotated ensembl 5-untranslated region (5-utr) that was at least 10 bp long . For each target gene's orthologue set, we required at least one of dog, mouse and rat, and at least one of chicken, frog, fugu, tetraodon and zebrafish . If the human 5-utr was <500 bp, we applied no utr requirements to orthologues; however, if the human 5-utr was> 500 bp, we required that all orthologues had annotated ensembl 5-utrs that were at least 10 bp long . After this filtering, for any orthologous region that was missing from an input sequence set, we added a sequence region from the current ucsc (11,12) multiple sequence alignment . For a small subset of the target genes, corresponding regions from encode - specific species were then added from the current encode multiple sequence alignment (13). Finally, regions were added from an internally processed version of the unannotated macaca mullata genome from . These rules delivered 7500 human target genes with sequence sets that contained a minimum of three and an average of six orthologous sequences from other genomes . Sequence regions extended 1.5 kb upstream and 100 bp downstream of transcription start sites (tss), net of all types of repeats except ltr / erv1, ltr / ervl, ltr / malr and of coding sequences, which were masked . In addition to a target sequence set, we supplied each discovery program with a genomic background input file . The background input for each species consisted of 1000 concatenated search regions that were randomly selected from the genome's entire set of search regions . We used multiple discovery methods in parallel, running each method with a range of parameter settings; typically target motif width and motif occurrence model were varied . We used a compact but diverse base set of discovery methods that consisted of consensus (14), meme (15) and motifsampler (16). Raw discovered motifs were post - processed, for example, to remove identical motifs reported by the same algorithm, and to merge strongly overlapped motifs . We assigned p - values to motifs discovered by multiple methods across large sets of target genes whose sequence sets varied in species composition, as follows . First, we identified a representative subset of target sequence sets that sampled the range of species compositions of the target sets . Then, for each representative target sequence set, we created random sequence sets by retaining the original sequence from the target species and replacing each orthologous sequence with a synthetic sequence . The random synthetic sequence was generated from the target sequence by a tool we developed to simulate neutral evolution using published substitution rates and indel rates and lengths . We then submitted each target sequence set and all random sequence sets to identical motif discovery and post - processing procedures . We assigned method - independent (mi) scores to all motifs discovered in target and random sequence sets, using a trainable function that contained four non - negative parameters: score()=(1+1d)(1+2cremote)(1+4w)(1+3(1cclose))b, where coefficients took the following possible values: d, w r, b {0, 1} and c [0, 1]. In the above equation, d characterized the number of site sequences in a motif; w and b characterized the shape of a motif's information content profile; and c characterized motif sequence conservation . The score increased when the motif was conserved for species that are evolutionarily remote from the target, and decreased when the motif was not conserved for species that are close to the target (primates, in the case of human). We used the distribution of mi scores for motifs from a target gene's random sequences to transform the mi scores for the target gene's motifs into p - values . Finally, we loaded the database with motifs whose p - values were below a threshold (which, for cisred 1.2e, was 0.05). A library of known transcription factor binding sites, split into mutually exclusive training and testing fractions, was used to optimize the scoring function and to characterize the performance of the system . The library contained 1000 sites for 300 human genes from transfac v9.1 (17), and 250 binding sites that we curated from the literature . We optimized the scoring function by simulated annealing, using a training fraction of known sites from randomly selected genes and two objective functions: the area under a receiver operating characteristic (roc) curve and the number of experimentally known motifs that were not predicted . We assessed the system's predictive performance with a test fraction of known sites, using observables like sensitivity, specificity and positive predictive value (ppv) (e.g.). Although comparisons of method performance are constrained by many factors, current system performance compared favourably to results in a recent study (6). To identify groups of similar motifs, we defined two pairwise motif similarity metrics . For the first metric, we used a version of the levenstein edit distance between two sequences that was modified to permit no internal gaps (18). For each motif, m, and its reverse complement, rc(m), we scanned motif pairs relative to each other, and reported the overall minimum average mutual edit distance to motif k, i.e. Min(d(m, k), d(rc(m),k)). The second metric was based on the maximum information content shared between position frequency matrices derived for each motif, and also treated a motif and its reverse complement as equivalent . We hierarchically clustered pairwise dissimilarity matrices with the local density - based optics algorithm (19). We extracted clusters from optics' reachability output by applying an automatic cluster recognition method that identifies cluster boundaries as inflection points in the reachability plot (20), then traversing these hierarchical segmentation results with an algorithm that traced a deepest available path, constrained by a maximum preset depth . The large size of mammalian genomes makes it challenging to organize the computational hardware and software infrastructure required to address such issues routinely . We did the large - scale discovery, similarity and co - occurrence calculations on a beowulf - style, 400 cpu (pentium iii, xeon, opteron) oscar cluster () running red hat linux 9; and remotely on the beowulf 1700 cpu glacier cluster at westgrid (). We clustered motifs on a 12 dual - core cpu (ultrasparc iv) smp server with 96 gb of ram running solaris 9 . The database infrastructure is designed to evolve to hold results from a range of mammals, as well as results from model organisms . Because promoter regions are enriched sources of regulatory elements, motif discovery and the cisred design were both based on regions around tsss . Cisred human v1.2 contains motifs from promoter regions of 7500 human genes using ensembl v30 (ncbi 35) data, as well as a pilot result set of 250 mouse genes . The current database design makes three types or levels of information available for regulatory elements: (i) atomic motifs, which are discovered independently in each target region sequence set; (ii) groups of similar motifs, each of which is a putative model for the binding site of a single transcription factor; and (iii) co - occurring patterns of models, which are putative regulatory modules . Predicted regulatory elements can be viewed directly in cisred's web user interface . From this interface, motifs can be viewed in the ucsc genome browser, in the ensembl genome browser via a das server, or in the sockeye comparative genomics workspace (21). A user can filter the displayed motifs by criteria like the p - value threshold, the orthologous species present in a motif and the discovery method . The database contains a table of high - confidence globally coexpressed genes (22); genes coexpressed with each cisred target gene are listed on that gene's page . The database also contains a table of single nucleotide polymorphisms (snps) from dbsnp (8) that occur in predicted motifs . When a predicted human motif contains a snp, the cisred atomic motif page highlights this variation on the target sequence of a motif site sequence set, and the highlighted base hyperlinks to the snp's primary source information in dbsnp . A current schema diagram is available from the databases & methods page, and direct sql queries can be run on the mysql databases at . A user can download the data, with sql files, as well as a compressed file that contains all input fasta sequence sets . Because older versions of the database may not be compatible with the current user interface, only recent versions for each species can be accessed through the web or via a mysql client . However, historical releases of cisred databases are archived and can be downloaded . Certain parts of the system's software are available from a tab on the cisred home page . Sockeye (21) permits, for example, a user to assess details of conserved regions relative to genomic annotations in multiple sequence alignments . The hitplotter visualizer displays large sets of discovered motifs from multiple - method discovery runs, and is available on request as a beta release . Database contents will be extended to include large - scale results for human, mouse, rat, caenorhabditis elegans and drosophila melanogaster . The input sequence sets for this database were based on human tsss that were identified by considering ensembl (7) and refseq (23) annotations . To address the limitations of gene and transcript annotations for non - human species, corresponding vertebrate search regions were taken from ucsc (11,12) and encode multiple sequence alignments (13). We are extending our ability to take advantage of unannotated and low - coverage genome sequence data . We are continuing to improve motif post - processing and scoring . Optimizing the scoring function depends on having a large library of known motif sites; we anticipate that a newly created web database for submitting and curating binding sites from the literature may help us to enlarge and improve this resource (; s. b. montgomery and o. l. griffith, manuscript in preparation). Given a scalable clustering method, we continue to assess motif similarity metrics and how best to use the hierarchical information output from optics . Given groups of similar motifs, we are applying group labels to atomic motifs, then identifying overrepresented co - occurring motif patterns using hypergeometric statistics, imposing separation constraints on neighbouring motifs, and searching in two stages for patterns larger than pairs (24,25). We are implementing methods for annotating discovered motifs as known or novel against known site resources . Given annotated motifs, we will annotate overrepresented co - occurring patterns of human motif pairs as known versus novel using the transcompel resource (26). We are applying genome - scale motif clustering and co - occurrence as filters for predicted motifs that may improve the predictive reliability and the resulting catalogue of conserved regulatory elements . We have assembled a large multi - species coexpression resource that contains public microarray and sage data from diverse sources (22) (table 1). We have shown that combining global coexpression data from multiple platforms improves confidence in coexpression predictions when assessed against the gene ontology (go) (27). From this, we established go - based pearson correlation thresholds that identified high - confidence globally coexpressed gene pairs . The coexpression database makes results available from this global analysis and from two other recent analyses (28,29). Although coexpressed genes can have similar regulatory elements, the system's predictive performance improved only marginally when inputs included coexpressed genes in addition to orthologous genes (data not shown). Given these results, currently we are assessing an approach that includes no coexpressed genes in motif discovery inputs, but uses coexpression information to assess groups and co - occurring patterns identified in genome - scale sets of atomic motifs . We will extend the database user interface to offer more complex user filtering, as well as motif searches based on consensus strings or matrices . For work with classes of regulatory elements that are defined by wet lab data types based on, for example, chip or dnase i hypersensitivity (e.g. See encode tracks within the ucsc genome browser) (11,13), we have designed a new schema that is based on search regions rather than on genes, and will extend the user interface to support this . We will continue to assess the contributions to regulatory element predictions of different genomes and sets of genomes . We will integrate and assess new motif discovery methods, and will identify a best minimal set of methods on an ongoing basis . Data processing system for high - throughput motif discovery, clustering, co - occurrence, annotation and performance assessment . Database contents and high - level links, from a web user perspective, as of cisred human v1.2 . Groups are clusters of similar motifs that are identified by large - scale optics (19) clustering.
G. v. black was the first to describe a systematic method of cavity preparation and the ideal cavity form to restore carious lesions . Classical cavity forms and principles remained appropriate and largely unchallenged for a period of 50 years using amalgam . Amalgam has been the most widely used dental restorative material for the restoration of posterior teeth due to straightforward handling procedures, well tested material properties, and clinical success which has been documented for over a century despite esthetic shortcomings . Low material price and rapid application however, amalgam cavities require precise procedures, usually resulting in uniform depths, particular wall forms, and specific marginal configurations with excessive tooth damage to ensure retention of amalgam . Thus, patient demand for tooth colored restorations, public concerns related to mercury in dental amalgams, and the desire for a minimally invasive restorations, have made posterior composites an indispensable part of the restorative process instead of amalgam . The increased conservation of healthy dental structure with resin based composite restorations compared to the amalgam ones is the greatest advantage of the former . Many clinicians have used this class of materials quite successfully during the last 5 to 10 years in posterior stress bearing areas.1 however, the inherited problems faced using resin based composites were inadequate wear resistance, marginal leakage, secondary caries and lack of appropriate contact.2 as manufacturers continue to search for tooth - colored resin - based composite materials that will have good physical properties, the introduction of new materials has taken dentistry a step closer to the goal . Recently, a new posterior composite material, quixfil, was introduced into the dental market . The bimodal filler technology of quixfil shows particle distribution with two distinct peaks at 0.8 and 10 m and polymerization shrinkage is stated 1.7 vol.% by the manufacturer . A longitudinal randomized clinical assessment of stress bearing class i and ii restorations showed that quixfil exhibited good clinical results for 3 years.3 nanotechnology may offer unique solutions to improve the performance or handling characteristics of restorative dental materials . Resin composite systems made by the use of nanotechnology can offer high translucency, high polish and polish retention similar to that of microfilled composites while maintaining physical properties and wear equivalent to several hybrid composites.4 grandio was used as one of the first resin composites with incorporated nanofillers beside conventional hybrid type fillers, being called nanohybrid composites . Kramer et al5 investigated clinical performance and margin analysis of grandio in class ii cavities and stated that they were satisfactory after four years . As a large number of new improved resin brands are being released to the market, it is important for dentists to be aware of the probable longevity and likely modes of failure in posterior composite restorations . This information is best obtained from randomized controlled trials conducted clinically and in the laboratory for a definitive assessment of dental materials.6 hence, the purpose of this study was to evaluate 12 month clinical performance of a nanohybrid and a low - shrinkage posterior resin composite in class i and class ii restorations . Thirty - one patients (10 male and 21 female) participated and provided written informed consent to participate in the study . Detailed exclusion and inclusion criteria were as follows: inclusion criteria were: (1) permanent premolars and molars requiring class i and ii for treating primary carious lesions,(2) with at least one neighbouring tooth and in occlusion to antagonistic teeth, (3) good oral hygiene . Exclusion criteria were: (1) patients with fewer than 20 teeth, (2) poor hygiene, (3) heavy bruxism habits, (4) periodontal problems and known allergic reactions against any components of the used materials, (5) pathologic pulpal diagnosis with pain (nonvital), (6) fractured or visibly cracked teeth, (7) defective restorations adjacent or opposing to the tooth, (8) rampant caries, (9) atypical extrinsic staining of teeth or staining of any existing tooth colored restorations . A total of 82 teeth (41 pairs) were restored with either a nanohybrid resin composite grandio (voco gmbh, germany) and its self - etch adhesive futurabond nr (voco, germany) or a low - shrinkage posterior composite quixfil (denstply, germany) and its self etch adhesive xenoiii (dentsply, germany) (table 1). The distribution of materials and tooth locations were randomized by tossing a coin (table 2). However, interference in the randomization procedure within patients was performed in order to equally distribute materials into some important variables such as tooth type and position, restoration class type in such a way that minimized the influence of those factors . The teeth were prepared using conventional instruments and adhesive conservative techniques, appropriate local anesthesia have been achieved preoperatively unless declined by the patient . The average facio - lingual width of the cavities was approximately one third of the intercuspal width . Calcium hydroxide (dycal, dentsply caulk, germany) was placed where indicated for deep cavities . The location of the cervical margins was not recorded . For class ii restorations, the dentists used metal matrix bands (toefflemire, teledyne waterpik technologies, usa) and wooden wedges . Placement of resin composites followed the incremental technique (2 mm - thick layers). The resin composite was adapted with a flat faced or elliptical condenser and light cured using a halogen light of 500 mw / mm intensity (hi - lux ultra, benlioglu, turkey). The light output of the curing unit was monitored with a light meter (curing radiometer model 100; demetron corp, usa) a post occlusal adjustment was performed with carbon paper and the quality of interproximal contacts and cervical adaptation was checked by means of dental floss and interproximal radiographs . The restorations were finished under water - cooling with fine and super fine diamond points (kg finishing kit, karensen ltd, brasil) and rubber polishing kits (eveflex polisher, eve ernst vetter gmbh, germany). All restorations were clinically evaluated after 1 week (baseline), 6 months and 12 months by 2 investigators using the modified usphs criteria as first described by cvar and ryge7 and adapted by wilson et al8 for retention, color matching, marginal discoloration, marginal adaptation, secondary caries, surface texture, anatomic form and postoperative sensitivity (table 3). The examiners were not involved in the placement of the fillings and were unaware of the materials used in this double - blind study . When disagreement arose during evaluation, the examiners had to reach a consensus . All evaluations were carried out under a dental operating light, using flat surfaced mouth mirrors and dental explorers . Restorations were scored as follows: alpha represented the ideal clinical situation; bravo was clinically acceptable; charlie was clinically unacceptable situations where the restoration had to be replaced . For secondary caries detection bitewing radiographs statistical analysis was performed using pearson chi - square and fisher s exact test for assessing the difference between the restorative materials (p<.05). Cochran s q test was also employed for evaluating the difference between examination recalls of the same restorative material . At the end of 12 months, all restorations (grandio or quixfil) were present and a total of 82 restorations were available for clinical evaluation in 31 patients (recall rate 100%). None of the restorations had shown any marginal discoloration and anatomic form loss until the end of the 12 months and no restorations exhibited post - operative sensitivity at any evaluation period . Summary of clinical findings of ryge criteria with respect to color match, marginal adaptation, secondary caries and surface texture is shown in table 4 . Mainly, the difference between the restorative materials (grandio and quixfil) at the end of 12 months was not statistically significant and demonstrating acceptable clinical performance . At the 6-month recall all the restorations received alpha score with respect to each evaluation criteria . Nevertheless, there were some statistically different issues regarding evaluation criteria of each material itself between the examination recalls . The percentages of alpha scores for color match were 95% (n=39) for grandio restorations and 100% (n=41) for quixfil restorations . Two grandio restorations (5%) received bravo score (p=0.135) at 12-month recall . Four grandio restorations (10%) received bravo ratings while 37 restorations (90%) received alpha ratings for marginal adaptation . This difference was found to be statistically significant (p=0.018) between baseline and 12 month recalls . Quixfil restorations marginal adaptation score was alpha for 40 restorations (98%) and bravo for 1 restoration (2%) at the end of 12 months (p=0.368). The evaluation of secondary caries results revealed that 39 restorations (95%) received alpha scores among quixfil restorations where 2 restorations (5%) received charlie ratings (p=0.135). The alpha and bravo scores of grandio restorations for surface texture were 40 (98%) and 1 (2%), respectively (p=0.368). All the quixfil restorations received alpha scores in terms of surface texture at 12 months . However, these developments have been so rapid that long - term clinical data on specific products are rarely available because of regular introduction of improved versions . Laboratory tests might provide useful information to the potential performance of a filling material and its handling, but such tests cannot adequately evaluate the clinical performance of a material or clinical handling characteristics . Besides, in vitro studies cannot answer questions about in vivo longevity of these tooth colored restorations.9 long term results with some of these newly developed materials are lacking and remain controversial as studies report inconsistent clinical results.10,11 while usphs system has served well for clinical evaluation, there are some concerns about the sensitivity of the approach in short term clinical evaluations . The lack of sensitivity of the ryge system to record small early changes, combined with the continually evolving clinical designs and non standard investigator modifications of the categories, scales, and reporting methods, has created a body of literature that is extremely difficult to meaningfully interpret . In many cases, the relative insensitivity of the ryge methods during short and medium term clinical trials (<3 - 5 years) may be misinterpreted.12 however, this system is still being used in the clinical researches to compare these finding with the previous ones that utilize the same system . The first 6 up to 24 months appear as the critical period for the development of deteriorations.13 mair14 evaluated posterior composite restorations over a 10-year period . Inevitably, this study can be criticized that the duration of the study is insufficient to confirm long - term suitability of the tested materials; nevertheless these findings provide an indication of their initial clinical performance . In the present study, the bonding of the two restorative materials was sufficient to provide adequate retention over 12 months and none of the restoration was lost . The findings of this study were similar to the results of other clinical studies examining the resin restorations for the same evaluation period.15,16 however, 2 quixfil restorations failed after twelve months due to secondary caries and these restorations were replaced . Many studies17,18 have indicated that up to 30% of the study populations have reported post - operative sensitivity following the placement of a posterior resin restoration . Self - etch primers make the smear layer part of the hybrid layer, as it dissolves the smear layer, incorporating it into the mixture of collagen fibers and resin monomers . Since the smear layer becomes an integral part of the hybrid layer, low sensitivity response may be the outcome, which was also seen in the present study.19 in regard to the clinical performance of self - etch systems, the literature contains contradictory findings, as the bonding effectiveness of these adhesives seems to be material dependent.20,21 a great variety of self - etch systems are available on the market . They differ in the number of bottles, steps, and acidity of the primer solution, among other factors . A closer analysis of the aforementioned clinical trials20,21 reveals that the self etching adhesive with good clinical performance did not belong to the group of strong self etching adhesives, but to the group of mild self etching adhesives . Futurabond nr s and xeno iii s ph are both 1.4 belonging to the same group . The loss of marginal adaptation and the presence of secondary caries are predictors of the failure of posterior resin based composites and the reason for the replacement of the restoration.17 this study revealed that two quixfil restorations demonstrated secondary caries although the evaluation period was short . According to mjr22 and saleh,23 development of secondary caries is not only due to the material itself . Clinical environment, caries experience of patients, criteria for replacements, different handling characteristics appeared to affect clinical results . Additionally, bernardo et al24 reported that the overall risk of failure due to secondary caries was 3.5 times higher in composite restorations than in amalgam restorations . Grandio restorations have already showed 10% bravo scores in terms of marginal adaptation, which is statistically significant between baseline and 12 months . Similar to our results, kramer et al5 found that for marginal adaptation grandio showed 17% bravo scores after one year clinical evaluation period . However, previous researches demonstrated that evaluation of the composites during initial periods of evaluation depicted minor changes compared to the baseline.25,26 marginal adaptation is directly influenced by the type of composite resin used.27 altering the amount and quality of the filler particles can change the esthetics and mechanical properties of restorative composite resins . Furthermore, lowering a material s viscosity by modifying the composition of the monomer system permits a higher filler load and at the same time improves the handling properties . 28 grandio has a filler degree of 87% w / w (71% volume) by combining spherical nano particles and none of the restorations had shown any marginal discoloration and anatomic form loss until the end of the 12 months and no restorations exhibited post - operative sensitivity at any evaluation period . Quixfil has 86% by weight (66% volume) filler load, which is approximately the same . In a previous study, manhart et al29 evaluated the clinical performance of quixfil for 18 months and found significant increase in marginal discoloration with time . While, marginal defects were observed for both materials in our study, none of the restorations showed marginal discoloration . Many of the these marginal defects appeared to result from the fracture of thin flashes of resin composite material extended on non - instrumented enamel surfaces adjacent to the cavity margins . The use of phosphoric acid etching30 and aggressive self - etch adhesives32 may reduce the occurrence of such defects, especially in high - stress - bearing areas, because of the improved enamel etching.30 in the present study, mild self - etch adhesive systems were used and marginal adaptation results for 12 months may be related to absence of acid - etching procedure . In consistent to our results, abdalla and garcia - godoy31 evaluated the clinical performance of futurabond nr in class v lesions and reported less deteriorations in regards to marginal adaptation and marginal discoloration when adhesive resin was applied following enamel etching . In the present study, both of the restorative materials demonstrated good color stability and surface texture . At the 1-year recall, the majority of scores were alfa, bravo scores were recorded for only two grandio restorations for color stability and one grandio restoration for surface texture . However, it has been reported that changes in surface texture and color stability of resin composite restorations could increase after one year.6,33 in our study, the greater range of shades was available for grandio and we expected better color matching ability for this material . Although, quixfil was available in one universal shade, none of the restorations showed bravo scores at baseline . Good color match results might be related to chameleon effect of quixfil, blending into the tooth structure around the restoration . In the present study, both of these restorative materials were used with their self - etch adhesive systems and demonstrated acceptable clinical performance after 12 months . These successful findings might be related to the relatively short evaluation period, which is consistent with many studies in which there were no significant differences between composite materials in early evaluation periods.15,16 it should be noted that the time frame for this study was not of such duration to indicate the long term suitability of the tested materials, but it may provide an indication for detecting material - related initial changes in color and surface topography regarding their future performance . It was concluded that nanohybrid (grandio) and low - shrinkage posterior composite (quixfil) demonstrated acceptable clinical performance after 12 months.
All procedures were approved by the animal care and use committee of boston children s hospital . We performed complete blood count and wright - geimsa analyses on peripheral blood recovered from adult pnt . Genetic mapping and positional cloning were utilized to identify zgc: 162207 (atpif1a) as the candidate gene for the pnt locus on zebrafish chr . We employed qrt - pcr using taqman gene expression assays (applied biosystems, carlsbad, ca) to measure levels of atpif1a and atpif1b mrna . Morpholinos (gene tools, philomath, or) against splice - site of atpif1a and atpif1b were designed and injected in wt embryos to verify loss - of - function phenotype . The crna for atpif1a, atpif1a - e26a, and atpif1b were injected in pnt embryos for complementation . The cdna prepared from wt and pnt embryos was sequenced, and the polymorphism in the 3utr of the atpif1a sequence was verified using sscp gels . The atpif1-silenced, differentiated hcd34 + and mel cells were stained with o - dianisidine to measure hemoglobinized cells, while mpfl cells were treated with drabkin s reagent to measure relative hemoglobin content . The loss of atpif1 protein and the state of mitochondrial structural proteins in mel cells were verified using western and electron microscopic analyses . We analyzed fluorescent intensities of tmre as a function of mitochondrial membrane potential, mg green as a function of atp levels, and ratio of carboxy snarf-1 to mitotracker green as a function of the mitochondrial matrix ph . We prepared fe - saturated transferrin, and measured fe incorporated in mitochondria and complexed in heme using a gamma counter . We examined ppix levels and the catalytic efficiency of fech in mel cells using spectrophotometric analysis . The mel cells were treated with fccp and 2,4-dnp, followed by analysis for hemoglobinized cells . Human and yeast fech were treated with dtn, and subsequently their catalytic efficiency were measured . The crna for zebrafish fech or yeast fech was injected in pnt embryos, and their efficiency to rescue the anemia in pnt was measured using o - dianisidine staining and verified by using sscp analysis.
We now appreciate that the immune system recognizes cancer and that patients with strong natural immune reactions have better survival compared with those with weak responses . This concept was first demonstrated in patients with colorectal cancer (crc) by pages et al . Here they demonstrated that the immune contexture, defined by number, type and location of tumour immune infiltrates in primary tumours, are key prognostic factors for disease - free and overall survival (os) in crc patients . Importantly, the immunoscore, an immune - based classification strategy derived from three aspects of the immune contexture, proved superior over the standard tumour node metastases classification in predicting outcomes in survival and relapse of crc patients and their response to therapy . Collectively, a good immunoscore, defined as high densities of tumour - infiltrating lymphocytes particularly with a t helper type 1 (th1) and cytotoxic orientation, was associated with longer disease - free survival and/or improved os . This correlation was first documented in crc but has now been extended to a number of other cancers, including melanoma, head and neck, breast, ovarian and lung . Importantly, recognition that cancer development and progression is influenced by the host immune system has led to the development of a conceptual framework called cancer immunoediting,' which explains the dual host - protective and tumour - promoting roles of the immune system . Furthermore, the demonstration that cancers actively evade immune destruction has led to its inclusion as an emerging hallmark of cancer in 2011 . Tumours can escape immune detection and destruction by a number of mechanisms that have been previously discussed . These can include: (i) downregulation of antigen and major histocompatibility complex class i (mhc i) expression, (ii) production of immunosuppressive mediators (for example, interleukin-10 (il-10), transforming growth factor-, adenosine, vascular endothelial growth factor - a (vegf - a), indoleamine 2,3-dioxygenase (ido)) to dampen effector cell activation and (iii) recruitment of immune cell subsets (t regulatory cells (tregs) and myeloid - derived suppressor cell (mdsc)) to suppress effector immune cell function and facilitate its growth and metastases . In addition to these pathways, we now understand that physiological negative feedback loops that curtail t - cell activation, to prevent autoimmunity, can be exploited by tumours to limit anti - tumour responses . For example, after activation, t cells upregulate checkpoint receptors such as cytotoxic t - lymphocyte antigen 4 (ctla-4), which bind to b7 ligands with higher affinity than the co - stimulatory receptor cd28, thus attenuating effector t - cell function . Other t - cell checkpoint receptors that limit activated t - cell effector function include programmed cell death-1 (pd-1), b and t lymphocyte attenuator (btla), t - cell immunoglobulin mucin 3 (tim3) and lymphocyte activation gene-3 (lag-3). Recently, it has been demonstrated in melanoma patients that tumours can also counter attack from activated t cells though another mechanism termed adaptive immune resistance . In this study, tumour - infiltrating lymphocytes producing inflammatory cytokines such as interferon- in the tumour microenvironment upregulated pd - l1/l2 expression on tumours, which delivers an inhibitory signal to pd-1-expressing t cells . Over the past 5 years, the use of antibodies to target checkpoint receptors (also termed checkpoint blockade) has emerged as one of the most effective ways to overcome tumour - induced immunosuppression and re - activate an endogenous anti - tumour response . In 2011, anti - ctla-4 (ipilimumab) was the first immunomodulatory monoclonal antibody approved by the food and drug administration for the treatment of patients with advanced melanoma on the basis of improved survival benefits . Recently, second - generation checkpoint inhibitors, anti - pd-1 and anti - pd - l1, have induced better anti - tumour efficacy (31% objective response rate) compared with ipilimumab (6%). With the recent observation of further increase in anti - tumour efficacy (53%) through the combination of anti - ctla-4 and anti - pd-1 clinical trials are currently in different stages of accrual and development to assess checkpoint receptor blockade in combination with (1) chemotherapies, (2) radiotherapy, (3) small - molecule inhibitors, (4) vaccines and (5) co - stimulatory receptors (for example, cd40, ox40 (also known as cd134), cd137, gitr (glucocorticoid - induced tumour necrosis factor (tnf) receptor - related protein) and cd27 . The induction of iraes is an important factor to consider when attenuating co - stimulatory and co - inhibitory immune receptors for cancer immunotherapy . Thought also has to be given as to how targeting of these receptors in combination or with other therapeutics may induce combination - specific iraes that may not be predicted or observed by monotherapies . Iraes are thought to be related to therapy - associated cytokine release and t - cell - mediated organ infiltration and different from bona fide autoimmunity as they normally resolve following therapy or with corticosteroids or anti - tnf therapy . Iraes can generally involve the gastrointestinal, liver, skin, nervous and endocrine systems (figure 1). In a pooled analysis of 325 patients treated with 10 mg kg of anti - ctla-4, iraes of any grade were observed in 72.3% . Similar proportions were also observed in patients treated with anti - pd-1 alone, although with less severity . In most cases, iraes are mostly mild and generally manageable with appropriate treatment algorithms now having been developed . This includes dose interruption / discontinuation and the use of systemic high - dose corticosteroids . Specifically, grade 3 or 4 iraes, which developed in each of these patients (14% for anti - pd-1 and 25% for anti - ctla-4) warranted attention, as in extreme cases these can be severe and life threatening . Patients who resolve their grade 2 iraes can recommence treatment, although any grade 3 or 4 iraes (with the exception of grade 3 skin toxicity) is a contraindication to further therapy with ipilimumab . Importantly, almost all patients (93%) developed iraes following concurrent anti - pd-1 and anti - ctla-4 monoclonal antibody therapy with an increase in grade 3 or 4 iraes (50%) being observed compared with those treated with monotherapy alone . Moving forward, the better safety and clinical efficacy of targeting pd-1 (most likely due to its role in regulating t - cell activation in peripheral tissues) suggest that it will be the checkpoint receptor of choice to combine with other therapies for cancer treatment . Nevertheless, one may predict that the act of combining immunotherapies increases the proportion of patients who may develop severe iraes . This may limit the number of patients who can fully benefit from combination cancer therapies due to discontinuation, as seen in 21% of patients treated with anti - ctla-4 and anti - pd-1 . Iraes generally manifest during the induction phase of treatment (initial 912 weeks of therapy) and organ - specific iraes appears to follow kinetics of appearance . In the case of ipilimumab where iraes of skin and mucosa develop after about 36 weeks, this is followed by diarrhoea / colitis around week 5 and liver toxicity and endocrinopathies around week 6 . More recently, an update on patients treated with anti - pd-1 reported on 2 years of safety monitoring and found that similar to what has been reported for ipilimumab, most adverse events tended to occur within the first 6 months of therapy . Hence, the goal of therapies targeting checkpoint receptors in combination with other approaches should aim to generate a strong therapeutic index over the induction period of therapy . Questions that have to be answered include whether it is possible to release / activate anti - tumour immunity without development of iraes if the right combination, dosing and scheduling is utilized . Alternatively, is the development of iraes a predictor of anti - tumour responses? In one study, it was reported that ipilimumab - treated patients who developed grade 3 or 4 iraes were more likely to achieve a clinical response compared with those who had no iraes . Interestingly, in a retrospective analysis of 498 patients pooled from four phase ii clinical trials treated with different doses of ipilimumab, feng et al . Reported that higher exposure (dose) was associated with better survival, albeit at a greater risk of developing iraes in the grade 3 or higher category . A caveat is that this correlation is observed simply because the longer the patients responding are treated, the greater the possibility of developing iraes . However, the study by feng et al . Also suggested that patients who did not experience iraes during the induction period were not likely to experience it during maintenance therapy with ipilimumab . It would be interesting to perform retrospective analysis to determine whether these group of patients also did not benefit as much clinically . Potentially these analyses may help answer the question of whether tumour reactive and autoreactive t cells are the same or distinct . It should be noted that, in some studies, there were patients, albeit at a low proportions, who developed durable responses with no associated iraes . Analysis of these patient cohorts may provide clues as to the requirements necessary to release anti - tumour immunity without inducing iraes . For patients who discontinued combination therapy due to iraes, do they still benefit clinically and what is the minimum period of therapy required to allow immune activation and/or release of immune suppression? A recent report suggests this is likely, where patients with advanced melanoma treated with ipilimumab were found to survive for up to 10 years, confirming the durability of the overall survival (os) trend observed . These results, the largest analysis of os for 1861 patients, included 2 phase iii trials, 8 phase ii trials and 2 retrospective trials . Their findings demonstrated that in 1015% of the total patients who responded, 22% of patients can achieve 310 years os and this os reaches a plateau at 3 years . This was observed regardless of dose (3 or 10 mg kg), previous treatment history and whether they had been kept on a maintenance therapy with ipilimumab . Analysis of safety data, which were not included in these results, may shed light on the association of iraes' severity with os as well as clinical benefits obtained following therapy cessation . In addition to checkpoint receptors, agonistic antibodies targeting co - stimulatory receptors belonging to the tnf receptor family (cd40, ox40, cd137, gitr and cd27) are also being assessed . These receptors, in general, act through activation of effector cell function and are currently being evaluated for their anti - tumour efficacy in various phase i / ii clinical trials . In particular, the data for agonistic antibodies targeting cd40 and cd137 (4 - 1bb) are most mature where some objective responses, as well as corresponding iraes, have been reported . In a number of phase i clinical trials, agonistic anti - cd40 monoclonal antibodies have been evaluated against solid tumours or b - cell non - hodgkin's lymphoma . Objective responses were reported in a proportion of these patients, with the most common iraes being primarily grade 2 cytokine release syndrome, which manifests as transient chills, fever and rigors and mild elevations in liver enzymes and decreases in circulating platelet numbers . Interestingly, iraes such as colitis or dermatitis, which are normally associated with checkpoint receptor blockade and can result in dose interruption / discontinuation, were not observed in targeting cd40, suggesting the comparative safety of anti - cd40 . Targeting of another co - stimulatory receptor cd134 (ox40) in one phase 1 clinical trial was also safe as no acute toxicities were reported at the dose tested . By contrast, grade 3/4 iraes (severe liver toxicity) were observed in patients treated with anti - cd137 (urelumab) particularly at high doses, resulting in the termination of a number of phase i trials . Currently, lower doses of anti - cd137 are being evaluated for their safety in a phasei / ii clinical trial with reports suggesting anti - tumour activity can still be elicited without significant liver toxicity . The experience with ipilimumab and immunotherapies in general is their kinetics of response is much slower but more durable compared with those seen with cytotoxics . Recently, a long - term follow - up study of 177 patients treated with ipilimumab reported a median time to achieve complete response of 30 months, consistent with slow kinetics of tumour regression . Similarly, the kinetics of anti - pd-1 responses is atypical with some patients responding rapidly as early as 8 weeks into therapy, whereas other patients displayed new tumours or growth of existing tumours before responding . In addition, some patients continued to respond despite cessation of anti - pd-1 therapy . Strikingly, a different kinetics of response was observed in patients treated with the maximum tolerated doses of anti - pd-1 and anti - ctla-4, given in combination . Impressively, these patients all had tumour reduction of 80% (classified as deep response) or more at their first scheduled assessment at 12 weeks . This is in contrast to patients who were given anti - ctla-4 and anti - pd-1 in a sequenced regime . This suggests anti - tumour responses can be rapid if the right combination is given at optimal dosage and timing . The question now is whether (1) maintenance dosage is required for patients treated with combination therapies who responded rapidly so as to minimize their risk of further developing more iraes or (2) can patients who developed grade 3 or 4 iraes and ceased therapy still benefit and can one correlate the number of doses they received before cessation, with clinical benefit to determine what is the minimum period of therapy required? (3) if iraes are predictors of response, are there biomarkers that can be used to determine which patients will develop them and thus enable monitoring and prophylactic treatment to prevent their escalation into grade 3 or 4 toxicities and cessation of treatment? Given that many patients with iraes treated with systemic corticosteroids and/or anti - tnf resolve their symptoms rapidly if treated when symptoms first appear, it would suggest serum tnf and other inflammatory cytokines like interleukin-6 could be measured as biomarkers and targeted . There seems to be a consensus that corticosteroids or anti - tnf administration do not impede anti - tumour immune responses following checkpoint blockade . Given that most patients will develop some form of iraes following immunomodulatory therapies, particularly in combination, it would suggest concurrent administration of anti - tnf and/or corticosteroids with combination therapies is an option that can be investigated . The demonstration that targeting checkpoint receptors activates endogenous anti - tumour immunity and leads to significant clinical benefit in different cancer types now spurs the question of how their efficacy can be further improved through rationale combination approaches . In advanced melanoma, concurrent anti - ctla-4 and anti - pd-1 therapy resulted in clinical benefits in 50% of patients, which to date is the best result obtained with cancer immunotherapies . Nevertheless, 50% of patients did not respond, and in some cancer types such as pancreas and prostate, checkpoint blockade does not appear to provide any significant clinical benefits . Thus, early - phase clinical trials are exploring how checkpoint inhibitors combine with other agents, including (1) conventional therapies (radiotherapy, chemotherapy), (2) alternative immunotherapies (vaccines, cytokine, adoptive cellular therapy), (3) targeted therapies (braf or vascular endothelial growth factor inhibitors) or (4) immunomodulatory antibodies . With combination immunotherapies increasingly being tested in clinical trials, iraes will be an ongoing issue that has to be dealt with (as discussed above) as it may limit their usage . Furthermore, even when both agents have regulatory approval and have distinct mechanisms of action and toxicity profile, unexpected specific iraes induced by the combination can occur . This was illustrated by a recent clinical trial that reported on the unexpected hepatotoxicity observed with melanoma patients after concurrent treatment with a braf inhibitor (vemurafenib) and ipilimumab, resulting in cessation of the trial . Given the beauracracy, cost and time associated with conducting clinical trials, utilizing preclinical mouse models that can more accurately model tumour immunity and iraes may allow more informed assessment of which therapies can be combined to induce optimal therapeutic index (figures 2 and 3). Tumour - associated autoimmune syndrome is very rare in patients with cancer, such as melanoma - associated retinopathy and vitiligo . However, new data suggest that it is not merely a side effect of robust anti - tumour immunity . The development of vitiligo is considered to be a benefit to the prognosis of the patient with malignant melanoma . In a preclinical study, mice with vitiligo generated more cd8 memory t cells, which protected them from melanoma expressing the same melanocyte antigens . In another study, inflammatory monocytes or dendritic cells accumulated in the skin were shown to be capable of killing melanoma cells as well as normal melanocytes . However, whether the relationship of tumour - associated autoimmune syndrome and tumour immunity is dependent on the innate immune system or adaptive immune system or both requires further investigation . In contrast, iraes are not true autoimmune diseases, as they typically resolve with cessation of therapy and appropriate immunosuppressive regimes . In addition, the experience with ipilimumab and immunotherapies in general is their kinetics of response is much slower but more durable compared with those seen with cytotoxics . Thus utilizing spontaneous mouse tumour models may better mimic the response kinetics that is observed in the clinic and may potentially allow for the development of any therapy - induced toxicity . These models can be divided into those that are carcinogen - induced such as methylcholanthrene (mca)-induced fibrosarcomas and 7,12-dimethylbenz[]anthracene (dmba)/12-o - tetradecanoylphorbol-13-acetate (tpa)-induced skin papillomas or genetically engineered mouse tumour models, which have enforced expression of oncogenes and/or the loss of function of tumour suppressors, often in a tissue - specific and/or temporally controlled manner (figure 2). Examples include the her2/neu or pymt transgenic mice to mimic breast cancer, the mt / ret model of spontaneous metastatic melanoma and braftyr - creerpten mice in which 4-hydroxytamoxifen (4-ht) induces de novo melanoma as well as the use of adenoviral vectors encoding cre recombinase to selectively introduce mutations in the oncogene kras and the tumour - suppressor gene tp53 in the pulmonary epithelia to induce autochthonous lung tumours . Interestingly, it has been noted that carcinogen - induced models are very immunogenic, whereas germline mutation models are often not, most likely due to the former carrying more passenger mutations, thereby generating more neoantigens that can potentially be recognized by the immune system . This was elegantly illustrated in two studies investigating the role of t cells in selecting for non immunogenic sarcomas using either a mouse model of sarcomagenesis driven by cre recombinase - triggered activation of the kras oncogene and inactivation of the trp53 tumour - suppressor gene or a mca - induced mouse model of sarcoma . In the first model, sarcomas that developed did not appear to be recognized by adaptive immunity as these tumours grew equally well when transplanted into wild - type or rag-2-deficient mice . On the contrary, mca - induced sarcomas, which had many passenger mutations in addition to kras and trp53, were demonstrated to generate tumour - specific t cells, which could then selectively sculpt tumour immunogenicity . Interestingly, mouse mca - induced sarcomas were also found to have qualitative and quantitative genomic mutation profiles to carcinogen - induced human cancers, such as smoker's lung cancer . Thus carcinogen - induced mouse models of cancer may better mimic cancers that are immunogenic . In contrast, transplantable tumours, which grow more rapidly and are employed as an initial model to assess the therapeutic potential of combination therapies, may be less useful . As most transplantable tumours are grown subcutaneously on the flanks of mice, an alternative approach is to inoculate them orthotopically to better mimic the tumour environment from which they originated . Indeed, immunotherapies that demonstrate efficacy against a renal tumour grown subcutaneously were not as effective when the same tumour was transplanted into the kidney . Although checkpoint blockade in patients commonly induces iraes, such events have rarely been commented upon or observed in preclinical mouse models, even when 3 different pathways are targeted . It is possible that while treated mice appeared outwardly healthy, closer examination of animals may have revealed the presence of biochemical autoimmunity, which is frequently observed in patients even if they do not display clinical symptoms . In addition, observable iraes may not have manifested owing to the generally short nature of preclinical mouse models experiments or, perhaps, the strain of mice used may be more resistant to developing iraes compared with humans . This was elegantly shown in a recent study where repeated dosing of anti - ctla-4 in sjl / j mice over 5 weeks was able to induce hypophysitis, an irae that appears to be associated with ipilimumab treatment . Testing checkpoint blockade in combination or with other therapies in mouse strains more prone to development of autoimmune symptoms (for example, nod, sjl / j) may be one strategy to assess the development of tumour immunity and autoimmunity . Furthermore, it has also been shown that repeated dosing of agonistic antibodies to co - stimulatory receptors such as gitr induced anaphylaxis in tumour - bearing mice that was caused by serum antibodies, and dependent on cd4 t cells, b cells, basophils, platelet - activating factor and gitr . Alternatively, to observe iraes in mice, a more dramatic alteration of the immune system such as the complete and systemic depletion of tregs may be required . Intratumour treg depletion by antibodies such as anti - ctla-4 (now a recognized mechanism) does not seem sufficient to induce iraes in mice, as are observed in humans . In addition, heterogeneity in the kinetics of response is normally seen in patients after immunotherapy, such as those that were treated with anti - pd-1, and thus a tumour model that mimics what is observed in the clinic will be useful . Using the de novo model of mca - induced fibrosarcoma, we observed that complete treg depletion in dereg mice bearing established mca - induced tumours displayed a similar heterogeneous range of tumour responses to that observed in the clinic . In our study, no overt autoimmunity with treg depletion was observed, but this may be explained by the potential compensatory effect of other nontransgenic regulatory cells in the dereg mice . Comparative experiments in foxp3-dtr knock - in mice, where autoimmunity is more easily generated upon treg depletion, are currently underway in our laboratories . In clinical trials, concurrent blockade of ctla-4 and pd-1 checkpoint receptors induced deep and rapid anti - tumour responses in contrast to the slower response kinetics seen in patients given anti - ctla-4 and anti - pd-1 in a sequenced - regime . This suggests that anti - tumour responses can be rapid if the right combination is given at optimal dosage and timing . It was not made clear if patients who had the rapid deep objective response had high / low grade iraes . Indeed, we recently reported the use of the poorly immunogenic b16f10 melanoma model to characterize a very heterogeneous anti - tumour effect of the immune response induced by complete treg depletion in dereg mice . Strikingly, the duration of the tumour immune system interaction induced in individual treg - depleted mice positively correlated with their propensity to develop vitiligo . A rapid complete tumour rejection was not associated with the development of autoimmunity; however, a proportion of mice that suppressed but did not effectively clear b16f10 melanoma did develop vitiligo . We would postulate that approaches that combine with treg depletion to rapidly reject tumours may also diminish iraes . Currently, cancer patients who have chronic autoimmunity are generally precluded from clinical trials with checkpoint blockade . However, patients with certain autoimmune diseases (pernicious anaemia, crohn's disease, ulcerative colitis, systemic lupus erythematosis and psoriasis) are generally thought to be at higher risk of cancer due to the underlying dysregulation of their immune system, as well as a consequence of their treatment regime . Thus, it is imperative we understand how and if toxicities induced by combination therapies in this cohort of patients differ to cancer patients who do not have underlying autoimmunity, that is, whether the therapies will be more toxic . Given that many tumour - associated antigens are self - antigens, and that self - reactive t / b cells are increased in patients with autoimmunity, should a case be made that cancer patients with stable underlying autoimmunity be allowed treatment with immunotherapies as they may respond better? Of course, these patients have to be monitored stringently owing to their increased risk of developing iraes or have their autoimmune symptoms exacerbated . Nevertheless, studies in this cohort of patients may potentially help in answering the question of how much overlap they are between tumour reactive and autoreactive t cells as well as their relative importance in different cancers . The foxp3-dtr mouse represents one model where we can evaluate how combination immunotherapies attenuate tumour immunity / iraes . In this setting, tumour - bearing foxp3-dtr mice can be conditionally depleted of their tregs to mimic the maximum release of suppression on all immune cells and can then be treated with different immunotherapies / agents . Potentially, this may allow us to assess how different co - inhibitory / co - stimulatory receptors combine with each other or with other therapies to attenuate anti - tumour immunity / iraes . Although clinical observations suggest that autoimmune effectors are intricately involved in tumour cell killing, evidence using antigen - specific preclinical mouse models indicates that, in some cases, the immune system can selectively target tumour tissue while sparing self . Indeed how self antigen - specific t cells target tumour versus healthy tissues, and how they are regulated in different microenvironments, is still unclear . To address this issue, miska et al . Evaluated the ability of specific t effector cells to kill tumour versus healthy cells expressing the same self antigen in the same animal . Their studies concluded that tumours suppressed autoimmune t effector cells locally without distal impairment, suggesting that higher levels of suppression exist in tumours compared with healthy tissues expressing the same self antigen . Their studies also highlighted an increased potency of regulatory mechanisms such as treg and mdscs in tumours, although the molecular mechanisms responsible for this increased suppression remain to be elucidated . Thus antigen - specific cd4 or cd8 t cells that are unable to eliminate tumours can still mediate destruction of healthy tissues, suggesting that the threshold of inducing autoimmunity is lower than tumour immunity . This implies that systemic administration of immunotherapies that result in t - cell activation will almost always induce autoimmunity unless a substantial antigenic difference is identified between tumour target and healthy tissue . Thus strategies that can alleviate immune suppression specifically at the tumour site will be the way forward for next - generation combination therapy approaches . Another issue for consideration is that many of the cancer patients may have underlying metabolic syndrome such as obesity and diabetes, which have repeatedly been associated with increased incidence for some common cancers . How would combination therapies impact on this cohort of patients in terms of tumour immunity / iraes? This question may be assessed by testing immunotherapies with the obese diabetic mouse (ob / ob) model . The durable clinical benefits obtained with immune checkpoint blockade have reinvigorated the field of cancer immunotherapy . Moving forward, checkpoint blockade looks set to be explored in combination with other therapies to further improve their therapeutic efficacy and their impact on more cancer types . However, the proportion of patients developing severe iraes following combination immunotherapies most likely will increase . Utilizing relevant preclinical mouse models of cancer that better model tumour
Experimental groups of 20 (4- to 6-week old) c57bl/6 female mice (charles river, l'arbresle, france) were injected intracerebrally with 20 l of 10% (weight / volume) homogenates per mouse prepared from brain stem samples of 3 cattle tse isolates . Two of the isolates were characterized, as previously described (7), by a higher molecular mass of unglycosylated prp (h - type isolates) and labeling with p4 monoclonal antibody (table). Mice were housed and cared for in an appropriate biohazard prevention area (a3) according to european (directive 86/609/eec) and french ethical committee (decree 87848) guidelines . Mice were checked at least weekly for neurologic clinical signs and were killed when they exhibited signs of distress or confirmed evolution of clinical signs . The whole brain of every second mouse was frozen and stored at 80c before western blot analysis . Frozen mouse brain tissues and fixed brain tissues were examined by western blot analysis and immunohistochemical tests as previously described (12,13). Prp extracted from half of whole brain was detected with monoclonal antibodies sha31 (1:10 from tesee sheep / goat western blot, bio - rad, hercules, ca, usa) (14) and 12b2 (340 ng / ml) (15). These antibodies are directed against the 144-wedryyre-151 and 88-wgqgg-92 murine amino acid prp sequences, respectively . Antibody 12b2, which has an n - terminal specificity similar to that of monoclonal antibody p4, shows poor binding to bse - derived prp, but unlike p4, binds with high affinity to prion protein from most mammalian species, including mice and cattle . Bound antibodies were detected by using enhanced enzymatic chemiluminescence (amersham, little chalfont, uk) or supersignal (pierce, rockford, il, usa) and visualized either on film (biomax, eastman kodak, rochester, ny, usa) or directly in an image analysis system (versadoc, bio - rad). Molecular masses of prp glycoforms were determined as the average of the center positions of the bands from at least 3 repeated electrophoretic procedures, as measured by comparison with a biotinylated marker (b2787, sigma, saint louis, mo, usa) included on each gel . Immunologic reactivities of antibodies 12b2 and sha31 were compared in western blots run in parallel with the same samples with both antibodies . After intracerebral injection of cattle brain samples into c57bl/6 mice, disease was observed in mice with the 2 h - type isolates, as well as with the bse sample . Survival periods of mice and results of prp detection among mice analyzed by western blot are shown in the table . Western blot analysis of prp from h - type infected mouse brains in comparison with bse - infected mice is shown in figure 1 . This pattern showed higher molecular mass prp glycoforms in mice infected with h - type isolates than in mice infected with a typical bse agent (1.1- to 1.5-da difference in the unglycosylated prp (figure 1a). Studies of prp protease cleavage showed that only the prp of mice infected with h - type isolates was recognized by antibody 12b2 (figure 1b). This finding is in contrast to the result obtained with monoclonal antibody sha31 directed against an epitope in the central region of the protein, which showed that the 12b2 epitope was preserved in h - type infected mice . Thus, the molecular features of h - type cattle isolates, which are distinct from those of the bse agent, were maintained after development of disease in mice . Western blot analysis of disease - associated prion protein (prp) from proteinase k treated brain homogenates of c57bl/6 mice infected with type h (lanes 2 and 4) or bovine spongiform encephalopathy isolates (lanes 3 and 5). Prp of mice infected with an experimental scrapie strain (c506m3) (6) was used as a control (lane 1). Monoclonal antibodies used for detection of prp were sha31 in panel a and 12b2 in panel b. lane m, molecular mass markers: 39.8, 29, 20.1, and 14.3 kda . Histopathologic analysis showed vacuolar lesions in the thalamus (figure 2a) that were absent from the hypothalamus, cochlear nucleus, and superior collicules . These 3 neuroanatomic sites were severely affected in c57bl/6 mice brain after primary passage of the bse agent as we and others have reported (1). Abnormal prp was detected only in amyloid plaques (figure 2b), in contrast to what was reported after bse transmission in c57bl/6 mice (1). A) characteristic vacuolar lesions in the thalamus (hematoxylin and eosin stained, scale bar = 60 m). B) immunohistochemical analysis of prion protein with monoclonal antibody 12b2 (diluted 1:200) shows the absence of granular deposition, but the presence of plaques in the thalamus . The inset shows that plaques are amyloids since they bind congo red and show birefringence in polarized light (scale bar = 60 m, scale bar in inset = 16 m). Our data show that the recently identified bovine h - type isolates involve an infectious agent that can induce development of a disease across a species barrier, while maintaining the specific associated prp molecular signature . This evidence in favor of a new bovine prion strain in cattle suggests that bse is not the only transmissible prion disease in cattle . These cases suggest either the existence of alternative origins of such diseases in cattle or phenotypic changes of prp after infection with the bse agent . However, based on analysis of molecular features of prion diseases in cattle, this situation is similar to that in humans (5), in which different subtypes of sporadic creutzfeldt - jakob disease agents are found.
Cancer is the important cause of death in many countries (1), including iran (2). In fact, cancer, being a life - threatening disease, makes the inevitable need for the implementation of an effective end - of - life care strategy in health care services more than ever (3). Physicians should consider the patients best interests (4); moreover, the treatment they choose should be beneficial to the patients and does no more harm . Besides, the treatment should be selected on the basis of the patients and their families views on end - of - life care and financial costs of terminal care (5). Therefore, on the basis of patients views and conditions, oncologists sometimes decide to continue curative cancer therapy for terminal patient to improve the survival rate or recommend palliative care to improve the patients quality of life (6, 7). Oncologists can fairly decide on end - of - life provided that they know patients and their families values and preferences (8), and can communicate with them honestly (9). Many physicians avoid informing patients of their survival chance, because they believe that discussing this issue may diminish patients hope (10). In addition, health care costs are high in many parts of the world and financial discussions on the cost of treatments and care of end stage cancer patients can be of paramount importance (11). Consequently, considering differences of health care services in various cultural backgrounds and social structures, the professionals in service providing face with numerous ethical problems for decision - making (12,13). Many studies have discussed ethical problems in decision making on end of - life care (12). In one study, the authors believed that physicians face different ethical problems, the most important of which being uncertainty about treatment, prognosis, quality of life and external factors such as economic and legal issues as well as work environment (14). Another study showed several factors which included patients characteristics and illness factors, health care provider and health care system agents (15). In another study, researchers reported a considerable difference in russian, swedish and german physicians approach in terms of end - of - life treatment decisions which relies on a large variety on socio - cultural context (16). Diagnosis of a life - threatening disease like cancer is undoubtedly crushing for the patient (17). The society tends to consider death as a taboo, something in which man cannot interfere . Western countries have done great attempts for conceptualization of death, and introduction of end - of - life care (19). Moreover, at present, in many countries improvement of the quality of health care services for the end stage patients has become the main subject of many research and clinical plans at national levels . But the results of studies conducted in other societies cannot be used in the iranian community . Meanwhile, cancer is one of the three major causes of death in iran and the burden of this life - threatening condition have caused many challenging problems for the public health system in our country . Furthermore, some cultural aspects of death and terminal patients care have not been considered yet in our country and very few researches are carried out regarding death and the end of life care . We should try to pay a great attention to cultural and social aspects because family ties are very strong among iranian families and usually the whole family is involved in a patient s problems . In fact, we can provide an appropriate care for cancer patients provided that we understand medical, ethical, legal and economical challenges which may be experienced by physicians and other cancer care providers in our health care system in the special socio - cultural context . These studies can help to provide appropriate guidelines for decision making and educational interventions in terminally ill cancer patients . Accordingly, we conducted a qualitative study on the oncologists experiences in end - of - life care for end stage cancer patients in iran to clarify ethical challenges experienced by them in an islamic middle eastern setting . We aimed to shed light on the ethical dilemmas which iranian oncologists may face in our health care setting and to determine factors influencing their decision - making process . The present study is a part of a doctoral thesis project to explore ethical dilemmas in decision - making process in end of life care in iran . We conducted a qualitative study using in - depth semi - structured face - to - face interviews . We were particularly interested to know how participants viewed experiences, beliefs and practices regarding ethical dilemmas in decision - making in end of life care of terminal cancer patients . Each participant gave written informed consent and the principal researcher assured all of them that the data would remain confidential . Therefore, the principal researcher would remove any identifying data from transcripts and keep the files separately . We used a purposeful sampling method and interviewed certain specialties including adult hematologist - oncologists, radiotherapists, and surgeon oncologists . Physicians from the department of oncology and cancer institute in a teaching hospital in tehran, tehran university of medical sciences and the department of oncology at a teaching hospital in kerman, kerman university of medical sciences were contacted by the principal researcher, and after explaining the study, were invited to participate . The aim of this sampling method was to gather the perspectives of a group of specialists who were involved in taking care of terminal patients and providing them and their families with the option of palliative care . The data collection and analysis process was based on the phenomenological approach, which is a methodology for exploring the experience of a group of individuals in a certain topic . Interviews were continued until thematic saturation, a point where no new or relevant theme is added to the gathered data, is achieved (20). In our study, thematic saturation occurred after interviewing of eight participants . The interviews, ranging in length from 30 to 45 minutes, were conducted by the principal researcher in a quiet environment at participants office room . The interviews began with questions on the participants demographic information and were followed by questions on the participants clinical experiences regarding end - of - life care decision making in cancer patients . A palliative medicine specialist, an expert in qualitative research methodology and a specialist in medical ethics planed the guide of interview questions . Following questions were asked: what are your experiences in end - of - life care of cancer patients? What are your beliefs and ideas about end - of - life care approach for patients with terminal cancer? What would you do for these patients? Furthermore, the principal researcher used probes to encourage participants to elaborate on their experiences; for example, what information do you say to patients and patients families prior to making the decision and how do you communicate with them? ; which factors influence your decision to select curative treatment or palliative treatment? ; which factors are related to diagnosing terminally ill patients? ; what ethical challenges you face end - of - life care decision - making? Each interview was transcribed ., the principal researcher reviewed the transcripts line by line several times and broke down, compared, conceptualized and categorized the data . Four members of the research group studied the codes and collaborated in the open - coding process . New themes were achieved based on the new interviews . To enhance the credibility of the analysis and to determine its dependability and to confirm ability, four steps were completed: 1-thematic saturation, 2- open coding process, 3- presentation the summaries of the interviews to three participants to confirm the researcher s perception from content, 4- presentation s preliminary analysis with attached codes to 3 participants to confirm the results . The present study is a part of a doctoral thesis project to explore ethical dilemmas in decision - making process in end of life care in iran . We conducted a qualitative study using in - depth semi - structured face - to - face interviews . We were particularly interested to know how participants viewed experiences, beliefs and practices regarding ethical dilemmas in decision - making in end of life care of terminal cancer patients . Each participant gave written informed consent and the principal researcher assured all of them that the data would remain confidential . Therefore, the principal researcher would remove any identifying data from transcripts and keep the files separately . We used a purposeful sampling method and interviewed certain specialties including adult hematologist - oncologists, radiotherapists, and surgeon oncologists . Physicians from the department of oncology and cancer institute in a teaching hospital in tehran, tehran university of medical sciences and the department of oncology at a teaching hospital in kerman, kerman university of medical sciences were contacted by the principal researcher, and after explaining the study, were invited to participate . The aim of this sampling method was to gather the perspectives of a group of specialists who were involved in taking care of terminal patients and providing them and their families with the option of palliative care . The data collection and analysis process was based on the phenomenological approach, which is a methodology for exploring the experience of a group of individuals in a certain topic . Interviews were continued until thematic saturation, a point where no new or relevant theme is added to the gathered data, is achieved (20). In our study, thematic saturation occurred after interviewing of eight participants . The interviews, ranging in length from 30 to 45 minutes, were conducted by the principal researcher in a quiet environment at participants office room . The interviews began with questions on the participants demographic information and were followed by questions on the participants clinical experiences regarding end - of - life care decision making in cancer patients . A palliative medicine specialist, an expert in qualitative research methodology and a specialist in medical ethics planed the guide of interview questions . Following questions were asked: what are your experiences in end - of - life care of cancer patients? What are your beliefs and ideas about end - of - life care approach for patients with terminal cancer? Furthermore, the principal researcher used probes to encourage participants to elaborate on their experiences; for example, what information do you say to patients and patients families prior to making the decision and how do you communicate with them? ; which factors influence your decision to select curative treatment or palliative treatment? ; which factors are related to diagnosing terminally ill patients? ; what ethical challenges you face end - of - life care decision - making?, the principal researcher reviewed the transcripts line by line several times and broke down, compared, conceptualized and categorized the data . Four members of the research group studied the codes and collaborated in the open - coding process . New themes were achieved based on the new interviews . To enhance the credibility of the analysis and to determine its dependability and to confirm ability, four steps were completed: 1-thematic saturation, 2- open coding process, 3- presentation the summaries of the interviews to three participants to confirm the researcher s perception from content, 4- presentation s preliminary analysis with attached codes to 3 participants to confirm the results . Three hematologist - oncologists, four radiotherapists and a cancer surgeon were included in the study . They have visited their patients (mean 30 patients) daily in teaching clinics in their hospitals and their private office too . We distinguished three main themes, according to the oncologists experiences, beliefs and practices in end stage cancer patients care . The participants believed that these issues were influential factors in end - of - life care decision - making . 1 . Assessment of cancer patients: many cancer specialists emphasized that they assessed their patients on the basis of performance status and their co - morbid conditions . Therefore, the specialists not only used formal assessment tools such as the eastern cooperative oncology group performance status (ecog) and the karnofsky scale, but also apply their experiences in cancer patients care . One of the hematologists - oncologists specialists said: as we graduated, we thought we have to treat the disease rather than the patient . Gradually, we understand that we should apply special treatments for each patient, similar to what happens in the court . We improve this judgment power by applying our experiences in cancer patients care, rather than relying only on text book . As we graduated, we thought we have to treat the disease rather than the patient . Gradually, we understand that we should apply special treatments for each patient, similar to what happens in the court . We improve this judgment power by applying our experiences in cancer patients care, rather than relying only on text book . Uncertainty in end stage definition: dealing with end stage definition, one of interviewees said: we cannot determine an individual precise time of death, thus we should assess each patient based on their condition . Our year s long practice show that we can never determine the exact time of death based on probability and statistics . It is hard to accurately define end stage.the first question of the patient s relatives is how long our patient will survive . We cannot determine an individual precise time of death, thus we should assess each patient based on their condition . Our year s long practice show that we can never determine the exact time of death based on probability and statistics . The first question of the patient s relatives is how long our patient will survive . 3 . The aim of cancer therapy: the physicians explained the aim of treatment for cancer patients well and classified these treatments into two main categories; palliative and curative . One of the experts said: most of time, we do not treat cancer to increase the patient s survival, but we only treat the patient to improve their quality of life.the purpose of palliative treatments is just to increase patient s life quality . At a stage which we know that the disease is not curable, we resort to palliative treatments . Most of time, we do not treat cancer to increase the patient s survival, but we only treat the patient to improve their quality of life . The purpose of palliative treatments is just to increase patient s life quality . At a stage which we know that the disease is not curable, we resort to palliative treatments . 4 . Withdrawal of treatment in cancer patients: all physicians considered withdrawing a treatment as one of the most difficult decisions in treating cancer patients . A radiotherapist said: i believe that i am not allowed to stop the treatment through interrupting the patient s fluid therapy or extubating them . We do nt withdraw the patient s treatment ourselves just because they are end stage patients . I believe that i am not allowed to stop the treatment through interrupting the patient s fluid therapy or extubating them . We do nt withdraw the patient s treatment ourselves just because they are end stage patients . Another oncologist insisted on maintaining the patient s hope and said: we have no right to disappoint patients and we should continue the treatment . We do nt want that patient think we are leaving them alone to die . Cost consideration (financial issues): the physicians expressed that financial problems and lack of optimal insurance system are one of the most important problems in this regard . As many oncology drugs are very expensive, the financial and economical problems can affect our decisions surely.the second ethical challenge, which to some extent is related to the same problem of medical decision - makings, is financial problems.doctors criterion is not medicines price, but they decide on the basis of scientific issues; when the patient says he ca nt afford it, we wo nt deprive him of the treatments . As many oncology drugs are very expensive, the financial and economical problems can affect our decisions surely . The second ethical challenge, which to some extent is related to the same problem of medical decision - makings, is financial problems . Doctor s criterion is not medicines price, but they decide on the basis of scientific issues; when the patient says he ca nt afford it, we wo nt deprive him of the treatments . Patients: physicians believed that cultural background is one of the most important issues in cancer patients care . Social and cultural issues affect the patients care very much, and they are very important . Based upon our culture, many families do not allow their patients to be aware of the nature and severity of their disease . Therefore the patient has no active role in decision making . In our society, people are strongly religious, and think such beliefs can help them during hard times . Families: in another part, the physicians stressed that many families ask for the patient being unaware of their disease . Therefore, in the iranian society, in many cases physicians encounter ethical dilemmas and cannot decide easily, as they are obliged to fulfill the request of patient s relatives . One of the physicians said: we have to tell the truth to the first - degree relatives of patients . We should give necessary information to the patient s family . Another issue presented by the physicians was the patients and their family tendency to take their patient home, and to do end - of - life care at home . They want their patient to die at home; they do not like death in hospital at all, this is their family belief . Practically, we have no hospice in iran, end of life care is mostly undertaken by patients family; perhaps it is because of eastern culture, not only iranian culture, we are not happy to leave our patients in hospital . 1 . Truth - telling: the interviewees emphasized that the cultural background of the society and the families requests are the main obstacle for truth - telling . We cannot directly tell many patients about their serious condition . The problem, with which personally i m challenging is, that informing the patient about his problem helps him to be prepared to face it . People are always more afraid of what they know nothing about . The patient who is looking into your eyes, and he is the one who has the right in this regard, should not be told that they believed that unawareness and incorrect participation of patients in treatment planning have forced many physicians to decide autonomously . One of the oncologist surgeons stated an important point in telling the truth to the patient and said: in some conditions, there is no other choice for decision - making and treatment but to tell the truth to the patient . Sometimes the patient has a cancer in his hand for example, which needs to cut the hand . Multidisciplinary team working: the interviewees agreed that advanced cancer patients should be treated in a multidisciplinary approach, and a group of specialists should be involved in treating these patients . They, however, stressed that multidisciplinary approach is not possible in our hospitals because our centers are solely designed for treatment and are not appropriate for providing supportive care . So, we should do everything on our own knowledge and experiences, the physicians are responsible for such tasks in our hospital while all of them are not in their job description . Oncology is a very complicated field, which needs coordination and cooperation among the groups . Our oncology hospitals are for treatment of patients, not for end - of - life care . Physician training: moreover, the oncologists believe that another reason, which creates contradictions for them and make them face difficult situations of decision - making, is educational constrains regarding medical care and ethical decision - making in courses of medicine, and even in residency courses that they have passed . We have also received no education in this field, and it creates conflict itself . Education can be very effective; even educating specialists is very important . 1 . Assessment of cancer patients: many cancer specialists emphasized that they assessed their patients on the basis of performance status and their co - morbid conditions . Therefore, the specialists not only used formal assessment tools such as the eastern cooperative oncology group performance status (ecog) and the karnofsky scale, but also apply their experiences in cancer patients care . One of the hematologists - oncologists specialists said: as we graduated, we thought we have to treat the disease rather than the patient . Gradually, we understand that we should apply special treatments for each patient, similar to what happens in the court . We improve this judgment power by applying our experiences in cancer patients care, rather than relying only on text book . In fact, the physician with more experience makes better decisions . As we graduated, we thought we have to treat the disease rather than the patient . Gradually, we understand that we should apply special treatments for each patient, similar to what happens in the court . We improve this judgment power by applying our experiences in cancer patients care, rather than relying only on text book . 2 . Uncertainty in end stage definition: dealing with end stage definition, one of interviewees said: we cannot determine an individual precise time of death, thus we should assess each patient based on their condition . Our year s long practice show that we can never determine the exact time of death based on probability and statistics . It is hard to accurately define end stage.the first question of the patient s relatives is how long our patient will survive . We cannot determine an individual precise time of death, thus we should assess each patient based on their condition . Our year s long practice show that we can never determine the exact time of death based on probability and statistics . The first question of the patient s relatives is how long our patient will survive . 3 . The aim of cancer therapy: the physicians explained the aim of treatment for cancer patients well and classified these treatments into two main categories; palliative and curative . One of the experts said: most of time, we do not treat cancer to increase the patient s survival, but we only treat the patient to improve their quality of life.the purpose of palliative treatments is just to increase patient s life quality . At a stage which we know that the disease is not curable, we resort to palliative treatments . Most of time, we do not treat cancer to increase the patient s survival, but we only treat the patient to improve their quality of life . The purpose of palliative treatments is just to increase patient s life quality . At a stage which we know that the disease is not curable, we resort to palliative treatments . 4 . Withdrawal of treatment in cancer patients: all physicians considered withdrawing a treatment as one of the most difficult decisions in treating cancer patients . A radiotherapist said: i believe that i am not allowed to stop the treatment through interrupting the patient s fluid therapy or extubating them . We do nt withdraw the patient s treatment ourselves just because they are end stage patients . I believe that i am not allowed to stop the treatment through interrupting the patient s fluid therapy or extubating them . We do nt withdraw the patient s treatment ourselves just because they are end stage patients . Another oncologist insisted on maintaining the patient s hope and said: we have no right to disappoint patients and we should continue the treatment . We do nt want that patient think we are leaving them alone to die . . Cost consideration (financial issues): the physicians expressed that financial problems and lack of optimal insurance system are one of the most important problems in this regard . As many oncology drugs are very expensive, the financial and economical problems can affect our decisions surely.the second ethical challenge, which to some extent is related to the same problem of medical decision - makings, is financial problems.doctors criterion is not medicines price, but they decide on the basis of scientific issues; when the patient says he ca nt afford it, we wo nt deprive him of the treatments . As many oncology drugs are very expensive, the financial and economical problems can affect our decisions surely . The second ethical challenge, which to some extent is related to the same problem of medical decision - makings, is financial problems . Doctor s criterion is not medicines price, but they decide on the basis of scientific issues; when the patient says he ca nt afford it, we wo nt deprive him of the treatments . 1 . Patients: physicians believed that cultural background is one of the most important issues in cancer patients care . Social and cultural issues affect the patients care very much, and they are very important . Based upon our culture, many families do not allow their patients to be aware of the nature and severity of their disease . Therefore the patient has no active role in decision making . In our society, people are strongly religious, and think such beliefs can help them during hard times . Families: in another part, the physicians stressed that many families ask for the patient being unaware of their disease . Therefore, in the iranian society, in many cases physicians encounter ethical dilemmas and cannot decide easily, as they are obliged to fulfill the request of patient s relatives . One of the physicians said: we have to tell the truth to the first - degree relatives of patients . We should give necessary information to the patient s family . Another issue presented by the physicians was the patients and their family tendency to take their patient home, and to do end - of - life care at home . They want their patient to die at home; they do not like death in hospital at all, this is their family belief . Practically, we have no hospice in iran, end of life care is mostly undertaken by patients family; perhaps it is because of eastern culture, not only iranian culture, we are not happy to leave our patients in hospital . 1 . Truth - telling: the interviewees emphasized that the cultural background of the society and the families requests are the main obstacle for truth - telling . We cannot directly tell many patients about their serious condition . The problem, with which personally i m challenging is, that informing the patient about his problem helps him to be prepared to face it . The patient who is looking into your eyes, and he is the one who has the right in this regard, should not be told that they believed that unawareness and incorrect participation of patients in treatment planning have forced many physicians to decide autonomously . One of the oncologist surgeons stated an important point in telling the truth to the patient and said: in some conditions, there is no other choice for decision - making and treatment but to tell the truth to the patient . Sometimes the patient has a cancer in his hand for example, which needs to cut the hand . Multidisciplinary team working: the interviewees agreed that advanced cancer patients should be treated in a multidisciplinary approach, and a group of specialists should be involved in treating these patients . They, however, stressed that multidisciplinary approach is not possible in our hospitals because our centers are solely designed for treatment and are not appropriate for providing supportive care . So, we should do everything on our own knowledge and experiences, the physicians are responsible for such tasks in our hospital while all of them are not in their job description . Oncology is a very complicated field, which needs coordination and cooperation among the groups . Our oncology hospitals are for treatment of patients, not for end - of - life care . 3 . Physician training: moreover, the oncologists believe that another reason, which creates contradictions for them and make them face difficult situations of decision - making, is educational constrains regarding medical care and ethical decision - making in courses of medicine, and even in residency courses that they have passed . We have also received no education in this field, and it creates conflict itself . Education can be very effective; even educating specialists is very important . Based on the results of the present study, cancer specialists focused more on issues such as telling the truth in our cultural context, uncertainty in end stage definition, multidisciplinary team working and cost consideration in iranian health care system that are priorities for end - of - life care cancer patients . One of the most specific issues indicated by our study s participants is telling the truth to end - stage patients . Many families prefer to hide the detailed information from their patients so that not to diminish their patient s hope . Furthermore, sometimes our physicians are obliged to fulfill the families requests, and they experience more distress . Recent studies have pointed out the difficulties of truth - telling in terminal patients (21,22). In one study in iran 5 years ago, the researcher questioned 400 physicians about truth - telling to patients suffering from life threatening diseases . According to this study, 35% of the respondents believed that the patients have the right to be aware of their disease, whereas 6% disagreed with disclosing information to the patients . Furthermore, 59% of the respondents believed that the patient should be informed in special circumstances (23). In some countries such as japan, china, greece, turkey, spain and italy, the physicians have not accepted the truth disclosure completely; however, they are more interested to inform the patients than before, but still do not apply it in practice(24,25). Japanese physicians first inform the patients families and then the families decide whether the patient should be informed or not (26). We can see a similar practice in the arabic islamic patriarchal cultural context (27, 28). In one study, the authors reviewed the cultural differences in the understanding of end of life care in seven european countries (29). Hence, the evidence indicated that truth telling issue in health care has a cultural origin and cannot be considered as an ethical dilemma (30). Our study showed that many physicians are reluctant to tell the truth as they were not ready for such interaction . Our physicians emphasized that they have not been received any formal training in key communication skills, truth - telling and breaking bad news that are very essential for end of life care . It can be highly satisfying for our physicians and their patients can have better outcomes if they can realize excellent communication skills . Several studies have shown that education about end - of - life care is very important and can improve physicians practices in this area (3134). One study introduced a workshop to teach third year medical students three skills in end of life care . They found that many students could apply these skills to patients care by six months and they felt to improve their skills (35). Thus, the patients should become aware of the required information based on their wishes . So, information about an end stage diagnosis should only be told by patients relatives in a longer time . They stressed that providing patients with unnecessary information would result in loss of patients hope but also deviate the treatment plan . Previous studies have indicated that the patients have different interests in seeking the information and most patients prefer to receive information gradually depending on their emotional responses . Physicians should know that total information disclosure is not helpful for all patients at particular times during their illness and they should take patients needs into account (36). Oncologists should apply various tools to assess the patients performance and the results of such this assessment greatly affect the final decisions (6). Our interviewees emphasized that they assess their patients on the basis of patients performance status and their co - morbid conditions by using formal assessment tools and their personal assessment . Our participants stressed that they were not able to determine the end stage disease certainly and exactly and cannot predict patients survival rate and may lead they cannot make the decision to shift the treatment or withdrawal of curative treatment . The evidence suggested that uncertainty to define end stage disease and patients response rate are the most important factors that may influence oncologists treatment planning (30, 36). Hence, physicians need to share the information and responsibilities with other professionals to ensure that they provide appropriate end of life care (36). In our study, the participants expressed their concern regarding their weak collaboration with other professionals such as psychiatrists, nutritionists, social workers, palliative medicine specialties, etc, whereas this cooperation would improve cancer patients care . Therefore, cancer specialists prefer to only discuss such cases in their tumor boards, and consequently, they experience more distress . Finally, multidisciplinary team - working is a good approach to clarify the general practitioners, specialists and nursing staff role in end of life care . The authors in one study believed that collaboration between primary and specialty physicians cancer care may improve care for these patients (37). Also, another study showed that cancer specialists prefer to consult their patients cases with other specialists such as geriatricians (38). Moreover, oncologists face an underlying moral question raised by expensive treatments in advanced cancer patients as to whether these interventions worth their high cost (11). Of course, in our study, most physicians would choose the standard treatment on the basis of scientific evidence and the high cost of treatment would not change their decisions . So, they may have to discuss with their patients and families about financial issues whereas they cannot avoid effective interventions on the basis of cost and they are responsible to advocate for their patients . Actually, the decision - making in this situation will be very difficult and distressful for our physicians . In one study, researchers demonstrated that financial issues may be problematic factors which can affect physicians practice in regards with decision making as they cannot tell patients that some treatments are more beneficial but more expensive (39). Furthermore, health care and insurance system in different parts of the world face many challenges in regards with terminal illness and health care providers and planners need appropriate resources and programs to improve the quality of end of life care (1). In iran s health care structure, the insurance system does not currently pay all of the oncology drugs costs because the existing insurance coverage is not optimal . Therefore the patients and their families have to pay out of the pocket to undergo these high expenditures treatments or to deprive themselves of some treatment options . In fact, if our patients can use an appropriate insurance coverage and governmental financial support, they can enjoy better treatment services and our physicians endure less distress . The qualitative designation of this study is considered as its point of power because this type of study allows the researcher to clarify cancer specialists perspective in depth . As subjectivity is the main limitation of such studies, we applied certain measures to reduce this risk . So, two researchers read the transcripts and the merging themes were discussed in groups . Another limitation is that we interviewed cancer specialists working in teaching hospitals in tehran and kerman . However, a representative sampling is not the aim of a qualitative study and thematic saturation is very important . Finally, the authors interviewed cancer specialists only, while ethical dilemmas in end - of - life care existed in other settings as well . Uncertainty about the definition of end stage disease for cancer patients causes physicians to be reluctant to shift from curative to palliative treatment . So, the experiences of iranian physicians indicated that although they would like to communicate with their patients more honestly, they endure more distress for disclosing the truth regarding terminal illness in our socio - cultural context . The other proposed reason for challenges our physicians are faced with is unequal availability of end of life care services and financial problems that exist in iran health care setting when it is medically indicated . Besides, as our care providers are not involved in teamwork for end of life care, they cannot share information and understand their responsibilities . According to the results of our study, there is a need for good planning in regards with terminal cancer which requires improvement of physicians communication skills, provision of appropriate services for end of life care, developing multidisciplinary team working and optimal insurance system . It could be suggested that the mentioned viewpoints are basic concerns in our healthcare system . Finally, the results of the present study can help policymaker to develop a guideline for ethical decision making and set educational priorities for physician working in this field . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors.
A 1997 national pediatric database in the united states was reviewed and found that 84,202 children were hospitalized with orthopedic trauma and tibia and/or fibula fracture accounted for 18,111 (21.5%). This indicates that in the pediatric orthopedic trauma setting, fractures of the tibia and/or fibula are the second most common, after femoral fractures.12 the average age for such fractures was 13 years, and the majority were males (71.0%). 9% of the pediatric tibial fractures are open and the most frequent concomitant injuries are fractures of the foot and ankle, followed by humeral, femoral, and radio - ulnar fractures.34 there is a huge variation of injury patterns with open tibial fractures and this has made it difficult to standardize treatment due to altering severity, tissue involvement, and risk of complication, namely infection.5 even though fractures of the tibia and fibula are relatively common in children,6 operative stabilization is not always required as they are usually treated conservatively with a plaster cast or a functional brace.5 indications for surgical stabilization include open fractures, children of age 10 years and above, those with an associated compartment syndrome, polytrauma, unstable fracture patterns, and those who do not maintain acceptable position after closed reduction.7 open fractures are associated with high energy injury, subsequently involving unstable fracture patterns, and significant soft tissue damage; hence, the increased indication for surgical intervention.8 open fractures are classified according to the gustilo - anderson classification.91011 in adults, one of the first line treatment options is reamed locked intramedullary nail fixation . However, in children, this is contraindicated to preserve the proximal tibial epiphysis . External fixators have traditionally been used when surgical stabilization is required in pediatric tibial fractures . However, due to their high complication rates, elastic stable intramedullary nails which do not cross the epiphysis have emerged as an alternative.212 however, there is no conclusive evidence or best practice guidelines for their management . We reviewed the available literature to determine if a preferable method of surgical stabilization could be found . Ovid medline(r) 1946 to present with daily update on march 16, 2014, and embase 1974 to march 14, 2014 . The following advanced search terms (key words) were used: open tibia fracture, fracture fixation, external fixation, intramedullary, and bone nail . The map to subject heading tool was used on the sophisticated ovid search for both databases [tables 1 and 2]. The mesh terms differed slightly between the two databases, so the most similar and appropriate was used . An additional limit was put in place, all child (018 years) and child for medline and embase, respectively . Searches using ovid medline (r) 1946 to present day searches using embase 1974 march 14, 2014 tables 1 and 2 show the searches using ovid medline(r) 1946 to present with daily update and searches using embase 19742014 march 14, respectively . The remaining journal articles were then screened using the abstract, with the application of inclusion criteria . The following inclusion criteria were used: (1) english language only; (2) studies focused on children only; (3) studies in which either external fixation or elastic stable intramedullary nailing was used; (4) studies published in the past 20 years (1994 present). The journal articles retrieved were further analyzed and the following exclusion criteria were implemented: (1) studies not focused on tibial fractures only (2) studies performed in a warzone environment [figure 1]. Methodology flow chart as a result of this literature search and methodology, 12 journal articles278131617181920212223 have been selected to undergo systematic review and critical appraisal . To determine which method of surgical stabilization is superior, outcome measures used in the literature813141516 include: time for fracture healing, time to mobility, time elapsed before the removal of device, incidence of compartment syndrome, incidence of infection, incidence of mal - union, delayed union and nonunion, rate of amputation, measuring limb function using scores such as the enneking score, patient health status questionnaires such as sickness impact profile and medical outcomes study short form provide a useful assessment of patients . Eleven studies (excluding the systematic review) carried out between 1996 and 2012 reported on 294 open fractures of the tibia occurring in the pediatric population, treated between 1979 and 2010, were analyzed . Of those open fractures, 157/294 (53.4%) were treated by surgical stabilization, including 74/157 (47%) managed by elastic stable intramedullary nailing and 83/157 (53%) by external fixation . There were 26 grade i, 38 grade ii, and 56 grade iii fractures; of the grade iii fractures, 22 grade iiia, 21 grade iiib, and 4 grade iiic were recorded; and the remaining 9 were recorded simply as grade iii . Of those open fractures treated by external fixation, there were 8 grade i, 17 grade ii, and 31 grade iii; of the grade iii fractures, 10 grade iiia, 15 grade iiib, and 4 grade iiic were recorded, the remaining 2 were recorded simply as grade iii . Of those open fractures treated by elastic stable intramedullary nailing, there were 18 grade i, 21 grade ii, and 21 grade iii; and of the grade iii fractures, 12 grade iiia and 6 grade iiib were recorded . Average age was recorded specifically to open fractures in only 3 of the studies, it was found to be 11 years and 3 months . Average time to union in open fractures only was also recorded in just 3 of the studies, it was found to be 23.4 weeks . Healing complications recorded in those open fractures treated by elastic stable intramedullary nailing were 10 delayed unions, 4 leg length discrepancies, 1 mal - union, and 1 nonunion . Other complications in this group included 1 deep infection, 2 superficial infections, 1 case of cellulitis, 2 cases of compartment syndrome, and 7 secondary procedures . In those patients with open fractures treated by external fixation, healing complications included 15 delayed unions, 2 leg length discrepancies, 2 mal - unions, and 1 nonunion . Other complications in this group included 5 pin tract infections, 1 superficial infection, 1 deep infection, and 3 cases of osteomyelitis [table 3]. Results (pooled data from 12 papers appraised in discussion) as a product of the literature search and methodology, 9 case series, 1 case control study, 1 cohort study, and 1 systematic review were finally used for review . All the studies were analyzed and subsequently assigned scores using the sign level of evidence table [table 4].24 sign evidence level score for appraised journals the high sign evidence level scores allocated to the studies under review are representative of the poor quality of scientific evidence available in the literature . Critical appraisal of the 12 studies have been performed systematically, according to the study design, following an initial assessment of two fundamental weaknesses in all the journal articles . Unfortunately, due to the nature of open fractures and the study designs associated with the journal articles documenting them, there are two inherent weaknesses in all the appraised papers . There is a consistently low sample size and an absence of randomization . In 11 of the studies undergoing appraisal (excluding the systematic review), 157 open fractures were treated with either of the methods of surgical stabilization under investigation . A mean of 12.8 open fractures (range 431) were treated with either elastic stable intramedullary nailing or external fixation in the studies . Due to the small sample sizes used in the studies, they are underpowered and so, given the relatively low incidence of open fractures in children, it is hard to overcome this . Ideally, randomization would be implemented in a study, determining which method of surgical stabilization to be utilized in the treatment of open tibial fractures in children . This would reduce bias and enable us to make a fair comparison between the two treatment options . In the studies under review, the decision regarding the choice of stabilization method has either been subjected to a set of criteria, left at the treating surgeon's discretion, or not mentioned . There is a trend in the literature, which is displayed well in the cohort study conducted by kubiak et al.7 that higher grade fractures, particularly those of gustilo grade iiib and iiic, are usually treated with external fixation . It is well understood that higher grade fractures have worse outcomes, and subsequently, this is reflected by more complications and a longer time to union in those treated by external fixation . However, with a random assignment of treatment method, this selection bias could be avoided . Unfortunately, randomization is not appropriate in the treatment of open fractures for a number of reasons . This is because open tibial fractures are severe injuries which can be limb and life threatening . In addition, open tibial fractures are relatively uncommon injuries and so, enrolling sufficient patients to enable randomization in a study would pose a major problem.2526 case series are studies conducted with relatively small populations, all of whom receive the same exposure . Case series are regarded as low quality of scientific evidence studies for a number of reasons . The lack of a control group means there is no group of patients without the specified condition or a group not receiving the same treatment to draw comparisons with . Case series are also prone to bias, and in particular, selection bias . In general, the study protocols of the case series appraised were poorly defined, and often very vague . Most of the studies were retrospective reviews of patients medical records, notes, and radiographs from the databases at their respective institutions, within a time period.13171819212223 the use of consecutive patients is very important in a case series, as it prevents the selective use of cases, depending on their results . Unfortunately, only one of the case series under review, by monsell et al.,8 has stated clearly the use of consecutive patients . All of the patients meeting their criteria, so although consecutive use of patients is implied, it cannot be confirmed.1317192021 the remaining studies have not used consecutive patients.182223 this suggests selective use of patients, and consequently, selection bias must be considered . Another aspect of the study design prone to bias is the criteria, or more so the lack of criteria, used to determine what method of surgical stabilization was implemented . Given the nature of a case series, and in particular, those which review retrospectively, randomization is not possible . However, the use of strict criteria to determine what method to use would prevent selection bias to an extent . Five of the case series appraised make no mention of how the decision was made.1318192021 however, this may have actually been due to a lack of information in the medical records, given their retrospective nature . In a study by buckley et al.,23 the decision was left to the treating surgeon's discretion . In studies by vallamshetla et al.17 and cullen et al.,22 there was usage of criteria to make the decision, but it lacked clarity and specificity . Only the prospective case series written by monsell et al.8 accurately documented strict criteria to determine their method of surgical stabilization . In summary, the majority of study protocols were poorly defined, with minimal information given on the inclusion and exclusion criteria used to acquire the populations used, and a retrospective approach to acquire information was used . Furthermore, strict criteria to decide on treatment options were only explicitly stated in one of the case series . However, it is important to mention that clinically relevant outcomes were recorded in many of these case series, and although they are neither validated outcomes nor possess the specificity to the question posed in this dissertation, they can still be used effectively . In the case control study by pandya and edmonds,2 a computerized search of an institution's billing database (department of pediatric orthopaedics, children's hospital and research centre oakland, university of california san francisco, oakland) was used to acquire the records which were reviewed retrospectively . Using this search, patients were classified into 2 groups . A case group of those with open fractures was compared with a control group of those with closed fractures, and all the patients were treated with elastic stable intramedullary nails . Identical patient selection and exclusion criteria were applied to both groups, indicating that the study was designed in a way aimed at minimizing bias . However, it is not fair to say that the cases and controls have been taken from comparable populations, as there was a significantly greater incidence of polytrauma in the case group containing open fractures (71% vs. 25%) with p = 0.04 . Consecutive patients have been reviewed in this study, which reflects favorably in terms of selection bias, as it indicates that all patients treated with elastic stable intramedullary nails have been included regardless of the desired outcomes . On the contrary, the initial choice to use elastic stable intramedullary nails for fracture treatment was left to the treating surgeon's discretion, as opposed to strict criteria, which in turn infers a risk of selection bias . Expected outcomes based on age, fracture severity, and associated injuries may have allowed the surgeon to choose patients where the result would be favorable to the study's desired findings to reflect on flexible nailing positively . For example, no open fractures above grade iiia were treated, and 10 of the 14 open fractures were grade ii . If the study was compiled of patients with high - grade fractures and associated vascular injuries, then the results may have been less favorable for flexible nailing . In addition, the study is retrospective and thus, all results obtained are dependent on the availability and accuracy of the medical records and so are subjected to scrutiny . Unfortunately, it does not separate the two groups in its results, thus limiting the study's usefulness as extracting data explicitly relating to open fractures was not possible . The same inclusion and exclusion criteria were used for both cohorts, the only difference being the two surgical stabilization methods being compared . However, the external fixation group had a considerably higher proportion of open fractures, and although it was not significant, this indicates an unfair comparison between the groups . In addition to this, the gustilo grading of the open fractures in either group has not been mentioned . Open fractures, and particularly those with a higher grade fractures are known to have less desirable outcomes and these have been treated by external fixation . This may have led to the more favorable results for the elastic stable intramedullary nailing cohort, indicating selection bias . This idea of selection bias is further emphasized as the method of surgical stabilization was chosen by a senior pediatric orthopedic surgeon or a senior orthopedic trauma surgeon, instead of a strict criterion . The systematic review by gougoulias et al.16 aims to identify management strategies applied to treating open tibial fractures in children and summarize the outcomes . Independent quality scoring of the studies was performed by two authors, using the coleman methodology score.2728 the literature search carried out was comprehensive, using medline, embase, cochrane, cinahl, and google scholar, by the following key words: open, tibia, fracture, children, paediatric, pediatric, external fixation, and nailing . Inclusion and exclusion criteria have been stated specifically, amounting to an accurate and reproducible methodology . This systematic review conducted by gougoulias et al.16 has succeeded in combining the data from the studies effectively, with the pooled results revealing some useful information . However, the low quality of the studies must be considered as the majority are case series as well, and no definitive conclusions can be drawn regarding the preferable method of surgical stabilization . As a product of the literature search and methodology, 9 case series, 1 case control study, 1 cohort study, and 1 systematic review were finally used for review . All the studies were analyzed and subsequently assigned scores using the sign level of evidence table [table 4].24 sign evidence level score for appraised journals the high sign evidence level scores allocated to the studies under review are representative of the poor quality of scientific evidence available in the literature . Critical appraisal of the 12 studies have been performed systematically, according to the study design, following an initial assessment of two fundamental weaknesses in all the journal articles . Unfortunately, due to the nature of open fractures and the study designs associated with the journal articles documenting them, there are two inherent weaknesses in all the appraised papers . There is a consistently low sample size and an absence of randomization . In 11 of the studies undergoing appraisal (excluding the systematic review), 157 open fractures were treated with either of the methods of surgical stabilization under investigation . A mean of 12.8 open fractures (range 431) were treated with either elastic stable intramedullary nailing or external fixation in the studies . Due to the small sample sizes used in the studies, they are underpowered and so, given the relatively low incidence of open fractures in children, it is hard to overcome this . Ideally, randomization would be implemented in a study, determining which method of surgical stabilization to be utilized in the treatment of open tibial fractures in children . This would reduce bias and enable us to make a fair comparison between the two treatment options . In the studies under review, the decision regarding the choice of stabilization method has either been subjected to a set of criteria, left at the treating surgeon's discretion, or not mentioned . There is a trend in the literature, which is displayed well in the cohort study conducted by kubiak et al.7 that higher grade fractures, particularly those of gustilo grade iiib and iiic, are usually treated with external fixation . It is well understood that higher grade fractures have worse outcomes, and subsequently, this is reflected by more complications and a longer time to union in those treated by external fixation . However, with a random assignment of treatment method, this selection bias could be avoided . Unfortunately, randomization is not appropriate in the treatment of open fractures for a number of reasons . This is because open tibial fractures are severe injuries which can be limb and life threatening . In addition, open tibial fractures are relatively uncommon injuries and so, enrolling sufficient patients to enable randomization in a study would pose a major problem.2526 in 11 of the studies undergoing appraisal (excluding the systematic review), 157 open fractures were treated with either of the methods of surgical stabilization under investigation . A mean of 12.8 open fractures (range 431) were treated with either elastic stable intramedullary nailing or external fixation in the studies . Due to the small sample sizes used in the studies, they are underpowered and so, given the relatively low incidence of open fractures in children, it is hard to overcome this . Ideally, randomization would be implemented in a study, determining which method of surgical stabilization to be utilized in the treatment of open tibial fractures in children . This would reduce bias and enable us to make a fair comparison between the two treatment options . In the studies under review, the decision regarding the choice of stabilization method has either been subjected to a set of criteria, left at the treating surgeon's discretion, or not mentioned . There is a trend in the literature, which is displayed well in the cohort study conducted by kubiak et al.7 that higher grade fractures, particularly those of gustilo grade iiib and iiic, are usually treated with external fixation . It is well understood that higher grade fractures have worse outcomes, and subsequently, this is reflected by more complications and a longer time to union in those treated by external fixation . However, with a random assignment of treatment method, this selection bias could be avoided . Unfortunately, randomization is not appropriate in the treatment of open fractures for a number of reasons . This is because open tibial fractures are severe injuries which can be limb and life threatening . In addition, open tibial fractures are relatively uncommon injuries and so, enrolling sufficient patients to enable randomization in a study would pose a major problem.2526 case series are studies conducted with relatively small populations, all of whom receive the same exposure . Case series are regarded as low quality of scientific evidence studies for a number of reasons . The lack of a control group means there is no group of patients without the specified condition or a group not receiving the same treatment to draw comparisons with . Case series are also prone to bias, and in particular, selection bias . In general, the study protocols of the case series appraised were poorly defined, and often very vague . Most of the studies were retrospective reviews of patients medical records, notes, and radiographs from the databases at their respective institutions, within a time period.13171819212223 the use of consecutive patients is very important in a case series, as it prevents the selective use of cases, depending on their results . Unfortunately, only one of the case series under review, by monsell et al.,8 has stated clearly the use of consecutive patients . All of the patients meeting their criteria, so although consecutive use of patients is implied, it cannot be confirmed.1317192021 the remaining studies have not used consecutive patients.182223 this suggests selective use of patients, and consequently, selection bias must be considered . Another aspect of the study design prone to bias is the criteria, or more so the lack of criteria, used to determine what method of surgical stabilization was implemented . Given the nature of a case series, and in particular, those which review retrospectively, randomization is not possible . However, the use of strict criteria to determine what method to use would prevent selection bias to an extent . Five of the case series appraised make no mention of how the decision was made.1318192021 however, this may have actually been due to a lack of information in the medical records, given their retrospective nature . In a study by buckley et al.,23 the decision was left to the treating surgeon's discretion . In studies by vallamshetla et al.17 and cullen et al.,22 there was usage of criteria to make the decision, but it lacked clarity and specificity . Only the prospective case series written by monsell et al.8 accurately documented strict criteria to determine their method of surgical stabilization . In summary, the majority of study protocols were poorly defined, with minimal information given on the inclusion and exclusion criteria used to acquire the populations used, and a retrospective approach to acquire information was used . Furthermore, strict criteria to decide on treatment options were only explicitly stated in one of the case series . However, it is important to mention that clinically relevant outcomes were recorded in many of these case series, and although they are neither validated outcomes nor possess the specificity to the question posed in this dissertation, they can still be used effectively . In the case control study by pandya and edmonds,2 a computerized search of an institution's billing database (department of pediatric orthopaedics, children's hospital and research centre oakland, university of california san francisco, oakland) was used to acquire the records which were reviewed retrospectively . Using this search a case group of those with open fractures was compared with a control group of those with closed fractures, and all the patients were treated with elastic stable intramedullary nails . Identical patient selection and exclusion criteria were applied to both groups, indicating that the study was designed in a way aimed at minimizing bias . However, it is not fair to say that the cases and controls have been taken from comparable populations, as there was a significantly greater incidence of polytrauma in the case group containing open fractures (71% vs. 25%) with p = 0.04 . Consecutive patients have been reviewed in this study, which reflects favorably in terms of selection bias, as it indicates that all patients treated with elastic stable intramedullary nails have been included regardless of the desired outcomes . On the contrary, the initial choice to use elastic stable intramedullary nails for fracture treatment was left to the treating surgeon's discretion, as opposed to strict criteria, which in turn infers a risk of selection bias . Expected outcomes based on age, fracture severity, and associated injuries may have allowed the surgeon to choose patients where the result would be favorable to the study's desired findings to reflect on flexible nailing positively . For example, no open fractures above grade iiia were treated, and 10 of the 14 open fractures were grade ii . If the study was compiled of patients with high - grade fractures and associated vascular injuries, then the results may have been less favorable for flexible nailing . In addition, the study is retrospective and thus, all results obtained are dependent on the availability and accuracy of the medical records and so are subjected to scrutiny . Unfortunately, it does not separate the two groups in its results, thus limiting the study's usefulness as extracting data explicitly relating to open fractures was not possible . The same inclusion and exclusion criteria were used for both cohorts, the only difference being the two surgical stabilization methods being compared . However, the external fixation group had a considerably higher proportion of open fractures, and although it was not significant, this indicates an unfair comparison between the groups . In addition to this, the gustilo grading of the open fractures in either group has not been mentioned . Open fractures, and particularly those with a higher grade fractures are known to have less desirable outcomes and these have been treated by external fixation . This may have led to the more favorable results for the elastic stable intramedullary nailing cohort, indicating selection bias . This idea of selection bias is further emphasized as the method of surgical stabilization was chosen by a senior pediatric orthopedic surgeon or a senior orthopedic trauma surgeon, instead of a strict criterion . The systematic review by gougoulias et al.16 aims to identify management strategies applied to treating open tibial fractures in children and summarize the outcomes . Independent quality scoring of the studies was performed by two authors, using the coleman methodology score.2728 the literature search carried out was comprehensive, using medline, embase, cochrane, cinahl, and google scholar, by the following key words: open, tibia, fracture, children, paediatric, pediatric, external fixation, and nailing . Inclusion and exclusion criteria have been stated specifically, amounting to an accurate and reproducible methodology . This systematic review conducted by gougoulias et al.16 has succeeded in combining the data from the studies effectively, with the pooled results revealing some useful information . However, the low quality of the studies must be considered as the majority are case series as well, and no definitive conclusions can be drawn regarding the preferable method of surgical stabilization . The literature describing the treatment of open tibial fractures in children, specifically using elastic stable intramedullary nailing or external fixation, is scarce . There are a finite number of papers addressing open tibial fractures only, and a separate set focusing on either of the two surgical stabilization methods mentioned . However, there is a paucity in the literature, with regards to papers relating to open tibial fractures only (not closed), in combination with external fixation or elastic stable intramedullary nailing . This is furthered by a trend in the studies focusing on the treatment methods under question, where the number of open and closed fractures in a population is stated, but presentation of the results has not been performed separately for the open and closed groups . Consequently, extracting truly relevant data from the results of the chosen papers has proven to be difficult and largely unsuccessful . This review focused on 12 journal articles, following a literature search and an appropriate set of inclusion and exclusion criteria . Only two of the articles contain the desired focus, looking at one of the chosen surgical stabilization methods, simultaneously with open fractures only.28 six of the articles target either one or both of the chosen surgical treatment methods for tibial fractures in the pediatric population, but neglect specificity to open fractures.71718192021 four of the articles target open tibial fractures in the pediatric population, but do not focus on our chosen surgical treatment methods.13162223 the paucity of true relevance to the question posed in this review limits the usefulness of the studies under review to varying extents . As previously mentioned, extracting truly relevant data from the results of the chosen papers has proven to be largely unsuccessful . Very few papers displayed results explicitly relating to open fractures, with a focus on surgical intervention . The combination of open and closed fractures in a results section was commonplace in the literature . For example, giving a single figure for time to union representing both open and closed groups and not two separate figures was a theme - repeated throughout . This meant that only a fraction, if any at all, of the results in the majority of the studies was appropriate for inclusion in our pooled set of results . The omission of so many results across a number of the studies has rendered the results obtained unrepresentative, unreliable, and brings their validity into question . With regards to the results that were successfully extracted from the studies, a number of shortcomings were encountered . Studies, including those conducted by pandya and edmonds2 and srivastava et al.,18 measured time to union as the main outcome measure . Alternatively, the study carried out by al - sayyad20 utilized the healing time of the fractures and another by monsell et al.8 recorded time elapsed from implementation of the fixation device to removal as their respective principal outcome measures . This was furthered by an inconsistency in the units of measurement, altering between days, weeks, and months across the literature . With regard to complications, there were major discrepancies in the recording of infection . Most studies divided infection into pin tract, superficial, and deep including those carried out by vallamshetla et al.,17 grimard et al.,13 and cullen et al.22 however, the study by pandya and edmonds2 neglected this desired level of specificity and recorded all variants under the single broad term, infection . There was also an inconsistency between studies regarding the recording of osteomyelitis as infection or as a separate entity . Studies by buckley et al.23 and cullen et al.22 recorded osteomyelitis separately, whereas the study performed by srivastava et al.18 recorded a patient with osteomyelitis as simply having an infection, disregarding the considerable difference in severity between a pin tract infection and a case of osteomyelitis . Unfortunately, due to a lack of desired focus and the nonsystematic presentation of results in the literature, any efforts at answering the question posed in this review, what is the preferable method of surgical stabilization for open tibial fractures in children, external fixation or elastic stable intramedullary nailing? Have been largely unsuccessful . The literature describing open tibial fractures in children and the methods of surgical stabilization is of a low scientific evidence level and of poor methodological quality . It consists mainly of retrospective reviews of patients medical records, charts, and radiographs . There are no validated outcome measures, making comparison of results between difficult papers, furthered by a nonsystematic presentation of data . The use of patient assessment questionnaires was recorded in only one of the studies reviewed . Although indications exist for the surgical stabilization of open fractures in children, there are no defined protocols in place as there are in the adult population . In agreement with the systematic review of the literature carried out by gougoulias et al.,16 it is obvious that further research is necessary.19 unfortunately, in the 5-year interim from 2009 to 2014, since the publication of this systematic review, only 2 papers of relevance with reliable standing have been published on this topic . Thus, our systematic review re - iterates the paucity of evidence mentioned by gougoulias et al.16 and calls for progress in research in the near future . We have shown that in 5 years, the apparent gap in the medical literature has not been remedied, and conclusive evidence and best practice protocols are still not in place . Until the literature is improved, we are unable to draw scientifically based conclusions regarding the optimal management strategy of open tibial fractures using surgical stabilization . It is difficult to perform randomized studies in open fracture management, and they would probably be considered unethical . Enrolling sufficient patients to enable randomization between different treatments would pose a problem, while the varying severity and concomitant injuries commonly associated with open fractures would prevent a fair comparison . Consequently, high - quality prospective cohort studies with a carefully designed study protocol utilizing a nationalized multi - hospital approach are needed . Documentation of variables including age, soft tissue condition, associated injuries, fracture severity, and information on the surgery should be recorded . Validated outcome measures need to implemented, to assert a consistency in the results of the literature, enabling comparison between studies . These should include time to union, complications, need for further operation, and the use of a universal patient outcomes questionnaire . The suggested research would enhance knowledge, enabling the establishment of protocols for the management of open tibial fractures in children, in which factors such as age, soft tissue condition, concomitant injuries, and fracture severity have to be put into clinical practice . It is difficult to perform randomized studies in open fracture management, and they would probably be considered unethical . Enrolling sufficient patients to enable randomization between different treatments would pose a problem, while the varying severity and concomitant injuries commonly associated with open fractures would prevent a fair comparison . Consequently, high - quality prospective cohort studies with a carefully designed study protocol utilizing a nationalized multi - hospital approach are needed . Documentation of variables including age, soft tissue condition, associated injuries, fracture severity, and information on the surgery should be recorded . Validated outcome measures need to implemented, to assert a consistency in the results of the literature, enabling comparison between studies . These should include time to union, complications, need for further operation, and the use of a universal patient outcomes questionnaire . The suggested research would enhance knowledge, enabling the establishment of protocols for the management of open tibial fractures in children, in which factors such as age, soft tissue condition, concomitant injuries, and fracture severity have to be put into clinical practice.
Opls - aa force field parameters and the tip3p model(22) are employed for potentials of alanine dipeptide and water, respectively . The first - order ermak and mccammon algorithm(1) is implemented in bd simulationswhere dt is a time step, di is the diffusion coefficient of atom i, and xi is a random noise vector obtained from a standard normal distribution . The diffusion coefficients of individual atoms are assigned according towhere i is the van der waals radius and is the solvent viscosity: the experimental values of for pure water and nabr solution are employed. (23) time steps of bd simulations are set to 10 fs, and trajectories of 300 ns are generated . We obtained the result of explicit - water md simulation by carrying out the nvt ensemble simulation including 491 water molecules . The time step of md simulation is set to 2 fs, and trajectories of 100 ns are generated . As was reported,(24) the ramachandran plot of alanine dipeptide strongly depends on the force field parameters.
Type 1 autoimmune hepatitis (aih) is a progressive liver disorder predominantly affecting women that is characterized by the presence of circulating autoantibodies [anti - nuclear antibody (ana) and/or anti - smooth muscle antibody (asma)], hypergammaglobulinemia, and a favorable response to immunosuppressive therapy (1 - 5). Individuals affected with aih often have concurrent non - hepatic autoimmune disorders, such as chronic thyroiditis (9.2%), sjgren's syndrome (7.2%), and rheumatoid arthritis (2.8%), but associations with immune thrombocytopenic purpura (itp) are rare (1.4%) (5). In the present report, we describe the clinical outcome of a patient with aih associated with itp who was successfully treated with prednisolone (psl). A 75-year - old japanese woman was admitted to the national hospital organization shinshu ueda medical center, japan, in july 2013 for further investigation of elevated serum aminotransferase levels and thrombocytopenia . The laboratory data from her referring institution were aspartate aminotransferase (ast) 935 iu / l, alanine aminotransferase (alt) 913 iu / l, total bilirubin 7.7 mg / dl, and platelet count 2.810/l . She had been diagnosed with essential hypertension three years prior and was taking a candesartan cilexetil / amlodipine besilate compound product . Her family history was negative for liver or autoimmune disease, and she denied exposure to agents relevant to hepatitis, such as blood transfusion or herbal (kampo) medicine . The laboratory data on admission at our facility (table 1, 2) showed severe thrombocytopenia and increased levels of hepato - biliary enzymes and gamma - globulin . Platelet - binding igg (pbigg) was negative, but platelet - associated igg (paigg) was 894 ng/10 cells (nl: 47). Her thyroid - stimulating hormone and free - thyroxin levels were within normal ranges, although anti - thyroglobulin (tg) and anti - thyroperoxidase (tpo) antibodies were positive . The diagnostic criteria for disseminated intravascular coagulation (dic) proposed by the japanese ministry of health, labor and welfare were not satisfied in this patient (score: 4). Tests for the hepatitis a, b, c, and e viruses, epstein - barr virus, cytomegalovirus, and herpes simplex virus were all negative . Her human leukocyte antigen (hla) a bone marrow examination uncovered normoplastic marrow with platelet depletion and a megakaryocyte count of 30/l (fig . Ret: reticulocyte, fdp: fibrin / fibrinogen degradation products laboratory findings on admission (2). Ana: anti - nuclear antibody, asma: anti - smooth muscle antibody, ama: anti - mitochondria antibody, anti - lkm1 ab: anti - liver / kidney microsome type 1 antibody, paigg: platelet - associated igg, pbigg: platelet - binding igg, tg antibody: anti - thyroglobulin antibody, tpo antibody: anti - thyroperoxidase antibody, h. pylori ab: helicobacter pylori antibody, ebv: epstein - barr virus, cmv: cytomegalovirus, hsv: herpes simplex virus, hla: human leukocyte antigen the histological findings of a bone marrow examination . Magnification: (a) 40, hematoxylin and eosin (h&e) staining; (b) 400, h&e staining . A diagnosis of itp was made based on the above clinical and laboratory findings . According to the criteria of the international autoimmune hepatitis scoring system (6), the patient's pre - treatment clinical score without histology was 16 (female: + 2, alp (alkaline phosphatase)/alt ratio: + 2, igg level: + 2, ana titer: + 2, anti - mitochondrial antibody (ama): 0, viral markers: + 3, drugs: + 1, alcohol: + 2 and immune disease: + 2), and indicative of definite aih . The patient promptly began treatment with 30 mg / day (0.6 mg / kg / day) of psl on day 5 of admission, which quickly restored her liver enzyme levels to within normal limits (fig . 3a and c), infiltration of lymphocytic and plasma cells, and mild interface hepatitis around the portal vein (fig . (d) the specimen showed infiltration of inflammatory cells consisting of lymphocytes and plasma cells, with mild interface hepatitis in the portal zone . Magnification: (a) 40, hematoxylin and eosin (h&e) staining; (b) 40, azan - mallory staining; (c) and (d) 400, h&e staining . Following an uneventful treatment course, the patient's serum transaminase and igg levels became elevated without thrombocytopenia due to a recurrence of aih when psl was tapered to 5 mg / day . Restoring the steroid dose to 20 mg / day normalized her laboratory findings, and the serum transaminase and igg levels and platelet count have since remained normal for over 19 months with a maintenance dose of 10 mg / day psl (fig . Aih is defined as a chronic liver disease with unknown etiological factors that is associated with aberrant auto - reactivity and a genetic predisposition (1 - 5). In contrast, itp is an acquired autoimmune disorder mediated by antibodies against platelet membrane glycoprotein (gp) ib or iib / iiia complexes and thrombopoietin receptor (8 - 10). The precise mechanism underlying itp remains elusive (11), and itp complicating aih is rare and of uncertain pathogenesis (12 - 14). In japan, given that type 1 aih represents the overwhelming majority (15) of aih cases, all reported cases of aih associated with itp have been type 1 . Summarized 16 cases of aih associated with itp appearing in the japanese literature (12). While aih preceded itp in 5 cases, the disorders manifested simultaneously in the others . In agreement with these findings, wada et al . Reported on a patient with a six - year history of aih who developed itp (13), and yamaike et al . Relapses of aih and/or itp were not found in any case . In our patient, either aih and itp developed simultaneously or aih shortly preceded itp, because liver histology (biopsied 9 days after commencing steroid therapy) showed very mild fibrosis (fig . 3b). The first - line therapy for both aih and itp is corticosteroids (1 - 5). Roughly 24 - 50% of aih patients experience relapse during steroid tapering or withdrawal (1,15). Approximately 75% of patients with itp respond to corticosteroids, but only 5 - 30% achieve a sustained remission (16). To our knowledge, the present case is the first of its kind, showing relapsing aih and non - relapsing itp during steroid tapering . We suspected that the response thresholds of the two diseases to psl were different in our subject . Hla class ii molecules on antigen - presenting cells play a crucial role in triggering the immune response, which begins with the recognition of peptide antigens in the hla class ii groove by the t - cell receptor of cd4 t cells through direct contact of both molecules . We previously reported that the most influential gene associated with type 1 aih susceptibility was hla - drb1 * 04:05 (17,18), while drb1 * 15:01 conferred disease resistance (19). Strong associations between anti - gp autoantibodies and hla class ii genes have been identified, as follows: anti - gpiib - iiia antibody association with drb1 * 04:05 and dqb04:01; and anti - gpib - ix antibody with drb1 08:03 and dqb1 * 06:01 (20). The hla typing pattern in the present case was drb1 * 04:05 and drb1 * 15:01 . Thus, the drb1 * 04:05 allele may be linked to aih associated with itp . However, it is difficult to explain the low frequency of aih with itp, although the immunologically different mechanisms of the two disorders, which remain unresolved, may be involved . Since itp and aih manifest as autoimmune - mediated disorders, the treatment for both conditions is psl . Here, aih recurred after psl tapering but itp did not . This differential immunosuppressive effect is of clinical interest and may provide insights into the mechanisms and interplay of autoimmune diseases.
We conducted a preliminary screening of the 16s rrna methylase - producing bacilli on our gram - negative microbial stock of 2,877 strains isolated from japanese hospitals within the past several years . Arbekacin, a semisynthetic aminoglycoside belonging to the kanamycin group, requires 2 modifications at the (6) aminogroup and the (2) hydroxyl group for inactivation, so this agent is not inactivated by known plasmid - mediated aminoglycoside - modifying enzymes . 512 mg / l) was used as a marker for screening the 16s rrna methylase - producing strains . All arbekacin - resistant strains were subjected to polymerase chain reaction (pcr) analysis to detect rmta, rmtb, or arma, and all strains were pcr positive, except for a strain of acinetobacter demonstrating a very high level of resistance to arbekacin (mic 1,024 mg / l). This strain was later shown to produce both aminoglycoside 6-acetyltransferase and 2-adenyltransferase (12), so arbekacin was inactivated in this strain by both 6-acetylation and 2-adenylation . Each pcr primer set was used to detect rmta and rmtb genes as in our previous reports (6,7). The pcr primers for amplification of arma were newly designed (forward: 5-agg ttg ttt cca ttt ctg ag-3, reverse: 5-tct ctt cca ttc cct tct cc-3), and the predicted size of the amplicon was 590 bp . These 3 sets of pcr primers were very reliable in detecting rmta, rmtb, and arma genes, respectively . Each pcr amplicon was then subjected to sequencing analyses on both strands to confirm its nucleotide sequences for detecting mutations in the methylase genes . As reported in our previous study, rmta and rmtb genes had been found in p. aeruginosa isolates (6,10) and in 1 strain of s. marcescens (7), respectively . As shown in the table, 5 p. aeruginosa strains isolated after our previous report (6) were rmta positive . The rmtb gene was additionally identified in 4 k. pneumoniae, 2 e. coli, and 1 k. oxytoca strains in japan . To our surprise, the arma gene, which had been found in various gram - negative microbial species belonging to the family enterobacteriaceae exclusively in europe as reported by galimand et al . (13), was also identified in japan in 1 strain each of e. coli, s. marcescens, and acinetobacter sp . Notably, the arma and rmtb genes were also recently identified in k. pneumoniae and e. coli in taiwan (9). Furthermore, the genetic environment of the arma gene found in c. freundii isolated in poland was similar to that of k. pneumoniae isolated in france . The genetic environments of the arma gene found in the 3 japanese microbial species, e. coli, s. marcescens, and acinetobacter sp ., (genbank accession nos . Ab116388 and ab117519), were also similar to those found in europe (genbank accession nos . Af550415 and ay220558). These findings suggest that the arma - producing gram - negative nosocomial microbes that harbor a very similar genetic environment carrying the arma gene have spread globally . As described previously, arbekacin still shows a very broad antimicrobial spectrum from gram - positive to gram - negative nosocomial microbes and has been approved solely to treat methicillin - resistant staphylococcus aureus (mrsa) infections in japan since 1990 to ensure the prudent use of this agent . The emergence and presence of the 16s rrna methylase - producing gram - negative bacilli, however, has not been well recognized in japan to date; arbekacin has not been listed among the antimicrobial agents for daily antimicrobial susceptibility testing of gram - negative microbes . The use of semisynthetic aminoglycosides, including arbekacin, in japanese clinical settings for> 10 years may have promoted the emergence and dissemination of the 16s rrna methylase - producing gram - negative microbes in japan . The large amount of various aminoglycosides used in livestock - farming environments could have also been a selective pressure for the emergence and spread of pathogenic microbes that harbor genetic determinants for the newly identified 16s rrna methylases, as exemplified by recent isolation of arma - producing e. coli from swine in spain (genbank accession no . Since acquisition of multidrug resistance against clinically important antimicrobial agents such as carbapenems and fluoroquinolones has been developing rapidly worldwide, the acceleration of even greater aminoglycoside resistance among gram - negative bacilli promises to become an actual clinical concern in the near future, just as vancomycin - resistant enterococci (vre) did in the 1990s (14). The emergence of gram - positive cocci including mrsa and vre that acquire the 16s rrna methylase could also be a grave clinical matter, although fortunately no such hazardous microbes have been identified . Thus, steps must be taken to further block proliferation of these multidrug - resistant gram - negative super microbes, including p. aeruginosa, k. pneumoniae, and acinetobacter spp ., as well as multidrug - resistant cocci such as mrsa and vre, which have acquired an extraordinarily high level of resistance to various aminoglycosides through production of 16s rrna methylases, especially in clinical environments.
Deep brain stimulation (dbs) is a neurosurgical technique aimed at improving functional neurologic disorders . To facilitate intraoperative neurophysiologic microelectrode recording (mer) and neurocognitive testing of the eloquent parts of the brain, dbs is commonly performed via an awake approach under a local anesthetic and conscious sedation . While a deeper plane of anesthesia can be used during the portion of the procedure not involved in testing, an awake and cooperative patient with fully preserved brain function is essen - tial during mer to ensure accurate lead placement 1,2 . Our case involved a developmentally delayed 24-year old, 80-kg male with traumatic brain injury (tbi) as an infant with resultant post - traumatic stroke, hydrocephalus, and right upper extremity hemidystonia, causing a prominent dystonic flexor position at the elbow . The surgical plan included implantation of intracranial dbs leads in the globus pallidus internus in an attempt to relieve the hemidystonia . A peripheral iv was placed and midazolam 2 mg was administered en route to the or . Standard asa monitors were applied along with 2 l / min of oxygen via nasal cannula, while the neurosurgical team prepared for head frame placement . A dexmedetomidine intravenous infusion at 0.5 g / kg / h was started, and a total of 1.2 g / kg of fentanyl was administered incrementally for local anesthetic infiltration at the head frame pin sites . During this period, the patient maintained spontaneous ventilation and did not react to local infiltration, pin insertion, or head frame manipulation . A radial arterial line and second peripheral iv were placed under local and propofol infusion at 100 g / kg / min . Before mer and neurocognitive testing, propofol was turned off in order to transition to the awake segment of the procedure . Once mer was complete, the propofol infusion was restarted to supplement the dexmedetomidine infusion during surgical site closure . The patient's postoperative course was uneventful, and he was discharged home 2 days after the procedure . At patient's 6-month follow up clinic visit, he had a dramatic reduction in his right upper extremity tremor and had a significant improvement in his ability to perform daily activities . Dbs involves the placement of wire electrodes into deep brain nuclei . For movement disorders, these deeper brain structures include the subthalamic nucleus, internal segment of the globus pallidus, and thalamic nucleus ventralis intermedius . Electrical impulses are delivered to these structures with the objective of altering specific neural networks, resulting in a therapeutic effect . The electrodes are then connected to an implanted pacemaker that produces high - frequency stimulations that help ameliorate the clinical manifestations of functional neurologic disorders, while having the added qualities of titratability and reversibility 3 . Targeting specific deep brain structures in dbs surgery is based on stereotactic principles that use advanced brain imaging and atlases . The surgical trajectory is guided by stereotactic platforms, which may be framed or frameless . The deep brain nuclei targets are verified by their electrophysiological signature using intraoperative neurophysiologic mapping . This presents several unique challenges to the anesthesiologist: providing patient reassurance and comfort, especially during head frame placement and burr hole drilling, and maintaining this level of supportive care over a potentially long surgery; ensuring proper positioning to allow for safe and optimal surgical conditions; and maintaining access to the patient's airway while anticipating emergency airway interventions in the event ventilatory compromise occurs under sedation . This is especially important as the head frame system (fig.1) can impair access to the airway, making mask ventilation problematic . Patient cooperation, providing an anesthetic technique that will minimally interfere with mer, and maintaining spontaneous ventilation and airway patency are crucial to a successful outcome in these cases . Finally, an appropriate blood pressure should be maintained in order to minimize the risk of intracranial bleeding, a well - known complication in dbs procedures 4 . The anesthetic management of an awake craniotomy has changed over the past 20 years in an attempt to address the aforementioned challenges . Currently, the most popular technique is the asleep - awake - asleep technique . This employs a heavier sedation or general anesthesia during the initial stages, alternating with consciousness using rapid - onset medications with a short duration of action during brain mapping and neurocognitive testing 2 . After mapping is complete, deep sedation or general anesthesia can be reestablished for surgical closure and removal of the pins . Propofol, remifentanil, and dexmedetomidine are some of the anesthetics that have been used for awake craniotomy (table1). While propofol and remifentanil are short - acting, propofol can attenuate mer and remifentanil may cause muscle rigidity . Both drugs can result in respiratory depression, so they must be titrated carefully . While high doses of dexmedetomidine can abolish mer, low dose infusion rates (0.30.6 g / kg / h) usually preserve mer integrity, while also providing analgesia and sedation without respiratory depression 1 . The -2a receptors in the locus ceruleus are responsible for the sedative, analgesic, and sympatholytic effects of dexmedetomidine . This specific effect over -2a receptors may allow cortical neurons to continue functioning upon stimulation in contrast to propofol or even barbiturates that produce generalized neuronal hyperpolarization . Commonly used anesthetic agents in awake craniotomies and dbs in a recent case study, 6 pediatric patients with severe dystonia successfully underwent dbs procedures with the use of low - dose dexmedetomidine as part of the anesthetic technique with unimpaired neuroelectrophysiological signals 5 . Since it does not directly affect the activity of subthalamic neurons, dexmedetomidine may be an ideal sedative medication for neurophysiologic monitoring 6 . Low - dose dexmedetomidine (0.10.4 g / kg / h) infusion has been shown to produce mer from subthalamic neurons similar to mer during the awake state 7 . Additionally, dexmedetomidine use has decreased the intraoperative need for antihypertensive medications used to prevent intracranial hemorrhage 4 . As seen in the presented case, the surgeon was able to perform successful cortical mapping during low - dose dexmedetomidine infusion allowing the patient to follow simple verbal commands . There was no evidence of respiratory depression, and dexmedetomidine also likely decreased the amount of narcotic needed for this stimulating procedure . It has been well - documented in the literature that dexmedetomidine decreases the need for narcotic administration in various surgical procedures . Despite the patient's severe dystonia and developmental delay dexmedetomidine helped facilitate this by decreasing the patient's anxiety and restlessness during the procedure and allowing for an easy transition from sedation to responsiveness . While dbs is most commonly performed for generalized dystonias, there are few reports in the literature describing dbs for tbi - induced dystonias . Here, we have presented a case of dbs in an awake patient with post - traumatic hemidystonia . Although various anesthetic techniques and combinations of drugs have been described for an awake craniotomy, dexmedetomidine appears to be useful in procedures, involving dbs and neurophysiologic monitoring . As the indications for dbs in the pediatric patient population are expanding and the demand for this procedure increases, the creation and implementation of standardized protocols guiding the complex anesthetic management for these cases would be of value.
There are no p waves and the rhythm is irregularly irregular, with a variable ventricular rate between 110 and 160 bpm . The qrs complexes are usually <120 ms unless there are preexisting bundle branch block, accessory pathway, or rate - related aberrant conduction . Fibrillatory waves, small, irregular waves seen as a rapid - cycle baseline fluctuation, may be seen . Af can be distinguished from atrial flutter (afl) by the presence of both saw - tooth wave configuration and slower atrial rates and from atrial tachycardia (at) with variable atrioventricular (av) block, which usually presents with an atrial rate of approximately 150 beats / min because the atrial rate in at is regular though the conduction to the ventricles is not . Paroxysmal af is self - terminating with episodes lasting <7 days, persistent af is nonself terminating and last more than 7 days, and permanent af last for more than 1 year . Many possible mechanisms are implicated in the pathophysiology, but it is thought to arise as a result of ectopic activity from tissues surrounding pulmonary veins (pvs) and other specialized tissues . They may occur at any age although it has been more in males, and the elderly and adults with valvular heart disease, especially with mitral valve (mv) lesions . Standard treatment methods include the control of ventricular rate, the control of rhythm with antiarrhythmic and prevention of thromboembolism . Surgery can also be used as a method of ablation, radiofrequency ablation (rfa) has however become accepted as the treatment of choice for drug - refractory cases, comprising mainly of ablations of peripulmonary areas as well as ablation of the av node (avn) with subsequent insertion of a permanent pacemaker . Rfa for af in south - east asia is under - reported, as most systematic have come from developed nations . In this report, we reviewed cases of af in patients treated at the cardiac electrophysiology department of madras medical mission, india, between the years january 2010 and march 2014, with view to describing the burden of af, electrophysiologic characteristics, associations, lines of management, as well as the initial outcome following radiofrequency catheter ablations (rfa). The study was carried out at the cardiac electrophysiology department of the institute of cardiovascular diseases, madras medical mission, india . We retrospectively studied records of cases of af that underwent cardiac electrophysiologic studies (eps) carried out from january 2000 to march 2014 . Af was diagnosed based on standard criteria . In our study, we described the demographic characteristics of the patients, the indication for the procedure and the prevalence of associated cardiovascular morbidity in the patients . We also observed the percentage of cases with recurrent af following previous rfa and documented the frequency of the various early complications of rfa and the success rate of the procedure . Patients had been chosen for cardiac electrophysiologic assessment if they had recurrent, drug refractory palpitations, recurrent palpitations with preference for ablative therapy over pharmacological, recurrent palpitations in association with syncopal attacks or dyspnea, symptomatic bradycardia, tachycardiomyopathy, and recurrent shocks for patients with automatic implantable cardioverter defibrillator device . Patients with significant basal bradycardia and av nodal disease were not considered suitable for rate limiting drugs and were considered for pv isolation (pvi) with or without permanent pacemaker implantation (ppi). Catheters used were quadripolar 6f for high right atrium, his and right ventricular apex, lasso 20 pole 7f or lasso spiral 7f for left atrial mapping, 20 pole optima spiral 6f, reflex on 20 pole and ibi lasso 20 and 10 pole for pv mapping, decapolar 6f for coronary sinus and ept blazer ii 7f std curve, j and j cordis webster medium curve 7f, cool flex (st . Transeptal punctures was obtained for deploying 8f sheath for ablation, and preface (johnson and johnson) sheath for placement of optima 20 pole catheters . The tachycardia was induced on programed atrial stimulation or with isupril infusion and vigorous protocols . In 21 patients (42.9%), three - dimensional (3d) electroanatomical mapping system (st . Jude ensite velocity) was employed creating a fusion with offline acquired computed tomography images to define the left atrium and pvs . Oral anticoagulation was stopped at 23 days before the ablation procedure . Throughout the procedure, the activated clotting time was maintained between 250 and 300 s using intravenous heparin . Antiarrhythmic drug treatment was suspended for the day of the ablation procedure and restarted the following day . For cases where avn ablation was indicated, radiofrequency (rf) energy were delivered at a site where the compact avn signals were optimal (a: h: v = 1:2:3) to produce complete heart block (chb). The patient was observed for more than h to ensure chb persisted . In patients with previous pacemaker implantation, the pacemaker was reprogramed to voo, avn was mapped at a site where h: v was 1:4 before rf energy (50c, 50 w) was used to create chb . At the end of 45 min post - rfa if patient remained in chb, device was reprogramed to vvi mode . Where tricuspid valve (tv) inferior vena cava (ivc) isthmus linear lesion was performed, a standard of 480 s, 50c, 50 w was used . For circumferential pv ablations (pva), after identifying the pv potentials, ablation lesions were delivered during sinus rhythm around the left and right superior and inferior pvs, resulting in termination of af followed by the absence of electrical potentials within the pv postablation a power of 30 w and a temperature of 45c was achieved using 7f st . Electrical disconnections into pv were confirmed with spiral catheter recordings documenting the absence of electrical potentials within the pv postablation . In 11 patients (22.4%), rf energy by conventional catheter was inadequate, and cool path irrigation tip catheter was used . Where patient remained in af post - rfa, under deep sedation and after confirming the absence of intracardiac clots and after giving intravenous amiodarone 150 mg bolus followed by 50 mg infusion, a single synchronized cardioversion (150 j, biphasic) was delivered using r2 pads to convert to stable sinus rhythm . For cases where avn ablation was indicated, radiofrequency (rf) energy were delivered at a site where the compact avn signals were optimal (a: h: v = 1:2:3) to produce complete heart block (chb). The patient was observed for more than h to ensure chb persisted . In patients with previous pacemaker implantation, the pacemaker was reprogramed to voo, avn was mapped at a site where h: v was 1:4 before rf energy (50c, 50 w) was used to create chb . At the end of 45 min post - rfa inferior vena cava (ivc) isthmus linear lesion was performed, a standard of 480 s, 50c, 50 w was used . For circumferential pv ablations (pva), after identifying the pv potentials, ablation lesions were delivered during sinus rhythm around the left and right superior and inferior pvs, resulting in termination of af followed by the absence of electrical potentials within the pv postablation a power of 30 w and a temperature of 45c was achieved using 7f st . Electrical disconnections into pv were confirmed with spiral catheter recordings documenting the absence of electrical potentials within the pv postablation . In 11 patients (22.4%), rf energy by conventional catheter was inadequate, and cool path irrigation tip catheter was used . Where patient remained in af post - rfa, under deep sedation and after confirming the absence of intracardiac clots and after giving intravenous amiodarone 150 mg bolus followed by 50 mg infusion, a single synchronized cardioversion (150 j, biphasic) was delivered using r2 pads to convert to stable sinus rhythm . The data were analyzed using spss statistical software version 15 (spss, inc ., chicago, illinois, usa). Forty - nine cases of af documented following cardiac eps were reviewed, comprised 23 males and 26 females . The frequency of associated cardiovascular diseases in the patients studied are diabetes mellitus 8 (16.3%), hypertension 18 (36.7%), coronary heart disease 14 (28.5%), hypertrophic cardiomyopathy 1 (2.0%), tachycardia - induced cardiomyopathy 1 (2.0%), mv prolapsed 1 (2.0%), dilated cardiomyopathy 1 (2.0%), degenerative aortic valve disease 1 (2.0%), atrial septal defect 1 (2.0%), congenital bicuspid aortic valve 1 (2.0%), rheumatic heart disease 1 (2.0%), myxomatous mv 1 (2.0%), and hypothyroidism 1 (2.0%). Over the study period, a total of 28 (3.3%) of these rfa were for patients with af . The distribution of indications for cardiac electrophysiologic assessment in the patients were recurrent, drug refractory palpitations 16 (32.6%), drug - refractory paroxysmal af 7 (14.3%), sick - sinus syndrome (sss) 3 (6.1%), persistent af 3 (6.1%), palpitations with syncope / presyncope 5 (10.2%), resuscitated cardiac arrest 1 (2.0%), syncopal attacks 3 (6.1%), af with fvr 4 (8.2%), palpitations with dyspnea 4 (8.2%), tachy - brady sss 2 (4.1%), and suspected sss with avb 1 (2.0%). There were three cases of previous rfa, one for typical avn reentry tachycardia (avnrt), and two for af . Documented arrhythmias at baseline are as follows: af 22 (44.9%), at / afl / af / sinus pauses 5 (10.2%), afl / af 3 (6.1%), regular narrow qrs tachycardia in 4 (8.2%), regular narrow qrs tachycardia with af 3 (6.1%), regular wide qrs tachycardia 2 (4.1%), irregular narrow qrs tachycardia 2 (4.1%), at / af 2 (4.1%), irregular narrow 2 (4.1%), combinations of regular and irregular narrow qrs tachycardia 1 (2.0%), afl / sinus bradycardia 1 (2.0%), af / atrial ectopics / sinus bradycardia1 (2.0%), and afl / af / pvc 1 (2.0%). The basic electrophysiologic characteristics of the study group are shown in table 1 with sample surface and intracardiac electrograms in figures 1 and 2 . Basic electrophysiologic characteristics of the study group variable p waves and ventricular rate in surface electrocardiogram irregular potentials from the high right atrium in atrial fibrillation echocardiographic findings were documented in 36 (73.5%) of patients . These include dilated left atrium 6 (16.7%), global hypokinesia 4 (11.1%), concentric left ventricular (lv) hypertrophy 3 (8.3%), and mild lv dysfunction 2 (5.6%). Asymmetrical septal hypertrophy, left atrial clot with global hypokinesia, severe lv dysfunction, atrial septal defect, and moderate lv dysfunction were all present at frequency of 1 (2.8%) while 17 patients (47.2%) had a normal echo study . It was rapid (above 100/min) in 31 (91.2%), controlled on medication in 2 (5.9%), and normal in 1 (2.9%). Fourteen (58.3%) of these did not have any sustained inducible tachycardia, 9 (37.5%) had inducible af while af was persistent in 1 (4.2%) without induction . The ventriculoatrial activation pattern was documented in 22 (43.1%), being concentric decremental in 13 (59.1%), and absent in 9 (40.9%). Af was paroxysmal in 40 (81.6%), persistent in 5 (10.2%), chronic in 3 (6.1%), whereas a diagnosis of lone af was made in 1 (2.0%). The frequency of associated arrhythmias is as follows: tachy - brady sss 6 (12.2%), at 5 (10.2%), afl 3 (6.1%), sss 3 (6.1%), and ventricular tachycardia (vt) 2 (4.1%) while there was one patient (2.0%) for each of the following: typical avnrt, sss / at, at / afl, typical avnrt / at, and atrioventricular nodal disease . Twelve (24.5%) had avn ablation, 10 (20.4%) had circumferential pva [figure 3]. Isthmus lesions were applied in 3 (6.1%), 2 (4.1%) had ablations of the focus of the initiating at . Avn ablation with isthmus lesions, as well as pva with isthmus lesions was both applied in 1 (2.0%). Avn ablation with ppi was done in 2 (2.7%) cases, one with associated af with fast ventricular rate, the other a case of tachycardia - bradycardia sss . Circumferential ablation of pulmonary veins rfa was not applied in 21 (42.9%) patients, reasons including: associated vt, considered for rfa of vt with 3d electroanatomical mapping and artificial implantable cardioverter - defibrillator implantation (1), deferment for pvi with 3d electroanatomical mapping (1), deferment for avn ablation with ppi at a later time (2), no intervention planned because af was not sustained (1), normal ep study and considered for hutt test (1), plan to optimize medications, to consider rfa if af persisted (3), medical therapy was recommended (6), recommendation for continued monitoring and later review (5), recommendation for pvi and ppi (1). Af with fvr developed in one patient who had a previous ppi for past indication of symptomatic afl with fast ventricular rate and intermittent prolonged chb . The pacemaker (axios s biotronik) was first reprogramed to voo and after mapping the avn, rfa was used to created chb, after which the device was reprogramed to vvi mode at a rate of 40/min . Of the 28 patients who had rfa, 11 (40.7%) had his bundle ablation on account of associated fast ventricular rate, 10 (20.4%) had ablations around the pvs (5 all pv ostia, 4 left common trunk, and right upper and lower pulmonary ostia, and 1 left superior and inferior pvs), 3 (6.0%) had ablations involving the tv ivc isthmus / coronary sinus - ivc isthmus on account of associated afl, 3 had ablations of ectopic atrial sites: superior crista region (1), para - hisian (1) and left right atrial free (1) sites for associated inciting at and one had ablation around the following: left superior pv, left atrial appendage, mitral isthmus, and tv - ivc isthmus . The patient was direct current - cardioverted and placed on medical therapy pending later review . In one patient (9.1%), it was only modified with resulting intermittent chb and complete right bundle branch block post - rfa . For the three that had inciting at, rfa was successful in 1, unsuccessful in 1, and empirical in another . Of the 21 (42.9%) patients not treated with rfa, 8 (38.1%) had normal eps, 4 (19.0%) needed to optimize medication before considering rfa, and 2 (9.5%) needed preparation for ppi . The following indications were all obtained in only 1 (4.8%) patient: asymptomatic, though persistent af, multiple atrial trigger sites in elderly with dilated left atrium, significant bradycardia in combination with av disease, chronic af, need for 3d electroanatomical study for pvi, underlying hypertrophic cardiomyopathy, and underlying dilated cardiomyopathy . Cardioactive medications recorded in our patients include warfarin 15 (30.6%), pradaxa 1 (2.0%), antiplatelets 11 (22.4%), statins 7 (14.35), diltiazem 9 (18.4%), amiodarone 13 (26.5%), digoxin 5 (10.2%), beta - blockers 13 (26.5%), flecainide 1 (2.0%), and angiotensin - receptor blockers 6 (12.2%). Pulmonary edema with accelerated hypertension and sinus tachycardia had developed in the observational period postprocedure, with respiratory acidosis, hypoxia, and hypotension postintubation, requiring elective intubation and inotropic supports . No mortality was seen . This study describes the results of cardiac electropysiologic study and catheter ablation of cases of af carried out in the electrophysiology department of madras medical mission between january 2000 and march 2014 . The mean age of 57.3 years in our sample is higher than the figure of 48 years reported by nasser et al . And the 53 years reported by oussama et al . This may be explained by late referrals in a center from a less developed nation . The most frequently associated cardiac condition was hypertension, followed distantly by coronary heart disease and diabetes . Reporting from iran found a much lower prevalence of hypertension though it was still the most common associated disease . However, nielsen et al . Reporting from denmark, found a markedly higher association with hypertension, similar to our own study . It is noteworthy that 3.3% of total ablations in madras medical mission over the study period were for cases of af . In comparison 1.25% of ablations reported by awan et al . From pakistan were for af and 1.7% was reported by iturralde - torres et al . From mexico . Madras medical mission being a quaternary - level referral center for interventional cardiology in india, a higher hospital prevalence for conditions requiring complex cardiac interventions would be expected . Most cases of af (81.6%) were diagnosed as paroxysmal . Majority (89.5%) of the cases reported by williamson et al . Were chronic . Their study was published in 1994 . As eps becomes more available and affordable, less severe cases are referred for investigation . A much lower success rate, 4560%, was recorded by chevalier et al ., but this was in the first 100 cases at their center . A total of 81 (95%) of 85 pvs could be completely isolated in a single - balloon technique by klein et al . The complication rate was 2.04%, and there was no mortality in this study . In their worldwide survey, the rates in our series are therefore comparable to that obtained in other reputable centers worldwide . It is noteworthy that this is the first systematic report, to the best of our knowledge, of relatively large number of cases of af our center . The reported distribution in types of af, the burden of af, the success and complication rates of af ablation from our center are thus new contributions to the medical literature . The nationality of patients was not included in the data collected and, the study being retrospective, gaps in the data recorded could not be filled . Important characteristics including family history of arrhythmias and sudden deaths, blood pressures, body mass index, electrolytes, echocardiographic function indices, renal function indices, details of pharmacological treatments, and serum lipid profile were also not part of the data retrieved during data acquisition . Follow - up data was also not collected to determine the intermediate - term success rate . This study shows that rfa of af had a high success rate and very low incidence of complication.
These two clinical entities are observed over time as separate diseases . Epidemiological and clinical evidence, as well as experimental observations have suggested a link between rhinitis and asthma leading to a definition of allergic rhino - bronchitis or united airways diseases and the concept of one airway one disease . Most important of them are pollens, dust mites, and animal products (4). House dust mites dermatophagoides pteronyssinus (df p) and dermatophagoides farinae are the most common indoor aeroallergens all over the word . Other aeroallergens animal origin, which are often described as a cause of respiratory allergies are cockroach, feathers and animal hair (5). Clinical epidemiological and pathophysiological studies suggest a strong functional and immunological relationship between the nose and bronchi and survey results report that pollens, especially grass pollens are the major cause of respiratory allergies worldwide (6, 7). The aim of this study was to determine hypersensitivity to the most common aeroallergens among our patients with nasobronchial allergy and to determine whether there are differences in hypersensitivity between rhinitis and asthma . The study is a retrospective, population analysis of the results of skin prick tests to aeroallergens in patients with nasobronchial allergy . The study included 2254 patients, aged from late adolescence (from 16 years of age) to adults, who were tested at the department of dermatovenerology, clinical centre of banja luka, during ten years period . Ambulatory patients, who were referred by family doctors, otolaryngologist, dermatologists, or pulmonologists were subjects of testing . Patients were tested by skin prick test, which is used worldwide as an assured and rapid method for allergy screening . In the first series there were seven allergens: df p, weed pollen mixture, grass pollen mixture, tree pollen mixture, feathers, animal dander and cockroach (blatella germanica). Patients who tested positive for the grass pollen mixture, were further tested for: cocksfoot (dactilys glomerata), meadow grass (poa pratensis), rye - grass (lolium perenne), timothy (phleum pratense), cultivated wheat (triticum aestivum) and corn (zea mays). Patients who tested positive for the weed pollen mixture, were further tested for: ragweed (ambrosia elatior), mugwort (artemisia vulgaris), sorrel (rumex acetosella), plantain (plantago lanceolata) and wall pellitory (parietaria officinalis). Patients who tested positive for the tree pollen mixture were further tested for: birch (betula verrucosa), hazel (corylus avellana), elder (sambucus nigra), linden (tilia cordata) and ash (fraxinus americana). According to the diagnosis in order to perform the necessary statistical tests we used the statistical software package spss for windows (version 13). For the analysis of the data, descriptive and inferential statistics methods where used . From descriptive statistical parameters the mean value and measures of variation were used, which describe the main characteristics of the data in a quantitative sense . From inferential statistical methods student s t - test, person the limit value of the existence of a statistically significant difference was set at p<0.05 . The total sample of our study included 2254 patients with nasobronhial allergy, 1376 (61%) women, and 848(39%) men . The difference between number of female and male patients was statistically significant (t test; p<0.01). Almost three times more patients, had allergic rhinitis than asthma (t test; p<0.01). In the rhinitis group were 957 (58.6%) were female and 677 (41.4%) were male patients, mean age was 45.7216.1 . In the asthma group 419 (67.6%) were women and 201 (32.4%) were men, mean age 45.6816.0 . In both group of all the patients, highest recorded number of positive prick tests was df p (27.5%) and weed pollens (21.9%), followed by grass (18.3%) and tree pollens (10.1%). Although there were more female than male patients in our total sample (p<0.001), results show that the number of positive prick tests, according to all allergens was larger in male patients (2 test, p<0.05). The patients with allergic rhinitis have a higher number of positive skin prick tests to df p, and all pollen mixtures, than patients with asthma (2 test, p<0.05). For cockroaches, feathers and animal hair, determined by a small number of positive skin prick tests, there were no statistically significant differences between patients with rhinitis and asthma (table 1). Positive skin prick tests in the total sample, by the sex of patients and type of allergic disease . * dermatophagoides pteronyssinus results of skin prick test for individual weed pollens in the total sample and by group of disease show that they were mostly positive to ragweed (28.9%), then followed by mugwort (11%) and plantain (8.1%). More patients with allergic rhinitis than with asthma had positive skin prick test to ragweed and sheep sorrel (2 test, p<0.05). Other weed pollens showed no statistically significant difference between the two groups of patients (table 2). Positive skin prick tests to weed pollens in the total sample tested to six individual, grass pollens showed highest number of positive tests to cocksfoot (14.4%) and meadow grass (14.3%). This was followed by rue - grass (12%) and wheat (10.2%). Patients with rhinitis had more positive tests for cocksfoot (15.3%), but the patients with asthma for meadow grass (12.6%). There was no statistically significant difference for grass pollens between the two groups of patients, except for timothy grass (2 test, p<0.032), in rhinitis group . Positive skin prick tests to grass pollens in the total sample of patients, the highest number of positive tests, was to birch pollen (7.3%), then hazel (5.7%), while for the other tree pollens, there were a small number of positive skin reactions . Both groups of patient had the highest positive tests for birch, but without statistically significant difference, as for the other tree pollens (table 4). Main findings of this study are that our patients with nasobronchial allergy more often have allergic rhinitis than asthma, and that df p is the most common cause of allergy . Although in the study there were more women than man, allergy was more often found in men . It is consistent with the results of similar studies which included more women than men, and with a higher incidence of adult non - atopic rhinitis in women . However, there are studies that found no difference in the gender distribution (3). The fact that a significantly greater number of patients had allergic rhinitis rather than asthma coincides with epidemiological data on the incidence and prevalence of these diseases in adolescence and adulthood (1, 7). Finding that df p is the common allergen in both groups of patients in our study, especially in the rhinitis group, is consistent with the results of a large number of similar studies (3, 8). When it comes to pollens, we found that the greatest number of positive skin prick tests was to weed pollens, followed by grass pollens and the smallest number for tree pollens . Aerobiological and allergic studies show that the pollen map of europe is changing and that depends of cultural factors, major international moving and climate changes (9, 10). A number of studies provide data that grass pollens are the main source of respiratory allergies worldwide (11, 12, 13, 14). In the same studies, tree pollens are generally found as well as in our study, according to the frequency in second place behind the grass and weed pollens . However, in recent years, weed pollens allergy has been increasing in certain parts of france, italy, austria, croatia and bulgaria (15). Our research, as the majority of studies in europe, shows that ragweed pollen is the leading weed pollen (6). In hungary, at least 60% of the patients who have an allergy to pollen are allergic to ragweed pollen (16). In croatia, which is a geographically close region, nearly half the patients with seasonal rhinitis and asthma have had sensitization to ragweed (17). In our study, after ragweed, the second most common weed pollen is mugwort . Ragweed and mugwort have nearly identical flowering season, and clinical and serological studies in europe suggest that hypersensitivity to this two pollens are frequently associated (18). Plantain, third weed pollen in our study, is cited as a significant cause of pollinosis in temperate regions of north america, australia, europe as well as in japan (19). The most common grass pollens in our study is cocksfoot and meadow grass . In similar studies meadow, cocksfoot and rye - grass are stated as the most common allergens (20, 21). Our result show that the birch is most usually allergenic tree pollen which is consistent with results from other studies that identified it as one of the most common causes of allergic rhinitis in europe (5). In the literature, numbers of adults which are allergic to birch vary depending on geographic region (22). Authors from the united kingdom were recommended that birch pollen is one of the seven allergens which are sufficient for identification of hypersensitive individuals in epidemiological studies (23). This pollen is often referred to the cause of pollen allergy in central and northern europe (24, 25). Our results show that a small number of patients have positive skin prick tests for cockroach, animal hair and feathers . Distribution of these allergens varies depending on the geographic region, climate and housing conditions, and the literature data are different . In recent years, a number of studies have investigated that cockroach exposure is a major risk factor for the development of asthma (26, 27). However, the results for cockroach allergy are similar to ours, as was also confirmed by croatian authors (28). Some studies show that one third of patients with respiratory allergy have an allergy to cat allergens, while multicenter study from china noted significant number of respondents have dog hair allergy (29). Our study, like the others, showed a very low percentage allergy for animal hair (30). More patients with nasobronchal allergy have rhinitis than asthma . Although majority of patients were female, allergy is more common in men, than in women . Dermatophagoides pteronyssinus and weed pollens are the most common aeroallergens for both groups of patients . The rhinitis group of patients had the greatest number of positive skin prick tests for house dust mite and all pollens, than the asthma group . Cocksfoot is the most common grass pollen in rhinitis group, and meadow and in asthma group of patients.
In 1935, rous and beard were the first to describe the progression of virus - induced papillomas to carcinomas in rabbits 1 . During subsequent decades, it has been widely accepted that the development of human cancer follows a multi - stage process involving tumor initiation, promotion and progression 2 . These stages are paralleled by an accumulation of several mutations in genes regulating critical cellular pathways, which provide a growth advantage for individual tumor cells . In this regard, only a few genetic modifications enable the clonal expansion of normal cells during tumor initiation . Additional mutations further support tumor growth during promotion, and tumor cells finally develop a malignant phenotype including invasive growth and metastasis during progression 3, 4 . Concerning colorectal cancer (crc), it has been known for several decades that carcinomas mostly develop from adenomas . In 1988, vogelstein et al . Described four specific mutations that accumulate during the progression of adenomas to carcinomas 5 . These mutations have subsequently been shown to involve so - called care- and gatekeeper genes, which enable genetic or epigenetic instability and support tumor growth respectively . Although several other mutations involved in crc development have been added during recent years, most sporadic crcs are believed to develop as a consequence of the mutations initially described by vogelstein et al . Various factors have been shown to be responsible for the accumulation of mutations in crc including inheritance and environmental factors (e.g. Composition of diet, obesity, diabetes mellitus, smoking, alcohol consumption) 6 . Of note, also chronic inflammation is regarded as an important risk factor for the development of cancer . This is especially apparent in patients with inflammatory bowel diseases (ibd), which have an increased risk for the development of colitis - associated crc depending on the duration and severity of intestinal inflammation 7 . Whereas the contribution of chronic inflammation to tumor development has been widely attributed to its ability to induce mutations (e.g. Through reactive oxygen or nitrogen species) 8, recent data propose a direct effect of inflammation on tumor growth . Several pro - inflammatory cytokines released by innate and adaptive immune cells have been shown to regulate cancer cell growth and thereby contribute to tumor promotion and progression . Among these, interleukin-6 (il-6) seems to take a center stage in human cancer development . An increased expression of il-6 has been detected and associated with an unfavourable prognosis in patients with various types of cancer including both sporadic and colitis - associated crc . Experimental studies found an activation of important oncogenic pathways in cancer cells through il-6 . In this article, we review the role of il-6 during sporadic and inflammation - associated crc development . Besides data from human crc, molecular mechanisms of il-6 signaling in experimental models of crc will be discussed with an outlook on future therapeutic implications . Following its initial description as a b cell differentiation factor in 1986 9, a versatile role has been attributed to il-6 for the regulation of innate and adaptive immunity . In fact, il-6 is involved in the regulation of the acute phase response through the induction of acute phase proteins in hepatocytes, the differentiation of monocytes to macrophages, the proliferation and resistance against apoptosis of t cells and th2 cytokine production 9 - 11 . Importantly, recent data suggest a critical role for il-6 during chronic inflammation, since il-6 is required for the induction of effector th17 cells and inhibits the differentiation of regulatory t cells . Il-6 is produced by various cell types including monocytes, macrophages, fibroblasts, keratinocytes, endothelial cells, b cells, t cells, and also several tumor cells 12 . However, monocytes and macrophages seem to be the predominant producers of il-6 during acute and t cells during chronic inflammation 13 . In these cells, il-6 expression is regulated through the activation of several transcription factors such as nf - kb, c / ebpbeta (caat / enhancer - binding protein beta) or ap-1 (activator protein 1). The regulation of il-6 expression through these transcription factors enables a rather unspecific upregulation of this cytokine during nearly every type of inflammation . Il-6 binds to the membrane - bound il-6 receptor alpha (mil-6r, cd126) subunit of the il-6 receptor on target cells . This complex then associates with a homodimer of the second receptor subunit, glycoprotein 130 (gp130, cd130), and thereby enables the activation of subsequent downstream signaling . This so - called classic signaling is restricted to cells expressing both the mil-6r subunit and gp130 . Although gp130 is widely expressed, mil-6r expression is limited to hepatocytes and some leukocytes 14 . Importantly, a soluble form of il-6r (sil-6r) enables il-6 signaling in cells that do not express mil-6r through trans - signaling . Sil-6r is either produced by limited proteolysis of mil-6r through the metalloproteinase adam17 or translation from a splice variant of il-6r mrna 14 . Sil-6r binds il-6 with a similar affinity as mil-6r and the complex of sil-6r and il-6 can interact with gp130 on target cells that don't express mil-6r . As signal transduction during both classic and trans - signaling these include the activation of janus kinases (jaks) with a subsequent activation of the transcription factor signal transducer and activator of transcription 3 (stat3) through phosphorylation . Stat3 activation has been shown to be an important step for promotion and progression through the induction of various target genes . These target genes are involved in tumor cell survival (e.g. Bcl-2, survivin, mcl-1), proliferation (e.g. C - myc, cyclin d1, cyclin b), angiogenesis (e.g. Hif1alpha, vegf), metastasis (e.g. Mmp2, mmp9), cell adhesion (e.g. Icam-1, twist1), inflammation (e.g. Il-6, il-17, il-23, cox2) and others (for review see 15, 16). Among these, suppressor of cytokine signaling 3 (socs3) is a direct inhibitor of stat3 signaling . Although the influence of these pathways on immune cells has been known for several years, only recent data provide a molecular insight on the importance of il-6 signaling during tumor development . Concerning the role of il-6 in b cell differentiation, it's not surprising that multiple myeloma was among the first types of cancer that have been shown to be influenced by il-6 . In fact, il-6 acts as an auto- and paracrine growth factor for myeloma cells and antibodies against il-6 inhibit myeloma cell growth in vitro and in vivo 17 . Today, il-6 is regarded as an important tumor promoting factor in various types of human cancer including glioma, lymphoma, melanoma as well as breast, ovarian, pancreatic, prostate, renal and, of course, colorectal cancer . Various studies have found an increased expression of il-6 in patients with crc, where il-6 levels are elevated in the serum of patients and in tumor tissue itself 18 - 20 . According to a review article by knpfer and preiss, il-6 expression can be associated with tumor stage, size, metastasis and survival of patients with crc 21 . Although data on il-6 expression in sporadic crc are well proven, there is an on - going debate about the source of il-6 expression in non - inflammation - associated cancer . For instance, belluco et al . Described an association of a polymorphism of the il-6 promoter with serum levels of this cytokine in patients with crc 22 . An additional mechanism could be an amplification of the il-6 gene, as reported in patients with glioblastoma, although this mechanism has not been shown for crc so far 23 . Another explanation for increased il-6 levels could be an infiltration of tumors with il-6 secreting inflammatory cells as seen in colitis - associated cancer (cac). As mentioned above, patients with inflammatory bowel diseases such as crohn's disease (cd) and ulcerative colitis (uc) have an increased risk for the development of cac . For instance, the cumulative risk for the development of crc in patients with uc is about 17.8% after 30 years of disease 24 . In patients with large bowel involvement of cd, there is a 8.3% risk for crc over a period of 30 years 25 . In fact, various studies have shown that il-6 is an important regulator of ibd pathogenesis, mainly through its effect on immune cell function 11 . For instance, il-6 trans - signaling has been shown to activate t cells in the lamina propria of patients with ibd and induces resistance of these cells against apoptosis through upregulation of anti - apoptotic factors such as bcl-2 and bcl - xl 27 . Due to the correlation of il-6 expression with crc prognosis and the increased expression of il-6 in patients with ibd, il-6 is thought to act as a link between chronic inflammation and tumor development . Importantly, corvinus et al . Could show an increased phosphorylation of stat3 in crc cells, but not in normal intestinal epithelial cells 28 . These data propose a functional relevance for il-6 directly acting on tumor cells in sporadic crc . This direct effect of il-6 on colorectal cancer cells is likely mediated through trans - signaling, as intestinal epithelial cells usually do not express mil-6r 14 . In fact, evidence for this hypothesis comes from various experimental studies in mouse models of colitis - associated cancer . In 1992, lahm et al . Were among the first to describe a growth - promoting effect of il-6 on colorectal cancer cell lines in vitro 29 . However, it was not until 2004 that becker et al . Were able to show that il-6, secreted by lamina propria t cells and macrophages, is also important for the development of cac in vivo 30 . In the widely used aom+dss mouse model of cac, the authors found an il-6 dependent growth of intestinal tumors that was dependent on il-6 trans - signaling in intestinal epithelial cells, possibly with downstream activation of stat3 . The tumor promoting effect of il-6 could be inhibited through treatment with anti - il-6r antibodies or sgp130fc, a designer variant of soluble gp130 that specifically blocks trans - signaling . Similarly, grivennikov et al . Found reduced tumor development in il-6 -/- mice exposed to the aom+dss model 31 . In this work, the authors underlined the importance of an il-6 dependent stat3 in tumor cells as critical for proliferation and the inhibition of apoptosis . These data were complemented by bollrath et al . Showing increased cac development following aom+dss treatment in gp130y757f mice, which have stat3 hyperactivation, and attenuated tumor development in conditional knockout mice with a specific deletion of stat3 in intestinal epithelial cells 32 . The effect of stat3 on tumor cells was mediated through the expression of various regulators of g1/s and g2/m cell cycle progression . Interestingly, in both studies defective il-6/stat3 signaling was impairing intestinal inflammation in aom+dss treated animals . In this regards, il-6 and stat3 were proposed as important regulators of intestinal homeostasis . In addition to il-6 and stat3, in a study by rigby et al . The specific deletion of socs3 in intestinal epithelial cells of mice treated with aom+dss was associated with increased tumor development 33 . In contrast, overexpression of socs3 in vitro was able to reduce proliferation of crc cell lines . Whereas most effects of stat3 have been attributed to a direct regulation of cell cycle progression through this transcription factor,, we were able to show that il-6 induces the expression of vegfr2 (vascular endothelial growth factor receptor 2) in intestinal epithelial cells and enables an auto-/paracrine feedback loop, which promotes proliferation of tumor cells in the aom+dss model of cac through vegfr2-dependent stat3 activation 34 . Despite substantial progress of crc treatment during recent years, crc still belongs to the leading causes of cancer related death in industrialized countries . Therefore, new therapeutics, especially for patients with advanced disease, are desperately required . According to the growing evidence supporting a critical role for il-6/stat3 signaling during various aspects of both sporadic and inflammation - associated crc development, therapeutics targeting this pathway could be promising options for affected patients . In fact, several therapeutics inhibiting the il-6/stat3 pathway have been developed for the treatment of human disease . These include anti - il-6 or anti - il-6r antibodies, soluble gp130fc (sgp130fc) and selective small molecule jak inhibitors 35 (table 1). Anti - il-6 antibodies were among the first therapeutics targeting the il-6/stat3 pathway to be used in clinical studies on human cancer during the 1990s . These include the treatment of multiple myeloma or aids - associated kaposi's sarcoma 36, 37 . However, these treatments only produced a limited response, and, as the antibody used (be-8) was from murine origin, an immune response against this therapeutic was induced in treated patients 38 . As a consequence, the chimeric, murine - human monoclonal anti - il-6 antibody siltuximab was generated during subsequent years . Although there are currently no data on the use of siltuximab in patients with crc, a study analyzing the effect of siltuximab in various types of solid cancer including crc has just been finished and the results are awaited eagerly (clinicaltrials.gov identifier: nct00841191). However, initial clinical studies using siltuximab in patients with metastatic renal cancer, ovarian cancer or prostate cancer provided mixed results 39 - 41 . A possible explanation might come from the fact that antibody - associated il-6 is not cleared from the circulation and thus increases systemic il-6 concentrations 35 . So far, several clinical studies have shown a promising effect of tocilizumab in chronic inflammatory diseases and led to the approval of this antibody for the treatment of rheumatoid arthritis and juvenile idiopathic arthritis by the fda 43 . Although there are preclinical data on a therapeutic effect of tocilizumab in cancer, clinical trials in human cancer are missing so far . Another strategy to inhibit il-6/stat3 for instance, the small molecule jak1 and 2 inhibitor ruxolitinib has shown promising results in a clinical trial in patients with post myeloproliferative neoplasms and acute myeloid leukemia 44 . Currently, there are no clinical data on the use of ruxolitinib in crc . However, cep-33779, another jak inhibitor, could successfully reduce tumor growth in experimental cac 45 all of the treatments mentioned above inhibit both classical and trans - signaling, and therefore also block physiological functions of il-6 . In contrast, a specific inhibition of trans - signaling could be achieved by sgp130fc . Sgp130fc is a designer cytokine that specifically binds il-6/sil-6r complexes and therefore only blocks trans - signaling . In fact, sgp130fc has been shown to be effective for the treatment of experimental cac in the study by becker et al . The substance will soon enter clinical development and it will be interesting to see its effect on human cancer 46 . Il-6 has been shown to be an important tumor promoting cytokine that enforces proliferation and anti - apoptotic effects in tumor cells . Clinical and experimental data strongly propose a contribution of il-6 signaling to the development of both sporadic and colitis - associated colorectal cancer development . In this regard, several components of the il-6 signaling pathway such as il-6, il-6r, jak have been proposed a promising targets for crc therapy . As initial clinical studies using anti - il-6 therapy are on their way, it will be interesting to see, if preclinical data will live up to their promise.
Ridge augmentation refers to the procedure that was performed for cases with insufficient vertical or horizontal volume of bone to augment the height or width of the alveolar ridge by executing particulated or block bone graft . Ridge augmentation is a type of onlay graft, and thus, the possibility of bone resorption after grafting and dehiscence of the upper soft tissues is high . The procedure involves one wall of the bony defect, and the healing of grafted tissues is dependent on the blood supply from the recipient bone tissues . The maxillary sinus is wrapped well within its walls, and maxillary sinus bone graft shows healing similar to the wound created by tooth extraction . Nevertheless, for cases whose residual bone volume is definitely insufficient and cases with poor blood supply, or to shorten the healing period, autogenous bone graft is recommended2,3 . Nonetheless, due to several problems associated with the harvest of autogenous bone, recently, the possibility that autogenous tooth bone graft may be a substitution for autogenous bone graft has been suggested4 . Autogenous tooth bone grafts always require that the tooth of the patient be extracted, and thus, its use is limited in many cases . Therefore, familial tooth bone grafts that treat the extracted teeth of immediate family members as bone - graft materials have been introduced . A 45-year - old male patient was transferred from another dental clinic for maxillary anterior horizontal ridge augmentation . The dentist planned to insert a 6-unit fixed prosthesis after implant placement in the #13 and #23 areas . The condition of the #13 and #23 areas involved an alveolar ridge of insufficient width. (fig . 1) the decision was made to extract the lower right 3rd molar (#48) of the patient and to treat this tissue as autogenous tooth bone graft material . The dentist planned to extract two impacted 3rd molars from the patient's daughter, prepare them as blocks and powder, and use them as graft materials. (figs . 2, 3) on april 10th, 2010, the lower right 3rd molar of the patient was extracted and prepared as powder - type graft material . On the same day, the impacted 3rd molars of the daughter were extracted, prepared as block and powder graft materials, and stored . On april 26th, 2010, in the maxillary anterior edentulous area (#13-#23), a flap was elevated by crestal incision . Block graft materials were grafted to the labial side of the maxillary canine area (#13 and #23 labial area), and additionally, powder graft materials were grafted to the vicinity with tissue adhesive (greenplast; green cross corp ., the area was covered with an absorbable collagen membrane (ossix plus; orapharma inc ., louis drive warminster, pa, usa), and the wound was sutured . Good bone healing without special complications was observed, and the patient was returned to the referred dental clinic for implant placement. (fig . 7) eight months after the surgery, implantation was performed at a local clinic . The condition of horizontal ridge augmentation was good, and thus 4 implants were placed in the #13, #12, #22, and #23 areas . 8, 9) the final prosthesis was carried out in local clinic successfully, further follow up was not performed . A 49-year - old male patient visited our clinic for pain in the maxillary left 2nd premolar (#25) and the treatment of implants in the 1st and 2nd molar areas (#26-#27). After diagnosis of an abscess in the #25 root apex, tooth extraction was decided upon . The patient was scheduled to undergo extraction of the mandibular right impacted 3rd molar (#48 impacted molar). This tooth and an impacted tooth from his son were prepared as graft materials, and maxillary bone graft was performed in the #26-#27 areas . 10, 11) on april 22nd, 2010, the #48 was extracted, and the left impacted 3rd molar of the patient's 22-year - old son was extracted . May 7th, 2010, the prosthesis between the #24-#25 area was cut, and the #25 was extracted . A flap was elevated by performing crestal incision on the #25-#27 area, and maxillary sinus bone graft was performed by lateral approach . Autogenous and familial tooth bone graft in powder form were used as bone - graft materials . On august 3rd, 2010, implants (osstem ts iii sa; osstem, seoul, korea, #25: 4 diameter/11.5 length, #27: 5 diameter/11.5 length) were placed in the #25 and #27 area, in a non - submerged type . The primary stability value measured by the osstell mentor (integration diagnostics ab, savedalen, sweden) was shown to be #25: 67 implant stability quotient (isq) and #27: 71 isq, respectively. (fig . 12) prior to implant placement, a bony specimen was harvested from the #27 area using a 2.0 mm diameter trephine bur . A healing abutment was connected, and the wound was sutured . On december 30, 2010, a final prosthesis was installed (prosthetic treatment was performed by dr . 13) the bone tissue specimens collected after 3 months were examined under light microscope . It was confirmed that in the sinus bone graft area, new bone had formed actively in the vicinity of graft materials . New bones formed along the border of the graft material were woven bones, and some bones had already formed short trabecular patterns . In some areas, they formed loose anastomosis with other trabecular new bones formed along the border of other graft materials . The more developed new trabecular bones were connected to the residual alveolar bone in a pattern that was more densely anastomosed. (figs . A 45-year - old male patient was transferred from another dental clinic for maxillary anterior horizontal ridge augmentation . The dentist planned to insert a 6-unit fixed prosthesis after implant placement in the #13 and #23 areas . The condition of the #13 and #23 areas involved an alveolar ridge of insufficient width. (fig . 1) the decision was made to extract the lower right 3rd molar (#48) of the patient and to treat this tissue as autogenous tooth bone graft material . The dentist planned to extract two impacted 3rd molars from the patient's daughter, prepare them as blocks and powder, and use them as graft materials. (figs . 2, 3) on april 10th, 2010, the lower right 3rd molar of the patient was extracted and prepared as powder - type graft material . On the same day, the impacted 3rd molars of the daughter were extracted, prepared as block and powder graft materials, and stored . On april 26th, 2010, in the maxillary anterior edentulous area (#13-#23), a flap was elevated by crestal incision . Block graft materials were grafted to the labial side of the maxillary canine area (#13 and #23 labial area), and additionally, powder graft materials were grafted to the vicinity with tissue adhesive (greenplast; green cross corp ., the area was covered with an absorbable collagen membrane (ossix plus; orapharma inc ., louis drive warminster, pa, usa), and the wound was sutured . Good bone healing without special complications was observed, and the patient was returned to the referred dental clinic for implant placement. (fig . 7) eight months after the surgery, implantation was performed at a local clinic . The condition of horizontal ridge augmentation was good, and thus 4 implants were placed in the #13, #12, #22, and #23 areas . 8, 9) the final prosthesis was carried out in local clinic successfully, further follow up was not performed . A 49-year - old male patient visited our clinic for pain in the maxillary left 2nd premolar (#25) and the treatment of implants in the 1st and 2nd molar areas (#26-#27). After diagnosis of an abscess in the #25 root apex, tooth extraction was decided upon . The patient was scheduled to undergo extraction of the mandibular right impacted 3rd molar (#48 impacted molar). This tooth and an impacted tooth from his son were prepared as graft materials, and maxillary bone graft was performed in the #26-#27 areas . 10, 11) on april 22nd, 2010, the #48 was extracted, and the left impacted 3rd molar of the patient's 22-year - old son was extracted . May 7th, 2010, the prosthesis between the #24-#25 area was cut, and the #25 was extracted . A flap was elevated by performing crestal incision on the #25-#27 area, and maxillary sinus bone graft was performed by lateral approach . Autogenous and familial tooth bone graft in powder form were used as bone - graft materials . On august 3rd, 2010, implants (osstem ts iii sa; osstem, seoul, korea, #25: 4 diameter/11.5 length, #27: 5 diameter/11.5 length) were placed in the #25 and #27 area, in a non - submerged type . The primary stability value measured by the osstell mentor (integration diagnostics ab, savedalen, sweden) was shown to be #25: 67 implant stability quotient (isq) and #27: 71 isq, respectively. (fig . 12) prior to implant placement, a bony specimen was harvested from the #27 area using a 2.0 mm diameter trephine bur . A healing abutment was connected, and the wound was sutured . On december 30, 2010, a final prosthesis was installed (prosthetic treatment was performed by dr . 13) the bone tissue specimens collected after 3 months were examined under light microscope . It was confirmed that in the sinus bone graft area, new bone had formed actively in the vicinity of graft materials . New bones formed along the border of the graft material were woven bones, and some bones had already formed short trabecular patterns . In some areas, they formed loose anastomosis with other trabecular new bones formed along the border of other graft materials . The more developed new trabecular bones were connected to the residual alveolar bone in a pattern that was more densely anastomosed. (figs . It has been reported that in allogenic tooth graft between parents and children and between siblings, specific immune reactions are delayed or reduced if tissue - located histocompatibility antigens (h - antigens) are compatible . Kim et al.5 have reported that if the teeth of 9 to 11-year - old children whose orthodontic therapy was planned were transplanted to the defect area of their parents or siblings, good results can be anticipated . Through a treatment process similar to that used for autogenous tooth bone - graft materials, the teeth extracted from immediate family members were preserved, treated, and stored . Tooth material was prepared as bone graft material; this could be donated, distributed, and grafted to the family for therapeutic purposes . Here, the term " family " refers to brothers, sisters, parents or children . The extraction and the tooth to be donated were teeth that could not be saved by dental treatments, the deciduous teeth, and the wisdom teeth . When a tooth is extracted from a family member and donated or received, the dental clinic obtains the individual's consent for donation as well as consent for transplantation . The consent is signed by the patients themselves or guardians, and a written agreement for treatment of the extracted tooth is signed . Donors are submitted to basic tests for venereal diseases and acquired immunodeficient virus if requested by the donor or the recipient . The recipient should prepare a document that proves the family relationship and sign agreement to transplantation6 . Isograft refers to the graft between genetically identical individuals (e.g., monozygotic twins). It has been reported that monozygotic twins have identical major histocompatibility complexes, and thus graft rejection reactions never occur . The genetic combination involved in tooth bone graft among immediate family members is not 100% identical; nonetheless, it shows a similar trend and the risk for immune rejection reactions is almost removed by the treatments (i.e., decalcification and freeze - drying). Allogenic bone - graft materials treated with decalcification processes do not require tissue compatibility tests such as abo typing . Because familial tooth bone - graft materials are also treated with the decalcification process, special tissue compatibility tests are not required7 . Barrett and reade8 performed tooth isograft in murine renal subcapsular sites and histologically evaluated the results . It has been reported that in teeth in which the root was not completely formed, the formation of alveolar bone and periodontal ligaments was observed . However, in the teeth with complete roots, formation of neither alveolar bone nor periodontal ligaments was observed . In this study, after the isograft of incomplete teeth, the alveolar bones were formed . In addition, in 1982, experimental studies were conducted on the isograft of immature molars in the intraosseous as well as extraosseous areas in mice . Bone formation was observed not only in the tibial area but also in the kidney area9 . Steidler and reade10 examined the effect of the extracorporeal time involved in tooth isograft in rodents . It was observed that if the extracorporeal time was longer than 30 minutes, pulp degeneration, necrosis of the cementum, resorption of the roots, and osseointegration occurred . In this study, the new bone formation was observed in the vicinity of tooth isograft in the tibia . Barrett and reade11,12 have reported the following results of animal experiments that were performed for the immunological examination of tooth isograft . The 3rd molar tooth of mature mice was grafted to the tibial shaft medulla and the renal subcapsular kidney site . It was observed that in both sites, early pulp degeneration was detected, and the continuous regeneration process associated with the formation of dentin was observed . Tibial shaft isografts were surrounded by bones, and continuous resorption initiated by the coronal dentin was observed . The teeth grafted to the subcapsular kidney site were not surrounded by bones, and coronal resorption findings were not shown . In other words, with regard to the tooth isograft transplanted in the intraosseous area, diverse levels of root resorption and osseointegration were observed . We used familial tooth bone - graft materials for alveolar ridge augmentation and maxillary bone graft and obtained good clinical outcomes . The impacted third molars of the patients themselves were extracted and prepared as autogenous tooth bone - graft materials . Nonetheless, the volume was not sufficient, and thus, the bone - graft materials prepared from the impacted third molar of their children were used in parallel . Four months after alveolar ridge augmentation and 3 months after maxillary bone graft, implants were placed secondarily . Bone healing was good, and the early stability of implants could be obtained readily . The results of histological tests of the specimens collected from case 2 showed excellent new bone formation and bone remodeling phenomena . In this study, only 2 cases were presented, and a mixture of autogenous tooth bone materials and family tooth bone materials was used . The problem of case 1 was that further follow up was not performed in our hospital after completion of final prosthesis in local clinic . The grafted bone in sinus and peri - implant bone were maintained well in case 2 . Thus, it is difficult to perform an accurate clinical evaluation of familial tooth bone graft.
Reinforced surveillance systems aimed at monitoring the introduction of chikv have been implemented in 6 departments in southeastern france, including the var department, where ae . Albopictus has spread since its introduction in 2004, presumably from northern italy (4). On august 29, 2010, a 7-year - old girl (patient 1) with acute febrile syndrome, headache, and abdominal pain sought treatment in the city of frjus (var) 1 day after she had returned from rajasthan, india . Continuous chikv circulation in northern india districts has been reported during 20092010 (www.promedmail.org). Three weeks after the notification of patient 1, another young girl (patient 2) experienced clinical symptoms that began on september 18 with fever, arthralgia, backache, headache, and retro - orbital pain . Patient 2 s physician reported that a young girl (patient 3), a close friend of her patient, showed clinical symptoms compatible with chikv infection at the same time . Patient 3, who lives near patient 1, had invited patient 2 to spend the night of september 15 at her home . A serum sample from patient 3 was collected 1 week after onset of fever and monoclonal antibody capture elisa detected high titers of specific anti - chikv immunoglobulin m. the serum sample also showed a weak rt - pcr signal for chikv . Given that patients 2 and 3 did not report any recent travel to areas endemic for chikv no complications were recorded, but all 3 patients had persistent weakness and joint pain 3 months after the acute phase . Intensive mosquito control measures, including spraying for adult mosquitoes and destroying breeding sites, were undertaken around the patients residences and areas visited by confirmed case - patients . No further cases were found by the active case finding system (a local physician and laboratories network) implemented for 45 days after the declaration of the last autochthonous case . A molecular study of france/2010 chikv strains isolated in frjus obtained from patients 1 (imported case) and 2 (autochthonous case) was performed . Viral genomic rna was extracted from chikv grown once in mosquito c6/36 cells and then subjected to rt - pcr amplification by using a set of primers targeting the structural genes of chikv (7). Paired sequence analysis of the e26k e1 junction showed that the 2 france/2010 chikv strains display a divergence rate <0.05% at the nucleotide level, whereas 100% identity was observed at the amino acid level . Phylogenetic analysis demonstrated that these viral strains belong to a cluster that is closely related to strains from india within the ecsa lineage (figure). The france/2010 chikv isolate from patient 2 might be derived from an indian strain introduced by patient 1 (index case). Genotypes e2 - 211 t, e2 - 312 m, e2 - 386a, 6k-8i, and e1 - 284e that are found in the currently circulating strains belonging to the ecsa lineage were identified in france/2010 chikv isolates (2,3,7). These isolates also display the genotype e1 - 211e specifically shared by viral strains belonging to the asian phylogenetic group (table). The residue ala at position e2 - 264 has not been previously described in any chikv strains . Phylogenetic relationships among chikungunya virus isolates from cases of chikungunya fever in france, based on complete e2 - 6k - e1 nucleotide sequence (2,771 nt) analysis . Phylogenetic analysis was inferred by using the maximum - likelihood method as implemented in mega version 5 software (www.megasoftware.net). The sequence of the strains from france described in this study has been deposited in genbank (accession number pending); other sequences were retrieved from genbank . * molecular signatures were based on the analysis of complete amino acid sequence e2 - 6k - e1 (923 aa). The numbering of amino acid positions refers to the african isolate s27 (genbank access no . Letters in parentheses after strain names refer to east / central / south africa (a), asia (b) and west africa (c) phylogroups . Recent attention has focused on the predominant role of e1 and e2 proteins in successful chikv infection of the anthropophilic ae . Vector competence experiments with la runion/2006 chikv isolates demonstrated the importance of the newly acquired e1-ala226val substitution for efficient transmission by ae . Albopictus from northern italy and from southeastern france showed disseminated infection rates ranging from 75%90% for chikv strains with e1 - 226v (10). The 2 france/2010 chikv strains isolated in frjus have ala at position e1 - 226 (table). The presence of an asp residue at position e2 - 60, found in most of the ecsa chikv strains, may in part counterbalance the less favorable transmission of e1 - 226a strain in ae . Albopictus (table). The thr residue at position e2 - 211 potentiates the infectivity of chikv in ae . The presence of e2 - 211 t in chikv isolates from france underlines the risk for emergence of a fully adapted viral variant if the e1 - 226v genotype was selected during continuous transmission within ae . The efficient chikv transmission in italy and southeastern france sheds new light on its dissemination potential in europe from 1 index case, regardless of the viral genetic background and mosquito species in the region of origin of the imported chikv (1,10,11). In emerging regions, such as italy and runion island, where the seroprevalence in the population was <50% however,> 2 years passed since the end of the epidemic in runion island before a local transmission of chikv was again detected . In europe where sylvatic cycles are absent, vertical transmission may participate in the maintenance and/or cyclic reemergences of chikv . Albopictus that may have more efficient vertical transmission than mosquito populations in eastern italy and tropical regions (11,12). In 2010, southeastern france faced the concomitant emergences of dengue virus (denv) and chikv (13). For each of these viruses, only 2 autochthonous infections were confirmed, which suggests that rapid detection and control measures implemented around imported and autochthonous cases have been efficient . A recent report mentioned the dual emergence of chikv and denv in southeastern france and urged the implementation of specific surveillance and response measures to reduce the risk for arbovirus emergence (14). Since 2006, a specific chikungunya / dengue national preparation and response plan based on rapid detection and investigation of imported and suspected autochthonous cases, mosquito control measures, and efficiency evaluation in the treated areas has been activated from may through november and then modified after annual debriefing meetings involving all partners . In 2010, this model proved to be well adapted to the early detection and control of chikv and denv . Albopictus mosquitoes and the successful emergence of chikv in italy and france, reinforced surveillance and response to chikv and denv dissemination should become a higher priority in europe (15).
Cd47 (originally named integrin - associated protein (iap)) is a cell surface protein of the immunoglobulin (ig) superfamily, which is heavily glycosylated and expressed by virtually all cells in the body . Cd47 was first recognized as a 50 kda protein associated and copurified with the v 3 integrin in placenta and neutrophil granulocytes and later shown to have the capacity to regulate integrin function and the responsiveness of leukocytes to rgd - containing extracellular matrix proteins [14]. Soon after this integrin - associated protein was cloned, it was shown to be identical to the erythrocyte cell surface antigen cd47 . The fact that cd47 is also expressed by cells like erythrocytes, that do not express integrins, indicates that it can be more appropriate to refer to this protein as cd47 than using its original name integrin - associated protein (iap). The protein is fairly well conserved between species and has about 6070% similarity in the amino acid sequence when comparing human cd47 with that of mouse, rat, and bovine cd47 . Cd47 has also been shown to be identical to the oa-3/ovtl3 antigen highly expressed on most ovarian carcinomas [6, 7]. It also shows homology to a protein family of variola and vaccinia viruses [1, 5, 6], the significance of which is still unclear . Cd47 consists of an extracellular igv domain, a five times transmembrane - spanning domain, and a short alternatively spliced cytoplasmic tail . In both humans and mice, the cytoplasmic tail can be found as four different splice isoforms ranging from 4 to 36 amino acids, showing different tissue expression patterns . The 16 amino acid form 2, which is by far the predominant isoform, is expressed in all cells of hematopoietic origin, as well as in endothelial and epithelial cells . In contrast, the 36 amino acid form 4 is expressed primarily in neurons, intestine, and testis . Expression of the 4 amino acid form 1 is found in epithelial and endothelial cells, while the expression pattern of the 23 amino acid form 3 resembles that of form 4 . Despite a study showing that cd47 form 3 and 4 could be associated with memory retention in rats, and that form 2 is predominating in astrocytes, little is known as to what these splice variants mean in terms of possible difference in the functionality of the protein . A new twist in the understanding of cd47 comes from a recent finding that cd47 can be expressed as a proteoglycan with a molecular weight of> 250 kda, having both heparin and chondroitin sulfate glycosaminoglycan (gag) chains . This form of cd47 was found to be expressed in both the human jurkat t cell line and in murine primary t cells, as well as in human umbilical vein endothelial cells (huvecs), murine lung endothelial cells, and in human smooth muscle cells . Functionally, the gag chains at cd47 ser were found to be crucial to inhibit t cell receptor signaling following the ligation of cd47 by its ligand thrombospondin-1 . Early studies of cd47 were based on the use of monoclonal antibodies (mabs) raised against the cd47 protein purified from placenta [2, 11], showing a role of cd47 in mediating an enhanced igg - mediated phagocytosis response in the presence of rgd - containing ligands, such as fibronectin, fibrinogen, vitronectin, or collagen type iv [2, 11]. The same mabs were also found to block neutrophil transendothelial migration stimulated by interleukin 8 (il-8) or the bacterial peptide n - formyl - methionyl - leucyl - phenylalanine (f - met - leu - phe) and to inhibit neutrophil migration across tumor - necrosis - factor-- (tnf-) stimulated endothelial cells, where cd47 on both the neutrophils and the endothelial cells was found to be important . Generation of other anti - cd47mabs, raised against epithelial membrane preparations, showed that cd47 is present at the basolateral membrane of epithelial cell monolayers, that mabs blocking cd47 on either neutrophils or the epithelial cells delay neutrophil trans - epithelial migration, and that efficient neutrophil chemotaxis correlates with an increased neutrophil cell surface expression of cd47 . The basement membrane protein entactin, which contains an rgd sequence, was also found to stimulate neutrophil adhesion and chemotaxis in a cd47-dependent manner in vitro . Generation of cd47-deficient mice further proved the importance of this protein in regulating neutrophil inflammatory responses, by showing an increased sensitivity to bacterial infection due to a delayed neutrophil accumulation in bacterial peritonitis . Cd47-deficient neutrophils also show a strongly impaired rgd - stimulated neutrophil adhesion, phagocytosis, and respiratory burst . For v 3 integrin - mediated cellular responses to the extracellular matrix protein vitronectin, cd47 was found to be required for v 3-mediated binding to vitronectin - coated beads, but not v 3-mediated adhesion to vitronectin - coated surfaces . In addition to its original association with v 3 integrins, cd47 has also been shown to interact with and regulate the integrins 2 1 and iib 3 on platelets [16, 17], the 2 1 integrin on smooth muscle cells, the 4 1 integrin on sickle red blood cells and b lymphocytes [19, 20], the 6 1 integrin in microglia, and the 5 integrin in chondrocytes (figure 1). Thrombospondin-1 (tsp-1) is the prototypic member of the thrombospondin family of extracellular matrix glycoproteins, which are implicated in regulating cell motility, proliferation, and differentiation . The extracellular igv domain of cd47 was found to be a receptor for the c - terminal cell - binding domain (cbd) of tsp-1, since the expression of cd47 in otherwise cd47-deficient cells promotes adhesion to tsp-1 or its cbd, and a functional blocking mab against cd47 can block endothelial cell chemotaxis against tsp-1 or the cd47 binding cbd - peptide 4n1k . It was later shown that tsp-1, its cbd, or the 4n1k peptide stimulates v 3 integrin - mediated cell spreading on vitronectin in a cd47-dependent manner . In platelets, tsp-1, the tsp-1 cbd, or 4n1k activates the platelet iib 3 integrin and induces platelet spreading on fibrinogen, platelet aggregation, and increased focal adhesion kinase (fak) tyrosine phosphorylation, which are all dependent on interaction between cd47 and integrin iib 3 . Furthermore, cd47 was found to mediate a synergistic effect of soluble type i collagen and tsp-1 or 4n1k, which enhance 2 1 integrin - mediated platelet activation or vascular smooth muscle cell chemotaxis [17, 18]. Early experiments also suggested that cd47 regulates tsp-1-induced cell spreading or platelet activation by affecting signal transduction in a pertussis toxin - sensitive way via a heterotrimeric gi protein [16, 24]. Cd47 was later shown to functionally associate with heterotrimeric gi, to suppress camp levels, and mediate the inhibition of erk in platelets and smooth muscle cells . More recently, cd47 ligated by tsp-1 was found to inhibit nitric oxide (no) signaling in vascular cells and to oppose no / cgmp - mediated inhibition of integrin activation to facilitate platelet aggregation . In addition to signaling through gi proteins, cd47 has been shown to signal via the 3 integrin cytoplasmic tail . Although it is not entirely clear how much these two signaling pathways overlap, accumulation of cd47/ 3-integrin - complexes in cholesterol - rich lipid rafts, which appears to depend on both the cd47 igv domain, the multiple transmembrane - spanning domain, and a long range disulfide bond between cys in the igv domain and cys in the transmembrane domain, engage in gi signaling . Cd47 has also been shown to be involved in the regulation of intracellular ca ([ca]i), exemplified by its regulation of an integrin - dependent increase in [ca]i in endothelial cells and tumor cells, and that cd47 synergizes with t cell receptor - stimulated elevations of [ca]i in t lymphocytes [33, 34]. The cytoplasmic tails of the form 2 and form 4 splice variants of cd47 were found to bind to the cytosolic ubiquitin - related proteins plic-1 and plic-2 (plic, proteins linking iap to cytoskeleton). In b lymphocytes, a role of cdc42 and rac has also been suggested in cd47-dependent regulation of neuronal development and neurite formation [36, 37]. Adhesion of intestinal epithelial cells to collagen i induces the association of cd47 with 2 integrins, and cd47 is necessary for collagen i - induced cyclooxygenase-2 (cox-2) expression and epithelial cell migration, which is mediated by g i3 (figure 1). Sirp proteins belong to the ig family of cell surface glycoproteins, where the first member identified was sirp (also known as shps-1, cd172a, bit, mfr, or p84) [3944]. Sirp is highly expressed in myeloid cells and neurons, but also in endothelial cells and fibroblasts, and has three extracellular ig - like domains, one distal igv - like domain, and two membrane proximal igc - like domains [41, 42]. In addition, an alternatively spliced form having only one igv domain has also been reported . In its intracellular tail, sirp has two immunoreceptor tyrosine - based inhibitory motifs (itims), which when tyrosine phosphorylated can bind the src homology 2 (sh2) domain - containing protein - tyrosine phosphatases shp-1 and shp-2 . Additional cytoplasmic binding partners for sirp are the adaptor molecules src kinase - associated protein of 55 kda homolog / skap2 (skap55hom / r), fyn - binding protein / slp-76-associated phosphoprotein of 130 kda (fyb / slap-130), and the tyrosine kinase pyk2 . Sirp is also a substrate for the kinase activity of the insulin, egf, and bpdgf receptors, and the overexpression of sirp in fibroblasts decreases proliferation and other downstream events in response to insulin, egf, and bpdgf . Since sirp is also constitutively associated with the m - csf receptor c - fms, sirp overexpression partially reverses the v - fms phenotype . Two other family members have also been identified, sirp (also known as cd172b) [42, 47] and sirp (also known as cd172 g or sirp2), whose extracellular ig - like domains are similar to that of sirp. However, the cytoplasmatic regions of sirp and sirp are different from that of sirp. Sirp has a very short cytoplasmatic tail with no signaling motifs . Instead, the transmembrane region contains a positively charged lysine residue, which can bind the immunoreceptor - tyrosine - based - activating - motif- (itam-) carrying adaptor protein dnax activation protein 12 (dap12/karap) [49, 50]. Sirp has no recognizable signaling motif or capability to interact with cytoplasmic signaling molecules and is therefore unlikely to generate intracellular signals . Cd47 has been shown to be a ligand for sirp [52, 53] and sirp [54, 55], but does not bind sirp . The cd47/sirp interaction regulates not only a multitude of intercellular interactions in many body systems, such as the immune system where it regulates lymphocyte homeostasis [56, 57], dendritic cell (dc) maturation and activation, proper localization of certain dc subsets in secondary lymphoid organs [5961], and cellular transmigration [62, 63], but also regulates cells of the nervous system (reviewed in [64, 65]). An interaction between these two proteins also plays an important role in bone remodeling [66, 67]. Cellular responses regulated by the cd47/sirp interaction are many times dependent on a bidirectional signaling through both receptors [51, 64, 65] (figure 1). The finding that cd47 on host cells can function as a marker of self and regulate phagocytosis by binding to sirp will be further described in a subsequent section . The interaction between cd47 and sirp has proven to be very specific species, as shown by the relatively weak binding of cd47 from mouse, rat, or cow to human sirp [69, 70]. In addition, the glycosylation of cd47 or sirp does not seem to be necessary for their interaction, but the level of n - glycosylation of sirp has, however, an impact on the interaction such that over glycosylation reduces the binding of cd47 . The long range disulfide bond between cys in the cd47 igv domain and cys in the transmembrane domain is also important to establish an orientation of the cd47 igv domain that enhances its binding to sirp . Ligation of cd47 by anti - cd47 mabs was found to induce apoptosis in a number of different cell types . This phenomenon was first described in jurkat t cells, in anti - cd3 activated but not in resting primary t cells, and in b - cell chronic lymphocytic leukemia (b - cll) cells [72, 73]. Cd47-induced apoptosis can be induced by several different mabs; however, while some of these (e.g., ad22, 1f7, or mabl) show potent apoptosis induction in suspension [7376], others (e.g., b6h12 and 2d3) need to be immobilized to a surface to promote cell death [72, 77]. Of the two sirp - family members known to bind the cd47 igv domain (sirp and sirp), sirp as a soluble fc - fusion protein does not induce cd47-dependent apoptosis, while sirp or sirp bound onto the surface of beads induces apoptosis through cd47 in jurkat t cells and the myelomonocytic cell line u937 . In addition, tsp-1 or the cd47-binding tsp-1 cbd - peptide 4n1k also induces cd47-dependent apoptosis [74, 75, 78, 79]. Indeed, mice deficient in cd47 or tsp-1 sustain oxazolone - induced inflammation significantly longer than wild - type mice due to a deficiency in t cell apoptosis . This form of cell death was initially described to be characterized by cell shrinkage, reduction in mitochondrial transmembrane potential, and exposure of phosphatidylserine (ps) on the cell surface, but to be independent of fas (cd95) or tnf receptor signaling . Classical apoptosis, and it is independent of cysteinyl aspartate protease (caspase) activation [72, 73] (figure 2). Furthermore, inhibitors of actin polymerization or mitochondrial electron transfer prevent cd47-induced ps exposure . In support of a role for the actin cytoskeleton, peripheral blood mononuclear cells (pbmcs) from wiskott - aldrich syndrome (was) patients, where mutations in the was protein (wasp) results in defective cdc42-induced regulation of the actin cytoskeleton, are resistant to cd47-induced apoptosis . Although the mitochondrial transmembrane potential is affected in cd47-induced apoptosis, it does not involve the mitochondrial release of cytochrome c or apoptosis - inducing factor (aif), but does involve the production of reactive oxygen species (ros). In jurkat t cells, it was shown that the inhibition of gi signaling with pertussis toxin can counteract cd47-induced apoptosis, that ligation of cd47 reduces intracellular camp levels, and that camp elevating agents prevents apoptosis by cd47 ligands . This signaling pathway, which likely also involves reduced signaling through protein kinase a (pka), is not only described in t cells, but also in several breast cancer cell lines . In the latter cell type, it was shown that epidermal growth factor can inhibit the cd47 death pathway via protein kinase c (pkc). A yeast two - hybrid screen, where cd47 was used as bait, identified the pro - apoptotic bcl-2 family member bcl-2-homology-3- (bh3-) only protein 19 kda interacting protein-3 (bnip3). In t cells, bnip3 was found to physically associate with cd47, which prevents its degradation in proteasomes and sensitizes t cells to cd47-induced apoptosis [78, 79]. Ligation of cd47 induces the translocation of bnip3 to mitochondria, and attenuation of bnip3 activity inhibits cd47-induced apoptosis, which together suggests that bnip3 is crucial as a mediator of this cell death pathway . Moreover, bnip3 gene expression was found to be increased and regulated by hypoxia - inducible factor-1 (hif-1) following the ligation of cd47 by single - chain fragments of an anti - cd47 mab which kills b - cll cell lines both in vitro and in vivo, where the knockdown of hif-1 represses cd47-induced cell death (figure 2). The finding that a jurkat t cell clone lacking cd47 is resistant to fas- (cd95-) induced apoptosis, but that expression of cd47 restores the sensitivity to fas - ligation, suggested that cd47 can augment fas - induced apoptosis via a mechanism that requires neither cd47 signaling nor its association with lipid rafts . In fact, the lack of cd47 impairs important proapoptotic events downstream of fas, such as loss of mitochondrial membrane potential, cytochrome c release, caspase activation, poly(adp - ribose) polymerase (parp) cleavage, and dna fragmentation . This function of cd47 is likely also important in primary cells, since t cells from cd47-deficient mice are protected from fas - induced apoptosis . In hematopoietic cells, cd47-induced apoptosis has been described in hematopoietic tumor cells [54, 7274, 7678, 81, 82, 84, 85] and in activated primary t or b cells [73, 74, 77, 79]. However, whether apoptosis can be induced through cd47 in nonactivated leukocytes is still somewhat unclear . The only situation where nonactivated t or b cells have been found to undergo cd47-induced apoptosis is when immobilized anti - cd47 mab has been used, but not when using soluble cd47 ligands or mabs known to induce apoptosis in activated cells or tumor cells [73, 74, 79]. Surprisingly, although cd34 hematopoietic progenitors express cd47, they are resistant to cd47-induced apoptosis by either immobilized or soluble mab [76, 77]. In addition, immature human monocyte - derived dendritic cells (idcs) were described as resistant to cd47-induced apoptosis, following incubation with an immobilized cd47 mab for 18 hours . However, another study showed that freshly isolated human monocytes or human monocyte - derived idc undergoes a rapid (within 60 min) cell death in response to the cd47-ligand 4n1k . This cell death, which was described to occur in a subset of cells and where monocytes or idc not affected by 4n1k remain viable in culture, is associated with cellular features previously described for cd47-induced apoptosis, such as not only ps exposure, increased plasma membrane permeability, reduced mitochondrial membrane potential, caspase independence, but also included dna fragmentation . Thus, these findings suggest that although a subset of idc may undergo cd47-induced cell death at an early time point, this may not be detectable at later time points . However, it raises the question if specific subsets of monocytes or idcs are sensitive to this form of rapid cell death whereas others are resistant and maintain their viability in culture . In addition to hematopoietic cells, overexpression of cd47 can induces cell death of cultured cerebral cortical neurons, which is enhanced by the coexpression of sirp and prevented by brain - derived neurotrophic factor (bdnf) when cd47 and sirp are coexpressed . Apoptosis in neurons overexpressing cd47, however, is dependent on caspases and apoptotic cells have condensed apoptotic nuclei with fragmented dna . It has also been shown that endothelial cells incubated under static conditions in the absence of flow increase their expression of tsp-1, which uses the cd47/ v 3 integrin as a receptor to trigger endothelial cell apoptosis . This mechanism also appears to be involved in endothelial cell apoptosis during proatherogenic turbulent flow conditions and in mechanosensitive induction of apoptosis in fibroblasts . Tsp-1-mediated apoptosis, mapped to the type-3 repeat / c - terminal domain of tsp-1, in promyelocytic leukemia cells (nb4-lr1) has also been suggested to depend on the engagement of both cd47 and the v 3 integrin . In contrast to the proapoptotic effects of cd47 described above, it was reported that the tsp-1-derived peptide 4n1 could abolish c2-ceramide - induced apoptosis in primary porcine thyroid cells by preventing reduction in intracellular camp levels, an effect blocked by the functional blocking antihuman cd47 mab b6h12 . A similar effect of 4n1 peptide was also found to inhibit the cytotoxic effects of the anticancer drugs camptothecin and doxorubicin in thyroid carcinoma cells . Although it is unclear how these effects of cd47-ligation can be explained in relation to the proapoptotic effects of this molecule, it is interesting to note that tumor cell tsp-1 overexpression has been linked to disease recurrence and decreased survival [9496], and it was suggested that this pathway could be one explanation behind drug resistance in thyroid cancers . Mature erythrocytes express high levels of cd47, but do not express integrins, which early indicated that other important functions of cd47 could be expected in these cells . The fact that individuals with the rhnull phenotype, which do not express any of the proteins of the rh protein complex, only express about 25% of normal levels of cd47 suggested a close relation between cd47 and erythrocyte rh proteins [5, 97]. In the erythrocyte cell membrane, rh polypeptides associate in a complex with many other proteins (e.g., rh associated glycoprotein (rhag), glycophorin b, lw, and cd47). Another erythrocyte membrane protein complex is formed by the band 3 anion exchanger and several other proteins (e.g., glycophorin a, protein 4.2, and ankyrin). The latter multiprotein complex mediates the anchorage of the erythrocyte membrane to the spectrin cytoskeleton [99, 100]. In addition, it has been suggested that the rh complex and the band 3 complex may in fact be associated in the erythrocyte membrane . Mutations in band 3, or complete band 3 deficiency, in human erythrocytes results in reduced expression of rh polypeptides and rhag and results in a virtual lack of cd47 . Moreover, human erythrocytes deficient in protein 4.2 also show a marked deficiency of cd47 as well as an altered glycosylation of rhag . When combining these finding, a hypothesis was put forward, which suggests that cd47 of the rh complex may indeed form a link to the band 3 complex by binding to protein 4.2 (figure 3). Studies of protein mobility within the erythrocyte membrane have shown that cd47 is associated with the erythrocyte cytoskeleton as being a part of the rh complex, but that cd47 is also present as a noncytoskeleton anchored pool which is more mobile in the erythrocyte membrane . Thus, cd47 in erythrocytes may serve several different functions depending on its grade of mobility in the plasma membrane . It has been suggested that the freely mobile cd47 pool may be of importance to accumulate cd47 in specific membrane areas upon cell - cell contacts, for example, in order to efficiently interact with sirp on other cell types such as phagocytic cells . Importantly, data from studies of murine erythrocytes have shown remarkable differences as compared with human erythrocytes, and the link between cd47, the rh complex, and protein 4.2 in murine erythrocytes is not well understood . First, there are little or no rh polypeptides in erythrocytes from band 3-deficient mice, while the expression of cd47 is only slightly reduced . Second, erythrocytes from cd47-deficient mice were found to contain normal amounts of murine rh and rhag polypeptides . Taken together, the total picture suggests that cd47 seems to interact with rh polypeptides and protein 4.2 in human erythrocytes, whereas the interaction between cd47, rh polypeptides, and proteins of the band 3 complex in murine erythrocytes is still unclear . A progressive decrease in the cd47 expression level has been observed on human erythrocytes stored under blood bank conditions at + 4c for more than 14 days [107109] and in a mouse model of erythrocyte storage which tried to mimic human blood bank conditions . However, the magnitude of reduction in cd47 expression was rather different, from a modest reduction of up to 6% at day 42 of storage, around 30% reduction on day 28 of storage, to a more than 50% reduction on day 14 of storage . Furthermore, a recent study indicated that the cd47 levels of erythrocytes stored for 35 days were not different from that of fresh cells . The discrepancy between these findings may have several explanations, such as the exact storage conditions or methods for the quantification of erythrocyte cd47 expression levels . In addition, the loss of cd47 may also be sensitive to leukocytes remaining in the erythrocyte concentrates . Indeed, a gradual loss of cd47 from erythrocytes during storage was observed in stored erythrocytes irrespective of whether the buffy coat was removed or not before storage, although buffy coat removal resulted in an increased expression level of cd47 at all time points tested, showing a significant correlation between the number of remaining leukocytes and erythrocyte cd47 levels . A study of cryopreserved leukoreduced erythrocytes was unable to detect any effects on erythrocyte cd47 expression levels . Microparticles released in the blood from blood cells or endothelial cells have recently gained interest due to their possible role in regulating a variety of normal or pathological biological functions . Such microparticles are also released from erythrocytes during cryopreservation or storage at + 4c, and these microparticles do among other erythrocyte membrane proteins also carry cd47 [112, 114]. Although the presence of cd47 on these microparticles suggests a mechanism for the observed loss of cd47 from stored erythrocytes, soluble cd47 has also been detected in the supernatants of erythrocytes stored at + 4c . In addition to a possible loss of cd47 on stored erythrocytes, a recent study also indicated that storage as well as experimental aging in vitro results in a conformational change of the cd47 protein . This modification can be detected as a selectively increased binding of the anti - cd47 mab 2d3, which recognizes an epitope different from the epitope involved in the binding of tsp-1 or sirp and recognized by mab b6h12 . However, the use of mouse models has been informative to further understand if the level of cd47 is changing during erythrocyte aging . In these models, biotin is injected intravenously to label all blood cells at one or two specific time points [115, 116]. Analyses of circulating erythrocytes at later time points will then allow for discrimination between older biotin - positive and younger biotin - negative circulating erythrocytes [115, 116]. Using this approach, it has been found that cd47 is gradually lost from the surface of circulating murine erythrocytes, where the oldest erythrocytes may have up to 30% lower cd47 expression levels as compared with younger erythrocytes [115, 117]. Sickle cell disease, caused by a mutation in the hemoglobin chain and a formation of insoluble intracellular aggregates of mutated hemoglobin, resulting in characteristic sickle shaped erythrocytes, is associated with severe vasoocclusive crisis [118, 119]. One important mechanism behind this pathology is the enhanced adhesion of sickle erythrocytes to vascular endothelium [118, 119]. Cd47 was shown to play a role in the pathologic sequestration of sickle erythrocytes to vascular endothelium under shear stress by binding to tsp . It has been found that the reticulocyte - enriched fractions of sickle erythrocytes are most efficiently binding to endothelial cells, that this function requires heterotrimeric g proteins and tyrosine kinase activity, and is mediated by 4 1 integrins on the reticulocytes . Interestingly, sickle erythrocytes also show an increased expression of the cd47 epitope recognized by mab 2d3 . In gaucher's disease, a sphingolipidosis caused by glucocerebrosidase deficiency, macrophages accumulate glucosylceramide following the excess phagocytosis of erythrocytes, which converts splenic macrophages to pathogenic gaucher cells . Erythrocytes from patients with untreated gaucher's disease have been found to have reduced levels of cd47, which can be reversed upon enzyme - replacement therapy . It has been suggested that the anemia associated with the untreated disease can in part be explained by a combination of reduced cd47 levels together with other morphological erythrocyte abnormalities observed in this disease . The distinction between self and non - self is central to the maintenance of integrity in a multicellular organism and allows for a powerful and successful elimination of potentially dangerous pathogens, while carefully preserving healthy host cells and tissues . This distinction has been well studied in the adaptive immune response, which is specialized in the recognition of foreign peptides by virtue of small modifications to major histocompatibility complex (mhc) molecules made by these peptides . For the innate immune system, recognition is thought to be based on a large extent on the recognition of specific microbial structures, pathogen - associated molecular patterns (pamps). The innate immune system of the host organism has through the evolution developed a group of receptors, pattern recognition receptors (prrs), which serves to specifically recognize pamps . In this way, the host may utilize a certain number of receptors, encoded in the genome, for the recognition of various evolutionary stable molecular pathogen - associated structures . While some of the prrs (like the mannose receptor (mr)) recognize pamps directly, others (like complement receptors (crs)) are specialized to detect products generated secondary to pamp recognition . However, a system based on specific recognition of foreign is clearly flawed as it prevents the recognition of anything that is also present on the organism's own cells . This can be very elegantly circumvented by a defense system that has very broad recognition, when it is combined with specific molecules that mark host cells and tissues as self . Thus, recognition of self will inhibit the activation of innate immune cells, whereas the recognition of missing self allows for an immune response to proceed . In other words, a system where the own cells express a unique marker of self, not present on foreign cells, would make the distinction between self and foreign very simple . In that way, it would not matter if the organism's own cells express substances or ligands that are similar to those found on foreign cells / particles . Innate immune cells such as macrophages would only look for the presence of the self marker on the recognized particle, where the presence of self would release the recognized particle but the absence of self would allow for activation and destruction . This would significantly simplify the recognition process, as there would only be a need for a few broad specific recognition receptors instead of a countless number of foreign - specific receptors . It would also fulfill the criteria for a defense system that effectively recognize and destroy foreign objects but at the same time reduces the risk of damaging the organism's own structures . Such a system for macrophage activation would be analogous to the well - established missing - self hypothesis for natural killer (nk) cell activation . Nk cells recognize target cells by a range of activating receptors which also recognize ligands on many normal cells . However, in the nk cell system expression of self - mhc class i will protect the recognized cell via the ligation of nk cell inhibitory receptors specific for it is, however, important to note, that nk cell inhibitory receptors are now described, which seem to have ligands other than mhc class i . Upon the binding of self - mhc class i, ligated nk cell inhibitory receptors will recruit and activate the phosphatases shp-1/shp-2 that mediate the inhibition of nk cell activation . Nk cells thus spare cells whenever they express markers of normal self, and eliminate them when these markers are absent or inadequately expressed . Other leukocytes also express molecules related to nk cell inhibitory receptors, further suggesting that similar mechanisms are operative also, for example, in macrophage activation . Many of these inhibitory receptors recognize mhc class i, but the marker of self could in principle be any ubiquitously expressed surface molecule . A new chapter in the understanding of cd47 and its functions started when cd47 was found to bind sirp [52, 53]. At the time, sirp was regarded as one of several immunoreceptors with cytoplasmic itim motifs, generally suggested to be involved in negative regulation of cellular functions, mediated by the recruitment of the tyrosine phosphatases shp-1 and/or shp-2 or the inositol phosphatase ship to the tyrosine phosphorylated itims . In addition, sirp was found to be highly expressed in primary macrophages and macrophage cell lines, as well as in other myeloid cells such as monocytes, granulocytes, and dendritic cells . In macrophages, sirp was found to negatively regulate signaling through tyrosine kinase - dependent signaling pathways (e.g., fcri). Although both shp-1 and shp-2 can bind to the phosphorylated sirp itims, only shp-1 has been associated with the inhibitory function of sirp in macrophages, similar to that of the nk cell inhibitory receptors, whereas shp-2 associated with sirp leads to a phosphatase - dependent enhancement of the signal in many situations . When studying cd47-deficient mice, we were struck by the fact that cd47-deficient bone marrow cannot reconstitute and engraft in lethally irradiated syngeneic wild - type recipient mice, while it engrafts normally in cd47-deficient recipient mice . Our work on trying to understand this controversy first involved experiments where different leukocyte populations were transferred from cd47-deficient mice into wild - type recipient mice . However, we later simplified the system by studying transfusion of erythrocytes instead of leukocytes . The reason for this is that erythrocytes in contrast to many leukocyte populations have a long half - life in circulation, they do not divide, do not express mhc class i, and they do not home to extravascular tissues or organs . These studies showed that fresh erythrocytes isolated from the blood of cd47-deficient mice, labeled with a fluorescent cell tracker dye and transfused into wild - type recipient mice, have markedly reduced survival, whereas their half - life is normal in cd47-deficient recipients . The clearance rate of such freshly isolated cd47-deficient erythrocytes is remarkably fast with complete clearance within 24 hours . To put this in perspective, the average lifespan of murine erythrocytes in circulation is somewhere between 45 and 60 days, depending on the mouse strain investigated [135, 136]. The rapid clearance of cd47-deficient erythrocytes from the circulation of wild - type recipient mice does not require complement, since cd47-deficient erythrocytes are also cleared from the circulation of complement factor 3- (c3-) deficient mice . Neither is there a requirement for lymphocytes or antibodies to enable the clearance of cd47-deficient erythrocytes from the circulation, since clearance is normal in rag1-deficient mice, which lack mature t and b lymphocytes . Rather, the transfused cd47-deficient erythrocytes that are eliminated from the circulation of wild - type mice are recognized and cleared by splenic red pulp macrophages, and the removal of these macrophages by splenectomy or by treatment with macrophage - toxic clodronate liposomes abrogates the elimination of cd47-deficient erythrocytes . Furthermore, macrophage sirp is tyrosine phosphorylated upon contact with cd47 on erythrocytes, and when sirp on isolated splenic macrophages is blocked, it increases the level of phagocytosis of wild - type erythrocytes to that seen with cd47-deficient erythrocytes, whereas phagocytosis of the cd47-deficient erythrocytes is unaffected by the antibody treatment . In addition, studies in sirp-mutant mice, where the cytoplasmic signaling domain of the receptor is deleted, have shown a shorter half - life of normal cd47-expressing erythrocytes in these mice, which also present with mild anemia . Such spontaneous anemia is, however, not seen in cd47-deficient mice, suggesting that cd47 could also be needed on the macrophages to facilitate the clearance of erythrocytes in the spleen . However, lack of cd47 on platelets also results in very rapid clearance when transfused into wild - type recipients, and both cd47-deficient mice and sirp-mutant mice have a mild spontaneous antibody - independent thrombocytopenia [139, 140]. Altogether, these findings indicated that all erythrocytes can be phagocytosed by splenic red pulp macrophages when sirp is blocked or cd47 is missing, and that these macrophages must have a receptor for erythrocytes . Indeed, we have identified ldl receptor - related protein (lrp-1), which by recognizing calreticulin on the surface of normal erythrocytes can mediate phagocytosis of untreated cd47-deficient erythrocytes [141, 142]. By showing that macrophages in the splenic red pulp can recognize normal circulating erythrocytes, but that these macrophages do not phagocytose erythrocytes as long as they display cd47 on their surface, these findings were the first to prove that macrophages are perfectly capable of recognizing normal host cells and rely on self recognition for proper function . In addition, it also demonstrated major similarities between mechanisms for self recognition in nk cells and macrophages . Based on the findings that unopsonized erythrocytes lacking cd47 can be phagocytosed by splenic macrophages, and that the cd47/sirp interaction can potently inhibit the prophagocytic mechanism operating in that situation, we next hypothesized that the cd47/sirp interaction might as well be able to negatively regulate phagocytosis of opsonized erythrocytes, and that for the cells of the innate immune systems front line defense (i.e., macrophages and dc) there would be a balance between signals from activating receptors (e.g., fcr or cr) and the inhibitory signal from sirp ligated by target cell cd47 . Indeed, the cd47/sirp interaction can also regulate phagocytosis of igg - opsonized or complement opsonized erythrocytes as well as other opsonized host cells, making cd47-deficient cells severely sensitive to being phagocytosed [139, 143145]. In addition, cd47-deficient mice are severely sensitive to experimental autoimmune hemolytic anemia (aiha) and experimental thrombocytopenia [139, 146]. On an autoimmune background prone to develop spontaneous aiha, lack of cd47 results in a more rapid and lethal aiha . Using motheathen viable (me / me) mice, which only have about 20% of normal levels of shp-1, but normal levels of shp-2 [147149], we could pinpoint the role of these phosphatases in mediating the phagocytosis inhibitory effect of the cd47/sirp interaction in vivo . When transfused into me / me mice, igg - opsonized wild - type erythrocytes are cleared with the same rapid kinetics as seen with equally opsonized cd47-deficient erythrocytes, showing that at that particular signaling strength through prophagocytic fc receptors, the level of cd47 on normal erythrocytes was not enough to prevent phagocytosis if the shp-1 level was reduced by about 80% . In contrast, the prophagocytic signaling mediating phagocytosis of unopsonized cd47-deficient erythrocytes (presumably mediated by lrp-1) is likely much weaker, since unopsonized wild - type erythrocytes are not cleared with the same rapid kinetics as cd47-deficient cells in me / me mice . However, while unopsonized cd47 heterozygous erythrocytes (expressing about 50% of the cd47 found on wild - type erythrocytes) show normal half - life when transfused into wild - type recipients, they were found to be cleared more rapidly when transfused into me / me mice . These findings thus proposed that a reduction of the cd47 level to 50% of normal, in combination with a strongly reduced level of shp-1 in the macrophages, together weakened the inhibitory signaling through sirp such that clearance of unopsonized erythrocytes was allowed . Furthermore, the rate of phagocytosis of igg - opsonized erythrocytes is distinctly regulated by the amount of cd47 present on the surface of the erythrocytes both in vivo and in vitro . Thus, activation of phagocytosis in a macrophage in contact with a target erythrocyte (or any other host cell) can be viewed as a balance between signals from activating receptors (i.e., fcr, cr, or lrp-1) and the inhibitory signal from sirp ligated by target cell cd47 . In the macrophage, neither signal appears to be dominant, but rather the decision to phagocytose a target host cell is based on an integration of positive prophagocytic signals and inhibitory cd47/sirp signaling (figure 4(a)). The same functional regulation also seems to be operating in dcs and in microglia . In hemophagocytic lymphohistiocytosis, hematopoietic stem cells are phagocytosed by bone marrow macrophages as a result of systemic inflammation . In this disease, hematopoietic stem cells were found to express reduced levels of cd47, which shows that pathological conditions may occur where a combination of inflammatory macrophage activation and reduced expression of cd47 results in a severe loss of critical cell types . However, not all prophagocytic receptors seem to be regulated by the cd47/sirp interaction . Although fc receptor - mediated phagocytosis of igg - opsonized oxidatively damaged erythrocytes is strongly inhibited by the cd47/sirp interaction, scavenger receptor - mediated uptake of unopsonized oxidized erythrocytes turned out to be insensitive to this inhibitory mechanism . The mechanism whereby recruitment of shp-1 to sirp can inhibit phagocytosis has been suggested to involve the tyrosine kinase syk and phosphoinositide 3 kinase (pi3 kinase). More recently, it was suggested that shp-1 mediates dephosphorylation of nonmuscular myosin iia at the phagocytic synapse between the phagocyte and a host cell, as a result of the interaction between macrophage sirp and cd47 on the host cell, which brings further insight into the mechanism behind phagocytosis inhibition by the cd47/sirp interaction . Based on the seemingly important interaction between cd47 and sirp to prevent phagocytosis of host cells, and the fact that cd47-deficient cells are rapidly phagocytosed when transfused into wild - type mice, it is clearly a puzzle why cd47-deficient mice do not present with a more severe phenotype where the macrophages phagocytose a large fraction of the cd47-deficient cells in those mice . However, this phenomenon is rather similar to what is described in 2 microglobulin deficient mice, which lack expression of mhc class i but where the nk cells still do not attack and destroy host cells and also show hyporeactivity to cells carrying ligands for activating nk cell receptors, cells which are efficiently killed by wild - type nk cells . One explanation proposed for this function in nk cells is that inhibitory nk cell receptors need to interact with licenced and able to become activated and kill target cells lacking or expressing reduced levels of self- mhc class i . By investigating the ability to phagocytose cd47-deficient cells in mice where cd47 was expressed by hematopoietic cells, nonhematopoietic cells, or both, the phagocytic tolerance to cells lacking cd47 in cd47-deficient mice it was found that macrophages developing in an environment where nonhematopoietic cells lack cd47 become tolerant to cells lacking cd47, which allowed cd47-defcient leukocytes to avoid clearance . Curiously, this did not involve erythrocytes, which were cleared by splenic macrophages also in the bone marrow chimeras where nonhematopoietic cells lacked cd47 and macrophages had become the latter phenomenon has so far not been explained, but may suggest that phagocytosis of erythrocytes is regulated differently from that of leukocytes . Although cd47-deficient macrophages express normal amounts of sirp, which can also become tyrosine phosphorylated upon contact with cd47 expressing cells (oldenborg et al ., unpublished observations and), it is possible that the tolerance to cd47-deficient cells that develop in cd47-deficient mice has to do with tuning of intracellular signaling pathways . In favor of such a hypothesis is the observation that transfused igg - opsonized wild - type erythrocytes are cleared from the circulation at a significantly slower rate in cd47-deficient mice, as compared with that seen in wild - type recipient mice (oldenborg et al . This is unlikely due to a different expression of fc receptors in cd47-deficient mice, since cd47-deficient igg - opsonized erythrocytes are cleared with the same kinetics in both wild - type and cd47-deficient recipient mice (oldenborg et al . Apoptosis is a physiological process of programmed cell death which is important for embryologic development, maintenance of homeostasis, and elimination of damaged cells . An important event related to this process is the rapid uptake of apoptotic cells or apoptotic bodies by phagocytic cells . The efficacy of this process in the body is shown by the fact that apoptotic cells are apparently removed with such extremely high efficiency that apoptotic cells are very hard to detect in tissues under normal physiological conditions . It has even been suggested that if apoptotic cells are in fact detected in vivo, this may indicate a possibility of defects in their clearance or the presence of a large overload of apoptotic cells [159162]. The largest part of apoptotic cell phagocytosis is mediated not only by professional phagocytes like macrophages and dcs, but also to some extent by nonprofessional phagocytes such as fibroblasts; epithelial cells and stromal cells are equipped with this function . One example of the latter phenomenon is the phagocytosis of apoptotic mammary epithelial cells by bystander epithelial cells during mammary gland involution [163, 164]. When cd47 was identified as a cell surface protein on host cells that can negatively regulate their phagocytosis through sirp, one important question was to understand if this signaling pathway is altered during apoptosis to facilitate uptake of apoptotic cells . One hypothesis would be that apoptotic cells downregulate the amount of cd47 on their surface, which together with an increased amount of prophagocytic ligands exposed during apoptosis would result in phagocytosis of the dead cells . Indeed we found a reduced expression of cd47 on apoptotic fibroblasts and neutrophils, but curiously not on apoptotic jurkat t cells or apoptotic murine thymocytes . This issue became even more confusing when apoptotic murine t cells lacking cd47, in contrast to the solid data showing that cd47 on host cells inhibits phagocytosis by macrophages, were found to be phagocytosed less efficiently by macrophages than equally apoptotic cd47 wild - type t cells [143, 165]. In apoptotic murine t cells, cd47 was rather found to be important in mediating tethering of the apoptotic cells to the phagocyte [143, 165]. In addition, cd47 is redistributed into patches on the apoptotic cell surface, areas of the plasma membrane which are different than those harbouring clusters of proteins that function as ligands for prophagocytic receptors [141, 143]. Thus, one possibility would be that the segregation of cd47 away from these phagocytosis promoting ligands could allow for tethering mediated by the cd47/sirp interaction, but that sirp would be too far away from the prophagocytic receptors to be involved in negative regulation (figure 4(b)). Another very interesting hypothesis was recently suggested, which shed new light on this process . As described above in section 4.2 experimentally oxidized erythrocytes, as well as erythrocytes stored in blood bank conditions, showed enhanced expression of the cd47 epitope recognized by mab 2d3, suggesting a conformational change in the cd47 igv domain . Importantly, this is associated with an increased binding of tsp-1 to cd47, which together could generate a new binding site for sirp that induces a prophagocytic signal instead of the normal inhibitory cd47/sirp signal . However, this very interesting hypothesis still has to also be investigated in the context of macrophage phagocytosis of apoptotic nucleated cells such as neutrophils or t cells . Thus, cd47 may operate in several different ways during cellular senescence in order to switch its normal phagocytosis - preventing role to rather facilitate and promote the phagocytosis of senescent cells . Lrp-1 is a multifunctional scavenger receptor, shown to be involved in mediating uptake of apoptotic cells [141, 166, 167], and as already mentioned it can also bind to calreticulin on viable erythrocytes to induce phagocytosis if the inhibitory cd47/sirp interaction is not strong enough [141, 142] (figure 4(b)). Glucocorticoids are powerful in treatment of inflammatory conditions, which can be attributed to their ability to downregulate production of and cellular responses to proinflammatory cytokines and their ability to inhibit the recruitment of inflammatory cells [168, 169]. However, another mechanism whereby glucocorticoids may also reduce inflammation is to stimulate phagocytosis of apoptotic cells [170, 171]. Interestingly, glucocorticoid treatment of macrophages results in increased macrophage expression of lrp-1 and increased phagocytosis of apoptotic cells or viable cd47-deficient erythrocytes . Since cd47 can inhibit phagocytosis of host cells, and the amount of cd47 on the cell surface is clearly important in determining the phagocytosis efficiency of macrophages, this also raised the question on whether cells such as tumor cells can also increase their cd47 expression levels in order to escape macrophage elimination . Indeed, early studies showed that ovarian carcinoma cell lines express increased levels of cd47 [6, 7], the functional significance of which was unclear at that time . More recently, an enhanced expression of cd47 has been reported for murine myeloid leukemias, as well as human normal and leukemic hematopoietic stem cells and many human solid tumors [172174], and that increased cd47 expression is associated with reduced patient survival in aml and solid tumors [173, 174]. To challenge the hypothesis that cd47 on the leukemic cells protects from phagocytosis by macrophages and supports tumor cell growth, a xenogenic mouse model was used to study a particular human aml clone (molm-13) with very low endogenous cd47 expression . Expression of murine cd47 in molm-13 cells and transplantation of molm-13 clones expressing low or high levels of cd47 showed an enrichment and spreading of the cd47-high expressing clones to many bones of recipient mice, while the cd47-low clones showed minimal engraftment . Depletion of macrophages in recipient mice allows for engraftment of cd47-low clones, and macrophage phagocytosis of aml cells both in vitro and in vivo is selective for tumor cells expressing low amounts of cd47 . Importantly, by blocking sirp on macrophages, phagocytosis of cd47-high aml cells is increased to that seen with cd47-low clones . Thus, these findings strongly suggest that an increased cd47 expression level on tumor cells could serve to avoid macrophage clearance and promote dissemination of tumor cells (figure 4(c)). It was also recently shown that treatment serving to block the cd47/sirp interaction can result in elimination of aml stem cells in a xenogenic model . Furthermore, inline with our original finding that the cd47/sirp pathway also potently inhibits fc receptor - mediated phagocytosis of igg - opsonized host cells [139, 145, 146, 150], it has been shown that antibody - mediated blocking of cd47/sirp signaling promotes phagocytosis of non - hodgkin lymphoma cells treated with rituximab and antibody - dependent cellular cytotoxicity (adcc) against her2/neu - positive breast cancer cells treated with traztusumab . Thus, blocking the cd47/sirp interaction may prove to be a powerful tool in the treatment of various tumors . While organ transplantation is an important procedure to treat end - stage organ failure, it is hampered by a shortage of organ donors . To solve this problem, it has been suggested that pigs could serve as donors of organs, tissues, or cells to be transplanted into humans (i.e., xenotransplantation) [158, 178]. Both the innate and adaptive immune system participates in the rejection of xenogenic transplants, the exact details of which is outside the scope of the present paper . However, of particular interest here are the findings suggesting that even in the absence of a functional adaptive immune system and in the absence of nk cells (both of which react to cell surface determinants of xenogenic cells recognized as non - self), rejection of xenogenic cells and tissues is seen, which suggests that macrophages could play an important role in this process . Indeed, in studies of transplantation of pancreatic islets [179, 180] or hematopoietic cells from pigs to mice, macrophage depletion significantly enhances engraftment . The ability of macrophage sirp to inhibit phagocytosis by binding to cd47 on a target cell, and the fact that this interaction is rather species specific suggested that this interaction could play a role in macrophage - mediated clearance of xenogenic cells . Indeed, it was found that porcine cd47 cannot bind to murine sirp and induce tyrosine phosphorylation of the sirp itims, which could explain the rapid clearance of porcine hematopoietic cells by macrophages both in vitro and in vivo [181, 182]. However, expression of murine cd47 in porcine cells markedly inhibits macrophage - mediated phagocytosis of these cells in vitro and prolongs their survival in vivo . Although a human sirp fusion protein was found to bind to porcine cd47, porcine cd47 does not activate human sirp . As a result, porcine hematopoietic cells are rapidly phagocytosed by human macrophages, but expression of human cd47 in porcine cells results in attenuated phagocytosis by human macrophages . These findings indicate that transgenic pigs expressing human cd47 could be an important possibility to further help reducing the rejection of porcine cells in xenotransplantation . The finding that cd47, by binding to sirp, could regulate rat alveolar macrophage fusion and formation of multinucleated giant cells in vitro suggested a function also in regulating formation of bone - resorbing osteoclasts and regulation of bone homeostasis . Using functional blocking monoclonal antibodies against either cd47 or sirp, the formation of tartrate resistant acid phosphatase (trap) multinucleated osteoclasts is strongly inhibited in murine cell culture systems in vitro . This finding can also be confirmed in vivo, since cd47-deficient mice have reduced numbers of osteoclasts in bone and are protected from tumor metastasis and subsequent bone resorption . There are a few hypotheses presented to explain the mechanism whereby the interaction between cd47 and sirp promotes osteoclastogenesis . One suggests that binding of cd47 results in sirp tyrosine phosphorylation and subsequent recruitment of shp-1 to the phosphorylated itims, which next would mediate dephosphorylation of nonmuscle cell myosin iia to promote fusion and formation of osteoclasts . This hypothesis is contrasted by a study of sirp mutant mice, expressing a truncated nonsignaling sirp cytoplasmic domain, where cultures of bone marrow cells generated the same number of osteoclasts of the same size, as found in wild - type bone marrow cultures . The important observation made in the latter study was that osteoclasts generated in sirp mutant mice had an increased bone resorbing activity, suggesting that sirp negatively regulates this function in osteoclasts . The contradictory findings presented regarding a possible role of signaling through either cd47 or sirp during fusion of preosteoclasts and formation of multinucleated osteoclasts must also be put in context of the originally presented hypothesis that the interaction between cd47 and sirp may mainly facilitate cell fusion by promoting cell - cell adhesion and bringing the plasma membranes of two cells close enough to facilitate cell fusion . Here it has also been highlighted that cd47 may interact with the shorter sirp isoform having only one extracellular igv domain, which would further reduce the distance between two opposing cellular membranes where cell fusion could take place . Cd47 can regulate many important physiological cellular mechanisms by interacting with integrins, tsp-1, or sirp. As outlined above, much knowledge has been collected over the past two decades, but much is probably still to be discovered regarding the functions of this protein . There are several areas where one can assume that further progress may result in new novel ways to interfere with biological mechanisms in pathological conditions . Although cd47 is expressed by virtually all cells in the body, in healthy as well as pathological cells, the data so far indicates that cd47-induced apoptosis may still be a way to kill, for example, tumor cells, since it appears that tumor cells and activated cells are much more sensitive to this cell death mechanism than nonactivated nave cells or hematopoietic stem cells . The ability of cd47 to inhibit phagocytosis is clearly an important mechanism whereby innate cells as macrophages or dendritic cells can discriminate between self and non - self, and maintain tolerance to host cells . In the field of xenotransplantation, further development and research to create xenotransplants carrying human cd47 may prove important to obtain even better conditions where xenogenic cell, tissues, or organs can be tolerated when transplanted into humans . In the field of cancer research, where tumor cells may express higher levels of cd47 as a way of avoiding phagocytosis and clearance by phagocytic cells, and where cd47-blocking antibodies have been shown to promote clearance of and to reduce the dissemination of tumor cells, brings hope that careful development of reagents that can block the cd47/sirp interaction may indeed be useful to treat many forms of cancer without having too much of a negative side effect in terms of inducing clearance of host cells . Also in the field of bone research, one may suggest that manipulation of the interaction between cd47 and sirp may be a way to modulate bone resorption and to prevent osteoporosis . However, data showing that these two proteins may also be involved in regulating bone formation indicate that manipulation of this signaling system in bone tissue may be more complicated.
Dentine bonding agents are bonding agents that consist of 3 parts: (i) an acid that removes the smear layer accumulated on the dentine and that helps increase the microporosity of the enamel (etching step), (ii) a substance that enhances the flow of bonding agents into the dentine and increasing the microporosity of the enamel by modifying dentine as a bonding substrate (priming step), and (iii) the bonding agents (bonding step). Traditionally, the use of dentine bonding agents required the use of all three of these steps . Recently, however, dentine bonding agents have been developed that reduce the process to only one or two steps, resulting in faster and more convenient application . Selection of a dentine bonding agent requires the consideration of the bonding properties (i.e., how effectively the bonding agent can bond the dental restorative material to the dentine) and the cytotoxicity of the dentine bonding agents.12 in a previous study, the cytotoxicity of three dentine bonding agents was determined using the agar overlay technique.3 the results showed that the toxicity of g - bond and clearfil s bond diffusing into the agar medium was moderate whereas that of clearfil se bond x was high . The study also found that the three dentine bonding agents yielded the same lysis index (i.e., 1). This result revealed that the three dentine bonding agents have low toxicity according to the iso / fdis 7405:2008 (e) standard, which is based on an in vitro evaluation of the biocompatibility of medical devices used in dentistry.4 however, the agar overlay technique only allowed a preliminary cytotoxicity evaluation and did not reveal the percentage of surviving cells . It is advisable to evaluate the biological properties of dentine bonding agents that are in close contact with dentine prior to using them in patients . According to the iso 7405:1997 standard, an in vitro evaluation of the biological properties of dentine bonding agents (e.g., cytotoxicity evaluation through a cell - culture test) is the primary method used to evaluate the cytotoxicity of such agents.5 originally, researchers used cell - culture tests to evaluate the biological properties of dental materials.6 the agar overlay method and the millipore filter method were introduced to simulate the material - cell contact interaction.78 however, the agar and filter methods still did not simulate dentine in vivo clinically . In 1977, the model cavity system was introduced to better simulate the clinical situation.9 the test material was separated from the cells by either a synthetic filter or a dentine slice . An in vitro test system using dentine for the evaluation of toxicity has been reported.1012 in these studies, the toxic products of materials that diffused through the dentine were diluted in at least 2.5 ml of cell culture medium before contacting the target cells . However, in a clinical situation, the leachable toxic product will have a direct effect on the cells of the pulp, which lie close to the dentine . In 1996, a dentine barrier model for the cytotoxicity evaluation of dental cement was reported.13 this model is based on a commercially available device and is considered to be an important prerequisite for a standard test . In this model, the cells were seeded on the pulp side of the dentine and were placed above the cell culture medium . Our study used a dentine model and three - dimensional cell cultures that have been previously described by ulker and sengun.14 cell perfusion was limited by the blood circulation inside the tooth cavity and was equal to 20 - 82.4 ml / min/100 grams of tissue.15 it has been reported that perfusing the chamber with 5 ml medium / h did not decrease toxicity but can lead to increased cell death or cell disruption.16 therefore, in the present study, the perfusion conditions included a cell feed flow rate of 2.0 ml / h . At this flow rate this difference may be because this rate mimics the blood flow within the pulp chamber, where cytotoxic leaching occurs . The aim of this study was to evaluate the cytotoxicity of three self - etching dentine - bonding agents (g bond, clearfil s bond and clearfil se bond x) with a three - dimensional cell culture and perfusion conditions that were not used in the previous study.3 the hypothesis tested was that different self - etching dentine bonding agents have different cytotoxic profiles . G bond, clearfil s bond and clearfil se bond x were the experimental materials . The negative and positive controls were president (coltene ag, alstatten, switzerland) and vitrebond (3 m medica gmbh, germany), respectively . Polyamide (diameter 8 mm) was etched with 0.1 m acetic acid for 30 min, washed with sterile water 3 times and sterilized by autoclaving (hirayama, tokyo, japan) before the experiment . The mesh was coated in fibronectin (0.03 mg / ml in water), and the mesh was left to dry for 2 h in a bio - hazard safety cabinet . The target cells used in this experiment were tcpc sv40 (bovine fibroblast pulp - derived cells transfected with simian virus 40 large t - antigen).16 a 1.25-ml volume of mem - alpha (minimum essential media, gibco, new york, usa), including 20% fetal calf serum, was added to each well of a 6-well tissue culture plate . Then, a millicell membrane (minucells and minutissue, bad abbach, germany; size 30 mm, pore size 0.45 m) was inserted in each well . The plate was incubated at 37o c with 5% co2 and 100% humidity for 48 h. then, each mesh was separately placed into the wells of a 24-well tissue culture plate . The cells on the meshes were fed with 1 ml of mem - alpha media, 20%fcs containing 50 g / ml of ascorbic acid, and the medium was changed every other day . After growing for 14 days in the incubator, the three - dimensional cell cultures on the meshes were ready for use in the experiment (figure 1). A dentine disc that was 500 25 m thick and that was close to the pulp cavity was longitudinally sectioned from a bovine incisor . A dentine disc with a diameter of 67 mm under the cementoenamel junction was cut for the experiment . The pulp side of each disc was etched with 50% citric acid for 30 s, soaked in normal saline and autoclaved before the experiment (figure 2). A commercial cell culture chamber (minucells and minutissue, bad abbach, germany) was used for the in vitro model.16 the chamber was separated into a pulp side and a cavity side by the dentine disc mentioned above . The pulp side of the disc was placed over the cultivated cell mesh, and a stainless steel clamp held the 2 compartments together . Cells in the mesh were fed with mem - alpha media, 20%fcs that was contained in the lower part of the chamber . The model was placed on a hot plate (37 2 c), and culture medium was perfused through the lower part of the chamber . Each dentine bonding agent as well as the negative and positive control was tested in 5 cell culture chambers . All experiments were repeated in triplicate . The perfusion pump (ismatec uk co. weston - super - mare, england) was connected and adjusted to a perfusion rate of 0.2 ml / h for 24 h before application of the test material (figure 3). A cotton pellet soaked with culture medium after 24 h of perfusion, the perfusion rate of the medium was adjusted to 2 ml / h to simulate blood flow in the pulp . The dentine in the cavity side was cleaned with sterile water and dried with gently blown air . Three self - etching bonding agents as well as the president and vitrebond controls were applied to the dentine according to the manufacturers recommendations . The enzymatic activity of target cells was analyzed using the mtt (3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide) assay after 24 h of test material exposure . The mesh was removed from the stainless - steel holder of the perfusion chamber and immediately inserted into 0.5 ml of freshly prepared mtt solution (1 well/1 mesh) in a 48-well tissue culture plate . The plates were incubated for 2 h. mitochondrial dehydrogenase in living cells converts the yellow water - soluble tetrazolium salt 3-(4, 5-dimethylthiazol-2-yl)-2, 5 diphenyltetrazolium bromide into dark blue formazan crystals that are stored in the cytoplasm of the cells . Then, the mtt solution was removed, and the mesh was washed twice with 0.5 ml of phosphate - buffered saline solution . Dimethyl sulfoxide (dmso; 250 l) was added to each well to dissolve the formazan . The plate was agitated on a shaker for 30 minutes to enhance the dissolution of the formazan . A 200-l aliquot was drawn from each well and transferred to a 96-well tissue culture plate . The mean optical density of the negative control group was set to represent 100% viability . The results for the experimental groups and the positive control were expressed as the percentages of the negative control . The statistical analysis was performed by applying the non - parametric mann - whitney test (p<.05). G bond, clearfil s bond and clearfil se bond x were the experimental materials . The negative and positive controls were president (coltene ag, alstatten, switzerland) and vitrebond (3 m medica gmbh, germany), respectively . Polyamide (diameter 8 mm) was etched with 0.1 m acetic acid for 30 min, washed with sterile water 3 times and sterilized by autoclaving (hirayama, tokyo, japan) before the experiment . The mesh was coated in fibronectin (0.03 mg / ml in water), and the mesh was left to dry for 2 h in a bio - hazard safety cabinet . The target cells used in this experiment were tcpc sv40 (bovine fibroblast pulp - derived cells transfected with simian virus 40 large t - antigen).16 a 1.25-ml volume of mem - alpha (minimum essential media, gibco, new york, usa), including 20% fetal calf serum, was added to each well of a 6-well tissue culture plate . Then, a millicell membrane (minucells and minutissue, bad abbach, germany; size 30 mm, pore size 0.45 m) was inserted in each well . The plate was incubated at 37o c with 5% co2 and 100% humidity for 48 h. then, each mesh was separately placed into the wells of a 24-well tissue culture plate . The cells on the meshes were fed with 1 ml of mem - alpha media, 20%fcs containing 50 g / ml of ascorbic acid, and the medium was changed every other day . After growing for 14 days in the incubator, the three - dimensional cell cultures on the meshes were ready for use in the experiment (figure 1). A dentine disc that was 500 25 m thick and that was close to the pulp cavity was longitudinally sectioned from a bovine incisor . A dentine disc with a diameter of 67 mm under the cementoenamel junction was cut for the experiment . The pulp side of each disc was etched with 50% citric acid for 30 s, soaked in normal saline and autoclaved before the experiment (figure 2). A commercial cell culture chamber (minucells and minutissue, bad abbach, germany) was used for the in vitro model.16 the chamber was separated into a pulp side and a cavity side by the dentine disc mentioned above . The pulp side of the disc was placed over the cultivated cell mesh, and a stainless steel clamp held the 2 compartments together . Cells in the mesh were fed with mem - alpha media, 20%fcs that was contained in the lower part of the chamber . The model was placed on a hot plate (37 2 c), and culture medium was perfused through the lower part of the chamber . Each dentine bonding agent as well as the negative and positive control was tested in 5 cell culture chambers . The perfusion pump (ismatec uk co. weston - super - mare, england) was connected and adjusted to a perfusion rate of 0.2 ml / h for 24 h before application of the test material (figure 3). A cotton pellet soaked with culture medium was placed on the dentine of the cavity side . After 24 h of perfusion, the perfusion rate of the medium was adjusted to 2 ml / h to simulate blood flow in the pulp . The cotton pellet in the cavity side the dentine in the cavity side was cleaned with sterile water and dried with gently blown air . Three self - etching bonding agents as well as the president and vitrebond controls were applied to the dentine according to the manufacturers recommendations . The enzymatic activity of target cells was analyzed using the mtt (3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide) assay after 24 h of test material exposure . The mesh was removed from the stainless - steel holder of the perfusion chamber and immediately inserted into 0.5 ml of freshly prepared mtt solution (1 well/1 mesh) in a 48-well tissue culture plate . The plates were incubated for 2 h. mitochondrial dehydrogenase in living cells converts the yellow water - soluble tetrazolium salt 3-(4, 5-dimethylthiazol-2-yl)-2, 5 diphenyltetrazolium bromide into dark blue formazan crystals that are stored in the cytoplasm of the cells . Then, the mtt solution was removed, and the mesh was washed twice with 0.5 ml of phosphate - buffered saline solution . Dimethyl sulfoxide (dmso; 250 l) was added to each well to dissolve the formazan . The plate was agitated on a shaker for 30 minutes to enhance the dissolution of the formazan . A 200-l aliquot was drawn from each well and transferred to a 96-well tissue culture plate . The mean optical density of the negative control group was set to represent 100% viability . The results for the experimental groups and the positive control were expressed as the percentages of the negative control . The statistical analysis was performed by applying the non - parametric mann - whitney test (p<.05). The percentages of viable cells compared to the controls for g bond, clearfil se bond x and clearfil s bond are shown in figure 4 . The average percent cell viability after exposure to g bond, clearfil se bond x, clearfil s bond and vitrebond was 113.03, 111.83, 90.98 and 59.90, respectively . Vitrebond was more toxic than g bond, clearfil se bond x and clearfil s bond (p<.01), whereas the experimental group did not have any toxicity compared with the negative control group (p>.05). In a previous study, the cytotoxicity levels of self - etching dentine - bonding agents (g bond, clearfil se bond x and clearfil s bond) were evaluated using the agar overlay technique . This analysis showed that the g bond and clearfil s bond were both moderately cytotoxic, whereas the clearfil se bond x appeared to be more toxic than the other 2 bonding agents . The amount of cells destroyed by each of the three dentine bonding agents was not significantly different.3 because this was only a preliminary evaluation of the cytotoxicity of the three dentine - bonding agents, it was not possible to determine the level of toxicity quantitatively . Hence, a qualitative study of a dentine barrier model simulating clinical practice was needed to obtain reliable data . This study revealed that the percent of viable cells for g bond, clearfil s bond and clearfil se bond x was 113.03, 90.98 and 111.83, respectively . In this study, three dentine bonding agents were studied under two systems . G - bond and clearfil s bond were processed in one step, and a two - step system was used for the self - etching primer bonding system of clearfil se bond x. in the all - in - one system, the etching, priming and bonding steps are combined together as one step for resin - bonding . In contrast, in the two - step self - etching primer bonding system, the etching and primer steps are combined together as a single step that is separate from applying the resin bonding agent prior to restoration of the tooth with a resin composite . In the clearfil s bond experiment, this value was lower than the other groups, but the difference was not statistically significant . The difference may be due to the presence of hydrophobic dimethacrylate in the composition . Hydrophilic monomers such as hema or tegdma have been shown to be cytotoxic, but to a lesser degree than a more hydrophobic monomer.17 however, self - etching adhesive systems were less cytotoxic than the total - etching system.18 the preparation of materials for experiments significantly has been reported to alter the apparent cytotoxicity of the materials.19 thus, every effort was made to simulate in vivo conditions in the laboratory . However, it is not possible to create an environment that totally replicates clinical conditions . Cell toxicity assays have been performed both in cell lines and primary cells, but immortalized cell lines are more stable than primary cells.20 no differences have been observed in the growth of bovine pulp - derived cell lines transfected with simian virus that were seeded on dentine discs and those seeded on tissue culture plates.21 scanning electron microscopy (sem) also showed biocompatibility between the dentine and cells . Thus, bovine teeth are an appropriate choice for use with the bovine pulp cell line in this experiment . It has been demonstrated that 0.5 mm of dentine can reduce material toxicity to 75% and that 1 mm of dentine can reduce toxicity by up to 90% of the control value (i.e., the value obtained when dentine was not present).22 most cytotoxicity research uses 500 m for the standard thickness of the dentine barrier slice in the pulp chamber model.23 the permeability of the dentine varies in different regions of the tooth . Therefore, the region of dentine that is selected is important when evaluating restorative materials in terms of bond strength and cytotoxicity . Maroli et al24 showed, using scanning electron micrographs, that there are more tubular openings in the cervical third of approximal sections than in occlusal and middle . The cervical area of the bovine tooth was used as the dentine barrier in this experiment . With respect to transdentine permeability characteristics, bovine dentine at the level of the cemento - enamel junction seems to be a suitable alternative for coronal human dentine.25 the use of perfused dentine barrier models is a widely accepted method of evaluating the biological properties and the toxicity of dental restorative materials that will come into contact with dentine . However if contamination occurs during the experiment, the experiment will be ineffective because the complete growth of the cell culture in the mesh requires 14 days . Moreover, researchers must have adequate experience with and knowledge of 3-d cell culture techniques . Each step requires meticulous technique, especially the installation of the perfusion system, which is a 3-way connection with a flow rate similar to blood flow in the actual pulp . Another advantage of this study was the ability to reduce the quantity and frequency of animals used in experiments . An experiment with animals is needed when the results from of in vitro studies are ambiguous . In accordance with the first priority of iso 7405, it is recommended to avoid the use of animals for experiments if the study can possibly be conducted in vitro . All three self - etching dentine - bonding agents were non - toxic compared with the negative control group (p>.05). These agents could be used clinically in cases where there is more than .5 mm of remaining dentine above the pulp.
In general, brain injury can occur due to sudden and severe head strike to a hard object, which can be mild, moderate or severe (1). The main causes of head injury include traffic accidents, falling from heights, physical violence, accidents at work, inside home accidents and during exercise incidents . However, the most important cause of head trauma in iranian population is traffic accident (2). Among the warning signs of head trauma are nausea, vomiting, dizziness, headache, blurred vision, and loss of balance, difficulty in sleeping, memory problems, tinnitus and fatigue (3). Nausea and vomiting are the most common complications after minor head trauma that in addition to severe harassment of patients increases the risk of aspiration and intracranial pressure rising . Ondansetron is a serotonin 5-ht3 receptor antagonist, which connects to the peripheral and central receptors of serotonin (1). This drug is mostly used in nausea and vomiting after chemotherapy and surgery (2). It does not have any effect on dopamine receptors thus; it does not have extra pyramidal effect (3). This drug has a half - life of 2 - 7 hours and is metabolized in the liver where it changes into glucuronide and sulfate which is inactive . Its most common side effects include headaches, fatigue, diarrhea, constipation, dizziness and anxiety . The recommended dose for the treatment of nausea and vomiting is 4 - 8 milligrams (4, 5). Metoclopramide as an old antiemetic is mostly used in high doses, before chemotherapy and for nausea and vomiting caused by various reasons (6 - 8). This drug blocks the dopamine receptors on the peripheral and central dopamine receptors and increases the movement of the upper gastrointestinal tract without increasing secretion (9, 10). Its intravenous absorption takes about 3 minutes and the peak of its effect is about 15 minute . This drug is metabolized in the liver and its half - life is approximately 4 - 5 hours (11). Its most common side effects include dystonia <10%, fatigue, drowsiness, and flushing . Based on the above - mentioned reasons, the present study was aimed to compare the antiemetic effects of metoclopramide and ondansetron in the treatment of post head trauma nausea and vomiting . Study design and setting the study was a controlled, randomized, double blind clinical trial, which was conducted in the first 6 months of 2014 in al - zahra and kashani hospitals in isfahan, iran . The present study was supervised and accepted by the ethics committee of isfahan university of medical sciences . The study was registered in iranian registry of clinical trial (irct number: irct2015043012072n6). The studied population included patients with minor head trauma associated with nausea and vomiting who were referred to the emergency department . The patients older than 15 years old, with minor head trauma, nausea and vomiting, and a triage level of 3 or higher based on emergency severity score were included . The exclusion criteria were considered as follow: hemodynamic instability; pregnancy / lactation; any neurologic deficit; restless leg syndrome; alcohol usage; consumption of any antiemetic drugs during the 8 hours prior to admission; previous administration of intravenous fluids; motion / vertigo related nausea and vomiting; chemotherapy or radiotherapy; inability to complete and understand study explanations or outcome measures; finally allergy or previous adverse reactions to metoclopramide or ondansetron; and lack of data regarding demographic data and the severity of nausea and vomiting based on the visual analog scale (vas). The patients were randomly divided into 2 groups: treatment with metoclopramide (10mg/2ml, slow injection) and treatment with ondansetron (4mg/2ml, slow injection). For the study to be double blind, the drugs were packed in nameless syringes, and in numbered, dark packs and only the main researcher knew about the drug content . The patients and the other researchers were blind to the drug content and the treatment group . Drug information and treatment group of the patients would only be revealed if the patients showed extrapyramidal side effects of the drugs, which did not happen in this study . If the severity of nausea had not decreased at least by 20 mm compared to the rate before the treatment intervention, a rescue dose (4 mg ondansetron) would be prescribed for the patient . Nausea severity was measured using self - rated visual analogue scale (vas) before and 20 minutes after the intervention . Vas was a standard 100 mm (mm) method on which the left side indicated no nausea and the right side was an indicator of the worst nausea possible . Using this scale for assessing nausea severity was accepted in previous studies . According to these studies the minimum difference in nausea severity counted as clinically significant, nausea severity was divided into 3 levels: severe nausea (vas> 70 mm), moderate nausea (50 mm <vas <70 mm) and mild nausea (vas <50 mm). The primary outcome was defined as mean nausea severity according to vas in the twentieth minute post drug administration . Statistical analysis population sample size for each group was determined based on comparing mean nausea severity between the 2 treatment groups . Based on previous studies (12), mean and standard deviation of nausea severity reduction before and after ondansetron administration was 40 mm and 24 mm respectively . Based on this, by considering = 0.05 and 90% power (= 0.1), the sample size of 43 patients in each group was sufficient . Nausea severity was expressed as mean and standard deviation . To compare the 2 groups, t - test was used and for comparing the effects of the drug before and after administration, paired t - test was used . The comparison between the 2 groups was done using the chi square, the fisher exact, or mann - whitney u test . In all the analyses, p <0.05 was defined as the level of significance . Finally, 120 patients with minor head trauma were distributed and studied into two groups of 60 patients (mean age 35.6 14.1 years; 50.0% male). Mean age of metoclopramide and ondansetron treated groups were 36.1 14.0 and 35.0 14.2 years, respectively (p = 0.69). The sex distribution in ondansetron (45.0% male) and metoclopramide groups (55.0% male) had no significant difference . Administration of both ondansetron and metoclopramide significantly reduced the severity of nausea (p <0.001). The average score of nausea severity before the injection of ondansetron and metoclopramide in the groups were 89.312.5 and 85.3 14.9, respectively (p = 0.11). Before intervention 51 patients (85.0%) of the ondansetron group and 47 patients (78.3%) of the metoclopramide group had severe nausea (vas> 70 mm) (p = 0.35). After intervention only 2 patients (3.3%) of the ondansetron treated and 5 patients (8.3%) of the metoclopramide treated group had severe nausea (p = 0.16). However, changes in the severity of nausea in both groups before and after the treatment revealed that nausea had been decreased significantly in both groups (p <0.001) (figure 2). The incidence of fatigue (p = 0.44), headache (p=0.58) and dystonia (p = 0.06) had no significant difference in the two groups but the incidence of drowsiness and anxiety in the metoclopramide group was significantly higher (p <0.001) (table 1). 2 (1.7%) patients needed the rescue dose which were in the metoclopramide treated group (p = 0.50). The present study showed that the antiemetic effect of ondansetron and metoclopramide in patients with minor head trauma is the same . The frequency of severe nausea in the ondansetron group reduced from 85% to 3.3% while in the metoclopramide group, reduced from 78.3% to 8.3% . The incidence of drowsiness and anxiety were significantly lower in the ondansetron treated patients . The antiemetic effects of ondansetron and metoclopramide have been compared in various studies, the results of which are in line with the current study . Reveals that the effectiveness of ondansetron and metoclopramide compared to the placebo, show no significant difference in decreasing nausea and vomiting in the patients admitted to the emergency department (13). Also egerton - warburton et al . Expressed in their study that the antiemetic effects of ondansetron and metoclopramide were no different compared to the placebo (14). In addition, barrett et al . And al - ansari et al . Have reported similar results (12, 15). In the present study, mean pain relief was 48.8 mm in the metoclopramide group and 57.0 mm in the ondansetron ones which was significantly different from the results of the mentioned studies . In this regard, egerton - warburton et al . Showed that administering 4 mg ondansetron and 20 mg metoclopramide resulted in a 27 mm and 28 mm decrease in nausea severity, respectively (2). Study was 40 mm for ondansetron and 32 mm for metoclopramide (15). Concerning the drugs side effects, patanwala et al . Propose in their review study that due to safety, ondansetron is a better choice for the first line of treatment for decreasing nausea and vomiting in the patients admitted to the emergency department (16). The present study also showed that compared to metoclopramide, ondansetron administration, showed less side effects . 6 patients showed side effects in the group treated with metoclopramide, whereas only 2 showed side effects in the group treated with ondansetron (14). If such a group was studied, an assessment of the placebo effect would have been possible . Mean changes of nausea severity before and after intervention in the 2 groups frequency of nausea before and after treatment in both groups since these complications can have adverse effects on the treatment of patients with brain injury, it is suggested that it may be better to use ondansetron in these patients . All authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors.
Formalin - fixed, paraffin - embedded tissue samples from 61 patients with primary localized esfts were obtained in korea, brazil, and argentina . Fifty - five of the 61 tissue samples were obtained by surgical biopsy and the other six were obtained by surgical excision . At the time of tissue sampling, none of the patients had a history of chemotherapy or radiation therapy and there was no evidence of metastatic disease . Briefly, they are small round cell sarcomas showing diffuse membranous cd99 immunostaining, cytoplasmic periodic acid schiff staining, and ewsr1 gene translocation as demonstrated with fluorescence in situ hybridization (zytolight spec ewsr1 dual color break apart probes, zytovision, bremerhaven, germany). However, lack of an ewsr1 gene translocation was not considered as grounds for exclusion if a tumor showed the typical immunophenotypes, which are inconsistent with other small round cell tumors in the differential diagnosis of diseases such as lymphoma and rhabdomyosarcoma . Data, including the follow - up period and overall survival, were available for 48 patients . During follow - up, the patients were grouped into dead of disease, alive with disease, and no evidence of disease (ned). The classification of patients as ned was established when the follow - up period had passed more than 24 months . Our study protocol was reviewed and approved by the kyung hee university institutional review board . Idh1/2 mutations were tested using the pentose nucleic acid (pna) clamp idh1/2 mutation detection kit (panagene, daejeon, korea). All reactions had a total reaction volume of 20 l and contained template dna, primer and pna probe sets, and fluorescent polymerase chain reaction (pcr) master mix . Real - time pcr reactions of pna - mediated clamping pcr were performed using a cfx 96 (bio - rad, hercules, ca, usa). Pcr cycling conditions were as follows: 5 minutes at 94c followed by 40 cycles of 94c for 30 seconds, 70c for 20 seconds, 63c for 30 seconds, and 72c for 30 seconds . In this assay the pna probe, which is complementary to the wild - type sequence, suppresses amplification of the wild - type target . This suppression results in preferential amplification of mutant sequences by competitively inhibiting the binding of dna primers to wild - type dna . Calculations of the delta ct (ct) value were done as follows: ct1=(standard ct)(sample ct), ct2=(sample ct)(non - pna mix ct). The gene was considered to be mutated when ct1 values were more than 2.0 . When ct1 values were between 0 and 2, genomic pcr for sequencing was performed in 20-l volumes using 30 ng of template dna and 2 taq pcr smart mix (solgent, daejeon, korea). The pcr primers used for idh1/2 amplification were as follows: idh1 forward primer (5'-cggtcttcagagaagccatt-3') and idh1 reverse primer (5'-gcaaaatcacattattgccaac-3'). Idh2 forward primer (5'-ccaatggaactatccg-3') and idh2 reverse primer (5'-ctccaccctggcctacctg-3'). Pcr cycling commenced with a 10 minutes hold at 95c, followed by 40 cycles of 95c for 30 seconds, 58c for 40 seconds, and 72c for 60 seconds, terminating with 72c for 5 minutes . Each amplified product was purified using a pcr clean - up kit (macherey - nagel, duren, germany) and sequenced in duplicate, in both the forward and reverse directions, using a bigdye terminator kit (applied biosystems, carlsbad, ca, usa) on an abi prism 3100 station (applied biosystems), according to the manufacturer s instructions . The primary antibody that is specific for the idh1 r132h point mutation (1:200, histonova dia - h09, dianova, hamburg, germany) was used for the samples bearing idh1 mutations, revealed by either direct pcr or pna clamping . The bond polymer intense detection system (vision biosystems, melbourne, australia) was used according to the manufacturer's instructions with minor modifications . Pearson s chi - square test or fisher exact test were performed to determine correlations between idh mutation status and clinicopathological parameters . Formalin - fixed, paraffin - embedded tissue samples from 61 patients with primary localized esfts were obtained in korea, brazil, and argentina . Fifty - five of the 61 tissue samples were obtained by surgical biopsy and the other six were obtained by surgical excision . At the time of tissue sampling, none of the patients had a history of chemotherapy or radiation therapy and there was no evidence of metastatic disease . Briefly, they are small round cell sarcomas showing diffuse membranous cd99 immunostaining, cytoplasmic periodic acid schiff staining, and ewsr1 gene translocation as demonstrated with fluorescence in situ hybridization (zytolight spec ewsr1 dual color break apart probes, zytovision, bremerhaven, germany). However, lack of an ewsr1 gene translocation was not considered as grounds for exclusion if a tumor showed the typical immunophenotypes, which are inconsistent with other small round cell tumors in the differential diagnosis of diseases such as lymphoma and rhabdomyosarcoma . Data, including the follow - up period and overall survival, were available for 48 patients . During follow - up, the patients were grouped into dead of disease, alive with disease, and no evidence of disease (ned). The classification of patients as ned was established when the follow - up period had passed more than 24 months . Our study protocol was reviewed and approved by the kyung hee university institutional review board . Idh1/2 mutations were tested using the pentose nucleic acid (pna) clamp idh1/2 mutation detection kit (panagene, daejeon, korea). All reactions had a total reaction volume of 20 l and contained template dna, primer and pna probe sets, and fluorescent polymerase chain reaction (pcr) master mix . Real - time pcr reactions of pna - mediated clamping pcr were performed using a cfx 96 (bio - rad, hercules, ca, usa). Pcr cycling conditions were as follows: 5 minutes at 94c followed by 40 cycles of 94c for 30 seconds, 70c for 20 seconds, 63c for 30 seconds, and 72c for 30 seconds . In this assay the pna probe, which is complementary to the wild - type sequence, suppresses amplification of the wild - type target . This suppression results in preferential amplification of mutant sequences by competitively inhibiting the binding of dna primers to wild - type dna . Calculations of the delta ct (ct) value were done as follows: ct1=(standard ct)(sample ct), ct2=(sample ct)(non - pna mix ct). The gene was considered to be mutated when ct1 values were more than 2.0 . When ct1 values were between 0 and 2, a ct2 value was then calculated . Genomic pcr for sequencing was performed in 20-l volumes using 30 ng of template dna and 2 taq pcr smart mix (solgent, daejeon, korea). The pcr primers used for idh1/2 amplification were as follows: idh1 forward primer (5'-cggtcttcagagaagccatt-3') and idh1 reverse primer (5'-gcaaaatcacattattgccaac-3'). Idh2 forward primer (5'-ccaatggaactatccg-3') and idh2 reverse primer (5'-ctccaccctggcctacctg-3'). Pcr cycling commenced with a 10 minutes hold at 95c, followed by 40 cycles of 95c for 30 seconds, 58c for 40 seconds, and 72c for 60 seconds, terminating with 72c for 5 minutes . Each amplified product was purified using a pcr clean - up kit (macherey - nagel, duren, germany) and sequenced in duplicate, in both the forward and reverse directions, using a bigdye terminator kit (applied biosystems, carlsbad, ca, usa) on an abi prism 3100 station (applied biosystems), according to the manufacturer s instructions . The primary antibody that is specific for the idh1 r132h point mutation (1:200, histonova dia - h09, dianova, hamburg, germany) was used for the samples bearing idh1 mutations, revealed by either direct pcr or pna clamping . The bond polymer intense detection system (vision biosystems, melbourne, australia) was used according to the manufacturer's instructions with minor modifications . Pearson s chi - square test or fisher exact test were performed to determine correlations between idh mutation status and clinicopathological parameters . Using the pna clamping method, idh1/2 mutations were detected in three of the 61 patients (5%). Of these three samples, two were idh1 mutants and one sample was an idh2 mutant . By direct sequencing, idh1/2 mutations were detected in two of the 61 patients (3%), of which, one sample was an idh1 mutant and one sample was an idh2 mutant . In total, four cases out of 61 (6%) harbored idh1/2 mutations by at least one of the two methods employed, and the numbers of idh1 and idh2 mutants were equal (table 1). Table 2 summarizes the clinicopathologic characteristics of the four mutant cases . In one of four cases, the idh1 mutation was found by both the pna clamping method and direct sequencing (case no, the idh1/2 mutation was found only by the pna clamping method (cases nos . 2 and 3). In one of four cases, examination by the pna clamping method showed equivocal results, but direct sequencing showed an idh2 mutation (case no . . The overall concordance rate of both methods was over 95% (58 of 61) and the discordance rate was less than 5% (3 of 61). In mutant cases, the concordance rate was 25% (1 of 4) and the discordance rate was 75% (3 of 4), although case no . 4 showed equivocal results by the pna clamping method . Immunohistochemistry with antibody to dia - h09 in the four cases bearing idh1/2 mutations showed positive reactions only in case no . In the four cases bearing idh1/2 mutations, three patients were korean and one patient was brazilian, and the male / female ratio was 1:1 . Three of the four patients were in their second decade and one patient was in the fifth decade . There was no evidence of distant metastasis in all patients and only one patient died during follow - up . Statistical analyses showed that idh1/2 mutant cases had stronger associations with korean patients than with south american patients (p=.009). There was no significant association between idh1/2 mutations and any of the other characteristics of tumors or patients (table 3). Research on idh1/2 mutations in human tumors has been active in recent years and has revealed that various tumors of different origins bear idh1/2 mutations . Following increased interest in idh1/2 mutations in soft tissue tumors, a rudimentary study on sarcoma cell lines demonstrated idh mutations in fibrosarcoma . Subsequently, a study on chondrogenic tumors demonstrated idh1/2 mutations in 81 of 145 (56%) cases with an idh1:idh2 mutation ratio of 10.6:1 . This study also included the evaluation of idh1/2 mutations in 222 osteosarcomas, 79 chordomas, and 25 esfts, and no mutations were found . Furthermore, previous studies support the value of examining idh mutations for the purpose of differentiating chondrosarcoma from chondroblastic osteosarcoma and chordoma . However, a recent study in japan showed that three of 12 osteosarcomas (25%) and 16 of 20 giant cell tumors (80%) harbor idh2 mutations, suggesting the possibility of idh1/2 mutations in various soft tissue tumors in addition to chondrogenic tumors . The pna clamping method is known to be sensitive, rapid, and simple to perform and can detect mutant alleles when present at levels 100-fold lower than those of wild - type alleles . In contrast, the minimum percentage of mutant dna required for analysis by direct sequencing is more than 25% . The two cases harboring idh mutations, found only by pna clamping, might have had less than 25% mutant dna . It is worth noting that three osteosarcomas bearing idh mutations were found in japanese, and three esft bearing idh mutations were found in korean patients . Although it is still early to remark on the background responsible for these findings, it is possible that asian populations may be predisposed to idh mutations in these tumors and therefore should be further evaluated . Idh1 r132h represents the most common type in gliomas, and idh2 r140q is exclusively found in acute myeloid leukemia . Whereas idh1 r132c represents the most common type in cartilaginous tumors, idh2 r172s is the dominant type in osteosarcomas and giant cell tumors . In our study, esfts demonstrated equal numbers of idh1 and idh2 mutations in which one case of r132h and one case of r172k were found . A previous study on cartilaginous tumors demonstrated that idh mutations are frequent in acral - based tumors without any other association with other factors . Idh mutations in osteosarcomas and giant cell tumors did not show any association with other clinical parameters . Our study also did not find a significant association between idh mutations and clinical parameters of esfts . In conclusion it provides evidence that esfts can harbor idh mutations in previously known hot - spot regions, although its incidence is rare . To provide generalized knowledge, our study is still lacking enough data about these mutations in esfts . Further validation with a larger case - based study would establish more reliable and significant data on prevalence rate and the biological significance of idh1/2 mutation status in esfts.
Rhabdomyosarcoma (rms) was first described by weber in 1854, is a malignant soft tissue neoplasm of the skeletal muscle origin . The most common sites of involvement of rms are head and neck, genitourinary tract, retroperitoneum, and extremities . Clinically, the manifestations of rms may vary from a small cutaneous nodule on the face to an extensive fast - growing facial swelling, which may be painless or occasionally associated with pain, trismus, paresthesia, facial palsy, and nasal discharge . The histogenesis of rms is still unclear, but the most widely accepted hypothesis is that rms arises due to the proliferation of embryonic mesenchymal tissue . The survival rate of patients with this tumor ranged from 20% to 35% in reported series . The purpose of this article was to report a case of oral rms with mobile tooth present in upper left posterior maxillary ridge surrounded by large, firm, and tender swelling in a 1-year - old boy and discuss the clinical, radiological, histopathological, and immunohistochemical features . An 1-year - old boy was referred to our institution with painful swelling in his mouth . On history taking, his parents reported that the swelling was present for 67 months which was earlier small and painless but now has increased in size up to 5 cm 6 cm . Initially, the patient was seen by a physician who prescribed antibiotic / anti - inflammatory therapy, however, the treatments were ineffective, and he was, therefore, referred to us . Written informed consent was obtained from her parent for further investigations . A mobile tooth is present in upper left posterior maxillary ridge surrounded by large, firm, and tender swelling . Intra - oral examination showed a 5 cm 6 cm, red, firm mass with grayish areas of central necrosis, covering the left side of the maxillary gingiva, from the canine to the second molar region [figure 2]. Extraoral photograph showing the lesion intraoral aspect showing extensive mass involving the maxillary alveolar mucosa computed tomography confirmed the presence of an extensive infiltrative lesion accompanied by severe bone destruction and displacement of adjacent structures [figure 3]. Histopathological analysis of the hematoxylin and eosin stained material showed clusters of small round cells with hyper chromatic nuclei and eosinophilic cytoplasm separated by fibrovascular septae [figure 4]. The neoplastic cells were strongly positive for vimentin, desmin, myoglobin, and muscle - specific actin . A diagnosis of oral rms was established on the basis of the history, clinical, radiographic and histopathological findings . Computed tomography scan showing extensive infiltrative lesion with displacement of adjacent structures photomicrograph showing a sheet of mesenchymal cells in a myxoid stroma (h and e, 200) after performing the standard diagnostic workup, the tumor was diagnosed as alveolar rms . He was referred to the pediatric oncology department, and the proposed treatment plan was a combination of chemotherapy, including vincristine, actinomycine, cyclophosphamide, and dexamethasone radiotherapy . The tumor continued to increase in size, and the patient died from lung metastases 6 months after the treatment . The incidence of rms is the highest in children aged 14 years, lower in children aged 1014 years, and lowest in those aged 1519 years . These tumors exhibit a fast and aggressive growth, reaching large dimensions, and are generally painless associated with high rates of recurrence and generalized metastases through the hematogenic and/or lymphatic routes . The head and neck region is the most common site for rms, with the orbit being the most frequent primary site . The most common site of involvement in the oral cavity is the tongue followed by the soft palate, hard palate, and buccal mucosa . In our patient, the maxillary alveolar ridge and hard palate were involved . A careful histological examination is required to differentiate such lesions from other more frequent and aggressive lesions affecting the concerned site . In our case, the marked pleomorphism noted was critical for differentiating rms from ewing's sarcoma . The presence of an alveolar pattern, pleomorphism, cohesive nature of the cells, and the absence of lymphadenopathy ruled out the diagnosis of lymphoma . In this respect, however, neuroblastoma, another small cell tumor characterized by a diffuse pattern of small round cells and the presence of rosettes / pseudorosettes with pale eosinophilic material is quite similar to the alveolar variant of rms . The frequently elevated level of urinary catecholamines in neuroblastoma aids in the differential diagnosis . The differential diagnosis also includes vascular malformations, within which the most common affecting the pediatric airway is the lymphatic or lymphatic - venous malformation . Prognosis of rms is relatively poor compared to that of other oral soft tissue malignant lesions and depends on the clinical staging and the anatomic site of the tumor . Unfortunately, in the present case, the lack of cooperation of the patient's guardians and the lack of institution of adjuvant chemotherapy and/or radiotherapy at first admission may have favored the rapid progression of the tumor and subsequently aggravated the severity of the condition, resulting in the child's death . Patients with rms may present signs and symptoms such as pain, paresthesia, loss of teeth, and trismus as a result of factors such as advanced tumor stage, infiltrative growth, and tumor location . In the present case, involvement of teeth it consists of surgical removal of the tumor followed by multiagent chemotherapy with or without radiotherapy since rms tends to metastasize to bone marrow . Finally, we conclude that in children, any swelling should be carefully examined, and treatment outcomes should be regularly followed up . High degree of suspicion, early diagnosis, and a multidisciplinary treatment approach would be of great importance in such cases.
The human lmo2 gene was first cloned from an acute t lymphocytic leukemia (t - all) patient with an (11;14)(p13;q11) translocation . It was a pivotal factor for both embryonic and adult hematopoiesis, as well as angiogenesis . Moreover, lmo2 is expressed in all hematopoietic cells except for mature t cells, and its forced ectopic expression caused t - all - like syndrome in mouse models and several x - scid patients who were treated with lentivirus - mediated gene therapy . In classic studies, lmo2 was recognized as a transcription factor and performed bi - directional regulation functions in its different target genes [79]. However, the lmo2 protein, which consists of only 2 tandem lim domains, lacks the direct dna - binding ability and functions as a bridge molecular in a transcriptional complex usually including ldb1, gata1, tal1, and e47 . Notably, recent studies revealed that lmo2 was expressed in a variety of solid tissues and tumors, with either nuclear or cytoplasmic localization, and played dual functions in tumor behaviors in different cancer types . As an adaptor molecule, many details about lmo2 binding partners, as well as molecular and cytological functions, need to be further investigated . Invasion and metastasis are hallmarks of highly aggressive tumor cells, and result primarily from enhanced cell motility controlled by actin cytoskeleton remodeling . Notably, in actin cytoskeleton regulation, profilin1 is an actin monomer - binding protein that participates in free actin monomer capture and delivery, while arp3, together with other members of the arp2/3 complex, functions as a core nucleation component for branched microfilament growth during cell migration . In a recent study, we found that lmo2 had a function of promoting tumor cell invasion and metastasis specifically in basal - type breast cancers . In the present study, we confirmed that arp3 and profilin1 were 2 binding partners of lmo2 in cytoplasm, and lmo2 facilitated the assembly of the complex including arp3, profilin1, and actin monomer, promoting lamellipodia / filopodia formation in basal - type breast cancer cells . The matchmaker gold yeast two - hybrid system (clontech, palo alto, ca, usa) was used for yeast two - hybrid assays . The lmo2 coding sequence was inserted into the pgbkt7 vector to express the gad4_bd - lmo2 fusion protein as bait . A pre - transformed library of human universal cdna cloned into pgadt7 vector was purchased from clontech . Positive clones, which presented as blue colonies, were re - seeded onto new selection medium plates and each inserted cdna fragment was pcr - amplified and sequenced . The human profilin1 and arp3 expression vectors were constructed by amplification of their coding sequences from human peripheral blood cdna and inserting into pcdna6b vector with a myc - tag . The coding region of lmo2 was inserted into the pmal - c2x vector for the expression of recombinant mbp - lmo2 fusion proteins . The lmo2 expression and lmo2-shrna lentivirus vector, as well as the control lentivirus vector, and the lenti - pac hiv expression packaging kit, the breast cancer cell line mda - mb-231 and human embryonic kidney cell line hek-293 t were obtained from atcc (manassas, va, usa) and cultured in dmem medium supplemented with 10% fetal bovine serum (life technologies, austin, tx, usa). Transfections were performed using lipofectamine 2000 following the manufacturer s instructions (life technologies). Stable cell strains of mda - mb-231-lmo2, mda - mb-231-control and mda - mb-231-sh - lmo2 were selected and maintained by cultured in the medium with puromycin (2 g / ml) 3 days after lentivirus infection . Cells transfected with rac1(q61l) or cdc42(q61l) expression vector were cultured in the presence of 500 g / ml g418 for 1 week for selection to remove the non - transfected cells before assay . Total proteins were extracted using a protein extraction kit (cwbio, beijing, china). Protein concentrations were assayed with a bca protein assay kit (pierce biotechnology, rockford, il, usa). Immunostaining was detected using an enhanced chemiluminescence system (amersham pharmacia biotech, buckinghamshire, uk). E. coli cells were transformed with pmal - c2x / pmal - lmo2, and then activated and cultured in a 1-l flask . Mmol / l) was added to cultures at a density of od 0.60.8 for 4 h to induce the expression of the recombinant proteins . The bacterial cells were then harvested by centrifuging at 4000 rpm for 15 min, re - suspended in ste buffer (50 mmol / l tris - hcl ph 7.9, 0.5 mmol / l edta, 50 mmol / l nacl, 5% glycerol), and sonicated 5 times (for 10 s at 250 w for each time) for protein extraction . Next, 10 mg total bacterial protein from each sample was purified with amylase - resin column (new england biolabs, ipswich, ma, usa) following the manufacturer s instructions . We used 100 l of purified mbp - lmo2 fusion or mbp proteins in an mbp - pulldown assay with 1 mg of total mda - mb-231 cell lysate in a total volume of 1 ml . Each mixture was incubated at 4c overnight with rotation before 100 l of the amylase - resin was added and the samples were incubated for an additional 2 h. then, the resin in each sample was washed 3 times with pbst, mixed with an equal volume of 2sds loading buffer, and heat - denatured for 10 min . Finally, the prepared samples were subjected to sds - page and analyzed by western blotting with the relevant antibodies . A total of 1/20 of the total protein mixture of each sample was loaded as the input . After pre - clearing with 5 l of 50% protein g beads (life technologies), the supernatant of each sample was incubated with 5 g anti - lmo2 or -v5 antibodies (1: 100 dilution) or rabbit igg as the control at 4c overnight with rotation . Then, 10 l of 50% protein g beads (life technologies) was added to each sample and rotated for an additional 2 h. after washing 3 times with pbst, the beads were mixed with an equal volume of 2sds loading buffer and heat - denatured for 10 min . The prepared samples were then subjected to sds - page and analyzed using western blotting with relevant antibodies . A total of 1/20 of the proteins from each sample was used as the input . Mda - mb-231 cells (210) were seeded onto cell chamber slides (corning, tewksbury, ma, usa) in 24-well plates 24 h before assaying . The cells on the slides were fixed with 4% formaldehyde and then stained by fitc - labeled phalloidin (sigma - aldrich, st . Louis, mo, usa, 1: 500 dilution), or stained with anti - lmo2 and anti - arp3/anti - profilin1 antibodies (1: 200 dilution) at 4c overnight, followed by incubating with the appropriate fluorescent secondary antibodies at room temperature for 1 h. images were captured using an fv1000 confocal microscope (olympus, center valley, pa, usa). The matchmaker gold yeast two - hybrid system (clontech, palo alto, ca, usa) was used for yeast two - hybrid assays . The lmo2 coding sequence was inserted into the pgbkt7 vector to express the gad4_bd - lmo2 fusion protein as bait . A pre - transformed library of human universal cdna cloned into pgadt7 vector was purchased from clontech . Positive clones, which presented as blue colonies, were re - seeded onto new selection medium plates and each inserted cdna fragment was pcr - amplified and sequenced . The human profilin1 and arp3 expression vectors were constructed by amplification of their coding sequences from human peripheral blood cdna and inserting into pcdna6b vector with a myc - tag . The coding region of lmo2 was inserted into the pmal - c2x vector for the expression of recombinant mbp - lmo2 fusion proteins . The lmo2 expression and lmo2-shrna lentivirus vector, as well as the control lentivirus vector, and the lenti - pac hiv expression packaging kit, the breast cancer cell line mda - mb-231 and human embryonic kidney cell line hek-293 t were obtained from atcc (manassas, va, usa) and cultured in dmem medium supplemented with 10% fetal bovine serum (life technologies, austin, tx, usa). Transfections were performed using lipofectamine 2000 following the manufacturer s instructions (life technologies). Stable cell strains of mda - mb-231-lmo2, mda - mb-231-control and mda - mb-231-sh - lmo2 were selected and maintained by cultured in the medium with puromycin (2 g / ml) 3 days after lentivirus infection . Cells transfected with rac1(q61l) or cdc42(q61l) expression vector were cultured in the presence of 500 g / ml g418 for 1 week for selection to remove the non - transfected cells before assay . Total proteins were extracted using a protein extraction kit (cwbio, beijing, china). Protein concentrations were assayed with a bca protein assay kit (pierce biotechnology, rockford, il, usa). Immunostaining was detected using an enhanced chemiluminescence system (amersham pharmacia biotech, buckinghamshire, uk). De3 e. coli cells were transformed with pmal - c2x / pmal - lmo2, and then activated and cultured in a 1-l flask . Mmol / l) was added to cultures at a density of od 0.60.8 for 4 h to induce the expression of the recombinant proteins . The bacterial cells were then harvested by centrifuging at 4000 rpm for 15 min, re - suspended in ste buffer (50 mmol / l tris - hcl ph 7.9, 0.5 mmol / l edta, 50 mmol / l nacl, 5% glycerol), and sonicated 5 times (for 10 s at 250 w for each time) for protein extraction . Next, 10 mg total bacterial protein from each sample was purified with amylase - resin column (new england biolabs, ipswich, ma, usa) following the manufacturer s instructions . We used 100 l of purified mbp - lmo2 fusion or mbp proteins in an mbp - pulldown assay with 1 mg of total mda - mb-231 cell lysate in a total volume of 1 ml . Each mixture was incubated at 4c overnight with rotation before 100 l of the amylase - resin was added and the samples were incubated for an additional 2 h. then, the resin in each sample was washed 3 times with pbst, mixed with an equal volume of 2sds loading buffer, and heat - denatured for 10 min . Finally, the prepared samples were subjected to sds - page and analyzed by western blotting with the relevant antibodies . A total of 1/20 of the total protein mixture of each sample was loaded as the input . After pre - clearing with 5 l of 50% protein g beads (life technologies), the supernatant of each sample was incubated with 5 g anti - lmo2 or -v5 antibodies (1: 100 dilution) or rabbit igg as the control at 4c overnight with rotation . Then, 10 l of 50% protein g beads (life technologies) was added to each sample and rotated for an additional 2 h. after washing 3 times with pbst, the beads were mixed with an equal volume of 2sds loading buffer and heat - denatured for 10 min . The prepared samples were then subjected to sds - page and analyzed using western blotting with relevant antibodies . A total of 1/20 of the proteins from each sample was used as the input . Mda - mb-231 cells (210) were seeded onto cell chamber slides (corning, tewksbury, ma, usa) in 24-well plates 24 h before assaying . The cells on the slides were fixed with 4% formaldehyde and then stained by fitc - labeled phalloidin (sigma - aldrich, st . Louis, mo, usa, 1: 500 dilution), or stained with anti - lmo2 and anti - arp3/anti - profilin1 antibodies (1: 200 dilution) at 4c overnight, followed by incubating with the appropriate fluorescent secondary antibodies at room temperature for 1 h. images were captured using an fv1000 confocal microscope (olympus, center valley, pa, usa). In a yeast two - hybrid assay using lmo2 as the bait, dozens of candidates that interacted with lmo2 were identified (presented as blue colonies; figure 1a). After pcr amplification and sequencing of the inserted cdna fragments for each clone, 2 fragments aligned to the coding sequence of profilin1 and arp3, respectively, were screened out (figure 1b), suggesting the potential binding between lmo2 and arp3/profilin1 . Further, using mbp - pulldown assay, binding between arp3/profilin1 and recombinant mbp - lmo2 fusion proteins were confirmed (figure 2a). Moreover, co - immunoprecipitation assay also confirmed the endogenous lmo2-arp3 and lmo2-profilin1 interaction (figure 2b). Immunofluorescence staining indicated strongly cytoplasmic co - localization of lmo2 and profilin1/arp3 (figure 2c), suggesting that these interactions occurred primarily in cytoplasm . Considering that both profilin1 and arp3 can bind with the actin monomer, lmo2, profilin1, arp3, and actin monomer may form a complex . Correspondingly, as shown in figure 3a, co - immunoprecipitation assay revealed that profilin1 and arp3 could indeed be immunoprecipitated by each other, while the amount of arp3 or profilin1 co - immunoprecipitated by each other was increased in lmo2-overexpressing mda - mb-231 cells compared to control cells (figure 3a, 3b). -actin, an actin monomer, could also be co - immunoprecipitated by arp3 or profilin1 . The amount of -actin co - precipitated by profilin1 was increased in lmo2-overexpressing mda - mb-231 cells compared to the control, but the change in -actin amount co - precipitated by arp3 was not obvious (figure 3a, 3b). Taken together, these data indicated that lmo2 could enhance the interaction between arp3 and profilin1 and facilitated the profilin1-mediated actin monomer delivery to the growing branched microfilaments marked by arp3, which primarily contributed to cell protrusion formation and cell movement . Notably, in a previous study, we found that basal - type breast cancer cell line mda - mb-231 with lmo2 knocking - down showed more tightly - attached cell morphologies and fewer cell protrusions, while overexpression of lmo2 in mda - mb-231 cells caused the opposite effect . Moreover, the small rho - gtpase family member rac1 and cdc42 are key positive regulators of lamellipodia and filopodia formation, respectively . In general, forced expression of the constitutively active form of rac1 (rac1(q61l)) or cdc42 (cdc42(q61l)) in mda - mb-231 cells increased lamellipodia (figure 4a, 4b) or filopodia (figure 4c, 4d), respectively . However, knocking - down of lmo2 largely eliminated these effects and maintained the relatively tightly - attached, less - protruding cell morphology (figure 4a4d). These results indicated the cytological function of lmo2 as a positive regulator of lamellipodia / filopodia formation and cell motility in basal - type breast cancer cells . In a yeast two - hybrid assay using lmo2 as the bait, dozens of candidates that interacted with lmo2 were identified (presented as blue colonies; figure 1a). After pcr amplification and sequencing of the inserted cdna fragments for each clone, 2 fragments aligned to the coding sequence of profilin1 and arp3, respectively, were screened out (figure 1b), suggesting the potential binding between lmo2 and arp3/profilin1 . Further, using mbp - pulldown assay, binding between arp3/profilin1 and recombinant mbp - lmo2 fusion proteins were confirmed (figure 2a). Moreover, co - immunoprecipitation assay also confirmed the endogenous lmo2-arp3 and lmo2-profilin1 interaction (figure 2b). Immunofluorescence staining indicated strongly cytoplasmic co - localization of lmo2 and profilin1/arp3 (figure 2c), suggesting that these interactions occurred primarily in cytoplasm . Considering that both profilin1 and arp3 can bind with the actin monomer, lmo2, profilin1, arp3, and actin monomer may form a complex . Correspondingly, as shown in figure 3a, co - immunoprecipitation assay revealed that profilin1 and arp3 could indeed be immunoprecipitated by each other, while the amount of arp3 or profilin1 co - immunoprecipitated by each other was increased in lmo2-overexpressing mda - mb-231 cells compared to control cells (figure 3a, 3b). -actin, an actin monomer, could also be co - immunoprecipitated by arp3 or profilin1 . The amount of -actin co - precipitated by profilin1 was increased in lmo2-overexpressing mda - mb-231 cells compared to the control, but the change in -actin amount co - precipitated by arp3 was not obvious (figure 3a, 3b). Taken together, these data indicated that lmo2 could enhance the interaction between arp3 and profilin1 and facilitated the profilin1-mediated actin monomer delivery to the growing branched microfilaments marked by arp3, which primarily contributed to cell protrusion formation and cell movement . Notably, in a previous study, we found that basal - type breast cancer cell line mda - mb-231 with lmo2 knocking - down showed more tightly - attached cell morphologies and fewer cell protrusions, while overexpression of lmo2 in mda - mb-231 cells caused the opposite effect . Moreover, the small rho - gtpase family member rac1 and cdc42 are key positive regulators of lamellipodia and filopodia formation, respectively . In general, forced expression of the constitutively active form of rac1 (rac1(q61l)) or cdc42 (cdc42(q61l)) in mda - mb-231 cells increased lamellipodia (figure 4a, 4b) or filopodia (figure 4c, 4d), respectively . However, knocking - down of lmo2 largely eliminated these effects and maintained the relatively tightly - attached, less - protruding cell morphology (figure 4a4d). These results indicated the cytological function of lmo2 as a positive regulator of lamellipodia / filopodia formation and cell motility in basal - type breast cancer cells . Based on gene expression features, breast cancers can be subdivided into luminal a, luminal b, her2, and basal subtypes (the pam50 subtyping system). Among all these subtypes, basal - type breast cancer is a prognostically unfavorable subtype characterized by high aggressiveness and metastasis . In a previous study, we demonstrated that, specifically in basal - type breast cancer, lmo2 promoted tumor cell migration, invasion, and metastasis, and this function was partially achieved by blocking lim kinase 1 (limk1)-mediated phosphorylation of cofilin1 . Herein, we found that high lmo2 expression also contributed to the regulation of cell protrusions by interaction with arp3 and profilin1 . Because lmo2 increased the release of actin monomers by targeting cofilin1, it can be speculated that interactions between lmo2, arp3/profilin1, and actin monomers may accelerate free actin monomer delivery by profilin1 as the materials for the growth of branched microfilaments marked by the arp2/3 complex, and these molecular interactions finally promote the branched microfilament growth and lamellipodia / filopodia formation (figure 5). Traditionally, lmo2 was primarily considered as a transcription factor in cell nuclei in hematopoietic cells and vascular endothelia; however, some recent studies revealed that lmo2 is expressed in a variety of other tissues and tumors, with either nuclear or cytoplasmic location . Moreover, lmo2 showed predominantly cytoplasmic location in most epithelial - derived tumors and dual effects on tumor behaviors: some reports indicated that lmo2 played an oncogenic role in glioblastoma and prostate carcinoma, but was a good prognostic marker for diffuse large b cell lymphoma (dlbcl), acute b lymphocytic leukemia (b - all), and pancreatic carcinoma . In breast cancers, lmo2 primarily is located in cytoplasm and plays additionally divergent functions in different breast cancer subtypes . Our data in the current study further support this viewpoint and provided 2 novel cytoplasmic lmo2 binding partners, arp3 and profilin1, for the annotation of the function of lmo2 in basal - type breast cancers . The current study identified 2 novel cytoplasmic lmo2-binding partners, arp3 and profilin1, and revealed a novel functional mechanism of lmo2 in promoting lamellipodia / filopodia formation via lmo2-arp3 and lmo2-profilin1 interactions in basal - type breast cancer cells . In general, these findings contribute to optimizing the knowledge of lmo2 in biochemistry and cell - level biology . Specifically, lmo2 exhibited complicated effects on tumor behaviors in different cancer types, and our study confirmed a basal - type breast cancer - specific tumor - promoting role of lmo2 . These findings also suggest the potential of lmo2 for use as a cancer - type - dependent biomarker for precision medicine in clinical practice.
The demand for food of animal origin increases each year . To satisfy this demand, livestock production within the european union (eu) in 2011 was approximately 10 million heads of goats, 80 million heads of sheep, 80 million heads of cattle, and 150 million heads of pigs . To produce safe and nutritional food products, the animals need to be in good health . Even though veterinary medicines contribute to improving and maintaining animal health, administration of these medicines by the farmer is carried out under licence via a veterinarian . The amount of drugs employed in food production estimated by kools et al . Was 6051 t, with antibiotics the most frequently used class of drug (5393 t). The groups of tetracyclines and -lactams were used in high amounts and antiparasitic agents (194 t) were the second most frequently used class of drug . Intensively produced animals are often fed with concentrated feed, a mixture of various materials (oats, wheat, barley, rye, cottonseed, and crambe) and additives . Antibiotic sulphonamides, tetracyclines, and -lactam are the most frequently used antibiotics, and coccidiostats and ivermectin are the most frequently used antiparasitic agents . Coccidiostats and histomonostats are a group of antiparasitic agents that have been shown to be persistent during the manufacture of feed and carry - over of this type of drugs has been demonstrated . The eu introduced maximum levels for these substances in nontarget feed in 2009; this regulation was later modified for some coccidiostats by the regulation ec/574/2011 . Cross contamination between medicated and nonmedicated feed could occur with any type of drug added to the feed, not only to coccidiostats, particularly when the cleaning process between batches is inefficient . Recently, a study conducted by stolker et al . In the netherlands confirmed that nonmedicated feed batches were contaminated with antibiotic residues such as tetracyclines, penicillins, and sulfonamides . From 140 samples the fact that antibiotics could be present as contaminants in feed without the farmers' knowledge implies that withdrawal times will not be considered and antibiotic residues could remain in animal products (meat, eggs, milk, honey, seafood, and fish), in addition to the development of antibiotic resistant bacteria . Due to the problems related to food safety, the authorities involved regularly monitor the presence of veterinary drugs in food of animal origin (eggs, milk, muscle, and liver). Controls on the water and food consumed by the animals have also been implemented, but the analysis conducted only evaluated the presence of substances such as pesticides [7, 8], nitrofurans, and mycotoxins [10, 11]. Methods based on hplc - ms / ms detection are considered confirmatory methods because these types of methods provide full or complementary information, enabling substances to be unequivocally identified and if necessary quantified at the level of interest, according to the european commission decision 2002/657/ec . Therefore, it is recommended to use confirmatory methods to detect the presence of antibiotics in nontarget feed . Van poucke et al . Reported a method for the analysis of zinc bacitracin, spiramycin, tylosin, and virginiamycin with quantification limits below 500 g / kg . Published a multiclass method for the analysis of 33 analytes for 14 groups of antibiotics (including tetracyclines, quinolones, penicillins, ionophore coccidiostats, macrolides, and sulphonamides) with quantification limits of 3.865.0 g / kg . Of the eight forms of commercially available tetracyclines, four are frequently used in food animal production (chlortetracycline, doxycycline, oxytetracycline, and tetracycline). Maximum residue limits (mrl) for these four tetracyclines and their three epimers have been introduced for various foods of animal origin, including eggs, muscle, and milk . As maximum levels (ml) for these substances in feed samples concentrations of tetracyclines in medicated feed are variable and depend on the target animal, with dosage rates between 25 and 700 mg / kg . Therefore, carry - over should be expected in the batch of feed manufactured after a medicated feed . Reported that 100% of samples from the first batch of feed produced after the manufacture of medicated feed were contaminated with tetracyclines, with concentrations of 0.5154 mg / kg . Based on these results, carry - over contamination is also expected for the other two commonly used tetracyclines (chlortetracycline and tetracycline) as they have similar chemical properties [16, 17]. Based on the common use of tetracyclines in food animal production and the absence of confirmatory methods for the presence of the four tetracyclines in animal feed, the aim of this work is to present an hplc - ms / ms method for the analysis of tetracyclines in nonmedicated feed samples at levels of g / kg . Disodium hydrogen phosphate dehydrate, anhydrous citric acid, ethylenediaminetetraacetic acid disodium salt (edta), trichloroacetic acid (tca), and formic acid (purity> 99% by analysis) were purchased from sigma - aldrich (mo, usa). Tetracycline, chlortetracycline, doxycycline, and oxytetracycline (purity> 98%) and demeclocycline, used as the internal standard (is), were supplied by sigma - aldrich (mo, usa). Organic solvents, methanol and ethyl acetate, hplc or analytical grade, were purchased from scharlau chemie (barcelona, spain) and demineralised water (resistivity 18 mu cm) was prepared in - house with a milli - q water system (millipore, bedford, ma, usa). Mobile phase a consisted of milli - q water acidified to 0.04% with formic acid and mobile phase b consisted of methanol, acidified to 0.1% with formic acid . To prepare the individual stock solution of tetracycline, 20 mg of tetracycline was dissolved in 20 ml of methanol and stored at 20c for up to six months . The intermediate solution, a mixture of tetracyclines, was prepared by diluting the stock solution of each tetracycline to a final concentration of 50 g / ml and stored at 20c for up to one month . A standard working solution of tetracycline was prepared freshly each day by diluting the intermediate stock solution to a final concentration of 1 g / ml . For the internal standard stock solution, mcilvaine buffer was prepared with 10.8 g of citric acid, 10.93 g of disodium hydrogen phosphate, and 33.62 g of ethylenediaminetetraacetic acid disodium salt dihydrate (c10h14n2na2o8). Once the three reagents were completely dissolved they were mixed and the volume was made up to 1 l and the ph adjusted to ph 4 . Hplc - ms / ms determination of tetracyclines was performed according to a previously reported method . The hplc - ms / ms consisted of an hplc alliance 2795 and a ms quattro premier xe triple quadrupole (waters, manchester, uk) controlled by the software masslynx 4.1 (waters, manchester, uk). The chromatographic analyses were performed by injecting 25 l of extract into a sunfire c18 column (150 2.1 mm i.d ., 5.0 mm) (waters, manchester, uk). Mobile phases a and b were mixed on a gradient mode and with a flow rate of 0.25 ml / min . An electrospray ionisation (esi) probe was set up on the triple quadrupole ms to evaporate the mobile phase coming from the hplc and to ionise the tetracyclines . Analytes were detected in positive - ion mode and under the following conditions: capillary voltage 3 kv, source temperature 120c, desolvation temperature 350c, cone gas flow 49 l h, and desolvation gas flow 650 l h. as indicated in the decision 2002/657/ec, tetracyclines were identified on the basis of their selected reaction monitoring (srm) transition and their retention time (rt). Different volumes of the tetracycline working standard solution were added to 2 g feed samples (exempt of tetracycline) and shaken in the dark for 30 min . Concentrations of tetracycline in the matrix matched feed samples were 0, 400, 800, 1200, 1600, and 1600 g / kg . To extract the tetracyclines from the feed samples, 2 g of grounded feed, 8 ml of mcilvaine buffer, 300 l of tca, and 0,1 ml of is working solution were added to a 50 ml polypropylene tube . After shaking the sample in the dark for 10 min, 6 ml of ethyl acetate was added and the samples were shaken in an orbital shaker at 200 rpm for 20 min . After 15 of centrifugation at 4500 rpm, in a model 5415d centrifuge (eppendorf, hamburg, germany), 2 ml of the supernatant was transferred to a 10 ml amber conical tube and evaporated to dryness, in a turboevaporator model turbo vap ii de zyrmark (hopkinton, ma, usa). The final residue was dissolved in 0.5 ml of a mixture of mobile phase components (90a:10b) and vortexed . To filtrate the final extract ultrafree - mc centrifugal filter (millipore, ma, us) was employed and centrifuged at 9000 rpm for 10 min . The filtrate was transferred into an hplc vial which contained a 0.3 ml microinsert and stored at 20c; analyses were conducted within 3 days . The guidelines used to validate the method and to interpret the results were those established in the commission decision 2002/657/ec . The decision establishes criteria and procedures for the validation of analytical methods to ensure the quality and comparability of analytical results generated by official laboratories . Aspects such us trueness / recovery, precision (under repeatability and reproducibility conditions), specificity, and applicability / ruggedness / stability of the method were investigated . Trueness and the other validation parameters were assessed through recovery of additions of known amounts of tetracyclines in blank feed samples (except tetracyclines) as no certified reference material exists for this type of analysis and following the recommendation included in the decision 2002/657/ec . For validation one batch of matrix - matched samples was prepared with 21 samples fortified with tetracyclines at six concentrations (0, 400, 800, 1200, 1600, and 4000 g / kg). For concentrations 400, 800, and 1200 g / kg six replicated samples were prepared with only one sample for the remaining concentrations (0, 1600, and 4000 g / kg). Additionally, two reagent samples were prepared for control, a blank reagent (containing only the reagents) and fortified reagent (containing 1200 g / kg of tetracycline and the reagents). To conduct the validation three batches of matrix - matched samples were prepared; each batch consisted of 21 samples fortified with tetracyclines at 0, 400, 800, 1200, 1600, and 4000 g / kg . While for levels of 400, 800, and 1200 g / kg six replicated samples were prepared, only one sample was used for levels of 0, 1600, and 4000 g / kg . After fortification, and prior to extraction, samples were shaken on an orbital shaker at 200 rpm for 10 min . After the samples extraction procedure explained above was applied . As well as the 21 matrix - matched samples, with each batch of samples two additional samples were prepared with reagents (no feed); one was spiked with tetracycline at 1200 g / kg (fortified reagents) and the other was not spiked with tetracyclines (blank reagent). Additionally, 20 feed samples were analysed to determine selectivity / specificity . Ten were spiked with tetracyclines at a validation level (800 g / kg) and with 400 g / kg of three antimicrobial drugs commonly used in food animal production (sulfadiazine, sulfamethoxazol, and trimethoprim). The other ten samples were analysed without adding any veterinary drugs (decision 2002/657/ec). The decision limit (cc) and detection capability (cc) were determined as described by freitas et al ., following the decision 2002/657/ec requirements and applying the validation level of 800 g / kg . Nonmedicated feed samples were collected from 50 milk farms located in galicia, spain, to investigate the presence of tetracycline residues in feed that are being consumed by cows that are producing milk daily . Additionally, samples were supplied by feed manufacturers to investigate carry - over levels of tetracyclines after making medicated feed . The sampling procedures in both cases were conducted following the requirement of the regulation 691/2013 . Feed samples were stored at room temperature and in the dark with the objective of using similar store conditions compared to that in the industry and farms . The main raw materials of the feed samples according to the labels were corn genetically modified (between 36 and 15%), soy flour produced from soya been genetically modified (present in some samples, between 4 and 38%), colza flour (present in some samples, between 3 and 47%), and barley (present in some samples, between 6 and 18%); each feed sample had a particular composition which normally depends on the manufacture . On the other proximate composition the feed samples were crude protein (between 18 and 26%), crude fibre (between 4 and 10%), oil and fat crude (between 2.5 and 6%), crude ash (between 6 and 10%), and sodium (between 0.7 and 4%). Tetracyclines have more than three hydroxyl groups that are easily ionisable by esi to enhance their detection . Therefore, esi is commonly used for the ionisation of tetracyclines when analysis is conducted by hplc - ms / ms, independently of the matrix type [14, 2024]. To optimise the ms parameters for a high ms signal response, standard solutions of 1 g / ml of individual tetracyclines were infused directly into the ms . During this procedure, one precursor ion and two product ions were selected for each tetracycline to conduct srm analysis (table 1). With the hplc - ms / ms operating on srm mode, two transitions and the retention time were used to achieve four identification points for each of the analytes, as required in the decision 2002/657/ec . It should be highlighted that with other detection methods, such as diode array or a fluorescence detector, only one identification point is achieved and more steps are required . The use of precursor and product ions identified in this research for tetracyclines was also reported by boscher et al . 2010 for the analysis of these analytes in feed, royal jelly, and muscle [14, 20]. The separation gradient could be run at ambient temperature; however, it was observed that an increase in mobile pressure can cause the system to collapse; therefore a temperature of 35c is recommended . Based on previously reported methods for tetracycline analysis in food and feed matrices [14, 2527] different extraction protocols were tested . Firstly, simple extractions with ethyl acetate, hexane, acetonitrile, methanol, and dichloromethane were tested . However, recoveries were low, due to the tendency of tetracyclines to form chelation complexes with different cations . Therefore, initial extraction with mcilvaine / edta buffer was employed and gave satisfactory results, as in previously reported methods [7, 21, 28, 29]. Tetracyclines dissolved in the mcilvaine / edta solution were then extracted with ethyl acetate, as these two solutions are immiscible, and separation could be easily conducted as the organic phase stays on the top layer . Other authors employ spe cartridges such as oasis for dispersive spe instead of ethyl acetate in order to purify the extract . The use of spe was avoided to reduce time and cost of the analysis as satisfactory results were achieved with the presented method . Animal feed is derived from a multitude of raw materials from plant and animal origin, as well as pharmaceutical and industrial sources . As feed ingredients vary depending upon the animal, that is, poultry, swine, and cattle, analysis of tetracyclines in different feed types could be more complicated, particularly as the fat content will vary . The method used in this paper has been tested in feed for cattle, laying birds and chickens, rabbits, and dairy cows, and satisfactory results were obtained in all cases . These matrices were tested by preparing matrix - matched calibration curves with each type of feed, depending on the animal that was going to consume the feed . Calibration curves to quantify concentrations of tetracyclines were obtained by spiking feed samples with the analytes at different concentrations . If linear regression coefficients (r) were below 0.98 the extraction procedure was repeated . Even if a signal to noise ratio (s / n) higher than 10 was achieved at 300 g / kg, validation was conducted at 800 g / kg to provide acceptable results at 0.5, 1, and 1.5 times the validation level (800 g / kg) recommended by the decision 2002/657/ec . Figure 1 shows chromatograms of a blank sample, figure 2 shows a blank sample spiked with all the tetracyclines at 400 g / kg, and figure 3 shows the srm transition employed for each tetracycline in one of the samples spiked at 400 g / kg . Reference materials were not available; therefore trueness of the method was calculated in terms of recoveries . However, the advantage of the presented extraction protocol is that it does not require solid phase extraction and the four main tetracyclines can be identified and quantified simultaneously . Results for repeatability, calculated as the mean rds of the rsd (n = 6) for each concentration on each day of the validation, were below 17% for chlortetracycline, doxycycline, oxytetracycline, and tetracycline (table 2). Results for reproducibility, calculated as the rds of 21 samples at the same concentration, were below 23% for all tetracyclines (table 2). To determine selectivity / specificity, 10 blank samples and the same samples spiked with the four tetracyclines at 800 g / kg were analysed . The successful quantification of tetracyclines and the absence of interfering peaks at the retention times of each analyte demonstrated the selectivity / specificity of the method . The limit of detection (lod) and limit of quantification (loq) of the method were calculated and verified with feed samples spiked with the tetracyclines at different concentrations . Based on s / n above 3 for lod and above 10 for loq in matrix - matched samples, the lod and loq of the method were set at 35 and 47 g / kg for chlortetracycline, 40 and 60 g / kg for oxytetracycline, 24 and 40 g / kg for tetracycline, and 100 and 150 g / kg for doxycycline . Cc and cc were determined using the conditions for substances for which no permitted limit has been established . Cc and cc were higher than lod and loq for all the compounds, meaning that tetracyclines detected at a higher level than the cc will be positive and levels of tetracyclines were quantifiable, without doubt . Cc and cc for chlortetracycline, doxycycline, oxytetracycline, and tetracycline were below 400 g / kg (table 2). Validation results already published have shown, in some cases, higher repeatability, reproducibility, and lower loq, such as the work conducted by boscher et al . Who reported rsd lower than 12% and loq of 20 g / kg . Similarly, the method reported by stolker et al . Achieved a loq of 0.1 g / kg for doxycycline and oxytetracycline . However, it should be highlighted that none of the methods reported, based on the authors knowledge, have been validated according to the decision 2002/657/ec . From 75 feed samples investigated oxytetracycline was the tetracycline more frequently detected present in 8% of the samples (n = 6); its concentration range was between 90 and 400 mg / kg . Each tetracycline was detected in individual samples and their concentrations were 150 and 110 mg / kg . Chlortetracycline was the pharmaceutical detected at the highest concentration in this study, 15.14 mg / kg in feed samples for calves . It is important to highlight that the consumption of contaminated feed at level such as 15.14 mg / kg could cause food safety problems giving positive food samples . Carry - over during feed manufacture has been proved for veterinary drugs such as coccidiostats and a similar case can be considered for tetracyclines, a group of antimicrobial agents commonly used in food animal production, due to its low cost . The research work presents a simple and fast method for the analysis of the four tetracyclines regulated in the production of food of animal origin (chlortetracycline, doxycycline, oxytetracycline, and tetracycline). The method was validated according to the european guideline and successfully applied to 75 nonmedicated feed samples . Results showed the presence of tetracyclines in 15% of the samples, indicating that cross contamination occurs and maximum levels for tetracyclines may be required in the future.
Oral squamous cell carcinoma (oscc) is one of the most aggressive malignancies worldwide and accounts for more than 90% of all oral cancers . It is ranked as the sixth leading cause of cancer mortality worldwide and the second leading cause of cancer mortality in india . The most common sites of oscc are the lateral ventral surface of the tongue, the floor of the mouth and buccal mucosa . A less frequent site to be affected is the gingiva which comprises of about 10% of all osccs and affects 91% of patients with gingival carcinoma aged above 66 years . Of all the intraoral carcinomas, gingival oscc is least associated with tobacco abuse and has the greatest predilection for females . After these contradictory reports, it was suggested to analyze the cause of the male dominant tendency of gingival squamous cell carcinoma (scc) in asian patients . These tumors commonly arise in the edentulous areas, although they may also develop at dentate areas . It is generally agreed that carcinomas of the mandibular gingiva are more common than those of the maxillary gingiva and 60% of those are located posterior to the premolars . Although generally classified as a subset of oscc, gingival scc is a unique malignancy and can mimic a multitude of other lesions, especially those of inflammatory origin . Clinical presentations of sccs of the gingiva can be quite variable and hence are misdiagnosed as benign tumors or other inflammatory responses . The 5-year survival rate of gingival scc is considerably less as compared to scc developing at other sites, suggesting a poor prognosis . Hence, scc of the gingiva should be considered in the differential diagnosis while dealing with gingival lesions particularly in elderly individuals and is of paramount importance that the lesion be diagnosed early to initiate treatment and thereby improve prognosis . A 62-year - old female patient reported to a private dental clinic with pain in the right lower back tooth region for the past 2 weeks . Intraoral examination revealed the presence of reddish buccal gingival growth in relation to mesial aspect of tooth no . Extraoral examination revealed a single palpable, nontender, mobile and firm submandibular lymph node on the right side . On the basis of above findings, the buccal growth was provisionally diagnosed as an inflammatory / reactive gingival growth and apical periodontitis in relation to 47 . Since the patient insisted only on symptomatic medical management, she was prescribed antibiotics, analgesics and chlorhexidine mouthwash for 3 days . A complete hemogram and biochemical assay for blood sugar was requested and the patient was asked to report after a week . One week recall visit revealed unsatisfactory healing and blood investigation reports were all within normal limits, excepting a slightly elevated erythrocyte sedimentation rate . Due to the persistence of the lesion and poor response to medical therapy a likelihood of noninfectious and noninflammatory pathology was strongly suspected . Since the patient did not want any further conservative management and insisted on an extraction, the dentist decided to extract the tooth . Considering the innocuous appearance of the lesion, perceived lack of risk factors and the patients insistence of symptomatic management and unwillingness of the patient to undergo any radiographic examination, the dentist requested for an expert opinion from the speciality services . Considering the age of the patient, ambiguous clinical presentation and the refractory nature of the lesion, a differential diagnosis of oscc and metastatic carcinoma to the gingiva, did the patient agree for immediate biopsy along with extraction and the radiograph was taken only on follow - up . On the 2 week recall, the patient reported with the panoramic radiograph and presented with a rapidly growing soft tissue mass in the extracted site . Clinical intraoral examination revealed an ovoid reddish, spongy mass measuring about 1 cm 1 cm from the extracted site [figure 1]. Two weeks postextraction shows reddish, ovoid growth on the posterior alveolar ridge orthopantomogram showing the extracted site (right mandible) with no osseous changes histopathological examination revealed islands and sheets of dysplastic epithelium invading into the underlying connective tissue stroma with keratin pearl formation . The overlying epithelium showed hyperkeratinized stratified squamous epithelium with dysplastic features suggesting a diagnosis of well - differentiated scc [figures 35]. Photomicrograph showing squamous epithelium with islands of dysplastic cells infiltrating the connective tissue (h&e stain, x40) photomicrograph showing well - differentiated squamous epithelial islands within the connective tissue (h&e stain, x100) high power view showing island and nests of squamous epithelial cells within the connective tissue (h&e, x400) the patient was referred to cancer speciality hospital for further management . The patient was administered radiotherapy fractionated at 60 gy each session for a period of 5 weeks . The patient is continuously under follow - up 6 months postradiation and does not show any signs of recurrence [figure 6]. Oral cancer is a major global public health problem with 5,00,000 new cases diagnosed annually . According to the international classification of diseases, oral cancer refers to a subgroup of head and neck malignancies that develop on the lips, tongue, salivary glands, gingiva, floor of the mouth, oropharynx, buccal surfaces and other intraoral locations . Nevertheless, the term is synonymous to oscc of oral mucosal origin . Despite rapid advances in treatment modalities, oral cancer still remains a life - threatening disease with no remarkable improvement in prognosis and survival . The oral cavity is amenable to routine screening and clinical examination for malignant changes and therefore, in theory, these changes should be more easily detected and diagnosed at early stages leading to more effective treatment . However, because of its varied site - related clinical presentation malignant oral disease is often difficult to distinguish from benign oral lesions . Carcinoma of the gingiva is an insidious disease, does not have the clinical appearance of a malignant neoplasm and is often misdiagnosed as one of the many inflammatory lesions of the periodontium . Gingival carcinoma typically arises from keratinized mucosa, most often in the posterior mandible, where it destroys the underlying bone structure causing tooth mobility . The most common etiologic factors associated with oscc are smoking and smokeless tobacco, which increases the general risk fourfold . Of all the intraoral carcinomas, gingival oscc is least associated with tobacco abuse and has the greatest predilection for females . Other causes include phenol use, exposure to ultraviolet radiation, iron deficiency, candidal infections, oncogenic viruses and immunosuppression which may play much smaller roles . Gingival scc more frequently involves mandible than maxilla and is predominantly observed in older females over 50 years . Gingival oscc is more aggressive and in its early stage bears a resemblance to common mucosal infection and, therefore, has frequently led to a delay in diagnosis or misdiagnosis, leading to delay in treatment and making the prognosis grave . Gingival sccs carry a higher risk of metastases owing to its proximity to the underlying periosteum and bone which invites early invasion of these structures . As such, gingival scc is diagnosed late, due its similarity with other common inflammatory lesions of the gingiva, invasive procedures such as curettage and extraction of the tooth worsens the prognosis, a hypothesis first suggested by peterson (1993) and it has been suggested that dissemination of cancer cells into the circulation during invasive procedures could increase the risks of distant metastases . Eun joo choi et al . Studied the prognosis of gingival osccs in dentate patients diagnosed after invasive procedures such as curettage and extraction and found that bone invasion was seen in 75.8% patients who underwent invasive procedures and in the remaining 24.2% patients bone invasion was not demonstrated probably because the procedure included removal of floating teeth without curettage . This result suggests that removal of floating teeth without curettage may not disseminate the cancer cells into the bone marrow . In this reported case, which was also initially misdiagnosed as an inflammatory mass, subsequently an atraumatic extraction was done for the mobile tooth based on the expert opinion . Such a cautious approach has to be exercised in the management of such suspicious lesions with an eye on prevention of untoward events . However, even in the current case the outcome of the treatment has to be viewed with caution, as the patient is only in the 6 month follow - up period . The prognosis with gingival carcinomas depends on the histological subtype and clinical extent of the tumor . A well - differentiated type such as in our case is generally considered to have a favorable prognosis . However, the most important indicator of the prognosis is the clinical stage of the disease . If the neoplasm is small and localized, the 5-year cure rate is around 60%~70%; however if cervical nodal metastasis occurs, the survival rate drops to about 25% suggesting that early diagnosis is imperative . Early detection of scc is vital as the prognosis is directly related to the size of the lesion . Lesions measuring <1 cm are amenable to treatment and have a long - term prognosis . Thus, it is prudent to biopsy any unexplained lesion which remains after 2 weeks following removal of any suspected etiologic agent to avoid unnecessary delay in diagnosing such conditions . The general dentist is frequently presented with oral lesions that are ambiguous in clinical presentation and behavior . Patients with oscc have a varied etiology, some of which are established while a few of the cases do not elicit classical risk factors . Very often, the dentist is faced with the challenge of making a decision to commence treatment as desired by the patient or pursue further investigation to rule out more potentially morbid diagnosis . Such a cautious stance by the dentist can be possible only if the suspicion index for potentially life - threatening lesions is high on the differential list . Alternatively, these clinical situations necessitate the services of expert opinion that would obviate the chance of missing a diagnosis . A missed diagnosis is a lost opportunity in instituting timely and definitive care for such life - threatening lesions . Gingival oscc is more aggressive in behavior and in its early stage bears a resemblance to common mucosal infections.
This study was performed as a part of the prospective ongoing research on the positioning of chronic kidney disease in specific health check and guidance in japan project . A new annual health check program, the specific health check and guidance in japan, was started by the japanese government in 2008, targeting early diagnosis and intervention for metabolic syndrome . The target population comprises japanese citizens between the ages of 40 and 74 years . In japan, there are 47 administrative divisions (prefectures), and 13 of these prefectures (yamagata, miyagi, fukushima, and niigata from the tohoku region in northeastern japan; tokyo, kanagawa, and ibaraki from the kanto region in central japan; osaka, okayama, and kochi from the kansai, tyugoku, or shikoku region in western japan; and fukuoka, miyazaki, and okinawa from the kyushu region in southern japan), which were randomly distributed across japan, agreed with the aims of this study and performed data collection prospectively from 2008 to 2009 . Data were sent to an independent data center, the nonprofit organization japan clinical research support unit after anonymization in a linkable fashion, and verified by trained staff (k.i . And y.o . ). After that, the database was locked with a security password, which contained the participant s information managed by a research i d number but did not contain the participant s name, and was sent to each investigator on a recordable compact disc . There were a total of 346,942 subjects (mean age, 63.4 years; 41% [n = 141,938] men) for whom information on age, sex, bp, bmi, habitual smoking or drinking, use of antihypertensive drugs, and previous history of cardiovascular diseases (i.e., stroke and cardiac diseases such as angina and myocardial infarction) were available, as well as data on the serum creatinine level and dipstick urine test for proteinuria (19). Some of the regions participating in our project (i.e., okinawa and osaka) concomitantly performed regular health checkups for employees as legally mandated in japan; as a result, the database used in the present analysis also included subjects aged 2039 years (n = 2,025). Among the 346,942 subjects, 29,820 subjects with a previous history of cardiovascular disease, 243 subjects with chronic kidney disease stage 5 (estimated glomerular filtration rate [egfr] <15 ml / min/1.73 m), and 47 subjects with both were excluded from the present analysis . Moreover, 88,101 subjects with insufficient blood sampling data of glucose and lipid parameters were excluded . Supplementary table 1 shows the differences in clinical characteristics between subjects who were included in the present analysis (n = 228,778) and those who had missing data (n = 88,101). The study was conducted according to the guidelines of the declaration of helsinki and ethical guidelines for epidemiological research (1 november 2007, ministry of education, culture, sports, science, and technology and ministry of health, labor, and welfare of japan). All subjects completed a self - administered questionnaire to document their medical history, current medications, smoking habits (current smoker or not), and alcohol intake (daily drinker or not). The study physicians performed a physical examination of each subject and rechecked their medical history to improve the precision of the information . Body height and weight were measured in light clothing without shoes, and the bmi was calculated (kg / m). Bp measurement and blood and urine sampling were performed at each local medical institution to cooperate with the nationwide medical checkup . According to the recommendations of the japanese ministry of health, labor, and welfare (http://www.mhlw.go.jp/bunya/shakaihosho/iryouseido01/info03a.html), bp was measured by medical staff using a standard sphygmomanometer or an automated device on the right arm after the subject had rested for 5 min in a seated position with the legs not crossed . Pulse pressure was calculated as systolic bp diastolic bp, and mean bp was calculated as diastolic bp + (pulse pressure/3). Blood samples were collected after an overnight fast and were assayed within 24 h with an automatic clinical chemical analyzer . All measurements were conducted locally rather than at a central laboratory without calibration among different laboratories, despite the fact that beginning several years ago, standardized methods to measure laboratory data were recommended and widely adopted by the activity of the japan society of clinical chemistry . The value for hemoglobin a1c (hba1c) was estimated as a national glycohemoglobin standardization program equivalent value calculated with the following equation (20): hba1c (%) = hba1c (japan diabetes society) (%) + 0.4% . Diabetes was defined in accordance with american diabetes association guidelines (17) as a fasting glucose concentration of 126 mg / dl or higher, hba1c 6.5% or higher, or self - reported use of antihyperglycemic drugs . Diagnosis of prediabetes was based on the new american diabetes association criterion of impaired fasting glucose (fasting plasma glucose 100125 mg / dl) or hba1c 5764%, or both (17). Urinalysis by the dipstick method was performed on a single spot urine specimen collected in the early morning after overnight fasting . Urine dipstick results are interpreted by the medical staff in each local medical institution and recorded as,, 1 +, 2 +, and 3 + . In japan, it is recommended and widely adopted by the activity of the japanese committee for clinical laboratory standards (http://jccls.org/) that all urine dipstick tests be manufactured so that a urine dipstick result of 1 + will correspond to a urinary protein level of 30 mg / dl . In the current study, egfr was derived using the following equation (21): egfr (ml / min/1.73 m) = 194 age (years) serum creatinine (mg / dl) (if women 0.739). All statistical analyses were performed with spss version 18.0 j software (spss, chicago, il). Data were expressed as the means sd (age, bmi, egfr, and bp values) or median and interquartile range (glucose and lipid parameters). Clinical parameters and bp or metabolic values according to the presence of diabetes or prediabetes were compared using anova, and categorical parameters were compared with the test . We subdivided the study population according to the quintiles of pulse pressure, and the prevalence of proteinuria (1 +) was compared by test among each group of the quintiles of pulse pressure separately in subjects with diabetes, prediabetes, or normal glucose tolerance, respectively . The highest quintile of pulse pressure (63 mmhg, n = 40,511) was defined as the high pulse pressure group in the present analysis . Next, we used a multivariable logistic regression analysis to examine the independent association of high pulse pressure with proteinuria (1 +) separately in subjects with diabetes, prediabetes, or normal glucose tolerance, respectively . In the initial model (model 1), these associations were assessed with adjustment for age, sex, bmi, current smoking and daily drinking, the presence of antihypertensive medications, and egfr . Extended models were used to assess whether the association of high pulse pressure with proteinuria (1 +) was attenuated by the potential confounding effects of glucose and lipid parameters (model 2) and systolic bp (model 3). In addition, to minimize the influence of systolic bp in the association between pulse pressure and proteinuria, we examined the association only in patients with diabetes whose systolic bp was within the normal bp range (i.e., <130 mmhg) (22). Finally, we examined the association of a + 1 sd increase of pulse pressure (+ 13 mmhg), rather than pulse pressure as a dichotomous variable, with proteinuria in patients with diabetes by a multivariable logistic regression analysis . This study was performed as a part of the prospective ongoing research on the positioning of chronic kidney disease in specific health check and guidance in japan project . A new annual health check program, the specific health check and guidance in japan, was started by the japanese government in 2008, targeting early diagnosis and intervention for metabolic syndrome . The target population comprises japanese citizens between the ages of 40 and 74 years . In japan, there are 47 administrative divisions (prefectures), and 13 of these prefectures (yamagata, miyagi, fukushima, and niigata from the tohoku region in northeastern japan; tokyo, kanagawa, and ibaraki from the kanto region in central japan; osaka, okayama, and kochi from the kansai, tyugoku, or shikoku region in western japan; and fukuoka, miyazaki, and okinawa from the kyushu region in southern japan), which were randomly distributed across japan, agreed with the aims of this study and performed data collection prospectively from 2008 to 2009 . Data were sent to an independent data center, the nonprofit organization japan clinical research support unit after anonymization in a linkable fashion, and verified by trained staff (k.i . And y.o . ). After that, the database was locked with a security password, which contained the participant s information managed by a research i d number but did not contain the participant s name, and was sent to each investigator on a recordable compact disc . There were a total of 346,942 subjects (mean age, 63.4 years; 41% [n = 141,938] men) for whom information on age, sex, bp, bmi, habitual smoking or drinking, use of antihypertensive drugs, and previous history of cardiovascular diseases (i.e., stroke and cardiac diseases such as angina and myocardial infarction) were available, as well as data on the serum creatinine level and dipstick urine test for proteinuria (19). Some of the regions participating in our project (i.e., okinawa and osaka) concomitantly performed regular health checkups for employees as legally mandated in japan; as a result, the database used in the present analysis also included subjects aged 2039 years (n = 2,025). Among the 346,942 subjects, 29,820 subjects with a previous history of cardiovascular disease, 243 subjects with chronic kidney disease stage 5 (estimated glomerular filtration rate [egfr] <15 ml / min/1.73 m), and 47 subjects with both were excluded from the present analysis . Moreover, 88,101 subjects with insufficient blood sampling data of glucose and lipid parameters were excluded . Supplementary table 1 shows the differences in clinical characteristics between subjects who were included in the present analysis (n = 228,778) and those who had missing data (n = 88,101). The study was conducted according to the guidelines of the declaration of helsinki and ethical guidelines for epidemiological research (1 november 2007, ministry of education, culture, sports, science, and technology and ministry of health, labor, and welfare of japan). All subjects completed a self - administered questionnaire to document their medical history, current medications, smoking habits (current smoker or not), and alcohol intake (daily drinker or not). The study physicians performed a physical examination of each subject and rechecked their medical history to improve the precision of the information . Body height and weight were measured in light clothing without shoes, and the bmi was calculated (kg / m). Bp measurement and blood and urine sampling were performed at each local medical institution to cooperate with the nationwide medical checkup . According to the recommendations of the japanese ministry of health, labor, and welfare (http://www.mhlw.go.jp/bunya/shakaihosho/iryouseido01/info03a.html), bp was measured by medical staff using a standard sphygmomanometer or an automated device on the right arm after the subject had rested for 5 min in a seated position with the legs not crossed . Pulse pressure was calculated as systolic bp diastolic bp, and mean bp was calculated as diastolic bp + (pulse pressure/3). Blood samples were collected after an overnight fast and were assayed within 24 h with an automatic clinical chemical analyzer . All measurements were conducted locally rather than at a central laboratory without calibration among different laboratories, despite the fact that beginning several years ago, standardized methods to measure laboratory data were recommended and widely adopted by the activity of the japan society of clinical chemistry . The value for hemoglobin a1c (hba1c) was estimated as a national glycohemoglobin standardization program equivalent value calculated with the following equation (20): hba1c (%) = hba1c (japan diabetes society) (%) + 0.4% . Diabetes was defined in accordance with american diabetes association guidelines (17) as a fasting glucose concentration of 126 mg / dl or higher, hba1c 6.5% or higher, or self - reported use of antihyperglycemic drugs . Diagnosis of prediabetes was based on the new american diabetes association criterion of impaired fasting glucose (fasting plasma glucose 100125 mg / dl) or hba1c 5764%, or both (17). Urinalysis by the dipstick method was performed on a single spot urine specimen collected in the early morning after overnight fasting . Urine dipstick results are interpreted by the medical staff in each local medical institution and recorded as,, 1 +, 2 +, and 3 + . In japan, it is recommended and widely adopted by the activity of the japanese committee for clinical laboratory standards (http://jccls.org/) that all urine dipstick tests be manufactured so that a urine dipstick result of 1 + will correspond to a urinary protein level of 30 mg / dl . In the current study, proteinuria was defined as 1 + or more . Egfr was derived using the following equation (21): egfr (ml / min/1.73 m) = 194 age (years) serum creatinine (mg / dl) (if women 0.739). All statistical analyses were performed with spss version 18.0 j software (spss, chicago, il). Data were expressed as the means sd (age, bmi, egfr, and bp values) or median and interquartile range (glucose and lipid parameters). Clinical parameters and bp or metabolic values according to the presence of diabetes or prediabetes were compared using anova, and categorical parameters were compared with the test . We subdivided the study population according to the quintiles of pulse pressure, and the prevalence of proteinuria (1 +) was compared by test among each group of the quintiles of pulse pressure separately in subjects with diabetes, prediabetes, or normal glucose tolerance, respectively . The highest quintile of pulse pressure (63 mmhg, n = 40,511) was defined as the high pulse pressure group in the present analysis . Next, we used a multivariable logistic regression analysis to examine the independent association of high pulse pressure with proteinuria (1 +) separately in subjects with diabetes, prediabetes, or normal glucose tolerance, respectively . In the initial model (model 1), these associations were assessed with adjustment for age, sex, bmi, current smoking and daily drinking, the presence of antihypertensive medications, and egfr . Extended models were used to assess whether the association of high pulse pressure with proteinuria (1 +) was attenuated by the potential confounding effects of glucose and lipid parameters (model 2) and systolic bp (model 3). In addition, to minimize the influence of systolic bp in the association between pulse pressure and proteinuria, we examined the association only in patients with diabetes whose systolic bp was within the normal bp range (i.e., <130 mmhg) (22). Finally, we examined the association of a + 1 sd increase of pulse pressure (+ 13 mmhg), rather than pulse pressure as a dichotomous variable, with proteinuria in patients with diabetes by a multivariable logistic regression analysis . The mean age sd of the 228,778 subjects was 63.2 8.9 years, and 89,877 of the subjects (39.3%) were men . There were 27,913 subjects (12.2% of the total subject population) with diabetes, of whom 10,980 subjects (39.1%) were taking antihyperglycemic medications . The clinical characteristics according to the presence of diabetes or prediabetes are shown in table 1 . Compared with subjects with normal glucose tolerance (as a reference), the odds ratio (or) for the increased risk of proteinuria (1 +) in diabetes itself was 2.14 (95% ci 2.032.25), and that in prediabetes was 1.10 (1.051.14), even after adjustment for significant covariates, such as age, sex, bmi, current smoking and daily drinking, the presence of antihypertensive medications, and systolic bp level (both p <0.001). Characteristics of the study population according to the presence of diabetes or prediabetes clinical characteristics and metabolic or bp parameters according to the quintile of pulse pressure are shown in supplementary table 2 . The increasing prevalence of proteinuria (1 +) in accordance with the increasing pulse pressure was more prominent in subjects with diabetes than those without diabetes (fig . Supplementary table 3 shows the prevalence of proteinuria subdivided by the dipstick positive scale according to the quintile of pulse pressure with or without diabetes . Prevalence of proteinuria according to the quintile of pulse pressure in subjects with diabetes, prediabetes, or normal glucose tolerance . The prevalence of proteinuria (1 +) was calculated among each group of the quintiles of pulse pressure separately in subjects with diabetes, prediabetes, or normal glucose tolerance, respectively . The p value was obtained by a test among each group of the quintiles of pulse pressure . Next, a multivariable logistic regression analysis was performed to examine the independent association between the highest quintile of pulse pressure and proteinuria, separately in subjects with diabetes, prediabetes, and normal glucose tolerance . In patients with diabetes, the highest quintile of pulse pressure (63 mmhg) was positively associated with proteinuria, independently of significant covariates, including systolic bp (models 13 in table 2). When we examined the association between pulse pressure and proteinuria only in patients with diabetes whose systolic bp was within the normal range (i.e., <130 mmhg, n = 11,074 [39.7%]), the highest quintile of pulse pressure still remained significantly associated with proteinuria (or 1.46 [95% ci 1.032.08]; p = 0.04, respectively), even after adjustment for significant covariates, as shown in model 2 in table 2 . When diastolic bp or mean bp was entered into model 3 in table 3 in place of systolic bp, the association between the highest quintile of pulse pressure and proteinuria still remained significant (1.61 [1.491.75] and 1.42 [1.311.55]; both p <0.001, respectively). In contrast, the highest quintile of pulse pressure in subjects with prediabetes or normal glucose tolerance was not associated with proteinuria independently of systolic bp (model 3 in table 2). When we examined the risk of the highest quintile of pulse pressure on proteinuria among subjects without antihypertensive medications (n = 167,110), the conclusion remained unchanged (model 4 in table 2). Use of antihyperglycemic or antihyperlipidemic drugs did not influence any of the above results (data not shown). In contrast, systolic bp, used as an adjusted factor in model 3 in table 2, showed significant associations with proteinuria in subjects with diabetes, prediabetes, and normal glucose tolerance (data not shown). Or for the highest quintile of pulse pressure in the association of proteinuria (1 +) according to the presence of diabetes or prediabetes or (95% ci) for proteinuria in diabetes (n = 27,913) finally, we analyzed the association of a + 1 sd increase of pulse pressure (+ 13 mmhg), rather than pulse pressure as a dichotomous variable, with proteinuria in patients with diabetes . We found that a + 1 sd increase of pulse pressure was associated with proteinuria independently of significant covariates, including systolic bp (table 3), diastolic bp, or mean bp (data not shown). The mean age sd of the 228,778 subjects was 63.2 8.9 years, and 89,877 of the subjects (39.3%) were men . There were 27,913 subjects (12.2% of the total subject population) with diabetes, of whom 10,980 subjects (39.1%) were taking antihyperglycemic medications . The clinical characteristics according to the presence of diabetes or prediabetes are shown in table 1 . Compared with subjects with normal glucose tolerance (as a reference), the odds ratio (or) for the increased risk of proteinuria (1 +) in diabetes itself was 2.14 (95% ci 2.032.25), and that in prediabetes was 1.10 (1.051.14), even after adjustment for significant covariates, such as age, sex, bmi, current smoking and daily drinking, the presence of antihypertensive medications, and systolic bp level (both p <0.001). Characteristics of the study population according to the presence of diabetes or prediabetes clinical characteristics and metabolic or bp parameters according to the quintile of pulse pressure are shown in supplementary table 2 . The increasing prevalence of proteinuria (1 +) in accordance with the increasing pulse pressure was more prominent in subjects with diabetes than those without diabetes (fig . 1). Supplementary table 3 shows the prevalence of proteinuria subdivided by the dipstick positive scale according to the quintile of pulse pressure with or without diabetes . Prevalence of proteinuria according to the quintile of pulse pressure in subjects with diabetes, prediabetes, or normal glucose tolerance . The prevalence of proteinuria (1 +) was calculated among each group of the quintiles of pulse pressure separately in subjects with diabetes, prediabetes, or normal glucose tolerance, respectively . The p value was obtained by a test among each group of the quintiles of pulse pressure . Next, a multivariable logistic regression analysis was performed to examine the independent association between the highest quintile of pulse pressure and proteinuria, separately in subjects with diabetes, prediabetes, and normal glucose tolerance . In patients with diabetes, the highest quintile of pulse pressure (63 mmhg) was positively associated with proteinuria, independently of significant covariates, including systolic bp (models 13 in table 2). When we examined the association between pulse pressure and proteinuria only in patients with diabetes whose systolic bp was within the normal range (i.e., <130 mmhg, n = 11,074 [39.7%]), the highest quintile of pulse pressure still remained significantly associated with proteinuria (or 1.46 [95% ci 1.032.08]; p = 0.04, respectively), even after adjustment for significant covariates, as shown in model 2 in table 2 . When diastolic bp or mean bp was entered into model 3 in table 3 in place of systolic bp, the association between the highest quintile of pulse pressure and proteinuria still remained significant (1.61 [1.491.75] and 1.42 [1.311.55]; both p <0.001, respectively). In contrast, the highest quintile of pulse pressure in subjects with prediabetes or normal glucose tolerance was not associated with proteinuria independently of systolic bp (model 3 in table 2). When we examined the risk of the highest quintile of pulse pressure on proteinuria among subjects without antihypertensive medications (n = 167,110), the conclusion remained unchanged (model 4 in table 2). Use of antihyperglycemic or antihyperlipidemic drugs did not influence any of the above results (data not shown). In contrast, systolic bp, used as an adjusted factor in model 3 in table 2, showed significant associations with proteinuria in subjects with diabetes, prediabetes, and normal glucose tolerance (data not shown). Or for the highest quintile of pulse pressure in the association of proteinuria (1 +) according to the presence of diabetes or prediabetes or (95% ci) for proteinuria in diabetes (n = 27,913) finally, we analyzed the association of a + 1 sd increase of pulse pressure (+ 13 mmhg), rather than pulse pressure as a dichotomous variable, with proteinuria in patients with diabetes . We found that a + 1 sd increase of pulse pressure was associated with proteinuria independently of significant covariates, including systolic bp (table 3), diastolic bp, or mean bp (data not shown). In this nationwide study of 228,778 japanese people (mean age 63.2 years) who had no known cardiovascular disease, we demonstrated for the first time that there was a significant difference in the association between the highest quintile of pulse pressure (63 mmhg) and proteinuria (1 + on dipstick) among subjects with diabetes, prediabetes, and normal glucose tolerance . The cross - sectional design of the current study did not allow us to elucidate the pathophysiological pathway linking high pulse pressure and proteinuria (1 +). However, there are some possible explanations for the observed association . Since the glomerular afferent arterioles provide relatively low resistance, the glomerulus is susceptible to barotrauma if the pulse pressure is elevated (16). In fact, prior studies have demonstrated an association of high pulse pressure with microalbuminuria even in subjects without diabetes (7,8). In the current study, we examined the possible association of high pulse pressure and proteinuria (1 +), i.e., macroalbuminuria, and found that this association was not significant independently of systolic bp in subjects without diabetes . In contrast, systolic bp was significantly associated with proteinuria in these subjects . Although the usefulness of the urine dipstick test for risk stratification of renal and cardiovascular disease has been recognized, this method is a less sensitive measure of albuminuria compared with the measurement of urinary albumin excretion (2326). Accordingly, we cannot deny the possibility of an association between high pulse pressure and microalbuminuria in subjects without diabetes . In spite of the strict collinearity between systolic bp and pulse pressure, the or of high pulse pressure to proteinuria was reduced but remained significant even after adjustment for systolic bp in patients with diabetes (table 2). Table 3 also shows that a + 1 sd increase of systolic bp and a + 1 sd increase of pulse pressure were associated with proteinuria independently of each other, with the or of the systolic bp increase on proteinuria being higher than that of the pulse pressure increase . These findings indicate that high systolic bp showed a confirmed association with proteinuria and is an important confounder explaining the association between high pulse pressure and proteinuria; however, even after adjustment for systolic bp, the pulsatile component of bp itself was still significantly associated with proteinuria in patients with diabetes . Intriguingly, even in the patients with diabetes who were within the normal range of systolic bp values, high pulse pressure was associated with proteinuria . First, since renal autoregulation is impaired in diabetes (13,1113), it may be possible that when pulse pressure is elevated, more barotrauma - induced glomerular ultrastructural changes leading to albuminuria occur in subjects with diabetes than in those without diabetes (15). Second, much as in the previous reports (27,28), higher pulse pressure was observed in diabetes than nondiabetes (table 1), suggesting the possibility that diabetes accelerates aortic and large arterial stiffness (29). Aortic stiffness itself has a potential etiologic role in the causation and progression of renal dysfunction (3032), because loss of the damping of ventricular ejection in the stiffened aortae could lead to an increase in the transmission of these pressure changes to the renal microcirculation . In the current study, however, we did not use any measure of vascular stiffness more direct than pulse pressure, such as pulse wave velocity, and thus the potential efficacy of such measures will need to be investigated in the future . Third, overt proteinuria in patients with diabetes, which is observed in long - standing diabetes, together with hypertension and increased arterial stiffness, is a surrogate marker not only for renal structural damages but also generalized vascular damages (3,6,24,25). Therefore, we speculate that patients with diabetes with proteinuria are likely to have systemic vasculopathy, and as a consequence, they have high pulse pressure . Lastly, since the current study is a cross - sectional analysis, we have to pay attention to another possibility that diabetic renal disease indicated by greater proteinuria raises systolic bp as well as pulse pressure rather than the reverse in patients with diabetes . The current study provided the first examination of the association of pulse pressure with proteinuria in prediabetes using a large sample size . Understanding such risk estimates is important, given the increases in the prevalence of prediabetes that have occurred in many populations in conjunction with the increasing prevalence of obesity, particularly in asian populations (33,34). In the current study, another japanese study performed in healthy japanese people (n = 6,636, mean age 50 years) demonstrated that the prevalence of prediabetes was 32% (35). This survey was performed between 1997 and 2003, and since the prevalence of diabetes in asian populations has increased rapidly in recent years (33,34), the high prevalence of prediabetes in the current study was not entirely unexpected . Several limitations of our study should be mentioned . First, single - measurement readings of bp, fasting glucose or hbalc, and proteinuria cannot be considered fully accurate . In particular, some of the dipstick - positive proteinuria could have been transient, and thus could not be taken as definitive evidence of the presence of persisting proteinuria . These factors may introduce a source of variability that could have led to a tendency to underestimate the true association between pulse pressure and proteinuria . However, the incidence of type 1 diabetes is extremely low (approximately two cases / year/100,000 individuals), and japan has one of the lowest incidence rates of type 1 diabetes in the world (36). Third, we could not assess the diabetes- and atherosclerosis - related information, such as the duration of diabetes and the presence of diabetes complications (e.g., neuropathy), which would be informative and extend the knowledge achieved in the current study . Lastly, we could not assess what kinds of antihypertensive drugs had been prescribed in treated hypertensive subjects . Some antihypertensive drugs (e.g., angiotensin receptor blockers or angiotensin enzyme converting inhibitors) have more favorable effects on vascular and renal protection (37). Therefore, their use was potentially confounding, although our conclusions remained unchanged when we analyzed our data while excluding the subjects with antihypertensive medications . In conclusion, among the japanese general population, high pulse pressure, particularly in individuals with diabetes, was associated with proteinuria, and this information has the potential to supplement other bp indices . To confirm our findings, a prospective study as well as interventions that examine whether or not reduction of pulse pressure can enhance nephron - protective benefits in diabetes will be required . Since the glomerular afferent arterioles provide relatively low resistance, the glomerulus is susceptible to barotrauma if the pulse pressure is elevated (16). In fact, prior studies have demonstrated an association of high pulse pressure with microalbuminuria even in subjects without diabetes (7,8). In the current study, we examined the possible association of high pulse pressure and proteinuria (1 +), i.e., macroalbuminuria, and found that this association was not significant independently of systolic bp in subjects without diabetes . Although the usefulness of the urine dipstick test for risk stratification of renal and cardiovascular disease has been recognized, this method is a less sensitive measure of albuminuria compared with the measurement of urinary albumin excretion (2326). Accordingly, we cannot deny the possibility of an association between high pulse pressure and microalbuminuria in subjects without diabetes . In spite of the strict collinearity between systolic bp and pulse pressure, the or of high pulse pressure to proteinuria was reduced but remained significant even after adjustment for systolic bp in patients with diabetes (table 2). Table 3 also shows that a + 1 sd increase of systolic bp and a + 1 sd increase of pulse pressure were associated with proteinuria independently of each other, with the or of the systolic bp increase on proteinuria being higher than that of the pulse pressure increase . These findings indicate that high systolic bp showed a confirmed association with proteinuria and is an important confounder explaining the association between high pulse pressure and proteinuria; however, even after adjustment for systolic bp, the pulsatile component of bp itself was still significantly associated with proteinuria in patients with diabetes . Intriguingly, even in the patients with diabetes who were within the normal range of systolic bp values, high pulse pressure was associated with proteinuria . First, since renal autoregulation is impaired in diabetes (13,1113), it may be possible that when pulse pressure is elevated, more barotrauma - induced glomerular ultrastructural changes leading to albuminuria occur in subjects with diabetes than in those without diabetes (15). Second, much as in the previous reports (27,28), higher pulse pressure was observed in diabetes than nondiabetes (table 1), suggesting the possibility that diabetes accelerates aortic and large arterial stiffness (29). Aortic stiffness itself has a potential etiologic role in the causation and progression of renal dysfunction (3032), because loss of the damping of ventricular ejection in the stiffened aortae could lead to an increase in the transmission of these pressure changes to the renal microcirculation . In the current study, however, we did not use any measure of vascular stiffness more direct than pulse pressure, such as pulse wave velocity, and thus the potential efficacy of such measures will need to be investigated in the future . Third, overt proteinuria in patients with diabetes, which is observed in long - standing diabetes, together with hypertension and increased arterial stiffness, is a surrogate marker not only for renal structural damages but also generalized vascular damages (3,6,24,25). Therefore, we speculate that patients with diabetes with proteinuria are likely to have systemic vasculopathy, and as a consequence, they have high pulse pressure . Lastly, since the current study is a cross - sectional analysis, we have to pay attention to another possibility that diabetic renal disease indicated by greater proteinuria raises systolic bp as well as pulse pressure rather than the reverse in patients with diabetes . The current study provided the first examination of the association of pulse pressure with proteinuria in prediabetes using a large sample size . Understanding such risk estimates is important, given the increases in the prevalence of prediabetes that have occurred in many populations in conjunction with the increasing prevalence of obesity, particularly in asian populations (33,34). In the current study, another japanese study performed in healthy japanese people (n = 6,636, mean age 50 years) demonstrated that the prevalence of prediabetes was 32% (35). This survey was performed between 1997 and 2003, and since the prevalence of diabetes in asian populations has increased rapidly in recent years (33,34), the high prevalence of prediabetes in the current study was not entirely unexpected . First, single - measurement readings of bp, fasting glucose or hbalc, and proteinuria cannot be considered fully accurate . In particular, some of the dipstick - positive proteinuria could have been transient, and thus could not be taken as definitive evidence of the presence of persisting proteinuria . These factors may introduce a source of variability that could have led to a tendency to underestimate the true association between pulse pressure and proteinuria . However, the incidence of type 1 diabetes is extremely low (approximately two cases / year/100,000 individuals), and japan has one of the lowest incidence rates of type 1 diabetes in the world (36). Third, we could not assess the diabetes- and atherosclerosis - related information, such as the duration of diabetes and the presence of diabetes complications (e.g., neuropathy), which would be informative and extend the knowledge achieved in the current study . Lastly, we could not assess what kinds of antihypertensive drugs had been prescribed in treated hypertensive subjects . Some antihypertensive drugs (e.g., angiotensin receptor blockers or angiotensin enzyme converting inhibitors) have more favorable effects on vascular and renal protection (37). Therefore, their use was potentially confounding, although our conclusions remained unchanged when we analyzed our data while excluding the subjects with antihypertensive medications . In conclusion, among the japanese general population, high pulse pressure, particularly in individuals with diabetes, was associated with proteinuria, and this information has the potential to supplement other bp indices . To confirm our findings, a prospective study as well as interventions that examine whether or not reduction of pulse pressure can enhance nephron - protective benefits in diabetes will be required.
However, a trans - placental and respiratory route of infection has been reported in rabbits, too (4). Rabbits suffering from encephalitozoonosis show various clinical signs, and most infections are initially asymptomatic until sudden death . Many rabbits infected with e. cuniculi subsequently develop renal failure, eye lesions, and neurological signs (5, 6). Encephalitozoon cuniculi, together with other microsporidia species, has emerged as an opportunistic infection in immunocompromised patients, i.e. Persons suffering from aids (79). In addition, viable e. cuniculi was isolated from aids patients in many parts of the world (1012). A few is known about its prevalence in rabbits and human from east asia . In japan, high prevalence of e. cuniculi in not only diseased but also healthy rabbits and human was demonstrated (13, 14). Until now, nothing is known about the prevalence of this parasite in rabbits and humans in china, this study is the first survey to evaluate the prevalence of anti - e . Cuniculi antibodies in rabbits and human in china by using the enzyme - linked immunosorbent assay (elisa), which might facilitate the development of rational strategies for disease control and management . Overall, 300 serum samples each from clinically healthy rabbits and human were collected from january to september 2013 . The collection of human and animal serum samples was approved by the ethical committee of the college of animal science, henan institute of science and technology, china (approved no . The samples were collected from three regions in china including northeast china (jilin province) and southwest china (sichuan province, chongqing municipality). The reason for choosing these locations was that these three regions are the major rabbit producing as well as consuming provinces . Due to the different climate and geographical environment, the rex rabbit, japanese white rabbit and new zealand rabbit were the main breed, respectively . The e. cuniculi used in the present study was a rabbit strain isolate and well conserved in liquid nitrogen in henan higher education engineering technology research center for animal diseases control and residues supervision, henan institute of science and technology, china . E. cuniculi spores were produced on the rk 13 cell line in minimal essential medium with antibiotics (10 u penicillin / ml; 0.1 mg streptomycin/ ml and 0.25 mg amphotericine / ml) and 5% fetal bovine serum . Spores were purified by density gradient centrifugation with percoll (sigma - aldrich, st . Louis, usa) using a standard procedure (visvesvara et al ., 1999). Following three cycles of freezing / thawing, spores of e. cuniculi were mixed with solid glass beads (400600 micrometer diameter, jencons scientific limited, west sussex, uk) and sonicated (10 min, 60 w). The number of spore pre and post sonication was counted in a hemocytometer to ensure at least 95% spore disruption in the homogenate . The protein concentration of the supernatant was determined with a bca protein assay kit (bio - rad, hercules, ca, usa). The soluble antigen solution was stored at 20c until use . An indirect enzyme - linked immunosorbent assay (elisa) corning, n.y .) Was coated with 1 g soluble e. cuniculi antigen diluted in 100 l carbonate bicarbonate buffer (100 mm, ph 9.6) and incubated at 4c for 3 days . The well surface was blocked with 5% bsa in 0.05% pbst (pbs containing 0.05% v / v tween-20) at 37c for 2 h, followed by washing five times in 0.05% pbst . The conjugate was horseradish peroxidase (hrp) conjugated goat anti - rabbit igg or goat anti - human igg (southern biotechnology, birmingham, alabama, usa), and diluted 1:6,000 in pbs . Substrate tetramethylbenzidine (tmb, tiangen biotech, beijing, china) was then added and incubated at room temperature for 20 min . 100 l sodium acid (100 ng / ml) were added to stop the colour reaction . The serum with absorbance at least 2.1-fold higher than that of the negative control serum was considered positive . Statistical analyses of e. cuniculi prevalence in different administrative regions and breed groups were performed by x -test . Correlations between e. cuniculi infection in humans and rabbits were tested with pearson s rank correlation coefficient . Statistical analysis was performed using spss 16 software for windows (spss inc, chicago, illinois, usa). Overall, 300 serum samples each from clinically healthy rabbits and human were collected from january to september 2013 . The collection of human and animal serum samples was approved by the ethical committee of the college of animal science, henan institute of science and technology, china (approved no . The samples were collected from three regions in china including northeast china (jilin province) and southwest china (sichuan province, chongqing municipality). The reason for choosing these locations was that these three regions are the major rabbit producing as well as consuming provinces . Due to the different climate and geographical environment, the rex rabbit, japanese white rabbit and new zealand rabbit were the main breed, respectively . The e. cuniculi used in the present study was a rabbit strain isolate and well conserved in liquid nitrogen in henan higher education engineering technology research center for animal diseases control and residues supervision, henan institute of science and technology, china . E. cuniculi spores were produced on the rk 13 cell line in minimal essential medium with antibiotics (10 u penicillin / ml; 0.1 mg streptomycin/ ml and 0.25 mg amphotericine / ml) and 5% fetal bovine serum . Spores were purified by density gradient centrifugation with percoll (sigma - aldrich, st . Louis, usa) using a standard procedure (visvesvara et al ., 1999). Following three cycles of freezing / thawing, spores of e. cuniculi were mixed with solid glass beads (400600 micrometer diameter, jencons scientific limited, west sussex, uk) and sonicated (10 min, 60 w). The number of spore pre and post sonication was counted in a hemocytometer to ensure at least 95% spore disruption in the homogenate . The protein concentration of the supernatant was determined with a bca protein assay kit (bio - rad, hercules, ca, usa). An indirect enzyme - linked immunosorbent assay (elisa) was used to detect e. cuniculi antibodies . Corning, n.y .) Was coated with 1 g soluble e. cuniculi antigen diluted in 100 l carbonate bicarbonate buffer (100 mm, ph 9.6) and incubated at 4c for 3 days . The well surface was blocked with 5% bsa in 0.05% pbst (pbs containing 0.05% v / v tween-20) at 37c for 2 h, followed by washing five times in 0.05% pbst . The conjugate was horseradish peroxidase (hrp) conjugated goat anti - rabbit igg or goat anti - human igg (southern biotechnology, birmingham, alabama, usa), and diluted 1:6,000 in pbs . Substrate tetramethylbenzidine (tmb, tiangen biotech, beijing, china) was then added and incubated at room temperature for 20 min . 100 l sodium acid (100 ng / ml) were added to stop the colour reaction . The serum with absorbance at least 2.1-fold higher than that of the negative control serum was considered positive . Statistical analyses of e. cuniculi prevalence in different administrative regions and breed groups were performed by x -test . Correlations between e. cuniculi infection in humans and rabbits were tested with pearson s rank correlation coefficient . Statistical analysis was performed using spss 16 software for windows (spss inc, chicago, illinois, usa). In the present study, 600 serum samples (300 each from rabbit and human) were collected and analyzed by elisa to detect the antibodies against the e. cuniculi . An overall seroprevalence of 18.67% (56/300) was recorded in the rabbits . In case of breed wise seroprevalence of e. cuniculi, the rex rabbit from jilin province was found more infected (41.00%, p<0.01) as compared with japanese white rabbit from sichuan province (9.00%) and new zealand rabbit from chongqing municipality (6.00%) (table 1). Seroprevalence of e. cuniculi infection in rabbits in china values bearing a different superscript letter (a, b) within a column differ significantly from one another (p <0.05) twenty - nine (9.67%) out of 300 human serum samples were found positive for anti - e . Cuniculi antibodies in jilin province (18.00%) followed by sichuan province and chongqing municipality with the prevalence rate of 6.00% and 5.00% respectively . The seroprevalence in males was 10.00% (15/150) and in females was 9.33% (14/150) (table 2). Thus, the gender was not significantly associated with e. cuniculi infection in this study (p>0.05). Seroprevalence of e. cuniculi infection in humans in china values bearing a different superscript letter (a, b) within a column differ significantly from one another (p <0.05) there was a direct correlation between e. cuniculi infection in humans and e. cuniculi infection in rabbits (r = 1.000, p<0.01). Many serological surveys of e. cuniculi infections in different animals have been conducted using diverse methods in different areas in the world (1720). However, very few studies have investigated the distribution of e. cuniculi infections in china . Meng et al reported that 16.7% of the fox serum samples collected in liaoning province were positive, while 2% of the dog serum samples collected in beijing, shanghai, and hunan were positive according to the elisa using rswp1(17). Until now, nothing is known about the prevalence of this parasite in rabbits and humans in china . The findings of the present study highlighted an alarming situation that the parasite is widespread in clinically healthy rabbits and human in china . The present survey showed that the overall seropositivity for e. cuniculi infection in domestic rabbits was 18.67%, which was similar to that observed in nigeria (16.5%) (21) and egypt (15.0%) (22) but lower than that in the united kingdom (52.0%) (23) and italy (31.675.4%) (2426). These differences may result from the different serological tests, rabbit populations, or climatic factors or to some combination of these conditions . In particular, the rex rabbit were showed to be associated to a higher frequency of infection respect to japanese white rabbit and new zealand rabbit (p<0.01). It is noteworthy to mention that also lonardi et al reported a higher seroprevalence in rabbits of the x breed than y breed and z breed (26). These results indicate that there may be a potential association between the genetic line and the seropositivity against e. cuniculi . The overall seropositivity for e. cuniculi infection in humans was 9.67%, which was similar to that observed in the czech republic (1016%) (27) but lower than that in the slovakia (26.4%) (28). In addition, viable e. cuniculi was isolated from aids patients in many parts of the world (1012). The findings of the e. cuniculi from human cases from three regions of the china revealed zoonotic sources of infection involving rabbits to be major route of transmission in humans . In this study, the gender of human was not significantly associated with e. cuniculi infection (p>0.05), which was consistent with other reports (23, 26). Among three provinces / municipalities, the highest prevalence of e. cuniculi infection in domestic rabbits and humans e. cuniculi spores are often ingested or inhaled through food or soil contaminated with infected urine . The spores are environmentally resistant and can survive on the ground for several weeks or months (22). In addition, it is likely that the majority of rabbits are infected at a very early age from their mother . These results indicated that the environment of the jilin province had been seriously contaminated with infected e.cuniculi spores . In addition, close contact between owners and their rabbits could lead to an increased exposure to e. cuniculi . Therefore, it is necessary for rabbit raisers, public health authorities to be aware of this problem in these regions . Comprehensive practical control approaches and measures, such as the improvement of feeding conditions and management of rabbit, serologic screening of breeding stock with elimination of e. cuniculi positive reactors, should be executed . Persons should avoid contact with the urine of infected or healthy rabbits, and always use good personal hygiene when washing cages and handling the rabbits . An overall seroprevalence of 18.67% (56/300) was recorded in the rabbits . In case of breed wise seroprevalence of e. cuniculi, the rex rabbit from jilin province was found more infected (41.00%, p<0.01) as compared with japanese white rabbit from sichuan province (9.00%) and new zealand rabbit from chongqing municipality (6.00%) (table 1). Seroprevalence of e. cuniculi infection in rabbits in china values bearing a different superscript letter (a, b) within a column differ significantly from one another (p <0.05) twenty - nine (9.67%) out of 300 human serum samples were found positive for anti - e . Cuniculi antibodies . The findings of the present study revealed highest prevalence of anti - e . Cuniculi antibodies in jilin province (18.00%) followed by sichuan province and chongqing municipality with the prevalence rate of 6.00% and 5.00% respectively . The seroprevalence in males was 10.00% (15/150) and in females was 9.33% (14/150) (table 2). Thus, the gender was not significantly associated with e. cuniculi infection in this study (p>0.05). Seroprevalence of e. cuniculi infection in humans in china values bearing a different superscript letter (a, b) within a column differ significantly from one another (p <0.05) there was a direct correlation between e. cuniculi infection in humans and e. cuniculi infection in rabbits (r = 1.000, p<0.01). Many serological surveys of e. cuniculi infections in different animals have been conducted using diverse methods in different areas in the world (1720). However, very few studies have investigated the distribution of e. cuniculi infections in china . Meng et al reported that 16.7% of the fox serum samples collected in liaoning province were positive, while 2% of the dog serum samples collected in beijing, shanghai, and hunan were positive according to the elisa using rswp1(17). Until now, nothing is known about the prevalence of this parasite in rabbits and humans in china . The findings of the present study highlighted an alarming situation that the parasite is widespread in clinically healthy rabbits and human in china . The present survey showed that the overall seropositivity for e. cuniculi infection in domestic rabbits was 18.67%, which was similar to that observed in nigeria (16.5%) (21) and egypt (15.0%) (22) but lower than that in the united kingdom (52.0%) (23) and italy (31.675.4%) (2426). These differences may result from the different serological tests, rabbit populations, or climatic factors or to some combination of these conditions . Interestingly, the breed seemed to influence the distribution of e. cuniculi seropositivity . In particular, the rex rabbit were showed to be associated to a higher frequency of infection respect to japanese white rabbit and new zealand rabbit (p<0.01). It is noteworthy to mention that also lonardi et al reported a higher seroprevalence in rabbits of the x breed than y breed and z breed (26). These results indicate that there may be a potential association between the genetic line and the seropositivity against e. cuniculi . The overall seropositivity for e. cuniculi infection in humans was 9.67%, which was similar to that observed in the czech republic (1016%) (27) but lower than that in the slovakia (26.4%) (28). In addition, viable e. cuniculi was isolated from aids patients in many parts of the world (1012). The findings of the e. cuniculi from human cases from three regions of the china revealed zoonotic sources of infection involving rabbits to be major route of transmission in humans . In this study, the gender of human was not significantly associated with e. cuniculi infection (p>0.05), which was consistent with other reports (23, 26). Among three provinces / municipalities, the highest prevalence of e. cuniculi infection in domestic rabbits and humans e. cuniculi spores are often ingested or inhaled through food or soil contaminated with infected urine . The spores are environmentally resistant and can survive on the ground for several weeks or months (22). In addition, it is likely that the majority of rabbits are infected at a very early age from their mother . These results indicated that the environment of the jilin province had been seriously contaminated with infected e.cuniculi spores . In addition, close contact between owners and their rabbits could lead to an increased exposure to e. cuniculi . Therefore, it is necessary for rabbit raisers, public health authorities to be aware of this problem in these regions . Comprehensive practical control approaches and measures, such as the improvement of feeding conditions and management of rabbit, serologic screening of breeding stock with elimination of e. cuniculi positive reactors, should be executed . Persons should avoid contact with the urine of infected or healthy rabbits, and always use good personal hygiene when washing cages and handling the rabbits . Therefore, the fields of veterinary and human medicine in china should be aware about this zoonotic issue and precautionary measure should be taken to avoid the spread of encephalitozoonosis.
Alterations in the influence of inhibitory gabaergic circuits can have a profound impact on the excitability of neural network function, and have been associated with hyperexcitable conditions such as epilepsy [1, 2]. Recent work has identified what may be one of the most important processes in ensuring that networks maintain appropriate activity levels; homeostatic plasticity is thought to maintain network spiking activity levels within a physiologically relevant range through compensatory adjustments in intrinsic cellular excitability, as well as excitatory and inhibitory synaptic strength [38]. This phenomenon has been identified in several systems, at different developmental stages, in vitro and to a lesser extent in vivo . When activity levels of cultured neuronal networks (cortical, hippocampal, spinal) are altered for days, cellular excitability and synaptic strength within the network are adjusted in a direction that appears to oppose the alteration in activity [914]. For instance, when spiking activity is blocked for 2 days, ampaergic synaptic strength increases and gabaergic synaptic strength decreases in excitatory neurons . When network spiking activity is increased, ampaergic synaptic strength decreases . In each case the amplitude of miniature postsynaptic currents (mpscs) changed in a direction to compensate for the perturbation . Several reviews have examined homeostatic plasticity, typically focusing on excitatory components within networks [36]. In this paper we will instead concentrate on the findings of homeostatic plasticity within gabaergic neurons and at gabaergic synapses onto excitatory neurons . Based on previous work studying homeostatic plasticity in the glutamatergic system, we make the simplistic prediction that inhibition would be reduced following network activity blockade and increased following increases in network activity . Therefore, following chronic reductions in network activity (figure 1 left), we would expect compensatory weakening of both gabaergic synapses on excitatory neurons and glutamatergic synapses on inhibitory neurons and to see reductions in the intrinsic cellular excitability of inhibitory neurons . If network activity is increased for days (figure 1 right), we would expect compensatory strengthening of both gabaergic synapses on excitatory neurons and glutamatergic synapses on inhibitory neurons and to observe increases in the intrinsic cellular excitability of inhibitory neurons . The most studied aspect of inhibition in homeostatic plasticity has examined the inhibitory gabaergic inputs to excitatory neurons (figure 1(a)). Immunocytochemical studies gave the first indication that gabaergic circuits experienced homeostatic plasticity, as reduced visual input led to decreased cortical expression of gabaa receptors, gaba, and gad [15, 16]. Compensatory changes in the amplitude of gabaergic mpscs have now been demonstrated in excitatory neurons following network activity perturbations in several different studies [10, 1720]. These changes in gabaergic mpsc amplitude are often mediated by changes in the number of synaptic gabaa receptors, and this is typically shown by quantitative immunocytochemistry [10, 20, 21]. In addition, compensatory changes in the vesicular inhibitory amino acid transporter, viaat, have been observed suggesting there are coordinated presynaptic contributions to homeostatic changes in mipsc amplitude [18, 20, 21]. While these studies have shown that mipsc amplitude is reduced following chronic activity blockade or increased following increased network activity, two studies suggest the opposite can occur . One study demonstrates that a subset of gabaergic inputs to hippocampal pyramidal cells are strengthened following activity block; however, the overall population of mipscs homeostatically scale downward . Another study shows that in vivo application of ttx for 2 days resulted in an increase in mipsc amplitude in pyramidal cells recorded from cortical slices, which also does not fit the simple homeostatic model . These studies highlight the need to carry out more homeostatic studies in vivo, as perturbations in living networks are likely to be more complicated in terms of network homeostasis, but crucial in elucidating the goals of homeostatic plasticity . In a separate study where spiking activity was blocked in vivo for 2 days in the embryonic spinal cord these changes in gabaergic currents were compensatory because gaba was depolarizing and excitatory at this developmental stage . Interestingly, homeostatic increases in gabaergic mpscs occurred through increased chloride accumulation, thus depolarizing the gabaergic reversal potential (egaba) and enhancing the driving force for these currents . Similarly, another study indirectly demonstrated that homeostatic changes in gabaergic currents could be produced by a shift in egaba . In this study, activity was perturbed in hippocampal organotypic cultures and compensatory changes in gabaergic currents were observed in pyramidal cells at a stage when gaba was no longer excitatory . These findings are important for understanding the maturation of gabaergic synaptic strength but also may have implications for neuronal injury in mature circuits where the same depolarizing shifts in chloride reversal potential are observed following spinal cord injury, peripheral nerve injury, and traumatic brain injury [2638]. It is tempting to speculate that following injury, homeostatic mechanisms may be engaged that produce the maladaptive increases in excitability associated with neuronal injury . Consistent with this idea, work in a model of febrile seizure suggests the possibility that compensatory increases in gabaergic strength appear to promote hyperexcitability by triggering the hyperpolarization - activated current, ih [39, 40]. Other studies in cultured networks demonstrated that homeostatic changes in mipsc amplitude were not due to changes in egaba [10, 41]. However, these studies used whole - cell recordings to measure egaba, which may dialyze intracellular cl and mask the experimenter's ability to observe changes in gabaergic driving force . Future studies assessing homeostatic changes in mipscs could use perforated patch recordings or chloride indicators to resolve this issue . Although not as common as homeostatic changes in mipsc amplitude, homeostatic changes in mipsc frequency have been reported . Increases or decreases in network activity have been shown to increase and decrease mipsc frequency, respectively, in excitatory neurons [10, 20]. This appears to be mediated by changes in the number of gabaergic inputs to excitatory pyramidal cells . To a large extent, gabaergic mpsc amplitude and frequency in excitatory neurons follow the homeostatic model, strengthening after chronic increases in activity and weakening after activity blockade . Our homeostatic model predicts that ampaergic synaptic inputs to gabaergic neurons will strengthen following increases in activity and weaken following activity blockade (figure 1(b)). Using hippocampal cultures, it was shown that parvalbumin - expressing inhibitory interneurons (pv ins) increased mepsc amplitude following chronic enhancement of activity levels and reduced mepsc amplitude following activity blockade . The changes in mepsc amplitude were mediated by changes in the number of an ampa receptor subunit, glua4, which was regulated homeostatically by neuronal activity - regulated pentraxin (narp). Similarly, chronic increases in activity induced a strengthening of excitatory inputs to inhibitory interneurons in neocortical cultures, expressed presynaptically as an increase in the vesicular glutamate transporter, vglut2 . Consistent with these findings, another study demonstrated that increasing bdnf levels, as occurs with increased network activity, led to an increase in mepsc amplitude in inhibitory bipolar interneurons . In this study, the increase in mepsc amplitude was mediated by an increase in the sensitivity of the postsynaptic cell to glutamate, consistent with an increase in synaptic glutamate receptors . However, when spiking activity was blocked for days in several different cultured cortical networks, mepsc amplitude was unaltered in multiple classes of inhibitory interneuron [8, 41, 44]. Thus far, the results are consistent with the idea that increased network activity levels triggered homeostatic increases in mepsc amplitude in interneurons, but that mepsc amplitude was typically unaltered by reductions in network activity . In none of these studies were changes in mepsc frequency observed . Finally, we know of no homeostatic studies examining mipscs in inhibitory interneurons following activity perturbations . Changes in interneuronal intrinsic cellular excitability (figure 1(c)) following activity block have been described in 2 different cortical cultures . In both studies, intrinsic cellular excitability was increased following activity blockade in 3 different classes of inhibitory interneuron [44, 45]. One of the studies suggested that the increased excitability was the result of an increase in input resistance . From a simplistic network perspective, increasing the excitability of an inhibitory neuron in an activity - blocked network is not what our homeostatic model would predict (figure 1(c) left). The enhanced inhibition may be offset by the observation that pyramidal cells also have increased intrinsic excitability following activity blockade, but the finding underlines the complexity of the homeostatic process [22, 25, 44, 45]. It is possible that activity perturbations result in changes in synaptic strength that are homeostatic for the network, while changes in intrinsic cellular excitability are homeostatic from the perspective of the individual cell . We have focused on mpscs because they provide a nice measure of a standard unit of synaptic strength . However, another potentially useful measure of synaptic strength is provided by looking at the functional connections between 2 components of the circuitry . The strength of the connections between inhibitory and excitatory neurons can be assessed through paired recordings, stimulating an inhibitory or excitatory neuron and recording a response in the other . The results of these studies have been somewhat mixed . When retinal activity is reduced in vivo by ttx infusion or lid suture, input to pyramidal cells in the visual cortex from inhibitory interneurons was homeostatically reduced in certain cases [46, 47]. In other cases reductions of visual input to cortical neurons resulted in a strengthening of both inhibitory inputs to pyramidal cells and pyramidal input to inhibitory neurons [46, 48]; from a network perspective, these results are opposite to that predicted by our model of homeostatic plasticity . One complication in these studies is that when visual input is perturbed in vivo, it is not always clear how this affects the activity of the visual cortical circuitry that is being studied; for instance, different results have been described when retinal activity is altered by lid suture versus ttx infusion . However, in one study in neocortical organotypic cultures, where network activity was clearly blocked, changes in the strength of connections between excitatory and inhibitory neurons were not simplistically homeostatic . Brain - derived neurotrophic factor (bdnf) has been implicated in the signaling pathway for homeostatic plasticity of both glutamatergic and gabaergic systems . Bdnf exerts its influence through changes in intrinsic cellular excitability, mepsc and mipsc amplitude and frequency . From these studies a pattern is beginning to emerge; when bdnf signaling is reduced, as occurs during activity blockade, there is an increase in the influence of excitatory neurons; when bdnf signaling is increased, as occurs during chronic increases in network activity, there is an increase in the influence of inhibitory neurons (figure 2). When activity is blocked in cortical cultures using ttx, pyramidal cells become more excitable through increases in mepsc amplitude, decreases in mipsc or spontaneous ipsc amplitude [21, 49], and increases in the intrinsic cellular excitability of these cells . All three of these compensatory changes appear to be mediated by reduced bdnf signaling because they are prevented by coapplication of bdnf and ttx and recapitulated by blocking bdnf signaling through its receptor, trkb . On the other hand, increases in bdnf signaling that would be associated with overly active networks enhanced the influence of inhibitory interneurons through increases in interneuronal projections (increased mipsc frequency), or through increased mepsc amplitude onto inhibitory interneurons [20, 41]. While the model shown in figure 2 is well supported by most of the experimental evidence, one exception to the homeostatic model is the observation that activity block triggers a bdnf - dependent increase in inhibitory interneuron intrinsic excitability in cortical cultures . The sensors of activity that trigger homeostatic plasticity changes are a major focus in the field but are poorly understood . Activity sensors triggering changes in inhibitory circuitry are even less well understood . In the vast majority of homeostatic studies, network activity is reduced by ttx or glutamate receptor blockers or increased by gabaa receptor antagonists . All of these treatments alter activity levels, as well as neurotransmission, throughout the network . Therefore, it is possible that changes in network spiking activity, cellular spiking activity, or synaptic transmission trigger homeostatic changes in mipscs . One recent study increased spiking activity in an individual cell in an otherwise unperturbed network . The finding is consistent with the idea that increases in individual cellular spiking activity trigger homeostatic compensations of gabaergic inputs . However, when activity was blocked in individual hippocampal pyramidal cells by transfecting them with a k channel or a mutant voltage - gated na channel, no change in mipsc amplitude was observed . The finding indicated that reductions in the activity of individual excitatory neurons did not trigger homeostatic changes in mipsc amplitude, but suggested that reductions in network - wide activity or neurotransmission may be required to induce this plasticity . Consistent with the possibility that sensors assess neurotransmission, we have determined that in vivo blockade of depolarizing gabaa transmission in the embryonic spinal network triggered compensatory increases in excitatory gabaergic mpsc amplitude and cellular excitability in motoneurons [50, 51]; these forms of compensatory plasticity were not dependent on alterations in spiking activity, suggesting that the network could sense reduced spiking activity levels through reduced gabaa transmission, essentially using gaba as a proxy for activity levels . A better understanding of the sensors that trigger compensatory changes in inhibitory neurotransmission will require more extensive work than the current studies, but it will be important to consider the possibility that neurotransmission is involved in the process . Gabaergic inputs to excitatory neurons in several different networks are strengthened following increases in activity and weakened following activity block; increases in activity lead to increased mepsc amplitude in inhibitory neurons; increases in bdnf signaling (associated with increases in activity) increase the excitability of inhibitory interneurons, while decreases in bdnf signaling (associated with decreased activity) increase the excitability of excitatory neurons . However, there are several clear examples that do not fit into any simplistic homeostatic model (interneuron intrinsic excitability, mepsc amplitude in interneurons following activity block, evoked responses between excitatory and inhibitory neurons). It will be important to identify common mechanisms of homeostatic plasticity, but it is likely that different preparations (e.g., in vitro versus in vivo) and different neural circuits use different homeostatic mechanisms . Further, compensatory mechanisms will be experienced in different elements of the circuitry at different developmental stages . In addition, the methods of altering network activity are likely to trigger different homeostatic mechanisms, for instance, increasing versus decreasing activity . In some cases, particularly in vivo studies, assumptions are made about alterations in cellular or network activity, but are not directly tested, leaving open the possibility that apparent antihomeostatic responses are actually homeostatic, or vice versa . It is also possible that in some cases absolute levels of spiking activity are not the homeostatic goal, but rather some more sophisticated pattern of activity, for instance, synchrony of the output neurons, which could be achieved through more complicated changes in gabaergic interneurons [53, 54]. In the end, it is important to recognize that changes in gabaergic synaptic strength or cellular excitability in inhibitory neurons are being tested in isolation, but they occur within complex networks where it is difficult to know the functional consequences of these changes . As the field matures it will be important to take these complexities into consideration . Because network - wide activity is clearly maintained across many neural circuits, there are likely to be strong homeostatic mechanisms maintaining global network activity; it will be important to differentiate these homeostatic mechanisms from those that maintain individual cellular activity or individual synaptic activity, each potentially being triggered by different sensors.
The lake malawi cichlid fauna comprises over 800 species offering a spectacular example of adaptive radiation with virtually all niches in the lake being filled by members of this family [2, 3]. With a few exceptions, all lake malawi cichlids form a monophyletic group as supported by mitochondrial [46] and nuclear ([79] but see) markers as well as allozymes [11, 12]. The phylogenetic reconstruction of lake malawi cichlid fauna has recovered six main mitochondrial dna (mtdna) lineages [5, 6, 10, 13]. The remaining cichlid fauna has been traditionally divided into two groups: one containing predominantly the rock - dwelling species commonly called mbuna and the second containing the remaining lake malawi cichlids . However, phylogenetic reconstructions have shown that both groups are artificial [5, 10, 13, 14]. Several lethrinops, aulonocara, and alticorpus species (ecologically and morphologically typically assigned to the non - mbuna) cluster within the mbuna clade . Furthermore, the non - mbuna genus copadichromis has been shown to have representatives belonging to both the non - mbuna clade, as well as to a separate lineage . The genus copadichromis, together with the genus nyassachromis and the newly erected genus mchenga, constitute the utaka, a species assemblage of midwater - feeding zooplanktivorous cichlid species . Not recovering mtdna monophyly within this assemblage: m. eucinostomus and c. borleyi were placed within the non - mbuna clade, while c. mloto (reidentified as copadichromis sp . Virginalis kajose, j. snoeks pers . And some other individuals of the copadichromis virginalis complex seemed to represent a different, well - diverged lineage . Therefore, currently available mtdna phylogenies are inconclusive as to whether the utaka are genetically associated with the non - mbuna clade, whether they constitute an originally separate ancestral lineage, or whether only one or a few species or specimens cluster in a separate lineage . If specimens of a species cluster in genetically distant lineages, this may be a result of the retention of ancestral polymorphism, the existence of a cryptic species, or traces of a past hybridisation / introgression event . Support for these alternative hypotheses may be gained by using a multilocus approach (e.g., [10, 1416]). If the nuclear genetic signature is concordant with the mtdna in subdividing a species into genetically separated units, this may point towards a cryptic species . On the other hand, if a mtdna split within a species is not supported by the nuclear genetic data, this may be an indication of introgression of genetic material from another species, or of shared ancestral polymorphism . Whereas the resolution of the specific interrelationships within the major clades remains problematic, the six main mtdna clades of the malawi cichlid flock are clearly delineated [5, 6, 13]. Shared polymorphism within taxa might result from incomplete lineage sorting, taxonomic inaccuracies, and/or hybridisation . While the other possibilities cannot be completely ruled out, there is a growing number of studies acknowledging the important role of hybridisation in the evolutionary history of adaptive radiations (e.g., [1719]). In this study we aim at elucidating the phylogenetic position of the utaka within the malawian cichlid radiation and shed light on the causes for its taxonomic and molecular assignment inconsistency . We examined individuals of five utaka species (copadichromis sp . Virginalis kajose, c. quadrimaculatus, m. eucinostomus, c. chrysonotus, and c. borleyi) from twelve localities throughout lake malawi and one locality in lake malombe (figure 1). Voucher specimens were fixed in 10% formalin and are curated at the royal museum for central africa in tervuren, belgium . We included additional copadichromis species that were sampled during the sadc / gef project and previously published mtdna control region (complete d - loop) sequences of lake malawi cichlids, which we obtained from genbank . Whole genomic dna was extracted from ethanol - preserved fin clips using proteinase k digestion and salt precipitation, according to aljanabi and martinez . The first fragment of the mtdna control region was sequenced for 412 utaka specimens (179 copadichromis sp . Virginalis kajose, genbank accession ef211832-ef211945 and ef647210-ef647271; 55 c. quadrimaculatus, genbank accession ef647341-ef647438 and ef647578-ef647579; 67 m. eucinostomus, genbank accession ef647356-ef647390, ef647439-ef647460, ef647498-ef647505 and ef647581-ef647582; 70 c. chrysonotus, genbank accession ef647273-ef647340, and ef647571-ef647572; 41 c. borleyi, genbank accession ef647470-ef647497, ef647520-ef647531, and ef647548), using published primers by meyer et al . . We additionally sequenced the second fragment of the control region using the primers by salzburger et al . And lee et al . For 14 individuals, selected on the basis of the results of the phylogenetic reconstruction for the first fragment of the control region . Polymerase chain reactions (pcrs) were carried out in 25 l buffered reaction mixtures, containing 5 l template dna, 5 l of each primer (2 m), 200 m of each dntp, 2.5 l of 10x buffer (1 mm mgcl2), and 0.65 units of red taq polymerase (sigma aldrich). Pcrs were performed under the following conditions: 94c for 120 s, followed by 35 cycles of 94c for 60 s, 52c for 60 s, 72c for 120 s, followed by 72c for 10 min . Pcr products were purified following the tmqiaquick pcr purification kit protocol and sequenced on an abi 3130 automatic sequencer (applied biosystems) using standard protocols . A total of 179 c. sp . Virginalis kajose, 230 c. chrysonotus, 252 c. quadrimaculatus, and 344 m. eucinostomus individuals were screened for genetic variation at nine microsatellite markers: pzeb1, pzeb3, pzeb4, pzeb5, unh002, tmom5, tmom11, tmom27, and ume003 . Pcrs were performed under the following conditions: 94c for 120 s, followed by 5 cycles of 94c for 45 s; 55c for 45 s; 72c for 45 s, followed by 30 cycles of 90c for 30 s; 55c for 30 s; 72c for 30 s, followed by 72c for 10 min . 10 l reaction mixes included 1 l template dna, 0.5 m of each primer, 200 m of each dntp, 0.26 units taq polymerase (sigma aldrich, germany), 1 l 10 reaction buffer (sigma aldrich). Pcr amplification products were run on 6% denaturing polyacrylamide gels using an alf express dna sequencer (amersham pharmacia biotech). Fragment sizes were scored with alfwin fragment analyser v1.0 (amersham pharmacia biotech), using m13mp8 dna standards as external references, following van oppen et al . . For the reconstruction of the phylogenetic relationships of the utaka, two datasets were analysed . The program collapse v1.2 was used to reduce this dataset to one individual sequence per haplotype for further analyses . Gtr+g+i model was the best - fitted model of sequence evolution inferred by modeltest v3.7 according to the akaike information criterion (aic). A maximum likelihood (ml) heuristic search was performed with phyml starting from a neighbour - joining (nj) tree . Parameters of the tree and of the substitution model were optimised sequentially until no increase in likelihood was found . Based on the results of the short control region phylogenetic reconstruction, we performed a second, more computationally intensive phylogenetic analysis with a smaller dataset containing 47 representatives of the different main lineages in the lake malawi cichlid flock (both new sequences and sequences extracted from genbank) to test the interrelationships between these main lineages . The final dataset, 837 bp long, was first run through modeltest, which selected the trn+i+g model (aic criterion). Phylogenetic inferences were carried out using maximum - parsimony (mp, 100 replicates starting from random stepwise addition trees; tbr branch swapping) with different transition - transversion weights (1: 1, 2: 1 and 3: 1) in paup * v4.0 . Ml reconstructions (100 replicates starting from random stepwise addition trees; tbr branch swapping) were run in paup. Sequential searches were performed by reestimating the substitution model parameters upon the best tree found and then running a new search with these parameters . This was done until no change in the likelihood of the tree or in the estimated parameters was found . Support for the internal branches in the ml tree was assessed by analysing 100 bootstrapped replicates in the program phyml . For bayesian inference (bi) analyses, the gtr+g+i model was used since the trn+g+i is not implemented in mrbayes v.3.1 . Two runs with four chains for each run were sampled every thousandth generation until the average standard deviation of split frequencies between runs reached ~0.003 . Inspection of plot of likelihood versus generation revealed that the runs had reached stability and so did the analysis of the potential scale reduction factors . Using the shimodaira - hasegawa test, as implemented in paup , we tested the relative fit of two alternative tree topologies: the forced monophyly of all utaka specimens was compared to the best, unconstrained tree . Significance of the difference in log - likelihood between the two trees was assessed by means of the resample estimated log - likelihood test (rell). We estimated the number of populations present in our microsatellite dataset using the program structure [36, 37]. We calculated the posterior probability for different numbers of putative populations (k from 1 to 18 populations) using a model - based assignment . Burn - in was set at 100,000 steps followed by 300,000 mcmc iterations at each k. simulations were run five times for each k to check for convergence of the mcmc . We performed clustering both under the admixture model without prior population information and with correlated allele frequencies between populations . To determine the most likely number of clusters, the rate of change in the log probability of data and in the statistic k between successive k values was estimated using structureharvester . First, we assessed the phylogenetic relationships among as many specimens as available from the five utaka species that we collected throughout the lake . For this extensive dataset, we sequenced the short (328 bp) but most variable part of the mtdna control region . By this analysis we aimed to detect specific or geographical patterns among the utaka species studied . Second, we attempted to resolve the phylogenetic position of the utaka species within the lake malawi cichlid flock . For this purpose we sequenced the complete mitochondrial control region for representative specimens (n = 14) of the previous dataset and included published sequences from species representing the main lineages in the malawian cichlid flock . A total of 115 haplotypes were found amongst the 412 utaka short mtdna control region sequences (figure 2). The ml tree presented two divergent clades within the utaka: a large clade containing circa 70% of all sequences, and a smaller group . Individuals (125 c. sp . Virginalis kajose individuals out of 179 sequenced clustered within this clade), together with two (out of 67) m. eucinostomus and one (out of 55) c. quadrimaculatus individuals . Both mtdna clades were present lake - wide in nearly all localities sampled, and within each lineage distinct geographic structuring was absent . The complete mtdna control region phylogenetic reconstructions using mp (with the different weighting schemes), ml, and bi consistently recovered the 6 main clades among the malawian cichlids (figure 3): (i) a lineage containing most non - mbuna and utaka species (non - mbuna clade hereafter); (ii) a clade containing only copadichromis individuals (virginalis clade hereafter); (iii) a mbuna clade containing all mbuna species plus some deep - water lethrinops species and an aulonocara specimen; (iv) a diplotaxodon clade; (v) a rhamphochromis clade; (vi) a clade containing a. calliptera . For these clades, bootstrap values and posterior probabilities displayed high node support values, except for the virginalis clade, which had a bootstrap support of 73 and a posterior probability of 0.87 (figure 3). The phylogenetic relationships between the clades remained, however, unresolved: their branching order was variable, depending on the reconstruction methods used and was even resolved as a polytomy in the bayesian analysis . The shimodaira - hasegawa test indicated a significant difference in likelihood score between the two topologies examined (p = 0.03), giving preference to the unconstrained topology (where utaka are paraphyletic) over the best tree obeying to the monophyly of all utaka specimens analysed . The model - based clustering approach implemented in the program structure yielded estimated ln probabilities for 1 k 18 ranging from 37678 to 34160 with the highest posterior probability and k (= 20.605) for k = 3 . In the most likely scenario, structure assigned m. eucinostomus and c. chrysonotus to two different groups, while c. quadrimaculatus and c. sp . The phylogenetic inferences of the utaka assemblage performed herein showed that it contains two genetically distant and geographically widespread mtdna lineages . The two lineages have been observed before [5, 10, 13, 14] but this is the first study to reveal the paraphyly not only of the genus copadichromis in individuals from throughout lake malawi, but also of three (of the five analysed) utaka species (based on the short mtdna sequences). In a wider taxonomic context involving the other malawian cichlid lineages, the most abundant of the two lineages in the utaka clustered within the non - mbuna mtdna clade, while the other formed a separate clade containing exclusively utaka specimens, mostly c. sp . Virginalis kajose the paraphyly of the utaka does not represent an artefact in our analyses, as corroborated by the long and well - supported branches that connect the non - mbuna and the virginalis clades, as well as by the significant result of the shimodaira - hasegawa test . One possible explanation is that the utaka share ancestral polymorphic alleles and/or represent a truly paraphyletic group containing multiple lineages that have undergone convergent evolution . Importantly, the occurrence of two divergent mtdna lineages within the utaka is related neither to taxonomic clustering, nor to geographical structuring . If the two haplogroups observed within the utaka indeed correspond to two ancestral lineages that are genetically isolated for such a long time that their mtdna genotypes have become so deeply diverged, we would expect this to be also reflected in the nuclear genome of the species . However, we did not find any subdivision of nuclear gene pools that corresponds to the deep mtdna divergence, neither across the utaka species, nor within c. sp . Virginalis kajose which yields the majority of the individuals in the divergent virginalis clade as well as a large number of individuals in the non - mbuna clade . It thus seems unlikely that the presence of a cryptic species is the cause of the mtdna divergence within c. sp . Virginalis kajose . Recently published phylogenetic reconstructions using aflp loci [10, 14] also showed a discordance between the nuclear and mitochondrial placement of copadichromis virginalis within the malawi cichlid radiation, supporting our finding that the observed paraphyly of the utaka and of c. sp . Virginalis kajose is unlikely to be the result of incomplete ancestral lineage sorting or true paraphyly . Alternatively, a disparate pattern of divergence between mitochondrial and nuclear dna among conspecific individuals may be the result of a past hybridisation and introgression event, a process which has been documented in malawian cichlids before (e.g., [4042]) and for which evidence is accumulating (e.g., [10, 14, 16, 43]). Under this hypothesis we advance two possibilities regarding the original position of the utaka within the malawi cichlid phylogeny . A first scenario assumes that all utaka species formerly constituted a separate ancestral clade within the malawi cichlid flock, corresponding with the current virginalis clade . Subsequent unidirectional introgression of mtdna from non - mbuna into the utaka could then explain the observed clustering of utaka specimens within the non - mbuna lineage . This scenario would involve that either all, or the ancestors of the current utaka species, would have been extensively hybridised with a non - mbuna species, resulting in the almost complete replacement of the original mtdna of the utaka . A second scenario assumes that all utaka species initially belonged to the non - mbuna lineage and a species from a distant mtdna lineage hybridised with copadichromis species . Interestingly and despite our extensive taxonomic sampling, the maternal species involved in the putative hybridisation event remains unidentified as the virginalis clade only contained representatives of the utaka assemblage . Hybridised either has thus far not been subjected to molecular studies or may no longer be present in the lake . Empirical evidence for or against the above scenarios can be gained by examining mtdna of supplementary utaka species to validate whether the majority of the taxa cluster is within the non - mbuna clade or within the virginalis clade . The more utaka species cluster within the non - mbuna clade, the less probable becomes the first scenario . Regardless of which of the two mtdna lineages is the original or the introgressing one, and irrespective of the maternal species involved in the hybridisation event, our results show that the two mtdna lineages have persisted within the gene pool of copadichromis sp . Virginalis kajose for a rather long period, as suggested by the diversity displayed by either of these two lineages (figure 2). It thus suggests that either the population size of this species has remained very high since the hybridisation event (such that genetic drift would represent a lesser issue) or that some other mechanism is maintaining the two lineages within the same species (e.g., balancing or frequency - dependent selection). Interspecific gene flow is increasingly recognized as an important factor in shaping speciation (e.g., [1719, 44, 45]). Progressively more examples for hybridization are known from african cichlid fish: among lake tanganyika's cichlids evidence is found for ancient introgression (e.g., [15, 4648]) and a complete replacement of mtdna in multiple tribes of the cichlid assemblage . From lake malawi, evidence for deep introgression leaving a long - term signal in its haplochromine radiation [10, 14, 43], as well as evidence for more recent natural hybridisation [16, 50, 51] among malawi cichlids, has been provided . In the lake victoria cichlid flock recent or ongoing hybridisation [5254] presumably affects large parts of the species' genomes by homogenization [54, 55], hampering the reconstruction of its young evolutionary history [54, 56, 57], yet potentially seeding the process of speciation but see . In cameroonian crater lakes the hybridisation of two ancient lineages resulted in the formation of a new and ecologically highly distinct species . Also for steatocranus cichlids from the congo basin it was recently shown that ancient as well as recent introgression of genes and hybridisation produced a genomic network that potentially promoted divergence and speciation . Our results chime well with previous studies reporting hybridisation in the early stages of a cichlid radiation . Our findings reconcile with the recently reported evidence for ancient introgression between mbuna and deep - benthic cichlids at the base of the malawi radiation . Virginalis kajose and c. quadrimaculatus, two phenotypically distinct taxa, by our microsatellite markers . However, it has already been reported that the performance of a clustering method may become poor for fst's below 0.05 (, j. pritchard, pers . Comm . ). The estimates of population differentiation were low in both species (= 0.006 in c. sp . Virginalis kajose and = 0.007 in c. quadrimaculatus, reported in), and slightly higher among the two species (= 0.01). Whether this observation might yield a demonstration of the relative ease of hybridisation among phenotypically well - differentiated taxa [14, 43] or be the result of an insufficient resolution of the markers used, deserves further research.
The online version of this article (doi:10.1007/s13300 - 014 - 0066-y) contains supplementary material, which is available to authorized users . Supplementary material 1 (pdf 190 kb) supplementary material 1 (pdf 190 kb) andrea messori, valeria fadda, dario maratea, sabrina trippoli and claudio marinai declare no conflict of interest . The analysis in this article is based on previously conducted studies, and does not involve any new studies of human or animal subjects performed by any of the authors . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.
Who has estimated that there were 171 million people worldwide with diabetes mellitus (dm) in 2000 and predicted that 366 million people will have dm by 2030 . The united states centers for disease control and prevention have estimated that 13 million persons in the united states have diagnosed dm, and an additional 5,2 million have the disease but it is not yet being diagnosed . Diabetes mellitus is a severe metabolic disease associated with a number of complications including retinopathy, nephropathy and neuropathy . Mortality related to dm and its complications result in 3.8 million deaths annually, accounting for 6% of the total worldwide mortality [2, 3]. The mortality risk in the diabetic population in the age of 4049 years is about 67 years and for the age category of 6069 it is about 3 - 4 years higher, compared to mortality risk, at the same age healthy population . The stage of nephropathy, including the severity of proteinuria is a predictable factor for the mortality risk . Approximately 2.5% to 15% of annual healthcare budgets is spent on care of patients with diabetes and associated complications . It has been estimated that programs to identify and treat diabetic retinopathy (dr) would have saved the united states health care budget nearly 400 million dollars annually in the early 1990s,] a figure that would probably be substantially higher today . A lot of studies in dm type 2 between which is the ukpds - study, have underlined the beneficial effect of having the hba1c, not <6% . A diverse array of micro- and macrovascular changes, are induced trough bad metabolic memory and increase, as well as decrease of hba1c (fig . 1). Increase of glycated hemoglobin in diabetic population at baseline, and in 6 years follow - up period, has the same impact on the cardiovascular complications, as the decrease of hba1c <6.0% accord increase of glycated hemoglobin in diabetic population at baseline, and in 6 years follow - up period, has the same impact on the cardiovascular complications, as the decrease of hba1c <6.0% retinal vascular changes in diabetic population are the most common cause of blindness among eye diseases . Impairment of retinal circulation results in blood flow alternations that affect the delivery of oxygen and metabolic substrates to the tissue . Release of oxygen derived free radicals, nitric oxide - mediated neurotoxicity, and delayed cell death lead to neuronal damage . Poor glycemic control sets the stage for initiation of the microvascular changes . The molecular basis of dr and maculopathy takes into consideration the role of growth factors and cytokines in the development of diabetic vascular alterations, their specific influence on the cellular interaction between retinal endothelial cells and pericytes, and the role of intravascular blood components . The earliest histological features of dr include neuroretinal damage, capillary basement membrane thickening, loss of pericytes and loss of endothelial cells . The hallmark of proliferative diabetic retinopathy (pdr) is neovascularization (nv) which occurs at the latter stages of the disease and can result in blindness; nv is the consequence of abnormal fibrovascular proliferations with subsequent bleeding and retinal detachment . Numerous studies have underlined the role of the angiogenic factors in the progression of dr and include vascular endothelial growth factor (vegf), insuline - like growth factor (igf-1), hepatocyte growth factor (hgf), basic fibroblast growth factor (b - fgf), platelet - derived growth factor (pdgf), pro / inflammatory cytokines and angiopoetins . On the other hand, the major antiangiogenic factors are: pigment epithelium derived factor (pedf), transforming growth factor beta (tgf - beta), thrombospondin (tsp) and somatostatin [57]. The balance among angiogenic and antiangiogenic factors has a determining role in the progression of dr . The early diabetic retinopathy study (edrs) demonstrates the ability of panretinal photocoagulation to reduce the rate of severe visual loss by 50% for eyes with high risk characteristics, defined as nv originating from optic disc (> 1/3 disc diameter), any nv originating from the optic disc with hemorrhage, and nv originating from the retina with vitreous hemorrhage . The edrs showed that patients with (type 2) dm who were older than 40 years of age, with severe nonproliferative dr (defined as hemorrhages in four quadrants, or intraretinal microvascular abnormalities in one quadrant), have benefited from early panretinal photocoagulation . The early vitrectomy diabetic study (evds) showed that early vitrectomy (within 6 months of onset of vitreous haemorrhage) was associated with better results in type 1 diabetes mellitus patients [79]. Where are we now in relation to our knowledge in prevention and early treatment of dr? Did we follow our investigations in a direction that can give us solution of the main problems, or our investigations do not have a real clinical impact? Can we expect better predictive strategies for early diagnosis and treatment? To answer these questions we will summarize our results achieved with currently available diagnostic and therapeutic approaches . A number of advances in science have been translated into real and measurable advances in patient care . The emerging investigations are concentrated on different secretory proteins and their role in the development on pdr . For example secreted acidic proteins rich in cystein (sparc) are isolated from the vitreus fluid and are increased in patients with pdr . Furthermore, subretinal injections of recombinant sparc adenovirus, induce pdr - like changes in the rat, thereby providing a relevant animal model for the investigation of pdr . Robo4, a member of roundabout (rabo) family, acts as a neuronal guidance receptor and plays some role in vasculogenesis and angiogenesis . Several studies have shown its effect on the formation of fibrovascular membranes in patients with pdr, and its role in choroids - retina endothelial (rf/6a) and human retinal pigment epithelial cells . Silencing the expression of robo4 in rf 6a and rpe cells inhibited their proliferation and reduced the hypoxic condition tolerance . A number of studies have estimated increased levels of interleukin 8 in vitreous samples from patients with pdr and in patients with more severe large - vessel gliotic obliteration . Cystein - rich 61 (cyr61) induces are reported to mediate angiogenesis, and they have been shown to cause proliferation, migration, and synthetic matrix tube formation of rf/6a cells . Recent reports indicate that cyr61 acts as an angogenic mediator of ocular nv in vitro and in vivo . It may interact in synergy with vegf in the pathogenesis of pdr . On the other hand, rosiglitazone maleate, an oral peroxsisome - proliferating activated receptor gamma agonist and oral insulin sensitising agent with potential antiangiogenic activity, delays onset of pdr . The golden standard of therapy in dm is insulin, and previous studies have emphasized its inhibitory effect on the progression of the dr . However, recent information suggests this to be controversial because insulin can stimulate vegf and hypoxia - inducible factor-1 (hif-1) expression in retinal pigment epithelial cells . Vegf is considered as a main factor for the development of the pdr, but recently, a 634c / g polymorphisms in the vegf gene was shown to be associated with pdr . The expression of vegf, vegfr1 and vegfr2 levels is much higher in patients with pdr and dm, than in diabetics with pdr and dm type 2 . Studies that have analyzed the expression of integrins and their localization within the endothelium (in membranes from proliferative dr isolated during the vitreoretinal surgery) may provide new possibilities for the future treatment of the proliferative dr . The results suggest an essential role of integrins alfa and beta3 in the pathogenesis of pdr . A number of studies have shown the beneficial effect of intravitreal anti - vegf therapy . The results were achieved between 13 weeks in the patients with retinal neovascularization elsewhere and neovascularization of the disc . Assessment of the short - term safety and efficacy of inravitreally administrated bevacizumab (an anti - vegf agent) as an adjunctive treatment for pdr, especially in the severe cases with iris nv, has been estimated in a number of studies [1720]. These studies confirmed regression of the nv, but the main disadvantage of the anti / vegf drug administration is the need of repeated injections in order to prevent recurrences of the nv . Glucocortcoids (e.g., triamcinolon acetonide) that are among the drugs used for intravitreal application can influence diabetic macular edema (dme). The pathogenesis of pdr is multifactorial involving both angiogenic and inflammatory processes . When administrated together with anti - vegf drugs (bevacizumab, ranibizumab) can induce nv and dme regression . The results achieved from the studies may make this procedure an important adjunctive treatment in the management of selected cases with severe pdr . The long - term results of intravitreal bevacizumab (avastin), alone, in patients with pdr do not reveal any safety concerns [22, 23]. For instance, laser photocoagulation, while superior to intravitreal triamcinolone (ivt) or anti - vegf drugs, reduces but does not eliminate the risk of continued visual loss and is destructive to the retina . Focal / grid laser is more effective than ivt with fewer side effects within the initial 2 years . Laser or ivt are both more likely to improve the va over three years compared to the expected untreated course . Clinical investigations include those which evaluated the efficacy of intravitreal injection of bevacizumab in preventing panretinal photocoagulation, macular thickening and visual dysfunction in eyes with severe pdr . The results showed that the best corrected visual acuity increased after the combined antivegf - laser treatment while the central foveal thickness decreased . Intravitreal injection of bevacizumab can also be used in patients with pdr, that are undergoing pars plana plana vitrectomy (ppv). The intravitreal administration of bevacizumab (before ppv for pdr) facilitates surgery and may decrease the rate of postoperative vitreous hemorrhage and improve visual acuity [24, 25]. Ranibizumab (lucentis) is an affinity - matured recombinant humanized immunoglobulin monoclonal antibody fragment with a molecular weight of 48 kd that binds to and inhibits the biologic activity of all isoforms of human vegf by preventing interaction with its receptors . The fragment is one third the size of a full - length antibody and readily penetrates all layers of the retina after intravitreal injection, consequently decreasing cell proliferation and vascular permeability . The latest studies have also shown the positive effect of the drug, applied intravitreal in cases of dme . The funding was through national eye institute that sponsored cooperative agreement that was initiated in september 2002 . At the moment there are eleven on - going protocols that should estimate the results of different therapeutic approaches in cases of dr . The objective is to develop a collaborative network to facilitate multicenter clinical research on dr, dme and associated conditions (fig . 2). 2searching for the results of different treatment modalities in cases of diabetic macular edema, according to the drcr network protocols searching for the results of different treatment modalities in cases of diabetic macular edema, according to the drcr network protocols the goals of the drcr are: involvement of community based practices as well as academic or university - based centres. Collaborate with industry to facilitate investigations and pursue opportunities otherwise not possible and to do so in a manner consistent with the networks dedication to academic integrity and optimal clinical performance . Involvement of community based practices as well as academic or university - based centres . Collaborate with industry to facilitate investigations and pursue opportunities otherwise not possible and to do so in a manner consistent with the networks dedication to academic integrity and optimal clinical performance . This will include the effects of cataract surgery upon dme and the effects of intravitreal plasmin to cause a posterior vitreous detachment upon dme . With the advent of new sophisticated techniques and diagnostic tools, the latest classification of the dr seems to be insufficient . Triggered on the molecular level, the non - responders to the standard therapy should be provided a strategy of personalized patient treatment . Although individualized therapy planning seems to be expensive, we should consider the fact that the diabetic complications lead to economic and psycho - social problems . The complicated treatment phase, including the sophisticated and expensive techniques of ppv, using different kind of drug substitutes do not always provide us satisfactory results . The main problem at this point is not only the associated complications of the treatment, but the chronicity of the disease . The long - term results of the surgery are not always stabile over time, and a lot of late complications cannot be avoided . Thus there is a need for new diagnostic and therapeutic approaches to be instituted much earlier at a time when there is no evidence of retinal damage . Hypertension, insulin resistance, dyslipidemia and obesity, are commonly found in a combination with this stage of pdr . New diagnostic images, that can discover early diabetic changes, can provide useful informations for the novel dr treatment . Pathology specific biomarkers, dna analysis in conditions of chronic diseases diagnostic and treatment, do not deliver us only information about the general concept of treatment, but also help us in the individual - treatment, individual drug response and benefits according to this strategy of individual healthcare . There is a need of collaborative network, to facilitate multicenter clinical activities, and thereby development of advanced treatment algorithms for dr and dme . The multidisciplinary approach to chronic diseases, such as dr can initiate research activities in different fields that could create the model of personal - based - patient - care . This means, we should gain new strategies to the optimal concept that includes: recognize the population at risk of the diseasefollow - up before the initial changes become manifestedsearch for new approaches that can prevent the development of the diseaseearly treatmentoptimal follow - up recognize the population at risk of the disease follow - up before the initial changes become manifested search for new approaches that can prevent the development of the disease
Several attempts have been made to address this problem such as diet changes, lowering carbohydrate intake, efficient oral hygiene measures and rinsing fluoride mouthwashes . Application of sealants, fluoride releasing bonding agents, elastic modules impregnated with fluoride and fluoride varnishes are the most commonly used preventative methods by orthodontists . Despite all these efforts, we still witness white spot lesions following bracket removal . If a void exists between the adhesive and enamel surface at the margin of brackets, this could lead to microleakage and accumulation of cariogenic bacteria in inaccessible areas . These lesions occur in about 45% of orthodontic patients and according to a previous study, they have a higher incidence in males . They are unsightly and appear as enamel opacity, involving at least one - third of the labial surface . Corrosion and craters in the stainless steel bracket base initiate at the gap developed between the brackets and adhesives . Investigated the amount of microleakage following the application of different adhesive systems for bonding ceramic and metal brackets . In their study, the amount of microleakage was reported to be higher beneath the metal brackets at both interfaces regardless of the adhesive system used . Uysal et al, also reported higher amount of microleakage at the gingival in comparison to the occlusal margin (light curing was done at the occlusal margin for both adhesive systems). Although use of light activated composites has become popular in orthodontics, prevention of light penetration by metal brackets, the most commonly used attachments in fixed orthodontics, is a major concern . Also, the stress due to the polymerization shrinkage is among the most important problems associated with light - activated composites . If the contracting forces of curing resins overcome the bond of adhesive, marginal failure and microleakage may result . To overcome this side effect, the suggested three - sided light curing technique was based on the assumption that contraction of photo - activated composite resin is directed toward the light source . In our study, the transillumination technique was used to assess its efficacy for bonding of metal brackets . This method was initially suggested for cementation of acid - etched fixed partial dentures . In this technique, some previous studies have investigated the bond strength of visible light - cured composites using transillumination as a curing technique [1518]. In 2013, kumar et al . Showed that 90% of light intensity was lost when using transillumination technique for bonding brackets . However, they found that both the conventional method and transillumination technique yielded similar results in terms of bond strength of metal brackets . Also, in 2013 heravi et al . Concluded that to achieve an acceptable bracket bond strength for the posterior teeth, doubling the curing time from 40 to 80 seconds and increasing the light intensity to 800 mw / cm during transillumination technique were required . From the previous studies it can be concluded that transillumination is an applicable technique for improving the bond strength; however, marginal seal is also an important factor to prevent marginal corrosion and bacterial attacks, and inappropriate marginal seal can lead to white spot lesions or bracket bond failure during the course of treatment . To the best of our knowledge, no study has evaluated the effect of transillumination as a curing technique on the microleakage beneath metal orthodontic brackets . The aim of this study was to evaluate the effect of transillumination as a light curing technique on the amount of microleakage, in comparison to the conventional technique of curing, using two methods of enamel conditioning . According to a study by arhun et al, 120 freshly extracted bovine deciduous mandibular incisors were collected for this study . The teeth were examined to be free of surface developmental defects and cracks under direct light . The soft tissue remnants and the debris were removed and the specimens were polished with pumice paste and rubber cups for 10 seconds each, and were then stored in distilled water for one month . Before the onset of the bonding process, all the specimens were disinfected by immersion in 1% thymol solution for one week . The middle - third of the enamel surface of each tooth was prepared using two enamel preparation methods . The first method included the use of 37% phosphoric acid gel (unitek, monrovia, ca) for enamel conditioning and transbond xt primer (3 m, unitek, monrovia, ca) as a sealant . In the second method, transbond plus (3 m, unitek, monrovia, ca) was applied as self - etching primer . The stainless steel twin maxillary central incisor brackets (.022-in - daynalock series, 3 m, monrovia, ca) were bonded on the middle third of the buccal surface in all samples with transbond xt (3 m, unitek, monrovia, ca), a light - cured orthodontic resin, using a light curing unit (coltolux 75, coltene / whaledent gmbh, langenau, germany) with a light intensity of 530 mw / mm . In order to maintain a fixed distance and angle of light curing, a holder was designed and used to set the position of the samples at 5 mm distance from the tip of the light - curing unit . The device held the samples vertically in such a way that the tip of the light - curing unit was perpendicular to the long axis of the samples on both sides depending on the group of samples (fig . The samples were randomly divided into four groups of 30 teeth and were prepared as follows: group i: the teeth were etched with 37% phosphoric acid for 30 seconds, and then rinsed and dried for 20 seconds with oil - free air spray . The brackets were bonded using transbond xt primer as the sealant and transbond xt as the adhesive . Finally, the mesial and distal margins of the brackets were light cured for 10 seconds each.group ii: the same methods of enamel preparation and bracket bonding were applied as in group i; but transillumination (applying the light source to the middle third of the lingual surface) was used for 50 seconds as the technique of resin polymerization.group iii: transbond plus self - etching primer was applied for 35 seconds with mild pressure of the brush according to the manufacturer s instructions, followed by a gentle burst of air for 12 seconds . Then, the brackets were bonded using transbond xt and 10 seconds of light curing was performed at the mesial and distal margins.group iv: the same method of enamel preparation as in group iii was applied; but transillumination for 50 seconds from the lingual side was used as the method of curing . Thermal cycling in deionized water was performed at 5 2 c 55 2 c for 500 cycles with a dwell time of 30 seconds and transfer time of 5 seconds . Then, the samples were stored in distilled water at room temperature and a dark environment for three months for the aging process . Group i: the teeth were etched with 37% phosphoric acid for 30 seconds, and then rinsed and dried for 20 seconds with oil - free air spray . The brackets were bonded using transbond xt primer as the sealant and transbond xt as the adhesive . Finally, the mesial and distal margins of the brackets were light cured for 10 seconds each . Group ii: the same methods of enamel preparation and bracket bonding were applied as in group i; but transillumination (applying the light source to the middle third of the lingual surface) was used for 50 seconds as the technique of resin polymerization . Group iii: transbond plus self - etching primer was applied for 35 seconds with mild pressure of the brush according to the manufacturer s instructions, followed by a gentle burst of air for 12 seconds . Then, the brackets were bonded using transbond xt and 10 seconds of light curing was performed at the mesial and distal margins . Group iv: the same method of enamel preparation as in group iii was applied; but transillumination for 50 seconds from the lingual side was used as the method of curing . Thermal cycling in deionized water was performed at 5 2 c 55 2 c for 500 cycles with a dwell time of 30 seconds and transfer time of 5 seconds . Then, the samples were stored in distilled water at room temperature and a dark environment for three months for the aging process . For evaluation of microleakage in all margins, each group was randomly divided into two subgroups of 15 samples in order to perform tooth sectioning in two different directions . In subgroup one, the teeth were sectioned from the middle of the brackets in incisogingival direction while in subgroup two, the teeth were sectioned in mesiodistal direction to evaluate the margins that were directly light cured as instructed by the manufacturer . The apices of all teeth were sealed with sticky wax and then all surfaces were coated with two layers of nail varnish except for 1 mm around the bracket margins . In the next step, the samples were immersed in 0.5% basic fuchsine solution for 24 hours at room temperature . After removal from the solution, the teeth were rinsed with distilled water, the superficial dye was removed with a brush and the teeth were left to dry . The samples were embedded in epoxy resin blocks according to the direction of sections using an index in the heavy putty impression (fig . One sample fixed in the holding chuck of the cutting machine (struers, denmark) before sectioning (a) and after sectioning (b) sectioning was carried out using a low - speed diamond saw (accutom-50, struers, denmark). All samples were numbered before sectioning according to their group allocation and were examined randomly under a stereomicroscope (motic, xiamen, china) at 40 magnification . The microleakage scores were directly recorded using an electronic digital caliper (guanglu measuring instrument co. ltd, shanghai, china) by a single blinded observer (sh.a). Half of the samples were randomly examined blindly for the second time under the same stereomicroscope by the same observer (sh.a) after a week to assess the intra - observer error of measurements . The incisogingival and mesiodistal dimensions of each section were examined at enamel - adhesive and adhesive - bracket interfaces (in each side) and scored based on the amount of microleakage (fig . Stereomicroscopic views (a and b) of a sample sectioned in mesiodistal direction (black arrow: enamel - adhesive interface, white arrow: adhesive - bracket interface) for data analysis, the mean and standard deviation values of all groups were obtained using spss version 15.0 (microsoft, il, usa). To compare the sides and interfaces within each group (dependent samples), the non - parametric wilcoxon singed rank test was used . The kruskal - wallis (independent non - parametric test) and the mann - whitney u tests with bonferroni correction were used to compare the groups . For evaluation of microleakage in all margins, each group was randomly divided into two subgroups of 15 samples in order to perform tooth sectioning in two different directions . In subgroup one, the teeth were sectioned from the middle of the brackets in incisogingival direction while in subgroup two, the teeth were sectioned in mesiodistal direction to evaluate the margins that were directly light cured as instructed by the manufacturer . The apices of all teeth were sealed with sticky wax and then all surfaces were coated with two layers of nail varnish except for 1 mm around the bracket margins . In the next step, the samples were immersed in 0.5% basic fuchsine solution for 24 hours at room temperature . After removal from the solution, the teeth were rinsed with distilled water, the superficial dye was removed with a brush and the teeth were left to dry . The samples were embedded in epoxy resin blocks according to the direction of sections using an index in the heavy putty impression (fig . One sample fixed in the holding chuck of the cutting machine (struers, denmark) before sectioning (a) and after sectioning (b) sectioning was carried out using a low - speed diamond saw (accutom-50, struers, denmark). All samples were numbered before sectioning according to their group allocation and were examined randomly under a stereomicroscope (motic, xiamen, china) at 40 magnification . The microleakage scores were directly recorded using an electronic digital caliper (guanglu measuring instrument co. ltd, shanghai, china) by a single blinded observer (sh.a). Half of the samples were randomly examined blindly for the second time under the same stereomicroscope by the same observer (sh.a) after a week to assess the intra - observer error of measurements . The incisogingival and mesiodistal dimensions of each section were examined at enamel - adhesive and adhesive - bracket interfaces (in each side) and scored based on the amount of microleakage (fig . Stereomicroscopic views (a and b) of a sample sectioned in mesiodistal direction (black arrow: enamel - adhesive interface, white arrow: adhesive - bracket interface) for data analysis, the mean and standard deviation values of all groups were obtained using spss version 15.0 (microsoft, il, usa). To compare the sides and interfaces within each group (dependent samples), the non - parametric wilcoxon singed the kruskal - wallis (independent non - parametric test) and the mann - whitney u tests with bonferroni correction were used to compare the groups . The overall intra - observer agreement for each group was high (kappa value of 0.792). In case of disagreements, the mean of measurements was reported . All groups showed microleakage at the incisal and gingival margins; but in comparison between conventional and transillumination groups, significant differences were observed only between incisal and gingival margins in the transillumination group (p<0.001). Comparison of mesial and distal margins revealed no statistically significant differences in any group (p>0.05). When direct illumination and transillumination were compared as the two methods of curing, the amount of microleakage was significantly higher at the gingival margins compared to the incisal margins in both interfaces in the transillumination group irrespective of the method of enamel preparation (p<0.05). At the mesial and distal margins comparison of groups based on the method of enamel conditioning revealed no significant differences at the incisal and gingival margins in any of the interfaces; but at the mesial and distal margins, only group seven (self - etching primer + direct illumination) showed significantly lower microleakage score in comparison with group five (acid - etching + direct illumination) (p=0.001). Comparison of microleakage scores (mm) between enamel - adhesive and adhesive - bracket interfaces in buccolingual sections n indicates sample size; sd, standard deviation; s, significant; ns, not significant group 1: acid etching + direct illumination; group 2: acid etching + transillumination; group 3: self etching primer + direct illumination; group 4: self etching primer + transillumination . Comparison of microleakage scores (mm) between enamel - adhesive and adhesive - bracket interfaces in mesiodistal sections n indicates sample size; sd, standard deviation; s, significant; ns, not significant group 5: acid etching + direct illumination; group 6: acid etching + transillumination; group 7: self etching primer + direct illumination; group 8: self etching primer + transillumination multiple comparisons among all groups are shown in tables 3 and 4 with bonferroni correction . Multiple comparisons of microleakage scores among groups at incisal and gingival margins in enamel - adhesive and adhesive - bracket interfaces n indicates sample size; sd, standard deviation; s, significant; ns, not significant; group 1: acid etching + direct illumination; group 2: acid etching + transillumination; group 3: self etching primer + direct illumination; group 4: self etching primer + transillumination . Multiple comparisons of microleakage scores among groups at the mesial and distal margins in enamel - adhesive and adhesive - bracket interfaces n indicates sample size; sd, standard deviation; s, significant; ns, not significant; group 5: acid etching + direct illumination; group 6: acid etching + transillumination; group 7: self etching primer + direct illumination; group 8: self etching primer + transillumination . This process occurs rapidly and mineral loss has been reported even within a few months of treatment initiation . The aim of the current study was to compare the amount of microleakage of an orthodontic adhesive following the use of two different methods of enamel conditioning and light curing . In this study, we used bovine incisors as available substitutes for human incisors . Bovine deciduous lower incisors have nearly the size of permanent human maxillary central incisors, which are the most ideal for testing bonding properties since they provide flat bonding surfaces . These two types of teeth have been compared in a number of previous studies [15,20, 21]. The assumption that the contraction of photo - activated composite resins is directed toward the light source, and also the problem of not being able to directly cure the composite resin under metal brackets led to the idea of evaluating transillumination as a method of curing in this study . Behrents et al, also supported the use of this technique for bonding of lingual attachments due to its practical application in the oral environment . In the current study, one reason for less microleakage following the use of self - etching adhesive systems at margins cured directly could be the simultaneous penetration of etchant and monomer and the identical length of primer tags in the etched enamel . In contrast to the conventional method of enamel conditioning, self - etching primers produce a uniform and more conservative etched pattern providing uniform adhesive penetration and less aggressive enamel demineralization . In a study conducted by vicente et al, on the effect of thermocycling on the microleakage beneath brackets bonded to bovine incisors, they found that microleakage increased significantly at the enamel - adhesive interface when using transbond xt as the bonding agent . In the current study, this may explain the greater amount of microleakage at all margins in comparison with some other studies on this topic [7, 24]. In 2013, sabzevari et al . Demonstrated that thermocycling did not significantly increase the microleakage when a self - etching primer was used as a conditioner . However, comparison of different methods of bonding after thermocycling showed no significant differences between self - etching primers and the conventional method of conditioning . Surface conditioning causes leakage of fluid and bacteria beneath the orthodontic brackets; thus, a deeper etching pattern with acid etchant cannot guarantee an interface free of microleakage . On the other hand, less penetrated resin tags in these systems may not resist the contracting forces of resin shrinkage . However, this is acceptable in restorative dentistry when a bulk of composite is placed in a prepared cavity . Orthodontic adhesive layers are very thin and the free, floating brackets are pulled closer to the enamel surface by the shrinkage . The amount of microleakage reported in our study was lower than that in some previous studies; this finding is in agreement with less microleakage reported for transbond xt in an in vitro study by sener et al . Less microleakage at the margins of specimens in self - etching primer groups cured directly is similar to the results of a study by uysal et al, which showed significantly higher scores at the gingival compared to the occlusal margins (where the tip of the light curing unit was positioned). Another factor that should be taken into account regarding the microleakage scores is a phenomenon called percolation . The linear coefficient of thermal expansion for enamel, metal brackets and the adhesive is not the same (=12 for enamel, =16 for stainless steel brackets and =2055 ppm / c for composite resin). These materials expand and contract at different rates when hot and cold foods are consumed; thus, the fluids are sucked in and pushed out at the margins of the brackets bonded to the teeth in both tooth - adhesive and adhesive - bracket interfaces . The greater the light energy received by the composite, the greater the polymerization; therefore, transillumination must provide greater light energy than direct curing . Since pulpal temperature should not exceed 56 c, extending the exposure time should be done with caution . With 1 mm of dentine between the composite and the pulp, the temperature increases to 6c with 40 seconds of continuous exposure . In orthodontics, oesterle and shellhart reported comparable bond strength in the group using transillumination for 50 seconds with the group cured for 40 seconds at the margins . However, heravi et al . Concluded that 80 seconds of curing with high power mode of blue phase c8led light curing unit with transillumination technique resulted in a clinically acceptable shear bond strength of brackets to posterior teeth with no risk of pulpal damage . As reported by yazici et al, and haiduc et al, led units cause significantly lower rise of pulp temperature in comparison with halogen light curing units . In the current study, the amount of microleakage in the transillumination groups was comparable to that in the conventional curing groups at most of the margins of brackets except for the gingival margin . This may be due to the reflection of light from the bracket base as was pointed out by oesterle and shellhart . Showed that even though the amount of light intensity lost in transillumination technique was significant, there were no differences in the shear bond strength of brackets bonded by transillumination technique or conventional method of curing at the mesial and distal margins . In our study, only at the gingival margin of the samples, irrespective of the method of enamel conditioning, a significant amount of microleakage was observed . This may be explained by the gradual increase of buccolingual width from the incisal toward the gingival side . Consequently, although some studies reported adequate bond strength by transillumination, microleakage should be a concern especially in teeth with greater thickness . As concluded by heravi et al, to achieve an acceptable bracket bond strength to the posterior teeth, doubling the curing time from 40 to 80 seconds and increasing the light intensity to 800 mw / cm during the transillumination technique should be done . In studies by ramuglu et al, and uysal et al, light was irradiated from the occlusal surface and a significant amount of microleakage was reported at the gingival margin . They reasoned that this result might be due to the degradation of light intensity and insufficient polymerization of composite . Other studies in which the samples were cured according to the manufacturer s instructions did not score the microleakage at the directly cured margins (mesial and distal margins). In our study, the manufacturers instructions were followed in all groups and evaluation of all margins showed that the amount of microleakage at the mesial and distal margins was lower than that at the incisal and gingival margins and these differences were statistically significant in groups which received self - etching primer for enamel conditioning . Polymerization starts in areas of resin closest to the light source . Even for metal brackets the best result will be gained if light is irradiated from all four sides of brackets . However, a well - designed study on this technique of curing may better elucidate this topic . It is impossible to extrapolate the results of an in vitro study to the actual oral environment; thus, future studies are necessary for further assessment of results . Within the limitations of this study, use of self - etching primer and conventional light curing method caused less microleakage compared to the transillumination technique . The transillumination technique, irrespective of the method of enamel preparation, caused greater microleakage in both interfaces at the gingival margin and thus should not be used as the method of curing in orthodontic treatment.
Many of the ligands trigger costimulatory growth signals in primary cells, lead to the activation of nuclear factor (nf)-b, or even induce cell death . A proliferation - inducing ligand (april) the development of cancer is viewed as a multistep process involving mutation and progressive selection for cells with increasing capacity for proliferation, survival, and invasion, even under conditions where the growth factor supply is limited . April allows tumor cells to proliferate at a reasonable rate even in low serum 1 . Moreover, april is abundantly expressed in many tumor cells and tumor tissues, in particular gastrointestinal tumors, including rectum, duodenum, colon, stomach, and esophagus 12, suggesting that april may function as an autocrine growth factor during tumorigenesis . April is a close sequence homologue of b cell activation factor of the tnf family (baff, also known as blys / ztnf4/tall-1) 34 . Baff, a costimulator of b lymphocyte survival and proliferation, has two known receptors, b cell maturation antigen (bcma) and transmembrane activator and calcium modulator and cyclophilin ligand (caml) interactor (taci) 4567 . In this study, we demonstrate that taci and bcma also bind to april and that inhibition of april with a soluble form of bcma interferes with tumor growth in vivo, suggesting an important role of april in carcinogenesis . Receptors fc fusion proteins and flag - tagged ligands (hapril amino acids [aa] 110250, mapril aa 88232) were produced in 293 t cells essentially as described 18 . For facs stainings, a soluble april was used in which the oligomerization domain of murine adipocyte complement - related protein 30 kd (aa 18111) was inserted 3 of the flag sequence and 5 of the april sequence . This chimeric protein has the same receptor binding properties as flag april and improved background staining by facs . A cdna encoding the fusion protein hbaff (aa 1132)hapril (aa 110250) was cloned in pcr-3 expression vector and stably transfected into 293 cells following established protocols 8 . Myc - tagged mapril (aa 98232) cloned into a ppic9 (invitrogen) derived vector was expressed in pichia pastoris strain gs115 grown in bmmy medium (invitrogen). Pichia supernatant was dialyzed overnight against 10 mm tris, ph 6.8, and then loaded onto a sepharose sp column . The column was washed extensively with 10 mm tris / hcl, ph 6.8, and eluted with 250 mm nacl in pbs . A second purification step was performed using a gel filtration column (s300; amersham pharmacia biotech). The purified protein was analyzed by western blot using the monoclonal 9e10 (anti - myc) antibody and nh2-terminal sequence determination . Fc (500 ng) mixed with flag ligands (200 ng) in 1 ml of pbs were incubated for 2 h at 4c on a wheel with 2.5 l of protein a beads were harvested, loaded in empty mini columns, washed three times with 100 volumes of pbs, eluted with 15 l of 0.1 m citrate - naoh, ph 2.7, neutralized, and analyzed by western blotting with anti - flag m2 antibody . Receptor binding elisa was performed essentially as described 8 . In brief, receptors fcs were coated to elisa plates in carbonate buffer . After blocking, serial dilutions of flag ligands were added, and ligand binding was revealed with anti - flag m2 antibody . Staining using the rat igg2a anti - hbaff antibody buffy-1 (formerly 43.9) stable cell lines expressing surface baff or surface april were stained with 200 ng hbcma fc, followed by goat anti human nih3t3 cells were stained with flag baff (100 ng per staining), flag april (100 ng per staining), or with flag april that had been previously depleted using protein a beads loaded with bcma fc or tnf - related apoptosis - inducing ligand receptor 2 (trailr2)fc (25 g). A 500-fold depletion was achieved with bcma fc, as assessed by elisa on bcma fc . Bound ligands were revealed with biotinylated anti - flag m2 antibody and pe - coupled streptavidin as previously described 34 . Total rna was obtained from 10 cells using the rneasy purification system (qiagen). 20 g of rna per sample was run on a 1.2% agarose gel containing formaldehyde and transferred to a nylon membrane . The northern blots were hybridized using random primed radioactive probes in expresshyb buffer (clontech laboratories, inc .) For 3 h and then washed at room temperature for 40 min with several changes of 2 ssc/0.1% sds followed by 0.1 ssc/0.05% sds for 40 min at 50c . The tetracycline - inducible mapril expressing cell lines were constructed using the tet - on expression system (clontech laboratories, inc . ). In brief, the soluble extracellular domain of murine april was pcr amplified using primers 5-tgtgaattccggccccaccatggattacaaagacgatgacgataaagggggctcagt - cagtcagagagcc-3 and 5-tgtctagatcatagtttcacaaaccccagg-3, which allowed directional cloning into the ptre vector . This april expression vector was stably transfected along with a hygromycin selection plasmid into a cell line that had already been stably transfected, under neomycin selection, with the ptet - on regulatory plasmid . Cell lines derived from this dual selection process were then selected on the basis of induction of april expression in the presence of the tetracycline analogue doxycycline (2 g / ml; sigma - aldrich). Cell extracts of stable clones were analyzed by western blotting using anti - flag m2 mab (sigma - aldrich). For cellular proliferation analyses, the tet - inducible april expression lines were maintained in 0.5% serum overnight to induce quiescence . Cells were then plated in 96-well plates at a concentration of 10 cells / ml in rpmi/1% serum and were left untreated, received 2 g / ml doxycycline, or received doxycycline and 20 g / ml bcma cells were left overnight and then pulsed for 8 h with 0.5 ci / well [h]thymidine (amersham pharmacia biotech). Tumor growth was investigated using 68-wk - old female nude (nu / nu) mice (harlan laboratories). Tumor cell lines ht29 and a549 were obtained from american type culture collection and cultured following the supplier's instructions . Cells were trypsinized, washed twice, and resuspended in pyrogen - free pbs at a concentration of 10 cells / ml . Mice were anesthetized using a ketamine / xylazine solution, and 100 l of cells was carefully implanted in the flank subcutaneously . Dosing was 200 g bcma fc or control higg in 100 l pbs intraperitoneally . Receptors fc fusion proteins and flag - tagged ligands (hapril amino acids [aa] 110250, mapril aa 88232) were produced in 293 t cells essentially as described 18 . For facs stainings, a soluble april was used in which the oligomerization domain of murine adipocyte complement - related protein 30 kd (aa 18111) was inserted 3 of the flag sequence and 5 of the april sequence . This chimeric protein has the same receptor binding properties as flag april and improved background staining by facs . A cdna encoding the fusion protein hbaff (aa 1132)hapril (aa 110250) was cloned in pcr-3 expression vector and stably transfected into 293 cells following established protocols 8 . Myc - tagged mapril (aa 98232) cloned into a ppic9 (invitrogen) derived vector was expressed in pichia pastoris strain gs115 grown in bmmy medium (invitrogen). Pichia supernatant was dialyzed overnight against 10 mm tris, ph 6.8, and then loaded onto a sepharose sp column . The column was washed extensively with 10 mm tris / hcl, ph 6.8, and eluted with 250 mm nacl in pbs . A second purification step was performed using a gel filtration column (s300; amersham pharmacia biotech). The purified protein was analyzed by western blot using the monoclonal 9e10 (anti - myc) antibody and nh2-terminal sequence determination . Receptors fc (500 ng) mixed with flag ligands (200 ng) in 1 ml of pbs were incubated for 2 h at 4c on a wheel with 2.5 l of protein a beads were harvested, loaded in empty mini columns, washed three times with 100 volumes of pbs, eluted with 15 l of 0.1 m citrate - naoh, ph 2.7, neutralized, and analyzed by western blotting with anti - flag m2 antibody ., receptors fcs were coated to elisa plates in carbonate buffer . After blocking, serial dilutions of flag ligands were added, and ligand binding was revealed with anti - flag m2 antibody . Staining using the rat igg2a anti - hbaff antibody buffy-1 (formerly 43.9) stable cell lines expressing surface baff or surface april were stained with 200 ng hbcma fc, followed by goat anti human nih3t3 cells were stained with flag baff (100 ng per staining), flag april (100 ng per staining), or with flag april that had been previously depleted using protein a beads loaded with bcma fc or tnf - related apoptosis - inducing ligand receptor 2 (trailr2)fc (25 g). A 500-fold depletion was achieved with bcma fc, as assessed by elisa on bcma fc . Bound ligands were revealed with biotinylated anti - flag m2 antibody and pe - coupled streptavidin as previously described 34 . Total rna was obtained from 10 cells using the rneasy purification system (qiagen). 20 g of rna per sample was run on a 1.2% agarose gel containing formaldehyde and transferred to a nylon membrane . The northern blots were hybridized using random primed radioactive probes in expresshyb buffer (clontech laboratories, inc .) For 3 h and then washed at room temperature for 40 min with several changes of 2 ssc/0.1% sds followed by 0.1 ssc/0.05% sds for 40 min at 50c . The tetracycline - inducible mapril expressing cell lines were constructed using the tet - on expression system (clontech laboratories, inc . ). In brief, the soluble extracellular domain of murine april was pcr amplified using primers 5-tgtgaattccggccccaccatggattacaaagacgatgacgataaagggggctcagt - cagtcagagagcc-3 and 5-tgtctagatcatagtttcacaaaccccagg-3, which allowed directional cloning into the ptre vector . This april expression vector was stably transfected along with a hygromycin selection plasmid into a cell line that had already been stably transfected, under neomycin selection, with the ptet - on regulatory plasmid . Cell lines derived from this dual selection process were then selected on the basis of induction of april expression in the presence of the tetracycline analogue doxycycline (2 g / ml; sigma - aldrich). Cell extracts of stable clones were analyzed by western blotting using anti - flag m2 mab (sigma - aldrich). For cellular proliferation analyses, the tet - inducible april expression lines were maintained in 0.5% serum overnight to induce quiescence . Cells were then plated in 96-well plates at a concentration of 10 cells / ml in rpmi/1% serum and were left untreated, received 2 g / ml doxycycline, or received doxycycline and 20 g / ml bcma fc fusion protein . Cells were left overnight and then pulsed for 8 h with 0.5 ci / well [h]thymidine (amersham pharmacia biotech). Tumor growth was investigated using 68-wk - old female nude (nu / nu) mice (harlan laboratories). Tumor cell lines ht29 and a549 were obtained from american type culture collection and cultured following the supplier's instructions . Cells were trypsinized, washed twice, and resuspended in pyrogen - free pbs at a concentration of 10 cells / ml . Mice were anesthetized using a ketamine / xylazine solution, and 100 l of cells was carefully implanted in the flank subcutaneously . Dosing was 200 g bcma fc or control higg in 100 l pbs intraperitoneally . As april is a member of the tnf ligand family, it was likely that it interacted with one of the currently known 25 members of the tnf receptor family, some of which are still orphan 9 . When supernatants from 293 t cells expressing recombinant soluble flag - tagged april (aa 110250, corresponding to the tnf homology region) were incubated with various soluble tnf receptor ig - fc fusion proteins (receptor fc), two of them, bcma fc and taci fc, were found to immunoprecipitate april . In contrast, no specific interaction with other receptors, including herpes virus entry mediator (hvem) and fas, which have been recently proposed to interact with april 2, was observed (fig . Both are devoid of a signal sequence and contain one (bcma) or two (taci) sets of a and c cysteine - rich modules instead of multiple a and b modules found in most other tnf receptor members 10 . Recently, bcma and taci have been identified as receptors for baff / blys / ztnf4/tall-1 4 . Baff, which promotes b cell survival and proliferation, is the closest sequence homologue of april 3 . Thus, both bcma and taci can act as receptors for the same two ligands, april and baff . Fc and taci fc did not immunoprecipitate any of the 14 other tnf ligand family members tested, confirming that the interactions with april and baff were specific (data not shown). Fc was coated to plastic, specific binding of both human and murine april was found in each case (fig . 1 b), indicating that there is ligand receptor cross - species reactivity . 1 b), in agreement with recent data 4 . Binding of bcma fc was not restricted to soluble ligands but was also observed with membrane - bound april and baff . 293hek cells were stably transfected with a baff or with a baff (stalk region)april (tnf homology region) hybrid ligand (fig . 1 c). Using the anti - baff stalk antibody (buffy-1), similar surface expression levels of baff and of the april hybrid construct were demonstrated in stably transfected cell populations . April and flag baff were incubated with bcma fc, only april was detected in bcma these data suggest that although bcma and taci are both receptors for april and baff, some specificity of interaction may be imposed by the apparent preference of bcma for april and of taci for baff . We have previously shown that nih-3t3 cells stably transfected with full - length human april proliferate faster than mock - transfected cells in vitro and in vivo 1 . As membrane - bound april is predicted to be efficiently processed in the extracellular stalk region by a furin to release soluble (s)april 3, we next investigated whether increased proliferation rates were also discernible in cell lines that directly expressed the soluble form . Nih-3t3 clones that expressed soluble murine april under a tetracycline - inducible promotor were generated . Sapril expression could be induced by treatment with the tetracycline analogue doxycycline for 16 h (fig . Two forms of sapril migrating at 17 and 22 kd were detected that corresponded to the expected sizes of the nonglycosylated and n - glycosylated proteins, respectively . We maintained the tet - inducible april expression clones in low serum to induce quiescence, and the cells were then either left untreated or incubated with doxycycline overnight . When proliferation was assayed using a [h]thymidine pulse, induced sapril cell lines showed a 3040% increase in proliferation rate (fig . This increase in growth rate is comparable to that observed with nih-3t3 clones stably expressing the membrane - bound april 1 . In the presence of bcma fc, the increased proliferation observed in sapril - expressing cells was reversed (fig . 2 b), indicating that the growth advantage was indeed april mediated . As bcma and taci mrna expression was reported exclusively in b cells or activated t cells 56, the proliferative effect of april on the fibroblastic nih-3t3 cells was difficult to explain . We therefore measured mrna levels of the two april receptors in a panel of murine and human cell lines and could confirm the previously reported cell type distribution (fig . Were bcma or taci mrna detected in nonlymphoid cells such as the human adenocarcinoma cell line ht-29, the lung carcinoma cell line a549, or the murine fibroblastic nih-3t3 cell line, even after prolonged northern blot exposure . As expected from the northern blot data, we were unable to stain these cells with baff, further supporting their lack of bcma or taci expression (fig . In contrast, a strong staining of these cells was observed with flag april, which could be partially reduced by prior depletion of flag april with bcma fc, but not with the control trailr2fc (fig the control raji cells, which express message for both taci and bcma, were positive for both baff and april staining as expected . Taken together, these results suggest that nih-3t3, ht-29, a549, and other fibroblastic and epithelial cell lines (data not shown) express a third yet uncharacterized april receptor that does not cross - react with baff (fig . The availability of a soluble high - affinity april receptor (bcma fc) capable of inhibiting april - proliferative effects in vitro allowed us to investigate the role of april in tumorigenesis . When the epithelial tumor cell line ht29 was grown as subcutaneous tumors in nude mice, small palpable tumors were observed 2 wk after injection, and the average tumor volume exceeded 0.5 cm after 6 wk . Fc (200 g per mouse every week, the first time immediately before tumor cell injection) almost completely blocked tumor formation, and even 6 wk after injection, tumors were barely detectable . The human lung carcinoma cell line a549 was also grown as a subcutaneous tumor and subjected to the same treatment course . Injection of bcma fc retarded tumor growth, resulting in a significant reduction of tumor size to <0.10 cm (fig . This difference was still very significant 10 wk after tumor implantation, indicating that bcma fc can modulate tumor growth over a long period of time (fig . Results similar to the a549 case were obtained with sw480 cells and nih-3t3 cells (data not shown). Several mechanisms could contribute to the retardation of tumor growth in bcma fc - treated animals . Most tumor cell lines investigated in this report express endogenous april (reference 1 and additional northern blot data not shown), and, because increased levels of april enhance proliferation in vitro, it is possible that bcma taci and bcma signaling leads to increased activation of the transcription factor nf-b (and nuclear factor of activated t cells and activator protein [ap]-1 for taci through caml) 5, and constitutive nf-b and ap-1 activation is frequently found in highly tumorigenic cells 11 . Therefore, a high local concentration of furin - processed soluble april 3, perhaps together with increased expression of april receptors, will potentially result in conditions that favor neoplastic growth . In this context, it is noteworthy that bcma was originally identified as a gene fused to the il-2 locus in a chromosomal translocation from a t lymphoma 12 . However, the growth stimulatory effects of april on nih-3t3 cells are unlikely to be due to the stimulation of the bcma or taci signaling pathways, as these cells do not express detectable amounts of these receptors . As strong april binding to nih-3t3 and other cells is observed, it is reasonable to assume that fibroblasts express an additional april receptor that, in contrast to bcma and taci, does not appear to cross - react with baff . High levels of april mrna expression have been described in carcinomas 12, a tumor class in which mutations in the tumor suppressor p53 gene are frequently found 13 . As april is localized on chromosome 17p13.1, 130150 kb telomeric to p53 14, it is conceivable that an increased local transcriptional activity may contribute to augment april expression . We cannot rule out, however, that the action of bcma fc is indirect . Fc may interfere with april produced by host cells, which may stimulate tumor growth in a paracrine manner . Moreover, as administration of bcma fc has been demonstrated to partially deplete b cells in mice 47, the effect of bcma we feel, however, that this latter possibility is unlikely given that nude mice lack t cells necessary for b cell help . April's growth - stimulatory capacity on transformed cells together with the observation that the growth of tumor cell lines is suppressed upon interference with april's activity suggests an important role for april in tumorigenesis . Therefore, a potential role for april in supporting the growth of b cell tumors that express high levels of bcma should also be considered . Indeed, stimulation of bcma and/or taci leads to increased bcl-2 expression in primary b cells 15, and the raji burkitt lymphoma cell line has enhanced growth in the presence of april 1 . Interestingly, burkitt lymphoma cells require signals from monocytes for optimal survival and proliferation 16 . As april is expressed in monocytes (our unpublished observations), it is possible that april may provide this stimulus . Such a signal may be a critical component in tumorigenesis in a variety of settings . For example, chronic inflammation in inflammatory bowel disease or after helicobacter pylori infection in humans has been implicated in the pathogenesis of cancers of the gastrointestinal tract, suggesting that tumor cells receive stimulatory signals from inflammatory cells 17 . Cancer is a major public health problem despite impressive advances in the understanding of molecular mechanisms underlying carcinogenesis and in the development of novel anticancer therapies . The recent success of antibodies to epidermal growth factor receptor2 (her2) in the treatment of breast cancer tumors 18 demonstrates that antibodies or antibody - like molecules can effectively be used to treat cancer patients, complementing classical drugs . Fc or other inhibitors interfering with april activity may therefore constitute exciting new tools in cancer therapy.
Neonatal intestinal perforation (nip) is an extremely rare complication of intestinal hemangioma (ih). Neonates younger than 30 days and having perforation include more common etiologies such as necrotizing enterocolitis, meconium ileus, and spontaneous idiopathic as well as gastric perforation.1 nip has been associated with mortality rates of 40% to 70%.2 this report presents a rare case of nip resulting from ih . A 27-day - old male neonate was admitted with low - grade fever, abdominal distension, and bilious vomiting associated with bouts of diarrhea of 2 days duration . Baby was a product of full - term spontaneous vaginal delivery with normal prenatal follow - up . Before coming to our hospital, the patient weighed 4.1 kg and was febrile, irritable, and moderately dehydrated . Plain abdominal radiographs suggested bowel obstruction versus ileus, therefore a barium meal follow through was obtained, which showed persistently dilated jejunal and proximal ileal loops but normal flow of contrast . Computed tomographic scan with intravenous contrast was not done because of family history of allergic reaction to the dye . On the basis of the diagnosis of intestinal obstruction, a decision for exploratory laparotomy was made . Laparotomy revealed dense inflammatory adhesions surrounding a solitary hemangioma located at the antimesenteric border 30 cm from the ileocaecal valve and on close inspection a small perforation was seen on one side of the hemangioma, which was sealed by extensive adhesions (fig . Other areas of the bowels inspected were normal and resection with primary anastomosis was done . Dilated capillary spaces lined by single layer of endothelium with proliferation of endothelial cells in between . Hemangiomas of the gastrointestinal tract are rare and account for only 0.05% of all intestinal neoplasms.3 they are commonly found within the small bowel, jejunum being the commonest site and compose 7 to 10% of all benign tumors.3 4 they have a tendency toward multiplicity, with solitary tumors being extremely rare.3 5 microscopically, ih may be classified as cavernous, capillary, or mixed types, commonest being the cavernous.6 the usual presentation is intestinal bleeding usually insidious presenting as anemia7 or sometimes acute and potentially life threatening.4 other forms of rare presentation include intussusception, obstruction, and perforation.8 9 10 ileal perforation is a rare complication of ih in neonates, and so far, only one case has been reported in the literature, by mcgaughey et al,11 who discovered evidence of ileal perforation due to ih while operating on a neonate with intestinal obstruction . Ours is the second reported case of nip due to ih, and what makes it unique is the fact that the hemangioma belonged to the rare capillary type whereas the previously reported case was of the commoner cavernous type . Diagnosis in both reported cases, including ours, were made only at surgery for presumed acute intestinal obstruction . Although various causes of nip including the rare ih have been reported, diagnosis can be difficult and exploratory laparotomy has often proved to be the final diagnostic tool . Although a rare cause of intestinal perforation in neonates, ih should be considered in the differential diagnosis.
Prostate cancer is a common health problem that in the majority of cases starts to develop at the age of 50 years, reaching its peak at 6070 years of age . A variation in its incidence and prevalence exists between western, asian and arabic populations . The highest incidence is in the usa and canada followed by european countries, then the asian population and the lowest incidence is in arabic population [1, 2]. The incidence of prostate cancer was reported to be about 100127/100.000 men in the usa, while only 3.1, 3.3 and 6.5/100.000 men in saudi arabia, oman and kuwait . The marked difference in the incidence and prevalence of prostate cancer between western and arabic countries is very interesting and can be attributed to different explanations . All arabic countries are actually islamic countries where muslims constitute the majority of the population . They adopt male circumcision in the first few years of life as an obligatory event in relation to the religion of islam . Interestingly, many recent studies confirmed the association between circumcision and the lower incidence of penile viral infections . Uganda trial reported that applying male circumcision results in a reduced incidence of hsv2 infection by 25%, hpv infection by 35% and hiv infection by 5060% [7, 8]. Morris recently reported that male circumcision is a surgical vaccine that guards against genital and urinary bacterial and viral infection and protects against penile and prostate cancer . In a study of 20,243 men in finland, infection with hpv18 was associated with a 2.6fold increase in risk of prostate cancer (p <0.005). For hpv16, some studies reported that uncircumcised men have more than twice the incidence of prostate cancer compared with circumcised men [1214] which explains why prostate cancer is relatively rare amongst jews . Of men operated on for prostatic obstruction, 1.8% of obstructions were cancerous in jews (circumcised), compared with 19% of non jews (uncircumcised). A study in the uk in 1996 found an odds ratio for the reduction in risk of prostate cancer in circumcised men to be 0.62 . Table 1 illustrates some recent publications studying the association between male circumcision, stds and prostate cancer . Publications studying the association of circumcision with sexually transmitted diseases and prostate cancer the age standardized incidence rate of prostate cancer is lower in asian countries than in the united states and european countries . However, the incidence rate in asians living in the united states is substantially higher than that in those living in their homelands . Migration studies have shown an increase in prostate cancer incidence in asian men after emigration to the united states . This observation suggests that environmental factors and changes in lifestyles, particularly in dietary practices, can affect the aetiology of prostate cancer . A higher intake of vegetables in the arabic population may be also a factor that contributes to the lower incidence of prostate cancer . A recent study from egypt confirmed higher vegetable intake to be of significant value in reduction of the risk of prostate cancer . A recent systematic review confirmed that a diet low in fat and meat and rich in vegetables and fruits is recommended to lower the risk for prostate cancer . Studied the difference in serum testosterone between arab and german groups of patients with diseases other than prostate cancer and was able to demonstrate a significantly lower level of testosterone in the arab population in the middle age group (<30 years), pointing out that the relatively lower level of serum testosterone in that age group may be protective in the long run . In another study, the same group published the difference in levels of serum testosterone between arabs and american caucasians and reported lower levels o in arabic men in all age groups, with a higher significance in the middle age groups (<30 years). Schistosomiasis is a parasitic disease that is endemic in tropical countries with more than half of the cases located in africa and middle east . Animal studies on the effect of schistosomal infection on the testes confirmed that schistosomal infection results in a significant decrease in the level of serum testosterone [2427]. Another endemic problem that emerged in egypt, secondary to schistosomiasis, is caused by the treatment itself . In the mid20 century, the egyptian ministry of health began to conduct mass treatment in rural areas and for every suspected infection using tartar emetic intravenous injection . At that time, the dangers of exposure to human blood weren't considered and disposable needles and syringes were not available [28, 29]. Frank et al . Reported a direct relationship between parenteral treatment of schistosomiasis and the country wide prevalence of antibodies to hepatitis c infection . Many studies [30, 31] confirmed the association between hepatitis c infection and chronic liver disease with the occurrence of hypogonadotropic hypogonadism manifested by low serum level of gonadotropic hormones and serum testosterone . Table 2 illustrates findings in publications correlating serum testosterone in arabic and western populations . Publications correlating serum testosterone in arabic and western populations serum psa is a widely used parameter for the early detection and monitoring of prostate cancer . In western countries men with total psa <2.5 ng / ml have a low probability of having prostate cancer, while those with psa> 10 ng / ml have> 50% chance of having prostate cancer [3234]. A recent paper from kuwait, demonstrated that for cases with psa> 10 ng / ml, prostate cancer was still of a low probability, with the majority of cases with elevated psa only suffering from prostatitis or bph . They could detected a psa value of> 50 ng / ml to carry 100% specificity for prostate cancer in the arabic population . A recent paper from saudi arabia studying the incidence of prostatic adenocarcinoma in patients admitted to king abdul aziz university hospital showed that prostate cancer was detected in 28.5% of patients with psa> 4 ng / ml, which is considered lower than the expected incidence for their patients median age group of 68 years . Table 3 demonstrates the difference in incidence between the findings in the saudi arabia study with a canadian and a multi institutional studies . Incidence of prostate cancer in different recent studies another arabic study compared age adjusted serum level of psa of the arabic population with that of usa caucasians and the japanese population . They showed that usa whites tend to have the highest total psa, followed by japanese population and finally the lowest psa level, adjusted to age, was present in arabic population . Psa density (psad) is another important parameter that was introduced by benston and colleagues as a useful tool to increase specificity of the detection of prostate cancer . Different cut off values of psad ranging from 0.1 to 0.15 was proposed by urologists aiming to increase the specificity of prostate cancer detection in the grey zone area of total psa level, and thus avoid unnecessary prostatic biopsies [4144]. Contrary to studies on the western population, a recent arabic study, trying to include psad as a mean to avoid unnecessary prostatic biopsy, concluded that in patients with total psa <10 ng / ml, values of psad <0.32 strongly suggest benign disease . The aim of our work was to report the pattern of prostate cancer presentation in alexandria university that as a tertiary referral center, provides care for uro oncology cases . Data collection for all patients diagnosed with prostate cancer at alexandria universityin egypt through the year 2012 was done . All possible information including patients age, clinical presentation, dre findings and serum total psa and prostate volume were evaluated . Analytical analysis was done using two tailed fisher exact test and two tailed unpaired t test . We found 950 patients diagnosed with prostate cancer in our database through the year 2012 . Mean serum total psa, prostate volume and psad were 149 ng / ml, 63 grams and 3.1 ng / ml / gm respectively . The remaining group was presenting with luts, including 23 patients who presented initially with back pain . Patients characteristics only 7 patients were found to fulfill the criteria of low risk prostate cancer namely, psa <10, t1c and gleason grade <7 . Symptomatic patients were significantly associated with finding suspicious nodules during dre (p 0.002) and higher psa density (p 0.01). Psa density of 0.15 did not yield any significant difference between both symptomatic and asymptomatic groups . The median psa density for the whole group was 0.425 . When we used that value as the cutoff value, symptomatic patients had significantly higher psa density values . Table 5 shows the analytical analysis for the studied groups . Analytical analysis for asymptomatic and symptomatic cases only 54 patients (25%) were diagnosed through surveillance programs for prostate cancer (annual total psa and dre) without having any symptoms . Thirty three patients had suspicious findings on dre and 42 patients had serum total psa> 10 ng / ml . The striking features in those groups were the high psa density and that most of the cases (46 patients) had a gleason grade> 6 . Irritative urinary symptoms were the main presenting complaints in our patients and the same findings of markedly higher psa density and higher gleason grade were noted . Using the suggested western psa density value of 0.15 did not give any significant difference between surveillance and symptomatic groups, as the majority of cases had a psa density> 0.15 . We decided to use psa density value of 0.425 as the cut off value, being as it was the median value from the all 216 cases . The surveillance group had 65% of cases with a value <0.425, while the symptomatic group had 46% of patients with values <0.425 (p 0.01). That in the arabic population, a high psa density value up to 0.32 may present benign disease . Our study also confirms the pivotal role of dre in the diagnosis of patients with prostate cancer as 77% of our cases had a suspicious finding during examination . It was clear that patients diagnosed with prostate cancer in egypt, regardless of their mode of presentation and whether screened or not, tend to have a high serum total psa, psa density, abnormal findings on dre and higher gleason grade, reflecting the aggressive nature of prostate cancer in the egyptian population (using the western definitions). A recent paper from nigeria showed that abnormal dre can predict higher gleason grades . Our study shows that prostate cancer may not be a single disease throughout the world and racial, religious and life style conditions may be contributing factors that affect the nature and presentation of the disease . Applying western definitions would mean that nearly all of our cases already had a metastatic and advanced disease, while really only 11% of them had metastatic deposits . Our reports confirm that egyptian men with prostate cancer had higher psa, psa density and higher gleason grade at initial diagnosis and tailored risk stratification may be needed to allow proper management for our cases . Egyptian men with prostate cancer have a markedly high psa density and gleason grade at diagnosis.
The supporting cells of the organ of corti are structurally and electrically coupled together by gap junctions (jahnke, 1975; gulley and reese, 1976; iurato et al ., 1976; hama and saito, 1977; santos - sacchi and dallos, 1983; kikuchi et al ., 1995). Such gap junctional coupling among the supporting cells provides for electrical and metabolic uniformity; cochlear homeostasis is believed to rely on intercellular coupling (santos - sacchi, 1985, 1986, 1991; kikuchi et al ., 1995). Gap junction channels are distinguished from other ionic channels since the integration of two aligned hemichannels from adjacent cells is required for normal function . In early work, hypertonic solutions, which cause cell and tissue shrinkage, were found to uncouple gap junctions in several different preparations (barr et al ., 1965, 1968; goodenough and gilula, 1974; loewenstein et al ., 1967). More recently, hypotonic treatments, which cause cell swelling, were determined to either increase (kimelberg and kettenmann, 1990) or decrease (ngezahayo and kolb, 1990) gap junctional coupling . These effects could have been due to a variety of factors, including direct mechanical influences, changes in nonjunctional resistance, and modulation of intracellular factors that are known to uncouple cells . In the study of ngezahayo and kolb (1990), where junctional conductance was studied directly, the decrease in coupling was abolished by 5 mm egta in nominally ca - free internal solutions, and was linked to the activity of pkc . In the present report, we used the whole - cell voltage clamp technique to examine the effects of turgor pressure on junctional coupling of isolated pairs or small groups of cochlear supporting cells . Both input capacitance (santos - sacchi, 1991; bigiani and roper, 1995) and transjunctional conductance measures were used to gauge intercellular communication . We report that data obtained with both techniques indicate that positive intracellular pressure, which is known to induce membrane tension, uncouples gap junctions of supporting cells in corti's organ . Detailed experimental methods can be found in previous reports (santos - sacchi, 1991; sato and santos - sacchi, 1994). In brief, isolated supporting cells or cell aggregates were freshly obtained from the organ of corti of the guinea pig cochlea by shaking for 515 min in nominally ca - free leibovitz medium containing 1 mg / ml trypsin . To reduce the voltage - dependent ionic currents from nonjunctional membrane during double voltage clamp experiments, cells were perfused with an ionic blocking solution containing (mm): 100 nacl, 20 tea, 20 cscl, 1.25 cocl2, 1.48 mgcl2, 10 hepes, ph 7.2, 300 mosm . In initial experiments, a modified leibovitz medium was used for measurement of input capacitance (cin) with a single pipette voltage clamp containing (mm): 136.9 nacl, 5.37 kcl, 1.25 cacl2, 1.48 mgcl2, 10 hepes, ph 7.2, 300 mosm . Pipette solutions were composed of (mm): 140 kcl, 10 egta or bapta, 2 mgcl2, and 10 hepes, ph 7.2 . For double voltage clamp recording, patch electrodes had initial resistances of 2.54 m, corresponding to 12 m in diameter . Series resistance (rs) after whole cell configuration was estimated from the current in response to 10-mv steps (huang and santos - sacchi, 1993). In single hensen cells, where rs could be unequivocally determined after whole cell configuration, the average value was 7.16 0.43 m (mean sem, n = 48). Cells were typically held at 80 mv, within the hensen cell's linear current voltage range (santos - sacchi, 1991). Currents were filtered at 10 khz with a four - pole bessel filter (axon instruments, foster city, ca). Intracellular pressure was modified either through the patch pipette with a syringe connected to the teflon tubing attached to the patch pipette holder or by changing osmolarity with y - tube pipette pressure was monitored via a t - connector to a pressure monitor (world precision instruments, inc ., all experiments were video tape recorded and performed at room temperature . Since the input capacitance can be measured by a single pipette voltage clamp and is correlated with junctional conductance (santos - sacchi, 1991; bigiani and roper, 1995), it can be conveniently used to study gap junctional coupling under conditions of less cellular damage than the double voltage clamp technique . Input capacitance, in conjunction with input resistance (rin), was continually measured on line to monitor junctional coupling . Cin and rin were determined from the transient charge and steady state current, respectively, induced by small (10 mv) test pulses with duration of 18 the clamp time constant at the holding potential; measures were made at 13 hz (santos - sacchi, 1991). 1\documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0 in \begin{document} \begin{equation}c_{in}=\frac{q_{in}}{v_{test}}\end{equation}\end{document}2\documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0 in \begin{document} \begin{equation}r_{in}=\frac{v_{test}}{{\delta}i_{{\infty}}},\end{equation}\end{document} where 3\documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0 in \begin{document} \begin{equation}q_{in}={\int _ {0}^{{\infty}}}i_{c}dt.\end{equation}\end{document} qin is the charge moved, vtest is the voltage of the test pulse, ic is the capacitive current induced by the test pulse, and i is the current difference between the steady state current induced by the test pulse and the holding current at the holding potential . For the double voltage clamp, each cell in a cell pair was separately voltage clamped using 200a and 200b patch clamps (axon instruments). Both cells were clamped at the same holding potentials and a test pulse (10 mv, 10 ms) superimposed only on cell 1 . The transjunctional current (ij) is equal to the current difference (i2) in cell 2 caused by the test pulses applied to cell 1 . The transjunctional conductance (gj) can be calculated by: 4\documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0 in \begin{document} \begin{equation}g_{j}=\frac{-{\delta}i_{2}}{v_{test}},\end{equation}\end{document} where vtest is the test pulse voltage applied to cell 1 . Data collection and analysis were performed with an in - house developed windows - based whole - cell voltage clamp program, jclamp (http: //www.med.yale.edu / surgery / otolar / santos / jclamp.html), using a digidata 1200 board (axon instruments). In some experiments, gj was measured online at 24 hz and the corresponding video images of recorded cells were digitally captured every 510 s under software (jclamp) control . The captured images were printed at 1,700 and the plane cell areas calculated . To gauge membrane stress, area strain (a / a0) was calculated, where a is the change of cell area after pressure or osmotic treatment and a0 is the original cell area . Hensen cells can be easily distinguished from other inner ear supporting cells by their prominent lipid vacuoles . The number of cells comprising isolates of hensen cells can be determined under the light microscope, and corresponds to the isolate's cin since hensen cells are well coupled electrically . Although the size of hensen cells is variable, the distributions of cin for one, two, and three hensen cells, whose numbers were visually confirmed, were quite distinct (fig . The peaks of the isolate distributions were clearly separated at 31.03 0.86, 64.75 1.5, and 103.9 3.05 pf, corresponding to one, two, and three cell contributions, respectively . The number of cells within isolates can also be confirmed using uncoupling agents, such as co2, octanol, or, as we now find, positive turgor pressure, to uncouple the cells . When cells fully uncoupled, cin reached single cell capacitance levels (e.g., figs . 2 and 3). The correlation of cin with degree of cell coupling is illustrated by real measures of cin in a coupled two - cell electrical model (fig . Cin of the electrical model was a monotonic function of transjunctional resistance or conductance, indicating the validity of cin as an indicator of cell coupling . Positive turgor pressure induced either by osmolarity changes or directly via the patch pipette decreased cin of cell pairs or three - cell groups (figs . 2 and 3), but did not reduce single cell capacitance (fig . This indicates that positive turgor pressure uncouples gap junctions between adjacent hensen cells . In fig . 2 a, bath application of hypo - osmotic solution (150 mosm) caused a hensen cell pair to swell (insets) and decreased cin of the pair to single cell levels . The uncoupling induced by increased turgor pressure is reversible since return to normal osmolarity solution often restored initial cin values; subsequent reperfusion with hypo - osmotic solution remained effective as an uncoupling stimulus (fig . 2 b). In single cells, while the same hypo - osmotic treatment caused cell swelling, cin remained stable (fig . 4 b). 3 illustrates the uncoupling effect of cell turgor pressure change induced by patch pipette pressure . As turgor pressure was directly increased to 1.2 kpa via the patch pipette, cin decreased to almost single cell levels (after an initial delay possibly due to pipette plugging), and immediately began to return when the pressure was released (fig . The cells could be permanently uncoupled during the application of prolonged, continuous positive pressure (fig . The uncoupling effect of positive turgor pressure was found in 40 of 42 cell pairs, or three - cell groups . As with osmolarity change, direct application of positive turgor pressure via the patch pipette also did not decrease the measured capacitance in single hensen cells despite cell swelling (fig . 4 a, insets). Although cin can be easily measured by single pipette voltage clamp to gauge the degree of cell coupling, transjunctional conductance cannot be measured directly since transjunctional voltage and current are unknown . Additionally, a quantitative estimate of degree of coupling based on cin is not easily established since cin is a nonlinear function of transjunctional conductance (see fig to further investigate the uncoupling effect of positive turgor pressure on gap junctions in hensen cells, the transjunctional conductance was directly assessed with a double voltage clamp technique, and corresponding changes of the cell plane surface areas (a / a0) (i.e., an indicator of membrane strain) were simultaneously measured . Cell areas increased in concert with decreases of transjunctional conductance as positive turgor pressure was delivered to the cells . The changes in cell area were observable before gap junctional uncoupling and occurred faster than gj decay (figs . 5 and 6). However, unlike pressure changes induced by pipette pressure, hypo - osmotic shocks produced changes in gj and cell areas that were quite fast . With extracellular perfusion of a 150-mosm solution, 6 b, and the average value was 5.1 1.86 s (n = 6). In fig . 6 b, the rise time constant of membrane strain was 4.43 s. the average rise time constant of membrane strain is estimated to be close to or less than that of the average gj decay since in most cases the swelling fully occurred within the 510-s video capture rate . In most, but not all, cases, it was noted that after membrane tension stabilized, transjunctional conductance likewise stabilized (fig . The correlated and reciprocal changes in gj and membrane strain (a / a0) were reversible and repeatable (fig . 6 a), strongly indicating that gj decreases were relative to increases of membrane strain; i.e., membrane tension . It should be noted that the latency to gj change after a/ a0 change is possibly due to the absence of significant membrane stress during the initial cell inflation, which clearly (based on the magnitude of cell enlargement) was accompanied by membrane unfolding . Uncoupling of hensen cell gap junctions by membrane stress was not inhibited by using pipette solutions containing 50 m h-7 (dihydrochloride; calbiochem corp ., la jolla, ca), a broad - based serine / threonine kinase inhibitor (boulis and davis, 1990) (figs . These data imply that the uncoupling effect of positive turgor pressure on inner ear gap junctions is independent of protein kinases, and that the effect is different from previous observations that cell volume changes induced uncoupling of gap junctions via the pkc pathway (ngezahayo and kolb, 1990). Nevertheless, cell swelling induced by hypo - osmotic shocks has been linked to increases of another uncoupling agent, intracellular ca (hoffmann and simonsen, 1989; suzuki et al ., however, uncoupling by ca, which occurs at millimolar intracellular concentrations in hensen cells (sato and santos - sacchi, 1994), can be ruled out since pipette solutions contained 10 mm bapta, a fast highly selective calcium chelating reagent, and extracellular and intracellular solutions were nominally ca free . Considering all evidence, the observed uncoupling effect of positive turgor pressure on inner ear gap junctions, which is fast (within seconds), correlated with changes of membrane strain, and independent of protein kinases and ca, is likely to occur via direct mechanical effects on the plasmalemma; i.e., membrane tension . The effect of membrane tension on gap junctional conductance was further studied by increasing turgor pressure in cell 1 and measuring ij in cell 2 at different membrane potentials (fig . Gap junctional conductance in hensen cells at a holding potential of 80 mv was 52.9 12.1 ns (n = 51). As the turgor pressure in cell 1 was increased, ij decreased (fig . 7 a). The junctional conductance at different membrane potentials reduced in parallel when the turgor pressure was increased . In those cell pairs where turgor pressure alterations were successfully applied without losing the cells, gj at 80 mv holding potential decreased 38.3 9.5% from 50.5 14 ns (n = 9) at a turgor pressure of 1.41 0.05 kpa . 7 . In this case, as the cells were depolarized, gj decreased (fig . 7 b). Other vm dependencies of transjunctional conductance were also found, including vm insensitivity and an increase with depolarization . We provide evidence, based on input capacitance and double voltage clamp measures, that junctional coupling is sensitive to positive turgor pressure - induced membrane tension . Turgor pressure has been used to induce membrane tension in a wide variety of cells, including the outer hair cell (ohc), where it has been shown that motility and motility - related gating current characteristics are directly altered (iwasa, 1993; gale and ashmore, 1994; kakehata and santos - sacchi, 1995). Membrane tension (possibly acting via cytoskeletal interactions) is also known to gate stretch - activated ionic channels (yang and sachs, 1989), which have been observed in outer hair cells (ding et al ., 1991; iwasa et al ., it is possible that membrane tension also alters gating characteristics of supporting cell gap junctions . We show, however, that unlike stretch channels, inner ear gap junctional conductance decreases with membrane stress . Recently, it has been postulated that gap junction channels possess two distinct gating mechanisms, namely, a voltage gating mechanism and a chemical gating mechanism (bukauskas et al ., 1995; bukauskas and peracchia, 1997; chemical uncoupling agents, such as co2, h, and ca, may act on sensor elements from the cytoplasmic side . Supporting cell coupling has been shown to be sensitive to a variety of chemical uncoupling agents (santos - sacchi, 1985; 1991), and we now report that supporting cell coupling is voltage dependent as well . The existence of voltage - dependent gap junctional conductance may account in part for previous reports of temperature - induced depolarization on supporting cell coupling ratios (santos - sacchi, 1986). Interestingly, junctional voltage dependence is unaffected by concomitant tension - induced junctional conductance change, possibly indicating that an independent tension gating mechanism may exist . Gap junctions consist of two aligned transmembrane hemichannels (connexons), one from each cell (revel et al ., 1984; goodenough et al ., 1988; bennett et al ., 1991). Each of these hemichannels is formed by six connexin subunits (kumar and gilula, 1996; perkins et al ., 1997). Our data indicate that membrane stress acts on inner ear gap junctions in a manner independent of ca, ph, and protein kinases . The rapid and reversible nature of the uncoupling also indicates that the mechanism is not due to some sort of mechanical destruction of the channels . While there may be other unknown links between membrane stress and junctional conductance, it is conceivable that tension may gate gap junction channels by a conformational change in connexon structure, possibly causing only the stressed membrane's hemichannel to close . Gap junction connexins represent a family of homologous proteins that have differing voltage gating characteristics (harris et al ., 1981; spray et al ., 1981; bennett et al ., 1991 cx26 was found in gap junctions of the rat (kikuchi et al ., 1995) and gerbil (forge et al ., 1997) more recently, cx26, cx30, cx32, and cx43 have been localized to supporting cell regions of the rat cochlea (lautermann et al ., 1997). Such diversity of connexins within the organ may provide for a variety of junctional communication characteristics; for example, rectifying junctional conductance . Indeed, in addition to our direct observation that voltage - dependent junctional communication exists in the supporting cells, we have preliminary evidence that junctional rectification occurs . Directional flow of ions mediated by rectified gap junctions may be crucial for normal cochlea homeostasis (see below). Since the mid 1980's, gap junctional coupling however, input capacitance and resistance reflect the degree of electrical coupling and can be conveniently measured using a single voltage clamp (santos - sacchi, 1991; sato and santos - sacchi, 1994; bigiani and roper, 1995). . 1 b, inset), and assuming that the individual cells have the same input impedance, the following equations are obtained (bigiani and roper, 1995), 5\documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0 in \begin{document} \begin{equation}c_{in}=\frac{(2r_{m}r_{j}+2r^{2}_{m}+r^{2}_{j})r^{2}_{m}}{(2r_{m}r_{s}+r^{2}_{m}+r_{s}r_{j}+r_{m}r_{j})^{2}}c_{m},\end{equation}\end{document}6\documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0 in \begin{document} \begin{equation}r_{in}=\frac{r_{s}r_{j}+2r_{s}r_{m}+r_{j}r_{m}+r^{2}_{m}}{r_{j}+2r_{m}},\end{equation}\end{document} where rs and rm are electrode series resistance and nonjunctional membrane resistance, respectively, and cm is single cell capacitance (see fig since rm is not readily available from recordings, we can solve eqs . 5 and 6 to remove rm . Rj can be finally expressed: 7\documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0 in \begin{document} \begin{equation}r_{j}= \left{\mid} \frac{c_{in}r^{2}_{in}+4c_{m}r_{s}r_{in}-2c_{m}r^{2}_{s}-2c_{m}r^{2}_{in}}{\sqrt{2c^{2}_{m}r_{s}r_{in}+c_{in}c_{m}r^{2}_{in}-c^{2}_{m}r^{2}_{s}-c^{2}_{m}r^{2}_{in}}} \right{\mid}.\end{equation}\end{document} cin, rin, and rs are readily obtained from recordings . 8 illustrates the measurement of these parameters during an uncoupling event, and the bottom panel shows the estimated gj based on those data . It should be noted that rs changes can also produce changes in cin and rin . For example, to obtain the observed maximum change in cin, an order of magnitude increase of rs would be required in this case . In our experiments, changes solely in rs required to produce a comparable change in cin were not observed . Series resistance remained constant, being 7.79 0.49 m (n = 7) for cell pairs that were well coupled and 6.34 1.13 m after those same cells were uncoupled with positive pipette pressure . Finally, how might the turgor pressure dependence of junctional coupling in the organ of corti affect cochlear function? In vivo, the organ of corti, comprising hair cells and supporting cells, is bathed in two different media, high k endolymph apically and low k perilymph basally . Since the receptor current through hair cells is predominantly carried by k, an accumulation of k within the perilymphatic space along the basolateral region of the hair cells is unavoidable . This would potentially depolarize hair cells with disastrous consequences for both forward and reverse sensory transduction . In the mammal, forward transduction (gating of stereociliar transduction channels) relies on the large driving force present across the hair cell's apical plasma membrane . Voltage gradients across the apical membranes of inner and outer hair cells (i.e., endolymphatic potential minus membrane potential) range from 125 to 150 mv, and drive the k - based receptor currents . Reduction of this gradient (e.g., by membrane depolarization) will reduce the magnitude of receptor potentials and synaptic output . Reverse transduction is a phenomenon that is restricted to the outer hair cell and is believed to provide for the enhanced high frequency selectivity and sensitivity enjoyed by mammals . Ohcs, which are additionally mechanically active, possess lateral membrane motors that are driven by voltage (santos - sacchi and dilger, 1988); the cell's mechanical response provides feedback into the basilar membrane, thereby enhancing the stimulus to the primary receptor cells, the inner hair cells (for review see ruggero and santos - sacchi, 1997). Not only will depolarization of the ohc alter the driving force for the mechanical response, but the function relating mechanical response to voltage will be shifted along the voltage axis as well, resulting in an altered gain for the cochlear amplifier (santos - sacchi et al ., 1998). A nutritive and k sinking role for gap junctions in the avascular organ of corti has been proposed (santos - sacchi, 1985, 1991; santos - sacchi and dallos, 1983). Inner ear supporting cells have been shown to share plasmalemmal voltage - dependent conductances due to the high degree of cell coupling (santos - sacchi, 1991). The magnitude and stability of their resting potentials is pronounced (close to 100 mv), and likely depends on cell coupling since isolated cell resting input conductance is only 1 ns . At the normal resting potential of this cellular syncytium, an inward rectifier appears continuously activated and may result in k removal from perilymphatic spaces . It should be noted that the large perilymphatic fluid spaces may provide little support in sinking k or directing its movement, since hair cell regions that are likely to experience k elevations are not directly exposed to those spaces . Inner hair cells are closely surrounded by supporting cells, and the region of the ohcs that possesses voltage - dependent conductances (e.g., outward k) is restricted to the basal pole of the cell (santos - sacchi et al ., 1997), which is surrounded by a deiters cell cup . (1995) provided morphological evidence detailing epithelial and connective tissue gap junctional systems within the cochlea that may complete the mechanism responsible for recycling k from the perilymphatic space near hair cells to the k - rich endolymph via the stria vascularis . The maintenance of normal fluid space architecture within the inner ear requires fine osmotic control; imbalances can lead to serious auditory and vestibular problems (e.g., meniere's disease). While at present we do not know the normal physiological significance of tension - dependent gap junctional communication, it is likely that fluid balance disorders in the inner ear will affect gap junctional communication, thus compromising sensory function by indirectly modifying hair cell activity . The cell numbers (1, 2, or 3) in the isolates were determined under the light microscope, and the cin was obtained at the holding potential 80 mv . Each bar represents the number of isolates within a bin width of 10 pf . The lines plotted over each histogram represent the fitted gaussian distribution for the three isolate groups . (b) cin was measured for a coupled two - cell electrical model as transjunctional resistance (rj) was changed . Rs, 4.7 m; rm, 500 m; cm, 33 pf . (a) when an extracellular 150 mosm solution was perfused (indicated by the horizontal bar) the cell pair swelled (see insets). Rs, 6.5 m. (insets) captured cell images before and during the perfusion of the hypo - osmotic solution . (b) decreases of cin due to hypo - osmotic challenge were reversible and repeatable . In this case, the cells finally fully uncoupled and cin remained at the single cell capacitance level . Rs, 3.8 m. hensen cells uncouple as turgor pressure is directly increased via the patch pipette . (a) in this example, increased pipette pressure caused cin to decrease to single cell levels after an initial delay (possibly due to pipette plugging), but returned to the original level soon after pipette pressure was released . Rs, 9.76 m. (b) a hensen cell pair uncoupled after prolonged application of pressure . Rs, 8.5 m. changes of turgor pressure caused either directly via the patch pipette (a) or by perfusion of hypo - osmotic solutions (b) do not decrease the measured capacitance in a single hensen cell . Rs: (a) 8.4 m, (b) 4.4 m. positive turgor pressure - induced reduction in transjunctional conductance is correlated with increases in membrane strain (a / a0). Transjunctional conductance was measured with a double voltage clamp technique, and membrane strains were calculated from captured images (see methods). (a) positive pipette pressure induced an increase in membrane strain and concomitantly reduced gj . (b) perfusion of 150 mosm solution also induced an increase in membrane strain and concomitantly reduced gj . (a) hypo - osmotic solutions induced reversible, concomitant changes in transjunctional conductance and membrane strain . (b) the time course of the uncoupling effect caused by hypo - osmotic shock is compared with the increase of membrane strain . The beginning of treatment is indicated by an arrow and continued during the observed period . Turgor pressure does not affect membrane potential (vm or vi - o) dependence of gap junctions in hensen cells . (a) voltage stimulus protocols for each cell and current trace recorded in cell 2 are plotted (only five traces are shown for clarity). Each cell in a hensen cell pair was separately voltage clamped at the same holding potential of 80 mv . Voltage steps from 140 to 70 mv for 100 ms in 10-mv increments were simultaneously delivered into both cells except for 10 mv, 10-ms test pulses superimposed on cell 1 only . Three current traces from cell 2 at different pressures were zeroed and superimposed in the middle . Rs at 0 kpa, 12.5 m; at 1.2 kpa, 12.7 m; at 2 kpa, 12.2 m. transjunctional conductance is estimated by cin and rin in single pipette voltage clamp . Rs, 8.73 m. (bottom) gj is estimated from cin and rin measurements from the cell pair data based on the coupled two - cell model . Cm was set as half of cin, 27.5 pf, at zero applied pressure, and rs was 8.5 m. the change in estimated gj corresponds well to changes in cin . The magnitude of gj is larger than the largest obtained under double voltage clamp (500 ns), and may be due to the fact that cell impedances are not actually identical as required in the model.
Delirium caused by somatic factors is a widespread and dangerous problem associated with the aging of the population . It has been reported that consciousness disorders are experienced by 10 - 15% of patients on general wards and up to 50% of patients admitted emergently to geriatric wards . The frequent occurrence of delirium stems from the commonness and number of risk factors for this complication, which include, among others: old age, organic injury of the central nervous system, alcoholism, malnutrition, chronic somatic diseases, chronic pain and analgesic treatment, long - term insomnia, electrolyte disorders, blood loss, dehydration, cognitive impairments, depression, metabolic disorders, use of psychoactive agents, immobility, urinary catheterization, and numerous factors associated (directly or indirectly) with surgical procedures [14]. One - year mortality of delirium in the population of intensive care unit patients is estimated to be around 40% [5, 6]. One should keep in mind that, although qualitative disorders of consciousness are reversible and transient, they directly precede the patient's death in 88% of cases . Persisting symptoms of delirium result in growing motor agitation, disorganization, and anxiety, which increases the risk of injury or self - harm, necessitates parenteral nutrition and the maintenance of water balance, and impedes cooperation, thus worsening the course and prognosis of the underlying disease . Consciousness disorders are believed to be among the most challenging diagnostic problems and the most difficult therapeutic problem among psychotic disorders . Differential diagnosis typically considers dementia as well as maniacal, paranoid, and delusional syndromes . A particular diagnostic challenge is presented by hypoactive delirium, which is often confused with depression, depressive stupor, catatonia, or apathetic - abulic syndromes . Retrospective studies state that this form of delirium with poor motor activity is observed in the decided majority of cases of delirium in old patients; its frequency correlates with the deterioration of the patient's general condition . These data indicate an obvious need for improving the diagnostics of consciousness disorders on somatic wards, especially those employing surgical procedures . In 1990, a new diagnostic tool for mid - level medical personnel was developed; the purpose of the confusion assessment method (cam) is the early detection of somatically induced delirium . Numerous studies conducted over the period of 16 years established cam's position as an effective standardized diagnostic tool; its sensitivity was estimated at 94 - 100%, specificity: 90 - 95%, positive predictive value: 91 - 94%, and negative predictive value: 90 - 100% . Therefore, the cam questionnaire had been translated into 10 languages by 2008; it is widely used in japan, germany, finland, denmark, france, italy, spain, portugal, turkey, china, and other countries . The aim of this article is to present the polish version of this screening diagnostic tool . The cam questionnaire consists of 9 points with questions verifying the presence of: acute changes in mental status, attention disorders, disorganized thinking, altered level of consciousness, disorientation, memory impairment, perceptual disturbance, psychomotor agitation or retardation, and sleep - wake cycle disturbances . The questions require the respondent to evaluate the severity and dynamics of the symptoms; space is also provided for descriptive comments . Most questions pertain to information that can be acquired during a single patient examination; answers to the first and last question require information concerning the patient's stay, which can be gathered from the patient's records or the attending medical personnel . The preliminary diagnosis of delirium only requires answers to the first five questions, constituting the so - called short form of cam . In order to interpret the questionnaire's results, it is necessary to be acquainted with the scoring manual, which has also been translated in this article . The aim of the authors was to provide a translation that would correspond to the intentions of the questionnaire's original creators to the largest degree possible . Therefore, the original authors were invited to actively cooperate on the project . After receiving approval from professor sharon k. inouye, the director of the aging brain center, the first stage of work on the translation began: two independent translation groups were formed, each consisting of three physicians, including one psychiatrist . The first group translated the original text into polish, while the second group translated the new polish text back into english without knowing the original version . Subsequently, the return translation was sent to the authors of the original questionnaire . Based on their concerns and suggestions, the final version was modified twice before receiving full approval of the original questionnaire's authors . The new polish version of cam was accepted for publication among the other official translations on the help webpage: (http://www.hospitalelderlifeprogram.org/uploads/disclaimers/cam_polish.pdf). Apart from cam, other tools for consciousness disorder screening are used around the world, including the delirium symptom interview (dsi), the neecham confusion scale, the delirium observation screening (dos) scale, the cognitive test for delirium (ctd), and the descard tool used in poland . Among these tools, evaluation using the cam questionnaire can be performed by any member of the medical staff based on the instructions contained within the cam training manual . The tool has already been translated into 10 languages and is being used in 10 non - english speaking countries . It can be suspected that introducing the cam scale into everyday practice in poland will also facilitate the diagnostics of consciousness disorders; however, one should keep in mind that evaluation using a questionnaire is only a screening tool, and one should always strive to confirm its preliminary diagnosis with a clinical examination, preferably conducted by a consulting psychiatrist . The questionnaire has been translated by physicians with active support provided by staff members of the aging brain center, the creators of the original version . The polish translation still requires validation on somatic wards as well as further studies to determine its effectiveness and sensitivity in clinical conditions . The first obtained data indicate that the polish version of cam is characterized by good diagnostic accuracy, but its usefulness in everyday practice requires further studies with more precise validation of the questionnaire in clinical conditions.
Fixed drug eruption (fde) is characterized by recurrent well - defined lesions in the same location each time the responsible drug is taken . We report here a rare case of fde induced by atenolol, a beta - adrenoreceptor - blocking agent . A 48-year - old tunisian woman was referred to our department for the appearance of five inflammatory plaques on both legs . She had been treated for hypertension with atenolol (hypoten, al - hikma pharmaceuticals, jordan) 100 mg once a day for six weeks . No other medications had been taken and she had not previously received beta - blocking agents . Physical examination revealed five well - demarcated reddish and round plaques with an itching and burning sensation on both legs (figure 1). Skin biopsy, taken from a lesion with no vesicular changes, showed focal necrosis of keratinocytes, hydropic degeneration of the basal cells, dermal edema and a perivascular lymphocytic infiltrate of the upper dermis . Topical desonide (locatop) was applied twice a day and skin lesions resolved within two weeks with a residual pigmentation . 6 weeks after complete resolution, patch testing was carried out according to the international contact dermatitis research group (jacobs et al 1999) recommendations with 10% atenolol in petrolatum on a previously affected site of the right leg (figure 2) and on normal skin of the back . A positive reaction (+ +) was seen at d2 and d3 on the left leg but no reaction was detected on the back . They mostly include nonsteroidal antiinflammatory drugs, nonopioid analgesics, sulphonamides, and tetracyclines (savin 2001). Topical provocation testing has been reported to be useful and safe for the diagnosis of fde when applied on previously affected sites (alanko et al 1987; alanko 1994; lee 1998; ozkaya - bayazit et al 1999). Different patch test methods (open / occlusive) and variations in their evaluation (erythema of more than six hours duration / erythema and infiltration) exist (ozkaya 2008). Beta - blockers - induced fde are very rare (palungwachira and palungwachira 1999; zaccaria et al 2006). Only two cases have been reported in the literature (palungwachira and palungwachira 1999; zaccaria et al 2006). They were induced by atenolol (palungwachira and palungwachira 1999) and propranolol (zaccaria et al 2006). None of them was confirmed by patch testing or systemic provocation (palungwachira and palungwachira 1999; zaccaria et al 2006). Thus, to the best of our knowledge, we report herein the first case of fde induced by atenolol and confirmed by a positive patch test on previously affected sites.
Natural orifice translumenal endoscopic surgery (notes) has developed rapidly in recent years, and transvaginal cholecystectomy has been successfully performed in humans . Researchers are actively evaluating different peritoneal accesses and development of novel instruments and innovative procedures . There have been few reports, however, on the immunological effects of notes . In the development of laparoscopic surgery laparoscopic procedures are associated with less host inflammatory response compared with that in open surgery . In addition, a more favorable cellular and humoral immunological response has been observed in laparoscopic colorectal resection in terms of a lower level of circulating il-6 and tnf-. Theoretically, with the lower degree of trauma induced by notes, a lower peri - operative proinflammatory response would be expected . In the current study, we aimed at analyzing the systemic inflammatory responses associated with transvaginal cholecystectomy in a porcine model . This study, using transvaginal cholecystectomy in the porcine model, was carried out in the animal laboratory, department of surgery, university of hong kong . The pigs, weighing 30 kg to 35 kg, were cared for by a registered veterinarian working in our laboratory before and after the procedures . Before the experiment, the pigs were housed in a large animal care facility and were maintained in an environment of 201c . They were quarantined and allowed to acclimatize in the animal facility for a minimum of 1 week before being used . All animals were given a standard diet and water ad libitum until the time of the experiment . The study was approved by the committee on the use of live animals in teaching and research of the university of hong kong . All experiments conducted in pigs followed the animal welfare guidelines for the care and use of laboratory animals . Six female pigs were used for the survival study after transvaginal cholecystectomy performed with endoscopic submucosal dissection (esd) instruments and a single - channel endoscope . Preparation was the same as in the pigs used for transvaginal cholecystectomy except that no operation was performed and anesthesia was reversed 180 minutes after induction . All pigs were fasted overnight before the procedure and were given 0.5 mg / kg ketamine and 1.2 mg atropine sulphate by intramuscular injection as a premedication before anesthesia . An ear vein was used for injection of 0.5 mg / kg of dormicum, 0.1 mg / kg of pavulon, and 0.01 mg / kg fentanyl for induction . The trachea was intubated with a cuffed endotracheal tube using an illuminated laryngoscope with an extra - long blade . Periodic injection of pavulon and fentanyl was used to ensure adequate anesthesia and muscle relaxation . On completion of the operation, 1 mg of neostigmine and 1.2 mg of atropine were used for anesthesia reversal, and the pigs were extubated . Ampicillin in a dose of 500 mg was injected intravenously just before the procedure and continued for 5 days every 8 hours . Buprenorphine 0.05 mg / kg to 0.2 mg / kg was given every 12 hours for 3 days after the operation for pain control . The pigs were sacrificed with 200 mg / kg of pentobarbital sodium 2 weeks after the experiment . All operating instruments were sterilized according to the standard autoclave protocol, whereas the endoscope was disinfected by immersing it for 20 minutes in 2.4% glutaraldehyde (cidex, johnson and johnson, new brunswick, nj) and then rinsed with sterile water . The peritoneal access and cholecystectomy were performed with a single - channel endoscope (gif - q240x, olympus optical co, ltd, tokyo, japan). The skin was prepared with povidone - iodine solution, and the vagina was irrigated with the same solution . A veress needle was inserted for creation of carbon dioxide pneumoperitoneum and maintenance of intraperitoneal pressure at 12 mm hg . The urogenital sinus was cannulated with the endoscope, and the vagina cavity was entered . After the cervix was identified, 2 approaches were used for accessing the peritoneal cavity: (1) the anterior vaginal wall was dissected with a hook knife (olympus optical co, ltd, tokyo, japan), and air was insufflated during colpotomy to maintain an optimal endoscopic view; the entrance to the peritoneal cavity was recognized by a sudden increase in monitored intraperitoneal pressure, and the hook knife then served as a guidewire for insertion of the endoscope into the peritoneal cavity: (2) the endoscope was passed beyond the cervix to enter the retroperitoneal plane, and the peritoneum was incised using a hook - knife to gain access to the peritoneal cavity . The endoscope was then manipulated so that minimal looping would be created and an end - on view of the cystic duct could be achieved . The gallbladder was retracted cranially and laterally . The covering peritoneum was incised and dissected using a combination of hook knife and hot biopsy forceps . After the cystic duct and artery were isolated, both were clipped together with endoscopic hemoclip (olympus optical co, ltd, tokyo, japan) and divided with endoscopic scissors (olympus). The gallbladder was then dissected from its liver bed by using a hook knife or it (insulated tip) knife, or both, (olympus optical co, ltd, tokyo, japan) with pd-60 and endoplasma (olympus optical co, ltd, tokyo, japan) where appropriate . Use of the it knife was advantageous as it could protect the liver from diathermy injury and minimize the chance of accidental gallbladder perforation . After clearing accumulated intraperitoneal fluid by suction via the endoscope, the gallbladder was grasped with either a pair of biopsy forceps or an endoscopic snare under direct vision . Porcine serum was prepared by centrifuging the clotted blood for 10 minutes at 3000 rpm, and the serum was then stored in aliquots at -80c . After collecting all specimens required for experimentation, tnf- and il-6 were quantitatively measured by the elisa method [r&d systems (quantikine), minneapolis, mn, usa]. The colored product formed at the end of assays was measured according to the manufacturer's instructions, and the concentrations of tnf- and il-6 were subsequently determined from their standard curves . The differences between operated on and control groups were determined by using the one - way anova test . All statistical analysis was calculated using spss for windows version 11.5 (chicago, il) (tables 1 and 2). Six female pigs were used for the survival study after transvaginal cholecystectomy performed with endoscopic submucosal dissection (esd) instruments and a single - channel endoscope . Preparation was the same as in the pigs used for transvaginal cholecystectomy except that no operation was performed and anesthesia was reversed 180 minutes after induction . Six female pigs were used for the survival study after transvaginal cholecystectomy performed with endoscopic submucosal dissection (esd) instruments and a single - channel endoscope . Preparation was the same as in the pigs used for transvaginal cholecystectomy except that no operation was performed and anesthesia was reversed 180 minutes after induction . All pigs were fasted overnight before the procedure and were given 0.5 mg / kg ketamine and 1.2 mg atropine sulphate by intramuscular injection as a premedication before anesthesia . An ear vein was used for injection of 0.5 mg / kg of dormicum, 0.1 mg / kg of pavulon, and 0.01 mg / kg fentanyl for induction . The trachea was intubated with a cuffed endotracheal tube using an illuminated laryngoscope with an extra - long blade . Periodic injection of pavulon and fentanyl was used to ensure adequate anesthesia and muscle relaxation . On completion of the operation, 1 mg of neostigmine and 1.2 mg of atropine were used for anesthesia reversal, and the pigs were extubated . Ampicillin in a dose of 500 mg was injected intravenously just before the procedure and continued for 5 days every 8 hours . Buprenorphine 0.05 mg / kg to 0.2 mg / kg was given every 12 hours for 3 days after the operation for pain control . The pigs were sacrificed with 200 mg / kg of pentobarbital sodium 2 weeks after the experiment . All operating instruments were sterilized according to the standard autoclave protocol, whereas the endoscope was disinfected by immersing it for 20 minutes in 2.4% glutaraldehyde (cidex, johnson and johnson, new brunswick, nj) and then rinsed with sterile water . The peritoneal access and cholecystectomy were performed with a single - channel endoscope (gif - q240x, olympus optical co, ltd, tokyo, japan). The skin was prepared with povidone - iodine solution, and the vagina was irrigated with the same solution . A veress needle was inserted for creation of carbon dioxide pneumoperitoneum and maintenance of intraperitoneal pressure at 12 mm hg . The urogenital sinus was cannulated with the endoscope, and the vagina cavity was entered . After the cervix was identified, 2 approaches were used for accessing the peritoneal cavity: (1) the anterior vaginal wall was dissected with a hook knife (olympus optical co, ltd, tokyo, japan), and air was insufflated during colpotomy to maintain an optimal endoscopic view; the entrance to the peritoneal cavity was recognized by a sudden increase in monitored intraperitoneal pressure, and the hook knife then served as a guidewire for insertion of the endoscope into the peritoneal cavity: (2) the endoscope was passed beyond the cervix to enter the retroperitoneal plane, and the peritoneum was incised using a hook - knife to gain access to the peritoneal cavity . The endoscope was then manipulated so that minimal looping would be created and an end - on view of the cystic duct could be achieved . The gallbladder was retracted cranially and laterally . The covering peritoneum was incised and dissected using a combination of hook knife and hot biopsy forceps . After the cystic duct and artery were isolated, both were clipped together with endoscopic hemoclip (olympus optical co, ltd, tokyo, japan) and divided with endoscopic scissors (olympus). The gallbladder was then dissected from its liver bed by using a hook knife or it (insulated tip) knife, or both, (olympus optical co, ltd, tokyo, japan) with pd-60 and endoplasma (olympus optical co, ltd, tokyo, japan) where appropriate . Use of the it knife was advantageous as it could protect the liver from diathermy injury and minimize the chance of accidental gallbladder perforation . After clearing accumulated intraperitoneal fluid by suction via the endoscope, the gallbladder was grasped with either a pair of biopsy forceps or an endoscopic snare under direct vision . Porcine serum was prepared by centrifuging the clotted blood for 10 minutes at 3000 rpm, and the serum was then stored in aliquots at -80c . After collecting all specimens required for experimentation, tnf- and il-6 were quantitatively measured by the elisa method [r&d systems (quantikine), minneapolis, mn, usa]. The colored product formed at the end of assays was measured according to the manufacturer's instructions, and the concentrations of tnf- and il-6 were subsequently determined from their standard curves . The differences between operated on and control groups were determined by using the one - way anova test . All statistical analysis was calculated using spss for windows version 11.5 (chicago, il) (tables 1 and 2). Twelve female pigs were used for the present study in which 4 were assigned to the control group without intervention after general anesthesia with the same protocol previously mentioned (c). Two pigs underwent laparoscopic cholecystectomy (l), and 6 pigs underwent notes transvaginal cholecystectomy with a single - channel endoscope and esd instruments (n). In all 6 pigs in the treatment group, satisfactory control of the cystic complex was achieved, and no major intraoperative complications occurred . The mean operating time for the notes group was 123 minutes (range, 92 to 175). The mean preoperative il-6 was 59.54 pg / ml for the control group (c), 63.5 pg / ml for the laparoscopic group (l), and 50.47 for the notes group (n) (p=0.897). Day 1 postoperative il-6 levels were 67.31 pg / ml (c), 68.68 pg / ml (l), and 57.37 pg / ml (n), respectively (p=0.790). Postoperative day 2 il-6 levels were 59.67 pg / ml (c), 54.07 pg / ml (l), and 57.54 pg / ml (n) (p=0.945). Similarly, no significant difference was noted in mean preoperative tnf-: 79.94pg / ml for the control group (c), 82.68 pg / ml for the laparoscopic group (l), and 53.99 for the notes group (n) (p=0.349). Mean postoperative day 2 tnf- levels were 69.19 pg / ml (c), 105.12 pg / ml (l), and 63.29 pg / ml (n) (p=0.11). But there was a significant increase in postoperative day 1 tnf- level in the laparoscopic group compared with the control and notes groups: 63.53 pg / ml (c), 93.83 pg / ml (l), and 50.59 pg / ml (n) (p=0.049). For the past 2 decades, laparoscopic surgery has been shown to be associated with less postoperative pain and faster postoperative recovery . This is usually attributed to the small incision, less manipulation, and avoidance of exposure of internal viscera during laparoscopic surgery . Together with the improved operative outcomes, the minimally invasive approach is merited with triggering fewer inflammatory responses in the patient . Inflammatory cytokines, as an indirect measurement of host acute inflammatory response, are usually used in the laboratory and clinically to assess the magnitude of the acute - phase reaction . Significantly lower levels of tnf-, il-1, and il-6 and other inflammatory markers were released in the laparoscopic surgery group compared with markers released in the open surgery group . With the recent increased interest in notes, the impact of transvaginal cholecystectomy on host response is being studied . In our experiment, we compared the postoperative inflammatory response between laparoscopic, notes, and control groups in a porcine model . Circulating cytokines, being the most sensitive indicator for host trauma, objectively reflect host immunological response . The differences in host immune responses between open and laparoscopic cholecystectomy have been well validated in the literature, and therefore we did not include an open cholecystectomy control group . We demonstrated no significant difference in terms of tnf- and il-6 levels 48 hours after surgery . However, a significant increase in tnf- levels was detected in the laparoscopic group compared with control and notes subjects on postoperative day 1 . But the rise is not significant when comparing laparoscopic and notes groups alone (p=0.059). It is difficult to predict whether it was due to a transient inflammatory host response to the skin incision, surgical procedures, or purely due to chance alone . Because only 2 subjects were included in the laparoscopic group, it is difficult to draw a conclusion about the significance of the greater cytokine response in laparoscopic surgery compared with that in notes . However, with smaller and fewer abdominal incisions, less inflammatory response should be triggered compared with that in laparoscopic or open surgery . Although the sample size is small for the whole study, it is logical to conclude that notes is safe in terms of the microcellular level in pigs . This finding needs to be further validated in randomized control trials in humans . Besides surgical access consistent or repeatedly high intraabdominal pressure causes abdominal compartment syndromes, with the potential danger of hemodynamic disturbances, impairing end - organ perfusions, or even pulmonary embolism . However, it is not an easy task to detect all these subtle changes in the porcine model unless invasive monitoring is adopted perioperatively . Therefore, pigs survival does not necessarily equal clinical safety . Notes is safe in animal models on the anatomical and cellular levels with minimal systemic inflammatory host responses elicited . Further study needs to be carried out in humans before notes can become part of routine practice.
Hepatocellular carcinoma (hcc) is the fifth most common malignancy worldwide.1 in malaysia, hcc is the thirteenth most common cancer affecting the population.2 the etiology of liver cancer is multi factorial; some of the well known risk factors include hepatitis b and c viral infection, exposure to chemicals such as aromatic hydrocarbons, and the ingestion of aflatoxin b1.3 - 5 the process of carcinogenesis involves an initiating event which induces genetic damage, followed by survival and progression of selected clones of the transformed cells to form tumors . Apoptosis, a form of programmed cell death, has been associated with delaying or inhibiting cancer growth.6,7 much of cancer research over the past two decades has focused on genes that, when mutated, act in either a dominant or recessive manner to enhance proliferation with dysregulation of apoptosis that is responsible for initiating cancer and its progression.8,9 many emerging data in recent years have shown that dietary chemopreventive agents preferentially inhibit growth of cancer cells by targeting signaling molecules, such as caspases, that subsequently lead to the induction of apoptosis.7 some of these dietary agents include epigallocatechin3gallate (egcg), found in green tea,10 curcumin in turmeric,11 genistein in soybeans,12 lycopene in tomatoes,13 anthocyanins in pomegranates14 and isothiocyanates in broccoli.15 there is a large body of evidence that links dna damage and apoptosis.16,17 the tumor suppressor protein p53 provides an important link between dna damage and apoptosis as it has been shown to mediate the upregulation of apoptotic proteins such as bax, caspase3 and 8, noxa, puma and p53aip.18 chlorella vulgaris, a unicellular green algae, has been widely used as a food supplement and credited with high antioxidant and therapeutic abilities.19,20 the supplement can be taken in the form of tablets, capsules, as a food additive or extracted as a liquid . Some health claims and benefits include improvement in the control of hypertension, fibromyalgia and ulcerative colitis.21 in vivo studies have revealed the significant antitumor and antigenotoxic efficacy of c. vulgaris.20 a study by hasegawa et . Al showed that a glycoprotein, designated ars2, found in c. vulgaris extract has an anticancer effect on miceinduced fibrosarcoma.22 to the best of our knowledge, the effect of c. vulgaris on hepatoma cells has not been studied in great detail . In this study, we investigated the anticancer effect of c. vulgaris extract on the hepatoma cell line hepg2 by evaluating changes in proliferation, dna damage and apoptosis . Stock of c. vulgaris beijerinck (strain 072) was obtained from the university of malaya algae culture collection (umacc, malaysia) and grown in bold's basal media (bbm) with a 12 hours dark 12 hours light cycle . The algae were dried using a freeze dryer and then mixed in distilled water at a concentration of 10% (w / v). The algal suspension was then boiled at 100c for 20 minutes using reflux method followed by centrifugation at 10 000 rpm for 20 min . The supernatant was lyophilized using a freeze dryer to obtain the powdered form of c. vulgaris liver cancer cell line hepg2 and normal liver cell line wrl68 were maintained in eagle's minimal essential medium (emem; flow labaratories, sydney australia) supplemented with 1 mm sodium pyruvate (sigma, st louis, mo, usa), 2 mm glutamine, 10% fetal calf serum and 100 u / ml penicillin and streptomycin at 37c in humidified 5% co2 incubator . Cell proliferation, apoptosis and collection of protein were performed when cells reached 70% confluence density . C. vulgaris extract at various concentrations (04 mg / ml) was added to cell lines 24 hours after incubation . A 96well plate was seeded with hepg2 and wrl68 cells at a uniform density of 2 10 cells per well . Twentyfour hours after incubation, cells were treated with the hot water extract of c. vulgaris and incubated for a further 24 hours . Cells were labeled with bromodeoxyuridine (brdu) during the last 3 hours of c. vulgaris extract treatment . The cells were fixed with denaturing solution and the incorporation of brdu was detected by immunoreaction . After substrate solution was added to each well, the amount of brdu incorporated was determined by measuring the absorbance at dual wavelengths (450/690 nm) using a scanning multiwell spectrophotometer [enzymelinked immunosorbent assay (elisa) reader] apoptotic cell death was determined by dead end colorimetric tunel system (promega, madison, wi, usa). After 24 hours of treatment with c. vulgaris extract, floating cells and adherent cells in culture were collected in a tube, trypsinized, centrifuged and washed in phosphate buffered saline (pbs). Cells were fixed by immersing slides in 4% formalin in pbs for 25 minutes at room temperature . After washing with pbs, cells were permeabilized by immersing the slides in 0.2% triton 100 solution in pbs for 5 minutes at room temperature . Cells were then equilibrated with 100 l of equilibration buffer (2.5 mm trishcl ph 6.6, 0.2 m potassium cacodylate, 2.5 mm cocl2, 0.25 mg / ml bsa .) For 7 minutes . The equilibrated areas were blotted with tissue paper before adding biotinylated nucleotide and tdt reaction mix (100 l) to the slides . The slides were then covered with coverslips to ensure an even distribution of the reagent before incubating at 37c for 60 minutes in a humidified chamber . Coverslips were removed and the slides were immersed in 2 salinesodium citrate (ssc; sodium chloride 0.15 m, trisodium citrate 0.015 m) buffer for 15 minutes at room temperature, and washed twice with pbs . Endogenous peroxidases were blocked by immersing the slides in 0.3% hydrogen peroxide for 4 minutes at room temperature and washed again in pbs . Streptavidin horseradish peroxidase (hrp) solution (1500 pbs) was added to each slide and incubated for 30 minutes at room temperature . After final washing with pbs, diaminobenzedine (dab) solution was added to the slides for 20 minutes until light brown staining was observed . Finally, each slide was mounted with dpx (bdh, england) to be examined under light microscope . The assay was performed as described by singh et al.23 thirty microlitres of the hepg2 cell suspension (<400,000 cells / ml) was mixed with 80 l of 1% low melting point (lmp) agarose and added to fully frosted slides that had been covered with a layer of 1% lmp agarose . Subsequently, the slides were immersed in lysis solution [2.5 m naoh, ph10; 0.1 m ethylenediaminetetraacetic acid (edta); 0.01 m tris; and 1% triton 100] for 1 h at 4c, followed by electrophoresis solution (300 mm naoh; and 1 mm edta, ph13) for 20 min to allow dna unwinding, and electrophoresed for 20 min at 25 v and 300 ma . Finally, the slides were neutralized with 0.4 m tris buffer (ph 7.5), stained with ethidium bromide (5 mg / ml) and analyzed using a fluorescence microscope (carl zeiss, gttingen, germany). Images of 50 randomly selected cells per experimental point were visually analyzed under the microscope . Hepg2 cells (110/dish) were seeded into a 9 cm dish and treated with various concentrations of hot water extract of c. vulgaris for 2, 6, 12, 18 and 24 hours . Hcl, 150 mm nacl, 1 mm ethylene glycol tetraacetic acid (egta), 1 mm edta, 20 mm naf, 100 mm na3vo4, 1% np40, 1% triton x100, 1 mm phenylmethylsulfonyl fluoride (pmsf), 10 g / ml aprotinin and 10 g / ml leupeptin] (sigma, st louis, mo, usa) on ice for 30 min to lyse the cells . After centrifugation, total protein was determined using a biorad protein assay kit (biorad, hercules, ca, usa). Protein was resolved (50 g) by 1015% sdspage and transferred to polyvinyl difluoride (pvdf) membranes . The membrane was blocked with blocking buffer (5% skim milk in 1% tween 20 in 20 mm trisbuffered saline, ph7.5) by incubating for 1 h at room temperature followed by incubation with the appropriate primary antibody (p53, bax, bcl2, caspase3 and 8; chemicon, billerica, ma, usa) at dilutions of 11000 in blocking buffer for 2 h at room temperature . The membranes were then incubated with the respective secondary antibodies for 1 h and antigens were detected by using the enhanced chemiluminescence blotting detection system (ge healthcare, piscataway, nj, usa). Results are expressed as mean sd with the experiment repeated at least 3 times . Stock of c. vulgaris beijerinck (strain 072) was obtained from the university of malaya algae culture collection (umacc, malaysia) and grown in bold's basal media (bbm) with a 12 hours dark 12 hours light cycle . The algae were dried using a freeze dryer and then mixed in distilled water at a concentration of 10% (w / v). The algal suspension was then boiled at 100c for 20 minutes using reflux method followed by centrifugation at 10 000 rpm for 20 min . The supernatant was lyophilized using a freeze dryer to obtain the powdered form of c. vulgaris liver cancer cell line hepg2 and normal liver cell line wrl68 were maintained in eagle's minimal essential medium (emem; flow labaratories, sydney australia) supplemented with 1 mm sodium pyruvate (sigma, st louis, mo, usa), 2 mm glutamine, 10% fetal calf serum and 100 u / ml penicillin and streptomycin at 37c in humidified 5% co2 incubator . Cell proliferation, apoptosis and collection of protein were performed when cells reached 70% confluence density . C. vulgaris extract at various concentrations (04 mg / ml) was added to cell lines 24 hours after incubation . A 96well plate was seeded with hepg2 and wrl68 cells at a uniform density of 2 10 cells per well . Twentyfour hours after incubation, cells were treated with the hot water extract of c. vulgaris and incubated for a further 24 hours . Cells were labeled with bromodeoxyuridine (brdu) during the last 3 hours of c. vulgaris extract treatment . The cells were fixed with denaturing solution and the incorporation of brdu was detected by immunoreaction . After substrate solution was added to each well, the amount of brdu incorporated was determined by measuring the absorbance at dual wavelengths (450/690 nm) using a scanning multiwell spectrophotometer [enzymelinked immunosorbent assay (elisa) reader] apoptotic cell death was determined by dead end colorimetric tunel system (promega, madison, wi, usa). After 24 hours of treatment with c. vulgaris extract, floating cells and adherent cells in culture were collected in a tube, trypsinized, centrifuged and washed in phosphate buffered saline (pbs). Cells were fixed by immersing slides in 4% formalin in pbs for 25 minutes at room temperature . After washing with pbs cells were then equilibrated with 100 l of equilibration buffer (2.5 mm trishcl ph 6.6, 0.2 m potassium cacodylate, 2.5 mm cocl2, 0.25 mg / ml bsa .) For 7 minutes . The equilibrated areas were blotted with tissue paper before adding biotinylated nucleotide and tdt reaction mix (100 l) to the slides . The slides were then covered with coverslips to ensure an even distribution of the reagent before incubating at 37c for 60 minutes in a humidified chamber . Coverslips were removed and the slides were immersed in 2 salinesodium citrate (ssc; sodium chloride 0.15 m, trisodium citrate 0.015 m) buffer for 15 minutes at room temperature, and washed twice with pbs . Endogenous peroxidases were blocked by immersing the slides in 0.3% hydrogen peroxide for 4 minutes at room temperature and washed again in pbs . Streptavidin horseradish peroxidase (hrp) solution (1500 pbs) was added to each slide and incubated for 30 minutes at room temperature . After final washing with pbs, diaminobenzedine (dab) solution was added to the slides for 20 minutes until light brown staining was observed . Finally, each slide was mounted with dpx (bdh, england) to be examined under light microscope . The assay was performed as described by singh et al.23 thirty microlitres of the hepg2 cell suspension (<400,000 cells / ml) was mixed with 80 l of 1% low melting point (lmp) agarose and added to fully frosted slides that had been covered with a layer of 1% lmp agarose . Subsequently, the slides were immersed in lysis solution [2.5 m naoh, ph10; 0.1 m ethylenediaminetetraacetic acid (edta); 0.01 m tris; and 1% triton 100] for 1 h at 4c, followed by electrophoresis solution (300 mm naoh; and 1 mm edta, ph13) for 20 min to allow dna unwinding, and electrophoresed for 20 min at 25 v and 300 ma . Finally, the slides were neutralized with 0.4 m tris buffer (ph 7.5), stained with ethidium bromide (5 mg / ml) and analyzed using a fluorescence microscope (carl zeiss, gttingen, germany). Images of 50 randomly selected cells per experimental point were visually analyzed under the microscope . Hepg2 cells (110/dish) were seeded into a 9 cm dish and treated with various concentrations of hot water extract of c. vulgaris for 2, 6, 12, 18 and 24 hours . Hcl, 150 mm nacl, 1 mm ethylene glycol tetraacetic acid (egta), 1 mm edta, 20 mm naf, 100 mm na3vo4, 1% np40, 1% triton x100, 1 mm phenylmethylsulfonyl fluoride (pmsf), 10 g / ml aprotinin and 10 g / ml leupeptin] (sigma, st louis, mo, usa) on ice for 30 min to lyse the cells . After centrifugation, total protein was determined using a biorad protein assay kit (biorad, hercules, ca, usa). Protein was resolved (50 g) by 1015% sdspage and transferred to polyvinyl difluoride (pvdf) membranes . The membrane was blocked with blocking buffer (5% skim milk in 1% tween 20 in 20 mm trisbuffered saline, ph7.5) by incubating for 1 h at room temperature followed by incubation with the appropriate primary antibody (p53, bax, bcl2, caspase3 and 8; chemicon, billerica, ma, usa) at dilutions of 11000 in blocking buffer for 2 h at room temperature . The membranes were then incubated with the respective secondary antibodies for 1 h and antigens were detected by using the enhanced chemiluminescence blotting detection system (ge healthcare, piscataway, nj, usa). Results are expressed as mean sd with the experiment repeated at least 3 times . Statistical evaluation was done using the student's ttest . A p value of <0.05 was considered significant . Chlorella vulgaris inhibited the proliferation of human liver cancer cells (hepg2) in a concentrationdependent manner, ranging from 04 mg / ml as shown by brdu proliferation assay with a 50% reduction at 1.6 mg / ml, (ic50) (fig . The high ic50 is expected as c. vulgaris is classified as a food and not a drug . Proliferation of normal liver cells (wrl68) was decreased when treated with c. vulgaris extract, resulting in a 50% reduction at 1.7 mg / ml . One hundred percent inhibition of proliferation of hepg2 cells and wrl68 cells was achieved at approximately 3 mg / ml and 4mg / ml, respectively . It was clearly seen that c. vulgaris induced apoptosis in hepg2 cells with distinct nuclear condensation and blebbing of the plasma membrane, a typical characteristic of apoptotic bodies (fig . 2).24 the percentange of apoptosis of hepg2 and wrl68 cells as induced by c. vulgaris extract at 2mg / ml is demonstrated in figure 3; the rate of apoptosis was significantly higher (70%) in hepg2 cells compared to normal wrl68 cells (15%). Wrl68 cells also underwent apoptosis but at a higher concentration of c. vulgaris (34 mg / ml), perhaps as a result of the cytotoxicity effects seen at higher concentrations (fig . Figure 4a shows that the level of p53 increased in a dosedependent manner and reached maximum induction at 2 h with 2 mg / ml treatment of c. vulgaris . 4b) in a timedependent manner . However, the activation of the mitochondrial apoptotic pathway in downstream caspase8 was not significant (fig . 4e), but a significant increase in the active form of caspase3 was observed after 24 h of treatment with c.vulgaris in a timedependent manner (fig . These results demonstrate that the mitochondrial signaling pathway is involved in c. vulgarisinduced apoptosis of hepg2 cells . Dna damage in hepg2 cells was increased by c. vulgaris treatments at all concentrations (fig . 5). At low doses of c. vulgaris extract, hepg2 and wrl68 cells generated smaller comets that were not significant, whilst at 2 mg / ml, c. vulgaris induced more damage in hepg2 cells (80%) compared to wrl68 (50%). Many chemopreventive agents have been associated with antiproliferative and apoptotic effects on cancer cells because of their high antioxidant activity, targeting signaling molecules, and preventing or protecting cells from further damage or transformation into cancer cells.7 chlorella vulgaris has been shown to exhibit high antioxidant activity compared to other microalgae.25 the antiproliferative effect of c. vulgaris (fig . 1) could be caused by an acidic glycoprotein found to have antitumour and antioxidant properties in tumourbearing mice.22 dna damage is a common event in life following which, repair mechanisms and apoptosis will be activated to maintain genome integrity . Dna damage results in cell cycle arrest at checkpoints or at g1 or g2 stage to inhibit cell cycle progression and to induce apoptosis, thus protecting cells against further damage.24 antioxidants are important inhibitors of lipid peroxidation as a defence mechanism against oxidative damage.26 plants and microalgae have developed a protective mechanism by possessing antioxidant compounds mainly with phenolic moieties to eradicate the accumulation of reactive oxygen species (ros) produced by ultraviolet (uv) radiation or heat from sunlight.26 our study showed that c. vulgaris, with its high antioxidant activity, protected normal wrl68 cells against severe dna damage but induced severe dna damage in hepg2 cells . Many chinese herbal remedies such as ganoderma lucidum, rubus coreanum, paeoniae radix and phyllanthus urinaria have been shown to trigger the apoptotic pathway in mcf7 human breast cancer cells, ht29 human colon cancer cells, hepg2 human hepatoma cells and lewis lung carcinoma cells, respectively.27 - 30 apoptosis is modulated by antiapoptotic and proapoptotic effectors, which involve a large number of proteins . The propapoptotic and antiapoptotic members of the bcl2 family act as a rheostat in regulating programmed cell death and as a target of anticancer therapy.31 the ratio of death antagonists (bcl2, bclxl) to agonists (bax, bclxs, bad, bid) determines whether a cell will respond to an apoptotic stimulus . Downregulation of the death suppressor bcl2 protein could repress tumor growth by promoting programmed cell death.32 - 34 . To investigate the mechanisms of c. vulgarisinduced apoptosis, we assessed the expression and activity of tumor suppressor protein p53 and a host of pro and antiapoptotic proteins: bcl2, bax, and caspases3 and 8 . Our results showed that c. vulgaris mediated apoptosis in a p53dependent manner with increased expression of bax and decreased expression of bcl2 proteins in a timedependent manner . The activation of p53 and related family members can either enforce cell cycle arrest or induce apoptosis . The rules that govern the choice between growth, arrest and apoptosis are likely to be enforced by other proteins that can antagonize or synergize with p53 to regulate apoptosis.35 the maximal increase of bax expression in hepg2 cells after 18 h incubation with c. vulgaris may be the result of the increase of p53 accumulation that peaked after 2 h. as a herbal extract, c. vulgaris contains a variety of compounds including antioxidants and a glycoprotein that may act on different pathways of tumor cell growth and survival, triggering an antagonistic effect of bax and bcl2 . Apoptotic signals are generally believed to be mediated through a hierarchy of caspase activation controlled by one of two distinct pathways that are associated with either mitochondrial caspase8 or 9 . Although we did not find significant activation of downstream caspase8 there was, however, a significant increase of the active form of caspase3 after 24 h of treatment with c. vulgaris, in a timedependent manner . These results demonstrated that the mitochondrial signaling pathway is involved in c. vulgarisinduced apoptosis of hepg2 cells . It could be postulated that c. vulgaris did not induce the initiator caspase8 but it may have activated the other initiator caspase9 . Among the ten different members of caspases identified in mammalian cells, caspase3 may serve as a general mediator of apoptosis . When cells are undergoing apoptosis, executioner or effector caspase3 triggers cellular proteins such as poly (adpribose) polymerase and dna fragmentation factor, resulting in the characteristic changes of apoptosis.36 caspase3 is synthesized as a 33 kda inactive proenzyme that requires proteolytic activation . Our results showed that a high level of proenzyme of caspase3 was present in untreated tumor cells, and active caspase3 gradually increased after c. vulgaris treatment, suggesting that c. vulgaris induced apoptosis through a caspase3dependent mechanism . The results of the present study suggest that the anticancer mechanism of c. vulgaris in hepatoma cells (hepg2) is by inhibiting dna synthesis, triggering dna damage and inducing apoptosis . This is shown by the reduced incorporation of brdu into replicating dna of hepg2 cells and an increase in the number of dna damageinducing and apoptotic proteins, bax and caspase3 in hepg2 cells treated with c. vulgaris . The possible mechanism is speculated to be an increase in p53, bax and caspase3 expression that would subsequently lead to apoptosis . This research was supported by a grant from ministry of science, technology and innovation (mosti)
Transcatheter closure of patent ductus arteriosus (pda) by use of the amplatzer duct occluder shows good results in properly selected patients.1 the advantages of the amplatzer duct occluder device include a user - friendly delivery system, the ability to retrieve or reposition the device when required, and a high complete closure rate (> 99% complete occlusion of pda within 6 months of implant).2 although embolization of an amplatzer duct occluder is rare, it can occur . We present a case of retrieval of an embolized amplatzer duct occluder by use of a percutaneous method in a young man . Transthoracic two - dimensional echocardiography and computed tomography (ct) confirmed pda (fig ., we deployed the amplatzer duct occluder ii (9-pda2 - 05 - 06, aga med ., usa) after confirmation of the proper position by repeated angiogram . However, 5 min after successful deployment, the amplatzer duct occluder device was suddenly embolized into the branch of the right pulmonary artery (rpa) (fig . 2a). Before surgical removal, we decided to remove the embolized device by use of a percutaneous method after obtaining consent from the patient's relatives . Multiple attempts at removal by use of guidewire twisting, a goose - neck snare, and a radiofrequency ablation catheter were unsuccessful . Because the embolized device was floating in the branch of the rpa, it moved into the distal portion of the rpa after several attempts of retrieval with the snare and ablation catheter . In order to stabilize the embolized device, a 5.020 mm balloon catheter was placed just distal to the embolized device and inflated . Endomyocardial biopsy forceps (cordis corp ., usa) were introduced from the left femoral vein through an 8-fr sheath . After multiple attempts, we caught the screw attachment tip of the embolized device and removed it into the 8-fr shuttle sheath (fig . Subsequently, an amplatzer duct occluder 8 - 6 (9-pda-005) was carefully deployed via a venous route . The device was confirmed to be properly positioned across the defect by echocardiography and the ct angiogram (fig . Neither clinical complications nor a residual shunt was observed during the 6-month follow - up . Transcatheter pda closure is currently the standard of therapy and is performed with high success rates and few complications.3 although the rate of device embolization is rare (<0.5%), this remains a major complication requiring urgent surgical management.4 the most common cause of embolization is the use of an undersized device . Therefore, exact pda sizing and the use of the proper size of device is essential to avoid this potential complication . Careful attention must be paid to imperfect alignment or malposition of the device or excessive tension on the delivery cable; performing the wiggle procedure may reduce the acute failure rate of the procedure.5 excessive tension on the delivery cable was the main cause of embolization in our patient . In this case, stabilizing the floating device by balloon inflation played a pivotal role in success . The use of a larger 8-fr sheath during retrieval could make easier device entry into the sheath after capture of the embolized device . In general, the following techniques are recommended to increase the chances of successful retrieval: the use of a sheath 2 fr sizes larger than the delivery sheath, the use of stiff sheaths to avoid kinking, and cutting a bevel or notch at the end of the sheath to facilitate the entrance of the embolized device.6 our case illustrates a practical transcatheter removal technique for an embolized amplatzer duct occluder . Even in procedures performed by the most experienced operators, thus, physicians have to keep in mind both the possibility and the treatment of this severe complication during pda closure.
Schizophrenia is a chronic, heterogeneous, severe mental illness with impairments in biological, psychological, and social functions . Even though the mode of inheritance in schizophrenia is complex and primarily nonmendelian, it is well established that the schizophrenia has a high heritability . Endophenotypes, described as internal phenotypes, are quantifiable characters which are the product of fewer genes when compared to phenotypes and this has the potential to simplify the genetic studies in schizophrenia . Endophenotype abnormalities are seen in patients with schizophrenia well before the start of the illness, and these changes are also seen in first - degree relatives of patients with schizophrenia . Of various markers, cognitive impairments, and event - related potential abnormalities p300 is a well - researched component of auditory event - related potential that shows abnormality in patients with schizophrenia . It is correlated with information processing in the brain and has high temporal correlation . In most of the studies,, an odd stimulus is inserted in between a regularly occurring stimulus and the person taking the test responds for the odd stimulus while not the regular stimulus . Since its first report in 1972, studies have shown that various event - related potential abnormalities manifest in persons suffering from schizophrenia, namely, the reduced p300 amplitude and increased latency . Hence, event - related potential abnormalities are considered as the biological vulnerability marker of schizophrenia . The cognitive defects in schizophrenia have been represented in eight different domains, namely, processing speed, attention / vigilance, working memory, verbal and visual learning / memory, reasoning and problem solving, verbal comprehension and social cognition . Moreover, it is observed that these deficits are also found to be present in unaffected relatives and twins of patients with schizophrenia . Research suggests that the cognitive deficits have a strong genetic linkage, tends to run in families and predispose the unaffected first - degree relatives of patients with schizophrenia to develop the disorder in future . There are only few studies in indian literature that has analyzed event - related potentials and neuropsychological measurements together in patients with schizophrenia and their unaffected siblings . The present study was based on the assumption that the p300 and neuropsychological measurements would show a continuum when compared between the patients with schizophrenia, their siblings, and normal controls . It was also hypothesized that the patients with schizophrenia would have the lowest scores in neuropsychological measurements and significant abnormalities in p300 while the siblings and normal controls would follow . For this, the study was designed to measure p300 and neuropsychological functions in patients with schizophrenia, their biological siblings, and normal controls . The current study was conducted at institute of mental health, madras medical college, chennai, tamil nadu, india . Thirty consecutive patients with schizophrenia, attending the psychiatry outpatient department, diagnosed using international classification of diseases-10 and confirmed using schedules for clinical assessment in neuropsychiatry (scan), were included . The inclusion criteria for the recruitment of patients were age between 18 and 40 years, no other comorbid psychical or mental illness except tobacco use and willing to give informed written consent . The sibling group which included thirty participants were either brothers or sisters of the patients with schizophrenia . The inclusion criteria for the siblings were age between 18 and 40 years, no history of psychical or mental illness except tobacco use and willing to give informed written consent . Normal controls were selected from the relatives and friends of patients who attended the hospital for psychical conditions and the inclusion criteria to recruit normal controls include age group between 18 and 40, having negative family history for psychiatric illness, no psychical or mental illness except tobacco use and willing to give informed written consent . Scan was administered to the sibling and normal control group to exclude any psychiatric illness . The following cognitive function tests were administered to all the participants of this study which include digit symbol substitution test (dsst), digit vigilance test (dvt), trail making test (tmt) b and stroop test using nimhans neuropsychology battery-2004-manual . The total time taken to complete dsst was used to measure the speed, attention, visual scanning, and memory . It consists of an array of nine numbers, each paired with a symbol . Beneath the array is a set of numbers alone and the subject's task is to write the correct symbol under each of these numbers as rapidly as possible . The raw score is computed by counting the number of correct responses made in 120 s. dvt measures sustained attention . The subject has to focus on the target digits, i.e., six and nine and cancel them alone amongst other distracter digits . Inability to sustain and focus attention leads to both increased time to complete the test as well as errors . B test is considered as a measure of focused attention . Here, subjects have to point to numbers in alternating colors with the successive numbers in ascending order . In each part the test is given only after the subject has understood the principle involved and has performed the practice sheet satisfactorily . The color print does not correspond with the color designated by the words . In the first trial, patients are asked to read the word and in the second trial, name the color in which the word was printed . The reading time is subtracted from the naming time to get the stroop test effect score . Rms neuro diagnostic system was used to record p300 auditory event - related potentials . For the purpose of this study the auditory stimuli were pure tones presented to the subjects at the rate of 1.25 s for 10 min . The pure tones were of 1000 and 2000 hz in which the rare frequency would be the 2000 hz . The probability of the occurrence of the rare frequency pure tone was set at 0.2 . The subjects who were being tested were instructed to press a button using the right thumb as soon as they hear the rare target stimuli . Using the copper electrodes, the electroencephalogram of the subject was recorded at three sites namely, frontal (fz), central (cz), and parietal (pz) according to the 1020 international system of electrode placement . The results were tabulated and analyzed using the statistical package, spss 16.0 (spss inc ., wallis test while the other socio - demographic variables were compared between the three groups by chi - square test . The statistical difference among the groups for p300 and neuropsychological measurements were analyzed by analysis of variance . The difference was considered statistically significant at p <0.01 for all the tests . The current study was conducted at institute of mental health, madras medical college, chennai, tamil nadu, india . Thirty consecutive patients with schizophrenia, attending the psychiatry outpatient department, diagnosed using international classification of diseases-10 and confirmed using schedules for clinical assessment in neuropsychiatry (scan), were included . The inclusion criteria for the recruitment of patients were age between 18 and 40 years, no other comorbid psychical or mental illness except tobacco use and willing to give informed written consent . The sibling group which included thirty participants were either brothers or sisters of the patients with schizophrenia . The inclusion criteria for the siblings were age between 18 and 40 years, no history of psychical or mental illness except tobacco use and willing to give informed written consent . Normal controls were selected from the relatives and friends of patients who attended the hospital for psychical conditions and the inclusion criteria to recruit normal controls include age group between 18 and 40, having negative family history for psychiatric illness, no psychical or mental illness except tobacco use and willing to give informed written consent . Scan was administered to the sibling and normal control group to exclude any psychiatric illness . The following cognitive function tests were administered to all the participants of this study which include digit symbol substitution test (dsst), digit vigilance test (dvt), trail making test (tmt) b and stroop test using nimhans neuropsychology battery-2004-manual . The total time taken to complete dsst was used to measure the speed, attention, visual scanning, and memory . It consists of an array of nine numbers, each paired with a symbol . Beneath the array is a set of numbers alone and the subject's task is to write the correct symbol under each of these numbers as rapidly as possible . The raw score is computed by counting the number of correct responses made in 120 s. dvt measures sustained attention . The subject has to focus on the target digits, i.e., six and nine and cancel them alone amongst other distracter digits . Inability to sustain and focus attention leads to both increased time to complete the test as well as errors . B test is considered as a measure of focused attention . Here, subjects have to point to numbers in alternating colors with the successive numbers in ascending order . In each part the test is given only after the subject has understood the principle involved and has performed the practice sheet satisfactorily . The color print does not correspond with the color designated by the words . In the first trial, patients are asked to read the word and in the second trial, name the color in which the word was printed . The reading time is subtracted from the naming time to get the stroop test effect score . Rms neuro diagnostic system was used to record p300 auditory event - related potentials . For the purpose of this study the auditory stimuli were pure tones presented to the subjects at the rate of 1.25 s for 10 min . The pure tones were of 1000 and 2000 hz in which the rare frequency would be the 2000 hz . The probability of the occurrence of the rare frequency pure tone was set at 0.2 . The subjects who were being tested were instructed to press a button using the right thumb as soon as they hear the rare target stimuli . Using the copper electrodes, the electroencephalogram of the subject was recorded at three sites namely, frontal (fz), central (cz), and parietal (pz) according to the 1020 international system of electrode placement . The results were tabulated and analyzed using the statistical package, spss 16.0 (spss inc ., wallis test while the other socio - demographic variables were compared between the three groups by chi - square test . The statistical difference among the groups for p300 and neuropsychological measurements were analyzed by analysis of variance . No statistical significance was noted among the three groups with respect to age, sex, and education . It was observed that there was a statistical difference among three groups in amplitude and latency of p300 . The amplitude was lowest in the patient group while the normal controls had the highest and siblings of patients with schizophrenia lying in between them . When the latency of p300 was compared, it was longer in patients when compared with normal controls . Table 1 depicts the results of neuropsychological measurements in the participants . Both the patients with schizophrenia and their siblings performed poorly in the neuropsychological tests when compared with the normal controls . Statistically significant difference was seen in all the neuropsychological tests administer among the three groups . The scores in the tests also showed an increasing trend that patients fall in the lowest range while the siblings and normal controls had higher and highest scores, respectively . With respect to p300 amplitude measurements in the three groups of subjects, there was a significant difference between the three groups . The difference was more in the case of the amplitude measured in the central and parietal regions when compared with the frontal regions and showed a statistical significance between the groups (f = 77.587). In a study, kidogami et al . Showed that amplitude of p300 in the patients with schizophrenia and the first - degree relatives of patients with schizophrenia was of low amplitude when compared with the control group but no statistically significant difference between the first degree relatives and patients with schizophrenia . In contrast, several studies have shown negative reports regarding p300 abnormalities in unaffected siblings of patients with schizophrenia . In this study, p300 latency was longer for the patients with schizophrenia followed by siblings and controls and showed a significant difference between the groups . In the study by araki et al ., it was found that latency was prolonged in the case of patients with schizophrenia when compared the controls . In the case of first - degree relatives of patients with schizophrenia, the latency was prolonged when compared to the normal controls and comparable to the patient group . In dsst, siblings showed a slower rate of mental speed when compared with the control group while patients with schizophrenia had the lowest scores in the test . In a study by amaresha et al ., it was showed that the patients with schizophrenia performed poorly and performance were dependent upon the negative score in positive and negative syndrome scale . Similarly, there was a decrease in the performance in the tests measuring the speed of processing in the first degree relatives of patients with schizophrenia . The patients with schizophrenia and their siblings performed poorly with errors when compared to the control group in the continuous performance test . Avila et al . Studied the continuous performance test in the schizophrenia spectrum disorders and showed a gradation in the performance with highest deficits in the patients with schizophrenia while lesser impairments in the patients with schizotypal personality disorder . In another study by bove which studied the continuous performance test in 24 first - degree relatives of patients with schizophrenia, showed a slight decrease in performance in the test when compared with the control group and test performance was not dependent on the basic symptoms . The present study showed a gradation in the scoring of tmt - b with lowest in the patients with schizophrenia followed by the siblings and the controls ., that the relatives of patients with schizophrenia show difference in the performance in both tmt a and b. the stroop effect showed a significant difference between the three groups indicating that the response inhibition was affected in the sibling and patient group when compared to the controls . Similar findings were reported by other studies and reviewed in a meta - analysis . However, in a study by becker et al ., the postconflict related performance in stroop test had intact results comparable to the general population . The present study's hypothesis that the patient and sibling groups would exhibit a p300 and neurocognitive performance continuum, with the controls performing the best, followed by the siblings and patients, was supported by the results . We observed a gradation in all the test measurements used in the present study and found a statistically significant difference among the three groups . Similar results were observed in a previous study where a continuum in cognitive performance was exhibited among the groups but did not reach the level of significance . The major strength of the present study is the evaluation of cognitive functions and p300 in patients with schizophrenia, their healthy siblings and normal controls who were matched for age, gender, and years of education . . A major limitations of the study were the small sample size and effect of antipsychotic drugs on p300 and cognition . In the future studies, the patients with schizophrenia could be followed up, and periodic assessment of the event - related potential, p300 and neuropsychological tests could be done to measure the progress of the illness . In the unaffected biological siblings of patients with schizophrenia, these can be used as markers for underlying biological processes and could help in early detection of illness . In conclusion, it is observed that there is a continuum in p300 and neuropsychological measures in patients with schizophrenia, their unaffected siblings and normal controls with an increasing graduation from the patients to controls . The present observation of p300 abnormalities and neuropsychological performances on various neuropsychological tests confirms the previous observation that p300 presents as a biological vulnerability marker for schizophrenia and also a trait marker . However, future observation in a homogenous patient sample with an exclusion of confounding variables and application of latest neuro imaging technologies will give a more precise report of p300 as endophenotype vulnerability marker for the genetic etiology of schizophrenia, thus helping the genetic research literature in schizophrenia there are no conflicts of interest.
Post - operative radiotherapy is an established adjuvant treatment after radical hysterectomy with intermediate- and high - risk early - stage cervical cancer patients [1, 2]. A conventional radiation technique for post - operative cervical cancer patients is whole - pelvic radiation therapy (wprt) requiring four static photon fields . This technique exposes most of the contents of the true pelvis, including the small bowel as well as the target volume . The highly conformal technique of intensity - modulated radiation therapy (imrt) has the potential for delivering the required radiation dose to the target volume, while avoiding surrounding normal tissues, and its effectiveness has been validated in several anatomical sites such as head - and - neck [3, 4] or prostate cancer treatment [5, 6]. However, the advantage of using the complex imrt technique in the field of gynecologic cancer has not yet been determined [79] and demands a prospective clinical trial for its validation . The radiation therapy oncology group (rtog) launched a multi - institutional prospective phase ii trial (rtog 0418) using imrt for post - operative endometrial and cervical patients in order to determine whether imrt could reduce short - term bowel toxicity . Recently, a positive preliminary result was presented . In japan, because of the concern about possible severe late bowel complications related to the combination of surgery and radiotherapy, and because of a positive result from adjuvant chemotherapy alone for intermediate- and high - risk post - operative cervical cancer patients, several institutions dare not use adjuvant radiation therapy for early - stage intermediate- or high - risk post - operative cervical cancer patients . Since the rtog 0418 trial included not only cervical cancer but also endometrial cancer patients, it was decided that the effectiveness and safety of imrt should be validated including only post - operative cervical cancer patients in a japanese multicenter prospective clinical trial . As a preparation for this clinical trial, it was regarded as important to ascertain the current status of imrt for post - operative cervical cancer in japan . The object of this study was to perform a surveillance study of imrt for post - operative cervical cancer in a working group within the radiation therapy study group (rtsg) of the japan clinical oncology group (jcog). In 2013, the working group conducted a surveillance using a questionnaire asking about the precise methods of conducting imrt . Six leading academic institutions in the field of gynecologic oncology, who have already commenced applying imrt for post - operative cervical cancer patients in clinical practice, were selected for the current survey . Data collection included: (i) the technical environment for imrt; (ii) patient preparation before taking planning computed tomography (ct); (iii) the technique for determining the target volume and the normal structure; (iv) the prescription dose, the dose constraint for organs at risk (oars), how to define the prescription dose; and (v) how patients were set up in daily treatment . Half of the institutions used conventional static imrt, while the others used volumetric - modulated arc therapy (vmat). One institution used a 15-mv photon beam, which could deliver radiation to deep - seated organs . All except one institution used either a vacuum cushion or a shell for patient body fixation, which was important for highly precise radiation therapy as imrt ., vosveld 9a, 2110 wijnegem, belgium), which was capable of fixing a patient's hips, legs and feet . According to the rtog 0418 protocol, in contrast to the rtog protocol, most of the institutions did not visualize the vaginal cuff before taking planning ct . 2.a bar graph showing the way of patient preparation before taking planning ct . A bar graph showing the way of patient preparation before taking planning ct . Figure 3 shows how physicians define the clinical target volume (ctv). For the elective lymph node region, all institutions used the guideline for pelvic nodal ctv created by the japan clinical oncology group gynecologic cancer study group (jcog gcsg). For contouring the vaginal cuff, the paracolpium and the parametrium, which may contain microscopic cancer cells after radical hysterectomy, four institutions used the rtog guideline for reference, while two institutions used the jcog gcsg guideline for the intact uterus with modification, because the uterus no longer existed after surgery . Two institutions used the fusion ct images taken with the bladder full and empty according to the rtog protocol to account for the internal motion of the ctv vaginal cuff, while others contoured the ctv vaginal cuff based on one ct series, adding a 510 mm internal margin . 3.a bar graph showing which guidelines physicians used as a reference when contouring the target volumes . A bar graph showing which guidelines physicians used as a reference when contouring the target volumes . The organs which were commonly selected as oars were the rectum, the bladder, the femoral head, and the small bowel / peritoneal cavity . One institution contoured the bowel loop, four the peritoneal cavity, and one did not contour either the bowel loop or the peritoneal cavity . 4.a bar graph showing which normal structures were selected as organs as risk (oars). A bar graph showing which normal structures the total prescription dose was either 50 gy/25 fr in 2 gy per fraction or 50.4 gy/28 fr in 1.8 gy per fraction . Five institutions used the planning target volume (ptv) dmean (mean dose of the ptv) as a prescription point, while one institution used ptv d95 (lowest dose encompassing 95% of the ptv). As for the dose constraint for oars, one institution did not set any specific dose constraint . In this institution the attending physician checked the dose distribution and paid careful attention to hot spots in oar . The other five institutions used the individual dose constraint definition, and this is summarized in table 1 . Preliminary compliance rates of dose constraints for oars for five to eleven patients treated during the study period are also summarized in table 1 . Table 1.dose constraint for oarinstitution a (adherence rate, n = 10)institution b (adherence rate, n = 10)institution c (adherence rate, n = 11)institution d (adherence rate, n = 5)institution e (adherence rate, n = 5)rectumv50 gy <40%, dmax <55 gy (100%)v50 gy <35% (80%)v40 gy <60% (18.2%)v50 gy <35% (100%)v40 gy <80% (40%)bladderv45 gy <50%, dmax <55 gy (80%)v45 gy <70%, v50 gy <35% (80%)v45 gy <35% (36.4%)v50 gy <35% (100%)v45 gy <35% (60%)small bowel / peritoneumv40 gy <40%, v55 gy 30% (45.5%)v40 gy <30% (80%)v40 gy <30% (80%)femoral headv30 gy <20% (80%)v30 gy <15% (20%)v30 gy <15% (36.4%)dmean <30 gy (80%)pelvic bonev20 gy <80% (80%)v10 gy <90%, v40 gy <37% (20%)cauda equinadmax <50 gy (40%)oar = organ at risk . Fig . 5.a bar graph showing the prescription dose and the definition of prescription dose . Dose constraint for oar a bar graph showing the prescription dose and the definition of prescription dose . With regard to the daily set - up of image - guided radiation therapy (igrt), three institutions took cone - beam ct (cbct) every day, one three times a week and two once a week . Three institutions encouraged patients to empty the rectum every day before treatment, whereas no instruction concerning rectum emptying was given to patients in the other three institutions; however, in two out of these three institutions, cbct was taken every day and if large amounts of gas or stools were found, patients were asked to empty the rectum before irradiation . Figure 6 shows a typical dose distribution of imrt for post - operative cervical cancer patients from the six institutions participating in this study . 6.a typical dose distribution of imrt for postoperative cervical cancer patients from six institutions participating in this study: institutions a f (a f). A typical dose distribution of imrt for postoperative cervical cancer patients from six institutions participating in this study: institutions a planning and delivery of radiation therapy have changed dramatically over the past several decades, and imrt is one of the most complicated and error - prone techniques, and thus requires thorough quality assurance programs, not only for multicenter clinical trials but for daily practical use . As a preparation for a future clinical trial using adjuvant imrt for post - operative cervical cancer patients, it was considered to be important to know the current status of imrt in terms of post - operative radiotherapy for cervical cancer in japan; therefore, the current surveillance study was performed . Half of the institutions used vmat, for which it was shown that the treatment time will be shortened compared with conventional static imrt for pelvic irradiation, but a dosimetric benefit would not be expected . The high - energy photon beam has an advantage of delivering photons to deep - seated organs with less attenuation; however, it brings with it a concern about creating neutrons along with photons . In the latest patterns of care study (pcs) for cervical cancer in japan, the most appropriate machine energy should be discussed for developing the protocol of a future clinical trial . Although visualization of the vaginal cuff was recommended in the rtog protocol, most institutions did not visualize them . It was supposed that inserting markers into the vaginal cuff would require manpower, time and patient endurance of pain . One institution inserted a small piece of gauze soaked with a contrast agent into the vaginal cuff, whereas it was not permitted to insert gauze into the vagina in the rtog protocol because it would potentially cause anatomical changes relative to the surrounding structures . It was considered to be feasible if only a small piece of gauze was manipulated; however, the impact from volume changes of the bladder and the rectum is considered to be more significant . Therefore, inserting a small piece of gauze with a contrast agent will be included in the protocol of a future clinical trial . It was supposed that when the bladder was filled with urine, the bowel would be pushed away from the small pelvis and it would protect the small bowel from radiation exposure . However, reproducibility of bladder filling is problematic because the pelvic nerve plexus has already been damaged to varying degrees by radical hysterectomy; therefore, monitoring daily bladder filling by some means needs to be considered to ensure the accuracy of the treatment . The reason why the rtog guideline was not used as a reference to contour the ctv lymph node was that the definition of the ctv lymph node according to the jcog first, in the jcog gcsg guideline, the cranial margin was set at the bifurcation of the aorta, not based on the bony structure as in the rtog guideline . It would be difficult to categorize the recurrence as a regional (pelvic recurrence) or a distant (para - aortic nodal) failure when the previous pelvic field was constructed based on the bony anatomy . Second, the japanese guideline involved the adipose connective tissue between the iliopsoas muscles and the lateral surface of the vertebral body, which was not included in the rtog guideline . This area was also included in the atlas of taylor et al . [18, 19]. Therefore, the current rtog definition may be insufficient in terms of lateral expansion of the ctv for the internal iliac node . As for the ctv vaginal cuff, while four institutions used the rtog guideline, two institutions used the jcog gcsg guideline for the intact uterus . Not all institutions used the rtog guideline, because the rtog guideline did not describe the paracolpium and the parametrium in detail . Although, theoretically, the jcog gcsg guideline for the intact uterus was not appropriate for contouring the post - operative female pelvis, the jcog therefore, this guideline can be used as a reference in contouring the paracolpium and the parametrium after making some modification . We are now creating a consensus - based guideline for ctv vaginal cuff as well as the paracolpium and the parametrium (which may contain microscopic cancer cells, even after r0 radical hysterectomy), because there exists no such consensus guideline other than the rtog guideline . With regard to the internal organ motion of the ctv vaginal cuff, two institutions used the fusion ct with the bladder full and empty according to the rtog protocol, while others contoured the ctv vaginal cuff based on one ct series, adding 510 mm internal margin to ctv vaginal cuff . The vagina is sandwiched by the rectum and the bladder, whose volume will potentially vary from time to time; therefore, it was considered to be important to make a consensus on the internal margin for the ctv vaginal cuff . Whereas all but one institution selected the small bowel or the peritoneal cavity as an oar, with four institutions contouring the peritoneal cavity and one the bowel loop, it was not standardized as to whether to contour only the bowel loop itself or the peritoneal cavity as well . In the current study, four institutions contoured the peritoneal cavity and one the bowel loop . The dose volume relationship will not be reliable if it is not consistent whether the bowel loop or the peritoneal cavity is contoured . Volume relationship was found between chronic gastrointestinal (gi) complications and dose to the small bowel loops, whereas no parameter for the peritoneal cavity was significantly associated with gi complications . On the other hand, some modification of the definition will be required if the peritoneal cavity is to be used as an oar, because part of the bowels are embedded in the retroperitoneal space, such as the ascending or the descending colon . Therefore, we will also develop a consensus - based definition of what constitutes normal structures for the post - operative cervical cancer patient . Most institutions did not employ ptv d95 as the prescription point for concern about possible dose escalation compared with the conventional dose prescription according to icru report 50 . Consequently, the rtog 0418 protocol, in which ptv d97 was used as a prescription dose, was considered to be a more aggressive prescription dose in our working group . The dose constraint for oars and preliminary compliance rates of dose constraints for oars are summarized in table 1 . Because every institution used individual dose constraints, and contouring of the small bowel / peritoneum was not uniform, a large variation in the actual compliance rate was found . Rtog 0418 reported that 6676% of patients did not meet the dose criteria for the bladder and the rectum, and the dose constraint was loosened in the next rtog 1203 protocol because it was considered to be too strict . It is, therefore, important to set achievable and clinically relevant dose constraints as well as to develop a consensus of contours for oars, especially the small bowel / peritoneum, for a future clinical trial using imrt for post - operative cervical cancer patients . The six institutions that contributed to this study were equipped with modern linear accelerators capable of doing cbct for daily set - up . It is very important to ensure accurate daily patient set - up when using imrt, which can generate a very steep and complicated dose distribution, especially when applied in such a large field as the pelvic region . If imrt is to become a standard therapy for post - operative cervical cancer, which is unfortunately still a relatively common cancer in our country, many institutions will need to update their accelerators with modern machines; this will contribute to improving the quality of radiation therapy in our country . The valuable information reported here was derived from six leading institutions in the field of gynecological oncology . This study was partially supported by the cancer research development fund (23-a-13, 26-a-4 and 26-a-28). Funding to pay the open access publication charges for this article was provided by the cancer research development fund (23-a-13, 26-a-4 and 26-a-28).
Maternal depression has adverse effects on infant behavioral, emotional, and cognitive development [17]. Studies investigating the impact of postpartum depression on child development have largely relied on correlative studies in humans . However, investigation into the mechanisms mediating the transmission of negative affect from depressed mother to child has been impeded by the lack of useful animal models . We previously characterized a mouse model with deficits in maternal care which exhibits depression - like behaviors during the postpartum period (gabrd mice). Here we utilize this mouse model to investigate the mechanisms underlying the negative impact of maternal depression - like behaviors on offspring development . Deficits in offspring development associated with maternal depression are correlated with elevated levels of stress hormones in both the mother and the fetus . Treatment of pregnant women with exogenous glucocorticoids results in deficits in child development similar to those related to postpartum depression, suggesting that the stress response may mediate the adverse effects of maternal depression on offspring development (for review see). The body's physiological response to stress is mediated by the hypothalamic - pituitary - adrenal (hpa) axis and involves the release of crh from the hypothalamus, which triggers the release of adrenocorticotropic hormone (acth) from the pituitary, ultimately resulting in glucocorticoid (corticosterone in mice and cortisol in humans) release from the adrenal gland . Although basal levels of corticosterone increase throughout pregnancy and lactation, stress - induced elevations in stress hormones are suppressed (for review see), which is thought to protect the fetus from the negative effects of exposure to high levels of glucocorticoids [13, 14]. Accumulating evidence suggests that dysregulation of the hpa axis plays a role in postpartum depression . The hpa axis may be hyperresponsive in postpartum depression, as indicated by elevated levels of cortisol, although these findings are controversial [16, 17]. More convincing evidence exists for increased levels of crh [18, 19] and acth associated with postpartum depression . Accordingly, it has been suggested that crh levels are increased in women with postpartum depression and may even be used as a diagnostic criteria for postpartum depression . Elevated levels of stress hormones in the depressed mother result in elevated levels of stress hormones in the infant and higher levels of stress hormones are associated with decreased maternal care and offspring anxiety . Therefore, it is reasonable to hypothesize that dysregulation of the hpa axis may play a role not only in postpartum depression but also in the negative impact of maternal depression on offspring development . Consistent with this hypothesis administration of exogenous corticosterone to the dams during the postpartum period induced behavioral abnormalities in the offspring . The activity of the hpa axis is governed by crh neurons in the paraventricular nucleus (pvn) of the hypothalamus (for review see). The activity of these neurons, and thus activity of the hpa axis, is tightly regulated by robust gabaergic inhibition (for review see [2426]), including tonic gabaergic inhibition mediated by subunit - containing gabaars . Interestingly, we demonstrated that a mouse model deficient in the gabaar subunit (gabrd mice) exhibit depression - like behaviors exclusively during the postpartum period and deficits in maternal behaviors . A recent study confirmed these findings demonstrating that gabrd dams provide fragmented maternal care and their offspring exhibit phenotypes similar to those subjected to early life stress . In this study, we utilized this mouse model (gabrd mice), which exhibit abnormal / fragmented maternal care and depression - like behavior during the postpartum period [8, 28], to investigate the impact of maternal depression - like behavior on offspring development and the involvement of stress - related steroid hormones . It is well known that maternal depression negatively impacts child development in humans [17]. Here we reproduce analogous deficits in offspring development associated with maternal depression - like behavior in gabrd dams which can be mimicked with unpredictable stress or exogenous corticosterone administration in wild type mice . Further, blocking crh signaling with antalarmin during pregnancy in gabrd mice prevents the adverse behavioral effects on the juvenile offspring . This study demonstrates the utility of gabrd mice in investigating the pathophysiological mechanisms of postpartum depression and implicates hyperexcitability of the hpa axis in postpartum depression - like behavior and the negative impact on offspring development . Adult (3 months old) c57/bl6 and gabrd mice were housed at the university of california, los angeles (ucla), division of laboratory animal medicine . The animals (4/cage) were housed in clear plastic cages in a temperature- and humidity - controlled environment with a 12 h light / dark cycle (light on at 6 a.m.) and were maintained on an ad libitum diet of lab chow and water . Animals were handled according to protocols approved by the ucla, chancellor's animal research committee (arc). For the pregnancy experiments, c57/bl6 and gabrd adult female mice the female was checked for a vaginal plug and placed into a separated home cage . The pregnant female was individually housed with the single litter until the pups were weaned . For the cross - fostering experiments, the mothers were removed from the native litter and swapped with a surrogate (either wild type or gabrd) immediately following delivery . The juvenile offspring remained in the home cage with the mother (or surrogate) and littermates until all behavioral testing was complete . This study utilized a stress paradigm devised by another research team, which they termed chronic ultramild stress [29, 30] and has been shown to elevate corticosterone levels during pregnancy [29, 30]. In the current study, this stress paradigm is referred to as unpredictable stress (us). Wild type and gabrd mice were subjected to unpredictable stress from d14 to d21 of pregnancy as previously described [29, 30]. Wild type and gabrd mice at d14 of pregnancy were randomly assigned to two groups: group 1 (stressed) were subjected to an unpredictable stressor (cage tilt, confinement in a small cage, overnight light exposure for a single night, soiled cage for a single 24-hour period, and difficult access to food) during the dark period for 7 consecutive days until d21 of pregnancy unless parturition occurred before at which time subjection to the stressors was immediately ceased . The stressors were alternated to prevent habituation to a single stressor . The periods of stress were separated by stress - free intervals of at least 12 hours . Group 2 (controls) were maintained in their home cage without subjection to the unpredictable stressors . Behavioral tests were performed on wild type and gabrd dams at 48 hrs postpartum, a time point which has previously been demonstrated to be associated with abnormal postpartum and maternal behaviors in gabrd mice . Behavioral tests in juvenile mice began at p21 with the open field test followed by the more stressful forced swim test 24 hrs later . P21 was chosen as the time point to test the impact of maternal behavior on the behavior of the offspring since this time point is prior to weaning and at this time the offspring still share a home cage with the mother . Depression - like behavior was assessed in wild type and gabrd dams subjected to unpredictable stress (us) at 48 hrs postpartum and in cross - fostered, cort, and antalarmin - treated offspring at approximately p21 using the forced swim test as previously described [8, 31]. Briefly, each mouse was placed individually in a glass cylinder (21 cm 12 cm), containing 9 cm of room temperature water (2225c), in which there is no escape . The latency to immobility and the total duration of immobility throughout the 6 min forced swim test were measured . The mouse was considered to be immobile when it ceased swimming and remained floating motionless, except for infrequent movements of a single hindlimb to maintain being afloat . Anxiety - like behavior was assessed in cross - fostered, cort, and antalarmin - treated juvenile offspring at p21 using the open field test . Animals were tested in the same testing area, under bright light, with no visual cues . The apparatus was cleaned with ethanol and water in between animals to prevent olfactory cues . The mice were placed into the center of the open field, which consists of a plexiglass container (40 30 40 cm) with a grid of squares (10 7) on the bottom . The amount of time spent in the center (6 3) squares was measured over a single 10 min testing period . The total number of lines crossed (beam breaks) during the 10 min test was also counted . The acute stress paradigm was utilized to measure stress - induced elevations in corticosterone in virgin and postpartum wild type and gabrd mice . An adapted protocol of the co2 exposure paradigm in adult female wild type and gabrd mice was used as an acute stressor . Exposure to 35% co2 for 2 min virgin and postpartum (48 hrs) wild type and gabrd mice were randomly assigned to two groups: group 1 (stressed) which were subjected to a single episode of co2 stress (35% for 2 min) and group 2 (controls) which were handled in a similar way as group 1 except they received air instead of air enriched with co2 . All animals were handled similarly in which their home cage was inserted into a larger ventilation box where co2 (or air in the case of controls) was administered . Blood was collected for corticosterone measurements from wild type and gabrd mice 30 min following acute co2 stress and compared to controls . Mice were anesthetized with isoflurane before whole blood was collected from experimental groups by retro - orbital bleeding between 12 and 14 hrs . Corticosterone levels were measured by enzyme immunoassay according to manufacturer's specifications (enzo life sciences) as described previously [27, 3436]. Briefly, triplicate 5 l plasma samples were assayed and compared to a standard curve using a spectrophotometer (at 450 nm). Intra - assay variability of the corticosterone assay was 7.8 ng / ml between paired samples and the interassay variability was 4.4 ng / ml for the same samples between assays . Wild type mice at day 14 (d14) of pregnancy were briefly anaesthetized with halothane until unresponsive to a foot pinch and were either sham implanted or implanted with a 21-day release 10 mg corticosterone pellet (innovative research of america, sarasota, fl). The hair from the incision site on the back of the neck was clipped and swabbed with ethanol and iodine prior to making the incision . A small 1 cm incision was made on the back of the neck and a small slow - release pellet (or nothing for sham) was placed underneath the skin using forceps without touching the external area . Pup survival was determined at postnatal day 7 (p7) and offspring behavior was assessed in the juveniles at p21 . Antalarmin was administered to gabrd mice from d14 to d21 of pregnancy in the drinking water to minimize the handling of the animals . At day 14 of pregnancy, the normal drinking water was replaced with the antalarmin solution (10 mg antalarmin/10 l ethanol/100 ml drinking water). The animals were maintained on either vehicle (10 l ethanol/100 ml drinking water) or antalarmin until d21 of pregnancy or immediately after parturition (if before d21) at which time the animals were returned to normal drinking water . This treatment strategy was previously shown to block elevations in corticosterone levels [35, 36]. Pup survival was assessed at p7 and offspring behavior was assessed at p21 . A one - way anova with tukey's post hoc multiple comparisons test was used to determine statistical significance for comparing more than two experimental groups . Student's t - test was used to determine statistical significance between two experimental groups . Here we utilized gabrd mice to investigate the impact of maternal depression - like behaviors on offspring behavior . To determine if the maternal behavior, per se, directly mediates the deficits in offspring behavior, we performed cross - fostering experiments . Immediately following delivery, the natural mothers of wild type or gabrd litters were replaced with a surrogate wild type or gabrd mother and the behavior of the cross - fostered animals was then assessed in the juvenile offspring at age p21 (figure 1(a)). Our data demonstrate that juvenile wild type or gabrd mice reared by mice exhibiting depression - like behavior during the postpartum period (gabrd mice) exhibit increased anxiety - like behavior in the open field test compared to juvenile wild type or gabrd mice reared by surrogate wild type mothers (table 1; figure 1(b)). Juvenile mice reared by gabrd mice spent less time in the center squares of the open field test compared to juvenile mice reared by wild type mothers (table 1; figure 1(b)) (n = 1217 mice per experimental group; denotes p <0.05 using a one - way anova with tukey's multiple comparisons test; f(3,54) = 7.778). However, there is no significant difference in the locomotor behavior, indicated by the number of lines crossed, between offspring reared by wild type and gabrd mothers (table 1; figure 1(c)) (n = 1217 mice per experimental group; denotes p <0.05 using a one - way anova with tukey's multiple comparisons test; f(3,54) = 2.819). These results suggest that maternal depression - like behaviors negatively impact offspring development, resulting in increased anxiety - like behavior . In addition, both wild type and gabrd juvenile mice, reared by gabrd mothers, exhibit an increase in depression - like behavior compared to mice reared by surrogate wild type mothers . Juvenile mice reared by gabrd mice exhibit a decreased latency to immobility and an increase in the total time spent immobile in the forced swim test compared to juvenile mice reared by wild type mothers (table 1; figures 1(d) and 1(e)) (n = 1012 mice per experimental group; denotes p <0.05 using a one - way anova with tukey's multiple comparisons test; latency: f(3,39) = 4.386; total time: f(3,39) = 12.61). These data demonstrate that maternal depression - like behaviors in gabrd mice during the postpartum period negatively impact offspring development and validate the use of this model for investigating the mechanisms mediating the negative impact of maternal depression on offspring development . We proposed that the abnormal postpartum behaviors in gabrd mice may be associated with altered stress reactivity during the postpartum period . Postpartum gabrd mice exhibit an increase in corticosterone levels following acute co2 stress (384.6 27.6 ng / ml) compared to postpartum wild type mice (81.0 10.4 ng / ml), virgin wild type mice (241.0 45.3 ng / ml), or virgin gabrd mice (225.6 32.7 ng / ml) (figure 2). However, there is no significant difference in circulating corticosterone levels between unstressed postpartum gabrd mice (20.5 4.5 ng / ml), postpartum wild type mice (16.8 4.1 ng / ml), virgin gabrd mice (59.9 10.6 ng / ml), or virgin wild type mice (30.7 5.3 ng / ml) (figure 2) (n = 717 mice per experimental group; denotes p <0.05 using a one - way anova with tukey's multiple comparisons test; f(8,93) = 20.94). If altered stress reactivity plays a role in maternal depression - like behaviors in gabrd mice, then we hypothesized that chronic stress would be sufficient to induce the same behavioral disturbances in wild type mice during the postpartum period . Wild type mice subjected to unpredictable stress (us) from d14 to d21 of pregnancy (figure 3(a)) exhibit a decrease in the survival rate of their pups compared to unstressed controls (table 1; figure 3(b)) (n: wild type = 12 mothers, 100 pups; wild type us = 9 mothers, 73 pups; denotes p <0.05 using student's t - test). Decreased pup survival is exacerbated in gabrd mice subjected to us compared to unstressed gabrd mice (table 1; figure 3(b)) (n: gabrd = 12 mothers, 84 pups; gabrd us: 5 mothers, 36 pups; denotes p <0.05 using student's t - test). Dams subjected to us also fail to build a nest and keep the pups at an increased distance from the mother (data not shown), similar to gabrd mice . These abnormal maternal behaviors in wild type mice subjected to the us paradigm are associated with depression - like behaviors in the dams (figures 3(c)-3(d)). Wild type mice subjected to unpredictable stress exhibit a decreased latency to immobility and an increased total time spent immobile in the forced swim test at 48 hours postpartum compared to unstressed postpartum wild type mice (table 1; figures 3(c)-3(d)) (n = 59 for each experimental group; denotes p <0.05 using a one - way anova with tukey's multiple comparisons test; latency: f(3,22) = 2.729; total time: f(3,22) = 7.874). These data are consistent with the hypothesis that altered stress reactivity plays a role in mediating abnormal postpartum behaviors . To investigate whether altered stress reactivity in gabrd mice plays a role in mediating the negative impact of maternal depression - like behaviors on offspring development, we either sham - implanted wild type mice or implanted them with a slow - release 10 mg corticosterone pellet on day 14 of pregnancy and assessed offspring behavior at p21 (figure 4(a)). We determined that corticosterone treatment does not interfere with pup delivery or litter size (7.3 0.9 pups) compared to sham implanted mice (6.0 0.8 pups) (n: sham = 9 mothers, 54 pups; cort: 10 mothers, 73 pups; denotes p <0.05 using student's t - test). Note: litter sizes were determined at the time of delivery since there is a decreased survival rate of the pups born to corticosterone implanted mice (figure 4(b)); however, all pups were alive at the time of delivery . Corticosterone levels are significantly elevated in the corticosterone implanted dams at 48 hours postpartum (192.8 50.3 ng / ml) compared to sham implanted mice (29.8 3.2 ng / ml), postpartum wild type controls (16.8 4.1 ng / ml), or stressed postpartum wild type mice (81.0 10.4 ng / ml) (n = 1015 mice per experimental group; denotes p <0.05 using student's t - test). Corticosterone treatment in the mothers at d14 was sufficient to induce abnormal postpartum behaviors in wild type mice, such as inability to build a proper nest (data not shown) and an increase in pup mortality rate due to cannibalism or neglect (table 1; figure 4(b)), similar to that seen in gabrd mice (n: sham = 9 mothers, 54 pups; cort: 10 mothers, 73 pups; denotes p <0.05 using student's t - test). Corticosterone treatment in the mother was also sufficient to induce behavioral deficits in their juvenile offspring . Juvenile mice (p21) reared by mothers treated with corticosterone spent less time in the center squares of the open field test compared to juvenile mice reared by sham implanted wild type mothers (table 1; figure 4(c)) (n = 8 mice per experimental group, 2 mice per litter in 4 different litters; denotes p <0.05 using student's t - test), indicative of anxiety - like behavior . In addition, corticosterone treatment alters locomotor behavior in the offspring of corticosterone - treated mothers, evident from the increased number of lines crossed in the open field test compared to sham implanted mothers (table 1; figure 4(c)) (n = 8 mice per experimental group, 2 mice per litter in 4 different litters; denotes p <0.05 using student's t - test). Corticosterone treatment in wild type mothers also induced depression - like behavior in the offspring . Offspring reared by corticosterone implanted wild type mothers spend an increased total time immobile during the forced swim test compared to juvenile mice reared by sham implanted wild type mothers (table 1; figure 4(d)) (n = 8 mice per experimental group, 2 mice per litter in 4 different litters; denotes p <0.05 using student's t - test). These data support the hypothesis that stress hormones, specifically corticosterone, mediate the negative impact of maternal depression - like behaviors on offspring behavior in the mouse . If altered stress reactivity in gabrd mothers plays a role in the impact of maternal depression - like behaviors on offspring development, we hypothesized that inhibiting the stress response in the mother with the corticotropin - releasing hormone (crh) antagonist, antalarmin, would decrease the anxiety- and depression - like behaviors in the juvenile offspring (figure 5(a)). We did not observe any changes in litter size associated with antalarmin treatment (7.6 0.9 pups) compared to vehicle treatment (6.5 0.8 pups). This dose of antalarmin was sufficient to decrease the stress - induced circulating corticosterone levels in postpartum gabrd mice (101.5 12.0 ng / ml) to levels similar to postpartum wild type mice (81.0 10.4 ng / ml) which is significantly lower than the stress - induced levels in postpartum gabrd mice (384.6 27.6 ng / ml). Gabrd dams treated with antalarmin exhibit an increase in pup survival compared to controls (table 1; figure 5(b)) (n: gabrd vehicle = 8 mothers, 52 pups; gabrd + antalarmin: 9 mothers, 68 pups; significance was determined as p <0.05 using student's t - test). Further, antalarmin treatment in the mother was also sufficient to ameliorate the mood disorders in juvenile mice reared by gabrd mothers . Juvenile mice (p21) reared by gabrd mothers treated with antalarmin spent more time in the center squares of the open field test, which is indicative of decreased anxiety levels, compared to juvenile mice reared by vehicle - treated gabrd mothers (table 1; figure 5(c)) (n = 810 offspring per experimental group, 2 mice per litter in 4 - 5 different litters; significance was determined as p <0.05 using student's t - test). There was no significant difference in the number of lines crossed in the open field test between the offspring of antalarmin - treated and vehicle - treated gabrd mothers (table 1; figure 5(c)). Similarly, offspring reared by antalarmin - treated gabrd mothers exhibit decreased depression - like behavior, evident by an increased latency to immobility and decreased total time spent immobile compared to offspring reared by vehicle - treated gabrd mothers (table 1; figure 5(d)) (n = 810 mice per experimental group, 2 mice per litter in 4 - 5 different litters; significance was determined as p <0.05 using student's t - test). These data demonstrate that inhibiting the stress response, such as with the crh antagonist, antalarmin, is therapeutic in ameliorating the abnormal postpartum behaviors in gabrd mothers as well as preventing the negative impact of maternal depression - like behaviors on offspring development . This study highlights the utility of a unique mouse model to investigate the underlying mechanisms mediating the pathophysiology of postpartum depression and the mechanism(s) through which postpartum depression negatively impacts offspring development . It is generally accepted that both genetic and environmental factors play a role in the pathophysiology of postpartum depression . However, either the current animal models exhibit a genetic predisposition for depression - like behavior or the behavior is environmentally induced . Here we describe a genetic mouse model exhibiting depression - like behavior that is restricted to the postpartum period, which is aggravated by environmental stress similar to the human condition . This is the first genetic mouse model which exhibits a predisposition to postpartum depression - like behavior in which there is also an environmental component . Therefore, we feel that this is a useful model for studying the mechanisms mediating postpartum depression - like behavior and the accompanying deficits in offspring development . Clearly, hormone changes throughout pregnancy and the postpartum period trigger the onset of postpartum depression . However, gonadal hormone levels do not appear to be significantly altered in women with postpartum depression [3941], suggesting that women must be predisposed to the disorder . During pregnancy, levels of estrogen and progesterone steadily increase due to placental production of these hormones, which decrease abruptly with the removal of the placenta . However, no change in estrogen or progesterone levels has consistently been shown to be associated with postpartum depression . There are numerous other hormonal changes that occur during pregnancy, including changes in oxytocin, prolactin, and cortisol levels (for review see). However, no alterations out of the physiological range were found for prolactin [41, 43], oxytocin, or vasopressin associated with postpartum depression . Hypercortisolism has been suggested to play a role in the pathophysiology of postpartum depression, since major depression is also associated with hypercortisolism . Normally, the stress - induced activation of the hpa axis is suppressed during pregnancy (, for review see), consistent with our observations in postpartum wild type mice (figure 2). Altered levels of cortisol [11, 18, 48], acth, and crh have been associated with postpartum depression . Researchers have gone so far as to say that elevated crh levels may be used as a diagnostic criterion for postpartum depression . However, other studies have failed to reproduce these results ([41, 43], for review see). Here we demonstrate hyperresponsivity of the hpa axis associated with depression - like behaviors during the postpartum period in a mouse model, similar to what has been observed in women with postpartum depression . Consistent with a role for hpa axis hyperresponsiveness in postpartum depression - like behaviors, this study supports a role for elevated corticosterone in the pathophysiology of postpartum mood disorders, since physiological stress is sufficient to induce depression - like behavior during the postpartum period in mice (figure 3). Previous studies have demonstrated that corticosterone alters maternal care and induces postpartum depression - like behaviors in the dams . Here we demonstrate that exogenous corticosterone treatment in wild type mice during pregnancy results in a robust decrease in pup survival (figure 4). This has previously been observed, albeit not to the same extent as in the current study . The discrepancy may be due to a prolonged exposure in our study to levels of corticosterone normally found in stress . However, we cannot rule out potential abnormalities in the pups due to corticosterone exposure which may impact pup mortality . Interestingly, our study demonstrates that physiological stress in the dams is sufficient to increase pup mortality in both wild type and gabrd mice (figure 3(b)). However, unpredictable stress does not alter depression - like behaviors in postpartum gabrd although it increases depression - like behaviors in wild type mice (figures 3(c) and 3(d)). We interpret these data to indicate that physiological stress is incapable of altering depression - like behaviors in postpartum gabrd mice in which corticosterone levels are already elevated, demonstrating a potential ceiling effect . Similarly, our results demonstrate that the crh antagonist, antalarmin, increases pup survival in gabrd mice (figure 5). These data demonstrate a direct role of stress hormones in postpartum mood disorders and may contribute to the negative impact of maternal depression on offspring development . Children exposed to mothers with postpartum depression exhibit deficits in cognitive development, motor, and emotional development (for review see). Many mechanisms have been proposed to mediate the negative association between maternal depression and offspring development, including environmental and genetic components . It is also possible that there is a direct, biochemical component of maternal depression which impacts offspring development . Deficits in child development associated with maternal depression are correlated with elevated cortisol levels in the mother [53, 54], suggesting that the stress hormones may play a role in the negative impact of maternal depression on child development . Consistent with this theory, we demonstrate behavioral deficits in mice reared by gabrd mothers, which exhibit hyperresponsiveness of the hpa axis, and offspring reared by wild type mice subjected to us or treated with exogenous corticosterone . Further, corticosterone treatment in dams has previously been shown to result in adverse behavioral effects in the offspring, which could be a direct effect of corticosterone levels in the offspring which may alter subsequent hpa axis activity . These data support a direct role of stress hormones in both the pathophysiology of postpartum depression and the negative impact of maternal depression on offspring development . In the current study, the mouse models which exhibit abnormal postpartum behaviors and a negative impact offspring development, including gabrd mice and wild type dams subjected to unpredictable stress or treated with exogenous corticosterone, exhibit a high degree of pup mortality due to cannibalism and/or neglect . This is in contrast to the human condition of postpartum depression which is not typically associated with infant mortality or infanticide . Neonaticide and infanticide are more commonly associated with postpartum psychosis . However, this is difficult to assess in mice and requires further study . Due to the high level of pup mortality in the mouse models exhibiting abnormal postpartum behaviors and a negative impact offspring development, including gabrd mice and wild type dams subjected to unpredictable stress or treated with exogenous corticosterone, we cannot rule out both the impact of changing litter size on maternal behaviors and the impact on offspring development . Relevant to the current study, smaller litter size is associated with more directed maternal care [57, 58]. Further, mice reared in smaller litters also exhibit decreased anxiety - like behaviors during adulthood . These findings are in contrast to the current study where we observe a decreased litter size in gabrd litters associated with abnormal maternal care and increased anxiety- and depression - like behaviors in the offspring reared by gabrd mice (figure 1). Thus, it does not appear that litter size impacts the findings in the current study . This study directly demonstrates the negative impact of postpartum depression - like behavior and deficits in maternal care on offspring behavior . Further, our data suggest a role for hpa axis dysfunction in mediating the negative impact of maternal mood on offspring behavior.
Increasingly, gerontological researchers, practitioners, policy makers, and planners are concerning themselves with the growing importance of aging in place . Aging in place does not have one single definition but broadly is considered to be the ability to continue to live in the environment of one's choice, even when declining competence reduces or threatens independence, while allowing for consumer choice in the types of services delivered . Lawler suggests that aging in place strategies can minimize inappropriate care and work best as a comprehensive and holistic approach to the needs of aging individuals and communities . Lau and colleagues have conceptualized a framework for aging in place safely and acknowledge the importance of multiple factors, including the biological and psychological characteristics of the individual, the network of social support, formal services, the need for medical services, and the structure of the home and neighborhood . This and other frameworks clearly recognize that aging in place strategies must consider not only the personal (micro) environment, including housing, but also community and structural components as well [4, 5]. Before embarking on a discussion of elder - friendly communities, it is important to discuss a number of theoretical frameworks and conceptualizations from gerontology that help inform our understanding of aging in place . There are numerous frameworks that are relevant to aging in place including ecological theory, person in environment, and social inclusion / exclusion . In addition, the area of environmental gerontology has specific relevance to this discussion . Ecological theory suggests that there is a mutual relationship and mutual reciprocity between individuals and their environment and that this interaction occurs at multiple levels, including the micro-, exo-, mezzo-, macro-, and chronosystems levels . Ecological theory is important for the concept of aging in place as it suggests that individuals interact with multiple levels of environment in their day - to - day lives . Older people must not only interact with microenvironments such as their home and immediate family, but also with broader systems that can equally influence their ability to age in place . This perspective, like ecological theory, acknowledges that the environment interacts with individuals at multiple levels and suggests that the environment is not a static backdrop but rather continually changes . From the person - in - environment perspective, the older person must continually take from the environment what he or she needs, control what can be modified, and adapt to conditions that cannot be changed . Also of relevance to, the theory of social inclusion / exclusion examines the role of older people and highlights the social costs when individuals, families, or communities are excluded from or become disengaged from larger society due to characteristics such as poverty, gender, ethnicity, or neighborhood . Scharf and colleagues conceptualize the inclusion and exclusion of older people as associated with three key themes: participation and integration (beyond the labor market), spatial segregation, and institutional disengagement . Of particular interest in our exploration of aging in place is the thematic area of participation and integration . Posit that participation and integration not only include older people's involvement in community life, but also are associated with their social capital, including civic participation, and the nature of social networks and mutuality / reciprocity . In addition to several theoretical frameworks, the field of environmental gerontology has specific relevance to the topic of aging in place . Wahl and weisman suggest that environmental gerontology's (eg) theories and findings can and should influence the development of age - friendly communities . For example, eg is concerned with the role of neighborhoods and the influence those neighborhoods have on opportunities and constraints of residents . At a more macrolevel, eg recognizes the community as a locus of aging with a sociophysical and policy perspective . With regard to elder - friendly communities, we can draw upon the work of lawton who posited that the environment has three major functions of maintenance, stimulation, and support . Maintenance is concerned with the consistency and predictability of one's environment, while stimulation is concerned with the effect of stimuli on behavior . Finally, support is concerned with the environment's potential to compensate for diminished or lost competencies . In recent years, the concept of elder - friendly communities has become central to the notion of aging in place . Described in various ways, an elder - friendly community is a place where people can live their entire lives, if they so desire, rather than having to relocate and lose their social capital [14, page 6]. An elder - friendly community examines the environment in more macro - level terms as places where older people are actively involved, valued, and supported by an infrastructure that accommodates their needs . In what was perhaps the first on - line conference focusing on elder - friendly communities, the sierra health foundation suggested that elder - friendly communities are those communities in which age is not considered a barrier to improving lifelong interests and activities, where support and accommodations exist to meet the basic health and social needs of those with age - related disabilities, and where opportunities exist for older adults to develop new sources of fulfillment and engagement . While the literature on elder - friendly communities is to a degree embryonic, several models have been developed in recent years . Among these models created in the united states, canada, and europe, for example, feldman and oberlink's work on the advantage initiative demonstrated that elder - friendly communities must address basic needs, optimize well - being, maximize independence, and promote civic engagement . The city of calgary elder - friendly community project noted that feeling safe, being valued and respected, staying active, and building community were important elements of an elder - friendly community . The world health organization (who) has established international guidelines for age - friendly communities that include the encouragement of active aging by optimizing opportunities for health, participation, and security in order to enhance people's quality of life as they age . According to the who, an age - friendly city adapts its structures and services to be accessible to, and inclusive of, older people with varying needs and capacities . While various models have emerged identifying aspects key to the concept of elder - friendliness, a consistent theme found in the literature is associated with social interaction or social connectedness . An elder - friendly community will assist older adults to maintain social connectedness while deepening existing relationships . Such a community will recognize the social capital of these relationships that in turn result in contribution . The concept of contribution recognizes the wisdom and experience of older citizens and sees them as more than clients, but rather as active contributors to community well - being . Similarly, the calgary project identified as important the active participation of older people in their communities . This premise is consistent with the work of rubinstein and colleagues who found that the ability to actively manage one's environment was a source of well - being for older adults . Similarly, the model of age - friendly communities developed by the who clearly recognizes that social participation and social support are strongly associated with overall well - being, allowing elders to exercise their competence and enjoy the respect and esteem of their community . Alley and colleagues remind us that a community's respect for older adults, which includes available opportunities, contributes significantly to their quality of life . While social participation and connectedness are important in an elder - friendly community for example, the advantage initiative promotes the importance of civic engagement, including meaningful connections, volunteer and paid opportunities, and the prioritization of aging issues . The who acknowledges that an age - friendly community provides the option for older adults to continue to contribute to their community through civic engagement with both paid and volunteer opportunities and to have the ability to be active in the political process . The benefits of such reciprocity are many, such as an increased sense of purpose and satisfaction for older adults as they engage with the community, while younger community members may benefit from the knowledge and experience older adults bring to the community . As an example, intergenerational programs recognize the knowledge and skills possessed by older adults that can be shared with youth, while providing opportunities for civic engagement for the older person . Much of the research on elder - friendly communities has highlighted the multidimensional nature of community life and has not focused primary attention on social connectedness despite the importance of interdependence and engagement as primary qualities of aging in community . For example, the advantage initiative identifies social and civic engagement but used quantitative measures to evaluate communities in three preordained realms . If an age - friendly community is a positive place to grow old, then the views of younger citizens (baby boomers, for example) need to be taken into account . Alley and colleagues suggest that in an age - prepared community, processes of planning and advocacy are utilized to foster aging in place, which may be a prospective view of what is needed in planning for future community needs . This process must take into account the views and needs of the citizens who are not yet defined as older adults, but who will bring their own needs and views to the community . The purpose of this paper is to further elucidate the importance of social relationships and social connectedness in developing an elder - friendly community . The process used in the project described here was inclusive of younger adults (age 4065) as well as older adults (65 +) in order to help understand how they envision a community that could support their own aging . Community [15, page 8] as one which has assessed its current services and is planning for the needs of future populations . Second, the qualitative methodology used in this study allowed for a more naturalistic and personal narrative . Padgett acknowledges the importance of meaning making in the narrative process that includes storytelling, conversation, and discourse of naturally occurring speech . This study, therefore, was informed by the perspective of narrative analysis and the use of the spoken and written word in narrating the meaning of social connectedness as we age . In april of 2002, surveys related to assessing the elder friendliness of communities were completed by 5.100 individuals, 65 and over, throughout 10 cities across the united states . In one participating community in western washington, findings suggested that older adults in that community were satisfied with their neighborhoods and participated in religious or cultural activities, and the majority of respondents were engaged in health screening . The vast majority of these respondents had participated in some type of social activity in the past week and slightly fewer than one in three people volunteered . The survey results were promising and positive, yet are now dated and do not reflect the opinions of members of the aging baby boom generation . Second, the original survey did not focus specifically on the issue of social connectedness but limited the focus to volunteering and participation in cultural and religious activities . Recognizing the need to better refine and focus attention on the importance of social connectedness as part of elder - friendly communities, a city committee responsible for the continuation of the elder - friendly community agenda sponsored a community forum in october of 2009 . A community forum using the world caf format was conducted in order to engage community members, 40 years and older, in conversation about the importance of social connectedness in elder - friendly communities . Previous research in this area has approached the topic of social connectedness through an a priori definition of social engagement, primarily utilizing quantitative methods for measurement and evaluation . This forum, however, sought to understand social connectedness from those approaching retirement using a more naturalistic method . A second purpose of this forum was to obtain data on what would keep aging boomers in their community as they age . The results of the forum and its applicability to elder - friendly communities and aging in place research are being presented here . The world caf is a concept that was born out of appreciative inquiry, which is a form of research that emphasizes the positive aspects of an experience, particularly how that experience can foster creativity among people . The world caf format involves exchanging ideas and sharing different points of view in a safe, intimate setting with the purpose of coalescing wisdom and experience into learning . A foundational component of the world caf concept is conversations, purposeful conversations that have a reason for taking place, conversations that matter [25, page 4]. They may be initiated to solve a community problem or to envision a preferred future, in this case an elder - friendly community, with a focus on social connectedness . The world caf format places an emphasis on moving from simply talking to taking action . This movement takes place as participants are able to understand the connection between talking and acting, or conversation as action . It was in this context of sharing collective discoveries [25, page 138] that the community forum took place . This study provided an opportunity to test the value of the world caf format as a method for future research . This study was determined to be an exempt study by the university of washington human subjects division . The method employed for this study involved a melding of the world caf format as the structure of the study with a focus group format as the process that informed data collection in the study . First, groups formed, discussed, and reformed with different participants for each of the three main questions that were posed at the forum . Second, instead of the more customary audio or video taping of the groups, each table was covered with paper on which participants wrote and/or drew as they discussed the topic at hand . These notes and doodles became the transcript along with notes taken by each table leader . This is consistent with narrative analysis in which both spoken and written words are used in meaning making . Finally, groups were given great latitude as to how they addressed the discussion topic for their table . The discussion leaders at each table helped to keep the group on topic and were careful not to inject their opinions into the group discussion . The setting for the study was a community forum for those over 40 years of age living within the school district boundaries of a suburban community in western washington with a population of approximately 37.000, whose residents are predominately caucasian (87%). The forum included refreshments, and people were invited to sit at one of several round tables covered with paper for writing thoughts as they occurred to the participants . The conversation at each table began with the posing of one of three questions, with ample time allowed for each table group to discuss, strategize, and imagine a preferred future in an elder - friendly community . The three questions were as follows (1) what does it mean to you to be socially connected? (2) how can our city help with life transitions that would keep you in this community? These three questions were developed through consensus by the city level committee charged with examining issues and processes that enhance an age - friendly community . The questions were designed to determine how people define and make meaning of being socially connected, to identify aspects of community life that would reinforce continuity with the community versus relocation to another community after retirement, and to ask participants to think about their own value to the community, thereby initiating thought around the idea of social reciprocity . Conversation was not limited to only the question at hand, and participants were invited to speak, draw, and write about the broader topic throughout the session . At set times, participants were asked to move to a different table, to be with a different group of people, and to consider a different question, until all three main questions were answered by most of the participants . One member from each table stayed behind during the rotation in order to serve as an ambassador for the previous members, thus assisting in continuity of conversation . A goal was to allow participants to engage creatively as they tackled the questions together . So, rather than gather individual feedback, table leaders encouraged participants to converse with each other and to spend time thinking together about potential solutions to dilemmas as they were raised by group members . Once the group session was completed, participants were invited to gather into a large group to debrief and discuss the most important topics from the perspectives of the participants . A purposive sample of people over age 40 was recruited through newspaper ads and invitations from the city parks and recreation department and through the aging in place committee (aip) membership . Membership lists from the senior activity center and local faith communities also served as sources for potential participants . The invitation requested community members to participate in a community forum to discuss how to create, promote, and maintain a more elder - friendly community . Ultimately, 23 individuals participated in the community forum and ranged in age from midforties to late eighties . Participants therefore represented both those who might be identified as baby boomers as well as those who are currently retired and may be defined more traditionally as older adults . We did not collect specific data on age, but some participants offered their age as part of the conversations . Since this was originally conceived by the aip committee as a community forum and not a research project, no additional sociodemographic data were collected on socioeconomic status, education, or other typical variables associated with creating a demographic profile . Following the world caf community forum, researchers were asked to analyze the data from the event in order for the aip committee to present findings and make recommendations to city government officials . No identifying information about participants was included with the data provided for analysis . Using an approach consistent with grounded theory first, they met together and carefully reviewed the data from each of the questions . They used an open coding process for notes of verbal exchanges, drawings and notes from participants, and memos from group leaders . The few illegible writings and unrecognizable doodles were dismissed from the analysis process . As categories began to emerge, the researchers engaged in conversation about meanings and interpretations, until they were satisfied they had a clear understanding of the data . In order to confirm that trustworthiness of the data was maintained, once the themes were identified, the aip committee reviewed the findings and then invited all of the original forum participants to attend a focus group to discuss the findings . The focus group was held in the same location as the community forum approximately two months after the forum was convened and was made up of five individuals (approximately 20% of forum members). Like the forum participants, most focus group participants were female and caucasian, with one or two individuals representing communities of color . The focus group participants reviewed, clarified, and added data to the transcripts and confirmed that the themes identified by the researchers were reflective of the community meeting . The review by the focus groups provided credibility and trustworthiness (validity) to the qualitative findings, reinforcing a fit between the respondents' views and the researchers' interpretation as well as being confirmatory, for example, demonstrating that the study's findings were not imagined . This process, known as member checking, not only serves to validate findings but is empowering to the participants and reinforces the close relationship between the researchers and the informants in qualitative research . The researchers identified three major themes that emanated directly from the data and were confirmed by the focus group . All three themes emerged from the open coding and were ultimately labeled as follows: social reciprocity, meaningful interactions, and structural needs / barriers . This theme was directly related to the overarching focus on social connectedness but illustrated the importance of added value in these relationships . Within the theme of social reciprocity, giving and receiving to / from one's community were both seen to be of equal importance . Some participants were currently volunteering or communicated an interest in doing so (giving). While exact ages were not available, it appeared that older adults (65 +) were more likely to be active volunteers than their younger counterparts . Baby boomers expressed interest in volunteerism, while older adults may have already engaged in that process if they were interested . Many participants expressed an interest in receiving through such things as enhanced educational opportunities (e.g., more age - friendly options from the local community college and public university). The idea of educational opportunities at no or low cost was initially mentioned by younger participants . Participants also indicated that venues for creating social connectedness could come from both formal and informal entities . Formal entities are those which would require some infrastructure involving an organization or business, such as theater, outdoor concerts, or free movie nights . An example might be the initiation of social activities through city government, the local chamber of commerce, or even a local business . Informal entities would include activities that require limited resources, such as the creation of book clubs or neighborhood gatherings . Participants also suggested that such activities aimed at increasing social connectedness could be sponsored or influenced by community resources . For example, through the senior activity center, the city might sponsor a new boomer or senior walking group . The city government, for example, could attempt to influence the policy of a not- for- profit community organization regarding how cumbersome and degrading the process is for older adults with limited income to obtain reduced membership fees . For example, a nongovernmental organization such as a church could recruit older volunteers from their congregation to volunteer in local schools . The theme of social reciprocity can and should conceptually occur at multiple levels, such as between governmental and nongovernmental organizations, as well as between individuals and their community . In all aspects of the data, reciprocity (the mutual exchange of commercial or other privileges) was exemplified as the willingness to give and receive in order to foster social connectedness . Inherent in the discussion of social reciprocity was the notion that the relationship between the individual older persons may occur at multiple levels of community and environment . Relationships and mutual exchange might occur at the level of neighborhood, a community organization, or at the level of city government or policy advocacy . For example, some forum participants suggested helping others by providing space for a communal garden (neighborhood), while some suggested that developing a volunteer position to work as a senior ombudsman related to negotiating city services would be beneficial to the whole (city government level). This exchange improves the well - being of those being helped while fostering a sense of accomplishment and service . While participants discussed the desire to give and receive in order to maintain social connectedness, they were clear, however, that these experiences should be meaningful both to themselves and others . While a high number of forum participants expressed a desire to volunteer in their community, they clearly stated that the activity should be meaningful to them and important to the community . This sentiment communicates the view that these individuals see themselves as having social capital (whether or not it is recognized by others). As one participant put it, we should all volunteer, even if it is in the home the participants shared a collective view that the purpose of volunteering was not to kill time . Rather, participants were interested in sharing their passions, time, sense of history, and even sharing personal space to accomplish this end . One participant suggested that people share their gardens with others or help others to do crafts in their homes . Participants also viewed volunteering as a way they could advocate for others and for their community . Finally, if participants were to be involved in meaningful interactions through volunteering, they wanted to feel appreciated for the work they did . They voiced the concern that organizations often diminished or ignored the value of their time as volunteers and took volunteers for granted . It is important to note here that forum participants did not suggest they wanted to volunteer for the sake of recognition, but rather they felt the need to be valued not taken for granted . The message that was communicated by forum participants was that they desired both the organization / community in which they served as well as themselves to view their contributions as meaningful . While speculative due to a lack of specific data on age, the older participants appeared more settled in their roles as volunteers, as many of them had held these roles for some time . Younger adults (boomers) appeared to have more concerns about the meaning they derived from volunteer opportunities and how that may be accomplished . While the majority of participants provided feedback on what or how they could contribute to their community to enhance social connectedness, a similar number of people voiced substantial frustration with the lack of either organized opportunities or communication with potential organizations with which to volunteer . These issues were impediments to social reciprocity as well as to meaningful interaction, and as such were labeled as structural needs or barriers . Structural (infrastructural) needs or barriers were those things participants viewed as currently lacking in the community but, if present, would facilitate social reciprocity both in terms of physical and social venues . For example, many forum participants expressed the need for improved methods by which potential volunteers could be connected to opportunities (community entities). The examples that were given included organizations that needed volunteers should return phone calls more promptly to potential volunteers, as well as the need for more personal connections between those requesting volunteers and the people who might be willing to give of their time . They were not interested in having to make numerous inquiries to potential organizations in order to volunteer . The feeling expressed was that there was a lack of reciprocity from the very beginning on the part of agencies or organizations with which these individuals might wish to volunteer . Transportation was described as an additional structural barrier and was mentioned frequently in all table conversations . Transportation was viewed as an essential element of social connectedness . In areas of both volunteerism as well as overall social connectedness, transportation issues associated with public transit and walkable communities issues concerning transportation included that a lack of reliable, frequent, and accessible transportation created barriers for participants within the community . The view communicated by these participants was that improved transportation can foster and enhance social connectedness by decreasing barriers of distance and reducing the need for use of one's personal vehicle . While younger participants voiced interest in improved transportation as a means toward improved social connectedness and as an environmentally friendly alternative to automobiles, older participants expressed a more urgent need for improved transportation, as well as having a more specific personal need . For example, one couple who was likely in their 70s expressed the need for improved transportation services for their parents (in their 90s) as they identified gaps in transportation services as personally problematic . The purpose of this research project was to analyze data gathered from aging individuals (including baby boomers) on the importance of social connectedness in the creation of elder - friendly communities through a naturalistic method of inquiry . By engaging in a more naturalistic conversation utilizing the world caf format, the participants in the study were able to utilize conversation in meaning making without the confines of any a priori assumptions about social connectedness . The findings from this community forum and the subsequent focus group reinforce earlier data from the original advantage initiative as well as other literature on elder - friendly communities and point to the utility of several important theories . First, these findings echo the original framework from the advantage initiative, which emphasizes the importance of social and civic engagement . The individuals from this community forum, as well as the elder counterparts in the original study, underscored the importance of meaningful connections to family, friends, and neighbors as part of civic engagement . An elder - friendly community needs to find new ways to promote active and continual engagement in community life . The findings from this study parallel the view of scharlach who suggests that as we get older and ever closer to the end of our lives, maintaining social connectedness and deepening existing relationships becomes a priority [14, page 9]. These findings also reinforce the importance of participation and integration, which is a critical element of social exclusion theory . Forum participants identified multiple activities associated with social inclusion / exclusion including production (economic or socially valued) activity, political activity to improve or protect the social environment, and social activity that involved engagement with family, friends, and community . Scharf and colleagues define participation and integration as older people's embeddedness in social networks and the extent to which older people contribute to or draw upon social capital that exists in their neighborhoods [8, page 316]. Thus, our findings related to social reciprocity appear consistent with the major theme from social inclusion / exclusion theory . A community needs to be dynamic in order to support changes in the older citizenry . While the concept of support is typically relevant to adjustment to altered or lost competencies, the concept of support can be extended to include the need for continued and changing modes of social and civic engagement . This study also reinforces both the importance of volunteer opportunities and that those opportunities be purposeful and meaningful . As suggested by scharlach, in an elder - friendly community, older adults are not just seen as clients or passive recipients of services, but active contributors to the well - being of the community [14, page 9]. In the original advantage survey, residents from this community volunteered at a rate substantially lower than the national average for the 10 advantage communities . What we learned from this study was that aging community members held interest and motivation to volunteer or otherwise be engaged in their community . We believe they see themselves as having social capital, but as putnam points out, others may not always share their view . The environmental function of stimulation is relevant here as participants seemed to look to their community for stimuli for enhanced social well - being and to elicit new and relevant social and leisure behaviors . Older participants appeared more likely to have volunteer and community activities in place, while younger adults (boomers) were perhaps seeking out methods for accomplishing that goal . Both younger and older participants also noted structural barriers to social connectedness and social integration, supporting alley et al . Who suggest that while communities may be able to support aging in place, they may also contain barriers that make community living difficult for older residents . A recent study of 253 older adults reinforces the importance of organizational structure in volunteerism . Tang et al . Found organizational support (defined as choice of volunteer activity, training, and ongoing support) to be associated with socioemotional benefits, including perceived contribution and personal benefits . These researchers concluded that the psychological well - being of older adults can be improved through engagement in meaningful volunteer activities and contribution to others [30, page 603], again reinforcing what rubinstein and colleagues noted concerning the connection between well - being and active environmental management . In order for these benefits to occur, however, an elder - friendly community must work to eliminate structural and organizational barriers to volunteerism and social connectedness . As scharf and colleagues assert, participation and integration are enhanced by good public service such as access to reliable transportation . To not provide such services serves to reinforce the social exclusion of older people . The identification of structural barriers also reinforces the person - in - environment perspective that the needs of older people change over time and must be successfully navigated in order to maintain social integration . If a community is to be elder - friendly, the infrastructure needs to be consistent and predictable at the very least, while at the same time dynamic in its ability to provide stimulation and support . Community - based research is particularly useful when it is able to identify problems and move toward a resolution of that issue . Researchers can partner with communities to study areas of interest, interpret results, and assist in the empowerment of community members to make changes . The findings from this study have already resulted in community level change efforts related to volunteerism . An annual volunteer fair was initiated in 2010 with the goal of creating a venue to match older volunteers with community level volunteer opportunities . This newly formed activity grew directly out of the identification of structural barriers in this research and was created through a partnership of senior advocates, the community's aip committee, and local organizations, including the area hospital . In the first year of operation, more than 80% of older adults were successfully matched with local organizations, thus improving social connectedness, integration, and reciprocity in a direct and clear way . This event has now been established as an annual event sponsored by seniors, city government, and other community entities . Its goal is to improve civic engagement among older residents, thus fostering the connectedness between older residents and organizations that serve the community . In addition to the importance of civic engagement, the philosophy of aging in place supports the continued importance of maximizing independence for not only the frail and disabled, but for aging adults of all abilities . In particular, these findings point to the need for accessible and available transportation, an issue that city officials and community advocates should attempt to improve through partnerships . As feldman and oberlink noted in their original findings, transportation and safety are fundamental factors that enable older adults to stay connected to the community [17, page 5]. Rosenbloom suggests that transportation in elder - friendly communities will need to be planned to provide more customized services, linking residential concentrations with important destinations, including volunteer opportunity destinations . The project findings noted that while all participants voiced the need for improved transportation services, the kinds of services desired may change with age . The lack of this kind of transportation was clearly identified as a major structural barrier reinforcing social exclusion and needs to be considered as future planning takes place . With impending cuts to public transportation, the aging in place committee is examining potential alternatives to improve transportation through private and voluntary means . The results of this study provide important information on social connectedness in elder - friendly communities . First, as a qualitative and naturalistic study, the findings are the specific views of those individuals involved and cannot be generalized to any larger population of aging adults . Second, a further limitation is that those who responded to the invitation to participate in the community forum may have had a greater interest in the topic, or a vested interest in having their voices heard as compared to those who did not or could not attend . However, the study results provide a new dimension to the subject area and support previous studies and theories on aging in place, thus adding to the picture of what needs to be done to support the creation of elder - friendly communities . Because of the homogeneous makeup of forum participants, the voices of other communities such as communities of color were not clearly heard . It must be acknowledged that the opinions and concerns of this group do not likely represent all older adults in this community . Finally, because sociodemographic data was not collected on individuals, distinctions between older (65 +) and younger participants are based upon educated guesses about participant's age . The results of this study reinforce the importance of social connectedness, participation, and integration in creating and maintaining elder - friendly communities and suggest that the findings are areas of concern not just for the old - old, but for recent and soon - to - be retired individuals wishing to maintain life satisfaction . The study suggests the possibility of using more nontraditional research techniques for gathering community level data such as the kinds of findings generated from the world caf process . While creating and fostering elder - friendly communities can be a long and ongoing process, small incremental change can occur from such studies as is illustrated by the case of the annual volunteer fair now established in this community . If a national agenda of enabling our aging population to age in place is to be accomplished, creating elder - friendly communities has a logical and important role . Scharf et al . Suggest an important association between social connectedness and quality of life . They found that older people who rated their quality of life as good were less likely to experience social exclusion . For aging in place to happen successfully, with older adults being continually valued and integrated into community life, city officials, policy makers, and gerontological researchers will need to collaborate in order to move these ideas from research to reality.
Lotus (nelumbo nucifera) belongs to the family of nelumbonaceae, all parts of which are edible in various forms . It is generally consumed as vegetable; chiefly the stem part is processed in different forms such as roasted, pickled, dried, and fried . The plant exhibits multiple nutritional and medicinal properties, hence considered as a popular health food . The alkaloid (liensinine) extracted from the stem is effective in treating arrhythmia, sunstroke, fever, dysentery, diarrhea, dizziness, and stomach problems . Its seeds find applications in folk remedies as a diuretic, cooling agent, antiemetic, and an antidote in the treatment of tissue inflammation and cancer . Biochemically, the rhizomes are composed of proteins, fats, carbohydrates, and minerals and are a good source of energy . Starch is considered to contribute to the textural properties of various foods and has several industrial applications as a thickener, stabilizer, adhesive, gelling, and water retention agent . Lotus is loaded with starch, which is commercially available in china and japan having numerous industrial applications as thickening agent in food products . Scanning electron microscopy of lotus stem starches revealed small rounded and typical oval shaped granules with a smooth surface . Swelling, solubility, and water absorption were improved with increasing temperature from 50 to 90c . Consumer preferences lead to the consumption of lss in preparations such as breakfast meals, fast foods, and traditional confectioneries and also the utilization of lss as potential food additives . Processes such as extrusion, baking, and pressure - cooking which employ heat - moisture treatment with pressure and shear have foremost applications in production of snack foods, ready - to - eat (rte) foods, breakfast cereals, and porridge . High proportion of starch is employed in formulations involving gums, salts, and sugars as potential ingredients to carry out reaction with starch in presence of water subsequently modifying its physicochemical properties . Hence, this interaction between additives and starch is of immense concern to food scientists . Hydrocolloids (gums) are utilized in food industries since they improve stability, modify textural profile, and reduce the retrogradation rate of the starch . Mandala and bayas investigated the effect of xanthan gum on swelling power, solubility index, and granules status of wheat starch dispersion (2% w / w). According to swelling power values and granules dimensions at 75c, xanthan addition enhanced swelling . Foods containing starches hold usual nature of changing the physicochemical properties frequently by addition of salt and sugar during food processing and storage . Rice starch with high content of amylopectin exhibits better swelling properties, while salt addition reduces it considerably . Sugar affects color, flavor, dimension, hardness, and surface finish of the food product . Sugar tends to disperse the protein and starch molecules making the product fragile, thereby preventing the formation of a continuous mass . Jin et al . Reported decreased water solubility index of corn meal on sugar addition due to inhibited degradation of the starch molecules in presence of sucrose . So far, there is no information on the effect of such additives on the physical properties of lotus stem starch . Hence, the aim of this study was to determine the effect of additives, that is, acacia gum, nacl, and sucrose on the physical properties such as water absorption (wa), water absorption index (wai), and water solubility index (wsi) of lotus stem starch (lss) employing response surface methodology (rsm). Sucrose was procured from sisco research laboratories private limited, mumbai, acacia gum was procured from merck specialties private limited, and nacl was procured from loba chemie private limited, mumbai . Starch granules in native form were extracted using the method of wei et al . With slight modification . Lotus stems were washed and then peeled to scrape off the outer skin and the peeled stems were then cut into small pieces . The small pieces were then homogenized with ice - cold water in a home blender followed by squeezing of the homogenate through four layers of cheese - cloth by hand . The fibrous residue was blended and squeezed twice with ice - cold water to facilitate the release of starch granules from the fibers . The starch was then extracted by washing four times with distilled water and centrifuged at 3200 rpm for 10 min . The yellow gel - like layer formed on top of the packed white starch granule 2.5 g of sample (ws) was taken in 25 ml of distilled water in a preweighed test tube . Contents were stirred using vortex shaker occasionally with a holding period of 30 minutes and finally centrifuged at 3000 rpm for 15 minutes . The water absorption (wa) was calculated by the ratio of hydrated starch (waw) and weight of samples (ws): (1)wa = wawws100 (g / g). For samples containing acacia gum, nacl, and sucrose, lss powder was mixed with these three additives and the procedure was continued as it was described for pure starch suspensions . Wai and wsi were determined using a modification of the method of leach et al . . Starch dispersion of 2.5% was put in centrifugal tubes and heated in a water bath at temperature of 90c for 15 minutes . In order to prevent granules' sedimentation during heating, stirring was applied periodically using glass stirrers . After heating, samples were centrifuged (3000 rpm, 10 min). Both phases were dried at 105c for 24 h and the dry solids in precipitated paste (wdp) and supernatant (wds) were calculated . Wai is the ratio of the weight of swollen starch granules after centrifugation (g) to their dry mass (g): (2)wai = wpwdp (g / g). Wsi is the ratio of dry mass of solubles in supernatant to the dry mass of whole starch sample (ws): (3)wsi = wdsws100 (g / g). Similarly, as executed for calculating wa, lss powder was mixed with three additives and the procedure was continued as it was described for pure starch suspensions . Water solubility index (wsi) was calculated based on the assumption also mentioned in a study by mandala and bayas that the total amount of additives remained in the supernatant . Wsi was calculated after subtracting dry weight of acacia gum, nacl, and sucrose from dry mass of soluble substances in supernatant . The experiment was designed according to a rotatable central composite surface response model with three variables and three levels . The three independent variables were acacia gum (0.51.5%), salt (0.51.5%), and sucrose (1030%). The three levels were coded as 1, 0, and 1, for the statistical analyses (table 1). The numbers of design points were obtained using the statistical software package, that is, design expert 8.0 (stat - ease, inc .) Based on the number of independent variables . The range of additives levels was selected on the basis of formulations normally used in starch - based breakfast cereals and processed foods [17, 21]. As lss involved three independent variables, the total number of combinations made was twenty in which the number of design points was 14 with six center point replications . The center points for these designs were selected with additives at levels expected to yield satisfactory results . For each response, analysis of variance (anova) was conducted to determine significant differences among various additive combinations . Wa and wai were maximized and wsi was minimized to obtain the most desirable optimized formulation of additives . Effect of three additives on lss was studied and optimized combination was obtained . The experimental design with three independent variables and the respective responses for the lss are given in table 2 . Since wa, wai, and wsi are important properties to assess the behavior of starch in food system containing water as one of the most essential ingredients, these parameters were taken as responses . The regression analysis of the responses was conducted by fitting 2fi model as suitable for the respective response . Analysis of variance was carried out to assess the significance of hypothesis for selected model and responses (table 3). 2fi model was highly suitable for wa (p <0.0001), wai (p = 0.0001), and wsi (p = 0.0003) response in lss . The p values given in the parenthesis for each response are for the model significance . The p value indicates the p> f - value which should be less than 0.05 for model to be significant; otherwise the model cannot be used for further routing or prediction . Multiple regression equations as obtained for all the three responses of lss with actual factors are represented as follows . Further, the optimization of variable levels was achieved by desirable maximization or minimization of the necessary response along the fitted 2fi models by numerical optimization procedure of design expert software . The effect of change in the levels of selected additives on the response parameters is represented in figure 1 . As can be seen from table 2, maximum response for wa (72.50%) minimum response for wa (41.00%) was obtained with acacia gum0.16%, sucrose20%, and nacl1% . Effect of acacia gum on wa of lss was highly significant (p <0.05) leading to increase in the latter value with increasing content of the former (see (4)). Interaction effect of acacia gum with nacl and also with sucrose was also found significant (p <0.05) for wa . The coefficient of determination (r) was obtained to be 0.9486 for wa (table 3). According to henika, the effects of three independent variables on wa of lss are depicted in response surface plots (figures 1(a)-1(b)). Maximum response for wai (15.20%) was obtained with acacia gum1.50%, sucrose10%, and nacl0.50% . Minimum response for wai (8.30%) acacia gum and nacl individually and their interaction were found to affect wai of lss significantly (p <0.05, see (5)). Interaction of nacl and acacia gum reduced the wai value of lss . A regression equation which had a good fitting capacity for wai of lss the effects of independent variables on wai of lss are depicted in response surface plots (figure 1(c)). In case of wsi, maximum response for wsi (19.00%) minimum response for water solubility index (0.20%) was obtained with acacia gum1%, sucrose36.82%, and nacl1% . Sucrose was found as significant factor (p <0.05) affecting the value (see (6)). High coefficient of determination (r = 0.8192) for wsi of lss was obtained . Finally in lss, the variables were optimized based on the maximization of the wa and wai and minimization of wsi values . The solutions were required to maximize the desirability function for the given criteria by being at random starting points . Lss thus treated with optimized level of additives were verified for the predicted values and the actual values for the responses . Actual and predicted values were compared using student's t - test and the p value (<0.05) suggested no significant difference between the two . Hence, the fitted models are best suitable for predicting the responses of the study (table 4). For obtaining optimized solution of formulation for the development of appropriate final product, responses were suitably maximized and minimized while performing rsm . Wa and wai of any starch of edible purpose should be high enough for proper gelatinization during heating in the presence of moisture for making it digestible . If this happens then the yield of starch could reduce and also desired property of starch may change . Hence, wsi of starch should be very less . With this view, wa and wai were kept maximized in rsm and wsi was kept minimized . Among the combinations studied in the present study, the combination which yielded maximum desirability was selected . Water absorption (wa) is the ratio of the wet weight of the sediment starch gel to its dry weight . Water absorption (wa) of starch is an imperative parameter for expressing the interaction of native starch with water in processing of food products to improve yield and consistency and impart desired body and textural characteristics to the food . When unheated native lss was used to estimate water absorbed by granules, significant increase was observed with increasing acacia gum content, which can be explained by the fact that hydrocolloids promotes swelling . Wa of lss was restricted by the interaction effect of gum with salt and sugars . The reason may be attributed to the limited water availability to starch granule in the presence of sugar and salt . Sucrose addition to starch dispersion significantly decreased water absorption attributed to the fact that sucrose has a higher number of oh groups which makes it more hydrophilic, thus limiting water availability to lss . Teixeira et al . Reported decrease in water uptake (~60%) by cassava starch with sugar (2%) addition . Likewise, chen et al . Also reported significant decrease in swelling of potato starch and flaxseed polysaccharide potato starch (fg - ps) complexes due to the addition of sucrose (24%) owing to reduced water activity and formation of more bonding water which was unable to take part in absorption process . No significant effect of nacl was observed on wa which can be supported by the study of zhu et al ., which concluded that if no heat is applied, no significant influence of nacl on the particle size distribution of wheat starch granules was observed . Hence, it can be interpreted that salts cannot be classified as swelling inhibitor or promoter as such, since it is the function of temperature at which the swelling is observed . Swelling power is simple analytical test to measure the water uptake during the gelatinization of starch . Amylopectin is considered as sole contributor to water absorption and subsequent swelling and pasting of starch granules, whereas amylose tends to retard this phenomenon . On heating at 90c for 30 min, significant changes in water absorption index (wai) or swelling power of lss were administered by addition of acacia gum and nacl and by interaction thereof . Effect of additives was investigated on gelatinized starch existing in two forms, that is, continuous phase (amylose / amylopectin matrix) and the dispersed phase (starch granules). Heating of starch dispersion causes swelling of granules, which influences the properties of both continuous and dispersed phases . Increase in wai with acacia gum addition can be supported by the study of mandala and bayas which reported that xanthan addition (0.09%) to wheat starch enhanced swelling of starch dispersion (2%) during heating at 90c for 30 min . The following assumption about the role of gums in starch systems supports the finding of mandala and bayas . According to abdulmola et al ., starch molecules can interact and a network can be created at concentrations well below this leads to force enhancement applied to them, facilitating swelling and amylose solubilisation and its exudation . Further increase in temperature causes leaked amylose and the xanthan in the continuous phase to create a film around the granules which further inhibit swelling . Effect of hydrocolloids addition on swelling of starch granules during heating was also reported by chaisawang and suphantharika suggesting that addition of guar or xanthan gum (0.073%) slightly enhanced swelling of native tapioca starch (1.25%) granules at temperatures that ranged from 60 to 90c . Decrease in wai of lss with increasing nacl content occurred due to competition between salts and starch for available water molecules at high temperatures . Also, electrostatic interaction between starch and ions from nacl has ability to limit the swelling of starch granules . Similarly, zhu et al . Reported limited promoting effect of nacl on wheat starch at higher temperatures concluding that swelling inhibiting effect of nacl is largely temperature dependent . Significant decrease in swelling power of rice starch subjected to heating at 75c on addition of 0.1 m nacl solution further sustains the results . Similar influence of hydrocolloid and salt on swelling power of rice starch has been reported by samutsri and suphantharika . Addition of salts (0.1 m) significantly decreased water uptake of rice starch complexed with xanthan and guar gum in 19: 1 (w / w) ratio of starch and gum . Hence, conclusion can be drawn that effect of nacl on reduction of swelling power of rice starch follows the order of the hofmeister series which is a classification of ions in order of their ability to salt - out or salt - in proteins . Spies and hoseney proposed that stabilization of amorphous region of the starch granules occurs when sugar molecules possibly restrict the mobility and flexibility of starch chains by forming bridges with more starch chains . This kind of sugar - starch chain interaction could be the reason for observed reduced amylose leaching . Richardson et al . Conducted a study to investigate the effect of sucrose (12 or 24%, w / w) on solubility index of wheat starch dispersion (8%) which revealed delayed amylose leakage and granule fragmentation above 50c . In the presence of acacia gum, nacl, and sucrose, the physical properties of lotus stem starch might be governed by hydrocolloid - salt, hydrocolloid - sugar interaction and individual effect of these additives . Desired or optimum level of these additives was obtained by using rsm, which returned 1.5% of acacia gum, 0.5% of nacl, and 30% of sucrose with a desirability of 0.844 . Wa, wai, and wsi are 65.42%, 14.95, and 2.74%, respectively . In presence of acacia gum, swelling power of starch increased . Nacl cannot be classified as swelling inhibitor or promoter as such, since it is the function of temperature at which the swelling is observed . Sucrose was found to inhibit water absorption by limiting the water availability to starch in the presence of acacia gum, thus reducing the swelling promoting effect of the latter . Sucrose also retarded amylose leaching (wsi) by mechanism of building bridges with starch chains and reducing their flexibility . Hence, results of present investigation suggest important practical inferences in applications of assayed additives in starch - based food products containing lotus stem starch as one of the major ingredients which is highly popular as functional food in east asian part of the world.
In this study we present a methodology for the direct sequencing of brca genes through a simple workflow implementable in a diagnostic lab . Most tumors are considered sporadic, whereas the remaining 510% is inherited as autosomal dominant disease and defined as hereditary breast and ovarian cancer (hboc). Brca1 and brca2 were identified in the early 90s as the genes that confer a higher risk of developing this hereditary cancer syndrome [2, 3]. Patients with hboc, differently from those with the sporadic type of cancer, are characterized by a young age of onset and the presence in the family of numerous cases of cancer, not only of breast cancer but also ovarian and/or cancer affecting other organs . Women bearing an alteration in brca1 or brca2 develop during their lifespan a breast cancer in 5080% of cases and an ovarian cancer in 2040% of cases (carriers of brca1 mutation) or in 1020% of cases (carriers of brca2 mutation). Brca1 and brca2 are tumor suppressor genes, with autosomal dominant transmission and high penetrance . Specific brca mutations can confer a different risk of disease, consistent to the fact that breast and ovarian cancer are multifactorial diseases, which can be influenced by many environmental and/or genetic factors affecting brca1 or brca2 penetrance . Brca1 and brca2 are the two main breast cancer susceptibility genes for which mutation recognition is important to assess cancer risk and to identify more suitable treatment strategies . It consists of 24 exons (with exon 11 constituting 61% of the coding region), which are distributed over a region of approximately 100 kb, and encodes a protein of 1,863 amino acids . Brca1 is regulated by two separate promoters inducing the transcription of two mrnas with different 5utrs . In some cancers brca1 downregulation occurs following the switch from the expression of 5utra, which enables an efficient protein translation, to the expression of 5utrb, which, conversely, strongly inhibits translation . It consists of 27 exons (with exons 10 and 11 constituting 60% of the coding region) spanning a region of approximately 70 kb and encodes a protein of 3,418 amino acids . Brca1 and brca2 are involved in the cellular response to dna damage intervening both in dna repair and in the transcriptional regulation of other genes involved in dna repair and cell - cycle checkpoints activation, thereby preventing the duplication of cells bearing damaged dna [912]. A thorough understanding of the mechanisms by which brca1 and brca2 maintain genome integrity is crucial to identify non - invasive treatment strategies for women with suspected family predisposition to hboc . Recently, inhibitors of poly (adp - ribose) polymerase (parp), involved in another dna repair pathway, such as base excision repair (ber), were found to have high efficacy against tumors bearing brca1 or brca2 mutations [14, 15]. Therefore, alterations in brca genes represent potential biomarkers predictive of the response to chemotherapy of hereditary cancer . Several criteria have been proposed for the identification of patients who have a hereditary breast and/or ovarian disease, but generally tumors are attributable to this class when there is a family history, onset of disease at a young age, and more than one family member affected . At present, epidemiologists and geneticists rely on statistical models, among which the most commons are boadicea, brcapro, and ibis . These programs, in the context of genetic counseling, are based on the collection of family medical history information, which allows to calculate the probability of the presence of brca1 and brca2 mutations, whereas genetic testing is performed only if the calculated probability exceeds a predetermined value . In the 90s the implementation of molecular tests for brca1 and brca2 has led to the recognition of a large number of mutations occurring in both genes . Many of these are silent, however, most mutations are small insertions or deletions resulting in non - sense or frame - shift alterations, which lead to a premature termination of translation and, consequently, in a truncated protein . Often the type of mutation is specific to the family / ethnic group (founder effect). It is possible to find rearrangements of large genomic portions, affecting brca genes, which lead to altered protein structure . In addition to these mutations there are other frequent amino acid substitutions in brca1 and brca2, which are defined as unclassified variants (uvs) because it is not known whether they can affect gene function and be of considerable clinical significance . Overall, the breast cancer information core (bic) database (research.nhgri.nih.gov/bic/) has recorded 1,639 and 1,853 distinct mutations, polymorphisms, and variants in the brca1 and brca2 genes, respectively (data 2010). Genetic tests have different purposes depending on if they are performed on patients or on their relatives . The complexity that characterizes genomic brca1 and brca2, their large size, the absence of mutational hot spots, the presence of uvs, and the different distribution of mutations according to geographic areas / ethnic groups, makes the molecular analysis particularly difficult . The study of the complete coding region by direct sequencing is arduous because of the large size of both genes . For this reason, in the past, several indirect techniques have been used as a pre - sequencing screening to identify gene or protein alterations, such as: protein truncation test (ptt), denaturing high performance liquid chromatography (dhplc), and high - resolution melting (hrm) analysis . However, the techniques used as indirect tests present several disadvantages, mainly: (a) they are only partially informative; (b) they add further costs to the cost of sequencing, which is in any case necessary for the characterization of the mutation; and the direct sequencing is the only way to characterize specific gdna alterations although the capillary system based on sanger methods is still very expensive in terms of time, cost, and knowhow required . Many efforts are ongoing to improve the performance of the direct method making it faster and cheaper . Here, to this purpose, we designed a new strategy and developed a new cost and time - effective approach for the assessment of brca mutational status . Peripheral blood from healthy donors and hboc patients, recruited at the national cancer institute of naples, was collected, by vacutainer system, in two 5 ml tubes . The gdna was extracted in duplicate from edta blood samples through the qiaamp dna maxi kit (qiagen) according to the supplier s recommendations . Pcr was performed in 50 l final volumes, starting from 200 ng of gdna . The amplification mixture included 1 pcr buffer (roche), 1 pmol/l of both forward and reverse primer, 200 mol of dntps, and 2 u of taq dna polymerase (roche). All amplicons were amplified using the following thermal profile . A first denaturation step at 95 c for 10 min, followed by 40 cycles: denaturation at 94 c for 30 s, annealing at 60 c for 30 s, and extension at 72 c for 1 min . The entire brca1 and brca2 coding regions were amplified through pcr as previously described with some changes (table 1). All primer sets, for both genes, were pre - spotted using a beckman coulter robotic station bfx liquid handler and dried in 96-well pcr plates through the eppendorf concentrator 5301.table 1new primer pairs amplifying various brca1/2 regionsbrca regionforward primer sequencereverse primer sequenceex 1abrca1ccatcctctgattgtaccttgattagcttcggaaatccactctcex 1bbrca1agctgacagatgggtattctttgagcacctcttcttccacaaggtex 2brca1aatgaagttgtcattttataaaccttttgacatgtcttttcttccctagtatgtex 9brca1gcttaactagcattgtacctgcccaagtcgtgtgtttacctatatex 16brca1attgaaagttgcagaatctgtcttagtcattagggagatacex 10brca2gaaggggtgactgaccgaggtatctacaactgtttcatatacex exon new primer pairs amplifying various brca1/2 regions negative controls, for all reactions, were pooled in 23 wells . All pcr products were analyzed simultaneously through gel electrophoresis (1% agarose gel in 1 tbe), run along with a mass and molecular weight marker (fermentas mass ruler 100 bp ladder) to confirm successful amplifications and to check negative controls . The pcr products were then purified using the millipore hts multiscreen pcr cleanup plates in automated procedures on a beckman coulter bfx liquid handler . In case of ambiguous results we re - amplified the specific region using native primers (without m13 tail) and cloned the purified pcr fragments through the stratagene strataclone pcr cloning kit according to the supplier s instruction . An automated procedure was developed on a beckman coulter bfx liquid handler to setup the sequencing plates (forward and reverse), according to the applied biosystem big dye terminator v3.1 cycle sequencing kit manual, and to purify sequence reactions that were subsequently analyzed by capillary electrophoresis on the applied biosystems 3730xl dna analyzer . To simplify the sequencing reaction we used an appropriate oligo design strategy . All forward primers were designed and synthesized adding, upstream to the sequence complementary to the brca region to amplify, the universal m13 forward primer sequence and the same strategy was used for the reverse primer adding the universal reverse m13 primer sequence to the specific brca complementary region (m13 forward: cgttgtaaaacgacggccatg and m13 reverse: tttcacaggaaacagctatgac). Data analysis was performed through the applied biosystems variant reporter software, version 1.1, a software that compares the sequence chromatograms with the wild - type sequence, which allowed us to obtain clear results and to standardize the analysis providing general criteria to evaluate and validate the screening . Brca1 (mim113705) and brca2 (mim 600185) nomenclature within this article is used as in the bic database according to genbank recommendations . Peripheral blood from healthy donors and hboc patients, recruited at the national cancer institute of naples, was collected, by vacutainer system, in two 5 ml tubes . The gdna was extracted in duplicate from edta blood samples through the qiaamp dna maxi kit (qiagen) according to the supplier s recommendations . Pcr was performed in 50 l final volumes, starting from 200 ng of gdna . The amplification mixture included 1 pcr buffer (roche), 1 pmol/l of both forward and reverse primer, 200 mol of dntps, and 2 u of taq dna polymerase (roche). All amplicons were amplified using the following thermal profile . A first denaturation step at 95 c for 10 min, followed by 40 cycles: denaturation at 94 c for 30 s, annealing at 60 c for 30 s, and extension at 72 c for 1 min . The entire brca1 and brca2 coding regions were amplified through pcr as previously described with some changes (table 1). All primer sets, for both genes, were pre - spotted using a beckman coulter robotic station bfx liquid handler and dried in 96-well pcr plates through the eppendorf concentrator 5301.table 1new primer pairs amplifying various brca1/2 regionsbrca regionforward primer sequencereverse primer sequenceex 1abrca1ccatcctctgattgtaccttgattagcttcggaaatccactctcex 1bbrca1agctgacagatgggtattctttgagcacctcttcttccacaaggtex 2brca1aatgaagttgtcattttataaaccttttgacatgtcttttcttccctagtatgtex 9brca1gcttaactagcattgtacctgcccaagtcgtgtgtttacctatatex 16brca1attgaaagttgcagaatctgtcttagtcattagggagatacex 10brca2gaaggggtgactgaccgaggtatctacaactgtttcatatacex exon new primer pairs amplifying various brca1/2 regions negative controls, for all reactions, were pooled in 23 wells . All pcr products were analyzed simultaneously through gel electrophoresis (1% agarose gel in 1 tbe), run along with a mass and molecular weight marker (fermentas mass ruler 100 bp ladder) to confirm successful amplifications and to check negative controls . The pcr products were then purified using the millipore hts multiscreen pcr cleanup plates in automated procedures on a beckman coulter bfx liquid handler . In case of ambiguous results we re - amplified the specific region using native primers (without m13 tail) and cloned the purified pcr fragments through the stratagene strataclone pcr cloning kit according to the supplier s instruction . An automated procedure was developed on a beckman coulter bfx liquid handler to setup the sequencing plates (forward and reverse), according to the applied biosystem big dye terminator v3.1 cycle sequencing kit manual, and to purify sequence reactions that were subsequently analyzed by capillary electrophoresis on the applied biosystems 3730xl dna analyzer . To simplify the sequencing reaction we used an appropriate oligo design strategy . All forward primers were designed and synthesized adding, upstream to the sequence complementary to the brca region to amplify, the universal m13 forward primer sequence and the same strategy was used for the reverse primer adding the universal reverse m13 primer sequence to the specific brca complementary region (m13 forward: cgttgtaaaacgacggccatg and m13 reverse: tttcacaggaaacagctatgac). Data analysis was performed through the applied biosystems variant reporter software, version 1.1, a software that compares the sequence chromatograms with the wild - type sequence, which allowed us to obtain clear results and to standardize the analysis providing general criteria to evaluate and validate the screening . Brca1 (mim113705) and brca2 (mim 600185) nomenclature within this article is used as in the bic database according to genbank recommendations . Until now, brca1/brca2 mutation analysis has been very difficult, time consuming and expensive, owing to the large size of the two genes and the need to use several various primers, each with a different annealing temperature, for pcr amplification and the subsequent sequencing . Our analysis was based on the approach of de leeneer et al . For primer design, although we did not use high - resolution melting analysis (hrm) but direct sequencing . We developed a pcr - based approach using 73 primers pairs to amplify the complete coding region of brca1 and brca2; splitting brca1 in 33 merging amplicons, 10 of which encompassing exon 11 and brca2 in 40 merging amplicons, 14 of which encompassing exon 11 . This allowed us to use a single 96-wells pcr plate for each sample: one individual = one plate pcr; reducing costs, reducing time, and eliminating a source of potential sample cross contamination due to the concurrent use of more samples . Moreover, to simplify the procedure, primers were pre - spotted and dried in a 96-well pcr plates immediately available upon analysis request . Furthermore, all the amplifications were optimized to the same thermal profile . This condition allowed us to carry out all the amplifications in a single experiment . We performed, at the same conditions used for the 73 sample amplifications, multiplex no - template pcr controls for all pcr experiments . Multiplex controls were prepared by mixing primer sets amplifying products of different lengths in order to easily identify, according to the size, possible contaminating bands, through the agarose gel electrophoretic run . Each primer was used at the same concentration used for the sample amplification and at the same annealing temperature . Although the efficiency of a multiplex pcr could be different from the efficiency of the single pcr and potentially underestimate a contamination this strategy, using multiplex for negative controls, allowed us to perform in a single pcr plate the analysis of both entire brca genes of each patient . To setup this methodology and for the following testing, we used a pool of gdnas from 5 different healthy donors . Whereas, to validate the reliability of our procedure, we used 10 gdnas samples from individuals who were clinically affected by hboc, whose brca mutational status had been formerly characterized by another independent group . We analyzed each of these samples testing all the 73 amplicons corresponding to the entire brca1 and brca2 coding regions . Our analysis was able to detect and confirm, in a blind way, all the previously identified mutations in both genes . We obtained for all the 15 samples analyzed 73 bands each one of the expected size and without contaminations (fig . 1a, b).fig . A 1% agarose gel electrophoresis of the pcr products to verify the correct amplification of the brca1/2 coding regions . Each lane corresponds to the amplicon relative to the indicated brca1 or brca2 exon . In particular, for brca1, we divided exon 11 and exon 16 in ten and two amplicons, respectively (11.111.10 and 16.116.2); for brca2 we divided exon 10, exon 11, and exon 27 in three, fourteen, and two amplicons, respectively (10.110.3; 11.111.14, and 27.127.2). For brca2 only, exon 5 and exon 6, exon 19 and exon 20, exon 23 and exon 24 were amplified within the same amplicon because they were sufficiently short . A 1% agarose gel electrophoresis of the pcr products to verify the correct amplification of the brca1/2 coding regions . Each lane corresponds to the amplicon relative to the indicated brca1 or brca2 exon . In particular, for brca1, we divided exon 11 and exon 16 in ten and two amplicons, respectively (11.111.10 and 16.116.2); for brca2 we divided exon 10, exon 11, and exon 27 in three, fourteen, and two amplicons, respectively (10.110.3; 11.111.14, and 27.127.2). For brca2 only, exon 5 and exon 6, exon 19 and exon 20, exon 23 and exon 24 were amplified within the same amplicon because they were sufficiently short . Mw: molecular weight marker once all the amplicons covering the entire coding regions of brca1 and brca2 were obtained, we proceeded to the dna sequencing phase . All pcr primers were designed to contain at the 5 end the m13 forward and the reverse sequence to easily perform the sequencing of both strands of the amplicons ., we compared several softwares: lasergene dna star; geneious, clc, etc . But we found that the applied biosystems variant reporter software version 1.1 was the most handy to analyze mutations . Moreover, this software provides detailed reports that are very helpful to prepare the response and keep the diagnostic results . To validate the results, all detected mutations were confirmed with a targeted pcr amplification on a new dna sample aliquot . In fact, for each patients we performed two dna extractions separately in two different tubes; then, one aliquot was used to perform the first test while the other one, in the presence of a mutation, was used to confirm the data . The sequence analysis showed that our methodology of investigation was able to detect and to confirm the 100% of the mutations previously found in both brca1 and brca2 genes for each of the samples . We identified mutations in exons 8, 18, and 20 of brca1 and in exon 11 of brca2 . Insertions or deletions in heterozygosity resulted in the presence of a double sequence . In these cases, to confirm the results, we cloned the amplicon of interest and subsequently we obtained the sequence of each strand . The analysis showed that one strand was wild type whereas the other one bore the mutation . Analyzing 6 further unknown samples, we found several differences compared to the wt sequences, but only two of these mutations, as resulted from the bic database, were correlated with the disease . The other identified alterations were either silent, and, therefore, did not modify the protein structure, or reported as of unknown significance by the bic database . To validate these results we repeated the test, focusing only on the regions containing the two mutations that are known to be associated to the pathology, using the other dna aliquot as mentioned above . For all the ten control samples, we never observed a preferential amplification of the wild - type allele; in fact, we were able to identify, in blind, all the mutations previously detected . The direct sequencing method (optimized through the use of the m13 primers and performed with quality controls) was able to correctly identify 100% of the mutations . Moreover, in the case of unclear sequence results, we proceeded with the amplicon cloning and subsequent sequencing, in order to obtain clear and univocal results on the selected difficult fragment in both alleles . Practically it is not feasible to obtain positive controls for each amplicon; however, the technological approach used implicitly foresees analytical steps . Moreover, there are no reasons to hypothesize a different mutation detection accuracy in different amplicon, it could be, instead, different in term of performances to detect different mutations like indels or base substitutions . In our control panel samples we tested, with positive results, the ability of our procedure to detect all different types of mutation in homo and hetero zigosity . Our experimental conditions, which included dna extraction, pcr amplification and testing through gel electrophoresis, amplicon purification, sequencing reactions, purification of sequencing reaction products, and sequencing by capillary electrophoresis along with overall data analysis, required about one week and a cost of about 1,200 (corresponding to ~1,500 $) including personnel cost and depreciation, maintenance and support of equipment . The experimental conditions refer to the maximum time needed to conduct the investigation of a patient and include the initial analysis (about two days), the validation of data and the possible repetition of the mutated region (about two days), and/or the cloning technique to resolve an ambiguous situations (about three days). The situation is different if the individual subjected to the investigation has a family history with a previously typed mutation . In this case it will be sufficient to study only the region of interest, which will take approximately 12 days . The low cost and the high speed of execution of this method, when compared to the techniques used so far, would allow to perform a more extensive screening, including a greater number of patients, guaranteeing an earlier identification of the risk and the implementation of ad hoc clinical surveillance programs . The clinical management of women, who are often young, carriers of breast and/or ovarian cancers vary depending on the presence or absence of brca mutations, which makes negligible the cost of the test when compared to the cost of the therapies . In fact, the screening for brca mutations could, along with other clinical and pathological information, allow to formulate a personalized therapy in the treatment of breast and/or ovarian cancer . In conclusion, we presented a fast and reliable strategy to detect mutations in the brca genes; this method is very rapid and less expensive than other methods and makes feasible to assess brca mutational status in the diagnostic setting requiring only ~2 working days (excluding the analysis of the electropherograms) (fig . A flow chart showing the timing of all the protocol steps including: dna extraction, amplification of 73 amplicons covering all the coding regions of brca1 and brca2, pcr analysis through gel electrophoresis, purification of amplification products, setup of sequencing reaction, purification of sequencing products, and sequencing by capillary electrophoresis . The whole testing requires a time of about 2 working days, representing a rapid and cost - effective method . B schematic representation of the experimental method for brca1/2 testing, showing the key role of the robotic station flow chart showing our experimental conditions . A flow chart showing the timing of all the protocol steps including: dna extraction, amplification of 73 amplicons covering all the coding regions of brca1 and brca2, pcr analysis through gel electrophoresis, purification of amplification products, setup of sequencing reaction, purification of sequencing products, and sequencing by capillary electrophoresis . The whole testing requires a time of about 2 working days, representing a rapid and cost - effective method . B schematic representation of the experimental method for brca1/2 testing, showing the key role of the robotic station in the future, third - generation sequencing technologies, such as those used by pgm ion torrent of life technologies or illumina, might contribute to lowering the costs of brca screening even more, but at present their use for diagnostic purposes is still very controversial and needs further testing.
This is a non - controlled, longitudinal study, carried out in a sample of 150 children 12 - 15 months of age in three health units of the municipality of rio de janeiro who received the combined mmr vaccine according to the basic immunisation schedule and nip routine procedures . Healthy male and female children, living in the city of rio de janeiro, with no significant past medical history, were selected for this study . The criteria for not including into the study were: (i) subjects with a history of measles, rubella and/or mumps, (ii) subjects who had already received mmr vaccination documented in the vaccination card, (iii) subjects with a history of receiving blood transfusion or blood products, including immunoglobulin in the past one year previous to the study, (iv) subjects who presented skin lesions at sites of venipuncture and (v) subjects who had used corticosteroids (except topical or aerosol) during the last six months or reported use of immunosuppressive drugs . Two blood samples were collected: before and 42 days after vaccination (minimum acceptable 30 days and maximum 60 days). Volunteers who did not seroconvert from seronegative to seropositive or who had inconclusive results for any of the antigens were vaccinated again and a third blood sample was collected within the same time range recommended for the second blood collection . Medical records were prepared using the teleform workgroup 2008 program, v.10.2, which allowed capture of the scanned data, without manual typing and creation of a database . Vaccine used on the study - the mmr received in bulk from gsk, formulated and distributed by bio - manguinhos, oswaldo cruz foundation (fiocruz), single lot (072vva007z), in 10 dose presentation, february/2007 production date and valid for two years, was used on the study . Each 0.5 ml dose of reconstituted vaccine contained at least 1,000 50% cell culture infectious dose (ccid50) of attenuated measles virus, schwarz strain, at least 1,000 ccid50 of attenuated rubella virus wistar ra27/3 strain and at least 5,000 ccid50 of attenuated mumps virus, rit 4385 strain, derived from jeryl lynn strain . For each component of the vaccine batch used in the study, the potencies at temperatures varying from 2c to 8c were, in log10, 4.26 (measles), 5.28 (mumps) and 4.02 (rubella) and, after storage at 37c, 3.96, 4.99 and 3.85, respectively . The vaccine administered into each volunteer was diluted at the time of study enrollment, according to the nip procedures and each volunteer received only the first dose from each vial . Laboratory methods - blood samples were placed into an insulated box kept between 4 - 10c from time of collection until arrival at the laboratory . The maximum time between blood collection and arrival at the laboratory was 6 h. igg antibodies against measles, mumps and rubella were determined at the reference laboratory for measles and rubella, oswaldo cruz institute / fiocruz using an enzyme immunoassay (eia) with a commercial kit from siemens (enzygnost igg). The results for optical density were converted to international units or units per millilitre of serum using a table provided by the manufacturer and categorised as negative for rubella, mumps and measles if <4.0 iu / ml, <231 u / ml and <150 miu / ml, respectively . These cut - offs were used in all studies referred to in the bibliographical references . Additionally, results were categorised as seronegative, inconclusive and seropositive, according to the kit instructions . At the end of 2010, samples were sent for retesting for the mumps component at the gsk biologicals laboratory (rixensart, belgium) using the same methodology (eia) and diagnostic kit used in the reference laboratory at fiocruz . Igm antibodies against mumps were measured after revaccination of children seronegative after the first dose in order to detect primary immune failures . Data analysis - a database for the study was created using the statistical package for social sciences program v.17 . The distribution of absolute and relative frequencies of subjects were tabulated by sex, age group, health units, interval between date of vaccination and date of blood sample collection . Immunogenicity of the mmr vaccine was assessed primarily in terms of the percentage of baseline seronegative children who seroconverted for antibodies against measles, mumps and rubella viruses (that is, developed antibody levels cut - off for seropositivity after vaccination). Criteria for protocol adherence were: children seronegative before vaccination with available serologic test results before and after vaccination and blood collected from 30 - 60 days after vaccination . We constructed 95% confidence intervals (ci) for proportions using winpepi (abramson 2011). Immunogenicity was also evaluated by geometric mean titre (gmts) after vaccination and the magnitude of the immune response could be assessed against the minimum antibody levels for seropositivity . Ethical aspects - the mmr vaccine administered to volunteers was the same used in the nip routine, having already gone through immunogenicity and reactogenicity clinical studies before registration and use on a large scale . The study protocol was approved by the research ethical committee of the municipal health secretariat of rio de janeiro (protocol 48/08). From may - august 2008, 165 children were enrolled, of which 150 were eligible and 146 (96.7%) had blood samples obtained before and after vaccination . There was a slight male predominance (55%) and most children (92.7%) were from 12 - 15 months of age . The intervals between vaccination and blood sampling after vaccination ranged from 34 - 73 days and of 146 volunteers who had a second blood sample collected, 97.9% had intervals from 30 - 60 days . Before vaccination, there was one child seropositive for measles, one for mumps and one for rubella and 143 children were susceptible to measles, mumps and rubella . According to the kit instructions and in children with adherence to protocol, 86 (60.1%) were seropositive for mumps, 42 (29.4%) inconclusive and 15 (10.5%) seronegative . For all children, with exception of one child seropositive to mumps before vaccination, 88 (60.7%) were seropositive and the number with negative or inconclusive results after vaccination was 57 (39.3%). Considering 231 u / ml as the cut - off, in children with adherence to protocol, seroconversion for mumps after first vaccination was 89.5% (95% ci: 83.3; 94.0) and 130/145, 89.7% (95% ci: 83.5; 94.1), for all available children who were seronegative before vaccination (table i). Table iresults of mumps serology (enzyme immunoassay) after the first dose of combined vaccine against measles, mumps and rubellaigg serologycut - off 231 u / ml n (%) according to kit n (%) negative15 (10.5)15 (10.5)inconclusive-42 (29.4)positive128 (89.5)86 (60.1) total143 (100)143 (100) post - vaccination gmts were 2,234 (95% ci 2039.4; 2447.7) mui / ml for measles, 596.6 (95% ci 517.2; 688.3) u / ml for mumps and 50.1 (45.1; 55.8) iu / ml for rubella . When contrasted with cut - off values for seropositivity, the gmts indicated considerably larger magnitude of the immune response for rubella (cut - off: 4.0 iu / ml) neither health unit nor time of blood collection after vaccination was relevant regarding immunogenicity (data not shown). Of the 58 children seronegative or with inconclusive serology for mumps after vaccination, 57 were eligible for revaccination (1 child was excluded due to a 2nd dose of mmr vaccine received during a mmr campaign, registered on the vaccination card). Blood samples were collected after the second vaccine dose in 54 children (94.7%) and were not collected in three children due to parent / tutor refusal . The interval between vaccination and revaccination ranged from 203 - 249 days, with a mean of 221 days [standard deviation (sd): 11.6] and a median of 220 days . The interval between revaccination and third blood collection ranged from 31 - 64 days, with a mean of 39 days (sd: 6.2) and a median of 37 days . After revaccination, all children had high igg titres for mumps, above 1,200 u / ml, with exception of one child, who had a titre of 457 u / ml . Measles and rubella antibody titres showed a modest rise (table ii). Table iiigg (elisa) geometric mean titres (gmt) after vaccination and revaccination and revaccination / vaccination ratios, for measles, mumps and rubellaigg titresnafter vaccination gmt (95% ci)after revaccination gmt (95% ci)gmt ratio revaccination / vaccination (95% ci)measles (miu / ml) 542,155.5 (1,828.0; 2,541.6)5,692.1 (4,815.5; 6,728.4)2.6 (2.3; 3.1)mumps (u / ml) 54247.6 (214.3; 286.0)3,157.0 (2,684.9; 3,712.0)12.8 (10.3; 15.8)rubella (ui / ml) 5441.3 (33.8; 50.4)151.0 (134.2; 169.9)3.7 (3.0; 4.5) moreover, after revaccination, igm for mumps was negative in 52/54 (96.3%) children and in two children results were inconclusive; for measles, 50/54 (92.6%) were igm negative and four were inconclusive; for rubella, 53/54 (98.1%) were igm negative and one was inconclusive . Due to the high percentage of negative and inconclusive results for mumps after the first mmr vaccination, according to the kit instructions, the pre and post - vaccination samples were sent for blind retesting for mumps at the gsk in rixensart, belgium . Mumps immunogenicity has been highly variable across mmr studies with features similar to the current study, that is, with the same jeryl - lynn based vaccine from gsk, after the first dose (mmr used alone or with simultaneous administration of varicella vaccines), with similar age at vaccination, using the same enzygnostkit and 231 u / ml cut - off for seropositivity . Of note, all assumed 231 u / ml for mumps indicated seropositive results (usonis et al . Studies from 1999 - 2002 presented the highest immunogenicity . A study in 2011 in germany showed a gmt for mumps of 523.7 u / ml, with 71.3% seroconversion (rmke et al . Efficacy trials represent the best scenarios of vaccine performance under controlled conditions and are commonly required before a new vaccine is licensed . They are measured usually as immune responses and when there are correlates of protection (that is, a cut - off of antibodies above which there will be protection against the disease), it is possible to estimate vaccine effectiveness from immunogenicity data . This is the case for measles and rubella . In the case of mumps, there are no correlates of protection, so it is not possible to estimate effectiveness - that is, the magnitude of reduction of disease rates attributable to vaccination under real life conditions . Many studies evaluated effectiveness of the mumps component in populations vaccinated with jeryl - lynn based vaccines . The recent mumps outbreak in new york and new jersey reported by the centers for disease control and prevention (cdc 2010) estimated a variation on mumps vaccine effectiveness from 73 - 91% after one dose and from 79 - 95% after two doses . Even so, overall vaccine effectiveness is not questioned, as the annual number of mumps cases in the united states of america decreased from 186,000 in 1967, when the vaccine was introduced, to less than 500, in the early 2000s . Waning immunity, that is, decrease on seroprotection since time of last vaccination, seems to be an important factor for vaccination failure, both for one and two - dose vaccinees . Waning may also partly explain why vaccination effectiveness has been in general lower than efficacy, which is usually assessed after shorter follow - up . There is a trade - off between mumps vaccine immunogenicity and reactogenicity, mainly regarding aseptic meningitis . Clearly, the jeryl lynn based vaccines are the safest, although probably not the most immunogenic . This evaluation should be done by each country, according to epidemiological considerations and degree of tolerance for adverse events . It should be noted that brazil has had a negative experience regarding adverse events with mmr campaigns using mumps strains other than jeryl - lynn (dourado et al . The strong response to mumps revaccination on the current study, with a very high after revaccination / after vaccination gmt ratio, suggests insufficient power of this vaccine to induce strong mumps immune response after one dose, but the booster response is reassuring concerning seroconversion after two doses . Moreover, after revaccination, 96.3% of children were igm negative for mumps, again suggesting a secondary immune response, with the caveat that the blood collection was taken from one - two months after revaccination, when igm levels are expected to be on the decrease . However, high igm levels after disease in unvaccinated subjects are maintained for several weeks or months (cdc 2012). Assessment of igm levels after mmr first dose was found in only one bibliographical reference, using the hoshino mumps strain, the elisa ibl kit, with blood collected four - seven weeks after vaccination and igm seropositivity was found in 71% of children (tabatabaei 2013). Limitations in the accuracy of the mumps laboratory test, particularly its sensitivity (81%), may have contributed to the suboptimal mumps immunogenicity results (backhouse et al . These considerations assumed no relevant virus circulation, which seemed reasonable, even though reporting of mumps cases is not mandatory in brazil, except outbreaks, which are usually perceived in health care units and are reported on the national notification system, which was not the case . The results of this study are in agreement with two previous studies done by our group, the first already referred (silva et al . 2011), which included 1,769 children, and a second not yet published, but with final report approved, which included 183 children 12 - 18 months of age, using the same methodology and cut - offs . In the absence of accepted correlates of protection for mumps, no definite statements regarding protection against disease can be derived from the results of this study . However, the data here provided strengthen the need of a second mmr dose to ensure maximum protection against mumps . Serological and epidemiological studies after two doses should be implemented to know if further doses and at which intervals are needed . Data from the current study confirm the high immunogenicity of the mmr measles and rubella components with one dose and suggest lower immunogenicity of the mumps component . After a second dose, the main and immediate implication of these findings is the reassurance that two mmr doses are highly immunogenic for all antigens included on the vaccine . As there is no serological correlate of protection for mumps, the implications of immunogenicity data should be considered cautiously, but they may be useful regarding immunisation practices and guidance, taking into account other variables, such as epidemiological data.
It is now considered that approximately 10% to 15% of the adult population has gallstones . Age, sex, diet, sudden weight loss, etc . According to the report of the us national institute of health, it is estimated that 6.3 million men and 14.2 million women, aged 20 - 74 years in the united states has calculosis of the gallbladder, due to which every year is performed about 700,000 cholecystectomy . Male patient, aged about 40 years, admitted at the clinic and laparoscopic surgery was performed in our department for chronic, as multiple, symptomatic gallbladder calculi . Intraoperative findings showed chronically inflamed, curled gall bladder, and wall thickening . After the first postoperative day there is no content in the drain bag and it is taken out, and the patient leaves the hospital without any problems . The seventh post - operative day occurred abdominal pain, weakness and fatigue, with striking yellow skin and visible mucous membranes . Clinical, laboratory and echo determined abdomen full of fluids, so it was suspected lesion of the bile duct . Intraoperative was found a lesion of the common bile duct in the form of a complete interruption . Created is anastomosis through transhepatic drain according to pradera . Early and late postoperative flow was entirely normal with normal laboratory and echofindings . Control, contrast imaging through a drain showed the orderly flow of extrahepatic bile ducts, with minimal extravasation of contrast . At the department of surgery of general hospital in konjic laparoscopic cholecystectomy is performed since 1999 . In the beginning it was done by three trocars (european style), and later, in order to prevent complications or injury of the bile duct is performed surgery with four trocars (american style). The number of complicated procedures in our hospital does not differ from similar indicators in foreign surgical facilities . The formation of gallstones in the gall bladder is very common (1 - 6). It is now considered that approximately 10% to 15% of the adult population has gallstones . Etiologies are various and include: age, sex, diet, sudden weight loss, etc . Sometimes the pain spreads to the back and can last from several minutes to several hours, it usually occurs after meals, especially after heavier and fatty foods . In patients with problems, or symptoms due to gallstones, surgical treatment is necessary, because in 3% of these patients within a year occurs some form of complication . The most common complications are: a) acute inflammation of the gallbladder, when stone is stuck on the exit from the gall bladder and requires urgent surgery; b) choledocholithiasis (stones from the gallbladder bile entering the conduits, which can be clogged); c) cholangitis (purulent bile ducts); d) an acute inflammation of the pancreas; e) bowel obstruction by calculus (if the stone passes into the duodenum or small intestine); f) carcinoma of the gallbladder . The existence of the symptoms requiring diagnostic tests which prove the existence of stones or changes in the gall bladder . Routine diagnostics include: a) clinical history; b) clinical examination; c) complete laboratory tests; d) x - ray of the lungs and heart; and e) echo examination . Additional diagnostic methods are ct and ercp . According to the report of the us national institute of health, it is estimated that 6.3 million men and 14.2 million women, aged 20 - 74 years in the united states has calculosis of the gallbladder, due to which every year is performed about 700,000 cholecystectomy (1). In patients with symptomatic gallstones treatment surgical removal of the gallbladder is not performed because it contains stones, but because it creates stones . In today s world and in our county the method of choice for removal of the gallbladder is considered laparoscopic cholecystectomy, which represents the gold standard . Male patient, aged about 40 years, admitted at the clinic and laparoscopic surgery was performed in our department for chronic, as multiple, symptomatic gallbladder calculi . Intraoperative findings showed chronically inflamed, curled gall bladder, and wall thickening . After the first postoperative day there is no content in the drain bag and it is taken out, and the patient leaves the hospital without any problems . The seventh post - operative day occurred abdominal pain, weakness and fatigue, with striking yellow skin and visible mucous membranes . Clinical, laboratory and echo determined abdomen full of fluids, so it was suspected lesion of the bile duct . Intraoperative was found a lesion of the common bile duct in the form of a complete interruption . Created is anastomosis through transhepatic drain according to pradera . Early and late postoperative flow was entirely normal with normal laboratory and echofindings . Control, contrast imaging through a drain showed the orderly flow of extrahepatic bile ducts, with minimal extravasation of contrast . Figure 1 an 2 show operative reconstruction of iatrogenic lesions of the common bile duct . As father of laparoscopic cholecystectomy is considered a french surgeon mouret, who in 1987 by laparoscopic method tourniquet artery and of the cystic duct, and removed gallbladder removed by mini laparatomy, but he did not publish his results (1). After him, this was performed by the french doctors dubois and perissat in 1988 . Mckennan and saye, the same year, performed the first laparoscopic cholecystectomy in the united states . In 2 - 4% of patients, this surgery cannot be fully performed, so in that case it is performed a conversion (traditional surgery). National institutes of health of the united states passed in the 1992 conclusion that laparoscopic cholecystectomy is the treatment of choice for symptomatic cholelithiasis . The first country in south eastern europe which has accepted this conclusion was croatia (1997). After laparoscopic surgery, the patient leaves the hospital the same day, or the day after, and may begin with everyday activities after 6 - 7 days . Hypercoagulability of blood is lower due to less stress, which contributes to minimal danger of deep vein thrombosis and pulmonary embolism . It was shown that laparoscopic cholecystectomy has significantly fewer complications than the open, but the iatrogenic lesions of the biliary tract occur twice or even three times more often . Already the first major multi - center study from europe and the united states has found such injuries in 0.5% of patients . The number of biliary tract injury during open cholecystectomy according to various authors injury of luschkin duct is found in 33% of the patients and it is a frequent complication . The biliary duct injury can be caused by lack of surgeon experience performing laparoscopy, but the cause may be difficult operating findings, such as gangrenous, acutely inflamed or atrophic gallbladder, which is a consequence of long - term chronic inflammation . Sometimes it is difficult to understand the anatomically changed relationships and erroneous surgical evaluation results in this complication . A common injury of the anatomical relations is the connection of the cystic duct into the right hepatic duct . Mirizzi syndrome is a wide communication between infudibulum of the gallbladder and hepatic duct, so the surgeon can cut away part of hepatic duct thinking that it belongs to the gallbladder . Cala and colleagues describe two types for classification of biliary tract injuries during laparoscopy: a) way classification and b) bismuth classification . According to the type and severity of biliary tract injuries were divided into 5 groups (way classification): puncture or minor lateral cutting injuries to the duct;setting clips on the right or left hepatic duct, common hepatic duct or choledocus, but without cutting;full cut of the common hepatic duct or choledocus;completely cut of the right or left hepatic duct;strictures.with regard to the place of stricture bismuth and blumgart divided them into four groups: stricture affect more than 2 cm from the confluence;stricture affect less than 2 cm from the confluence;stricture at the confluence;strictures on the left or right gall duct . Puncture or minor lateral cutting injuries to the duct; setting clips on the right or left hepatic duct, common hepatic duct or choledocus, but without cutting; full cut of the common hepatic duct or choledocus; completely cut of the right or left hepatic duct; with regard to the place of stricture bismuth and blumgart divided them into four groups: stricture affect more than 2 cm from the confluence; stricture affect less than 2 cm from the confluence; stricture at the confluence; strictures on the left or right gall duct . In case of stab wounds or minor cuts symptoms occur after 2 to 4 postoperative days . Patients complain on pain under the right rib arc in the right shoulder, body temperature is elevated, expressed leukocytosis, hyperbilirubinemia, increased secretion of bile into the drain, 200 - 400 ml/24h . That kind of injury can be solved by single resorbable sutures at the bile duct and/or by placing the t - drain . Early strictures and mistakenly placed clips on choledocus are reflected by strong biliary colic and progressive jaundice . Injuries caused by placing clips on choledocus will be resolved by repeated laparoscopy, with special emphasis on the vitality of the tissues to prevent stricture . Late strictures occur over weeks or months after surgery and cause a clinical picture of recurrent cholangitis and liver damage . To assess the injury of the bile ducts, can be used ct, mri, ercp, hida scintigraphy and percutaneous cholangiography . For sure completely cut choledocus short choledocus defects can be reconstructed by direct suture only if they are less than 1 cm . The problem of direct suture can be tensions in suture line or poor blood supply to the bile duct anastomosis line . The tension can be reduced by mobilizing the duodenum . For defects larger than 1 cm required the requirement for a good long - term outcome of biliodigestive anastomosis is good vitality of the bile duct tissues because if compromised, leading to biliary secretion, poor healing of the anastomosis and scarring . It is important to prepare the bile duct as shorter as possible to preserve the nutritive vessels that run along it to the right and left sides . Anastomosis is performed with removed jejunal curve according to roux, termino - lateral, by resorbable suture 5/0 . Seams are single, and by making up nodes outside the lumen . As the choice of therapy should be considered also endoscopic choledocus drainage, setting prosthetics trough the papilla vateri and papillotomy . Prevention of biliary tract injuries, and thus the occurrence of enteric fistulas and recurrent cholangitis allow intraoperative cholangiography . It is important to identify and classify injury to the biliary tract and make quality primary care for each following reconstruction attempt more difficult and demanding . At the department of surgery of general hospital in konjic laparoscopic cholecystectomy is performed since 1999 . In the beginning it was done by three trocars (european style), and later, in order to prevent complications or injury of the bile duct is performed surgery with four trocars (american style). The number of complicated procedures in our hospital does not differ from similar indicators in foreign surgical facilities.
Cardiac resynchronization therapy (crt) is an important device - based, non - pharmacological approach that has shown to improve the outcome in selected patients with chronic heart failure (hf). Large randomized trials have demonstrated that crt improves left ventricular (lv) function and reduces both morbidity and mortality rates . Until recently, crt was indicated in patients with advanced hf [new york heart association (nyha) functional class iii iv], reduced lv systolic function [ejection fraction (ef) 35%], evidence of electrical dyssynchrony (qrs duration 120 ms), receiving optimal medical therapy, and who were in sinus rhythm (sr). In the last esc recommendations, for the first time, atrial fibrillation (af) patients, who constitute an important subgroup of hf patients treated with crt, have been considered as eligible to receive crt on the condition that the effects of underlying rhythm be neutralized by atrio - ventricular junction (avj) ablation . The aha / acc / hrs guidelines also favourably considered crt in hf patients with af, without however emphasizing the possible need for aggressive rate control . Also, these guidelines remain imprecise in defining differentiated approaches according to the forms of af other than permanent . The present review explains, in the first instance, in which way af interferes with adequate crt . Secondly, a brief overview on the effects of crt in af patients is presented, followed by some recommendations, based on current evidence, on the most adequate approach according to patient characteristics, emphasizing the extent of atrial arrhythmic [atrial tachycardia (at)/af] burden . It is important to point out that these recommendations remain unsupported by evidence derived from randomized controlled trials (rcts), which are much needed . Atrial fibrillation (whether permanent, persistent, or paroxysmal) poses a number of challenges for adequate crt delivery . An intrinsic, intermediate - to - high, irregular spontaneous af rhythm reduces the percentage of effectively biventricular paced captured beats (bvp%). Even in a patient who has normal rate af, phases of effective biventricular capture alternate with phases of competing af rhythm which causes spontaneous, fusion, or pseudo - fusion beats (figure 1) this suggests that the global effective crt - dose may be markedly reduced compared with atrial - synchronous rhythm with a short av interval (as is achieved during sr) since the number of effective biventricular captured beats are reduced . Moreover, in af patients, during exertion, spontaneous ventricular rate tends to override bvp rates, determining a further reduction of paced beats precisely when patients are most in need of having biventricular capture, thus greatly limiting functional capacity . Another problem is the possible negative impact on prognosis of using combinations of negative chronotropic therapy to achieve adequate rate control . In fact, some studies have indirectly suggested that the use of either digoxin or amiodarone in hf may increase morbidity and mortality . A patient with af and hf treated with crt, spontaneous irregular intrinsic beats alternate with fusion and pseudo - fusion beats, thus markedly reducing effective crt . Adequate management of af and other atrial arrhythmias is primarily based on defining the at / af burden and how it impacts negatively on crt delivery . Defining atrial arrhythmic burden is derived from integrating clinical, device - derived data, as well as instrumental findings (such as echocardiographic measures). Any hf patient with a history of atrial arrhythmias requires particular attention, especially in the first months of crt, in order to ensure that resynchronization be adequately delivered . From a clinical standpoint, it is important to identify symptoms such as palpitations, and more importantly, worsening effort dyspnoea which may suggest that the resynchronization effect is reduced because of the interference of the underlying atrial rhythm . These clinical aspects should be substantiated by instrumental echocardiographic data, which may show unchanged or further progression of lv dysfunction expressed through increased ventricular volumes and further ef reduction . Retrieving relevant information (bvp%, duration, and numbers of mode switch episodes, etc .) Through device monitoring (figure 2) may complement clinical and echocardiographic data and, thus, provide a more complete picture on the extent of af / at burden in each patient . These different aspects, all obtainable during a routine outpatient visit, allow provision of an approximation of the effective af / at burden influencing crt delivery . Recently, kamath pointed out the importance of an accurate evaluation of crt - dose using sophisticated 12-lead holter monitoring, which seemed to be more accurate than conventional device - based information . Different aspects of crt patients with af before and after avj ablation, which may be appreciated through device features . In a 59-year - old female with permanent af treated with a crt - d device, avj ablation yielded the following improvements: better functional status as shown by the number of hours of activity per day; maximization of bvp%; and improvement of heart rate variability profile . Rate control strategy encompasses treatment options which effectively reduce and regularize heart rate in patients who usually have permanent af or a persistent af which cannot be readily cardioverted to sr . First, lowering heart rate to intermediate - to - low rate allows better diastolic filling and increases stroke volume in hearts with conserved frank the recourse to rate control drugs and/or activation of device - based algorithms is reasonable as first - line approach when af / at burden is low / intermediate . Rate control drugs considered effective in hf patients with depressed lv function include digoxin, amiodarone, and beta - blockers . However, more recent findings derived from randomized trials have suggested caution in the use of digoxin and amiodarone in patients with hf . Some device - derived features may be helpful to improve rate control and thus improve crt delivery these features include ventricular rate regularization (vrr) which consists in performing bvp, which overrides intrinsic rhythm, through faster ventricular - paced depolarization allowing to reduce short cycles through retrograde concealed penetration of the av node . The benefits of rate control achieved by activating vrr function is well established in patients with chronic af and no or only mild hf treated with a single chamber right ventricular (rv) pacing . In these patients, vrr has been demonstrated to confer acute haemodynamic benefits, to restore autonomic balance, and to provide a more regular rhythm during exercise, thus potentially improving functional status . Ventricular sense response (also called trigger function) which triggers lv pacing after a premature rv sense event is detected: this option may be activated in all crt devices of the latest generation . In the context of crt, the effectiveness of such rate control and rate regularization algorithms combined with the use of rate control drugs has not been investigated in an rct . Findings derived from different large observational cohort studies on the effects of crt in patients with permanent af have yielded contrasting results . One of these studies observed that treatment combining negative chronotropic drugs and activation of device features (vrr and trigger mode), even if permitting 85% of biventricular stimulation, did not yield significant long - term improvements in functional status, lvef, or lv end - systolic volume (lvesv) reduction . The ineffectiveness of this approach further found confirmation through another more extensive multicentre european study, which reported relatively high death rate, particularly occurring for worsening progressive hf in af patients treated with negative chronotropic drugs . Quite differently, other smaller studies have advocated that to achieve good results after crt in terms of survival, aggressive rate control strategy is not necessary . It is worth emphasizing, however, that when the survival curves of the hf patients with af treated with a combined device - based / drug regimen are compared, yearly death rate for any cause is considered to be remarkably high, amounting to over 14%/year in both separate cohorts of non - ablated patients (figure 3). Comparison of kaplan meier analysis for freedom from death for any cause between the gasparini et al . And the khadjooi et al . Sr, sinus rhythm; af, atrial fibrillation; af - drugs: atrial fibrillation with preserved av node conduction; af - abl, atrial fibrillation group with ablated av node . It therefore follows that in hf patients treated with crt who present a high or intermediate at / af burden, the pursuit of an aggressive treatment strategy, such as avj ablation, is warranted . Atrio - ventricular junction ablation is commonly performed in patients with symptomatic, drug - refractory, fast, permanent af as part of the conventional ablate and pace strategy, and has been shown to confer symptomatic relief . Atrio - ventricular junction ablation in individuals with af treated with crt has mainly been confined to selected patients in whom high - rate af or at jeopardizes satisfactory biventricular stimulation, and in crt - implantable cardioverter defibrillator (icd) recipients determines inappropriate icd interventions . The problem of inappropriate icd therapies during af, constituting 30% of all icd interventions, has an important negative impact on the quality of life of patients and may be completely resolved after avj ablation . However, in the context of crt in hf patients with concomitant af, a growing amount of evidence has demonstrated that avj ablation may be useful to optimize crt delivery by eliminating the deleterious haemodynamic effects of a competing, irregular, spontaneous intrinsic rhythm . The mustic af randomized trial, besides being the first randomized trial demonstrating possible benefits of crt in hf patients with permanent af and conventional indication for crt, also showed that in these patients, the preferred mode of ventricular stimulation was biventricular as opposed to rv . The study enrolled af patients with either slow - rate af or those who underwent ablation of the av node; the effects between pacing modes were compared using a crossover design with two 3-month periods . Although no result was found in the intention - to - treat analysis between the two modes (because of high numbers of dropouts), hf patients who completed the study improved in terms of functional status with bvp . Two other prospective studies investigated the effects of pacing mode in the management of af with rapid ventricular rates following avj ablation . Rate control achieved following avj ablation significantly improved symptoms and functional status with no difference between the pacing modalities, whether lv or rv, but in a population with much better lv function . The pave trial further confirmed the benefits of the ablate and pace approach using different pacing modes . The latter study observed a greater benefit of the bvp mode in patients with depressed lvef (45%) and/or in nyha functional class iii . Further observational studies have investigated the acute and short - term effects of avj ablation in hf patients with af treated with crt and have demonstrated an increase in global lv function, a reduction of mitral regurgitation, and an increase in exercise capacity; others have confirmed the chronic effects of crt in this patient subgroup, reporting improvements in nyha class, exercise capacity, and global lv function . It is important to stress that these benefits appear to be confined to af patients with previous avj ablation or spontaneous low - rate af . One large observational prospective investigation specifically evaluated the effects of avj ablation on crt delivery using a pre - defined protocol . This study showed that only those af patients who underwent avj ablation (and thus approaching 100% effective bvp) showed significant improvements in lvef, lvesv, and exercise capacity . Furthermore, a significantly higher proportion of responders (response defined as a 10% reduction in lvesv) were observed in the avj ablation group (68%) compared with the non - ablated group (18%) at 12 months . As later observed by the same groups in a more extensive observational multicentre study, crt combined with avj ablation conferred a significant reduction of deaths for any cause compared with crt alone, particularly by reducing deaths for progressive hf . Taken together, based on current observational data on af populations treated with crt, the benefits of avj ablation in allowing appropriate crt delivery seem to outweigh the risks associated with creating pacemaker dependency . The peculiarity of crt devices (using an rv and an lv pacing leads) should, theoretically, at least reduce the risks of pacemaker dependency related to lead fractures or malfunction . Nonetheless, the fear of pacemaker dependency remains a limiting aspect for the wider diffusion of avj ablation . Further studies are of course needed to investigate the extensive benefits of adding avj ablation to crt in hf patients with af following a prospective, randomized, multicentre design . The avert - af (atrio - ventricular junction ablation followed by resynchronization therapy in patients with chf and af) and the an - art study (av node ablation in crt) are both concerned with establishing whether avj ablation coupled with bvp may significantly improve functional capacity compared with pharmacological therapy in hf patients with permanent af and depressed ef . It should be stated that such studies aiming to assess the effects of crt according to soft / subjective endpoints may add little to the current recommendations . There is a great need to design rcts with strong endpoints, even though such designs may be difficult to implement for ethical and financial reasons . A reasonable and up - dated approach to investigate the effects of crt in this group involves using device - based surrogates of major clinical events . Device - based remote continuous patient monitoring may provide information on a daily basis of the patients' functional and clinical status, before the onset of an overt clinical event becomes manifest . But before these parameters may be validated as surrogates for strong endpoints of major cardiovascular events, better definition of their accuracy is needed . Atrial fibrillation and other atrial rhythm disturbances in patients with hf may have an important negative impact on the clinical benefit conveyed by crt, if these are not appropriately managed . Careful overall evaluation is mandatory to define precisely the at / af burden in order to articulate tailored diagnostic and therapeutic strategies . On the basis of recent observational data, in patients presenting intermediate or elevated at / af burden, avj ablation may represent a fundamental tool to achieve full crt delivery and, thus, confer marked improvements in global cardiac function, and, further, in survival . More studies are necessary to further support the recourse to avj ablation in this situation . Efforts should also be dedicated towards establishing tailored treatment approaches to adequately manage different atrial rhythm issues in hf patients treated with crt . Funding to pay the open access publication charges for this article was provided by electrophysiology and pacing unit, irccs istituto clinico humanitas, rozzano, milano.
A 52-year - old previously healthy male patient visited the emergency department of a local clinic due to dyspnea with the recent onset of chest pain . An emergency coronary angiogram (cag), which was prompted by a 12 lead ekg study suggesting precordial lead st segment elevation myocardial infarction revealed a totally occluded distal left circumflex coronary artery . Although percutaneous stenting of the culprit vessel was successfully performed, the symptoms of dyspnea had persisted . A subsequent trans - thoracic echocardiogram showed severe mitral regurgitation (mr) caused by a ruptured papillary muscle head . The patient was, therefore, subsequently transferred to our hospital for urgent surgery of the mitral valve . A preoperative echocardiogram showed severe prolapsing mitral regurgitation (a proximal isovelocity surface area radius of 14 mm at an aliasing velocity of 40 cm / sec) due to rupture of the posteromedial papillary muscle and a decreased left ventricular ejection fraction of 48% . Mild to moderate pulmonary hypertension with a tricuspid regurgitation (tr) velocity of 3.3 m / sec was also noted . At surgery moderate hypothermic cardiopulmonary bypass at 27 esophageal temperature was performed through selective cannulation of the aorta, superior vena cava, and inferior vena cava . Maintenance of cardioplegia was achieved by continuous retrograde coronary sinus infusion of cold blood cardioplegia . The mitral valve was exposed by transseptal incision extended to the left atrial roof, as exposure would otherwise have been extremely difficult through sondergaard's groove in the relatively small - sized normal left atrium of this patient . When viewed directly, it became clear that the anterior mitral valve a3 prolapse was caused by the disruption of a subpapillary muscle head of the posteromedial papillary muscle . After careful examination to rule out any additional structural valvular pathology that could have complicated the planned simple repair, the disrupted papillary muscle tip was reattached to the papillary muscle base with three interrupted mattress sutures of 5 - 0 polytetrafluoroethylene buttressed by a pledget . The approximating sutures were passed through healthy tissue adjacent to the endocardial surface at the base, thereby avoiding suturing the friable, necrotic tissue of the detached margins . Finally, a 26 mm cosgrove - edwards annuloplasty band (edwards lifesciences, irvine, california, usa) was used to perform the undersized mitral annuloplasty (fig . Two interrupted stitches of 5 - 0 polypropylene sutures were placed to approximate the lateral commissural portions of the anterior and posterior mitral leaflets to correct the residual trivial mr on saline testing . After an uneventful weaning of the cardiopulmonary bypass (cpb), the proceeding trans - esophageal echocardiography showed no residual mitral stenosis or regurgitation . Follow up echocardiography on the fifth postoperative day showed no mitral regurgitation but persistent mild left ventricular dysfunction with an ejection fraction of 42% . The patient remained in excellent clinical condition on the 4 postoperative month, which was the last follow up . Severe mr occurs in about 3% of patients presenting with an acute myocardial infarction, and is associated with an in - hospital mortality of up to 70% . Although progress in surgical management has led to improved outcomes over the decades, operative mortality remains high . The papillary muscle is a contiguous structure of the adjacent left ventricular wall that serves to preserve the contractile function and acts as an anchor for the chordae tendinae . While the anterolateral papillary muscle receives dual blood supply from the left anterior descending and circumflex coronary arteries, the posteromedial papillary muscle usually receives a single blood supply from either the right or left circumflex coronary artery . As a result, the posteromedial papillary muscle is relatively more vulnerable to rupture than the anterolateral papillary muscle, with a nearly three- to six - fold higher reported rate of disruption after acute myocardial infarction . Repair is usually recommended over replacement for the treatment of functional ischemic mr, as it is generally conducive to superior survival outcomes . However, in acute postinfarction papillary muscle rupture, experience is limited and most surgeons prefer to replace rather than repair the mitral valve . This is mainly due to their uncertainty regarding the durability of a repair that inevitably requires suturing onto friable and infarcted myocardial tissue . In addition, the potential for a longer aortic cross clamping time, greater technical difficulties in achieving a successful repair, and the likelihood of ventricular remodeling progression with consequent recurrence of mitral regurgitation have also led to a greater preference for valve replacement in this subset of patients . In the present case, one of two papillary projections of the posteromedial papillary muscle was disrupted . The basal portion of the main posteromedial papillary muscle appeared to be non - necrotic . Therefore, from the perspective of the papillary muscle mass involvement, the posteromedial papillary muscle was partially infarcted and thus considered to be amenable to repair by re - attaching the detached papillary muscle head to normal tissue . Reported a modified papillary muscle re - implantation technique involving reattaching the ruptured papillary muscle tip to a healthy area of the papillary muscle and reinforcing the repair with additional sandwiched pericardial pledgetted ptfe sutures . We avoided approximating necrotic tissue directly with necrotic tissue by placing the sutures through healthier - appearing tissue that was closer to the ventricular endocardium at the papillary muscle base . A search of the literature published in korea revealed surgery for acute post infarction papillary muscle rupture performed in nine patients . Of note, in all of them, therefore, to the best of our knowledge, this is the first reported case of a post infarction papillary muscle rupture that was treated with reimplantation of the papillary muscle in korea . Although the repair was successfully performed, further studies are warranted to substantiate and validate the durability of this method.
Ganglioside may influence growth and cell - to - cell interactions may be of importance in the development of malignancy . In the present study, we used a transplantable murine hepatoma as the experimental model, and treated the animals with 5-fluorouracil (5-fu) as the active therapeutic drug to determine the membrane glycolipids content variety . Kunming mice (normal mice) were obtained from the animal center at fu - dan university shanghai medical college . Mice containing the ascites - form transplantable hepatoma were obtained from the cancer institute of jiangsu province . The ascites was drawn from the transplantable hepatoma mice by a sterilized injector and placed into bacteria - free 0.9% nacl for dilution (1/3, v / v). Subsequently, the normal mice were inoculated with 0.2 ml of diluted cells under the skin in the foreleg and armpit regions . The tumors were allowed to grow for 13 days . Usually, solid tumors weighing 12 g were found afterwards . The animals were injected with 5-fu (0.2 mg/0.2 ml / day) i.p . At 48 h after tumor cell transplant . In the control group the animals were injected with a sterilized solution of 0.2 ml of 0.9% nacl instead of 5-fu . A third group of animals, raised without hepatoma transplant or any other form of treatment, was used as the normal group . After the administration of 5-fu or saline, the animals were sacrificed, and tissue and blood samples were collected for examination . Based on the method of sevenerholom, the contents of ganglioside, tsa lsa, and r - sa were determined . One - way anova was conducted to compare the biochemistry index of membrane glycolipids between the 2 groups . Kunming mice (normal mice) were obtained from the animal center at fu - dan university shanghai medical college . Mice containing the ascites - form transplantable hepatoma were obtained from the cancer institute of jiangsu province . The ascites was drawn from the transplantable hepatoma mice by a sterilized injector and placed into bacteria - free 0.9% nacl for dilution (1/3, v / v). Subsequently, the normal mice were inoculated with 0.2 ml of diluted cells under the skin in the foreleg and armpit regions . The tumors were allowed to grow for 13 days . Usually, solid tumors weighing 12 g were found afterwards . The animals were injected with 5-fu (0.2 mg/0.2 ml / day) i.p . At 48 h after tumor cell transplant . In the control group the animals were injected with a sterilized solution of 0.2 ml of 0.9% nacl instead of 5-fu . A third group of animals, raised without hepatoma transplant or any other form of treatment, was used as the normal group . After the administration of 5-fu or saline, the animals were sacrificed, and tissue and blood samples were collected for examination . Based on the method of sevenerholom, the contents of ganglioside, tsa lsa, and r - sa were determined . One - way anova was conducted to compare the biochemistry index of membrane glycolipids between the 2 groups . In evaluating the ability of antimetabolic drug 5-fu to inhibit tumor growth, we found that the weight of tumors was significantly different between the 2 groups (p<0.05) (table 1). Ganglioside content in hepatoma tissue was significantly different among the 3 groups (p<0.01), and those in the therapeutic group were significantly lower than in the control group (p<0.01). In the plasma of the hepatoma mice, the tsa and lsa contents were higher in in the control group than in the normal group (p<0.05), but the tsa and lsa content in the therapeutic group was lower than in the control group (table 3). The tsa and lsa contents in the plasma of the hepatoma mice were higher in the control group than in the therapeutic and normal groups (p<0.05). No significant difference was found in the r - sa between the therapeutic and control groups . Percent inhibition was calculated from the following equation: [(tumor weight of control group tumor weight of the therapeutic group)/tumor weight of the control group] 100% . * * p<0.05 . To observe the ability of antimetabolism drug 5-fu in the inhibition of tumor growth are showed in table 4, the transplanted hepatoma group weight of tumor was significance higher than that of normal control group (p<0.05). Therapeutic group, control group and normal group membrane content variety the ganglioside content in hepatoma tissue from the control group was significantly higher than that in normal mouse liver (p<0.01), whereas those in the therapeutic group was significantly lower than in the control group (p<0.01). In the plasma of the hepatoma mouse, the tsa and lsa content was significantly higher in the control group than the normal group (p<0.05), and the therapeutic group was significantly lower than the control group (table 6). The ability to produce transplantable hepatoma and the effect of 5-fluorouracil (5-fu) in the inhibition of tumor growth are depicted in table 4 . Our data reconfirm the ability of 5-fu to inhibit the proliferation of tumor cells by competitive inhibition of the synthesis of thymidine monophosphate . The mechanism could involve sialic acid, a family of acylated derivatives of neuragmic acid, which usually occurs as a terminal component at the nonreducing end of carbohydrate chains of glycolipids . Cell surface and membrane components play a vital role in neoplastic behavior . Increasing concentrations of sialic acid are common on the tumor cell surfaces of neoplasms . The carbohydrate moiety may have an influence on growth, as well as cell - to - cell interaction and the development of malignancy . The biochemistry index of membrane glycolipids may be considered as an ancillary indicator for judging therapy effect in transplanted hepatomas in mice.
Cardiac disease and hypertension have been the third and eighth leading causes of death in taiwan since 2000 . According to a recent study, the percentage of the population with a prescription for antihypertensive drugs in taiwan has increased from 2001 to 2006 . The authors of this study report that during this period, the average annual increase in prescriptions for calcium channel blockers (ccbs), angiotensin ii receptor blockers (arbs) and angiotensin - converting - enzyme inhibitors (aceis) were 10.7, 22.1 and 4.5%, respectively . In 2013, the sale volume of the three leading antihypertensive drugs in taiwan amounted to about us$5 million; in comparison, in the usa the value of prescriptions filled for antihypertensive drugs in 2013 totaled about us$678.2 million . The use of antihypertensive agents (ahs) has grown globally over the last decade . However, available data on a potential association between the use of ahs and risk of breast cancer are conflicting . Recent epidemiological studies suggest that beta - blockers prevent breast cancer progression or reduce recurrence and then improve survival [46]. In contrast, other studies have reported an increased risk or no association at all between the use of beta - blockers / ccbs and breast cancer risk [79]. In addition, evidence for any association between the use of aceis / arbs and breast cancer is also inconsistent, with some studies suggesting that aceis / arbs are not associated with cancer risk [10, 11], and others reporting an increased or reduced risk . To address the conflicting evidence from previous studies, the aim of the study reported here was to evaluate the risk of breast cancer associated with long - term use of ahs in hypertensive women . Data were retrieved from the national health insurance research database (nhird) and registry for catastrophic illness patient dataset (hv dataset) between january 1, 1998 and december 31, 2011 in taiwan . The nhird contains comprehensive information on demographic characteristics, pharmacy records and medical services from inpatient, outpatient and emergency care under a national health insurance program in which over 99% of the 23 million inhabitants of taiwan are enrolled . The hv dataset comprises specific data subsets of the nhird for research purposes and contains registration files and original claim data on patients registered in the nhird who have / had a catastrophic illness . Therefore, this study was exempt from the approval by the ethics review board at our institution . From the hv dataset, we identified 330,699 women with newly diagnosed hypertension [international classification of disease, ninth revision (icd-9 cm) codes 401405] who had been treated with any ahs continuously for at least 6 months between january 1, 1998 and december 31, 2011 . Among these, we further identified women with a first diagnosis of breast cancer (icd-9 cm codes 174.xx and 175.xx); these women were the cases in our study (fig aht antihypertensive, h / t hypertension, hv registry for catastrophic illness patient dataset, nhird national health insurance research database study flow diagram . Aht antihypertensive, h / t hypertension, hv registry for catastrophic illness patient dataset, nhird national health insurance research database we excluded patients who had a history of breast cancer or any cancer recorded in the hv dataset any time before the initiation of antihypertensive treatment and patients without continuous enrolment in a nhi program . Patients were followed from the date of diagnosis of hypertension in 1998 up to december 31, 2011 (median duration 13 years) or death, whichever came first (fig . We randomly selected hypertensive women registered in the nhird without any diagnosis of breast cancer who were receiving treatment for hypertension in the same period as the cases . These were matched (1:4) for age (5-year categories), index date and year of hypertension diagnosis with the cases to establish the control group (fig . 1). The main exposure of interest was that to beta - blocker, ccb, acei and arb therapy . We collected information on prescribed drug types according to anatomical therapeutic chemical classification system codes (c07 for beta - blockers; c02d, c08c, c08d, c08da51 for ccbs; c02e, c02l, c09a, c09ba for aceis; c09ca for arbs), dosage, date of prescription, supply days and total number of prescriptions from the outpatient and inpatient records . The cumulative defined daily dose (cddd) of each ah was calculated as recommended by the world health association . Beta - blockers were further classified as nonselective and beta-1 selective beta - blockers, and as selective and nonselective alpha - blockers . Several potential covariates, including age and comorbidities at cancer diagnosis, were also measured in the year preceding the index date . We evaluated the sensitivity effects by changing the inclusion criteria of drug prescription for three types of ah beginning at least from 69 months before the index date . Logistic regression was used to estimate the crude and adjusted odds ratio (or) and 95% confidence interval (ci) for breast cancer risk . We calculated a running sum of the duration and ddd of each drug from the date of the initial ah prescription to the index date . We categorized the cumulative use for each patient as follows: 1, 12, 23 and 3 years of duration . Data were analyzed using the sas statistical package, version 9.3 (sas institute, cary, nc). The significance level was set at p <0.05 (two - tailed test). Data were retrieved from the national health insurance research database (nhird) and registry for catastrophic illness patient dataset (hv dataset) between january 1, 1998 and december 31, 2011 in taiwan . The nhird contains comprehensive information on demographic characteristics, pharmacy records and medical services from inpatient, outpatient and emergency care under a national health insurance program in which over 99% of the 23 million inhabitants of taiwan are enrolled . The hv dataset comprises specific data subsets of the nhird for research purposes and contains registration files and original claim data on patients registered in the nhird who have / had a catastrophic illness . Therefore, this study was exempt from the approval by the ethics review board at our institution . From the hv dataset, we identified 330,699 women with newly diagnosed hypertension [international classification of disease, ninth revision (icd-9 cm) codes 401405] who had been treated with any ahs continuously for at least 6 months between january 1, 1998 and december 31, 2011 . Among these, we further identified women with a first diagnosis of breast cancer (icd-9 cm codes 174.xx and 175.xx); these women were the cases in our study (fig . 1). Aht antihypertensive, h / t hypertension, hv registry for catastrophic illness patient dataset, nhird national health insurance research database study flow diagram . Aht antihypertensive, h / t hypertension, hv registry for catastrophic illness patient dataset, nhird national health insurance research database we excluded patients who had a history of breast cancer or any cancer recorded in the hv dataset any time before the initiation of antihypertensive treatment and patients without continuous enrolment in a nhi program . Patients were followed from the date of diagnosis of hypertension in 1998 up to december 31, 2011 (median duration 13 years) or death, whichever came first (fig . 1). We randomly selected hypertensive women registered in the nhird without any diagnosis of breast cancer who were receiving treatment for hypertension in the same period as the cases . These were matched (1:4) for age (5-year categories), index date and year of hypertension diagnosis with the cases to establish the control group (fig . The main exposure of interest was that to beta - blocker, ccb, acei and arb therapy . We collected information on prescribed drug types according to anatomical therapeutic chemical classification system codes (c07 for beta - blockers; c02d, c08c, c08d, c08da51 for ccbs; c02e, c02l, c09a, c09ba for aceis; c09ca for arbs), dosage, date of prescription, supply days and total number of prescriptions from the outpatient and inpatient records . The cumulative defined daily dose (cddd) of each ah was calculated as recommended by the world health association . Beta - blockers were further classified as nonselective and beta-1 selective beta - blockers, and as selective and nonselective alpha - blockers . Several potential covariates, including age and comorbidities at cancer diagnosis, were also measured in the year preceding the index date . We evaluated the sensitivity effects by changing the inclusion criteria of drug prescription for three types of ah beginning at least from 69 months before the index date . Logistic regression was used to estimate the crude and adjusted odds ratio (or) and 95% confidence interval (ci) for breast cancer risk . We calculated a running sum of the duration and ddd of each drug from the date of the initial ah prescription to the index date . We categorized the cumulative use for each patient as follows: 1, 12, 23 and 3 years of duration . Data were analyzed using the sas statistical package, version 9.3 (sas institute, cary, nc). The significance level was set at p <0.05 (two - tailed test). We identified 6,463 hypertensive women with breast cancer as cases and 18,987 hypertensive women without breast cancer as controls . Among the 6,463 cases, the most commonly prescribed ahs was ccbs (52.8%), followed by aceis (45.5%) and beta - blockers (41.1%) (table 1). Ever - use of ccbs and beta - blockers for longer than 10 years was significantly associated with breast cancer (or 1.09; 95% ci 1.031.16) in an adjusted model . The risk of breast cancer was even higher in patients receiving hormone replacement therapy (or 1.28, 95% ci 1.181.39) and statins (or 1.68, 95% ci 1.501.83) (table 1).table 1characteristics of hypertensive patients with breast cancer and non - breast cancer during the study period (19982011)characteristiccase (n = 6,463)control (n = 18,987)odds ratio (95% ci) n% n% crudeadjustedmean age, years (sd)61.9(10.7)61.9(10.9) 18442724.217854.13 45541,48923.04,40923.2 55642,32035.96,72935.4 65741,61024.94,77825.2 75846459.981,91210.1 85 + 1271.973741.97menopause4,70272.713,79372.6mean cci score (sd)0.33(0.87)0.34(0.92)0.98 (0.951.01) diabetes1,76127.34,80325.31.11 (1.041.18)*1.08 (1.021.16) hyperlipidemia3,19649.59,20748.51.04 (0.981.10)ever users of hrt no5,45084.316,62687.61.00 (reference)1.00 (reference) yes1,01315.72,36112.41.31 (1.211.42)*1.28 (1.181.39)ever users of statins no5,72588.617,70093.21.00 (reference)1.00 (reference) yes73811.41,2876.781.77 (1.611.95)1.68 (1.521.85)types of aht acei no3,52054.510,15253.51.00 (reference) yes2,94345.58,83546.50.96 (0.911.02) arb no4,68272.414,29075.31.00 (reference)1.00 (reference) yes1,78127.64,69724.71.16 (1.091.23)1.04 (0.981.12) ccbs no3,05247.29,69751.11.00 (reference)1.00 (reference) yes3,41152.89,29048.91.17 (1.101.23)1.09 (1.031.16) * beta - blocker no3,80658.911,72161.71.00 (reference)1.00 (reference) yes2,65741.17,26638.31.13 (1.061.19)**1.05 (0.991.12) p <0.05, * * p <0.01, * * * p <0.001 sd standard deviation, cci charlson comorbidity index, hrt hormone replacement therapy, aht antihypertensive therapy, acei angiotensin - converting - enzyme inhibitor, arb angiotensin receptor ii blocker, ccb calcium channel blocker, ci confidence interval characteristics of hypertensive patients with breast cancer and non - breast cancer during the study period (19982011) * p <0.05, * * p <0.01, * * * p <0.001 sd standard deviation, cci charlson comorbidity index, hrt hormone replacement therapy, aht antihypertensive therapy, acei angiotensin - converting - enzyme inhibitor, arb angiotensin receptor ii blocker, ccb calcium channel blocker, ci confidence interval when we stratified the risk of breast cancer associated with different sub - types of beta - blockers, we found a statistically significant risk of breast cancer with most beta-1 selective beta - blockers, such as atenolol (or 1.14; 95% ci 1.051.25) acebutolol (or 1.29; 1.001.66) and bisoprolol (or 1.08; 1.011.16) (fig . 2). The non - selective beta - blockers, alpha - selective and beta - non selective showed no significant association with breast cancer (fig . 2).fig . 2forest plot of breast cancer risk associated with use of beta - blockers, 19982011 . Or odds ratio, ci confidence interval forest plot of breast cancer risk associated with use of beta - blockers, 19982011 . Or odds ratio, ci confidence interval we then stratified beta - blocker, arb and ccb users by exposure duration and the cumulative ddd . The results show that the risk of breast cancer was significantly increased in beta - blocker and ccb users with increasing exposure duration and increasing cddd compared to the controls [trend test for beta - blocker users: p = 0.003 (exposure duration), p = 0.0003 (cddd); trend test for ccb users: p = 0.006 (exposure duration), p = 0.002 (cddd)] (table 2).table 2odds risk and 95% confidence intervals for risk of breast cancer associated with exposure to different types of antihypertensives, duration of exposure and dosagetype of antihypertensive agentno . Of study subjectsno . Of breast cancer casesmultivariable - adjusted odds ratioodds ratio (95% ci) p for trendany beta - blocker never use15,5273,8061.00 (reference) ever - use exposure duration (years)0.003 12,0855210.99 (0.891.11) 122,3005480.91 (0.821.01) 231,5124021.03 (0.921.17)> 34,0261,1861.16 (1.071.26) * * * cumulative ddd 0.0003 cddd <q12,4805970.93 (0.841.02) q1 cddd <q22,4826210.97 (0.881.07) q2 cddd <q32,4806841.08 (0.981.19) cddd q42,4817551.22 (1.111.34)**any arb never use18,9724,6821.00 (reference) ever - use exposure duration (years)0.71 11,3553701.05 (0.931.19) 121,6524391.00 (0.891.12) 231,0832880.98 (0.851.12)> 32,3886841.03 (0.931.14) cumulative ddd 0.53 cddd <q11,6184441.06 (0.941.19) q1 cddd <q21,6214140.95 (0.841.07) q2 cddd <q31,6184411.00 (0.891.13) cddd q41,6214821.07 (0.951.21)any ccb never use12,7493,0521.00 (reference) ever - use exposure duration (years)0.006 12,2575721.05 (0.941.16) 122,6626961.08 (0.981.19) 231,9585221.09 (0.981.22)> 35,8521,6211.11 (1.031.19) * cumulative ddd 0.002 cddd <q13,1758181.05 (0.961.15) q1 cddd <q23,1768341.07 (0.981.18) q2 cddd <q33,1748381.06 (0.971.17) cddd q41,6214821.16 (1.061.28) * * * * p <0.01, * * * p <0.001 cddd cumulative defined daily dose adjusted for peripheral vascular disease, diabetes mellitus and medicine use (included hrt, statin, arb and ccb) beta - blocker: q1 (25%) = 195.25 ddd, q2 (50%) = 448 ddd, q3 (75%) = 1,012 ddd . Ccb: q1 (25%) = 390.1 ddd, q2 (50%) = 851 ddd, q3 (75%) = 1,641.3 ddd . Arb: q1 (25%) = 405 ddd, q2 (50%) = 800.5 ddd, q3 (75%) = 1,464 ddd adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statin, beta - blocker and ccb) adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statin, beta - blocker and arb) odds risk and 95% confidence intervals for risk of breast cancer associated with exposure to different types of antihypertensives, duration of exposure and dosage * * p <0.01, * * * p <0.001 cddd cumulative defined daily dose adjusted for peripheral vascular disease, diabetes mellitus and medicine use (included hrt, statin, arb and ccb) beta - blocker: q1 (25%) = 195.25 ddd, q2 (50%) = 448 ddd, q3 (75%) = 1,012 ddd . Ccb: q1 (25%) = 390.1 ddd, q2 (50%) = 851 ddd, q3 (75%) = 1,641.3 ddd . Arb: q1 (25%) = 405 ddd, q2 (50%) = 800.5 ddd, q3 (75%) = 1,464 ddd adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statin, beta - blocker and ccb) adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statin, beta - blocker and arb) the risk of breast cancer increased with ever - use of atenolol or acebutolol (table 3). This risk increased with increasing exposure, duration of use (trend test: p = 0.0003 for atenolol; p = 0.01 for acebutolol) and cddd (trend test: p = 0.002 for atenolol; p = 0.02 for acebutolol).table 3breast cancer risk associated with exposure duration and dosage of specific beta - blockers during the study period (19982011)variableacebutololatenololbisoprolol n / n odds ratio (95% ci) n / n odds ratio (95% ci) n / n odds ratio (95% ci)duration of exposure to antihypertensive agent aht non - use6,371/25,1631.00 (reference)5,661/22,6831.00 (reference)4,887/19,6971.00 (reference) exposure duration (years) 130/1041.10 (0.711.68)248/9421.01 (0.871.17)1,318/4,9131.06 (0.991.14) 2321/711.10 (0.661.84)222/7951.07 (0.911.26)121/4021.14 (0.921.42) 3417/521.37 (0.772.46)120/4231.08 (0.871.34)57/1791.24 (0.901.70)> 324/601.85 (1.103.12)212/6071.43 (1.201.70)*80/2591.12 (0.861.47) p for trend0.010.00030.03dosage (cddd) <q121/711.10 (0.661.84)187/8911.04 (0.871.23)384/14571.04 (0.921.18) q1<q219/720.97 (0.571.64)187/6891.03 (0.871.23)408/14291.14 (1.011.29) q2<q326/721.56 (0.962.53)202/6951.13 (0.961.34)382/14351.02 (0.901.15) q326/721.59 (0.982.58)226/6921.30 (1.101.53)*402/14321.10 (0.981.25) p for trend0.020.0020.053 p <0.05, * * p <0.01, * * * p <0.001adjusted for diabetes mellitus and medicine use (including hrt, statins, arbs and ccbs) n number of breast cancer patients using a specific aht, n total number of study population using a specific aht beta - blocker: q1 (25%) = 195.25 ddd, q2 (50%) = 448 ddd, q3 (75%) = 1,012 ddd . Ccb: q1 (25%) = 390.1 ddd, q2 (50%) = 851 ddd, q3 (75%) = 1,641.3 ddd . Arb: q1 (25%) = 405 ddd, q2 (50%) = 800.5 ddd, q3 (75%) = 1,464 ddd breast cancer risk associated with exposure duration and dosage of specific beta - blockers during the study period (19982011) * p <0.05, * * p <0.01, * * * p <0.001 adjusted for diabetes mellitus and medicine use (including hrt, statins, arbs and ccbs) n number of breast cancer patients using a specific aht, n total number of study population using a specific aht beta - blocker: q1 (25%) = 195.25 ddd, q2 (50%) = 448 ddd, q3 (75%) = 1,012 ddd . Ccb: q1 (25%) = 390.1 ddd, q2 (50%) = 851 ddd, q3 (75%) = 1,641.3 ddd . Arb: q1 (25%) = 405 ddd, q2 (50%) = 800.5 ddd, q3 (75%) = 1,464 ddd in the sensitivity analysis for exposure duration of ahs, the results were unchanged when the inclusion criteria of ah prescription was changed from <6 to> 9 months (table 4).table 4sensitivity analysis for criteria of antihypertensive usevariableany beta - blocker any arb any ccb n / n odds ratio (95% ci) n / n odds ratio (95% ci) n / n odds ratio (95% ci)non - user4,107/16,6901.00 (reference)4,876/19,7001.00 (reference)3,367/14,0121.00 (reference)user2,356/8,7601.04 (0.981.11)1,587/5,7501.01 (0.941.09)3,096/11,4381.09 (1.031.16)drug use (years) 2220/9220.94 (0.801.10)176/6271.08 (0.901.29)257/9941.07 (0.921.24) 23548/2,3000.91 (0.821.01)439/1,6521.00 (0.891.12)696/2,6621.07 (0.981.18) 34402/1,5121.03 (0.911.16)288/1,0830.97 (0.841.12)522/1,9581.09 (0.981.22)> 41,186/4,0261.15 (1.061.25)684/2,3881.03 (0.931.14)1,621/5,8241.11 (1.031.19) * p for trend0.0050.760.005 * p <0.05, * * p <0.01, * * * p <0.001 n total number of study population using specific aht, n number of breast cancer patients using specific aht adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statins, arbs and ccbs) adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statins, beta - blockers and ccbs) adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statins, beta - blockers and arbs) sensitivity analysis for criteria of antihypertensive use * p <0.05, * * p <0.01, * * * p <0.001 n total number of study population using specific aht, n number of breast cancer patients using specific aht adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statins, arbs and ccbs) adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statins, beta - blockers and ccbs) adjusted for peripheral vascular disease, diabetes mellitus and medicine use (including hrt, statins, beta - blockers and arbs) the results of this study suggest that the use of acei, arbs, and nonselective beta - adrenergic receptor antagonists (propranolol or carteolol) is not associated with breast cancer . These results are consistent with those of most observational studies [10, 11]. We also found that ccbs and the beta-1 selective beta - blockers acebutolol, atenolol and bisoprolol may increase the risk of breast cancer . This finding seems to differ from those of previous studies which reported that beta-1 selective beta - blockers and ccbs had marked protective effects [15, 16]. However, the authors of a recently published study reported observing a weak inverse association between cardio nonselective beta - blockers and breast cancer risk . However, since the association did not reach statistical significance, the results did not support the hypothesis of beta - blocker usage protecting against breast cancer progression . The results of a recently published network analysis indicated a lack of consistency in the effect of ccbs on breast cancer; this was attributed to the short duration of the follow - up in the trials included in the network meta - analysis . The results of previous preclinical studies are inconclusive in terms of whether beta - blockers have agonist activity in breast cancer growth . Some studies has demonstrated that beta-2 adrenergic signaling plays a role in several pathways involved in breast tumor progression and metastasis [17, 18], but others have found that beta - adrenergic receptor (ar) stimulation may both inhibit and promote breast tumor growth [1923]. A recently published study adds further to the body of evidence on the effect of agonist type, indicating that the beta 2-ar antagonist in particular seems to be the most cytotoxic beta - blocker in non - stimulated cancer cells . However, the majority of clinical observational studies carried out to date have focused on comparing the association between the use of propranolol or atenolol and breast cancer risk or mortality and have not explored the relationship between the subtype of beta - ar expression and breast cancer risk [25, 26]. Our study is the first from asia to report that treatment with the beta-1 selective blocker but not the nonselective 1/ blocker may increase the risk of breast cancer (fig . 2). These results appear to be consistent with those of preclinical studies suggesting that the effects of beta - adrenergic signaling on tumor progression and metastasis are inhibited by the 2-receptor antagonists but not by 1 antagonists [1824]. Consequently, better designed observational studies or randomized controlled trials are required before this type of beta - blocker can be considered as a therapeutic option for patients with breast cancer . This finding is consistent with those from a recently published study performed by li et al . . Both studies seem to revive an earlier previous hypothesis and focus on the long - term use of ccbs among current or ever - users (10 years if the study of li et al . ; 13 years in our study). However, other previously published studies found no increased risk of breast cancer associated with ccb use [25, 26]. Therefore, to date, the results on the effect of ccbs on breast cancer risk are inconsistent . Again, larger and more comprehensive studies are needed to confirm the effects of long - term use of ccbs on breast cancer . A major advantage of our study was that we collected information prospectively on healthcare beneficiaries registered in a large population - based database for whom complete data on drug prescriptions and cancer diagnoses were available . First, the health insurance database that we used was developed for administrative purposes and contained de - identified records of each individual registered . Second, the database only provided information on the frequency and classes of prescribed medications and did not provide any clinical laboratory data or clinical information; therefore, we could not estimate patient s responses to drug therapy . Finally, the database did not contain information on various lifestyle risk factors for cancer, such as physical activity, alcohol consumption, smoking, body mass index, socioeconomic status and diet; therefore, these were not included in the analysis . Although we adjusted the potential covariates, such as co - morbidities and the use of other medications, the misclassification of these covariates may have some impact on our results . Our findings indicate that the long - term use of ccbs or beta-1 selective blockers are likely to be associated with breast cancer risk . Further comprehensive and large population - based studies are needed to confirm these findings before any definitive conclusion can be drawn . Henry w. c. leung, li - ling hung, agnes l. f. chan, and chih - hsin mou declare no conflict of interest . This study was exempt from the approval by the ethics review board at our institution . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.
Most cases of spontaneous rupture of the renal pelvis and ureter are associated with ureteral obstruction by calculi . Although uterine cervical cancer is an exceedingly rare cause of renal pelvic or ureteral rupture, several cases have been reported (singh et al ., 2009, mcclinton et al ., 1989, spurlock et al ., 1987). The mechanism by which uterine cervical cancer causes spontaneous rupture of the renal pelvis and ureter has been suggested to involve obstruction of the ureter by tumor or swollen lymph nodes . We report a case of spontaneous ureteral rupture that occurred during concurrent chemoradiotherapy in a woman who had uterine cervical cancer associated with mild hydroureter without obstruction of the urinary collecting system . A 66 year - old woman with a diagnosis of uterine cervical cancer was referred to the gynecologic department of our hospital . Pelvic examination showed a 5-cm cervical tumor with bilateral parametrial involvement, which had infiltrated to bilateral pelvic walls . Histopathological examination revealed squamous cell carcinoma of the cervix, and federation of gynecology and obstetrics (figo) stage iiib disease was diagnosed . Contrast - enhanced computed tomography performed 10 days before starting concurrent chemoradiotherapy showed a normal renal pelvis and right mild hydroureter (fig . 1). The serum creatinine and hemoglobin levels were 0.68 mg / dl and 12.9 g / dl, respectively . Uniform bilateral enhancement of the renal cortex was seen on contrast - enhanced ct, indicating normal functions of both kidneys . Moreover, contrast - enhanced ct and ultrasonography showed no stone in the ureter or renal pelvis . During the first week of concurrent chemoradiotherapy, 40 mg / m of cisplatin and 3 l of infusion solution were administered as an intravenous drip infusion, followed by 2 l of infusion solution on the next day . The patient's body weight increased by 2 kg as compared with before treatment, and 10 mg of furosemide was given as an intravenous bolus injection . The serum creatinine and hemoglobin levels were 0.80 mg / dl and 13.3 g / dl, respectively . First, rupture of the renal pelvis and ureter can occur during concurrent chemoradiotherapy in the presence of uterine cervical cancer with ureteral stenosis . Second, contrast - enhanced ct was more useful than ultrasonography for the diagnosis of this condition . First, our experience showed that rupture of the renal pelvis or ureter can occur during concurrent chemoradiotherapy in patients who have uterine cervical cancer with hydroureter . This is most likely attributed to the fact that the lower ureter has three layers of myometrium, whereas the upper ureter has only two layers . Although tumors rarely cause rupture of the renal pelvis or ureter, several previous studies have reported that obstruction of the ureter by tumor or swollen lymph nodes is a potential cause (singh et al ., 2009, mcclinton et al ., 1989, spurlock et al ., 1987 we confirmed that the ureter was not obstructed when the double - j stent was inserted after ureteral rupture . In the presence of normal kidney function with partial obstruction of the ureter however, hydration does not lead to increased urine production in patients who have decreased renal function with complete obstruction of the ureter . The renal rupture in our patient was apparently caused by the rapid elevation of intrapelvic pressure due to hydration and treatment with furosemide . To our knowledge, this is the first reported case of ureteral rupture occurring during concurrent chemoradiotherapy in a patient who had uterine cervical cancer without obstruction of the urinary collecting system . Our second important finding was that contrast - enhanced ct was more useful than ultrasonography for diagnosis immediately after ureteral rupture had occurred . Several case reports have documented that renal rupture complicated by retroperitoneal abscess can lead to sepsis (hadar and servadio, 1979, lin et al . Intravenous pyelography can confirm dilation of the ureter and renal pelvis, as well as perirenal extravasation of contrast medium . Although it is easy to diagnose renal rupture when we see a hyperechoic lesion and urine around the kidney, most ruptures of the renal collecting system are not associated with a hyperechoic lesion or urinoma immediately after rupture has occurred (hwang et al ., 2000, koktener et al ., 2007). We diagnosed ureteral rupture on detecting the extravasation of contrast medium from the ureteral pelvis on contrast - enhanced ct . Therefore, if we encounter a patient with dilation of the renal pelvis with acute abdomen during concurrent chemoradiation, spontaneous ureteral rupture should be kept in mind . One report documented rupture of the renal pelvis in a patient with a ureteral stone who was being observed while receiving hydration and analgesics (tas et al ., 2013). Another study reported on a woman at 19 weeks' gestation in whom rupture of the renal pelvis occurred after she received a rapid intravenous infusion before cervical cerclage during spinal anesthesia (huang et al ., both cases of renal pelvic rupture were caused by a hydration - induced increase in urine flow under the condition of ureteral stenosis . In conclusion, rupture of the renal pelvis and ureter can occur during concurrent chemoradiotherapy in the presence of uterine cervical cancer with ureteral stenosis . We consider contrast - enhanced ct to be more useful than ultrasonography for the diagnosis of rupture of the renal pelvis or ureter . The early diagnosis of renal pelvic and ureteral rupture can prevent the development of severe complications, such as abscess . In women who have uterine cervical cancer with ureteral stenosis and normal renal function, the placement of a double - j stent before concurrent chemoradiotherapy may help to prevent rupture of the renal pelvis and ureter.
Carcinomas producing granulocyte colony - stimulating factor (g - csf) are extremely malignant and have a poor prognosis [1, 2]. Thus, a liposarcoma producing g - csf is particularly rare and has only been described in a few case reports [1, 3]. Here, the tumor also showed spontaneous rupture, which has not been previously reported for retroperitoneal liposarcoma . Positron emission tomography using f - fluorodeoxyglucose (f - fdg - pet) is used to detect tumors based on elevated glucose metabolism in carcinoma cells . It has also been shown that f - fdg uptake by bone marrow is correlated with the peripheral blood neutrophil count, since uptake reflects increased marrow metabolism . We performed f - fdg - pet with computed tomography (pet / ct) for imaging of the g - csf - producing tumor and found high f - fdg uptake by the tumor itself and diffuse uptake throughout the bone marrow . These are the first pet / ct images of a g - csf - producing tumor in a urological disease . The patient was a 63-year - old man with a history of hypertension and no specific family history . He was taken to the emergency department of our hospital due to significant aggravation of the pain in late july 2008 . An abdominal ct imaging (fig . 1) revealed a non - fatty, non - fibrotic, and non - calcified right retroperitoneal tumor of 15 cm in size and retroperitoneal hemorrhage . Hemorrhagic shock occurred due to spontaneous rupture of the retroperitoneal tumor during the examination, and an emergency transcatheter arterial embolization was conducted . The nutrient vessels were the superior and inferior suprarenal arteries, inferior phrenic artery, renal capsular artery, and the first lumbar artery . Three days after admission, the patient was transferred to our department for a more detailed examination of the retroperitoneal tumor . A routine peripheral hematological examination indicated a high white blood cell (wbc) count of 37,820/l and a strong left - shift of the differential leukocyte count, with a neutrophil count of 34,794/l . However, no infection appeared to be present based on physiological and biochemical findings, and endocrinological tests showed no abnormal findings . Since the wbc count remained high after the transfer to our department, further tests were carried out at the department of hematological internal medicine, based on the suspicion of a g - csf - producing tumor or a comorbid hematological disease . In parallel, elevated uptake of <f - fdg correlated with the tumor site (maximum standardized uptake value, suvmax, was 18.5) and the case was diagnosed as malignant . Pet / ct imaging also indicated diffuse uptake throughout the bone marrow, and particularly elevated uptake in the vertebral bone (suvmax: 10.5) (fig . 2). However, bone scintigraphy showed no bone metastasis, and bone marrow biopsy revealed little fat, significant hyperplasia, and increased neutrophils, but no findings of metastasis or bone marrow involvement . Based on all the above findings and the high serum g - csf level of 2,670 pg / ml (normal <8 pg / ml), the cause of the increased wbc count was determined to be a g - csf - producing tumor . A malignant tumor was suspected and right nephrectomy and retroperitoneal tumorectomy were conducted in mid - september . However, since the tumor had infiltrated into the inferior vena cava, diaphragm and abdominal wall already, only partial resection of the tumor was performed . Histopathological tests using hematoxylin - eosin staining showed findings for malignant fibrous histiocytoma mixed with those for well - differentiated liposarcoma (fig . The tumor was diagnosed as dedifferentiated liposarcoma based on the diagnostic criteria of the world health classification (who) [5, 6]. The postoperative peripheral wbc count was 21,000/l and the serum g - csf level was 1,170 pg / ml, both of which showed a transient decrease . With informed consent from the patient, only symptomatic therapy, but no chemotherapy or radiotherapy, was carried out while observing the prognosis . Liposarcomas are morphologically subdivided into five main subgroups: well - differentiated, myxoid, round cell, pleomorphic, and dedifferentiated . Dedifferentiated liposarcoma was first recognized by evans in 1979 and was defined in 2002 as a tumor with a clear - cut and well - differentiated component clearly separated from or occupying a large area beside a poorly differentiated component [5, 6]. Among 78 cases of retroperitoneal liposarcoma, fabre - guillevin et al . Described 52 cases of dedifferentiated liposarcoma with a differentiated component with features of malignant fibrous histiocytoma (36 undifferentiated pleomorphic sarcoma; 14 fibrosarcoma; 1 myxofibrosarcoma; 1 osteosarcoma; and/or 4 leiomyosarcoma), 21 of well - differentiated liposarcoma, 2 of myxoid liposarcoma, 2 of round cell liposarcoma, and 1 of pleomorphic liposarcoma . The cases of dedifferentiated liposarcoma had local recurrence and metastasis at rates of about 40 and 20%, respectively, and a poorer clinical outcome compared to well - differentiated liposarcoma [6, 7]. The production of g - csf has been reported in cases of hepatocellular carcinoma, pancreatic cancer, and gastric cancer [8, 9, 10]. G - csf - producing carcinomas show aggressive growth and a very poor prognosis [8, 9, 10]. There have only been a few previous case reports of a g - csf - producing liposarcoma [1, 3]. Six cases of liposarcoma accompanied by leukocytosis have been described in the english literature . However, the g - csf level has only been evaluated in 3 cases: in an upper arm dedifferentiated liposarcoma described by sakamoto et al ., in a mesenteric pleomorphic liposarcoma reported by nakamura et al ., and in the current case . In all 3 cases, the g - csf level and peripheral wbc counts were correlated with the clinical course . The g - csf level and wbc count showed a transient postoperative decrease in our patient, but this was followed by an aggressive clinical course and the wbc count was 145,800/l at the time the patient died . No hematological diseases such as leukemia or a leukemoid reaction were observed and bone marrow biopsy only showed hyperplasia . These findings led to the diagnosis of a g - csf - producing retroperitoneal dedifferentiated liposarcoma . This is an extremely rare clinical presentation, with the description of spontaneous rupture of a renal liposarcoma by mazuch et al . The rapid aggressive growth of the g - csf - producing tumor may have caused the rupture, and palliative surgery was performed because of the rupture . Pet / ct is useful for the evaluation of malignant lesions . In cases of carcinoma, diffuse f - fdg uptake in bone marrow is often indicative of bone metastasis or bone marrow involvement . In our case, pet / ct showed diffuse f - fdg uptake throughout the bone marrow, which indicated multiple bone metastases . Described 2 cases of g - csf - producing lung cancer that showed diffuse f - fdg uptake throughout the bone marrow . Commented that diffuse elevated f - fdg uptake in bone marrow may be helpful in the diagnosis of a g - csf - producing tumor . Bone metastasis is a differential diagnosis, and in our case bone scintigraphy and bone marrow biopsy were useful for ruling out bone metastasis . Murata et al . Showed that f - fdg uptake by bone marrow is strongly correlated with the wbc count (especially neutrophil count) and suggested that f - fdg uptake by bone marrow reflects marrow metabolism, which is mainly regulated by granulocyte progenitors and stimulated by endogenous hematopoietic growth factors . Found increased f - fdg uptake in patients treated with g - csf and showed that the increased uptake returned to the pretreatment value approximately 1 month after discontinuation of g - csf . The serum g - csf level is likely to be higher in patients with a g - csf - producing tumor than in those treated with g - csf thus, for a g - csf - producing tumor, at least 1 month is needed before a pet / ct evaluation after removal of the primary lesion . Other conditions associated with diffuse f - fdg uptake in the bone marrow include marrow hyperplasia resulting from hemolytic / iron - deficiency / blood - loss anemia . In addition, van de weile et al . Examined the relationship between bone marrow f - fdg uptake and levels of serum cytokines . In patients with non - small cell lung carcinomas, which are known to produce cytokines, f - fdg uptake by bone marrow thus, bone marrow f - fdg uptake in patients with a g - csf - producing tumor may also be related to cytokines such as tgf-. In conclusion, we encountered a rare case of a g - csf - producing retroperitoneal dedifferentiated liposarcoma that underwent spontaneous rupture due to rapid aggressive growth . This case is also the first report of pet / ct imaging of a g - csf - producing tumor in a urological disease . In such cases, one needs to be careful to avoid a misdiagnosis of bone metastasis, but imaging may be useful for differential diagnosis of a g - csf - producing tumor in patients with abnormally high wbc counts in the absence of infection.
Flynn et al ., reported the incidence of cubitus varus deformity after treatment was 5%, whereas arino et al ., reported that it was almost 21%, ulnar nerve deficit was found in 15% of patients who were treated with medial and lateral pin as per the report of chai.2345 many different methods are described such as close reduction and long arm cast or slab, dunlop skin traction, olecranon traction, but all of these methods had large complication rate.126789101112 the current preferred method of treatment for displaced supracondylar fracture has been close reduction and percutaneous pin fixation . This method has given excellent results reported by various authors.101112131415 thus, i conducted this retrospective study to compare whether lateral pin construct, if placed properly, can provide the same stability like medial and lateral pin fixation, at the same time avoiding the possibility of iatrogenic ulnar nerve palsy.161718 this retrospective study was carried out at orthopaedics department of m. m. medical college from july 2005 to july 2010 . A written informed consent was obtained from all the patients (by their parents).1920 in this study, 170 children with grade iii close supracondylar fractures of humerus were included . The patients were aged between 1.5 years and 13 years with the mean age of 7.76 years . The time of operation ranges from the 1 day of injury to the 8 day of injury with the mean time of operation being 4.6 days . The patients were evaluated as described by flynn and the results compared with the contra lateral normal elbow.2 under general anaesthesia, using c - arm fluoroscopy closed reductions were done.21 when satisfactory reduction had been achieved, then fixations were done by k - wires of 1.5 or 2.0 mm size and well - padded above - elbow posterior back - slabs were applied . [figures 1a - c] [figures 2a - c]. The patients were carefully observed for 12 - 72 hours (average 58 hours) and then discharged . The above - elbow plaster of paris (pop) back slabs were kept for two to three weeks and the pins and slab were removed in the outpatient (opd) clinic . Elbow range of motion (roms) was started after removing the pop back slab . The follow - ups were arranged as follows: the first follow - up on the 7 day to inspect the wound; the second follow - up on the second week for wound inspection or suture removal and to see the pin configuration ., x - rays were taken to see the callus formation; if callus is formed, then we remove the pop and pins and to start physiotherapy; the third follow - up on the 4 week and the fourth follow - up on the 8 week post - operatively to see the rom and carrying angle of the elbow, and the final follow - up on the 6 months post - operatively to see the final result of the study . (a) pre - operative a - p and lateral radiographs showing supracondylar fracture of humerus of 4-year - old child, (b) post - operative anteroposterior radiographs of supracondylar fracture of humerus showing with crossed k - wire fixation, (c) post - operative lateral radiographs of supracondylar fracture of humerus showing with crossed k - wire fixation (a) pre - operative a - p radiograph showing supracondylar fracture of humerus of 6-year - old child, (b) pre - operative lateral radiograph showing supracondylar fracture of humerus of 6-year - old child, (c) post - operative a - p and lateral radiographs of supracondylar fracture of humerus showing with 2 lateral k - wire fixation the protocol was approved by institutional ethics committee and thus meets the standards of the declaration of helsinki in its revised version of 1975 and amendments made to it in 1983, 1989 and 1996 (jama 1997;277:925 - 6). The protocol was approved by institutional ethics committee and thus meets the standards of the declaration of helsinki in its revised version of 1975 and amendments made to it in 1983, 1989 and 1996 (jama 1997;277:925 - 6). There were 170 children in this study, 97 children were male and 73 children were females . There were 103 left - sided and 67 right - sided fractures . Among 170 children, 102 children had injury during playing, 44 children had met with a road traffic accident and 24 had a fall from a height . The extension types were 158 (92.94%) and flexion types 12 (7.05%). 85 (50%) cases were treated by two lateral parallel k - wires and 85 (50%) by cross k - wires . Preoperatively, six cases had nerve injuries (median nerve three, ulnar nerve two and radial nerve one) and there were no cases of vascular injuries . Post - operatively, eight patients (4.70%) got ulnar nerve injury in the crossed k - wire group (n = 85). Six (3.52%) patients got pin tract infection, four in the crossed k - wire group (n = 85), and two in the lateral k - wire group (n = 85), which were superficial and healed after removing pins and oral antibiotic administration . There were no ulnar nerve injuries in the patient treated by inserting only lateral two k - wires . Callus formations were seen in all patients at the 2 - 3 weeks post - operatively before removing the k - wires . Results were analysed using flynn's criteria.2 all patients were followed at 8 week, 16 week and the 24 week, postoperatively . However, comparison between two groups showed that all categories such as 8 weeks, 16 weeks and 24 weeks with respective excellent, good, fair and poor were not found statistically significant . In cases of ulnar nerve injuries and pin tract infections all patients achieved complete radiographic healing at a mean of 4 weeks (range: 3 - 6 weeks). In a subjective measure of outcome at follow - up, in the crossed k - wire group (n = 85), the results were excellent in 88.23% and good in 5.88% patients, and in the lateral k - wire group, the results were excellent in 91.75% and good in 7.05% patients . No patients or parents reported their out - come as not satisfied . At follow - up, all patients went on to osseous union and regained a full range of movement after rehabilitation . During this study, complications like vascular injury, compartment syndrome, myositis ossifications, significant mal - union and non - union were not red . Distal pin migration was seen in five (2.94%) patients, loss of reduction was seen in six (3.52%), which was not significant and did not require re - reduction and re - pinning . Comparison between two groups such as cross k - wire group (85) and lateral k - wire group (n = 85) by using the chi square test showed that in case of 8 weeks with (p - values = 0.89), in 16 weeks (p = 0.91) and 24 weeks (p = 0.85) with respective excellent, good, fair and poor categories were not found statistically significant . The mean baumann angle loss in the medial - lateral pin fixation group and the 2-lateral pin fixation group was 5.96 and 5.30, respectively . Analyses of the baumann angle loss showed no significant difference between medial lateral pin fixation and 2-lateral pin fixation management of displaced extension type iii supracondylar fracture of humerus treated by close reduction and percutaneous pin fixation has consistently given satisfactory result compared to other method of treatment . However, controversy persists regarding the adequate pin fixation technique comparing medio - lateral and lateral pin fixation . In this study, not much difference between both fixation methods in terms of stability was found but there is an evidence of iatrogenic ulnar nerve injury (4.70%) in medio - lateral pin fixation group . Iatrogenic ulnar nerve injuries in this study were most likely neuropraxia (sunderland type 1) since all of them recovered without exploration or repair within 3.5 months post - operatively . Complete transaction of the nerve or neurotmesis was not seen in this study . In cases of ulnar nerve injuries and pin tract infections also not found statistically significant.22 the medio - lateral pin fixation method supposed to have the advantage of better fracture stability, although iatrogenic ulnar injury can occur with this technique . Pin fixation from lateral side has the advantage of avoiding ulnar nerve injury but this construct has been thought to be biomechanically less stable . Lee ss et al ., and ziouts et al ., reported that medial and lateral entry provides greater torsional rigidity than lateral entry pin fixation does.1920 the total strength of this construct is not only related to pin entry but mainly to divergence of the pins in different column and number of pins . The greater strength seen with the divergence of the pins was related to the location of the interaction of the two pins and the fact that the greater amount of divergence between the two pins allow for some purchase in the medial and lateral column.1920 there are some authors who advocated the use of the third wire to prevent the displacement of the distal fragment.2324 the use of a third pin requires the medial pin to enter the joint and thus increases the risk of joint penetration and infection . Skaggs et al.,13 found no ulnar nerve palsy and no reduction was lost in 124 children managed with only lateral - entry pins . In an other study of skaggs et al.,14 of 204 children who had a gartland type-3 fracture, 51 were treated with lateral pins only and 153 were treated with crossed pins . The configuration of the pins did not affect the baumann's angle in gartland type 3 fractures . The most common complication in the treatment of closed reduction and percutaneous pinning of displaced supracondylar fractures of the humerus is iatrogenic ulnar nerve palsy with the use of medial pin.1826272829 the rate of ulnar nerve injuries varies in different studies . Lyons et al.,29 have reported this number as 6%, royce et al.,27 as 3%, agus et al.,28 as 58% . It is found that postoperative nerve palsies after percutaneous pinning was with direct injury to the nerve, not after manipulation of closed reduction.11262730 skaggs et al.,14 noted the incidence of ulnar nerve injury as 4% in patients whom the pins were applied without hyper flexion of the elbow and as 15% in whom the medial pin was applied with the elbow hyperflexed . It is also showed that lateral - pins decrease the rate of ulnar nerve injury when compared with medial - pins . In the present study, there was no incidence of ulnar nerve injury where pinning was done from the lateral side; and i did not find any difference in bone healing and stability between lateral - pin insertion and cross - pin insertion as the same treatment protocol was followed for both the groups . Skaggs found that the use of lateral - entry pins alone was effective for even the most unstable supracondylar humeral fractures and they saw no iatrogenic ulnar nerve injuries, and no reduction was lost.1314 in the present study, iatrogenic nerve injury was seen in eight patients (4.70%) where pinning was done from cross pin insertion . Although most of the ulnar nerve injuries recover spontaneously between 4 months and 6 months, permanent damage has been reported in the literature.2731 lyons et al.,18 observed spontaneous functional recovery after the removal of medial pin . Pathological electromyographic measurements can be detected in most of ulnar nerve injuries during the early postoperative period . In this study, the results of both lateral and cross pin insertion groups at 8 post - operative week showed excellent results in around 70% of patients . At the final follow - up, these excellent results were seen in around 90% of the cases . In post - operative period those patients who had good or fair results were having severe soft tissue injuries or repeated closed reduction . Khan obtained 88% excellent, 4% good and 4% poor results in his study.32 tiwari observed 88% satisfactory results, among which 42% were excellent, in his series of late - presenting supracondylar fractures of humerus in children.33 these two studies are comparable to our study . Cubitus varus deformity is the most common problem seen after the treatment of supracondylar fractures . The cause of the deformity is coronal rotation, or tilting of the distal fragment.34 some investigators believed that varus deformity is due to epiphyseal growth disturbance or rotation of the distal fragment.35 smith suggested that residual medial tilt after reduction is the most important factor in varus angulations, with isolated rotational deformities being corrected by compensatory rotation at the shoulder.36 this concept has become popular in understanding the sequel of alteration in carrying angle.37 in this series, six patients (3.52%) had nerve injury preoperatively, out of which three had median, two ulnar and one radial . Eight patients got ulnar nerve injuries post - operatively, which is 4.70% of the total number . The incidence of postoperative has been estimated to range from 5% to 19%.38 culp recommends that initial observation and supportive therapy for neural injury associated with a closed, displaced, supracondylar fracture of the humerus; and that if there is no clinical or electromyography evidence of return of neural function at five months after injury, exploration and neurolysis should be performed . If the nerve is in continuity, the prognosis after neurolysis is excellent.39 in my study, six (3.52%) patients developed pin - tract infections, which were superficial and healed after removing pins and administration of oral antibiotics . Pirone found superficial pin - tract infection in 2% of cases with no deep infection and septic arthritis.40 in the present series, the distal pin migration was seen in five (2.94%) patients and loss of reduction in six (3.52%), which were not significant and so required no re - reduction and re - pinning . Gordon observed pin - tract migration in 6% of cases and lee noticed the loss of reduction in 7% of cases.1219 lee et al.,41 stated that the lateral pinning technique was found to be more beneficial than the medial and lateral crossed pinning technique for supracondylar fractures of the humerus in children, on the basis of current evidences . Avoiding the worst clinical scenario (permanent ulnar nerve palsy) might be more important and affordable than obtaining favourable clinical results (stable fixation) at the potential cost of disastrous complications . Dua et al.,42 proposed that closed reduction and crossed pinning of displaced supracondylar fractures of humerus in children is a safe and effective method even with delayed presentation . Erpelding et al.,43 stated that open treatment of distal humeral fractures with an extensor mechanism - on approach results in excellent healing, a mean elbow flexion - extension arc exceeding 100, and maintenance of 90% of elbow extension strength compared with that of the contra lateral, normal elbow . Woratanara et al.,44 stated that lateral pinning is preferable to cross pinning for fixation of pediatric supracondylar humerus fractures as a result of decreased risk of ulnar nerve injury . The main goal of the treatment of displaced paediatric supracondylar humerus fractures is to achieve an anatomic reduction . This reduction should be supported by a fixation with a good stability and less morbidity . When all these are taken into consideration, we believe that closed reduction and percutaneous lateral pinning is an efficient, reliable and safe method.
Cervix cancer is one of the leading causes of cancer morbidity among women worldwide and it is the second most common cancer among women in developing countries . Except for early stage, cancer cervix is usually treated with radiotherapy which consists of external beam radiotherapy followed by intracavitary brachytherapy . Bladder and rectum are the main organs at risk in the treatment of cervical intracavitary brachytherapy whose doses are ensured not to exceed the limits of tolerance . Several authors have shown that the dose distribution is affected by the geometry of the intracavitary applicators, age of patient, disease stage, length and angulation of the tandem, size of the ovoids and tandem [2, 3], volume of bladder and rectum . Similarly dwell position of source, vaginal packing, balloon inflation technique [6, 7] and proximity of the applicator to the bladder and rectum do affect the dose to organs at risk . It is a well known fact that the abdominal and pelvic organs move during respiration and can therefore lead to changes in the dose to organs at risk . Although there are many studies related to critical organ dose variation with respect to the factors as stated above, there is no study which evaluates the possible dose alteration induced by respiration in intracavitary brachytherapy . In this study, an effort has been made to evaluate the effect of respiration on the doses to bladder and rectum for patients undergoing cervical intracavitary brachytherapy . Fifteen cervix cancer patients of figo stage iib - iiib were included in this study . External beam radiotherapy was delivered to pelvis to a total dose of 50 gy in two phases, 40 gy in 22 fractions by four field box technique in first phase and 10 gy in 5 fractions with midline shield in the second phase . Subsequently all of them were treated with high dose rate intracavitary brachytherapy to a total dose of 21 gy delivered in three equal fractions at an interval of 1 week . During the procedure, a foley catheter was inserted into the bladder and its balloon was filled with 7 cc of radio - opaque fluid (omnipaque). The insertion of intracavitary applicators was performed under general anaesthesia and in each application an intrauterine tandem was place inside the uterine cavity and the ovoids in the vagina at the level of fornices . Five patients were kept on continuous bladder drainage while the rest had their foley s tube clamped to allow formation of full bladder . All the patients were scanned with philips brilliance big bore 16 slice ct scanner following intracavitary applicator insertion . The movement of the patient s chest was monitored using bellows during the scanning procedure . The respiratory bellows (philips medical systems, cleveland, oh) was tied around the chest at thoraco - abdominal junction . As the belt gets stretched with every respiratory effort, the pressure transducer produces disturbance in electrical voltage which is displayed in the monitor as waveforms corresponding to different phases of respiration . Four sets of ct image datasets each of 3 mm slice thicknesses with applicator in place were acquired at different phases of a respiratory cycle . The brachytherapy applicators were reconstructed from the ct image datasets and treatment plans were generated for all the four ct datasets on the planning system . In each treatment session, a dose of 7 gy was prescribed to point a. doses to icru 38 bladder (ibrp) and rectal (irrp) reference points were evaluated in all the four ct datasets . Besides, another point was taken at the center of the foley s balloon chosen to represent the mean dose to the bladder (bmean). Repeated mea - sures analysis was used to compare the differences in ibrp, irrp and mean bladder dose in all the four respiratory phases . Figure 1a shows the topogram of a patient with intracavitary applicator and 1b displays the respiratory waveform displayed on the philips 4d ct console . Table 1 shows the mean, range and median of the maximum dose to ibrp in all the four different respiratory states for full and empty bladder . Similarly, table 2 shows the mean, range and median doses of the mean doses to the bladder for full and empty bladder . The maximum dose to the icru 38 rectal reference point in the four different respiratory phases is displayed in table 3 . The maximum observed variation in doses to ibrp for full and empty bladder among the four respiratory phases was 15% and 3% respectively . Similarly the maximum observed variation in doses to irrp for full and empty bladder among the four respiratory phases was 12% and 8% respectively . The mean variation between the doses to full bladder at different phases of respiration is 4% whereas it is less than 1% with empty bladder . The dose to icru rectal reference point is within 3% for both full and empty bladder . No statistical significance was observed between different respiratory phases with ibrp, irrp and bmean for full and empty bladder condition . Dose to icru bladder reference point (ibrp) mean dose to bladder (bmean) dose to icru rectal reference point (irrp) a) topogram of a patient with applicator, b) respiratory waveform displayed on philips 4d ct console the doses to bladder and rectum are the major determining factor for late complications in intracavitary brachytherapy . There are several studies illustrating the different ways of reducing the dose to these organs at risk . Jain et al have demonstrated that proper vaginal packing and patient anatomy can minimize the dose to the bladder and rectum . Have shown that the bladder and rectal doses can be reduced by adjusting the dwell positions and relative dwell times of source positions . Studies have also shown that inflating the balloon of a foley catheter significantly reduces the dose to rectum and bladder [6, 7]. Quantified the displacement of points identified on the anterior uterine body, posterior cervix and upper vagina . They found that rectal filling may affect cervical position, while bladder filling has more impact on uterine body position, highlighting the need for specific instructions on bladder and rectal filling for treatment . Chan et al . Studied the internal movement of tumour, cervix, and uterus using serial cinematic magnetic resonance imaging scans and point - of - interest analysis . Both inter- and intra - scan motion was greatest at the fundus of the uterus, less along the canal, and least at the cervical os . The isotropic internal target margins required to encompass 90% of the interscan motion were 4 cm at the fundus and 1.5 cm at the os . In contrast, smaller margins of 1 cm and 0.45 cm, respectively, were adequate to encompass the intrascan motion alone . Currently 4d ct is being used extensively in imaging organs with evident internal movement . In many institutions, mri guided 3d optimization significantly improved the target coverage while retaining the constraints to organs at risk [1114]. In this study, we have used the 4d ct datasets to analyze the bladder and rectal dose at different respiratory phases . We noted that there is a difference between the doses to rectum and bladder at different phases of respiration . To the best of our knowledge, this is a unique study addressing the issue of organ motion with respiration in brachytherapy of cervix cancer . In our practice, the intracavitary treatment plan based on point a prescription icru points are preferably chosen for treatment evaluation than the 3d volume dvh parameters to avoid the possible dosimetric errors introduced by organ contours in the latter method . In our study, the variation of dose distribution in bladder is more with full bladder than when it is empty . Filling status of bladder also affects the rectal dose variation . An important observation from our study is that the dose to ibrp for those patients with full bladder was less as compared to those with empty bladder . This may be due to the fact that when the bladder is full, the foley s balloon falls farther from the applicator . The individual ibrp dose variation was of the order of 15% as compared to 3% for full and empty bladder respectively . This indicates that the foley s balloon get displaced with respiration when the bladder is distended but remain restricted in position in an empty bladder . The individual dose to irrp for different respiratory phases with full bladder is 12% as compared to 8% with empty bladder condition . Hence, the radiation oncologist could be advised to consider a possible variation in the doses to the bladder and rectum while planning intracavitary brachytherapy . One of the limitations of this study is that the study has been performed with ct based brachytherapy whereas gec - estro recommends mri based brachytherapy that enables accurate delineation of bladder and rectal volumes . Our study shows that respiration affects the bladder and rectal doses in cervix cancer brachytherapy . The dose to irrp was found to be affected with both full and empty bladder whereas the dose to ibrp was found to be affected more with full bladder than with empty bladder . Even though the mean variation in dose to bladder and rectum was within 4%, large individual dose difference was observed in some patients . Hence it is advisable to reduce the critical organ dose to account for the dose variation introduced by respiratory motion.
Several factors have been associated with this trend range from changes in the physical, social and economic way of life and environments of the people, to genetic and physiologic factors . Education is one of the media that influences greatly the attitude, social, economic and physiologic behaviors of the people . Many studies have established relationship between education and socioeconomic status (ses)[46]. While education can be seen to influence both ses and obesity, a number of works has been done on the relationship of obesity and ses, but the same cannot be said for obesity and education . Part of the growing concern in the increasing rate of obesity and overweight is the varying rates at which they are distributed across social groups, by levels of education, ses and ethnic background . Lipowics commented on the increase in the association between obesity and higher social class among men, women and children in developing countries, but noted a strong inverse relationship between obesity and social class only among women in developed countries . While sobal and stunkard noted inconsistent and general non - linear direction in the relationship of obesity and ses in men and children, they noted consistent relationship with women, where obesity was more prevalent in women of low ses, than those of upper ses . In view of the present increase in the prevalence of obesity in developing countries and accelerated increase in blood pressure (bp) amongst black population adopting western lifestyle . This work has been designed to determine the impact of education on obesity and bp in the ibo ethnic group of nigeria . This was based on a random sampling of 567 subjects aged 20 to 80 years of the ibo ethnic group of nigeria . This is of the three major ethnic groups (ibos, hausa and yoruba) in nigeria having a population density of over 800- 1500 per square kilometer . After focused grouped discussions on the objective of the study, and with the consent of the participants, questionnaires were distributed to them and bp and anthropometric measurements were taken . Pregnant women and hypertensive patients and individuals with structural deformities were excluded from the measurement . The first group called the primary education level consisted of candidates who had no form of formal education at all and also candidates who did not go beyond the first 6years of formal primary education . The second group called the secondary education level included candidates that did not go beyond the secondary or college education . The third group, tertiary education level, included candidates that have gone beyond the secondary education to tertiary education . Participants were allowed to rest at least for 10minutes in a seated position with arms supported at the level of the heart . The bp was measured three times with the cuff completely evacuated and recovery allowed between readings . The average of the readings was used as the systolic (sbp) and diastolic blood pressures (dbp). Height (ht) was measured to the nearest 0.5 cm using a vertical scale of portable stadiometer with the participant in erect position without shoes and head held in the frank fort plane . Weight was measured to the nearest 0.1 kg with a bathroom scale with the participant lightly clothed . Bmi was calculated as weight divided by square of height (kg / m2). Hip circumference (hc) was measured at the largest posterior extension of the buttocks . Arm circumference (ac) and forearm circumference (fac) were taken at the midpoints respectively . Skin fold thickness was measured on the subject's body at 3 sites (triceps, subscapular and calf) with a large caliper (cambridge, md). The triceps skin fold (tsf) was measured in midline of the posterior aspect of the arm over the triceps muscles, midway between the lateral projections of acromion process of the scapula and the inferior margin of the ulna olecranon process . The subscapular skin folds (ssf) calf skin fold thickness was measured in the midline over the level of maximum protrusion . In each case a double thickness of skin and underlying tissue were raised and measured . Based on the who definition for cardiovascular disease risk, the following were accepted as cut - off points for obesity, bmi> 29.9 kg / m, wc>102 cm for men and 88 cm for women, whr> 1.0 in men and 0.85 in women . Whtr> 0.05 was used as a cut - off point . Following who standard for definition of elevated blood pressure; the following were accepted as elevated bp; sbp> 140mmhg and/ or dbp> 90mmhg . The population characteristics, anthropometric indicators, sbp and dbp for both rural and urban populations are shown as means and standard deviations . Pearson correlation between the blood pressure indicators with adiposity indicators were carried out and also differences between the various adiposity indications between the two populations were also noted using the t - test . Participants were allowed to rest at least for 10minutes in a seated position with arms supported at the level of the heart . The bp was measured three times with the cuff completely evacuated and recovery allowed between readings . The average of the readings was used as the systolic (sbp) and diastolic blood pressures (dbp). Height (ht) was measured to the nearest 0.5 cm using a vertical scale of portable stadiometer with the participant in erect position without shoes and head held in the frank fort plane . Weight was measured to the nearest 0.1 kg with a bathroom scale with the participant lightly clothed . Bmi was calculated as weight divided by square of height (kg / m2). Hip circumference (hc) was measured at the largest posterior extension of the buttocks . Arm circumference (ac) and forearm circumference (fac) were taken at the midpoints respectively . Skin fold thickness was measured on the subject's body at 3 sites (triceps, subscapular and calf) with a large caliper (cambridge, md). The triceps skin fold (tsf) was measured in midline of the posterior aspect of the arm over the triceps muscles, midway between the lateral projections of acromion process of the scapula and the inferior margin of the ulna olecranon process . The subscapular skin folds (ssf) calf skin fold thickness was measured in the midline over the level of maximum protrusion . In each case a double thickness of skin and underlying tissue were raised and measured . Based on the who definition for cardiovascular disease risk, the following were accepted as cut - off points for obesity, bmi> 29.9 kg / m, wc>102 cm for men and 88 cm for women, whr> 1.0 in men and 0.85 in women . Whtr> 0.05 was used as a cut - off point . Following who standard for definition of elevated blood pressure; the following were accepted as elevated bp; sbp> 140mmhg and/ or dbp> 90mmhg . The population characteristics, anthropometric indicators, sbp and dbp for both rural and urban populations are shown as means and standard deviations . Pearson correlation between the blood pressure indicators with adiposity indicators were carried out and also differences between the various adiposity indications between the two populations were also noted using the t - test . Participants were allowed to rest at least for 10minutes in a seated position with arms supported at the level of the heart . The bp was measured three times with the cuff completely evacuated and recovery allowed between readings . The average of the readings was used as the systolic (sbp) and diastolic blood pressures (dbp). Height (ht) was measured to the nearest 0.5 cm using a vertical scale of portable stadiometer with the participant in erect position without shoes and head held in the frank fort plane . Weight was measured to the nearest 0.1 kg with a bathroom scale with the participant lightly clothed . Bmi was calculated as weight divided by square of height (kg / m2). Waist circumference (wc) was measured in centimeters at the narrowest waist . Hip circumference (hc) arm circumference (ac) and forearm circumference (fac) were taken at the midpoints respectively . Skin fold thickness was measured on the subject's body at 3 sites (triceps, subscapular and calf) with a large caliper (cambridge, md). The triceps skin fold (tsf) was measured in midline of the posterior aspect of the arm over the triceps muscles, midway between the lateral projections of acromion process of the scapula and the inferior margin of the ulna olecranon process . The subscapular skin folds (ssf) calf skin fold thickness was measured in the midline over the level of maximum protrusion . In each case a double thickness of skin and underlying tissue were raised and measured . Based on the who definition for cardiovascular disease risk, the following were accepted as cut - off points for obesity, bmi> 29.9 kg / m, wc>102 cm for men and 88 cm for women, whr> 1.0 in men and 0.85 in women . Whtr> 0.05 was used as a cut - off point . Following who standard for definition of elevated blood pressure; the following were accepted as elevated bp; sbp> 140mmhg and/ or dbp> 90mmhg . The population characteristics, anthropometric indicators, sbp and dbp for both rural and urban populations are shown as means and standard deviations . Pearson correlation between the blood pressure indicators with adiposity indicators were carried out and also differences between the various adiposity indications between the two populations were also noted using the t - test . A total number of 567 individuals from the ages of 18 to 80 years were used for this study . 325 (57.3%) of the individuals were males while 254 (42.7%) were females . The mean age of the study group was 33.6 + 14 years, and 33.7 + 14 and 33.5 + 13 years, for males and females respectively . The mean ages of the males and females of the various groups and also the mean values of all the anthropometric measurements, blood pressure values, and obesity indicators have been summarized in table 1 . Summary of the means and standard deviations of the various anthropometric and blood pressure parameters by sex across the educational levels the largest mean value of subcutaneous fat for both males and females was noted in the primary education group, followed by the secondary education group . The bmi assessment has the smallest mean value for both males and females in the tertiary education group . In the measurements of the central obesity indicators, the largest mean wc was noted within the males and females of the primary education group while the least was noted in the tertiary education group . Both mean values of whr and whtr were noted to be smallest in the males and females of the tertiary education group . The mean blood pressure values were also largest for the primary education group and least for the tertiary education group . For all the indicators of subcutaneous fat (ssf, tsf, csf, and sts), general obesity (bmi), and central obesity (wc, whr, whtr) largest mean deposition of both subcutaneous, general and abdominal fats were noted amongst women of the primary education group . The males showed larger mean bp values than the females in all the groups . In the summary of the obesity and cardiovascular disease risk occurrence, shown in table 2, the primary education group was noted to be at most risk as against the tertiary education group . Prevalence of obesity and cardiovascular disease risk by various indicators by sex across educational levels the prevalence of obesity and cardiovascular disease risk was found to be highest amongst females of the primary education group . All the obesity and blood pressure indicators used in this study (wc, bmi, sbp, dbp, whr, whtr, sts) showed inverse correlations with educational levels, which are significant for wc, sbp, dbp, and whtr . The highest and most consistent relationship was noted with blood pressure (sbp, dbp). It is an important risk factor for major chronic diseases, such as diabetes, heart disease, stroke and certain cancers and its link with education and socio - economic status in the various communities and ethnicities has been the query of most researches . Education has been shown to be a major determinant of health status, particularly in poor countries . Varying results have been reported on the effect of education on obesity and blood pressure from the different researches on various ethnicities and countries . Higher mean values of the measured anthropometric dimensions and ratios were observed in the individuals that had little or no education than in those that had better education . This same group also was more vulnerable to obesity and all the related cardiovascular disease risks . Both general, subcutaneous and abdominal obesities were worse for all the females of the various education group and worst for the females of the least educated group . This work has noted a strong education gradient in obesity for the studied population with the education gradient in obesity being stronger in women than in men . Similar findings have being reported for other countries and ethnicities . Increasing education at any point along that spectrum cutler and lleras - muney found that those with more years of schooling are less likely to smoke, drink a lot, to be overweight or obese or to use illegal drugs . Grossman and kaestner in their work effects of education on health concluded that years of formal schooling is the most important correlate of good health . Various explanations have been proffered on the reasons for this strong relationship between education and obesity . Educated individuals have been reported to make better use of health related information than those who are less educated . The lack of education about energy contents of foods has also been suggested to be a contributor to the effects of social class on obesity . Cutler and lleras - muney found that those with more years of schooling are less likely to smoke, drink a lot, to be overweight or obese or to use illegal drugs . Yoon suggested that it is possible that more highly educated people have the knowledge to develop healthy lifestyles and have more awareness of the health risks associated with being obese . The positive effect of education on obesity can summarily be attributed to greater access to health - related information and improved ability to handle such information by the educated, clearer perception of the risks associated with lifestyle choices and improved self - control and consistency of preferences over time . The establishment of a strong relationship between obesity and blood pressure within any community, group or country is important in the development of the most suitable education - based policies to counteract the present increase in obesity and related chronic diseases both in developed and developing communities and countries . This relationship between education and health has been traced to the health information which is part of education . So health education programs aimed at promoting healthy lifestyles might in principle generate similar effects to those associated with school education by providing relevant health information . To this effect government and other relevant policy making bodies are called upon to intensify actions toward organizing and funding of public health education campaigns . Education, whether through formal schooling or health promotion campaigns, has been identified as one of the factors that can be used to combat the present increase in the prevalence of elevated blood pressure, obesity and obesity related diseases.
Nevertheless, they propagate the high tie technique since it allows better lymph node retrieval and therefore a more accurate tumour staging . In another review comparing the low tie with the high tie technique, lange et al . Nevertheless, they favour the low tie technique since it is less invasive, also with regard to colonic innervation and motility, and it would be beneficial for anastomotic perfusion compared to the high tie technique . Performing a high tie (ht) technique allows anastomotic perfusion only through the marginal artery, which may lead to a decrease in anastomotic perfusion [5, 6]. When a low tie (lt) technique is performed, anastomotic perfusion is allowed not only through the marginal artery, but through the left colic artery and its ascending branch as well . This anatomical reality suggests that anastomotic perfusion is higher after low tie; however, no evidence exists supporting this hypothesis . The aim of this study is to compare the high tie technique to the low tie technique with regard to anastomotic perfusion . Patients planned for elective rectal resection for malignancy in four participating hospitals, with nine participating surgeons, were eligible for this non - randomized, prospective study . The o2c system (oxygen to see, lea medizin technik, giessen, germany) is a laser doppler flowmetry system that has often been used to measure intestinal blood flow for research purposes [7, 8]. Blood flow, expressed in arbitrary units, is determined by analysing the doppler frequency shifts in laser light (820 nm) reflected from moving red blood cells . The laser light is emitted into the tissue, and the backscattered light is detected with a flat probe with a measurement depth of 46 mm (lea medizin technik, giessen, germany). The o2c measurement frequency is 30 hz . Measurements were performed at two moments during the operation, being (a) right after median laparotomy and (b) just before construction of the anastomosis or colostomy, in case of abdominoperineal resection . The measurements were performed on the antimesenterial, serosal side of the colon segment that was to become, or was after resection (at moment b), the proximal loop . For all measurements, after placement of the flat probe, the flow measurement was allowed to stabilize until a constant flow was measured . The mean of these 15 measurements was used to calculate the blood flow ratio (bfr), b / a . During the measurements, the blood pressure was measured as well, and the mean arterial pressure (map) was calculated . The high tie technique was defined as ligation of the inferior mesenteric artery (i m a) at its origin . The low tie technique was defined as ligation of the superior rectal artery (sra), just below the branching of the left colic artery (fig . 1). B the dashed line indicates the level of ligature in ht, leaving no flow in the inferior mesenteric artery and its branches . C the dashed line indicates the level of ligature in lt; grey indicates the flow area of i m a after lt the vasculature of the colon . B the dashed line indicates the level of ligature in ht, leaving no flow in the inferior mesenteric artery and its branches . C the dashed line indicates the level of ligature in lt; grey indicates the flow area of i m a after lt the bfr distribution was normalised by a logarithmic transformation and compared between the ht and lt groups by means of an unpaired t test . A ht was performed in 16 patients (48%) of whom 12 (75%) received a primary anastomosis . A lt was performed in 17 patients (52%) of whom also 12 (71%) received a primary anastomosis . In all patients receiving a primary anastomosis, nine patients (75%) in the high tie group and ten patients (83%) in the low tie group received a defunctioning stoma . The mean number of lymph nodes harvested in the high tie group was 11 (range, 623); in the low tie group, 12 (range, 633) (p = 0.35). The mean number of positive lymph nodes harvested in the high tie group was 3 (15); in the low tie group, 4 (19) (p = 0.32). Two patients developed anastomotic leakage, one in the ht group and one in the lt group . In the ht group, no significant differences were found in the remaining baseline characteristics (table 1). Table 1patient characteristics of included patientsbaseline characteristicshigh tielow tiep valuegender (m / f)11/512/51.000age (years)55 1761 130.363bmi (kg / m)25 327 70.473operation1.000apr45lar1212neoadjuvant therapy0.024rt148no rt29asa score0.170i75ii86iii16cardiovascular comorbidity2 (13%)4 (24%)0.656operating time (minutes)160 (100340)145 (45225)0.450tumour stage0.250010i44iia24iib10iiia23iiib13iiic01iv40m / f male / female, bmi body mass index (kilograms per square meter), apr abdominoperineal resection, lar low anterior resection, rt radiotherapy, asa score american society of anaesthesiologists score patient characteristics of included patients m / f male / female, bmi body mass index (kilograms per square meter), apr abdominoperineal resection, lar low anterior resection, rt radiotherapy, asa score american society of anaesthesiologists score the mean bfr was significantly higher in the lt group as depicted in table 2, whereas the blood pressure during measurements was not significantly different as depicted in table 3 . Table 2comparison of blood flow ratios between the ht and lt techniquesratioht / ltmean ratiostd . Error of the meanp valueb / aht0.910.240.04lt1.480.32table 3map measured during the blood flow measurements at time points a and b, respectivelygroupmap a / bmeanstd . Error of the meanp valuehta67.12.20.473b64.23.2lta69.84.40.075b75.72.0 comparison of blood flow ratios between the ht and lt techniques map measured during the blood flow measurements at time points a and b, respectively to date, the discussion on the matter of high tie versus low tie continues . This study focuses on the colorectal vasculature and the flow change after ht or lt . Found the colonic blood flow to vastly decrease after ligation of i m a or sra, with the subsequent conclusion that this could be an unavoidable factor in the pathophysiology of colorectal anastomotic leakage . Only a slightly decreased blood flow was observed at the end of the operation (bfr 0, 91), whereas an increased blood flow was measured after lt (bfr 1, 48). The blood flow changes occurred independently from the systemic blood pressure (table 3). These different findings may be explained by the time interval between arterial ligation and measurement . Study the first measurement was performed immediately after laparotomy, and the second measurement, just before construction of the anastomosis or colostomy, i.e. At the end of the operation . Therefore, the interval between ligation and measurement is much longer in this study compared to the aforementioned study . This suggests that over time, a recruitment of colonic arteries occurs, allowing recovery of blood flow . In order to study whether these blood flow changes are permanent or not, blood flow measurements in the postoperative period would be interesting . In addition, since anastomotic leakage is generally detected around the eighth postoperative day, it could provide important information on the pathophysiological processes concerning blood flow leading to al . The bfr was significantly higher after lt which means lt allows better perfusion of the proximal anastomotic loop at the end of the operation . Most likely, this is due to the preservation of the left colic artery and its ascending branch . In addition to the marginal artery, these arteries allow a second pathway for blood supply and faster and/or a more extensive recruitment of colonic arteries . Therefore, since good perfusion is essential for proper anastomotic healing, lt would be the preferred technique for this aspect of the high tie low tie comparison . The average bfr after lt shows an increase in blood flow compared to the initial value at the end of the operation . This has been described before by karlicek et al . And could be due to reactive hyperaemia as a result of colon manipulation . However, it could also be due to a variety of ischaemia reperfusion injuries (iri). These injuries have been well described in animal models in which an iri leads to visible hyperaemia and decreased anastomotic strength . This response is probably also present after ht; however, it is more outspoken after lt most likely due to preservation of the left colic artery . Whether these findings have an impact on the incidence of anastomotic leakage should be evaluated by analysing the blood flow during the postoperative period or in a similar but larger study . The o2c allows non - invasive measurement of blood flow; however, the measurements are sensitive to several variables . Since it is virtually impossible to mark a spot on the colon without influencing the local blood flow or without hindering the progress of the operation, placement of the probe will be slightly variable . Second, the measurements are sensitive to different pressures applied on the probe when holding it in the right position . Higher pressures are likely to lead to more compressed arteries and a lower blood flow . In order to limit the influence of these variables on the outcome in addition, the blood flow ratio was calculated for which the first measurement served as a control . The use of a ratio also allowed standardizing intrinsic, patient - related differences like microangiopathy due to atherosclerosis and diabetes mellitus . Table 1 shows baseline characteristics to be comparable between ht and lt except for radiotherapy . This is, however, unlikely to have an effect on the blood flow in the proximal anastomotic loop since this loop is located outside the radiation field . In addition, the high tie group contained a higher number of patients with metastasized disease (stage 4 present in 25% in the ht group vs. 0% in the low tie group). This difference most likely illustrates the participating surgeons having preferred to perform a high tie technique in patients with metastasized disease . When comparing high tie ligation to low tie ligation, this study shows the perfusion of the proximal loop of the anastomosis to be better after low tie ligation . Considering neither of both techniques is favourable on the oncological or technical aspect, low tie ligation may be the technique of choice in patients undergoing rectum resection.
The main purpose of restorative dentistry is to restore and maintain tooth health by an adequate restorative treatment in order to protect and re - establish pulp function . Pulp plays an important role in the formation and nutrition of dentin as well as in the inervation and defense of the teeth (figure 1). The primary pulp function is dentin formation, which begins in the moment that the peripheric mesenchimal cells differentiate into odontoblasts and starts the deposition of collagen matrix, in a sequence of deposition / mineralization that ends with the complete tooth formation . Even after the initial formation, pulp continues to physiologically produce dentin due to the tooth aging . Odontoblasts maintain their processes inside the newly formed tissue, thus creating real channels that are responsible for dentin nutrition . The transportation of fluids and nutrients maintains pulp vitality and the resilience necessary to neutralize the masticatory tension / stress of the dentin . Finally, the pulp is responsible for the response to different stimuli, which forms the defensive action and includes blood vessel dilatation and permeability, and the presence of inflammatory cells . When the stimulus does not exceed the pulp healing capacity, modification in the dentin - pulp complex may occur, including repair67 . The protection of the dentin - pulp complex consists of the application of one or more layers of specific material between the restorative material and dental tissue to avoid additional challenge to the pulp tissue caused by operative procedures, toxicity of restorative materials and bacteria penetration due to microleakage . The materials that can be used for this purpose are varnishes, calcium hydroxide (ch)-based products, glass ionomer cements (gics) and adhesive systems . The biological compatibility of dental materials is of paramount importance to avoid or limit pulp tissue irritation or degeneration . Cytotoxicity and biocompatibility of materials used in dentistry have been widely studied in different cell cultures or in deep cavities with or without pulp exposure . The aim of this review article was to summarize and discuss the cytotoxicity and biocompatibility of materials used for protection of the dentin - pulp complex, some components of resin composites and adhesive systems when in direct or indirect contact with the pulp tissue . These potential aggressions include microbial toxins, heat, mechanical trauma, restorative materials, cleaning solutions and cavity liner cements . Following various injuries, pulp cells have the intrinsic capacity to repair, differentiate into odontoblasts and produce various dentin matrix proteins during wound healing11 . Some studies have shown that gingival38,51 and pulp5,13,84 fibroblasts can secret many types of cytokines in response to various stimuli in the same manner as odontoblasts, endothelial cells and immune cells27,65,78,82 . Cytokines are proteins secreted by innate or adaptative immune cells that act stimulating these cells . Different cytokines are produced in response to microorganisms and other stimuli, triggering several responses in immune and inflammatory cells . Some cytokines have structural homology that stimulate leukocyte dislocation and regulate the migration of blood to the tissue, which are denominated chemoattractant cytokines . These are produced by various cell types in response to inflammatory stimuli, and consequently recruit leukocytes to the inflammation area1 . When the injury is removed before pulp damage, a repair process begins81 and collagen synthesis is accellerated in this phase 62 . The deposition of collagen in the pulp tissue is increased by the action of cytokines . Collagen synthesis can be improved by transforming growth factor (tgf)-1 and tgf-2 and interleukin (il)-15,11 . Fibroblasts at an inflammatory microenviroment deposit collagen in a remarkable amount during the inflammatory process as opposed to normal conditions5 . The collagen synthesis by fibroblasts during the inflammatory process is a key event for human pulp repair11 . Ch solutions have been largely used with increased frequency, due to their property of stimulating sclerotic and reparative dentin formation and protecting the pulp against termal stimuli and antibacterial action30,76 . The first formulation of ch was introduced in dentistry by hermann (1920), and presented the capacity to induce pulp tissue to form a mineralized barrier, blocking the exposed surface . Ch is a multipurpose agent and there are several indications for its clinical application . Some of its indications include direct and indirect pulp capping, apexogenesis, apexification and treatment of root resorption, iatrogenic root perforations, root fractures, replanted teeth and interappointment intracanal dressing28 . Ch is certainly one of the most studied dental materials and it is classically used as the gold standard in biocompatibility tests due to its direct or indirect effect on exposed pulp repair . It is the material of choice for all pulp conservative treatment because of its biological and therapeutic potential25 . Ch, in dry powder, suspension or cement form, has been recommended for the treatment of exposed pulp due to its beneficial properties, such as induction of mineralization and inhibition of bacterial growth9 . Many studies indicate pulp repair and hard tissue barrier formation when exposed pulp tissue is directly capped with different ch formulations (figures 2 and 3). In the clinical practice, the presence of hard tissue barrier after capping can be considered an asset, since it provides natural protection against the infiltration of bacteria and chemical products44 . However, the importance of calcified hard tissue barrier formation after capping has been challenged by other studies, which have shown multiple tunnel defects and cell inclusions in bridges following pulp capping with ch . This may lead to leakage and bacteria penetration into pulp tissue unlike the permanent seal produced by bonding agents37,69 . These tunnels not caused by the ch itself but are rather a consequence of the severity of the trauma to the pulp and the number of vessels injured during the mechanical exposure . It has been observed that inside the tunnels there are blood vessels, which maintain the calcium source to the necrotic tissue . The calcium ions in the necrotic layer are responsible for partial dystrophic calcification of the coagulation necrosis . Another type of defect in hard tissue barriers, when present, is represented by cellular inclusions generally situated between the coagulation necrosis and the calcification zone69 . The presence of a hard tissue barrier must be recognized not only as a structural barrier against future injuries, but also as a sign of biological recovery, represented by odontoblast activity76 . Yoshiba, et al.86 reported findings that support the hypothesis that the differenciation of pulp cells into odontoblasts during reparative dentinogenisis is mediated by fibronectin, which is associated with the initially formed calcified layer after pulp capping with ch86 . Capping of contaminated and inflamed dental pulps results in a remarkably high degree of healing, characterized by resolution of inflammation, reorganization of soft tissue, and formation of new hard tissue at the exposed site76 . The mechanism of pulp repair using ch as a direct pulp capping agent is still not well understood . However, it has been reported that the high alkaline ph of ch solutions can solubilize and release some proteins and growth factors from dentin . Due to its high ph, ch induces a coagulation necrosis layer when in direct contact with pulp tissue43 . Ch products do not act as bioestimulators neither are biocompatible to the pulp tissue . On the contrary, cells in contact with ch are killed due its alkaline ph, forming a necrotic layer (cauterization zone) of variable thickness . Then, rather than the pulp capping agent (ch), the subjacent pulp tissue is responsible for the pulpal healing associated with hard tissue barrier formation . Similar effects on pulp exposures are caused by cements that present high ph, such as different formulations of mta cements32 . Classical microscopic studies have shown that ch produces a superficial pulp necrosis and forms calcium carbonate, whose globules act, in a first moment, as dystrophic calcification nucleous, in the margin and in the interior of the dense reticular fiber deposition, immediately beneath the granular zone43, where odontoblast - like cells differentiate and organize to produce dentin . It has been suggested that the ph increases due to the presence of free hydroxyl ions may initiate mineralization80, although other alkaline compounds, such as barium hydroxide and calcium phosphate, failed in this process55 . The alkaline ph can neutralize the lactic acid secreted by osteoclasts and may help preventing mineral tissue destruction . Ch can act as a local buffer against the acid reactions produced by the inflammatory process42 . Heithersay31 (1975) suggested that the calcium ions can reduce capillary permeability, thus low intercellular fluid produces increasing calcium ions concentration at the mineralization area42 . In spite of all these advantages, . The multiple tunnel defects present a morphological disruption of the dentin bridge barrier, in that they fail to provide not only a solid barrier, but also a long - term biological seal against bacterial infection . Consequently, the tunnels permit oral contaminants, such as bacteria and their toxic factors, to eventually gain access to the pulp tissue through the marginal gap formed at tooth / restoration interface76 . The presence of bacteria and their products that penetrate via microleakage, and not the medicament per se, is the main factor responsible for pulp inflammation and necrosis76 . Mta materials are a mixture of a refined portland cement and bismuth oxide, and are reported to contain trace amounts of sio2, cao, mgo, k2so4, and na2so4 24 . Although it may be inferred that portland cement could serve as a mta substitute, mta products have been reported to have a smaller mean particle size, contain fewer toxic heavy metals, has a longer working time, and undergo additional processing / purification than regular portland cements47 . Up to 2002, only one mta cement, consisting of a graycolored powder, was commercially available . In the same year, white mta (wmta) was introduced as proroot - mta (dentsply, tulsa, ok, usa) to address esthetic concerns24 . After that time, two forms of mta materials were categorized: the traditional gray mta (gmta) and wmta . Scanning electron microscopy (sem) and electron probe microanalysis characterized the differences between gmta and wmta, and revealed that the major difference between them is in the concentrations of al2o3, mgo, and feo24 . Wmta was also reported to possess an overall smaller particle size than gmta26, while it was also suggested that the reduction in magnesium could also contribute to the lighter color of wmta24 . Mta materials were reported to form a porous matrix characterized by internal capillaries and water channels in which increased liquid / powder mixing ratio produced more porosity and increased solubility33 . Gmta solubility levels have been reported to be stable over time, but the usually reported ph between 11 or 12 may slightly decrease32 . The high ph level of mta materials has led some authors to theorize that the biologic activity and its biocompatibility is due to the formation of ch26,32,33 . Both wmta and gmta have been shown to possess antibacterial and antifungal activities, which are presumably due to its ph . The cytotoxicity of gmta, amalgam and zoe was measured using a cell viability assay for mitochondrial dehydrogenase activity in human periodontal ligament fibroblasts after 24 h of exposure to extracts of varying concentrations of the tested materials, in both freshly mixed and 24-h set states49 . In the freshly mixed state, the sequence of toxicity was amalgam> super - eba> mta . In the 24-h set state, the sequence of toxicity at a low extract concentration was super - eba> mta, amalgam; while at higher extract concentrations it was super - eba> amalgam> mta49 . Similarly, another report reinforced that gmta did not affect negatively human periodontal ligament fibroblast mitochondrial dehydrogenase activity52 . Wmta, as well as ch and a zoe sealer, was shown not to affect the cell viability or the prostaglandin e2 synthesis of murine macrophages and fibroblasts54 . Wmta effect on dental pulp cell viability and proliferation has been evaluated using mouse mdpc-23 odontoblast - like cells and od-21 undifferentiated pulp cells . After 24 h of exposure to wmta, apoptosis was not induced in either cell line, and wmta was reported to cause increase in dna synthesis, suggesting a positive effect on cellular proliferation56 . This was corroborated by another report that suggested that wmta had a more stimulating effect on human dental pulp cells than a commercial ch preparation79 . Some reports speculated that mta material biocompatibility was derived from ch formation24,33 . A prospective study compared ch and gmta as permanent dentition pulp - capping medicaments and concluded that ch specimens were hallmarked by tissue inflammation with a 0.15-mm thick dentinal bridge with adjacent pulp tissue necrosis noted at 6 months2 . These findings were in contrast with those for gmta specimens displaying mild tissue reactions with a 0.28-mm and 0.43 mm dentin bridge noted at 2 and 6 months, respectively, as well as absence of pulp tissue inflammation, associated with a near - regular odontoblastic layer2 . However, the authors did acknowledge a small sample size and the need for further studies . A second prospective study compared wmta and a ch preparation as direct pulp cap medicaments and concluded that at 30 post - treatment days, wmta group had 20 teeth with clinically normal pulpal status while three were diagnosed with reversible pulpal disease48 . Ch group showed 17 teeth with normal pulpal signs, 6 exhibited signs of reversible pulpal disease, and 1 was diagnosed with irreversible pulpal disease48 . At the 136th recall day, all 23 teeth present for the wmta group were clinically diagnosed as successful as well as 22 teeth of the ch group48 . For use of mta materials as direct pulp cap medicaments, the two clinical prospective studies suggest that both gmta and wmta may perform equally in comparison to traditional ch in non - carious mechanical pulp exposures in teeth with normal pulp tissue70 . Although the initial results are positive, further clinical studies are needed, especially in more clinically relevant situations involving carious pulp exposures before mta materials can be unequivocally indicated as direct pulp - capping agents70 . The histologic pulpal response comparing wmta to ch as pulpotomy dressings was investigated in premolars extracted for orthodontic purposes, reporting that wmta induced a more homogenous and continuous dentin bridge with less pulpal inflammation than ch at both 4 and 8 weeks after treatment10 . Reports have strongly suggested that the favorable biologic performance exhibited by mta materials is due to hydroxyapatite formation when these materials are exposed to physiologic solutions . Although the overall results in human studies involving mta materials are very positive, further longitudinal studies are encouraged, as at present insufficient well - designed and controlled clinical studies exist that allow systematic and meta - analysis review of mta materials in all of its suggested clinical indications57,70 . Although physical properties of resin composites are being improved constantly, in vivo studies have shown that the use of resins as restorative materials is occasionally associated with irritation and necrosis of the pulp6,75,77 periodontal tissues60 . Most components of the adhesive systems and resin composites, such as bisphenol a - glycidyl methacrylate (bis - gma), urethane dimethacrylate (udma), triethylene glycol dimethacrylate (teg - dma), camphoroquinone, 2-hydroxyethyl methacrylate (hema) and others, have been shown to have definite cytotoxicity when in direct contact with mammalian fibroblasts39 . In that study39, the most cytotoxic monomers were bis - gma and udma, which caused irreversible effects on the cellular metabolism39 . These monomers, when applied on dentin discs, even in the presence of internal pressure, are able to diffuse through the dentinal tubules and reach the pulpal space in concentrations directly proportional to the molecular weight of the monomeric materials7 . Resin composite components can be leachable when the degree of conversion is not reached29 or when the resin is degraded by esterase from saliva or when hydrolytic degradation occurs31 . Adhesive resin systems are used to enhance retention, reduce microleakage, and decrease postoperative sensitivity of composite resin restorations . In vivo studies have demonstrated that the application of an adhesive resin directly onto a site of pulp exposure, or to a thin layer of dentin (less than 0.5 mm), causes dilatation and congestion of blood vessels as well as chronic inflammatory pulpal response (figure 4)40,41 . Complete polymerization of adhesive resins might be unachievable during direct pulp - capping procedures due to the presence of the pulpal edema . In additiom, it has benn shown that the oxygen prevents complete polymerization of adhesive resin monomers34 . Consequently, unpolymerized monomers released from the resin - based material can diffuse directly into the pulp at the exposure site, as well as diffuse through the dentinal tubules to cause cytotoxic effects to the pulp cells66 . There is a dramatic difference in the responses of cells to the three conditions of polymerization (light curing for 0, 10 or 40 s). While unpolymerized and partially polymerized adhesive resin induced apoptosis very rapidly in macrophages, undifferentiated pulp cells (od-21) and mouse odontoblast - like cells (mdpc-23), polymerized adhesive resin induced significant apoptosis only in macrophages . These findings might be explained by the lower leaching of toxic elements from polymerized as compared with unpolymerized adhesive resins, and underline the importance of thorough polymerization of the adhesive system before placement of the resin composite53 . Although many resins present excellent physical and mechanical properties, when irradiated for short periods of time or with a low light intensity, inadequate conversion of the monomers may interfere negatively on mechanical properties and increase the resin cytotoxicity . Costa, et al.18, 2003, in an in vitro study evaluated the cytotoxic effects of a restorative resin composite applied to an immortalized odontoblast cell line . The results suggest that the amount of unconverted monomers on dentin should be reduced to avoid diffusion of the residual monomers to the pulpal space, resulting in chemical damage to the pulp tissue . This may be accomplished by treating appropriated increments of restorative resin with adequate light intensity and the time of light curing, which will play an important role in converting uncured monomers into polymers18 . Bonding agents have been found to release camphoroquinone, a photoinitiator and photosensitizer widely used to generate free radicals including reactive oxygen species46 . It has been documented that the camphoroquinone acts not only as a cytotoxic agent, but also as a mutagen and its lixiviation may partly explain why these kind of resinous products are considered as toxic agents46 . Although clinical and in vivo studies have shown a low incidence of unfavorable effects of dentin bonding systems, pathological changes of pulpal tissues, such as dilatation and congestion of blood vessels, inflammatory responses and production of irregular dentin as well as odontoblastic displacement or tooth sensitivity can occur after placement of composite restorations75 . The monomers in contact with oxygen are not converted into polymers and will remain at the outer layer of the adhesive systems29 . The unconverted monomers of the adhesive systems and resin composite in the cavity may diffuse to the pulp through dentinal fluid66 and may cause adverse effects35 . In addition, dentin bonding agents may be responsible for undesirable pulpal reactions when placed directly on the pulp or in deep cavities, due to the presence of bis - gma, which is the major component of most current bonding systems . These pulp reactions can be related to components of the adhesive resins (tegdma and hema) that were shown to be soluble in aqueous solutions and cytotoxic to immortalized 3t3-fibroblast cultures36 . The high concentration of hema present in primers and adhesive resins available in the dental market may promote remarkable cytopathic effects on cultured pulp cells, even after curing and rinsing the experimental materials in order to decrease the concentration of acidic and non - acidic agents, which are common ingredients of dentin adhesive resins22 . When the adhesive system (scotchbond mp; 3m / espe - dental products, st paul, mn, usa) and the monomer hema (polysciences, inc ., warrington, pa, usa) were implanted in subcutaneous tissue of rats, persistent inflammatory reaction was observed adjacent to the material . This persistent inflammatory response was mediated by macrophages and giant cells and may be caused by partially or unpolymerized resin particulates that remain in contact with the connective tissue21 . In another study in subcutaneous tissue of rats, the authors concluded that the adhesive systems applied directly on the tissue promote persistent inflammatory reaction that interfere with the healing, which indicates that these materials cannot be considered as biocompatible16 . In addition, when the adhesive system is applied directly on exposed human pulps, it has been shown that there is no formation of hard tissue barrier or pulp tissue repair, but rather a persistent foreign - body reaction characterized by macrophages and giant cells adjacent to the pulp exposure site3 . Several studies have suggested that an etch - and - rinse / bonding treatment of pulp exposures may also lead to tissue repair23 . These studies support the hypothesis that pulps can heal after placement of acidic restorative system in deep cavities or even on exposed pulps, as long as the hemorrhage is controlled before placement of the adhesive system64 and a hermetic seal against bacterial infiltration is guaranteed69 . This concept is popular despite the fact that several in vitro and in vivo studies have shown the definite cytotoxicity of resin - based composites and their components applied to cell culture or in direct contact with subcutaneous tissue or pulp tissue in animals69 . In human pulps, direct capping with bonding systems has shown different degrees of pulp inflammation, regardless of the presence of bacteria40,69 . These studies describe a persistent chronic inflammation with a considerable number of giant cells surrounding residues of adhesive scattered into the pulp tissue close to the exposure after a postoperative period of 180 days . There are remarkable differences between the pulp responses to capping procedures with adhesive system and dental products with high ph, such as mta and ch (figures 5 and 6). These differences are related to the quality of pulp tissue, the nature and the degree of the inflammatory process and the quality of tissue repair after pulp capping . In short - term periods, pulps capped with the adhesive systems exhibited different degrees of inflammation in which mononucleated inflammatory cells predominate and the odontoblastic layer subjacent to the pulp exposure site is disrupted or sometimes absent, indicating a low tolerance of these cells close to the adhesive system69 . In a previous study69, the histological features of pulps capped with ch were different, with the migration of pulp cells subjacent to the pulp exposure site as early as 9 days after capping . The adjacent odontoblast layer, cell - free zone of weil and the cell - rich zone were well preserved as well as the deeper structures of the pulp . These early manifestations of pulp repair coincided with a high rate of success found at the longest periods, when a normal pulp and a complete bridge formation were common events69 . Only a few studies with human teeth have been performed to indicate whether or not dental materials can be used for pulp capping of dental cavities with or without pulp exposure . An adhesive system and a ch paste were placed directly on exposed pulps40 and after seven days, a large area of neutrophil infiltrate underlying the adhesive system and death of adjacent odontoblasts were observed . The neutrophil reaction was replaced by fibroblast proliferation with macrophages and giant cells surrounding globules of resin scattered in the coronal pulp tissue . The persistent inflammatory reaction and hyaline alteration of extracellular matrix inhibited complete pulp repair or dentin bridging . In contrast, at the 7th day, the pulp tissue capped with ch exhibited odontoblast - like cells organized underneath a zone of coagulation necrosis, pulp repair and apparent complete dentin bridge formation after 60 days . These findings suggeste that adhesive systems seem to be indicated for direct pulp capping of human teeth40 . There is a controversy concerning the use of animals for evaluation of the biocompatibility of dental materials . The self - etching adhesive system clearfil liner bond 2 v (kuraray co., tokyo, japan) and the resin - modified glass - ionomer cement vitrebond (3m / espe) allowed pulpal healing characterized by cell - rich fibrodentin and tertiary dentin deposition as well as calcified barrier formation19 . These results were obtained when these materials were placed on pulp exposures in class i cavities prepared on the occlusal surface of maxillary first molars of rats and compared with ch as control group . In the control group, it was observed an intense deposition of tubular reparative dentin continuous with the reactionary dentin deposited by primary odontoblasts around the pulp exposure site that gave rise to a defined calcified barrier19 . The histological features observed in this specific in vivo study performed in rat teeth confirmed that the results observed in animal pulps cannot be directly extrapolated to human beings . Gic were developed by wilson and kent, in 1971, and introduced in the market in the early 1970s . Their popularity is due to the fact that these materials present several important properties such as fluoride release, coefficient of thermal expansion and modulus of elasticity similar to dentin, bonding to both enamel and dentin and biocompatibility61 . Despite these advantages, conventional gics possess limitations as restorative materials, which are related to their susceptibility to dehydration12 and poor physical properties, such as high solubility and slow setting rate58 . Developments in the field of gics have led to the introduction of light - activated hybrid gic versions creating the resin - modified gics (rmgics)72 . The incorporation of polymerizable water - compatible monomers such as hema to the formulation of conventional gics resulted in enhanced flexural strength, diametral tensile strength, elastic modulus and wear resistance83, although they may not be as biocompatible as conventional gics74 . The incorporation of hema to the formulation of conventional cements has been proven to increase their toxic effects and as a consequence, rmgics have been shown to be more cytotoxic than conventional gics4 . Although the degree of monomer conversion of the rmgics has not been determined, several studies have demonstrated that measurable quantities of hema are released into the storage solutions used4 . Leached residual hema can easily diffuse through the dentinal tubules due to its hydrophilicity and low molecular weight, thus reaching dental pulp cells4 . The magnitude of the damage that may be caused by residual monomers to the pulp cells is inversely proportional to the remaining dentin thickness between the cavity floor and the pulp tissue4 . One may expect that rmgics might trigger an inflammatory reaction when applied directly in contact to the connective tissue73 . To compare the cytotoxicity of five rmgics and one metal - reinforced gic, stanislawski, the most toxic materials were the metal - reinforced gic and rmgic vitremer (3m / espe), while the least toxic were the rmgics compoglass (ivoclar vivadent ltda ., so paulo, sp, brasil) and photac fil (3m / espe). This toxicity was due to the presence of unpolymerized monomers, such as hema and tegdma, and polyacrilic acid, which were leached from resin modified materials and metal - reinforced gic . The main elements responsible for the toxicity of the metal - reinforced gic were cu+ and ag+ present in toxic concentrations . It was further analyzed the possible cytotoxicity of some ions that are present in significant amounts in gics, such as f-, al, zn and sr . The zinc was the only component that was found to be of a sufficiently high concentration to induce cytotoxicity . These elements were present in the metal - reinforced gic and may have contributed to its cytotoxicity74 . Complementing the results presented above, the cytotoxic effects of five rmgics and conventional gics on an odontoblast cell line were studied . The gics were the least cytotoxic experimental materials and the rmgics caused intense cytophatic effects on the cultured cells decreasing significantly the cell metabolism as well as causing remarkable cell death . The high cytotoxic effects observed for rmgics in that study may be caused by unreacted resin monomers rather than by other compounds such as f-, al, sr, zn which are present in the conventional gics17 . Although a true rmgic must be capable of setting without being light - activated45, higher levels of released hema are found when these cements are only allowed to cure chemically4 . The liner rmgic vitrebond (3m / espe) releases a high concentration of hema monomer before immersion in distilled water, even when polymerized according to the manufacturer's recommendations, when compared to the amount released from the restorative rmgic vitremer (3m / espe)4 . Other rmgic toxic components, such as fluoride, aluminum, silver, siliceous, strontium, zinc and silicate, may also be released during the setting reaction or solubilization of the cement in a wet environment4, but it was already mentioned that the ions released from the rmgic are not sufficiently high to cause cytotoxic effects, except for zn 74 . Other studies affirm that conventional gics are less cytotoxic than the rmgics vitrebond (3m / espe) and vitremer (3m / espe), which caused intense cytophatic effects in cell cultures decreasing significantly the cell metabolism as well as causing remarkable cell death (figures 7)17,63 the adverse effect caused by vitremer (3m / espe) was attributed to the leaching of at least two components of polyacidic phase (hema) as well as unidentified acidic species63 . Other authors compared the toxicity of 9 types of gics on cultured human dental pulp cells and concluded that rmgics are more toxic to pulp cells than conventional gics . However, current in vivo studies performed in human teeth have demonstrated that the rmgic vitrebond (3m / espe) applied as a liner in very deep class v cavities caused no inflammatory pulp response15,20 . In this way, it seems that the presence of a dentin barrier between this kind of light - cured rmgic and the pulp cells may prevent pulpal damage . Before initiating any restorative procedure, it is important to select the most appropriate dental materials to be used for each case . Attention should be taken not only to the handling characteristics of the materials, but also to the possible cytotoxic effects that they may cause to the oral mucosa and teeth . Within the experimental limitations of the iso recommendations for in vivo testing of dental materials, which do not allow direct extrapolation of the results to clinical situations, researchers and clinicians must be aware that all clinical procedures in dentistry must be carried out based on scientific evidence . These potential aggressions include microbial toxins, heat, mechanical trauma, restorative materials, cleaning solutions and cavity liner cements . Following various injuries, pulp cells have the intrinsic capacity to repair, differentiate into odontoblasts and produce various dentin matrix proteins during wound healing11 . Some studies have shown that gingival38,51 and pulp5,13,84 fibroblasts can secret many types of cytokines in response to various stimuli in the same manner as odontoblasts, endothelial cells and immune cells27,65,78,82 . Cytokines are proteins secreted by innate or adaptative immune cells that act stimulating these cells . Different cytokines are produced in response to microorganisms and other stimuli, triggering several responses in immune and inflammatory cells . Some cytokines have structural homology that stimulate leukocyte dislocation and regulate the migration of blood to the tissue, which are denominated chemoattractant cytokines . These are produced by various cell types in response to inflammatory stimuli, and consequently recruit leukocytes to the inflammation area1 . When the injury is removed before pulp damage, a repair process begins81 and collagen synthesis is accellerated in this phase 62 . The deposition of collagen in the pulp tissue is increased by the action of cytokines . Collagen synthesis can be improved by transforming growth factor (tgf)-1 and tgf-2 and interleukin (il)-15,11 . Fibroblasts at an inflammatory microenviroment deposit collagen in a remarkable amount during the inflammatory process as opposed to normal conditions5 . The collagen synthesis by fibroblasts during the inflammatory process is a key event for human pulp repair11 . Ch solutions have been largely used with increased frequency, due to their property of stimulating sclerotic and reparative dentin formation and protecting the pulp against termal stimuli and antibacterial action30,76 . The first formulation of ch was introduced in dentistry by hermann (1920), and presented the capacity to induce pulp tissue to form a mineralized barrier, blocking the exposed surface . Ch is a multipurpose agent and there are several indications for its clinical application . Some of its indications include direct and indirect pulp capping, apexogenesis, apexification and treatment of root resorption, iatrogenic root perforations, root fractures, replanted teeth and interappointment intracanal dressing28 . Ch is certainly one of the most studied dental materials and it is classically used as the gold standard in biocompatibility tests due to its direct or indirect effect on exposed pulp repair . It is the material of choice for all pulp conservative treatment because of its biological and therapeutic potential25 . Ch, in dry powder, suspension or cement form, has been recommended for the treatment of exposed pulp due to its beneficial properties, such as induction of mineralization and inhibition of bacterial growth9 . Many studies indicate pulp repair and hard tissue barrier formation when exposed pulp tissue is directly capped with different ch formulations (figures 2 and 3). In the clinical practice, the presence of hard tissue barrier after capping can be considered an asset, since it provides natural protection against the infiltration of bacteria and chemical products44 . However, the importance of calcified hard tissue barrier formation after capping has been challenged by other studies, which have shown multiple tunnel defects and cell inclusions in bridges following pulp capping with ch . This may lead to leakage and bacteria penetration into pulp tissue unlike the permanent seal produced by bonding agents37,69 . These tunnels not caused by the ch itself but are rather a consequence of the severity of the trauma to the pulp and the number of vessels injured during the mechanical exposure . It has been observed that inside the tunnels there are blood vessels, which maintain the calcium source to the necrotic tissue . The calcium ions in the necrotic layer are responsible for partial dystrophic calcification of the coagulation necrosis . Another type of defect in hard tissue barriers, when present, is represented by cellular inclusions generally situated between the coagulation necrosis and the calcification zone69 . The presence of a hard tissue barrier must be recognized not only as a structural barrier against future injuries, but also as a sign of biological recovery, represented by odontoblast activity76 . Yoshiba, et al.86 reported findings that support the hypothesis that the differenciation of pulp cells into odontoblasts during reparative dentinogenisis is mediated by fibronectin, which is associated with the initially formed calcified layer after pulp capping with ch86 . Capping of contaminated and inflamed dental pulps results in a remarkably high degree of healing, characterized by resolution of inflammation, reorganization of soft tissue, and formation of new hard tissue at the exposed site76 . The mechanism of pulp repair using ch as a direct pulp capping agent is still not well understood . However, it has been reported that the high alkaline ph of ch solutions can solubilize and release some proteins and growth factors from dentin . Due to its high ph, ch induces a coagulation necrosis layer when in direct contact with pulp tissue43 . Ch products do not act as bioestimulators neither are biocompatible to the pulp tissue . On the contrary, cells in contact with ch are killed due its alkaline ph, forming a necrotic layer (cauterization zone) of variable thickness . Then, rather than the pulp capping agent (ch), the subjacent pulp tissue is responsible for the pulpal healing associated with hard tissue barrier formation . Similar effects on pulp exposures are caused by cements that present high ph, such as different formulations of mta cements32 . Classical microscopic studies have shown that ch produces a superficial pulp necrosis and forms calcium carbonate, whose globules act, in a first moment, as dystrophic calcification nucleous, in the margin and in the interior of the dense reticular fiber deposition, immediately beneath the granular zone43, where odontoblast - like cells differentiate and organize to produce dentin . It has been suggested that the ph increases due to the presence of free hydroxyl ions may initiate mineralization80, although other alkaline compounds, such as barium hydroxide and calcium phosphate, failed in this process55 . The alkaline ph can neutralize the lactic acid secreted by osteoclasts and may help preventing mineral tissue destruction . Ch can act as a local buffer against the acid reactions produced by the inflammatory process42 . Heithersay31 (1975) suggested that the calcium ions can reduce capillary permeability, thus low intercellular fluid produces increasing calcium ions concentration at the mineralization area42 . In spite of all these advantages, the multiple tunnel defects present a morphological disruption of the dentin bridge barrier, in that they fail to provide not only a solid barrier, but also a long - term biological seal against bacterial infection . Consequently, the tunnels permit oral contaminants, such as bacteria and their toxic factors, to eventually gain access to the pulp tissue through the marginal gap formed at tooth / restoration interface76 . The presence of bacteria and their products that penetrate via microleakage, and not the medicament per se, is the main factor responsible for pulp inflammation and necrosis76 . Mta materials are a mixture of a refined portland cement and bismuth oxide, and are reported to contain trace amounts of sio2, cao, mgo, k2so4, and na2so4 24 . Although it may be inferred that portland cement could serve as a mta substitute, it is important to emphasize portland cement and mta are not identical materials70 . Mta products have been reported to have a smaller mean particle size, contain fewer toxic heavy metals, has a longer working time, and undergo additional processing / purification than regular portland cements47 . Up to 2002, only one mta cement, consisting of a graycolored powder, was commercially available . In the same year, white mta (wmta) was introduced as proroot - mta (dentsply, tulsa, ok, usa) to address esthetic concerns24 . After that time, two forms of mta materials were categorized: the traditional gray mta (gmta) and wmta . Scanning electron microscopy (sem) and electron probe microanalysis characterized the differences between gmta and wmta, and revealed that the major difference between them is in the concentrations of al2o3, mgo, and feo24 . Wmta was also reported to possess an overall smaller particle size than gmta26, while it was also suggested that the reduction in magnesium could also contribute to the lighter color of wmta24 . Mta materials were reported to form a porous matrix characterized by internal capillaries and water channels in which increased liquid / powder mixing ratio produced more porosity and increased solubility33 . Gmta solubility levels have been reported to be stable over time, but the usually reported ph between 11 or 12 may slightly decrease32 . The high ph level of mta materials has led some authors to theorize that the biologic activity and its biocompatibility is due to the formation of ch26,32,33 . Both wmta and gmta have been shown to possess antibacterial and antifungal activities, which are presumably due to its ph . The cytotoxicity of gmta, amalgam and zoe was measured using a cell viability assay for mitochondrial dehydrogenase activity in human periodontal ligament fibroblasts after 24 h of exposure to extracts of varying concentrations of the tested materials, in both freshly mixed and 24-h set states49 . In the freshly mixed state, the sequence of toxicity was amalgam> super - eba> mta . In the 24-h set state, the sequence of toxicity at a low extract concentration was super - eba> mta, amalgam; while at higher extract concentrations it was super - eba> amalgam> mta49 . Similarly, another report reinforced that gmta did not affect negatively human periodontal ligament fibroblast mitochondrial dehydrogenase activity52 . Wmta, as well as ch and a zoe sealer, was shown not to affect the cell viability or the prostaglandin e2 synthesis of murine macrophages and fibroblasts54 . Wmta effect on dental pulp cell viability and proliferation has been evaluated using mouse mdpc-23 odontoblast - like cells and od-21 undifferentiated pulp cells . After 24 h of exposure to wmta, apoptosis was not induced in either cell line, and wmta was reported to cause increase in dna synthesis, suggesting a positive effect on cellular proliferation56 . This was corroborated by another report that suggested that wmta had a more stimulating effect on human dental pulp cells than a commercial ch preparation79 . Some reports speculated that mta material biocompatibility was derived from ch formation24,33 . A prospective study compared ch and gmta as permanent dentition pulp - capping medicaments and concluded that ch specimens were hallmarked by tissue inflammation with a 0.15-mm thick dentinal bridge with adjacent pulp tissue necrosis noted at 6 months2 . These findings were in contrast with those for gmta specimens displaying mild tissue reactions with a 0.28-mm and 0.43 mm dentin bridge noted at 2 and 6 months, respectively, as well as absence of pulp tissue inflammation, associated with a near - regular odontoblastic layer2 . However, the authors did acknowledge a small sample size and the need for further studies . A second prospective study compared wmta and a ch preparation as direct pulp cap medicaments and concluded that at 30 post - treatment days, wmta group had 20 teeth with clinically normal pulpal status while three were diagnosed with reversible pulpal disease48 . Ch group showed 17 teeth with normal pulpal signs, 6 exhibited signs of reversible pulpal disease, and 1 was diagnosed with irreversible pulpal disease48 . At the 136th recall day, all 23 teeth present for the wmta group were clinically diagnosed as successful as well as 22 teeth of the ch group48 . For use of mta materials as direct pulp cap medicaments, the two clinical prospective studies suggest that both gmta and wmta may perform equally in comparison to traditional ch in non - carious mechanical pulp exposures in teeth with normal pulp tissue70 . Although the initial results are positive, further clinical studies are needed, especially in more clinically relevant situations involving carious pulp exposures before mta materials can be unequivocally indicated as direct pulp - capping agents70 . The histologic pulpal response comparing wmta to ch as pulpotomy dressings was investigated in premolars extracted for orthodontic purposes, reporting that wmta induced a more homogenous and continuous dentin bridge with less pulpal inflammation than ch at both 4 and 8 weeks after treatment10 . Reports have strongly suggested that the favorable biologic performance exhibited by mta materials is due to hydroxyapatite formation when these materials are exposed to physiologic solutions . Although the overall results in human studies involving mta materials are very positive, further longitudinal studies are encouraged, as at present insufficient well - designed and controlled clinical studies exist that allow systematic and meta - analysis review of mta materials in all of its suggested clinical indications57,70 . Although physical properties of resin composites are being improved constantly, in vivo studies have shown that the use of resins as restorative materials is occasionally associated with irritation and necrosis of the pulp6,75,77 periodontal tissues60 . Most components of the adhesive systems and resin composites, such as bisphenol a - glycidyl methacrylate (bis - gma), urethane dimethacrylate (udma), triethylene glycol dimethacrylate (teg - dma), camphoroquinone, 2-hydroxyethyl methacrylate (hema) and others, have been shown to have definite cytotoxicity when in direct contact with mammalian fibroblasts39 . In that study39, the most cytotoxic monomers were bis - gma and udma, which caused irreversible effects on the cellular metabolism39 . These monomers, when applied on dentin discs, even in the presence of internal pressure, are able to diffuse through the dentinal tubules and reach the pulpal space in concentrations directly proportional to the molecular weight of the monomeric materials7 . Resin composite components can be leachable when the degree of conversion is not reached29 or when the resin is degraded by esterase from saliva or when hydrolytic degradation occurs31 . Adhesive resin systems are used to enhance retention, reduce microleakage, and decrease postoperative sensitivity of composite resin restorations . In vivo studies have demonstrated that the application of an adhesive resin directly onto a site of pulp exposure, or to a thin layer of dentin (less than 0.5 mm), causes dilatation and congestion of blood vessels as well as chronic inflammatory pulpal response (figure 4)40,41 . Complete polymerization of adhesive resins might be unachievable during direct pulp - capping procedures due to the presence of the pulpal edema . In additiom, it has benn shown that the oxygen prevents complete polymerization of adhesive resin monomers34 . Consequently, unpolymerized monomers released from the resin - based material can diffuse directly into the pulp at the exposure site, as well as diffuse through the dentinal tubules to cause cytotoxic effects to the pulp cells66 . There is a dramatic difference in the responses of cells to the three conditions of polymerization (light curing for 0, 10 or 40 s). While unpolymerized and partially polymerized adhesive resin induced apoptosis very rapidly in macrophages, undifferentiated pulp cells (od-21) and mouse odontoblast - like cells (mdpc-23), polymerized adhesive resin induced significant apoptosis only in macrophages . These findings might be explained by the lower leaching of toxic elements from polymerized as compared with unpolymerized adhesive resins, and underline the importance of thorough polymerization of the adhesive system before placement of the resin composite53 . Although many resins present excellent physical and mechanical properties, when irradiated for short periods of time or with a low light intensity, inadequate conversion of the monomers may interfere negatively on mechanical properties and increase the resin cytotoxicity . Costa, et al.18, 2003, in an in vitro study evaluated the cytotoxic effects of a restorative resin composite applied to an immortalized odontoblast cell line . The results suggest that the amount of unconverted monomers on dentin should be reduced to avoid diffusion of the residual monomers to the pulpal space, resulting in chemical damage to the pulp tissue . This may be accomplished by treating appropriated increments of restorative resin with adequate light intensity and the time of light curing, which will play an important role in converting uncured monomers into polymers18 . Bonding agents have been found to release camphoroquinone, a photoinitiator and photosensitizer widely used to generate free radicals including reactive oxygen species46 . It has been documented that the camphoroquinone acts not only as a cytotoxic agent, but also as a mutagen and its lixiviation may partly explain why these kind of resinous products are considered as toxic agents46 . Although clinical and in vivo studies have shown a low incidence of unfavorable effects of dentin bonding systems, pathological changes of pulpal tissues, such as dilatation and congestion of blood vessels, inflammatory responses and production of irregular dentin as well as odontoblastic displacement or tooth sensitivity can occur after placement of composite restorations75 . The monomers in contact with oxygen are not converted into polymers and will remain at the outer layer of the adhesive systems29 . The unconverted monomers of the adhesive systems and resin composite in the cavity may diffuse to the pulp through dentinal fluid66 and may cause adverse effects35 . In addition, dentin bonding agents may be responsible for undesirable pulpal reactions when placed directly on the pulp or in deep cavities, due to the presence of bis - gma, which is the major component of most current bonding systems . These pulp reactions can be related to components of the adhesive resins (tegdma and hema) that were shown to be soluble in aqueous solutions and cytotoxic to immortalized 3t3-fibroblast cultures36 . The high concentration of hema present in primers and adhesive resins available in the dental market may promote remarkable cytopathic effects on cultured pulp cells, even after curing and rinsing the experimental materials in order to decrease the concentration of acidic and non - acidic agents, which are common ingredients of dentin adhesive resins22 . When the adhesive system (scotchbond mp; 3m / espe - dental products, st paul, mn, usa) and the monomer hema (polysciences, inc ., warrington, pa, usa) were implanted in subcutaneous tissue of rats, persistent inflammatory reaction was observed adjacent to the material . This persistent inflammatory response was mediated by macrophages and giant cells and may be caused by partially or unpolymerized resin particulates that remain in contact with the connective tissue21 . In another study in subcutaneous tissue of rats, the authors concluded that the adhesive systems applied directly on the tissue promote persistent inflammatory reaction that interfere with the healing, which indicates that these materials cannot be considered as biocompatible16 . In addition, when the adhesive system is applied directly on exposed human pulps, it has been shown that there is no formation of hard tissue barrier or pulp tissue repair, but rather a persistent foreign - body reaction characterized by macrophages and giant cells adjacent to the pulp exposure site3 . Several studies have suggested that an etch - and - rinse / bonding treatment of pulp exposures may also lead to tissue repair23 . These studies support the hypothesis that pulps can heal after placement of acidic restorative system in deep cavities or even on exposed pulps, as long as the hemorrhage is controlled before placement of the adhesive system64 and a hermetic seal against bacterial infiltration is guaranteed69 . This concept is popular despite the fact that several in vitro and in vivo studies have shown the definite cytotoxicity of resin - based composites and their components applied to cell culture or in direct contact with subcutaneous tissue or pulp tissue in animals69 . In human pulps, direct capping with bonding systems has shown different degrees of pulp inflammation, regardless of the presence of bacteria40,69 . These studies describe a persistent chronic inflammation with a considerable number of giant cells surrounding residues of adhesive scattered into the pulp tissue close to the exposure after a postoperative period of 180 days . There are remarkable differences between the pulp responses to capping procedures with adhesive system and dental products with high ph, such as mta and ch (figures 5 and 6). These differences are related to the quality of pulp tissue, the nature and the degree of the inflammatory process and the quality of tissue repair after pulp capping . In short - term periods, pulps capped with the adhesive systems exhibited different degrees of inflammation in which mononucleated inflammatory cells predominate and the odontoblastic layer subjacent to the pulp exposure site is disrupted or sometimes absent, indicating a low tolerance of these cells close to the adhesive system69 . In a previous study69, the histological features of pulps capped with ch were different, with the migration of pulp cells subjacent to the pulp exposure site as early as 9 days after capping . The adjacent odontoblast layer, cell - free zone of weil and the cell - rich zone were well preserved as well as the deeper structures of the pulp . These early manifestations of pulp repair coincided with a high rate of success found at the longest periods, when a normal pulp and a complete bridge formation were common events69 . Only a few studies with human teeth have been performed to indicate whether or not dental materials can be used for pulp capping of dental cavities with or without pulp exposure . An adhesive system and a ch paste were placed directly on exposed pulps40 and after seven days, a large area of neutrophil infiltrate underlying the adhesive system and death of adjacent odontoblasts were observed . The neutrophil reaction was replaced by fibroblast proliferation with macrophages and giant cells surrounding globules of resin scattered in the coronal pulp tissue . The persistent inflammatory reaction and hyaline alteration of extracellular matrix inhibited complete pulp repair or dentin bridging . In contrast, at the 7th day, the pulp tissue capped with ch exhibited odontoblast - like cells organized underneath a zone of coagulation necrosis, pulp repair and apparent complete dentin bridge formation after 60 days . These findings suggeste that adhesive systems seem to be indicated for direct pulp capping of human teeth40 . There is a controversy concerning the use of animals for evaluation of the biocompatibility of dental materials . The self - etching adhesive system clearfil liner bond 2 v (kuraray co., tokyo, japan) and the resin - modified glass - ionomer cement vitrebond (3m / espe) allowed pulpal healing characterized by cell - rich fibrodentin and tertiary dentin deposition as well as calcified barrier formation19 . These results were obtained when these materials were placed on pulp exposures in class i cavities prepared on the occlusal surface of maxillary first molars of rats and compared with ch as control group . In the control group, it was observed an intense deposition of tubular reparative dentin continuous with the reactionary dentin deposited by primary odontoblasts around the pulp exposure site that gave rise to a defined calcified barrier19 . The histological features observed in this specific in vivo study performed in rat teeth confirmed that the results observed in animal pulps cannot be directly extrapolated to human beings . Gic were developed by wilson and kent, in 1971, and introduced in the market in the early 1970s . Their popularity is due to the fact that these materials present several important properties such as fluoride release, coefficient of thermal expansion and modulus of elasticity similar to dentin, bonding to both enamel and dentin and biocompatibility61 . Despite these advantages, conventional gics possess limitations as restorative materials, which are related to their susceptibility to dehydration12 and poor physical properties, such as high solubility and slow setting rate58 . Developments in the field of gics have led to the introduction of light - activated hybrid gic versions creating the resin - modified gics (rmgics)72 . The incorporation of polymerizable water - compatible monomers such as hema to the formulation of conventional gics resulted in enhanced flexural strength, diametral tensile strength, elastic modulus and wear resistance83, although they may not be as biocompatible as conventional gics74 . The incorporation of hema to the formulation of conventional cements has been proven to increase their toxic effects and as a consequence, rmgics have been shown to be more cytotoxic than conventional gics4 . Although the degree of monomer conversion of the rmgics has not been determined, several studies have demonstrated that measurable quantities of hema are released into the storage solutions used4 . Leached residual hema can easily diffuse through the dentinal tubules due to its hydrophilicity and low molecular weight, thus reaching dental pulp cells4 . The magnitude of the damage that may be caused by residual monomers to the pulp cells is inversely proportional to the remaining dentin thickness between the cavity floor and the pulp tissue4 . One may expect that rmgics might trigger an inflammatory reaction when applied directly in contact to the connective tissue73 . To compare the cytotoxicity of five rmgics and one metal - reinforced gic, stanislawski, the most toxic materials were the metal - reinforced gic and rmgic vitremer (3m / espe), while the least toxic were the rmgics compoglass (ivoclar vivadent ltda ., so paulo, sp, brasil) and photac fil (3m / espe). This toxicity was due to the presence of unpolymerized monomers, such as hema and tegdma, and polyacrilic acid, which were leached from resin modified materials and metal - reinforced gic . The main elements responsible for the toxicity of the metal - reinforced gic were cu+ and ag+ present in toxic concentrations . It was further analyzed the possible cytotoxicity of some ions that are present in significant amounts in gics, such as f-, al, zn and sr . The zinc was the only component that was found to be of a sufficiently high concentration to induce cytotoxicity . These elements were present in the metal - reinforced gic and may have contributed to its cytotoxicity74 . Complementing the results presented above, the cytotoxic effects of five rmgics and conventional gics on an odontoblast cell line were studied . The gics were the least cytotoxic experimental materials and the rmgics caused intense cytophatic effects on the cultured cells decreasing significantly the cell metabolism as well as causing remarkable cell death . The high cytotoxic effects observed for rmgics in that study may be caused by unreacted resin monomers rather than by other compounds such as f-, al, sr, zn which are present in the conventional gics17 . Although a true rmgic must be capable of setting without being light - activated45, higher levels of released hema are found when these cements are only allowed to cure chemically4 . The liner rmgic vitrebond (3m / espe) releases a high concentration of hema monomer before immersion in distilled water, even when polymerized according to the manufacturer's recommendations, when compared to the amount released from the restorative rmgic vitremer (3m / espe)4 . Other rmgic toxic components, such as fluoride, aluminum, silver, siliceous, strontium, zinc and silicate, may also be released during the setting reaction or solubilization of the cement in a wet environment4, but it was already mentioned that the ions released from the rmgic are not sufficiently high to cause cytotoxic effects, except for zn 74 . Other studies affirm that conventional gics are less cytotoxic than the rmgics vitrebond (3m / espe) and vitremer (3m / espe), which caused intense cytophatic effects in cell cultures decreasing significantly the cell metabolism as well as causing remarkable cell death (figures 7)17,63 the adverse effect caused by vitremer (3m / espe) was attributed to the leaching of at least two components of polyacidic phase (hema) as well as unidentified acidic species63 . Other authors compared the toxicity of 9 types of gics on cultured human dental pulp cells and concluded that rmgics are more toxic to pulp cells than conventional gics . However, current in vivo studies performed in human teeth have demonstrated that the rmgic vitrebond (3m / espe) applied as a liner in very deep class v cavities caused no inflammatory pulp response15,20 . In this way, it seems that the presence of a dentin barrier between this kind of light - cured rmgic and the pulp cells may prevent pulpal damage . Before initiating any restorative procedure, it is important to select the most appropriate dental materials to be used for each case . Attention should be taken not only to the handling characteristics of the materials, but also to the possible cytotoxic effects that they may cause to the oral mucosa and teeth . Within the experimental limitations of the iso recommendations for in vivo testing of dental materials, which do not allow direct extrapolation of the results to clinical situations, researchers and clinicians must be aware that all clinical procedures in dentistry must be carried out based on scientific evidence . Based on this literature review, it may be concluded that: calcium hydroxide products are the best choice for conservative treatment of the pulp due to their therapeutic and biological potential and the property of stimulating the formation of sclerotic and reparative dentin as well as protecting the pulp against thermal stimuli . Monomers present in resin composites and adhesive systems (e.g. : bisgma, udma, tegdma, hema) have been shown to have cytotoxic effects as a consequence of direct contact with fibroblasts and may be leached during the polymerization when the conversion degree is not fully reached . In human pulps, direct pulp capping with adhesive systems produces different degrees of pulp inflammation, even without bacterial presence and absence of dentin bridge formation as well as pulp repair . Some studies support the idea that when hermetic seal of cavity is obtained, the dentinpulp complex protection materials are unnecessary and they not influence the pulp repair, but hermetic seal of the restoration is difficult to be obtained . 4rmgics are more cytotoxic to the pulp cells than conventional gics due to the presence of unpolymerized monomers, and should not be applied directly to the pulp tissue.
Infarct of the anterior spinal artery is the most common subtype of spinal cord infarct, and is characterized by bilateral motor deficits with spinothalamic sensory deficits . We experienced a case with atypical anterior - spinal - artery infarct that presented with bilateral hand weakness but without sensory deficits . A 29-year - old man presented with sudden neck pain and bilateral weakness of the hands . Magnetic resonance imaging (mri) of the brain did not reveal any lesion . His motor symptoms improved rapidly except for mild weakness in his left wrist and fingers . Magnetic resonance angiography showed proximal occlusion of the left vertebral artery; a spine mri revealed left cervical cord infarction . Bilateral or unilateral hand weakness can be the sole symptom of a cervical cord infarct . Spinal cord infarction is much less frequent than cerebral infarction, accounting for only 1% of all strokes.1 the anterior spinal artery supplies the anterior two - thirds of the spinal cord via the sulcal (central) artery . This usually results in anterior spinal artery infarcts presenting with profound bilateral motor deficits, sensory disturbances, and spinothalamic sensory deficits.2,3 although the mechanisms are not completely understood, there are some case reports of restrictive clinical syndromes, such as the' man - in - the - barrel syndrome' and the sulcal artery syndrome.4,5 here we describe a patient who presented with bilateral hand weakness but without sensory deficits due to left vertebral artery occlusion . A healthy 29-year - old man without any vascular risk factors presented with sudden neck pain and bilateral hand weakness . After flexing his neck while tying his shoelaces, the patient experienced a sudden, severe pain (with a maximum score on a visual analog scale) that started in the posterior neck and spread rapidly across the entire head . Bilateral hand weakness that followed the pain onset prevented the patient from tying his shoelaces . The patient's vital signs were stable upon hospital admission, except for markedly elevated blood pressure (202/108 mm hg). The initial neurological examination revealed weakness in both flexion and extension of the wrists and fingers bilaterally, and during left leg extension [medical research council (mrc) grade 4]. However, the deep tendon reflexes were normal and the patient denied hypoesthesia in any sensory modality including pain, temperature, proprioception, and vibration . Laboratory findings were normal, and chest radiography did not reveal any pathology; an electrocardiogram also produced no evidence of ischemia or arrhythmia . His motor symptoms improved rapidly within 1 day except for mild weakness of his left wrist (mrc grade of flexion / extension iv / iv) and fingers (mrc grade of flexion / extension iv / iv; slightly more severe in the 5th finger). Brain computed tomography (ct) and brain magnetic resonance imaging (mri) did not reveal any signal abnormalities or mass lesions . However, ct aortography identified severe stenosis and occlusion of the left vertebral artery, and a pseudo lumen with mural thrombi was suspected on cervical mri (fig . Mri of the cervical segment produced high signal intensities in the left gray matter of spinal cord at the c3, c4, and c6 levels on diffusion - weighted images (fig . Magnetic resonance angiography performed 3 months after symptom onset showed persistent occlusion of the left vertebral artery . Unique features of this spinal - cord - infarct patient were bilateral hand weakness, absence of sensory deficits, and rapid improvement of motor symptoms in the right hand and left leg . Weakness of both arms has been reported previously in association with cervical cord infarcts, typically also with spinothalamic sensory deficit and vertebral artery occlusion.4,5,6,7 the mechanism that preserves leg strength in these cases is most likely collateral flow from the surrounding pial plexus.4 nevertheless, weakness of both hands without sensory deficits is rare in infarcts of the cervical spinal cord, and its mechanism remains to be determined.7,8 the anterior spinal artery forms at the level of the foramen magnum from the branches of the vertebral artery, and gives rise to the sulcal (central) arteries that penetrate the right and left sides of the spinal cord.3 unlike circumferential areas of the spinal cord, its interior has no anastomosis and the sulcal arteries are essentially end arteries . Therefore, the weakness of both hands in the present patient suggests that the end - arteries zone or the zone bordering the sulcal artery and circumferential artery corresponds to a region where hand motor neurons are located bilaterally.8 this would include the ventrolateral to lateral regions within the gray matter of the lower cervical spinal cord (fig . 3).9,10 alternatively, the hand motor areas may be more vulnerable than the more proximal arm motor areas . The hand motor area occupies a relatively large proportion of the cortical homunculus, so the hand motor area may occupy a larger area in the spinal gray matter, or require a larger blood supply.11,12 finally, the isolated unilateral hand weakness of this patient may be related to variation in the branches of the sulcal artery . Successive sulcal arteries generally alternate in their distribution to the left or right side of the spinal cord, but not both; this would make unilateral involvement or improvement possible.5 sensory deficit was absent in the present case . All subtypes of spinal cord infarcts are presumed to have sensory deficits, and therefore a pure motor presentation can result in misdiagnosis.2,3 anterolateral involvement could explain the present atypical presentation, and bilateral presentation without facial weakness may indicate a spinal cord infarct.5 transient ischemic attacks in the spinal cord reported occur primarily in the cervical cord, and recovery depends on the severity of the initial involvement and its collateral flow.1,2,6 cervical lesions are generally less vulnerable to ischemic insults than are thoracic or lumbar lesions due to the intensive vascularization from the vertebral and radicular arteries.3,6,13 the rapid improvement in the present case might therefore have resulted from initial distal involvement and collateral flow from the intact right vertebral artery . In conclusion, transient bilateral hand weakness can be the initial symptom of a spinal cord infarct, and unilateral hand weakness can be the sole symptom of a cervical cord infarct.
The prevalence of obesity in children and adolescents is increasing world - wide, notably in developing countries . Now - a - days, this problem has become one of the important concerns about general health at the global level . Obesity in childhood and adolescence has different effects on mental health, including symptoms of anxiety, depression, insomnia, social isolation etc ., in turn, these conditions would have negative consequences on social relationships and learning issues . Some studies documented higher prevalence of mental disorders as depression and anxiety in obese than in normal - weight individuals . In contrast, the prevalence of mental disorders is increasing in children around the world; this can be due to the escalating trend of childhood obesity . Due to the importance of mental health, it is considered as part of the world health organization global school - based health survey (who - gshs). Similar to most other developing countries, iran is facing double burden of nutritional disorders . Some studies in iran have considered the relationship of overweight and obesity with mental disorders . Although most studies in western countries found a higher prevalence of psychiatric disorders in overweight children and adolescents, but studies conducted in two cities in iran did not document the relationship of body mass index (bmi) with depression and anxiety in iranian students . Because of diversity in the cultural and socioeconomic background in different regions of iran, it is necessary to extrapolate such investigations in different parts of the country to help in designing and implementing health promotion programs . This nationwide study aims to assess the relationship of excess weight with some mental disorders in iranian students by using the who - gshs questionnaire . This nationwide cross - sectional study was conducted as part of the third national survey of a school - based surveillance system entitled the childhood and adolescence surveillance and prevention of adult non - communicable disease - iii study . After explanation of the study aims and methods, verbal assent was obtained from students and written informed consent from their parents . This study was conducted in 2009 - 2010 among 5570 students, aged range from 10 to 18 years . They were selected by random cluster sampling from urban and rural areas of 27 provinces in iran . The questions related to the mental distress are presented in appendix i. trained health professionals conducted the physical examination under standard protocols and by using calibrated instruments . Bmi was calculated as weight (kg) divided by height squared (m). Continuous variables are expressed as mean (standard deviation [sd]) and categorical variables are presented as number (percentage). Logistic regression analysis was used to assess the association of obesity and overweight with mental disorders . Continuous variables are expressed as mean (standard deviation [sd]) and categorical variables are presented as number (percentage). Logistic regression analysis was used to assess the association of obesity and overweight with mental disorders . Their mean sd age was 14.7 (2.4) years, without significant difference in terms of gender . Table 1 shows the frequency of anxiety according to gender and bmi categories . According to their self - report, 3182 (58.7%) students had anxiety, which consisted of 1417 (53.1%) girls and 1765 (64.7%) boys . No significant association was documented neither between overweight and anxiety (odds ratio [or]: 0.86, 95% confidence interval [ci]: 0.68 - 1.09), nor between obesity and anxiety (or: 1.11, 95% ci: 0.88 - 1.40). Frequency of self - reported anxiety among iranian adolescents by gender and weight status: the caspian - iii study as can be seen in table 2, 3389 (62.6%) of students reported to have depression, they consisted of 1643 (61.1%) girls and 1746 (64.3%) boys reported to have depression . There was no significant relationship between overweight and depression (or: 1.11, 95% ci: 0.86 - 1.43) and between an obesity and depression (or: 1.01, 95% ci: 0.79 - 1.29). The self - reported frequency of insomnia among students is presented in table 3 . It shows that 2618 (49.4%) of students consisting of 1285 (49.1%) girls and 1333 (49.7%) boys had insomnia . No significant relationship was found neither between overweight and insomnia (or: 1.17, 95% ci:, 0.91 - 1.51), nor between obesity and insomnia (or: 0.91, 95% ci: 0.71 - 1.17). Frequency of self - reported depression among iranian students by gender and weight status: the caspian - iii study frequency of self - reported insomnia among iranian students by gender and weight status: the caspian - iii study this study, which is the first nationwide study of its kind in iran, showed that overweight and obesity were not associated with depression, anxiety and insomnia in iranian adolescents . Contrary to our findings, several studies in western countries have documented higher prevalence of these mental disorders in overweight and obese individuals . These differences could be because of social and cultural differences, especially the attitude of friends, family members and the community to obesity and obese person in various societies . Similar to previous studies in iran, our findings propose that overweight and obesity in adolescence are well - accepted by the community and therefore the overweight or obese person is not under pressure by parents and peers . Some previous studies have suggested that obese children, who are mocked by their friends, would experience some negative feelings including shame, isolation and depression . Moreover, these studies proposed that pressure and sneap imposed by parents is increased in overweight and children and adolescents . It is also suggested that depression might lead to unhealthy behaviors and in turn might result in overweight and obesity . The current study showed that anxiety and depression are more prevalent in boys than in girls . Some previous studies reported higher prevalence of such disorders in 12 - 18-year old girls and 10 - 12-year old boys . They suggested that such differences might be because of hormonal changes during puberty . In another study, depression was reported to be more prevalent in girls with 15 - 18 years of age and boys aged 10 - 14 years . Further studies shall be conducted about the effects of various items including genetic, environmental, cultural, social and nutritional factors on gender differences documented by various studies about the psychiatric distress during adolescence . The present study did not find any significant difference in the prevalence of insomnia according to gender and weight status . Some studies documented higher prevalence of insomnia in girls and obese individuals . In our study, the prevalence of depression and anxiety was more than a previous study in iran, however, our finding is consistent with some other studies . Study limitations and strengths: the main limitations of this study are its cross - sectional setting and using self - reported data on psychiatric distress among adolescents . The main strengths are the novelty in the region, recruiting a large sample size of adolescents from diverse parts of the country, as well as using an internationally accepted questionnaire . We did not find significant relationship between excess weight and psychological distress in iranian students . This can be because of positive attitude of iranian families toward fatness in childhood and adolescence.
Despite the significant improvement in adhesive systems, they are not capable of preventing the formation of microgaps at the dentinal margins of composite restorations . Even when immediate complete marginal sealing was established, degradation of resin - dentin interface can occur rapidly over time . Also, the plaque accumulation containing microorganisms on the composite surface is more than that of the enamel surface and other restorative materials . Additionally, some active microorganisms may be left in the cavity due to lack of definitive and reliable assessment criteria for detection of carious dentin and complete elimination of microorganisms in the cavity . Particularly, this problem is more serious by increasing predilection to a minimally invasive tissue - saving dentistry . Subsequently, the adjunctive treatment with antibacterial agents during dentin bonding would be beneficial for preventing the detrimental effects caused by residual bacteria or by microleakage . The self - etching primer systems have become popular in adhesive dentistry due to their advantages over etch - and - rinse adhesives including less technique sensitivity; reduced postoperative sensitivity; and elimination of etching, washing, and drying as a separate step . However, demineralized smear layer possibly containing microorganisms is incorporated into the hybrid layer, so the effect of antibacterial activity is of major importance in these adhesives . The antibacterial activity is provided by two types of materials, disinfecting solution as agent releasing type and adhesive containing antibacterial monomer as a nonagent releasing type . Unpolymerized mdpb exhibits strong bactericidal activity similar to a disinfecting solution, such as chlorhexidine digluconate (ch). This name was given due to the fact that the agent is immobilized at the adhesive - dentin interface after copolymerization with other monomers . This unique antibacterial effect is long lasting and it may have no adverse effect on mechanical properties and bonding efficiency of the adhesive . Commercially available product containing mdpb is clearfil protect bond (pb) which is derived by addition of this monomer to the self - etching primer adhesive, clearfil se bond (se) as its parent . The latter contains no antibacterial agent . Apart from antibacterial effect of ch, it functions as a matrix metalloproteinases (mmps) inhibitor . This additional effect of ch can prevent collagen degradation at the bonding interface over time . Mmps are a class of metal - dependent endopeptidases that were expressed by human pulp fibroblasts in dental extracellular matrix . These enzymes can be activated during dentin demineralization process following carious lesions formation or application of the acidic adhesives . The beneficial preservation effect of ch on the bond stability was reported in restorations bonded by simplified etch - and - rinse and self - etch adhesives . The naked collagen fibrils at the base of the hybrid layer following incomplete resin penetration are susceptible to degradation by mmps . If ch has no adverse effect on dentin bond strength of two self - etch adhesives with or without antibacterial monomer, it may preserve bonding interface of these adhesives . Furthermore, little information is available on the effect of ch on the long - term bond strength of these adhesives, particularly the antibacterial self - etching adhesive . The simultaneous application of two types of antibacterial materials may improve the durability of the self - etch adhesive . Therefore, the aim of the present study was to test the null hypothesis that adjunctive use of ch with a self - etch adhesive (se) and a self - etch adhesive containing mdpb (pb) has no effect on immediate (24 h) bond strength to dentin, or after water storage for 6 months plus thermocycling . The teeth were stored in 1% chloramine t solution for 2 weeks, then in distilled water at 4c before use . After removing the roots, the midcoronal dentin surfaces were exposed by removing the occlusal enamel with a diamond saw under a water spray . The dentin surfaces were examined under a stereomicroscope (carl zeiss inc, oberkochen, germany) to ensure that no enamel or pulp tissue remained . The flat dentin surfaces were polished with 600-grit silicone carbide abrasive paper (snam abrasives pvt . After ultrasonic cleaning, rinsing, and drying; the adhesive tape was applied to the prepared surfaces to limit the bonding area . The prepared teeth were randomly divided into four main groups of 20 teeth each according to the adhesive system used: se and pb . Each adhesive was assigned to two control and experimental groups . In the latter groups, 2% chlorhexidine digluconate solution (ch, consepsis, ultradent, usa) was applied on the dentin surface prior to application of acidic primer of the adhesives . All of the materials were used according to manufacturer's instructions [table 1]. Materials used in the current study the resin composite (filtek z250, 3 m, usa) was placed on the cured adhesives using a cylindrical split mold with a height of 2.5 mm and surface diameter of 2 mm in two increments of 1 and 1.5 mm . Each increment was light - cured for 40 s at 600 mw / cm with a light - curing unit (vip junior, bisco, schaumburg, il, usa). Half of the specimens (n = 10) in each group were stored in tap water at 37c for 24 h and the other half (n = 10) were stored in tap water containing 0.4% sodium azide with a stable ph at 37c for 6 months and additionally thermocycled 1,000 times (between 5 and 55c with 20 s dwell times) during 6 months prior to bond strength testing . The shear test was performed using universal testing machine (instron z020, zwick, roell, germany). A knife - edge shearing rod at a crosshead speed 1 mm / min was used to load the specimens until fracture . Shear bond strength in mpa was calculated from the peak load at failure divided by the specimen's surface area . One specimen from the control and experimental groups pretreated with ch and bonded with the self - etch adhesive (pb) were prepared for sem examination . Approximately, 2-mm thick disks were prepared from each specimen with accutom-50 cut - off machine (struers, denmark) prior to examination with scanning electron microscope (sem, xl30, philips, netherland) operating at 17 kv . All data were analyzed with three - way analysis of variance (anova) for the effect of adhesive system, ch, and storage time . For each adhesive, a two - way anova was done to evaluate the interaction effect of storage time and ch, and t - test was done to compare the effect of two factors . All tests were done at a 0.05 level of significance and all analyses were performed using spss version 11.5 software (chicago, il, usa). After testing, the fracture modes were evaluated using a stereomicroscope (carl zeiss inc, oberkochen, germany) at 10 and classified according to the predominant mode of fracture including: 1) adhesive, 2) cohesive in dentin, 3) cohesive in composite, and 4) mixed, a combination of adhesive and cohesive . The mean strength and standard deviations in the eight experimental groups are summarized in figure 1 . Three - way anova showed that bond strength was significantly influenced by the adhesive type (p <0.001) and time (p = 0.004). The effect of ch, the interactions between adhesive type and time, between adhesive type and ch, and the interaction among all the three factors was not significant (p> 0.05). However, the interaction between ch and time was statistically significant (p <0.001). This interaction was statistically significant for each adhesive, se (p = 0.02) and pb (p = 0.006). The bond strength of pb was significantly lower than that of se in two time periods (p = 0.001). The mean shear bond strength for eight tested groups the bond strength of two adhesives was significantly reduced after aging (p = 0.004). For two adhesives (se, pb), ch had a significantly negative effect on the initial bond strength (p = 0.04 and 0.004, respectively), but bond strength was not altered over the 6 months of storage (p = 0.84 and 0.70, respectively). After a 6-month period, bond strength of two adhesives associated to ch did not vary with their control groups (p = 0.25 and 0.48). Representative sem images of the dentin / restoration interface for the control and experimental groups are shown in figures 2 and 3 . The frequency of fracture modes of eight groups a representative scanning electron microscope (sem) image of a bonded interface in control group (self - etch adhesive), where gap - free interface can be observed (250). C = composite, d = dentin a representative sem image of a bonded interface in experimental group (self - etch adhesive + chlorhexidine). In spite of a potential benefit for antibacterial activity, it is noteworthy that achieving effective durable bonding to dentin is still one of the most critical factors affecting long - term clinical success of a restoration . Hence, in the current study, the effect of two types of antibacterial agents on the bond strength of the two self - etch adhesives to dentin was tested in two time periods . The present results revealed that although the ch application prior to the two tested adhesives significantly decreased the immediate bond strength, this bond was stable after aging in water; there was no significant difference between the control and experimental groups treated with ch after 6 months of storage . The adverse effect of ch solution on initial bonding performance of se was previously reported by ercan et al . Also, meiers and shook reported that ch application prior to acidic primer of syntac significantly decreased its bond strength to dentin . However, in other studies, no adverse effect was found on sealing ability of se and bond strength of se to dentin . In a study by siso et al ., although there was no significant difference between the control and ch - treated groups, the latter group revealed a higher value of microleakage than that of the control group bonded by se . It was reported that the application of ch prior to self - etch adhesives (clearfil tri s bond and se) did not affect immediate bond strength resin composite to dentin . The self - etch adhesives used in this study contain a functional acidic monomer, 10-mdp . It was demonstrated that dissociated ch cations could bind to phosphate groups and calcium of the hydroxyapatite . The remaining cations might form bonds with phosphate anions of 10-mdp molecules of the self - etch adhesives after application of the adhesive on the surface treated with ch . This inhibitory effect on 10-mdp may impair the bonding ability of this functional acidic monomer (10-mdp) to dentinal calcium, reducing the bond strength to dentin . According to our results, a significant decrease in bond strength of the two adhesives although self - etch adhesives are capable of simultaneous etching and priming, a discrepancy in the depth of demineralization and resin infiltration may occur in these adhesives . The disintegration of these collagens could contribute to a decrease in the dentin bond strength of two self - etch adhesives observed in the current study after aging . Moreover, it has been shown that mild versions of self - etch adhesives can activate mmps, resulting in degradation of suboptimal infiltrated collagen and loss of bond strength . The results of the present study revealed that although ch application compromised the immediate bond strength, it diminished loss of bond strength after aging . Ch was applied on the smear layer - covered dentin, and then covered with acidic primer and adhesive resin may protect the unprotected collagen created during bonding procedures . The beneficial effect of 2% ch on stability of hybrid layer formed by an etch - and - rinse and a self - etch adhesives was reported in a recent study . Few studies have so far reported the effect of ch application prior to two - step self - etch adhesives on long - term bonding effectiveness to dentin . In a study by campos et al ., the preservative effect of ch 2% on bond strength of an all - in - one self - etch adhesive, clearfil tri s bond, to dentin was reported during a 6-month aging period . However, mobarak has recently demonstrated that pretreatment with 2 or 5% ch is not able to diminish the loss of bond strength of se to normal dentin over 2-year aging in artificial saliva under simulated intrapulpal pressure . These divergent results may be due to the difference in the ch concentration, aging condition, and aging duration time, bonding substrate, and testing method . The results of the current study indicated that pb showed significantly lower bond strength to dentin than that of se . The nonuniform distribution of naf fillers may contribute to a relative poor mechanical property in some areas of bonding interface, resulting in lower bond strength of pb compared to se . Contrary to our results, some studies have suggested that incorporation of antibacterial monomer into primer did not adversely affect the dentinal bond strength of the adhesive . When evaluating the fracture modes of the eight tested groups in this study, the higher number of the adhesive fracture was detected in two groups of pb + ch and control group of pb (24 h). It seems that the higher number of the adhesive fracture was associated to the lower bond strength of these groups . Further studies should investigate the interaction of ch with other two - step self - etch adhesives and the long - term effect of ch on bond strength of these adhesives to dentin . Within the limitations of the current study, it may be concluded that although ch was capable of decreasing the loss of bond strength of the two - step self - etch adhesives to dentin over time, it compromised the initial bonding of the self - etch adhesives . Thus, further in vitro and in vivo studies should be conducted before the combined application of ch, and two - step self - etch adhesives can be recommended in clinical practice.
Striated muscle cells contain a complex, highly ordered cytoskeleton, mainly composed of interdigitating thick myosin and thin actin filaments . Muscle contraction and relaxation occurs by the sliding of myosin filaments past actin filaments under the strict regulation of their accessory proteins, which are responsible for their assembly and maintenance as well as the regulation of contractile activity . Myosin - binding protein - c (mybp - c) comprises a family of accessory proteins of the thick myosin filaments that encompasses ~2% of the total myofibrillar protein . To date, two major roles have been attributed to mybp - c; it contributes to the regular organization and stabilization of thick filaments and modulates the formation of cross - bridges between myosin and actin, via direct interactions with both filamentous systems (as reviewed in [3, 4]). Within the sarcomere, mybp - c localizes to the c - zone, the cross - bridges containing region of the a - band, in 79 transverse stripes that are ~43 nm apart [57]. Three mybp - c isoforms have been identified; cardiac, slow skeletal, and fast skeletal (cmybp - c, smybp - c, and fmybp - c), encoded by different genes localizing to human chromosomes 11, 12, and 19, respectively [8, 9]. The core structure of mybp - c is composed of seven immunoglobulin (ig) domains and three fibronectin type iii (fn - iii) repeats, numbered from the nh2-terminus as c1c10 (figure 1;). A proline / alanine- (pro / ala-) rich motif and a conserved linker region, termed mybp - c or m - motif, flank the first ig domain, c1 . Cmybp - c possesses three unique features, including an additional ig domain at the extreme nh2-terminus (termed c0), a 9-residue long insertion within the m - motif containing consensus phosphorylation sites and a 28-amino acid long loop in the middle of domain c5 [8, 11]. Conversely, smybp - c comprises a subfamily of four alternatively spliced variants (v), v1v4, differing from one another due to the retention or exclusion of select exons encoding three novel insertions . These are located at the very nh2-terminus within the pro / ala- rich motif, the middle of domain c7, and the very cooh - terminus of the molecule, following the c10 domain (figure 1;). The presence of these insertions may result in different topographies and possibly functions of the smybp - c variants that contain them [12, 13]. Consistent with this, v1, which carries the cooh - terminal insertion preferentially localizes to the periphery of the m - band, rather than the c - zone, where it codistributes with its binding partners obscurin and titin (our unpublished observations) and plays key roles in the structural integrity of m- and a - bands . The last ig domain (c10) of smybp - c v1 interacts with the second ig domain (ig2) of obscurin . Although the presence of the novel cooh - terminal insertion further strengthens this interaction, it is not required for binding . However, this novel motif is both necessary and sufficient to support binding of smybp - c v1 to the last ig domain of titin, m10, which is a hotspot for mutations associated with tibial muscular dystrophy [14, 15]. Moreover, our laboratory has recently identified novel phosphorylation sites within the pro / ala- rich motif of the nh2-terminus of smybp - c, specifically ser-59, located in the novel nh2-terminal insertion and ser-62 are targets of pka, while ser-83 and thr-84 are targets of pkc; ser-204 is a substrate for both pka and pkc . Similar to its cardiac counterpart, phosphorylation of these sites may be essential in regulating the activities of smybp - c . Nevertheless, despite the differences in the core structure of the cardiac, slow, and fast mybp - c proteins, they share a ~50% homology and a ~65% identity . Although mybp - c was identified over forty years ago as a contaminant of purified myosin, a better understanding of its physiology has emerged in the last two decades, paralleling the discovery of mutations in cmybp - c that result in the development of familial hypertrophic cardiomyopathy (fhc; [18, 19]). Consequently, most of our knowledge originates from studies focusing on the cardiac form of the protein . This review will focus on the role of mybp - c in regulating the formation of actomyosin cross - bridges via its direct interaction with both myosin and actin filaments . Myosin is a hexameric protein consisting of two heavy chains (mhc) and two light chains (regulatory and essential, rlc and elc, resp . ). A dimer of heavy chains forms a coiled - coil helix that constitutes the rod or light meromyosin (lmm) segment of myosin . Toward its nh2-terminus, the helix unwinds and each mhc gives rise to a catalytic head, referred to as subfragment 1 (s1) that has atpase activity and participates in the formation of cross - bridges with filamentous actin [21, 22]. The lever arm, referred to as subfragment 2 (s2), separates the s1 segment from the rod portion, and transduces the chemical energy from the hydrolysis of atp into mechanical movement along the thin filament . A pair of rlc and elc binds in tandem to each head of the s1 segment modulating the speed and force of contraction [24, 25]. In addition to myosin light chains and actin, myosin is intimately associated with mybp - c (table 1 and figure 2;). The cooh - terminal c10 domain of all three mybp - c isoforms harbors binding sites for the lmm portion of myosin . Charged residues r1064, e1079, n1083, r1100, and r1101 present on the surface of the c10 domain of mybp - c support an electrostatic interaction with residues 15541581 of the rod domain of myosin that has a modest affinity of ~3.5 m [28, 29]. Moreover, through domains c8c10, mybp - c interacts with titin, a giant sarcomeric protein spanning half a sarcomere, which is also tightly bound to the thick myosin filament . Specifically, mybp - c binds to the first ig domain of an 11-domain superrepeat present in the a - band portion of titin . Thus, it has been speculated that the repetitive binding of mybp - c to the a - band portion of titin likely contributes to its periodicity within the c - zone . Consistent with these findings, a number of studies have further shown that the cooh - terminal c8c10 domains are necessary and sufficient to target mybp - c to the a - band [44, 45]. While binding of the cooh - terminus of mybp - c to the rod domain of myosin may contribute to the maintenance and stability of the thick filament, (reviewed in [3, 4]), binding of the nh2-terminus of mybp - c to myosin may mediate contractile regulation a number of biochemical and structural studies have implicated the nh2-terminal portion of cmybp - c, containing domains c0c2, in binding to the s2 region of myosin . Specifically, the m - motif located between the c1 and c2 ig domains has been shown to bind directly to the nh2-terminal 126 residues of the s2 fragment with an affinity of ~4.3 m; this interaction is abolished by phosphorylation of specific ser residues within the m - motif of cmybp - c via camp - dependent protein kinase [4649]. Similarly, the c2 domain has been also shown to interact with the same 126 residues of the nh2-terminus of the s2 fragment, albeit with considerably lower affinity (~1.1 mm), compared to the m - motif . Interestingly, molecular modeling has suggested that the interaction between the s2 portion of myosin and the c2 domain of cmybp - c is mediated by polar residues . On the other hand, the c1 domain of cmybp - c has been reported to interact with the hinge region between the s1 heads and the s2 fragment, in close proximity to the myosin light chains, while a recent study reported that the first ig domain of cmybp - c, c0, binds to the rlcs with an affinity of ~3.2 m . In support of this, overexpressed c0 targets to the a - band independently of the rest of the molecule, likely through its interaction with the rlcs . Taken together, these findings strongly suggest that cmybp - c may regulate the position and thus proximity of the myosin s1 heads relative to the actin filament, through its interaction with the s2 region and the rlcs, therefore affecting the formation of actomyosin cross - bridges . In addition to the mounting experimental support indicating the intimate association of the nh2-terminus of cmybp - c with the s2 region of myosin, there is also significant evidence supporting its direct interaction with actin thin filaments . Early studies have shown that purified full - length cmybp - c binds to filamentous actin (f - actin) [36, 50]. However, reconstituted thin filaments (i.e. Preincubated with troponin and tropomyosin) fail to bind purified full length cmybp - c in the presence of edta, a ca chelating agent, but binding is restored upon addition of ca [36, 50]. Further studies have recently begun to identify the actin - binding domain(s) of cmybp - c through biochemical and structural approaches . Neutron scattering experiments have indicated that recombinant c0c2 binds to f - actin in a repetitive manner, stabilizing it, while biochemical studies have shown that recombinant c0 is capable of directly interacting with f - actin . Moreover, bacterially expressed c1-c2 associates with naked f - actin as well as reconstituted thin filaments, likely through the m - motif, exhibiting a binding affinity of ~10 m to naked f - actin [40, 41]. This finding has been also substantiated by a recent study that used negative stain electron microscopy and three - dimensional reconstruction to show that bacterially expressed c0c3 is well ordered on actin filaments near subdomain 1 . Noticeably, some of the above studies report linear, nonsaturating binding, suggesting the presence of weak electrostatic interactions, as exemplified by the calculated micromolar affinity . Consistent with this, these binding reactions depend largely on ph and ionic strength and are regulated by phosphorylation of cmybp - c . Thus, an increase in ph or ionic strength significantly decreases the capacity of the aforementioned cmybp - c peptides to bind to f - actin [4042]. Similarly, pretreatment of these recombinant peptides with pka results in a dramatic reduction of their ability to associate with f - actin . Importantly, a recent study by rybakova and colleagues investigated the actin - binding capabilities of cmybp - c across its entire length . In support of previously published studies discussed above, the authors found that the nh2-terminal domains of cmybp - c bind to f - actin in a linear, nonsaturating manner, likely mediated by weak electrostatic interactions . However, recombinant full - length cmybp - c, expressed in the baculovirus system, supported a direct and saturating interaction with f - actin with a calculated kd of ~4.3 m . Moreover, constructs lacking domains c0c5 exhibited similar binding properties as full - length cmybp - c; this observation prompted the authors to conclude that the weak actin binding mediated by the nh2-terminus of the molecule does not contribute significantly to the overall affinity of cmybp - c for f - actin . Moreover, the authors further showed that the actin binding supported by the cooh - terminal c6c10 domains, unlike the nh2-terminal c0c2 domains, is independent of the regulatory elements, troponin and tropomyosin, of thin filaments, the levels of ca, and the phosphorylation status of the m - motif . Although the cooh - terminus of cmybp - c exhibits a higher affinity for f - actin, the minimal binding region and its physiological relevance are still elusive . These open questions are especially important because the cooh - terminal domains c6c10 also harbor binding sites for myosin and titin filaments (discussed above). Indeed, space constraints would favor dynamic rather than simultaneous interactions of the cooh - terminus of cmybp - c with the actin, myosin, and titin filaments . However, three - dimensional reconstruction of thick filaments demonstrated that domains c7c10 of cmybp - c run along the length of the myosin rod, suggesting that its interaction with the lmm portion of myosin is not of dynamic nature . Collectively these studies suggest the presence of various but weak binding sites for f - actin in the nh2-terminus of cmybp - c as well as the presence of a high affinity, saturating binding site in the cooh - terminus of the molecule . Obviously, more work is required before we can obtain a clear understanding of the physiological relevance of these interactions during muscle contraction and relaxation . Early work has shown that the skeletal isoforms of mybp - c also interact directly with both thick and thin filaments; however, their binding is much less characterized (figure 3 and table 2). Similar to cmybp - c, the skeletal isoforms bind to the rod portion of sarcomeric myosin through their c10 domain and to the s2 region through their nh2-terminus . Further characterization of the nh2-terminal binding has shown that the first two ig domains of smybp - c (c1-c2) bind to the s2 region with an affinity of ~2.2 m [26, 34]. In addition, native skeletal mybp - c (presumably containing a mixture of the slow and fast isoforms) coaggregates with f - actin in a ca sensitive manner . It becomes apparent from the above studies that our knowledge on the interaction of slow or fast mybp - c with myosin and actin filaments is limited . The identification of multiple mutations in the cardiac isoform that have been causally linked to the development of fhc is a major contributing factor that has shifted the interest of researchers towards cmybp - c; however, this has recently changed, as mutations in smybp - c were identified in patients suffering from distal arthrogryposis type 1 (da1), a disorder characterized by congenital contractures of the hands and feet (; please see below). More importantly, the molecular diversity of the skeletal isoforms further complicates the relevant studies as there are at least five different skeletal forms of mybp - c (one fast and four slow variants) that share homologous or common sequences, contain novel insertions in the nh2- and cooh - termini, and may coexist in the same muscle, fiber, or even sarcomere . Further detailed investigation is, therefore, necessary to evaluate the ability of each isoform to bind to myosin and actin filaments as well as the physiological significance of these interactions . During the last decade, an overwhelming number of mutations (~200) have been identified in the mybpc3 gene, which encodes the human cardiac mybp - c protein . These include missense, nonsense, deletion / insertion, and frame - shift mutations and have been causally linked to the development of modest and late onset familial hypertrophic cardiomyopathy (fch) [5658]. The majority of the nonsense and frame - shift mutations result in truncated forms of the protein, that lack the cooh - terminus harboring binding sites for lmm, actin and titin, and thus negate the ability of cmybp - c to associate with these filaments and regulate contractile activity . Interestingly, these truncated peptides are often undetectable in patient biopsies, possibly due to transcriptional misregulation or rapid degradation . Contrary to non - sense and frame shift mutations, missense mutations are generally associated with a less severe cardiomyopathic phenotype and do not affect the structure or stability of the protein although some of them have been suggested to weaken myosin binding . Moreover, recent genome wide linkage analysis revealed that mutations in the mybpc1 gene that encodes the human skeletal mybp - c slow protein lead to the development of distal arthrogryposis type 1, an autosomal dominant disorder characterized by congenital contractures of the hands and feet . Two missense mutations have been identified to date, w236r and y856h, which are present in the m - motif and c8 domain, respectively . Evaluation of skeletal muscle biopsies obtained from affected individuals revealed that slow twitch fibers were significantly smaller than fast twitch fibers . Importantly, the locations of these two mutations indicate possible alterations in the ability of smybp - c to interact with myosin or actin via its nh2-terminus and to associate with the thick and titin filaments through its cooh - terminus . The causal involvement of the mybp - c family of proteins in the development of cardiac and skeletal myopathies, as exemplified by the aforementioned studies, clearly indicates that the members of this multifaceted and complex family are essential components and key regulators of muscle structure and function . Through its dynamic interactions with myosin and actin filaments, mybp - c affects the formation and cycling of cross - bridges in three distinct ways: (i) by maintaining the normal structure of myosin and actin filaments, (ii) by regulating the rate at which myosin and actin interact, and (iii) by modulating the atpase activity of myosin . Consistent with this, the addition of skeletal mybp - c reduces the critical concentration necessary for myosin polymerization in vitro and results in the formation of longer and more uniform thick filaments [61, 62]. In addition, the nh2-terminal region c0c2 of cmybp - c supports actin bundling in vitro, as evidenced by the increased turbidity of f - actin in the solution and the formation of significantly thicker actin filaments, as visualized by electron microscopy . Notably, the effect of cmybp - c on actin bundling is dependent on ph and regulated by phosphorylation events mediated by pka . Moreover, in vitro motility assays, examining the sliding of actin filaments over myosin heads in the presence of full - length or truncated forms of cmybp - c revealed a significant reduction in their sliding velocity [40, 63, 64]. Notably, the degree of reduction was also dependent on the presence of the actin regulatory proteins, troponin, and tropomyosin; in their presence, there was a lesser effect on the decrease of actin motility over full - length myosin [63, 65], hmm or s1 heads . Mybp - c also modulates the atpase activity of myosin, though in an indirect way, via interactions with both myosin and actin filaments supported by its nh2-terminus . In agreement with this, purified smybp - c inhibited the atpase activity of actin - activated myosin; however, native cmybp - c moderately enhanced the actin - activated atpase activity of myosin [66, 67]. Surprisingly though, recombinant cmybp - c containing the c0c2 region inhibited the atpase activity of myosin in the presence of actin . The majority of the aforementioned studies have been performed with native proteins obtained from different species or types of muscles, presumably due to ease of purification . However, alyonycheva et al . Have convincingly shown that the strength of the interaction between myosin and mybp - c is considerably increased when both proteins are purified from the same source . As such, cmybp - c and skeletal mybp - c bound with higher affinity to cardiac and skeletal myosin, respectively . As our knowledge about the molecular and functional properties of mybp - c broadens, it becomes apparent that through interactions supported by its cooh and nh2 termini, mybp - c contributes to the maintenance of the normal structure of thick filaments, and the regulation of cross - bridges formation and cycling . It has, therefore, been suggested that mybp - c may serve as a linker, whereby its cooh - terminus is necessary for anchoring it to lmm in the a - band, leaving the nh2-terminus available to modulate contractility through dynamic interactions with the head region of myosin and actin . Consequently, calaghan and colleagues proposed the tether model to explain how mybp - c modulates the formation of actomyosin cross - bridges . This model suggests that both myosin binding sites on mybp - c act together by limiting the movement of the s1 heads relative to lmm and actin, thereby restricting the formation of actomyosin cross - bridges . Phosphorylation of select ser residues within the m - motif of cmybp - c, mediated mainly by pka, regulates the interaction between cmybp - c and myosin by acting as an on - off switch . Consequently, when in the on or dephosphorylated state, the nh2-terminus of cmybp - c binds to myosin and limits its interaction with actin, when in the off or phosphorylated state, myosin is free to interact with actin and form cross - bridges . The tether model is centered on the dynamic and highly regulated interaction of mybp - c with myosin and actin filaments . However, it is necessary to understand the orientation of mybp - c within the sarcomere, as well . Two proposed models for the topology of mybp - c have been suggested: a collar model in which a trimer of mybp - c molecules wraps around the rod domain of myosin, and an axial model, where the cooh - terminus of mybp - c runs along the length of the rod domain . A stipulation of the collar model is that mybp - c is required to dimerize . In support of this, it has been shown that mybp - c dimerizes through interactions mediated by domains c5 and c7 with c8 and c10, respectively [43, 72]. On the other hand, x - ray diffraction in combination with molecular and computational modeling studies support the axial model, suggesting that the last three domains of mybp - c lay along the length of the myosin rod [71, 73]. Recently, a study using electron microscopy and three - dimensional reconstructions of cardiac thick filaments further demonstrated that the cooh - terminus of cmybp - c runs along the rod domain surface of thick filaments . Although mybp - c dimerization is not essential for the arrangement of mybp - c along the length of the myosin rod, the axial model does not negate its dimerization . Nevertheless, in both models the nh2-terminus of mybp - c extends into the interfilament space where it is accessible to bind to the s2 portion of myosin and actin . Physiological dynamic interactions of mybp - c with myosin and actin are possible as the distance between thick and thin filaments is ~916 nm and the length of extended mybp - c is ~40 nm . Therefore, mybp - c is capable to span the interfilament space, enabling interactions with both actin and myosin filaments . It is not without precedence that regulation of contractility occurs through dynamic interactions with both actin and myosin filaments, as the essential and regulatory light chains bind tightly to myosin, but also interact with actin [25, 76, 77]. Additionally, twitchin, a protein similar to titin, characterized in c. elegans as a thick filament regulatory protein, interacts with both myosin and actin in a phosphorylation - dependent manner to modulate cross - bridges formation [78, 79]. However, current models (as described above) to explain the mechanism of contractile regulation through dynamic binding to myosin and actin are lacking . Undoubtedly, more work is necessary in order to understand the precise mechanisms by which mybp - c modulates contractility.
The converge consortium has obtained a large number of samples (including 5,303 cases of mdd and 5,337 controls, all chinese subjects) for inclusion in genome - wide association studies (gwas). Snp rs35936514 in the lhpp gene has been reported to be significantly associated with mdd at a genome - wide level . Lhpp encodes an enzyme known as phospholysine phosphohistidine inorganic pyrophosphate phosphatase (lhpp), which was originally purified from swine brain tissue and shows high levels of expression in the brain [3, 4]. This region of the genome has been implicated in the etiology of mdd using a combination of linkage and association analysis . Lhpp or a product of a collinear brain - specific transcript, therefore, may interact with htr1a in the pathogenesis of major depression . A recent study has extended the findings of previous literature by supporting the role of lhpp in risk for mdd . A single study has shown the expression of lhppase to be associated with thyroid function, which could be interesting given that thyroid disorder is thought to mediate the functional regulation of mdd patients . A link between thyroid function and depression any impairment of thyroid function supply to the developing cns causes severe changes to the overall architecture and function of human brain, leading to various neurological dysfunctions [912]. Recently, genetic imaging has been used to investigate the association of genetic variation with neuroimaging endophenotypes . Genetic imaging is an emerging field that is rapidly identifying genes that influence the brain, cognition, or risk for diseases . Along with clinical diagnosis, it has fostered new enthusiasm in depression research, because this approach allows for assessing the neural impact of candidate genes in vivo and thus provides for a new level of evidence [17, 18]. Resting - state functional magnetic resonance imaging (rs - fmri) is often used to examine mental disorders . The amplitude of low - frequency fluctuations (alff) is thought to detect the intensity of spontaneous neural activity at rest . It has been considered a reliable and sensitive measure to study both healthy and clinical populations [2022]. The effects of the neural system and their association with lhpp variation in the context of mdd are not yet understood . Identifying previously unknown physiological pathways can open new avenues for the development of novel depression drugs . In the present study, the association of lhpp rs35936514 with the resting - state brain activity was measured using alff . It is here hypothesized that variations in rs35936514 may influence spontaneous brain activity at rest in mdd patients . 45 mdd patients (mean age 27.13 sd 12.65 years, range 1359 years, 71% female) were recruited from the outpatients at the department of psychiatry, the first hospital of china medical university, and the mental health center of shenyang . The diagnosis of mdd was confirmed by 2 trained psychiatrists using the structured clinical interview for dsm - iv disorders (scid). Scores on the 17-item hamilton rating scale for depression (hamd) were obtained from each participant except for one, who did not complete these evaluations . Here, 115 healthy control (hc) subjects (mean age 33.96 sd 14.25 years, range 758 years, 57% female) without any personal history of any axis i disorder or first - degree family member with a major mood or psychotic disorders were recruited through surrounding communities . Exclusion criteria for both groups included history of neurological disease, loss of consciousness 5 min, any medical condition that might affect neurovascular function including hypertension, current substance abuse, or dependence, and having contraindications for mri . All participants provided written informed consent after receiving a complete description of the study as approved by the institutional review board of the china medical university . Subjects were further divided into two groups: a cc group homozygous for the c allele (23 mdd, 57 hc; mean age = 34.06 14.45 years, 60% female) and risk t - carrier group (ct / tt genotypes; = 22 mdd, 58 hc; mean age = 30.02 13.57 years, 61% female). Genotype frequencies were consistent with hardy - weinberg equilibrium expectation (mdd: = 2.894, p = 0.08; hc: = 2.52, p = 0.11). The mri data were acquired using a ge signa hdx 3.0 t mri scanner (general electric, us) in the department of radiology of the first hospital of china medical university . Soft pads and earplugs were used when scanning to restrict head motion and reduce scanner noise . Participants were asked to relax with their eyes closed but remain awake throughout the resting - state scan . Three - dimensional t1-weighted images were obtained using a fast spoiled gradient - echo (fspgr) sequence: repetition time (tr) = 7.1 ms, echo time (te) = 3.2 ms, field of view (fov) = 24 cm 24 cm, flip angle = 15, matrix = 240 240, slice thickness = 1 mm, and no gap . Functional images were acquired using a gradient echo planar imaging (epi): tr = 2000 ms, te = 30 ms, fov = 24 cm 24 cm, flip angle = 90, matrix = 64 64, slice thickness = 3 mm, no gap, and slices = 35 . The first 10 volumes of each subject were discarded to allow participants to adapt to the scanning environment . The remaining data were preprocessed including slice timing, head motion correction, and spatial normalization to the standard montreal neurological institute (mni) space (resampling to 3 3 3 mm). Subsequently, the images were spatially smoothed with a 6 mm full - width at half - maximum (fwhm) gaussian kernel . Participants with head motion less than 3.0 mm in any dimension or 3 rotation at any point during the course of the scan were included for further analysis . Subsequent data preprocessing included removal of linear trends and temporal filtering (band pass, 0.010.08 hz) to reduce the effects of low - frequency drift and high - frequency noise . The square root was calculated at each frequency of the power spectrum and averaged square root was between 0.01 and 0.08 hz . The alff of each voxel was divided by the global mean alff value within a brain mask . Resting - state fmri data analysis toolkit (rest) (http://www.restfmri.net/) was performed for further data processing and alff analysis . Demographic data (sex, age, education, and hamd) were analyzed using chi - square tests and two - way analysis of variance (anova) with diagnostic group (hc, mdd) and genotype group (cc, ct / tt) as between subject factors . A two - sample t - test was used to compare the durations of illness across genotypes within the mdd group . A voxelwise anova (2 2 anova: diagnosis genotypes) was used to determine the effects of diagnosis and genotype on alff values, and age and sex were considered as covariates . Post hoc t - test was used to explore the details of the main effects and interactions . Correction for multiple comparisons was based on monte carlo simulation [alphasim, analysis of functional neuroimages (afni), cluster size> 3321 mm]. Pearson correlation analyses and spearman correlation analyses were performed to determine the correlation of alff values between regions showing significant differences with the hamd scores, education, and illness duration in the two diagnostic groups . There was no significant effect of diagnosis, genotype, or interaction between diagnosis and genotype for age, sex, or education . The effect of diagnosis in hamd was significant, with significantly higher hamd scores in the mdd group than in the hc group . Two - sample t - tests showed no difference in the duration of illness between the mdd subgroups (table 1). The influence of diagnosis and genotypes on alff in the cc and ct / tt genetic subgroups in the mdd and control subjects is listed in table 2 . After performing a two - way anova on the alff maps, a significant main diagnosis group effect was observed (f = 56.39, p <0.001, corrected). Mdd patients showed significantly increased alff in the left middle temporal gyrus and left occipital cortex compared with individuals in hc group (figure 1). There was also a significant main effect of genotype (f = 31.80, p <0.001, corrected). The t - carrier group showed increased alff in the left superior temporal gyrus (figure 2). Significant diagnosis by genotype interaction was noted (f = 22.24, p <0.001, corrected). Among patients with mdd, the t - carrier group had significantly lower alff values in the bilateral lingual gyri than the cc group (f = 2.92, p = 0.006). Within - genotype comparisons showed that t - carriers with mdd had significantly lower alff in the bilateral lingual gyri than healthy controls who were t - carriers (f = 4.82, p = 0.02). In addition, alff were highest in the brain regions of the bilateral dorsal lateral frontal cortex (dlpfc) and left medial prefrontal gyrus (mpfc) in mdd rs35936514 t - carriers compared to mdd rs35936514 cc homozygotes and both control genotype groups (p <0.001) (figure 3). Correlation analyses did not show any significant associations between alff and hamd scores, illness duration, or education in mdd or hc groups . Based on the large number of samples studied on lhpp rs35936514 associated with mdd in chinese subjects, it was here noted that lhpp was associated with thyroid disorders, which may affect depression . Multiple studies have reported that both hypo- and hyperthyroidism may potentially increase the risk of cognitive impairment and neurodegeneration . The association between hypothyroidism and depression might be explained by higher rates of hypercortisolism in depression, which might lead to changes in the hypothalamic - pituitary - thyroid / adrenal (hpt / hpa) axes . Dysfunctional hpt / hpa axes regulation might be a trait in mdd patients, producing changes in the monoaminergic pathways that modulate hormonal responses . Autoimmune thyroiditis which is marked by the presence of thyroid antibodies with normal or abnormal thyroid hormone level is also a major cause for mdd . A bidirectional association between depression and the immune system has been also reported [33, 34]. Depression has been linked with increased inflammatory markers and depression risk alleles have been found to be associated with regulating genes of the immune response . However, the current work did not show apparent relationship between lhpp, thyroid disorders, and mdd . Our present study may provide a new imaging genetics approach to explore their relationships . In order to assess the effects on the neural system associated with lhpp variation and mdd, the current work demonstrated that lhpp rs35936514 snp polymorphism may influence the spontaneous brain activity in individual subjects with mdd and also healthy controls . The spontaneous low - frequency fluctuations (lff) of blood oxygenation level - dependent (bold) signals at rest have been identified as a biological measure of baseline spontaneous activity in the brain [21, 22, 36]. Abnormal alff can reflect pathophysiological states in the regional brain area and may help to locate specific impaired brain regions during the resting state . As an additional advantage, alff can be used to assess neuronal activity within the entire brain . In particular, by rs - fmri, the cortico - limbic - striatal circuits (including the pfc, hippocampus, amygdala, and striatum) have been implicated in the dysfunctional regulation in mdd . The current study showed significant interactions between diagnosis and genotype in the bilateral lingual gyri, bilateral dlpfc, and left mpfc . The alterations of alff in the mdd t - carrier group suggest that the risk t allele is associated with abnormal spontaneous activity in mdd . More research is needed to identify the mechanisms by which these regional activities in individuals with mdd may be more vulnerable to the effects of variations in rs35936514, which render them more vulnerable to genetic liability . However, it remains unknown when and how this interaction could change alff, although many factors could influence the status of mdd [3840], which are well established as a risk for mdd . Furthermore, expression of multiple genes involved in mdd, and their interaction with the lhpp genotype could make a change in the neural circuits of mdd patients . The parts of the brain in the mpfc are believed to be the neural site of self - referential processing, like the anterior node of the default mode network (dmn). Alterations to the mpfc functional networks are involved in the development of mdd [43, 44]. Altered resting state in the dlpfc of mdd could adversely affect activity during emotional or cognitive regulation . The lingual gyrus has been reported to participate in the visual recognition network and to play a role in the perception of emotions [45, 46]. Many studies have reported decreased activity in the lingual gyrus [45, 47, 48] in patients with mdd . This may be attributable to different roles and levels of expression of the lhpp gene in different regions of the brain, different structural or functional bases (activities) of different brain regions, the combined effects of the t - carrier genotype, and other unknown factors . In this study, independent of genotype, increased alff was observed in the left middle temporal gyrus and left occipital cortex among mdd participants compared to that among hcs . The increased spontaneous activity in the temporal and occipital lobe within mdd patients was consistent with the findings of rs - fmri studies examining depression [4951]. Genotype was found to have an effect on alff in the left superior temporal gyrus . It was higher among t - carriers of the lhpp rs35936514 polymorphism in both the hc and mdd groups than in cc individuals within the respective diagnostic groups . It is here suggested that the mdd rs35936514 t - carriers may function as one of several factors that can be used to diagnose mdd . It is possible that variation in lhpp may contribute to the different alff values in temporal lobe in individuals with or at risk for mdd . In this way, the subgroup with mdd that carries the t allele may be a risk factor to abnormal brain activity . However, exploratory analyses did not reveal significant correlations between alff values in regions of significant group differences and clinical factors within each group . We speculate that the relative small sample size or other clinical factors may limit our ability to detect the relation . One lhpp snp, rs11245316, was found to confer risk of mdd by qtl - specific association analysis . However, these data do not provide preliminary indications of how genetic variation in high - risk regions influences susceptibility to neural circuits abnormalities in patients with mdd . First, many snps and genes implicated in mdd were not included in the study . Gene - gene interaction studies and even pathway studies are needed to search for valid mdd - associated genetic and neuroimaging biomarkers . Second, owing to the small sample size, the study placed individuals with ct and tt genotype in a single group . As a result, no analysis of the alff values among 3 genotype groups could be performed, and the effect of the risk t allele could not be established as dominant or codominant . A larger - sample study should be performed to further investigate the effect of genes . In conclusion, the present study demonstrated for the first time that lhpp rs35936514 ct / tt genotype may affect regional brain activity in mdd patients . This suggests that the influence of lhpp variation may be one mechanism that contributes to the neural circuits of mdd.
It was a blend of 19th century american metaphysical culture . In that cultural milieu, metaphysics had to do with the individual and universe communing through energetic and spiritual harmony . The combination of worldviews and the practices that went along with them are often described in terms of colliding worldviews such as vitalism vs mechanism or holism vs reductionism . The complexity of worldview development is not as simple as a polar dichotomy because worldviews are cultural / historical artifacts and developmentally enacted in individuals . Thus, attempts in the literature to solve the philosophical impasses in the chiropractic profession through pluralism do not go far enough because they do not address the central problems of worldviews and how they evolve . Chiropractic was part of a new and evolving worldview, an embodied attempt to reconcile the fractures inherent to western culture between mind and body, and spirit and nature . Such a paradigmatic approach to chiropractic's origination has not been adequately addressed in the literature . By exploring how this new worldview emerged historically and culturally and how it was different from previous worldviews in human history, we can better understand chiropractic, including its philosophy, politics, science, morals, and practice . We can also begin to understand the role chiropractic has played in the history of worldview development and philosophy itself . The most comprehensive way to explore the worldviews from which chiropractic emerged is to examine a history of western philosophy with an emphasis on philosophical ideas that were precursors to chiropractic's core philosophical concepts . This article will focus on selected major philosophers and some wider theories about the worldviews from which they came from, all in relation to 2 chiropractic concepts . The 2 concepts central to the philosophy of chiropractic are innate intelligence (ii) and universal intelligence (ui). In a section called chiropractic defined in his book the science, art, and philosophy of chiropractic, the founder of chiropractic, dd palmer, wrote: the philosophy of chiropractic is founded upon the knowledge of the manner in which vital functions are performed by innate in health and disease . When this controlling intelligence is able to transmit mental impulses to all parts of the body, free and unobstructed, we have normal action which is health . The philosophy of chiropractic is founded upon the knowledge of the manner in which vital functions are performed by innate in health and disease . When this controlling intelligence is able to transmit mental impulses to all parts of the body, free and unobstructed, we have normal action which is health . Innate refers to innate intelligence, which was central to dd palmer's definition of chiropractic . Palmer continues: knowing that our physical health and the intellectual progress of innate (the personified portion of universal intelligence) depend upon the proper alignment of the skeletal frame, we feel it our bounden duty to replace any displaced bones so that physical and spiritual health, happiness and the full fruition of earthly life may be fully enjoyed . Knowing that our physical health and the intellectual progress of innate (the personified portion of universal intelligence) depend upon the proper alignment of the skeletal frame, we feel it our bounden duty to replace any displaced bones so that physical and spiritual health, happiness and the full fruition of earthly life may be fully enjoyed . The expression of intelligence through matter was at the core of the philosophy of chiropractic . Dd palmer's son, bj palmer, led the palmer school from 1906 to 1961 and expanded the concepts of ii and ui in his voluminous writings to include an even wider conception of the role chiropractic played in the unification of the physical and spiritual aspects of reality . This article suggests that the way ui and ii were defined and used in practice was a philosophical and embodied attempt to overcome the dualism between mind and body, and spirit and matter inherent to western philosophy . By bringing together the metaphysical religious culture with science through a practice, chiropractic was a new paradigm and thus bound to face legal, social, linguistic, personal, scientific, and cultural challenges . Thus, one way of approaching a better understanding of chiropractic is to view it as a response to the fragmentation of consciousness in the modern era . By situating the philosophy of chiropractic in the lineage of western philosophy and the development of self - identity (as in structures of consciousness through time) two distinctions about these terms, ii and ui, should be acknowledged at the outset . Linguistically, both dd palmer and bj palmer used the same terminology such as ii to represent very different categories of being such as life, soul, and spirit . S to represent the immanent and transcendent divine, as one whole permeating and comprising all matter . This usage is consistent with dd palmer's use of the term (fig 1). The essence of ii and ui was based on embodied experiences originally cultivated by both palmer's through the same types of altered states related to hypnotic trances and magnetic passes, which may have inspired william james, sigmund freud, and henri bergson . It is important, however, to keep the embodied and experiential nature of the philosophy of chiropractic at the forefront of any discussion of the worldviews from which it emerged, as such distinctions are not usually addressed in the literature . It is equally important to differentiate the different levels of linguistic definitions associated with terms like innate intelligence . It is proposed that chiropractic was, in part, an attempt to unite matter, body, life, soul, and spirit through contemplation, the chiropractic adjustment, and worldview development . The main focus of this article is to situate these ideas in the context of a history of ideas, with an emphasis on the premodern worldview and the premodern sense of self . An earlier article on the philosophy of chiropractic examined the attempts to critique and update the philosophy of chiropractic and categorizes those approaches into 8 methodologies . The current article and its 2 companion articles use 2 methodological families (hermeneutics and ethnomethodology) as a way to more fully situate chiropractic in a history of ideas and worldviews . This genealogical approach (observing how worldviews developed through time) may also hold an alternative view to how chiropractic thrived whereas other healing methods born of the same period withered . Finally, this approach offers completely new interpretations of the dichotomies, criticisms, and solutions to the philosophical problems proposed in the literature . Constructing a philosophy of chiropractic requires a deep look at the history of ideas and worldviews they grew from to situate the complexity of these ideas in a comprehensive framework . This sets the tone for a construction rooted in a more accurate context . By taking this approach, we get a picture of the debates and traditional issues in the philosophy of chiropractic not fully painted before . This is a picture that explores the evolution of worldviews rather than only contrasting opposing views and determining how they may or may not fit together . It shows how complex the modern self actually is and how that complexity is essential to understand chiropractic and its philosophical ideas . By reframing chiropractic's emergence in this genealogical way, many of the problems and critiques in the literature on the philosophy of chiropractic can be solved, dismissed, or integrated . Therefore, the current article uses the theoretical model of integral methodological pluralism (imp). I describe chiropractic situated in a history of philosophy with an emphasis on worldview development, perspective development, and development of self - identity across history, while focusing on premodernity . By looking at the different ways that individual philosophers viewed the world in the premodern, modern, and early postmodern era, we can contrast those worldviews to that of dd palmer, founder of chiropractic . We can do this in part by examining the roots, foundation, and core elements to the ideas of innate and universal intelligence . I argue that the roots of the philosophy of chiropractic can be found in premodern worldviews, the foundation of the philosophical ideas can be found in modern worldviews, but the core of the ideas is rooted in postmodern worldviews . Chiropractic developed from an early postmodern worldview with a unique and very modern sense of self at its foundation . By understanding this argument, the groundwork can be laid for the construction of a philosophy of chiropractic from an entirely new perspective, one that addresses the unique moment of chiropractic's inception in terms of the history of ideas and of the self . Integral methodological pluralism's 8 methodological families described in the previous article are phenomenology, structuralism, autopoiesis theory, empiricism, social autopoiesis theory, systems theory, hermeneutics, and ethnomethodology . It has been proposed that any construction of a philosophy of chiropractic should include all 8 methodological families to be truly holistic . Ethnomethodology, hermeneutics, phenomenology, and developmental structuralism were shown to be the least addressed methodological families in the literature on the philosophy of chiropractic . Wilber's insights are important to any discussion about new worldviews emerging in the modern and postmodern eras . He argues that the postmodern consciousness is, in part, an attempt to heal the cartesian dualism and the disassociations common to western culture between mind / body; matter / spirit; and, most notably, art, science, and morals . It is this argument i will build upon by emphasizing the structural development of worldviews over time . Worldviews can be understood by using objective criteria to examine how societies, cultures, and individuals develop meaning . The evolution of worldviews through time is a useful way to contextualize the origination of any idea or philosophy . Common methods for this third - person view of interiors are cultural anthropology, cultural history, and ethnomethodology for collective worldview development . This approach to understanding worldviews has been explored by tracing patterns of perspective or meaning - making through cultures and history . Worldviews can also be approached hermeneutically by attempting to understand how individuals understand each other . Using these methodologies, the need for a genealogical approach to the philosophy of chiropractic becomes obvious when examining the literature linking the philosophy of chiropractic to the history of ideas and the branches of philosophy . Although they are important precursors to constructing a philosophy, these approaches are inadequate to do so on their own . Any critique or discussion of philosophy in chiropractic that does not account for worldview development will miss central elements at the heart of the philosophy the only exceptions to this are historical approaches that emphasize cultural worldviews, yet these approaches rarely acknowledge the genealogical or structural aspect of worldview development . Chiropractic historians have focused on retrospectively linking concepts and theories from chiropractic's principles to the roots of the ideas in the past . For example, jacelone wrote, the fundamental philosophic principles, upon which chiropractic science and art are based have origins in ancient thought . Although this is a valid and important approach to establishing the cultural authority of chiropractic, such approaches would have stronger validity claims were they to incorporate worldview development . Unfortunately, many historians downplay dd palmer's philosophical insights while emphasizing other scientific or philosophical roots . For example, donahue links the concept of wellness and treating the whole body to the ancient greek followers of hippocrates, the coans from cos . He suggests that we should get rid of dd palmer's personal beliefs about spirituality and stick to these ancient wellness concepts . Palmer's mystical innate philosophy, we are still left with a usable coan perspective . Religious historians and scholars take issue with this approach, and for good reason . Robert fuller writes: i think that donahue, as well as other current historians seeking to show chiropractic's early commitment to scientific research, minimizes the metaphysical dimensions that palmer had injected into the movement in its early days . I think that donahue, as well as other current historians seeking to show chiropractic's early commitment to scientific research, minimizes the metaphysical dimensions that palmer had injected into the movement in its early days . On a similar and more recent note, gunther brown writes: chiropractic historians who feel uncomfortable with the palmers' religious views, embarrassed by their anti - medical statements, and eager for the profession to achieve scientific legitimacy have (unjustifiably in moore's view) minimized the ongoing influence of harmonial chiropractic . Chiropractic historians who feel uncomfortable with the palmers' religious views, embarrassed by their anti - medical statements, and eager for the profession to achieve scientific legitimacy have (unjustifiably in moore's view) minimized the ongoing influence of harmonial chiropractic . Gunther brown is referring to another historian, stuart moore, and his book chiropractic in america . Moore pointed out that the harmonial tradition goes far back in western philosophy and chiropractic can be viewed as part of that tradition . Moore acknowledges the cultural and historical aspects to the philosophy of chiropractic but does not include a structural or genealogical approach to how these ideas emerged . This leaves the analysis of the philosophy incomplete and could lead to a false equivalence between premodern ideas and dd palmer's ideas . Another approach to the philosophy of chiropractic is relating it to the classic branches of philosophy . One of the biggest problems with this approach centers on the use of the term metaphysics . Metaphysics is the branch of philosophy established by aristotle's book by that title . Catherine albanese has noted that palmer's tradition was born of the american metaphysical religion, which is a different usage of the term than the classical one . Metaphysics is often used in different ways in the literature, in the classical sense as a branch of philosophy and in the cultural religious sense, usually as in the shelf in the new - age bookstores . For example, phillips and leach write: while the branch of philosophy dealing with metaphysics (i.e., beyond the physical world; religion, ghosts, magic, the transcendental, and anything that we cannot physically measure, see, touch, or define) may not be essential for chiropractic science, or for any science, there are chiropractic philosophers who believe it need not be abandoned . While the branch of philosophy dealing with metaphysics (i.e., beyond the physical world; religion, ghosts, magic, the transcendental, and anything that we cannot physically measure, see, touch, or define) may not be essential for chiropractic science, or for any science, there are chiropractic philosophers who believe it need not be abandoned . In the above quote, the authors confuse philosophical metaphysics with metaphysical religiosity, include a host of attributes to such religiosity (ghosts, magic, etc), and then suggest that philosophers of chiropractic that include metaphysics accept all of that . Metaphysics as a branch of philosophy deals with philosophical questions such as first causes, ideal forms, and the mind / body problem . The second definition of metaphysics deals with the full spectrum from contemplative and energetic experiences associated with meditation practices and alternative and complementary medicine, to religious experiences associated with a communion between the spiritual realm and the physical realm, to magical belief systems . When using the term metaphysics in regards to the philosophy of chiropractic, a distinction should be made as to exactly how the term is being applied and defined . I have suggested, as has gunther brown, that albanese's distinction of definition be used when discussing chiropractic's origins . This is a useful approach because albanese has captured how the term was used during dd palmer's time and in relation to palmer and similar healing traditions specifically . Albanese writes: in this context, metaphysical forms of religion have privileged the mind in forms that include reason but move beyond it to intuition, clairvoyance, and its relative such as revelation and higher guidance . Here versions of a theory of correspondence between worlds prevail . The human world and mind replicate either ideally, formerly, or actually a larger, often more whole and integrated universe, so that the material world is organically linked to a spiritual one . In this vision of so powerful and constitutive of their reality that they discover themselves to be, in some sense, made of the same stuff . If there are differences, they are of degree and not of kind . Moreover, the influx of energy (let us now call it divine) that enlivens their world is a healing salve for all its ills and in the strongest statement of their view renders them divine and limitless . In this context, metaphysical forms of religion have privileged the mind in forms that include reason but move beyond it to intuition, clairvoyance, and its relative such as revelation and higher guidance . Here versions of a theory of correspondence between worlds prevail . The human world and mind replicate either ideally, formerly, or actually a larger, often more whole and integrated universe, so that the material world is organically linked to a spiritual one . In this vision of as above, so below, metaphysicians find a stream of energy flowing from above to below so powerful and constitutive of their reality that they discover themselves to be, in some sense, made of the same stuff . Moreover, the influx of energy (let us now call it divine) that enlivens their world is a healing salve for all its ills and in the strongest statement of their view renders them divine and limitless . Fuller even suggests that dd palmer made advances to the various approaches of the day by creating specific terminology (ii and ui) and pathways through which these energies can heal and enlighten the world (chiropractic). Palmer's claim to originality lies in his interest in discovering the precise physiological routes through which the individualized segment of divine spirit, innate, directs the life process within the individual . Thus, dd palmer's metaphysical religious outlook should not be described as a branch of philosophy . Metaphysics as a branch of philosophy can however be applied to interpreting aspects of palmer's philosophy . The branches of philosophy (metaphysics, epistemology, ontology, ethics, etc) will play an important role in constructing a philosophy of chiropractic in the future . In that regard, it will be important to draw from the literature in integral theory, not only from imp, but also from integral post metaphysics, integral epistemological pluralism, and integral ontological pluralism, as well as from integral situational ethical pluralism . These approaches will naturally situate the philosophy in the type of holistic picture described in the first article . The main problem with albanese's overall approach, which can be said for most approaches that capture the interior and cultural elements behind chiropractic's origins, is the lack of structural genealogy . Among the many historical approaches linking chiropractic's origins to the history of philosophy, albanese, moore, gaucher - pelsherbe, and fuller they do not however situate that knowledge within an evolution of worldviews . By adding the structural and genealogical aspect of worldview development, we can truly understand palmer in an entirely new light, construct a philosophy of chiropractic, and make new sense of the many debates in the profession for more than the last 100 years . One very important way this new approach can be used to further the philosophy of chiropractic is by dispelling the misleading historical interpretation that chiropractic's philosophy only exists because of legal survival . This was most recently applied to chiropractic in terms of the history of philosophy by phillips . The argument that philosophy in chiropractic emerged solely for legal purposes was initiated by lerner, expanded upon and clarified by rehm, and vigorously promoted by keating and his colleagues . Although based on facts, this interpretation of chiropractic's embrace of philosophy strictly because of the need to demonstrate it was a separate and distinct profession overemphasizes the legal / social over the cultural and personal influences on the philosophy and limits a more robust view of the development of philosophy . Solely focusing on the legal viewpoint fails to recognize the early importance of palmer's philosophy of innate . A genealogical approach to the history of ideas and consciousness and palmer's place in that milieu remedies this limited interpretation . Hopefully, the alternate approach offered in this article will create a more complete context for the emergence of chiropractic and its philosophical ideas without a political agenda, which is so obvious in the legal argument . There are 3 important ways to look at premodern worldviews and their impact on chiropractic's philosophical roots: structures of consciousness, self - identity, and ideas . Each one of these is interwoven, as they complement, reinforce, and help to shape each other . Structures of consciousness and self - identity are best understood using the methodologies of cultural anthropology, ethnomethodology, hermeneutics, structuralism, and phenomenology . As previously described, none of these are well represented in the literature on chiropractic's philosophy . This is very important because the chiropractic concepts of ii and ui are very similar to premodern conceptions of the soul, the body, and god . But without taking into account the worldview that those ancient conceptions arose from and the self - identities of the individuals who espoused such early formulations of these ideas, a very obvious error could be committed by equating chiropractic's ideas with premodern ideas . Innate intelligence is defined as the inner organizing force of all living systems . It is a piece of universal intelligence, the inherent organizing force of all matter . Dd palmer writes of innate: it continues to care for and direct the organic functions of the body as long as the soul holds body and spirit together.innate is embodied as a personified part of universal intelligence; therefore, co - eternal with the all - creative force . The intellectual expansion of innate is in proportion to the normal transmission of impulses over the nervous system; for this reason the body functions should be kept in the condition of tone . It continues to care for and direct the organic functions of the body as long as the soul holds body and spirit together . Innate is embodied as a personified part of universal intelligence; therefore, co - eternal with the all - creative force . The intellectual expansion of innate is in proportion to the normal transmission of impulses over the nervous system; for this reason the body functions should be kept in the condition of tone . Innate was also referred to as spirit, whereas palmer wrote, the body as an organism, is directed by an intelligence known as spirit . Innate intelligence was also described as the director of the soul, which was defined as intelligent life and the product from uniting intelligence and material, spirit and body; the result of a combination of the immaterial with the material . The soul was defined as the link between spirit (innate) and matter . In his later years, bj palmer developed the concept of ii to include a hierarchy of personal development . He believed ii could be developed biologically, mentally, and spiritually as a deep intuition and connection to the cosmos . For example, bj palmer wrote, innate communicates with you and when innate is in contact you are in tune with the infinite . These 2 levels of the definition, biological and psycho / spiritual, have led to a great deal of debate, criticism, and revision to the philosophy of chiropractic . Universal intelligence was defined by dd palmer as the organizing wisdom at the heart of all matter, also referred to as god, the eternal, the all - wise and the infinite source of all intelligence . It was later described by bj palmer as the first principle of the philosophy of chiropractic, the great i am that i am, the great unkown source, and the resident life principle . Having such explicit references to god and spirit as central to the philosophy of chiropractic has caused many philosophical problems in terms of further developing the philosophy, science, and art of chiropractic . By sorting out these ideas from the haze of premodern worldviews, locating their foundation in the modern identity, and also teasing out the newer elements from postmodern perspectives, we can more adequately deal with these philosophical questions in their proper context . Cultural historian jean gebser is one of the most important scholars of culture from the last century because he was able to explain the chaos of modern times in relation to the evolution of consciousness and the emergence of a new worldview . Gebser examined language, art, science, religion, architecture, poetry, as well as social practices and correlated 5 major structural developments or mutations in human consciousness throughout the course of human history: archaic, magic, mythic, mental, and integral . There is a move in academia to dismiss structural approaches to the history of ideas or consciousness mainly because such approaches were used in the past to assert social and cultural superiority in various ways . Gebser's objective approach, as well as the other approaches i will draw from in this article, should not be equated with what riane eisler refers to as domination hierarchy; rather, it should be understood for what it is, a cultural and historic anthropology, which tracks the development of perspectives over time, what eisler defines as actualization hierarchy . Recently, munzinger, a legal history scholar, critiqued the chiropractic profession on the way it writes its own history . Munzinger made the important point that when we look to the past, we should never assume that our predecessors held the same worldview as we . He writes, while it is true that we have much in common with people of the past, basic perceptions and worldviews do change over time, sometimes drastically, and it is misleading to examine our predecessors from a presentist perspective . Munzinger also concludes we should not assume that there was one simple path through history to get us to this point . Gebser's work does trace the history of consciousness in a seemingly progressive route to the latest advances in perspective . Yet, gebser and other similarly minded theorists like wilber, combs, and taylor are not suggesting that the latest developments in consciousness were inevitable and that history's purpose was to get us to this point . Nonetheless, there is an advance in consciousness being studied in all of their theories; and thus, to understand the philosophy of chiropractic from this perspective, we need to set aside judgment of this approach in the spirit of open - minded scholarship and pluralism . Gebser's 5 structures of consciousness, archaic, magic, mythic, mental, and integral, are a useful way for us to explore the evolution of worldviews over time . This is especially important because of gebser's emphasis on what he called the integral aperspectival structure, which began around the turn of the 20th century, the time of chiropractic's emergence . According to combs, gebser's 5 levels referred to the worldviews that were implicit in the structures of consciousness . These were complete experiential ways of understanding and relating to the world, as well as ways of perceiving and knowing . These 5 worldviews overlapped . In each epoch, one structure became dominant enough for most adults in a culture to achieve it . In any one culture, there could be many people at various worldviews; but the dominant one left its mark on art, literature, science, and history . There are virtually no extant data to corroborate the archaic structure or the way our ancient human ancestors viewed the world . Hallmarks of this structure are early cave paintings, shamans, cyclical time, as well as the interchangeability of space and time, and the one - dimensional point . This ancient magic structure is still with us today in positive forms in the deep resonances we feel when in love and the dreaminess we feel from music . Negative forms are evident in mass movements such as nazi germany or other lessened forms such as repression and projection . Mickunas, one of gebser's translators, relates the magic structure to the vital region of humans including vitality of consciousness and the miraculous in healing by prayer . The mythic structure began around 10 000 years ago with the neolithic humans, the late stone age with overlap into the next mental structure . The mythic gave rise to gods and goddesses, and mythic imagination; space was viewed as 2-dimensional, and time was not yet linear as we understand it today . Gebser referred to time in the mythic as temporicity such as long ago and far away . It is the differing conceptions of space and time that help to define each structure of consciousness . The mental structure began in the premodern era before the ancient greeks and has dominated the 20th century in much of the world . Feuerstein suggests that the transition from mythic to mental lasted from 10 000 to 500 bce . Based on his analysis of wilber's writings, reynolds depicts 3 phases of the mental era: early (2500 - 500 bce), middle (500 bce-1500 ce), and late (1500-present). In the next articles, we will explore the middle and late eras in detail in terms of philosophy and the emergence of the modern self - identity . Understanding the difference between the premodern and modern sense of self will help us to draw distinctions around dd palmer's concepts of innate and universal intelligence from similar concepts in history and also help us to situate chiropractic in a postmodern or postconventional worldview, what gebser referred to as integral aperspectival . The hallmark of the mental structure is the use of rationality and also the development of perspective . Perspectival consciousness developed as a worldview during the renaissance in the architecture of brunelleschi and the art of da vinci . It was a new way of viewing the world, one that situated the viewer in the point of view of the artist . Before this for the first time, 3 dimensions are captured in art . By looking at the art, you are able to view the spatial depths from the artist's 3-dimensional perspective . The magic and mythic structures were marked by 2-dimensional and preperspectival consciousness, such as cave paintings, where the images were dreamy; egyptian paintings, with 2-dimensional beings; or medieval tapestries, where the figures were floating with no ground or perspective . In those examples just by looking at perspectival art, like the mona lisa, a mutation of consciousness spread; and the world was never the same . Once an individual grasps the world in a new and more authentic way, such as from a 2-dimensional perspective to a 3-dimensional perspective, his or her worldview is forever changed . It is well documented that young children cannot take another person's point of view . As they grow and develop, they can begin to put themselves in another's shoes . Once this ability develops, an individual does not regress except perhaps in cases of brain injury . Individuals can still retain remnants of that previous level of egocentric perspective such as narcissism, but they now have the ability at least to see the world from another's perspective . In the past, these mutations of consciousness that gebser points out are the moments in history when these new worldviews emerged . Today, we take them for granted as the course of normal development . This new perspective or combs notes how the big change occurred when people began to take their own point of view with them into daily life . It not only brings one's point of view to the world, but tends to divide up, split up, and cause arguments over small matters . After viewing all the buildings, libraries, dorms, etc, he asked, where is the university? He was mistaking one category with another . The original definition of innate intelligence did something similar; it used the same term to describe the eternal spirit and the director of biological organization . For example, dd palmer wrote: that which i named innate (born with) is a segment of that intelligence which fills the universe . This universal, all wise, is metamerized, divided into metameres as needed by each individualized being . This somatome of the whole, never sleeps nor tires, recognizes neither darkness nor distance, and is not subject to material laws or conditions . It continues to care for and direct the functions of the body as long as the soul holds body and spirit together.innate's existence and consciousness are not dependent upon its body, no more than we on the house we live in . It is invulnerable, is not subject to traumatic or toxic injuries, is not subordinate to material substance . That which i named innate (born with) is a segment of that intelligence which fills the universe . This universal, all wise, is metamerized, divided into metameres as needed by each individualized being . This somatome of the whole, never sleeps nor tires, recognizes neither darkness nor distance, and is not subject to material laws or conditions . It continues to care for and direct the functions of the body as long as the soul holds body and spirit together . Innate's existence and consciousness are not dependent upon its body, no more than we on the house we live in . It is invulnerable, is not subject to traumatic or toxic injuries, is not subordinate to material substance . Biological functions are one category . In modern times, biology as a discipline has its roots in the mental structure of consciousness . The soul, which holds the body and spirit together, comes from the mythic structure of consciousness . The invulnerable and invincible spirit is the spiritual category and has its roots in the premodern magic and mythic structures . Palmer thus combined 3 levels: body, soul, and spirit or mental, mythic, and magic . The category error can be corrected by viewing these levels as emerging from different structures of consciousness and palmer's attempt to unite them as a new and emergent structure . Nowhere is the need for such a correction more evident than with the critiques of ii, which are based on ii's premodern roots . For example, donahue writes, the whole concept of innate of course rests on accepting on faith the basic premises without hope of any concrete proof . Concrete proof comes from a modern worldview . If accepting ii on faith was the only claim to its validity, it would represent a premodern concept and donahue would be correct . Incorporated into the definition of ii is an empirical approach from the mental structure of consciousness, the modern worldview . Dd palmer may not have been trained in the scientific method; but he did distinguish faith, belief, and knowledge in regards to science . Palmer wrote: science is accepted, accumulated knowledge, systematized and formulated with reference to the existence of general facts the operation of general laws concerning one subject . Chiropractic is the name of a classified, indexed knowledge of successive sense impressions of biology the science of life which science i created out of principles which have existed as long as the vertebrate.science is the knowledge of knowing . Scientific religion embraces a systematic knowledge of facts which can be verified by conscious cerebration . Faith is an inward acceptance of some personal act; we believe thon is trustworthy, therefore, we have faith . Faith is a union of belief and trust . Belief is an intellectual process, the acceptance of some thing as true on other grounds than personal observation and experience . Science is accepted, accumulated knowledge, systematized and formulated with reference to the existence of general facts the operation of general laws concerning one subject . Chiropractic is the name of a classified, indexed knowledge of successive sense impressions of biology the science of life which science i created out of principles which have existed as long as the vertebrate . Scientific religion embraces a systematic knowledge of facts which can be verified by conscious cerebration . Faith is an inward acceptance of some personal act; we believe thon is trustworthy, therefore, we have faith . Faith is a union of belief and trust . Belief is an intellectual process, the acceptance of some thing as true on other grounds than personal observation and experience . Conscious cerebration, in regards to scientific religion is an example of combining the premodern reliance on internal experience with the modern requirement of establishing repeatable and verifiable facts, or using gebser's structures as our scaffolding, we can begin to explore the history of the self and its ideas through time . This will allow us to separate these categories or levels and distinguish appropriate language for each, whether we are comparing premodern to postmodern, preconventional to postconventional, or just body to mind to soul to spirit . It is a piece of universal intelligence, the inherent organizing force of all matter . Dd palmer writes of innate: it continues to care for and direct the organic functions of the body as long as the soul holds body and spirit together.innate is embodied as a personified part of universal intelligence; therefore, co - eternal with the all - creative force . The intellectual expansion of innate is in proportion to the normal transmission of impulses over the nervous system; for this reason the body functions should be kept in the condition of tone . It continues to care for and direct the organic functions of the body as long as the soul holds body and spirit together . Innate is embodied as a personified part of universal intelligence; therefore, co - eternal with the all - creative force . The intellectual expansion of innate is in proportion to the normal transmission of impulses over the nervous system; for this reason the body functions should be kept in the condition of tone . Innate was also referred to as spirit, whereas palmer wrote, the body as an organism, is directed by an intelligence known as spirit . Innate intelligence was also described as the director of the soul, which was defined as intelligent life and the product from uniting intelligence and material, spirit and body; the result of a combination of the immaterial with the material . The soul was defined as the link between spirit (innate) and matter . In his later years, bj palmer developed the concept of ii to include a hierarchy of personal development . He believed ii could be developed biologically, mentally, and spiritually as a deep intuition and connection to the cosmos . For example, bj palmer wrote, innate communicates with you and when innate is in contact you are in tune with the infinite . These 2 levels of the definition, biological and psycho / spiritual, have led to a great deal of debate, criticism, and revision to the philosophy of chiropractic . Universal intelligence was defined by dd palmer as the organizing wisdom at the heart of all matter, also referred to as god, the eternal, the all - wise and the infinite source of all intelligence . It was later described by bj palmer as the first principle of the philosophy of chiropractic, the great i am that i am, the great unkown source, and the resident life principle . Having such explicit references to god and spirit as central to the philosophy of chiropractic has caused many philosophical problems in terms of further developing the philosophy, science, and art of chiropractic . By sorting out these ideas from the haze of premodern worldviews, locating their foundation in the modern identity, and also teasing out the newer elements from postmodern perspectives cultural historian jean gebser is one of the most important scholars of culture from the last century because he was able to explain the chaos of modern times in relation to the evolution of consciousness and the emergence of a new worldview . Gebser examined language, art, science, religion, architecture, poetry, as well as social practices and correlated 5 major structural developments or mutations in human consciousness throughout the course of human history: archaic, magic, mythic, mental, and integral . There is a move in academia to dismiss structural approaches to the history of ideas or consciousness mainly because such approaches were used in the past to assert social and cultural superiority in various ways . Gebser's objective approach, as well as the other approaches i will draw from in this article, should not be equated with what riane eisler refers to as domination hierarchy; rather, it should be understood for what it is, a cultural and historic anthropology, which tracks the development of perspectives over time, what eisler defines as actualization hierarchy . Recently, munzinger, a legal history scholar, critiqued the chiropractic profession on the way it writes its own history . Munzinger made the important point that when we look to the past, we should never assume that our predecessors held the same worldview as we . He writes, while it is true that we have much in common with people of the past, basic perceptions and worldviews do change over time, sometimes drastically, and it is misleading to examine our predecessors from a presentist perspective . Munzinger also concludes we should not assume that there was one simple path through history to get us to this point . Gebser's work does trace the history of consciousness in a seemingly progressive route to the latest advances in perspective . Yet, gebser and other similarly minded theorists like wilber, combs, and taylor are not suggesting that the latest developments in consciousness were inevitable and that history's purpose was to get us to this point . Nonetheless, there is an advance in consciousness being studied in all of their theories; and thus, to understand the philosophy of chiropractic from this perspective, we need to set aside judgment of this approach in the spirit of open - minded scholarship and pluralism . Gebser's 5 structures of consciousness, archaic, magic, mythic, mental, and integral, are a useful way for us to explore the evolution of worldviews over time . This is especially important because of gebser's emphasis on what he called the integral aperspectival structure, which began around the turn of the 20th century, the time of chiropractic's emergence . According to combs, gebser's 5 levels referred to the worldviews that were implicit in the structures of consciousness . These were complete experiential ways of understanding and relating to the world, as well as ways of perceiving and knowing . These 5 worldviews overlapped . In each epoch, one structure became dominant enough for most adults in a culture to achieve it . In any one culture, there could be many people at various worldviews; but the dominant one left its mark on art, literature, science, and history . There are virtually no extant data to corroborate the archaic structure or the way our ancient human ancestors viewed the world . Hallmarks of this structure are early cave paintings, shamans, cyclical time, as well as the interchangeability of space and time, and the one - dimensional point . This ancient magic structure is still with us today in positive forms in the deep resonances we feel when in love and the dreaminess we feel from music . Negative forms are evident in mass movements such as nazi germany or other lessened forms such as repression and projection . Mickunas, one of gebser's translators, relates the magic structure to the vital region of humans including vitality of consciousness and the miraculous in healing by prayer . The mythic structure began around 10 000 years ago with the neolithic humans, the late stone age with overlap into the next mental structure . The mythic gave rise to gods and goddesses, and mythic imagination; space was viewed as 2-dimensional, and time was not yet linear as we understand it today . Gebser referred to time in the mythic as temporicity such as long ago and far away . It is the differing conceptions of space and time that help to define each structure of consciousness . The mental structure began in the premodern era before the ancient greeks and has dominated the 20th century in much of the world . Feuerstein suggests that the transition from mythic to mental lasted from 10 000 to 500 bce . Based on his analysis of wilber's writings, reynolds depicts 3 phases of the mental era: early (2500 - 500 bce), middle (500 bce-1500 ce), and late (1500-present). In the next articles, we will explore the middle and late eras in detail in terms of philosophy and the emergence of the modern self - identity . Understanding the difference between the premodern and modern sense of self will help us to draw distinctions around dd palmer's concepts of innate and universal intelligence from similar concepts in history and also help us to situate chiropractic in a postmodern or postconventional worldview, what gebser referred to as integral aperspectival . The hallmark of the mental structure is the use of rationality and also the development of perspective . Perspectival consciousness developed as a worldview during the renaissance in the architecture of brunelleschi and the art of da vinci . It was a new way of viewing the world, one that situated the viewer in the point of view of the artist . Before this for the first time, 3 dimensions are captured in art . By looking at the art, the magic and mythic structures were marked by 2-dimensional and preperspectival consciousness, such as cave paintings, where the images were dreamy; egyptian paintings, with 2-dimensional beings; or medieval tapestries, where the figures were floating with no ground or perspective . In those examples, there is an unreal quality and no third dimension is captured . Just by looking at perspectival art, like the mona lisa, a mutation of consciousness spread; and the world was never the same . Once an individual grasps the world in a new and more authentic way, such as from a 2-dimensional perspective to a 3-dimensional perspective, his or her worldview is forever changed . It is well documented that young children cannot take another person's point of view . As they grow and develop, they can begin to put themselves in another's shoes . Once this ability develops, an individual does not regress except perhaps in cases of brain injury . Individuals can still retain remnants of that previous level of egocentric perspective such as narcissism, but they now have the ability at least to see the world from another's perspective . In the past, these mutations of consciousness that gebser points out are the moments in history when these new worldviews emerged . Today, we take them for granted as the course of normal development . This new perspective or combs notes how the big change occurred when people began to take their own point of view with them into daily life . It not only brings one's point of view to the world, but tends to divide up, split up, and cause arguments over small matters . After viewing all the buildings, libraries, dorms, etc, he asked, where is the university? The original definition of innate intelligence did something similar; it used the same term to describe the eternal spirit and the director of biological organization . For example, dd palmer wrote: that which i named innate (born with) is a segment of that intelligence which fills the universe . This universal, all wise, is metamerized, divided into metameres as needed by each individualized being . This somatome of the whole, never sleeps nor tires, recognizes neither darkness nor distance, and is not subject to material laws or conditions . It continues to care for and direct the functions of the body as long as the soul holds body and spirit together.innate's existence and consciousness are not dependent upon its body, no more than we on the house we live in . It is invulnerable, is not subject to traumatic or toxic injuries, is not subordinate to material substance . That which i named innate (born with) is a segment of that intelligence which fills the universe . This universal, all wise, is metamerized, divided into metameres as needed by each individualized being . This somatome of the whole, never sleeps nor tires, recognizes neither darkness nor distance, and is not subject to material laws or conditions . It continues to care for and direct the functions of the body as long as the soul holds body and spirit together . Innate's existence and consciousness are not dependent upon its body, no more than we on the house we live in . It is invulnerable, is not subject to traumatic or toxic injuries, is not subordinate to material substance . Biological functions are one category . In modern times, biology as a discipline has its roots in the mental structure of consciousness . The soul, which holds the body and spirit together, comes from the mythic structure of consciousness . The invulnerable and invincible spirit is the spiritual category and has its roots in the premodern magic and mythic structures . Palmer thus combined 3 levels: body, soul, and spirit or mental, mythic, and magic . The category error can be corrected by viewing these levels as emerging from different structures of consciousness and palmer's attempt to unite them as a new and emergent structure . Nowhere is the need for such a correction more evident than with the critiques of ii, which are based on ii's premodern roots . For example, donahue writes, the whole concept of innate of course rests on accepting on faith the basic premises without hope of any concrete proof . Concrete proof comes from a modern worldview . If accepting ii on faith was the only claim to its validity, it would represent a premodern concept and donahue would be correct . Incorporated into the definition of ii is an empirical approach from the mental structure of consciousness, the modern worldview . Dd palmer may not have been trained in the scientific method; but he did distinguish faith, belief, and knowledge in regards to science . Palmer wrote: science is accepted, accumulated knowledge, systematized and formulated with reference to the existence of general facts the operation of general laws concerning one subject . Chiropractic is the name of a classified, indexed knowledge of successive sense impressions of biology the science of life which science i created out of principles which have existed as long as the vertebrate.science is the knowledge of knowing . Scientific religion embraces a systematic knowledge of facts which can be verified by conscious cerebration . Faith is an inward acceptance of some personal act; we believe thon is trustworthy, therefore, we have faith . Faith is a union of belief and trust . Belief is an intellectual process, the acceptance of some thing as true on other grounds than personal observation and experience . Science is accepted, accumulated knowledge, systematized and formulated with reference to the existence of general facts the operation of general laws concerning one subject . Chiropractic is the name of a classified, indexed knowledge of successive sense impressions of biology the science of life which science i created out of principles which have existed as long as the vertebrate . Scientific religion embraces a systematic knowledge of facts which can be verified by conscious cerebration . Faith is an inward acceptance of some personal act; we believe thon is trustworthy, therefore, we have faith . Faith is a union of belief and trust . Belief is an intellectual process, the acceptance of some thing as true on other grounds than personal observation and experience . Conscious cerebration, in regards to scientific religion is an example of combining the premodern reliance on internal experience with the modern requirement of establishing repeatable and verifiable facts, or using gebser's structures as our scaffolding, we can begin to explore the history of the self and its ideas through time . This will allow us to separate these categories or levels and distinguish appropriate language for each, whether we are comparing premodern to postmodern, preconventional to postconventional, or just body to mind to soul to spirit . Examining how self - identity developed throughout the mental structure can be viewed through arguments from charles taylor's sources of the self . His goal was to better understand the modern self - identity and its sources of morality . Taylor's examination of the history of philosophy in search of how and where the modern self emerged can help us understand how dd palmer's sense of self, for instance, was distinct from that of previous philosophers from socrates to augustine and descartes to kant . Taylor's insights have been applied to the philosophy of chiropractic in 2 instances: the first was by smith, who applied these ideas to the development of psychosomatic medicine from the history of ideas; and the second was a precursor to this article by the author . It is one thing to acknowledge that the people of the past held different worldviews; it is quite another to determine just how they were different . Using taylor's approach to the development of the self gives us yet another way to understand how dd palmer's worldview was very different from the premodern or the modern worldview . This is because we can now understand more precisely not just the worldview but the self within that worldview . As taylor has shown, one of the most comprehensive ways to do so is to study the development of ideas through the history of western thought . According to taylor,; that is, knowledge was not in the individual or subject; it was located in outside reality . In the pre - socratics such as thales (625 - 546 bce), anaximander (610 - 546 bce), and anaxemenes (546 - 578 bce), we find the earliest attempts to locate the individual in regards to a universal order . In pythagoras (572 - 497 bce), we find an emphasis on the structure of a thing to define its causes of behavior . These attempts provide us with the earliest roots of ii and ui, the search for the individual in the cosmos and for the sources of the structure and form of things . It is in the philosophies of socrates, plato, and aristotle that we can see the most explicit premodern roots to chiropractic's philosophy . In the teachings of socrates, teacher of plato, we find the first turning within to point reason to the soul instead of just the universe . We can see dd palmer's debt to plato in the ascent of the philosopher to know the ideal forms as described in the republic . The ideal forms existed in a timeless plane and represented the perfected form of each thing in the world . To say that innate intelligence is an aspect of universal intelligence is rooted in this idea . In plato's timaeus, however, comes the idea that the many emanate from the one, the good . The good can be viewed as the ultimate source of all the ideal forms . In terms of palmer's approach, we can now locate individual innates, as many coming from the one universal, an even deeper debt to plato . And yet, we might say that palmer's view of innate is closer to aristotle, who expanded upon plato's theory of forms . Aristotle brought the ideal forms down into the world as things striving to express their ideal . Palmer's concept that the eternal innate can be expressed in the form of the body's functions can be traced to this idea . According to wilber, the tone for western philosophy was set by this dialectic tension between the ascent to the one and the descent from the one to the many . Building upon alfred north whitehead's famous observation that all of western philosophy is footnotes to plato, wilber points out that the footnotes are fractured because most philosophers have chosen one or the other path and there is no real way to integrate the two . Wilber writes: for, as we will see, while plato emphasized both movements, western civilization has been a battle royale between these two movements, between those who wanted only to live in this world of manyness and those who wanted to live only in the other world of transcendent oneness both of them equally and catastrophically forgetting the unifying heart, the unspoken word, that integrates both ascent and descent and finds spirit both transcending the many and embracing the many . For, as we will see, while plato emphasized both movements, western civilization has been a battle royale between these two movements, between those who wanted only to live in this world of manyness and those who wanted to live only in the other world of transcendent oneness both of them equally and catastrophically forgetting the unifying heart, the unspoken word, that integrates both ascent and descent and finds spirit both transcending the many and embracing the many . The split in philosophy between spirit and matter really began with the emergence of the mental structure as exemplified in plato and the attempt to reconcile this split by aristotle . We can now see that the attempt to heal the split between mind and body that chiropractic represents goes further back in history than previously supposed with the cartesian dualism . And the first real attempt to overcome it was by plotinus, the inspiration to generations of philosophers, including the philosophic lineage of dd palmer . For plotinus (204/5 - 270), the one overflowed with the good to create the many . The many is another term for the separateness between things or forms in the world . All individuals are parts of the many and the one . In the introduction to his translation of plotinus, elmer o'brien writes, the one, therefore, transcendent to all differentiation and form, is the source of all . Through meditation and philosophical contemplation of the one, the individual might unify with it . This movement toward integration with the one may also be found in the works of both dd palmer and bj palmer . For plotinus, the ascent went from matter to life to mind to soul and then to the one . For both dd palmer and bj palmer, there was a similar hierarchy from matter to life to educated intelligence (ei), to innate intelligence, and to universal intelligence . His hierarchy emphasized the descent and went from ui to ii to intelligent life (soul), which was the link to matter . Innate created living functions and thought (ei). For him, the progression and perfection of ii (the ascent) extended to life and beyond . Bj palmer took his father's philosophical insights even further and described a psychospiritual awakening process similar to plotinus' philosophical contemplation . In his midlife, bj palmer described the descent from the one to the many . He wrote: my innate intelligence is not god, but for want of better i shall refer to it as an emanation . This supply of superior force is being supplied constantly, but it is not innate in me until it passes thru transitions . What remains passes onward, thru the mind.each step brings it nearer to a physical, utilizable level . Having passed thru the two ethereal processes, let us now make of it a practical substance by proceeding thru the brain, converting it to a reality mental impulse physical power life . My innate intelligence is not god, but for want of better i shall refer to it as an emanation . This supply of superior force is being supplied constantly, but it is not innate in me until it passes thru transitions . Each step brings it nearer to a physical, utilizable level . Having passed thru the two ethereal processes, let us now make of it a practical substance by proceeding thru the brain, converting it to a reality mental impulse physical power life . In his later life, after more than 60 years of developing chiropractic, its philosophy, and his own self, bj palmer wrote of the ascent to universal or the infinite . The process of ascent started through the healthy function of biological expression of the intelligence (as a result of the chiropractic adjustment) and was then evolved further by the ei's acceptance of ii as a wiser intelligence, which could ultimately result in a total sublimation to ui in the form of infinite awareness . Bj palmer wrote: should that time come when his finite mind could and did know the infinite mind within, then his external finite mind would cease to be, because it would then be infinite in scope, understanding, and application . Should that time come when his finite mind could and did know the infinite mind within, then his external finite mind would cease to be, because it would then be infinite in scope, understanding, and application . Again, we can find the roots to these ideas here but not their essence because the ontic self of plotinus was far from the perspectival (modern) and aperspectival (postmodern) selves of the palmers . According to taylor, st augustine (354 - 430 ce) makes the next major discovery in terms of the relationship between the subjective self and the universal other . Augustine inverts plotinus' ascent to the one or ascent to plato's ideal forms and ascends by going within . Augustine began what taylor called radical reflexivity, the development of first - person perspective and the first search for god within ., this represented an arrested ascent that would freeze european thought for 1000 years . The problem for wilber was that augustine did not believe he could ever fully merge with god within . They could not go fully within nor could they fully explore the outer world, as goodness was now to be found on the interior, where god was, and not in the exterior, where sin was . The the source of the good was now found within, and the look without was halted . According to wilber, the west would wait until boehme and then bruno to find the goodness outside in nature, enough so that exploring nature would be akin to exploring god's goodness . Future philosophers of western culture, would have to overcome this arrested ascent to establish a fully modern sense of self, dd palmer included . The very notion of ii as an individualized portion of ui, as the expression of living form and thus of nature, is dependent on overcoming this medieval approach to i. without the ability to overcome this block, the philosophy of ii would indeed be a throwback to a magic / mythic worldview as critics such as donahue and keating have suggested . It is a philosophy that grew out of this tradition and drew from the developments that came after augustine . There were several notable vitalistic philosophers and physicians before the western enlightenment whose systems could also be viewed as roots of dd palmer's ii, ui, and conception of chiropractic . We can view the prerational argument in terms of gebser's idea of regression, whereas vitalism is viewed as a return to magical thinking and also in terms of wilber's concept of the pre / trans fallacy . Confusing the prerational with the postrational or what gebser calls arational is a common error . By acknowledging a difference between dd palmer's prerational and postrational ideas, a gigantic leap forward wilber's pre / trans fallacy can also be applied to bj palmer's concept that enlightenment (postrational) can be achieved through the body's expression of intelligence (prerational). Structuralism as it is applied to individuals and cultures is the key to making these distinctions between pre and post . Paracelsus (1493 - 1541) sought to create harmony between man and nature, and microcosm and macrocosm by using herbs, plants, and minerals to assist the body's natural powers to heal . His follower, von helmont (1577 - 1644), created a hierarchy with the soul directing the main archeus, which then directed the archeus of each organ . Boehme (1575 - 1624) had a similar notion to paracelsus' archeus, which he called primus . Boehme mixed the magical views of paracelsus with mystical views of meister eckart and plotinus, combined with augustine's interior . Boehme described the world's flourishing, the life giving sap, as god's expression through the world and through the divine spark of life . This paved the way for modern science and an embrace of the world as good rather than sinful . Boehme also had a great influence on swedenborg, schelling, as well as several early spiritual communities in america . We can view dd palmer as part of this lineage but even more so than chiropractic historians have allowed, as this type of analysis includes not just the similarity of ideas that were precursor to his, such as primus, archeus, and their closeness to ii, but the worldview and self that were bequeathed through such ideas . The conception of nature by these vitalistic philosophers was not yet modern and so not really representative of palmer, his worldview, or his self . With the life of giordano bruno (1548 - 1600), we can see the beginning of the modern world . Bruno was a true martyr to the modern self because he was burned at the stake by the inquisition because of his beliefs . He reasoned that if the universe overflowed with the good of god and if earth revolved around the sun (as his contemporary copernicus espoused), then stars were filled with planets teaming with life as an expression of god's goodness . As noted above, more than 400 years later, bj palmer would refer to universal intelligence as the the life principle; and dd palmer would write of chiropractic principles, they originate in divinity, the universal intelligence, and constitute the essential qualities of life . The notion of a cosmos made of divine life did more than just decenter the earth from the center of the cosmos; bruno decentered man, especially with respect to the biblical accounts of man's special place in god's universe . For this, wilber refers to the true birth of the modern age as the brunonian revolution rather than the copernican revolution . It was that step into the modern world that would set the tone for all future western philosophy, including the philosophy of chiropractic . Chiropractic's most basic concepts of ii and ui have their roots in premodern worldviews . Such structures are represented by magic, mythic, and early mental - rational structures of consciousness . These structures are characterized by an evolution of the sense of self from the greek's ontic logos to the augustinian radical reflexivity and the invention of the i to the embrace of nature as an emanation of the one and god's goodness, the divine life of the cosmos . The development of these worldviews is also characterized by the development of perspective through time . The advent of the modern worldview coincided not only with the development of a unique sense of self but also with the 3-dimensional perspective as characterized by the renaissance art, spatial awareness, and individualized consciousness . All of these developments can be explained as precursors to the concepts of ii and ui; and thus, these concepts are not equivalent to premodern ideas . None of the premodern ideas can truly be equated with dd palmer, bj palmer, or the philosophy of chiropractic because they grew from worldviews so foreign to the way dd palmer viewed the world . The greeks, st augustine, the vitalists, and even bruno considered life from a different perspective from either of the palmers . Thus, roots to the ideas that are central to chiropractic can be found in premodern philosophy, the premodern worldview, and the self associated with those eras; but that was only the beginning . ; that is, knowledge was not in the individual or subject; it was located in outside reality . In the pre - socratics such as thales (625 - 546 bce), anaximander (610 - 546 bce), and anaxemenes (546 - 578 bce), we find the earliest attempts to locate the individual in regards to a universal order . In pythagoras (572 - 497 bce), we find an emphasis on the structure of a thing to define its causes of behavior . These attempts provide us with the earliest roots of ii and ui, the search for the individual in the cosmos and for the sources of the structure and form of things . It is in the philosophies of socrates, plato, and aristotle that we can see the most explicit premodern roots to chiropractic's philosophy . In the teachings of socrates, teacher of plato, we find the first turning within to point reason to the soul instead of just the universe . We can see dd palmer's debt to plato in the ascent of the philosopher to know the ideal forms as described in the republic . The ideal forms existed in a timeless plane and represented the perfected form of each thing in the world . To say that innate intelligence is an aspect of universal intelligence is rooted in this idea . In plato's timaeus, however, comes the idea that the many emanate from the one, the good . The good can be viewed as the ultimate source of all the ideal forms . In terms of palmer's approach, we can now locate individual innates, as many coming from the one universal, an even deeper debt to plato . And yet, we might say that palmer's view of innate is closer to aristotle, who expanded upon plato's theory of forms . Aristotle brought the ideal forms down into the world as things striving to express their ideal . Palmer's concept that the eternal innate can be expressed in the form of the body's functions can be traced to this idea . According to wilber, the tone for western philosophy was set by this dialectic tension between the ascent to the one and the descent from the one to the many . Building upon alfred north whitehead's famous observation that all of western philosophy is footnotes to plato, wilber points out that the footnotes are fractured because most philosophers have chosen one or the other path and there is no real way to integrate the two . Wilber writes: for, as we will see, while plato emphasized both movements, western civilization has been a battle royale between these two movements, between those who wanted only to live in this world of manyness and those who wanted to live only in the other world of transcendent oneness both of them equally and catastrophically forgetting the unifying heart, the unspoken word, that integrates both ascent and descent and finds spirit both transcending the many and embracing the many . For, as we will see, while plato emphasized both movements, western civilization has been a battle royale between these two movements, between those who wanted only to live in this world of manyness and those who wanted to live only in the other world of transcendent oneness both of them equally and catastrophically forgetting the unifying heart, the unspoken word, that integrates both ascent and descent and finds spirit both transcending the many and embracing the many . The split in philosophy between spirit and matter really began with the emergence of the mental structure as exemplified in plato and the attempt to reconcile this split by aristotle . We can now see that the attempt to heal the split between mind and body that chiropractic represents goes further back in history than previously supposed with the cartesian dualism . And the first real attempt to overcome it was by plotinus, the inspiration to generations of philosophers, including the philosophic lineage of dd palmer . For plotinus (204/5 - 270) the many is another term for the separateness between things or forms in the world . All individuals are parts of the many and the one . In the introduction to his translation of plotinus, elmer o'brien writes, the one, therefore, transcendent to all differentiation and form, is the source of all . Through meditation and philosophical contemplation of the one, the individual might unify with it . This movement toward integration with the one may also be found in the works of both dd palmer and bj palmer . For plotinus, the ascent went from matter to life to mind to soul and then to the one . For both dd palmer and bj palmer, there was a similar hierarchy from matter to life to educated intelligence (ei), to innate intelligence, and to universal intelligence . His hierarchy emphasized the descent and went from ui to ii to intelligent life (soul), which was the link to matter . Innate created living functions and thought (ei). For him, the progression and perfection of ii (the ascent) extended to life and beyond . Bj palmer took his father's philosophical insights even further and described a psychospiritual awakening process similar to plotinus' philosophical contemplation . In his midlife, bj palmer described the descent from the one to the many . He wrote: my innate intelligence is not god, but for want of better i shall refer to it as an emanation . This supply of superior force is being supplied constantly, but it is not innate in me until it passes thru transitions . What remains passes onward, thru the mind.each step brings it nearer to a physical, utilizable level . Having passed thru the two ethereal processes, let us now make of it a practical substance by proceeding thru the brain, converting it to a reality mental impulse physical power my innate intelligence is not god, but for want of better i shall refer to it as an emanation . This supply of superior force is being supplied constantly, but it is not innate in me until it passes thru transitions . Having passed thru the two ethereal processes, let us now make of it a practical substance by proceeding thru the brain, converting it to a reality mental impulse physical power life . In his later life, after more than 60 years of developing chiropractic, its philosophy, and his own self, bj palmer wrote of the ascent to universal or the infinite . The process of ascent started through the healthy function of biological expression of the intelligence (as a result of the chiropractic adjustment) and was then evolved further by the ei's acceptance of ii as a wiser intelligence, which could ultimately result in a total sublimation to ui in the form of infinite awareness . Bj palmer wrote: should that time come when his finite mind could and did know the infinite mind within, then his external finite mind would cease to be, because it would then be infinite in scope, understanding, and application . Should that time come when his finite mind could and did know the infinite mind within, then his external finite mind would cease to be, because it would then be infinite in scope, understanding, and application . Again, we can find the roots to these ideas here but not their essence because the ontic self of plotinus was far from the perspectival (modern) and aperspectival (postmodern) selves of the palmers . According to taylor, st augustine (354 - 430 ce) makes the next major discovery in terms of the relationship between the subjective self and the universal other . Augustine inverts plotinus' ascent to the one or ascent to plato's ideal forms and ascends by going within . Augustine began what taylor called radical reflexivity, the development of first - person perspective and the first search for god within ., this represented an arrested ascent that would freeze european thought for 1000 years . The problem for wilber was that augustine did not believe he could ever fully merge with god within . They could not go fully within nor could they fully explore the outer world, as goodness was now to be found on the interior, where god was, and not in the exterior, where sin was . The source of the good was now found within, and the look without was halted . According to wilber, the west would wait until boehme and then bruno to find the goodness outside in nature, enough so that exploring nature would be akin to exploring god's goodness . Future philosophers of western culture, would have to overcome this arrested ascent to establish a fully modern sense of self, dd palmer included . The very notion of ii as an individualized portion of ui, as the expression of living form and thus of nature, is dependent on overcoming this medieval approach to i. without the ability to overcome this block, the philosophy of ii would indeed be a throwback to a magic / mythic worldview as critics such as donahue and keating have suggested . It is a philosophy that grew out of this tradition and drew from the developments that came after augustine . There were several notable vitalistic philosophers and physicians before the western enlightenment whose systems could also be viewed as roots of dd palmer's ii, ui, and conception of chiropractic . We can view the prerational argument in terms of gebser's idea of regression, whereas vitalism is viewed as a return to magical thinking and also in terms of wilber's concept of the pre / trans fallacy . Confusing the prerational with the postrational or what gebser calls arational is a common error . By acknowledging a difference between dd palmer's prerational and postrational ideas, a gigantic leap forward wilber's pre / trans fallacy can also be applied to bj palmer's concept that enlightenment (postrational) can be achieved through the body's expression of intelligence (prerational). Structuralism as it is applied to individuals and cultures is the key to making these distinctions between pre and post . Paracelsus (1493 - 1541) sought to create harmony between man and nature, and microcosm and macrocosm by using herbs, plants, and minerals to assist the body's natural powers to heal . His follower, von helmont (1577 - 1644), created a hierarchy with the soul directing the main archeus, which then directed the archeus of each organ . Boehme (1575 - 1624) had a similar notion to paracelsus' archeus, which he called primus . Boehme mixed the magical views of paracelsus with mystical views of meister eckart and plotinus, combined with augustine's interior . Boehme described the world's flourishing, the life giving sap, as god's expression through the world and through the divine spark of life . This paved the way for modern science and an embrace of the world as good rather than sinful . Boehme also had a great influence on swedenborg, schelling, as well as several early spiritual communities in america . We can view dd palmer as part of this lineage but even more so than chiropractic historians have allowed, as this type of analysis includes not just the similarity of ideas that were precursor to his, such as primus, archeus, and their closeness to ii, but the worldview and self that were bequeathed through such ideas . The conception of nature by these vitalistic philosophers was not yet modern and so not really representative of palmer, his worldview, or his self . With the life of giordano bruno (1548 - 1600), we can see the beginning of the modern world . Bruno was a true martyr to the modern self because he was burned at the stake by the inquisition because of his beliefs . He reasoned that if the universe overflowed with the good of god and if earth revolved around the sun (as his contemporary copernicus espoused), then stars were filled with planets teaming with life as an expression of god's goodness . As noted above, more than 400 years later, bj palmer would refer to universal intelligence as the the life principle; and dd palmer would write of chiropractic principles, they originate in divinity, the universal intelligence, and constitute the essential qualities of life . The notion of a cosmos made of divine life did more than just decenter the earth from the center of the cosmos; bruno decentered man, especially with respect to the biblical accounts of man's special place in god's universe . For this, wilber refers to the true birth of the modern age as the brunonian revolution rather than the copernican revolution . It was that step into the modern world that would set the tone for all future western philosophy, including the philosophy of chiropractic . Chiropractic's most basic concepts of ii and ui have their roots in premodern worldviews . Such structures are represented by magic, mythic, and early mental - rational structures of consciousness . These structures are characterized by an evolution of the sense of self from the greek's ontic logos to the augustinian radical reflexivity and the invention of the i to the embrace of nature as an emanation of the one and god's goodness, the divine life of the cosmos . The development of these worldviews is also characterized by the development of perspective through time . The advent of the modern worldview coincided not only with the development of a unique sense of self but also with the 3-dimensional perspective as characterized by the renaissance art, spatial awareness, and individualized consciousness . All of these developments can be explained as precursors to the concepts of ii and ui; and thus, these concepts are not equivalent to premodern ideas . None of the premodern ideas can truly be equated with dd palmer, bj palmer, or the philosophy of chiropractic because they grew from worldviews so foreign to the way dd palmer viewed the world . The greeks, st augustine, the vitalists, and even bruno considered life from a different perspective from either of the palmers . Thus, roots to the ideas that are central to chiropractic can be found in premodern philosophy, the premodern worldview, and the self associated with those eras; but that was only the beginning . By understanding how the elements of chiropractic's philosophical theories come from premodern worldviews, magic, mythic, and early - mental structures of consciousness, and the history of the self, we can more accurately contextualize and develop a philosophy of chiropractic . Much of the criticism of the philosophy of chiropractic has been aimed at the premodern roots to the philosophy . An adequate context using ethnomethodology to understand the development of cultural worldviews and hermeneutics to interpret the meaning individuals gave to their ideas over time opens up the interpretations of chiropractic's ideas in a new way . Dd palmer, the founder of the chiropractic, was a modern individual at the turn of the 20th century, fully steeped in the metaphysical religious culture of his time and the current state of scientific knowledge of his time . As an individual, he embodied a worldview and a sense of self that could never be equated to the worldviews or selves of philosophers of premodern times . For this reason, it is very important when developing a philosophy of chiropractic to acknowledge the importance that philosophers of the past and worldviews of the past may have played in planting chiropractic's roots; but that is all they will ever be . Roots of the ideas and roots of the self are not the ideas or the self, no matter how similar they may sound to modern and postmodern ears or interpreted through today's worldviews . Thus, chiropractic can be more fully understood as a unique attempt in a particular time, place, and culture to come to grips with all that has come before, which included an attempt to honor certain premodern truths from a modern worldview, which may imply a new and emergent worldview, one that bridges the gap between modern and premodern; for now, let us call it postmodern . Simon senzon has received from the global gateway foundation a writing grant to further the objectives of the foundation.
Cystinuria is an autosomal recessive disorder characterized by the abnormal urinary excretion of cysteine and the dibasic amino acids in the renal tubule and epithelial cells of small intestine . Two genes including slc3a1 and slc7a9 are associated with cystinuria and two different types of cystinuria have been known according to genetic defects . Type i of cystinuria is caused by mutations in slc3a1, an amino acid transporter gene located on chromosome 2 (2p16.3 - 21), and consists of 10 exons ranging in span from 120 to 461 bp which encodes the b transporter - related protein (rbat). This protein creates the heavy chain of the renal cystine transport system (rbat / b at). Due to its biological functions, mutations in slc3a1/rbat mutations in b at cause loss of function of the transporter system b by defect in folding and trafficking . In addition, digenic inheritance (type ab) has been described . In previous studies, these mutations consist of nonsense, missense, splicing, frame shifts, and large sequence rearrangements . An overview on the most frequent cystinuria mutations in slc3a1 gene in different ethnic groups shows that the selected exons are very important . Considering a few studies on the genetic basis of the cystinuria in the middle east and the population - specific distribution of mutations in the slc3a1, we tried to find genetic variants in three exons (1, 3, and 8) of slc3a1 . Twenty - five cystinuria unrelated patients were referred from al - zahra hospital, isfahan university of medical sciences, by a urologist (11 women and 14 men). These patients were selected according to the type of cystine stones in the patients who had been subjected to operation for removing kidney stones . The ethics committee of the medical university of isfahan approved this study according to the national helsinki guidelines (declaration of helsinki) (research project number: 294207). Dna of the samples was extracted according to the standard protocol of kit (bio genet kit, korea). Polymerase chain reaction was used to amplify three pairs of slc3a1 gene primers (exons 1, 3, and 8) in chromosome 2 (2p16.3 - 21) [table 1]. Primers were designed using primer blast program (htpp://www.ncbi.nlm.nih.gov / tools / primer - blast) according to the genomic sequence references available at the genome browser (gene i d: 6519, updated on december 6, 2016). Finally, all samples were sequenced using sanger sequencing method (macro gene co. korea). According to direct sequencing of exons 1, 3, and 8 of slc3a1 gene, we found five patients (c4, c6, c10, c21, c23, and c25) who were heterozygote for the polymorphism g38 g in exon 1 [figure 1a]. (c. 114a> c) makes a synonymous variant of gga (glycine). The amino acid variant m467k detected in exon 8 in one patient (c18). M467k is a missense mutation that changes methionine (atg) to lysine (aag) at position 179 t / a . Two intronic variants in intron three including c. 610 + 147c> t and c. 610 + 169c> g were also identified in one patient (c20) [figure 1c and d]. (a) c. 610 + 147c> t, (b) c. 610 + 169c> g, (c) m467k, (d) g38 g this novel variant is located in exon 1 before initiation codon in 5 untranslated region (5utr) that changes g to a (c.-29a> g). Mutations in the 5utr cause increase or decrease of translation efficiency that recently described as a novel molecular mechanism of disease . Changes in the consensus sequence for the translation initiation may intensify context - dependent leaky scanning of ribosomes and/or initiation from a downstream aug codon . One previously identified polymorphism in codon 38 (114c - a) was also identified . G38 g is synonymous variant (gga change to ggc) because no amino acid change occurs . It only changes one codon of amino acid glycine (gga) to another codon of glycine (ggc) at position 114 of exon 1 (c. 114a> c). In addition, the frequency of ggc codon in african, american, east asian, european, and south asian populations is 80%, 67%, 38%, 77%, and 86%, respectively . In our study, two known mutations (c. 610 + 147c> t, c. 610 + 169c> g) were found in intronic regions of the slc3a1 gene (intron 3) [table 2]. Prevalence of c. 610 + 147c> t intronic mutation is 3%, 1%, 2%, and 1% in african, american, south asian, and european people, respectively . Intronic mutation c. 610 + 169c> g was found in 3%, 1%, 1% 2% of african, american, european, and south asian people, respectively (http://www.ensemble.org). All patients in our study had percutaneous nephrolithotomy . In our research, we found that1of the 25 (4%) patients had m467k mutation in exon 8 . In addition, six of patients (24%) showed g38 g polymorphism in exon 1 and 7 out of 25 (28%) had a new mutation in 5utr (c.-29a> g) in the slc3a1 gene . Both intronic mutations (c. 610 + 147c> t, c. 610 + 169c> g) found in 1 out of 25 patients . In conclusion, our results confirm that cystinuria is a heterogeneous disorder at the molecular level . This study contributes to the understanding of the distribution and frequency of mutations causing cystinuria in the iranian population . Sm contributed in the acquisition, analysis of data for the work and drafting the work, and agreed for all aspects of the work . Mk contributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work . Ad contributed in the conception of the work, approval of the final version of the manuscript, and agreed for all aspects of the work . Mm contributed in the clinical conception of the work, approval of the final version of the manuscript, and agreed for all aspects of the work.
A sample of 296 wives was randomly selected from a database at the iranian martyrs and veterans affairs foundation there were 139 wives of prisoners of war; 60 wives of martyrs, whose husbands were killed during the war; and 97 wives of disabled veterans (according to imvaf classification, based on the severity of the veterans disability, they were placed in categories ranging from 25% to 70% and above). The cultural and economical class of the randomly selected participants varied from one another . It is generally agreed that subjective wellbeing (swb) can be measured through questions of satisfaction directed to people's feelings about themselves (29). It is based on life domain scale in which there is a domain - level representation of global life satisfaction and 7 other domains whose scores are computed as personal well - being . Each item refers to a specific life domain (aspect), and the scores of all items are averaged to produce a measure of swb . The pwi scale contains seven items of satisfaction, each one corresponding to a quality of life domain as: standard of living, health, achieving in life, relationships, safety, community - connectedness, and future security . These seven domains are theoretically embedded, as representing the first level deconstruction of the global question: how satisfied are you with your life as a whole? (29). Cronbach's alpha lies between .70 and .85 in australia and overseas (international well - being group, 2005). In this study, we computed the cronbach's alpha of the persian translation as high as 0/845 . Pwi - a in this study showed a negative correlation with family inventory of life events and changes scale (31). Furthermore, pwi - a showed a negative correlation as high as 0/498 with stress - related symptoms checklist alpha=0/0001 . Prior stressors, strains, and transitions were measured with the family inventory of life events and changes . This scale has 71 items in 9 sub - scales that assess life events in the general areas of family conflicts, marital relations, births / pregnancies, money, jobs, moves, deaths, and other; and was developed by mccubbin, patterson & wilson (31). This self - report instrument was designed to assess both the normative and non - normative family life events, transitions, and strains a family unit may have experienced during the past year . The alpha coefficient for the total scale was reported as .81, and test - retest reliability was reported as .80.the overall reliability was reported as high as 0/83(32) and its reliability for mothers has been reported to be up to 0/87, and for fathers from 0/70 to 0/83 (33). In this study, it included 41 stress - related symptoms which were adopted from the 56 ones of casanova - rosado et . (34).in this study, stress - related symptom inventory showed a positive correlation with family inventory of life events and changes scale as high as 0/19 (in 0/001 significancy level) and negative correlation (0/498) with pwi . A) a complete list of wives of martyrs, prisoners of war, and wives of disabled veterans was gathered from the iran's veterans foundation in qom (bonyad - e - shahid va omoore isargaran). A random sample was prepared from the four urban and educational districts of this city . Wives of these people were informed that the iranian veterans foundation is intending to reveal the psychological problems of the families and their consequences . The researcher of this study (the corresponding author) was also serving these families as a social psychologist for several years and was well - known to them . After providing the primary information regarding the study through telephone, the visit times were defined; and educated interviewers as well as researchers were sent to the subjects' houses . Then, the interviewers asked the subjects to complete the questioners . For those un educated or low educated subjects, completion of questionnaires b) regarding the ethical principal of the research procedures, it should be mentioned that the interviewers presented a written introduction about themselves, and no personal indicator of samples was registered in the questionnaires . The subjects were familiar with the chief researcher of the study as a clinical physiologist . C) no awards were promised for such voluntary participation of the samples and they just participated in the study based on their familiarity with the researcher and feeling of confidence regarding them . D) inclusion criteria were the type of the husband's situation and his residence site . Exclusion criteria were death (1 case), displacement or movement to another city (2 cases). Next, each participant was called by a trained graduated psychologist and upon the subject's approval; she was paid a visit at her home, where the psychologist executed the measures . Our psychologists presented every participant with an invitation letter describing the aim of the research to inspire their participation . This study is an ex - post facto research design . To compare the three groups of the participants, we used anova . Furthermore, linear multivariate regression analysis (stepwise method) was used to find out which variable could predict personal well - being . A sample of 296 wives was randomly selected from a database at the iranian martyrs and veterans affairs foundation there were 139 wives of prisoners of war; 60 wives of martyrs, whose husbands were killed during the war; and 97 wives of disabled veterans (according to imvaf classification, based on the severity of the veterans disability, they were placed in categories ranging from 25% to 70% and above). The cultural and economical class of the randomly selected participants varied from one another . It is generally agreed that subjective wellbeing (swb) can be measured through questions of satisfaction directed to people's feelings about themselves (29). It is based on life domain scale in which there is a domain - level representation of global life satisfaction and 7 other domains whose scores are computed as personal well - being . Each item refers to a specific life domain (aspect), and the scores of all items are averaged to produce a measure of swb . The pwi scale contains seven items of satisfaction, each one corresponding to a quality of life domain as: standard of living, health, achieving in life, relationships, safety, community - connectedness, and future security . These seven domains are theoretically embedded, as representing the first level deconstruction of the global question: how satisfied are you with your life as a whole? (29). Cronbach's alpha lies between .70 and .85 in australia and overseas (international well - being group, 2005). In this study, we computed the cronbach's alpha of the persian translation as high as 0/845 . Pwi - a in this study showed a negative correlation with family inventory of life events and changes scale (31). Furthermore, pwi - a showed a negative correlation as high as 0/498 with stress - related symptoms checklist alpha=0/0001 . It is generally agreed that subjective wellbeing (swb) can be measured through questions of satisfaction directed to people's feelings about themselves (29). It is based on life domain scale in which there is a domain - level representation of global life satisfaction and 7 other domains whose scores are computed as personal well - being . Each item refers to a specific life domain (aspect), and the scores of all items are averaged to produce a measure of swb . The pwi scale contains seven items of satisfaction, each one corresponding to a quality of life domain as: standard of living, health, achieving in life, relationships, safety, community - connectedness, and future security . These seven domains are theoretically embedded, as representing the first level deconstruction of the global question: how satisfied are you with your life as a whole? (29). Cronbach's alpha lies between .70 and .85 in australia and overseas (international well - being group, 2005). In this study, we computed the cronbach's alpha of the persian translation as high as 0/845 . Pwi - a in this study showed a negative correlation with family inventory of life events and changes scale (31). Furthermore, pwi - a showed a negative correlation as high as 0/498 with stress - related symptoms checklist alpha=0/0001 . Prior stressors, strains, and transitions were measured with the family inventory of life events and changes . This scale has 71 items in 9 sub - scales that assess life events in the general areas of family conflicts, marital relations, births / pregnancies, money, jobs, moves, deaths, and other; and was developed by mccubbin, patterson & wilson (31). This self - report instrument was designed to assess both the normative and non - normative family life events, transitions, and strains a family unit may have experienced during the past year . The alpha coefficient for the total scale was reported as .81, and test - retest reliability was reported as .80.the overall reliability was reported as high as 0/83(32) and its reliability for mothers has been reported to be up to 0/87, and for fathers from 0/70 to 0/83 (33). In this study, the test - retest reliability was 0/722 . It included 41 stress - related symptoms which were adopted from the 56 ones of casanova - rosado et . (34).in this study, stress - related symptom inventory showed a positive correlation with family inventory of life events and changes scale as high as 0/19 (in 0/001 significancy level) and negative correlation (0/498) with pwi . A) a complete list of wives of martyrs, prisoners of war, and wives of disabled veterans was gathered from the iran's veterans foundation in qom (bonyad - e - shahid va omoore isargaran). A random sample was prepared from the four urban and educational districts of this city . Wives of these people were informed that the iranian veterans foundation is intending to reveal the psychological problems of the families and their consequences . The researcher of this study (the corresponding author) was also serving these families as a social psychologist for several years and was well - known to them . After providing the primary information regarding the study through telephone, the visit times were defined; and educated interviewers as well as researchers were sent to the subjects' houses . Then, the interviewers asked the subjects to complete the questioners . For those un educated or low educated subjects, completion of questionnaires was performed through an oral procedure similar to the wexler test of intelligence . B) regarding the ethical principal of the research procedures, it should be mentioned that the interviewers presented a written introduction about themselves, and no personal indicator of samples was registered in the questionnaires . The subjects were familiar with the chief researcher of the study as a clinical physiologist . C) no awards were promised for such voluntary participation of the samples and they just participated in the study based on their familiarity with the researcher and feeling of confidence regarding them . D) inclusion criteria were the type of the husband's situation and his residence site . Exclusion criteria were death (1 case), displacement or movement to another city (2 cases). Next, each participant was called by a trained graduated psychologist and upon the subject's approval; she was paid a visit at her home, where the psychologist executed the measures . Our psychologists presented every participant with an invitation letter describing the aim of the research to inspire their participation . Furthermore, linear multivariate regression analysis (stepwise method) was used to find out which variable could predict personal well - being . Frequency of participant groups as we can seedemonstrated in table 2, there is no significant difference between the three groups in their overall satisfaction of life . Wives of martyrs (killed veterans), disabled veterans and prisoners of war have shown almost equal overall satisfaction of life . However, their personal well - being, family stresses and stress - related symptoms differ significantly . Independent variables includes well - being of wives of disabled veterans, in graph 1, we seeit can be seen that the wives of disabled veterans experience the lowest level of personal well - being, whereas, both . However, the wives of prisoners of war and martyrs are on the same level, which is higher in comparison to the wives of disabled veterans . The wives of prisoners of war suffer from higher levels of family stress, while the other two groups of wives experience lower levels of family stress . For stress - related symptoms, the wives of martyrs are at the highest level followed by the wives of disabled veterans in the middle, and finally the lowest level belongs to the wives of prisoners of war . By looking at the graph 1, we can see that the wives of prisoners of war experience a high level of family stress while showing the least amount of stress - related symptoms and feeling the highest personal well - being . Although the wives of killed veterans also show a high level of personal well - being, but they experience a low level of family stress and show the highest level of stress - related symptoms . Finally, the wives of disabled veterans experience a low level of family stress, but show a high level of stress - related symptoms and feel the lowest level of personal well - being . We will discuss these findings later . To assess variance predictions, we used linear multivariate regression analysis in which the total score of family stress is the dependent variable and the nine family sources of stress are the independent variables . According toas demonstrated in table 3, in all the participants, family conflicts predicted 94.6% of the total score of the family inventory of life events and changes . It seems that family conflicts are the main source of stress in the life of all the wives of veterans' wives . Now, we must see whether all the three groups have a unique main source of stress in their families . Linear multivariate regression analysis (stepwise method) to evaluate the predictors of personal well - being among the three groups of participants, a linear multivariate regression analysis (stepwise method) was executed in which discriminative events among participants entered the regression equation . . Linear multivariate regression analysis (stepwise method) in wives of prisoners of war as we can see, automatic thoughts, and chronic stress symptoms and be among the wives of disabled veterans' wives predict personal well - being scores ., we can see demonstrates that the wives of prisoners of war experience the most amount of family stresses because of economic limitations (r square= 0/962). Other sources of stress had the lowest effects in the family life events and changes had the lowest effects . Linear multivariate regression analysis (stepwise method) in wives of prisoners of war the main source of stress for the wives of killed veterans (martyrs) was legal problems (problem with law). According to table 6, legal problems of one of the family members have predicted 98.6% of variances of the family life events and changes' score . Different from the other two groups, ffamily conflicts are the main source of family stresses for the wives of disabled veterans . Comparing three groups in overall life satisfaction, personal well - being, total family stress score and chronic stress symptoms score (p values: overall satisfaction: .741; personal well - being: .035; total family stress scores: .0001; chronic stress symptoms scores: .01) linear multivariate regression analysis (stepwise method) in wives of killed veterans family conflicts have predicted 98.1% of variances of the total score of family inventory of life events and changes . . Linear multivariate regression analysis (stepwise method) in wives of disabled veterans first, we compared personal well - being, overall satisfaction of life, family stresses and stress - related symptoms, in the three groups of participants the results are displayed in table 1 . Whether it is the death instinct that drives the nations into wars, or whether there are other complicated reasons for this horrific phenomenon, it seems that wars have become a part of our lives . No matter how offensive or defensive, wars always bring humans unimaginable heartache and misery . Three decades ago, when iranians were so busy trying to get their lives together after a revolution in their country, they had to enter an eight - year war with saddam's regime in iraq . Although men are the ones fighting at the frontline, women also experience their share of war - related stresses . Some of the war - related sources of stress for women include: providing care for the disabled veterans, looking after children, managing the household, and finally putting up with their husbands ptsd . Studies suggest that wives of injured men experience more distress than mothers and that the impact of a traumatic injury upon a marriage partnership is different from the impact upon a parent - child relationship (1619). Findings from many researches suggest that the veterans wives experience more stress, show more stress - related symptoms and have a poorer quality of life; in another words, they have lower subjective well - being (22, 28, 3537). Just as whalley hammell (25) reported, the rehabilitation processes had been focused mainly on the injured person and had rarely included their wives in iran . Wives of disabled veterans only receive a monthly nursing fee and an ordinary insurance without any complementary insurance (unlike the disabled veterans). Furthermore, the wives of prisoners of war rarely receive instruction in rehabilitation skills, whereas wives of killed veterans (martyrs) can have psychological counseling services, although they don't exactly look forward to these services! In this study, all the three groups showed similar overall satisfaction of life, but different levels of personal well - being, family stresses and stress - related symptoms . First of all, it seems that they are experiencing a form of acquired hopelessness as a result of having to confront constant sources of stress for a long time without ever learning the coping skills in systematic ways, consequently losing their homeostasis . Second, due to iranian - islamic culture, they have overused positive reassessment of their difficult situation, meaning that they have focused on figuring out the hikmah for their problems, trying to find positive reasons to justify their sufferings and stresses . Third, they believe that enduring stresses is a way of defending their islamic beliefs and government and so may be good as it makes god happy . However, there are some differences among the wives . For example, although the wives of disabled veterans show more stress - related symptoms and experience the least amount of personal well - being, according to many studies, in comparison to the wives of prisoners of war, they experience the least amount of family stress . Partial social isolation of these families has decreased their general social support . Furthermore, veterans' secondary health problems have produced family conflicts in the families of disabled veterans . Anger, low sexual function, physical and other psychological problems increase the conflicts in these families . Although the wives of killed veterans have their own family conflicts, the difference is that they have gradually accepted their conditions without having to experience the hassles of taking care of a veteran with health problems . Therefore, they are usually involved in handling problems caused as a result of the absence of a father in the family . For instance, as the heads of their families, they might have to deal with legal problems . Finally, there are the wives of prisoners of war whose families seem to somehow function more naturally . Although their husbands have some problems such as ptsd symptoms, their symptoms are milder than those of disabled veterans . Their problems arise from the fact that they have some health problems after all, and also they have relatively higher expectations . It also seems that they demonstrate displaced aggression by taking their negative reactions to society out on their family members . Therefore, their wives experience more stress and enjoy less personal well - being . At the same time, semi - natural family functioning and homeostasis have helped the wives of prisoners of war to cope with sources of stress better than the wives of disabled veterans and killed veterans . Gathering the needed official data was not easy because of some limitation from the related organizations and the researcher had to obtain different legal grands for accessing such data . Financial problems were another limitation of this study as the researchers did many of the processes of the research by themselves.
The dietary magnesium intake tends to be lower than that recommended worldwide even in western countries . Several factors have been identified to be trigger for lowering magnesium intake including the waterborne magnesium factor, the loss of magnesium during food refining, and the magnesium content of vegetarian diets, as well as various metabolic situations such as hypertension, pregnancy, osteoporosis, drug therapy, alcoholism, stress, and even cardiac trauma . Magnesium is the most abundant intracellular divalent cation that is important for physiological processes including neuromuscular function and maintenance of cardiovascular tone . The importance of magnesium intake in relation to cardiovascular diseases has been increasingly described, so that its intake can be inversely related to the risk of hypertension and type 2 diabetes mellitus and may improve serum lipid profiles . Recent surveys in sweden [3, 4] have indicated that vegetarian diets provide a more adequate intake of magnesium, as illustrated in table 4 . Note that the magnesium intake of men and women on vegetarian diets was considerably greater than the rda requirement; this was attributed to the high intake of vegetables and whole - grain cereals by these individuals . Recent studies have shown that some components of the mediterranean diet such as vegetables, legumes, and nuts are rich sources of magnesium; therefore, it seems that the high adherence to the mediterranean diet is associated with high consumption of magnesium . Although the main dietary regimen of iranian population is mediterranean diet components especially the major sources of magnesium, the rate of coronary artery disease (cad) risk factors among this population has been considerably high . Therefore, in the present study, we tried to determine effect of mediterranean dietary approach on laboratory parameters related to cad risk factors with the focus on serum magnesium concentration among iranian patients with cad . Baseline characteristics and clinical data of 102 consecutive patients with the diagnosis of cad and candidates for isolated coronary artery bypass surgery were entered into the study . Studied data were collected by the review of clinical recorded files in the day of admission . In this study, cad was considered significant if there was a 75% or greater stenosis in the cross - sectional diameter and 50% or greater stenosis in the luminal view . Blood samples were drawn from the corresponding peripheral vein into vacutainer tubes after 1214 h of overnight fasting and before operation . Plasma glucose concentrations were assessed by means of a glucose hexokinase method (pars azmoon kits accredited by bioactiva diagnostica, germany). Serum total cholesterol, hdl cholesterol, and triglycerides were measured via enzymatic techniques (pars azmoon kits accredited by bioactivadiagnostica, germany). The friedewald formula was used to calculate low density lipoprotein (ldl) cholesterol, except when the triglyceride level was> blood pressure was calculated as the mean of two measurements, performed in the sitting position after 5 minutes of rest, using a random - zero sphygmomanometer (hawksley - gelman, lancing, sussex, uk). C - reactive protein (crp) level was measured by immunoturbidimetry (pars azmun, iran), and lipoprotein(a) was measured using tint eliza (biopool, usa). Creatinine was measured with jaffe reaction (parsazmon kit, tehran, iran) using an autoanalyzer (hitachi, tokyo, japan). Studied patients were also interviewed on admission to surgical ward and before operation to report the consumption of food items listed as the number of times per day, per month, or per year during the previous year . We assessed nutritional status by a validated food frequency questionnaire (ffq), previously validated in iran and a 24-hour dietary recall questionnaire to record the types, amounts, and frequencies of foods consumed . Sum of the consumption of each of several food items was used to determine the overall consumption of the food group to which each item belonged [9, 10]. The diet score was calculated on the basis of mediterranean diet quality index (med - dqi) that the construction of the score for this index (table 1). The index assigns a score of 0, 1, or 2 according to the daily intake of each of the seven components and then final score was reported as a summation of all nutrient scores ranged between 0 and 14 . We divided studied patients into two groups according to the final score: the groups with final score lower than 5 (n = 35) and those who had final score between 5 and 10 (n = 67). We compared categorized variables between the two above groups using chi - square test or fisher's exact test if required . Multivariate linear regression analysis was used to investigate the potential confounding effects of patients' characteristics and clinical data on the association between serum magnesium concentration and mediterranean regimen score . All the statistical analyses were performed using spss version 13.0 (spss inc ., chicago, il, usa). Studied patients had the mean age of 58.8 year (ranged between 38 and 78 years) and 40.2% of them were male . Hyperlipidemia and hypertension were observed in 75.5% and 56.9% of patients, respectively, and 51.0% of them were diabetics . Half of the studied patients had moderate functional class, but three coronary arteries were involved in the majority of them (table 2). Comparison of the concentrations of serum laboratory parameters between the two groups with lower mediterranean dietary score and group with higher dietary score showed no significant differences between the concentration of albumin, last fasting blood sugar, last creatinine, and lipid profiles (table 3); however, serum magnesium concentration in the group with dietary score between 5 and 10 was lower than that in group with higher score (p = 0.026). Linear multivariate regression analysis also showed that the lower mediterranean dietary score was a predictor for serum magnesium concentration after adjusting for confounders (table 4). Recent studies could confirm the cardioprotective role of intravenous magnesium for prevention of cardiac arrhythmia, pump dysfunction, and death in patients with cad, especially in the immediate postinfarction period [12, 13]. Magnesium can inhibit the influx of calcium in vascular smooth muscle cells and therefore inhibit arrhythmic recurrence and the production of il-6 and mmp-1 after reperfusion and prevent the increase of myocardial lesions caused by calcium overload on myocytes . However, effect of dietary intake of this mineral on control and inhibition of cad risk factors has been questioned . Some researchers have been hypnotized that the low intake of magnesium may be related to the least degree of cardiovascular disease [15, 16]. Some others could show that the dietary magnesium intake can be inversely associated with fasting serum insulin, plasma high density lipoprotein - cholesterol, and systolic and diastolic blood pressure . In the present study, we showed the potential effect of mediterranean dietary regimen on increasing of serum magnesium concentration that can mainly lead to the favorite control and prevention of cad risk factors . We have shown that not only intravenous magnesium administration can be related to the lower risk of poor outcome in patients with cad, but also these effects can be obtained by dietary intake of this mineral via mediterranean dietary regimen . In a similar study by schrder, it was found that the high consumption of vegetables, fruits, legumes, nuts, fish, cereals, and olive oil as main components of mediterranean regimen led to high absorption of magnesiumin obesity and type 2 diabetes . Also, singh showed that the increased intake of dietary magnesium in association with the general effects of a nutritious diet can offer protection against cardiovascular deaths among high - risk individuals predisposed to cad . Furthermore, in another study, it was observed that the intake of dietary magnesium was associated with a reduced risk of cad; however, associations between dietary magnesium and coronary events occurring after fifteen years of follow - up were modest . It seems that the mediterranean dietary regimen and its components as rich pools of magnesiummight optimize micronutrient status in main body organs especially cardiovascular system . In the present study, it was also found that the patients' baseline characteristics and even severity of cad had no relationship with serum magnesium concentration in multivariate analysis . Similarly, in a study by mataix et al ., the risk of hypomagnesemia was not associated with any of the other factors that were investigated such as gender, educational level, obesity, smoking habits, alcohol consumption, and physical exercise . However, some studies showed that the magnesium intake could decrease in advanced age and in men for each of the different race or ethnic groups . It seems that the serum magnesium changes are mainly dependant on nutritional habit, metabolicprocesses, inflammatory biomarkers, and other related - potential mechanisms that should be investigated in future studies . In conclusion, taking mediterranean dietary regimen can be associated with increased level of serum magnesium concentration, and thus this regimen can be cardioprotective because of its effects on serum magnesium.
Human papillomavirus (hpv) is the most common sexually transmitted infection (sti) among young adult women, and it plays a critical role in the development of cervical cancer [1, 2]. Biologic susceptibility to hpv acquisition and immune competence for clearance of an hpv infection could be affected by common, treatable vaginal infections that disrupt the intricately balanced vaginal ecosystem and its innate protective mechanisms against infection and disease . Bacterial vaginosis and trichomoniasis are associated with high levels of anaerobic microorganisms and their byproducts, that can damage vaginal epithelium, degrade cervical mucus, and cleave immunoglobulin a [36]. Despite the similar effects of bacterial vaginosis and trichomoniasis on the vaginal environment, there is increasing evidence only for an association between hpv and bacterial vaginosis, albeit of unknown directionality [79]. Bacterial vaginosis and trichomoniasis are categorized, along with vulvovaginal candidiasis, under the somewhat misnomer of vaginitis . Unlike bacterial vaginosis and trichomoniasis, studies on vulvovaginal candidiasis are complicated by its lack of a clear laboratory definition, since the etiologic agent may exist as part of the commensal microbiota in healthy women . Candida albicans is the most prevalent species in most cases of asymptomatic colonization and vulvovaginal candidiasis; however certain species of candida are more pathogenic than others and induce hyphae formation and have enhanced proteolytic activity and antigen modulation, enabling candida to penetrate the mucosal surface and induce mucosal swelling, erythema, and exfoliation of cells [1012]. The role of vaginal infections in hpv pathogenesis has been evaluated in primarily cross - sectional studies and has yielded conflicting results [8, 9, 1319]. The purpose of the current study was to evaluate associations for vaginal infections with prevalent hpv, incident hpv, and clearance of hpv in a large, prospective cohort of hiv - infected and high - risk, hiv - uninfected women . The hiv epidemiology research study (hers) was a longitudinal multi - site investigation of the biological, psychological, and social effects of hiv infection among us women . Briefly, from april 1993 through january 1995, 871 hiv - infected women and 439 high - risk hiv - uninfected women were enrolled at four study sites: bronx, ny; baltimore, md; detroit, mi; and providence, ri . Institutional review boards at each participating medical center and at the centers for disease control and prevention approved the study protocol . Women aged 1655 years were eligible for participation if they had a history of injection drug use or high - risk sexual behavior, were fluent in either english or spanish, and if hiv - seropositive, reported no history of clinical aids - defining conditions . At each study site, hiv - seronegative women were frequency matched to hiv - seropositive women on hiv status (1: 2 ratio) and hiv risk behavior (1: 1, sexual behavior to injection drug use). Women completed up to 15 study visits scheduled 6 months apart that consisted of an interview, physical and pelvic examination, and blood, urine, oral, and cervicovaginal specimen collection . Hpv testing used polymerase chain reaction (pcr) to amplify virus obtained by cervicovaginal lavage . The amplified product was identified by hybridization with a generic hpv probe and probes specific to 26 hpv types: 6, 11, 16, 18, 26, 31, 33, 34, 39, 40, 42, 45, 51, 52, 53, 54, 55, 56, 58, 59, 66, 68, 73, 82, 83, and 84 . Samples with missing (n = 17) or negative (n = 72) test results for hybridization with the control, b - globin probe were considered of unsatisfactory quality, and the hpv results were set to missing . For the purposes of the current analysis, visit - specific prevalent hpv infection was defined by detection of any hpv dna by general probe at a given visit . Incident infection was defined as detection of a new type of hpv not present at any prior visit . Thus, hpv type - specific negative women at enrollment were at risk for infection with the respective hpv type . Women who were hpv - negative by all type - specific probes and generic probe prior to testing positive by generic probe only (i.e., untypable infection) were classified as having incident hpv at that visit . For the evaluation of time to hpv clearance, women contributed event times for each incident hpv type . Time to clearance was defined as the interval from the type - specific incident visit to the first of two consecutive type - specific negative visits . The flagging negative visit was required to avoid misclassification from fluctuating detection of hpv . Hpv infections that were followed by a single hpv - negative, final study visit were censored at that negative visit . Hpv infections that were positive at the last study visit had 6 months added to ensure comparability of assumptions about clearance of hpv infection for censored and noncensored observations . Hpv infections spanning a single missing visit were assumed to persist over the unobserved period . Presence of bacterial vaginosis was determined by nugent scoring of a gram - stained slide . A nugent score of 7 to 10 defined bacterial vaginosis, whereas a score of 0 to 6 defined normal - intermediate vaginal flora . For visits without a nugent score (<1%), presence of vaginal candida colonization was based on a positive culture for candida species or detection of yeast or pseudohyphae on gram stain . Presence of trichomoniasis was determined by detection of trichomonas on wet mount (all visits) or on culture (visits 4 and above). Women were eligible for the current analysis if they had baseline data on hpv dna and bacterial vaginosis, vulvovaginal candidiasis, or trichomoniasis test results (n = 1256). Of these women, 108 who did not have a cervix at baseline and one woman who had cervical treatment and a hysterectomy within 6 months before and after enrollment, respectively, were excluded . For simplicity, an additional 11 women who seroconverted to hiv - seropositive during follow - up were excluded, leaving 1136 subjects for this analysis . Person - time was censored at the date of cervical treatment (e.g., excisional biopsy, cryotherapy) or hysterectomy for 111 subjects . Potential confounders of the relationship between vaginal infections and prevalent hpv, incident hpv, and clearance of hpv were selected based on the literature and a proposed causal directed acyclic diagram (not shown) used for identification of sufficient sets of confounders . The a priori model for prevalent hpv and incident hpv included sexual risk factors (new or multiple male sex partners and frequency of condom use), illicit drug use, cigarette smoking, use of hormonal contraceptives, immunologic predisposing factors (hiv status, cd4 count, and viral load), and demographic indicators for hpv prevalence in the usa (age, race, and socioeconomic status) [1, 25]. A priori models for time to hpv clearance also included a covariate indicating coinfection with another hpv type within the type - specific duration and its cancer risk classification . All statistical models included the study design variables: study site and risk behavior cohort (sexual or injection drug use). In addition, models included a covariate for visit number, year of visit, or year of hpv onset to account for period effects . In addition to the variables selected a priori, other factors related to cervicovaginal health were evaluated in bivariate and multivariable analysis using sas versus 9.2 (sas institute inc ., these factors included potential hormonal influences (e.g., pregnancy, postmenopausal state, and estrogen replacement therapy), sexual behavior (e.g., sexual frequency), genital tract infections (e.g., herpes simplex virus-2 serostatus at baseline culture and pcr testing for chlamydia and gonorrhea ceased after the third study visit due to very low frequency in this population), and other risk behaviors or conditions (e.g., alcohol drinking and hepatitis c serostatus at baseline). The importance of a covariate was evaluated in terms of the causal directed acyclic graph, collinearity with other covariates, and its coefficient magnitude, statistical significance, and impact on the effect estimates for vaginal infections upon addition to and removal from the statistical model . A generalized linear mixed model with a random intercept and a slope based on a toeplitz matrix was used to model associations between current vaginal infections and prevalent hpv while accounting for between - subject variation and repeated measures correlation . To evaluate associations between vaginal infections at the preceding visit and incident hpv, as well as to explore the temporal relationship between hpv and bacterial vaginosis, the case - crossover analytic approach was used . The case - crossover approach is useful for identifying associations between recent, time - varying exposures and an incident outcome while adjusting for all time - independent factors by comparing each woman's case (e.g., incident hpv) visits to her own noncase visits . To evaluate temporality, separate case - crossover models were run for incident hpv and incident bacterial vaginosis that were adjusted for a few shared time - dependent predictors: a combined indicator for hiv status and cd4 category (with 4 categories: hiv - negative and hiv - positive with cd4> 500, cd4 200500, and cd4 <200) and self - reported crack or cocaine use, new or multiple sex partners, and consistency of condom use since the prior study visit . Analyses of time to clearance of a type - specific hpv infection used the wei, lin, and weissfeld extended cox model . Hazard ratios less than 1.0 indicate lower clearance rates (i.e., longer duration of infection). Vaginal infections, and most of the covariates, were modeled as time - dependent variables allowing the instantaneous effects to vary with changes in the time - dependent variables . Upon finalizing the main effects models, modification of the effect estimates for vaginal infections across levels of biologically relevant covariates (e.g., hiv status, concurrent vaginal infections) was evaluated for magnitude and significance (p <0.15) using the wald and likelihood ratio tests . Due to effect measure modification of the association between certain vaginal infections and hpv outcomes by hiv status, tabular results are presented separately for hiv - infected and hiv - uninfected women . At baseline, hiv - infected women (n = 756) were similar to hiv - uninfected women (n = 380) in age, number of live births, cigarette smoking status, and prevalence of bacterial vaginosis, trichomonas vaginalis, chlamydia trachomatis, and neisseria gonorrhoeae infections (table 1). The hiv - uninfected women were more likely to have recently used crack cocaine or injection drugs and had multiple sex partners in the prior 6 months . The hiv - infected women were more likely to be of african american race, of lower educational level, and seropositive for hepatitis c and herpes simplex 2 . Hiv - infected women were also more likely to be vaginally colonized with candida species and have detectable hpv . The prevalence of hpv among hiv - infected women (64%) was over twice that of hiv - uninfected women (29%), and hiv - infected women were more likely to be coinfected with multiple hpv strains (table 1). However, among women with hpv, the proportion with untypable hpv infections was greater among hiv - uninfected women (30.3%) than among hiv - infected women (20.3%). At enrollment, most of the hiv - infected women (83%) had cd4 counts above 200 cells/l . Enrollment was completed before the onset of the highly active antiretroviral therapy (haart) era, so none of the women were on haart regimens at baseline . However, one - third of the hiv - infected women were taking antiretrovirals . The prevalence of hpv infection at visits 115 ranged from 38% to 56% (4968% for hiv - infected women and 1232% for hiv - uninfected women). Longitudinal, multivariable analysis for prevalent hpv demonstrated a strong association with hiv status and immunodeficiency . Hiv - infected women with cd4 cell counts below 200 cells/l had greater odds for prevalent hpv compared to hiv - infected women with cd4 counts above 500 cells/l (adjusted odds ratio (aor) = 1.53, 95% ci: 1.25, 1.86). There was no modification of the odds ratio for bacterial vaginosis on prevalent hpv by hiv status (table 2). In a model adjusted for a combined indicator of hiv status and cd4 group, bacterial vaginosis was significantly associated with increased odds for prevalent hpv among all hers women (aor = 1.14, 95% ci: 1.04, 1.26). Hiv status significantly modified the associations among trichomoniasis, vaginal candida colonization, and hpv prevalence . In a model for hiv - uninfected women, there was no significant association for trichomoniasis or vaginal candida colonization with prevalent hpv (table 2). However, among hiv - infected women, there was a significant interaction between trichomoniasis and vaginal candida colonization: trichomoniasis was significantly associated with decreased odds for prevalent hpv among women without vaginal candida colonization, and vaginal candida colonization was significantly associated with increased odds for prevalent hpv among women with trichomoniasis (table 2). When vaginal candida colonization was removed from the model, trichomoniasis remained significantly associated with decreased odds for prevalent hpv among the hiv - infected women (aor = 0.85, 95% ci: 0.73, 0.98). In contrast, when trichomoniasis was removed from the model, vaginal candida colonization was not associated with prevalent hpv (aor = 1.02, 95% ci: 0.92, 1.12). Incident hpv infections occurred at 14% of follow - up visits (17.4% among hiv - infected women and 7.5% among high - risk, hiv - uninfected women). There was no modification of the odds ratio for prior bacterial vaginosis on incident hpv by hiv status (table 3). In a model adjusted for a combined indicator of hiv status and cd4 group, bacterial vaginosis at the preceding visit was significantly associated with 24% increased odds for incident hpv among all hers women (aor = 1.24, 95% ci: 1.04, 1.47) (table 3). Bacterial vaginosis at the current visit was similarly associated with incident hpv (aor = 1.25, 95% ci: 1.05, 1.48). In contrast, a case - crossover analysis for the outcome of incident bacterial vaginosis found that hpv at the current visit (aor = 1.46, 95% ci: 1.12, 1.90), but not at the preceding visit (aor = 1.05, 95% ci: 0.80, 1.37), was predictive of incident bacterial vaginosis among all women . Trichomoniasis and vaginal candida colonization was not significantly associated with incident hpv, regardless of timing of vaginal infection relevant to hpv infection (table 3). The majority of incident hpv infections cleared over subsequent study visits (63.1% clearance among hiv - infected women and 74.8% among hiv - uninfected women). Among hiv - infected women, those with cd4 counts below 200 cells/l were half as likely to clear an hpv infection as those with cd4 counts above 500 cells/l (adjusted hazards ratio (ahr) = 0.51, 95% ci: 0.40, 0.64). Hiv status and cd4 category did not significantly modify the hazard ratios for vaginal infections with hpv clearance . However, there was a statistical interaction between bacterial vaginosis and vaginal candida colonization (table 4). Among all hers women with vaginal candida colonization, bacterial vaginosis was associated with a lower rate of hpv clearance (ahr = 0.65, 95% ci: 0.51, 0.83), and vice versa, among women with bacterial vaginosis, vaginal candida colonization was associated with delayed hpv clearance (ahr = 0.73, 95% ci: 0.58, 0.93). When vaginal candida colonization was removed from the model, bacterial vaginosis remained significantly associated with delayed clearance of hpv among all hers women (ahr = 0.84, 95% ci: 0.72, 0.97). In contrast, when bacterial vaginosis was removed from the model, vaginal candida colonization was not associated with hpv clearance (ahr = 0.93, 95% ci: 0.81, 1.08). We did not detect a significant association between trichomoniasis and time to clearance of hpv infection, regardless of hiv status (table 4). Consistent with a recent meta - analysis of primarily cross - sectional studies, bacterial vaginosis was associated with increased odds for prevalent hpv among women in hers . Furthermore, in this large, prospective study, bacterial vaginosis was associated with increased odds for incident hpv and delayed clearance of hpv . The former finding is consistent with a reported increase in hpv incidence among women with bacterial vaginosis in the women's interagency hiv study (wihs). Prior attempts to decipher the temporal relationship between bacterial vaginosis and hpv yielded conflicting findings [8, 9]. In this study, bacterial vaginosis, whether considered at the preceding or current visit, was associated with incident hpv, whereas, in an alternate multivariable model for the outcome of incident bacterial vaginosis, only hpv at the current visit was significant . These findings are in accord with biologic plausibility since, unlike most cervical hpv infections, bacterial vaginosis causes major changes in the local environment leading to degradation of innate defenses . While trichomoniasis infection was not significantly associated with hpv outcomes among hiv - uninfected women in hers, hiv - infected women with trichomoniasis had decreased odds for prevalent hpv . A similar finding was reported from a wihs analysis which combined 1736 hiv - infected and 493 hiv - uninfected women into one analytic group . In that study, detection of trichomoniasis on wet mount was associated with lower prevalence, increased incidence, and shorter duration of hpv infection . In the current study, we did not detect a significant effect of trichomoniasis on incident hpv or clearance of infection; however, this may have been due to lower statistical power . Smaller studies among only hiv - uninfected women are more consistent with our findings among the hiv - uninfected women in suggesting absence of an association between trichomoniasis and prevalent, incident, or persistent hpv [14, 15, 18]. The apparent difference by hiv status in associations for trichomoniasis with hpv prevalence and duration may be attributable to the strong effect of hiv on duration of hpv infection relative to the minimal, if any, effect of hiv on duration of trichomoniasis . Explicitly, as the duration of hpv infection increases, the proportion of hpv - positive visits that have trichomoniasis present decrease, giving the appearance of a protective association . The presence of vaginal candida colonization alone was not significantly associated with hpv outcomes; however when concurrent with bacterial vaginosis or trichomoniasis, it negatively impacted their effects on certain hpv outcomes . The decreased odds for prevalent hpv among women with trichomoniasis was not observed among women with vaginal candida colonization, and the association between bacterial vaginosis and delayed clearance of an hpv infection was strongest among women with vaginal candida colonization . Standard antibiotic treatment for bacterial vaginosis or trichomoniasis may precipitate a vaginal yeast infection, and a high incidence of asymptomatic and symptomatic vulvovaginal yeast infection has been reported in patients with recurrent bacterial vaginosis . Therefore, concurrent vaginal candida colonization may indicate more severe or difficult - to - treat bacterial vaginosis or trichomoniasis . The hers cohort, two - thirds of which are hiv - infected, represents a population at increased risk for vaginal infections and hpv . As such, there are two primary concerns regarding these study's findings: (1) the potential dependency of the results on hiv disease and (2) the generalizability of the results to the general population of women . Several methods were used to reduce potential confounding of the relationships between vaginal infections and hpv by hiv - associated factors: (1) by design, hiv - infected women were frequency matched at enrollment to hiv - uninfected women on sexual and injection drug use behavior, (2) self - reported risk behavior between study visits was included in multivariable analyses, (3) models among all hers women were evaluated for statistical interaction with a composite variable of hiv status and cd4 count, and (4) separate models were built for hiv - infected and hiv - uninfected women, with the former adjusted for cd4 category and logarithm of viral load . Despite these efforts, disentangling the interrelationships between hiv disease and concurrent vaginal infections was limited by decreased statistical power to detect significant associations among hiv - uninfected women separately . While the hers cohort is a population at high - risk for genital tract infections, the primary findings involve two infections for which the general female population is also at high risk: bacterial vaginosis and hpv . Moreover, there is mounting evidence for an association between bacterial vaginosis and hpv across diverse study populations . This is the second large, prospective study among hiv - infected and hiv - uninfected women to report consistent findings for bacterial vaginosis with increased prevalent and incident hpv . In the current study, bacterial vaginosis while there is mounting evidence for an association between bacterial vaginosis and hpv, a temporal association has remained unclear [79]. In the current study, we found that bacterial vaginosis, whether considered at the preceding or current study visit, was associated with incident hpv, whereas hpv at the current, but not preceding, visit was associated with incident bacterial vaginosis . In summary, the current study suggests bacterial vaginosis may predispose a woman to hpv infection and delayed hpv clearance, underscoring the importance of prevention and successful treatment of bacterial vaginosis . Bacterial vaginosis is associated with increased odds for prevalent and incident hpv as well as delayed clearance among women in the hiv epidemiology research study.
Psychobehavioral approaches attempt to identify the underlying cognitive dissonance creating the intense emotional discomfort that can trigger seizures . A recent review of psychobehavioral therapy for epilepsy recommends case reports as a research design to explore specific psychological mediators of seizure self - control . This case report illustrates how a psychobehavioral intervention addresses cognitive dissonance in order to decrease internal stressors of seizures and was prepared according to the consensus - based care guidelines for standardized clinical case reporting . His magnetic resonance imaging (mri) shows extensive bilateral gray matter band heterotopia (fig . 1). Electroclinical day- and nighttime seizures captured during video - eeg studies displayed seizures with loss of consciousness consisting of irregular shaking of his body correlating with epileptiform activity originating from bilateral parasaggital regions synchronously and tonic posturing of arms originating from the left hemisphere . Before losing consciousness, he feels a loss of sensation in some of his body parts, usually starting from his right arm . These findings suggest localization - related epilepsy originating from the left hemisphere and bilateral parasagittal regions with simple and complex partial as well as secondarily generalized seizures . He experiences predominantly nocturnal seizures that occur in clusters of up to four complex partial seizures once or twice per week and daytime seizures once or twice per month . A. 's parents had installed an acoustic monitoring device in his bedroom and reported that this baseline seizure frequency had remained unchanged for> 3 years prior to the beginning of the intervention . A. is currently taking valproate, topiramate, and lamotrigine and complies with the modified atkins diet protocol . Past medication failures have included carbamazepine, levetiracetam, clobazam, and oxcarbazepine . During previous psychological assessments, he has been diagnosed with a verbal and auditory learning disability as well as expressive language impairment . Because of parental worries that challenges would increase a. 's seizure frequency, a. received parental support for doing his schoolwork, and he was never expected to contribute to household chores . As a result, a. was deprived of opportunities to build his confidence in his own achievements and pictures himself as broken otherwise, a. is in good health; he has never used alcohol or tobacco . A. and his parents consented to the use of these data for this case report . To resolve the resultant conflict between insecurity with his performance, fear of failure, and high expectations of himself, a. actively avoided responsibility and demanded help rather than engaging in self - reliant problem - solving behaviors . This defense mechanism that incorporated learned helplessness and secondary gain issues was exacerbated by an anticipated challenge at school or social anxiety . After an initial assessment period comprising two sessions of 3 h each, a treatment plan was formulated including the workbook taking control of your epilepsy, daily journaling, and daily relaxation exercises . The participant received training in abdominal breathing and visualization techniques (imaginary journey and an attention - focusing exercise) to address early seizure warning symptoms . The initial assessment was followed by weekly counseling sessions of 1030 min that were conducted over the phone for 12 months, and monthly sessions were conducted for a 6-month follow - up period . A. engaged in a daily guided relaxation practice after returning from school and listened to a nonguided relaxation tape before going to bed . He reports that he is able to interrupt warning signs of the early onset of a seizure by utilizing deep diaphragmatic breathing, visualization techniques, and self - affirmation statements of personal choice (e.g., peace and release). A. 's parents report that he took on responsibility for the completion of his schoolwork and studies in a self - motivated and timely fashion, all of which helped him to prevent the buildup of anxiety . After a nighttime seizure, he can reliably identify the behavioral strategy which he could have employed in order to avoid the buildup of distress during the day prior to the seizure . A. admitted that it was, at times, easier to have a seizure rather than to address the situational accumulation of seizure triggers by taking responsibility and implementing the appropriate proactive behaviors . Hence, motivational exercises were employed to allow a. to deliberately weigh the motivational factors and obstacles regarding prior set goals (e.g., an early bed rest) to facilitate informed changes of his present decision - making habits . While he considered himself broken at the beginning of the intervention, he has developed a perspective on life in which he feels that he can shape his future according to his preferences if he follows through with taking responsibility for the acquisition of self - organizational skills (see patient perspective in table 1). By the end of the follow - up period his nighttime seizures dropped to 12 clusters per month after 6 months of participating in the intervention . Since the internalization of the therapeutic principles is an active process that requires continuous learning, motivation, and compliance of the individual, effects are usually expected 36 months after the beginning of the intervention, especially since it takes an individual at least 12 weeks to finish the 12 sessions of the workbook . This seizure frequency has remained stable during the remaining 6 months of the intervention and the 6-month follow - up period (fig . (3 months after the follow - up period), the seizure frequency has still remained the same despite increasing stressors that arise within the framework of a. 's successful admission to college . The implementation of the therapeutic strategies correlated with a cessation of daytime seizures and a clinically significant drop of nighttime seizures . Literature suggests that seizure frequency may be positively influenced by the restoration of balance within the autonomic nervous system by the regular practice of relaxation exercises and proactive avoidance of emotional distress during wakefulness, thereby preventing the buildup of seizure activity . Furthermore, a. would regularly wake up during the night when preictal or early ictal phenomena arose; he would then react with the application of previously practiced countermeasures . Literature indicates that evidence for the enhancement of psychological well - being by psychobehavioral therapy is more established, while reliable evidence on its role on seizure control is scarce . The a / r intervention may represent the most comprehensively developed cognitive behavioral approach to epilepsy that has repeatedly been correlated with a reduction of seizure frequency in individuals with complex partial seizure disorders in uncontrolled prospective and retrospective studies,, . The possibility of false negative self - reports of seizure occurrence cannot be ruled out but seems unlikely because the patient and his parents have been very conscientious in keeping a seizure diary for a long time . Because of the uncontrolled nature of a case report, nonspecific effects of attention and natural fluctuations of seizure frequency that could have contributed to improve seizure frequency cannot be factored into the interpretation of the presented data . However, the long and stable seizure frequency prior to the intervention makes natural fluctuations unlikely . Furthermore, the decreased seizure frequency has remained stable during follow - up and post follow - up with decreased and no contact with the a / r counselor which makes unspecific effects of attention implausible . In this case of a 16-year - old male, the acquisition of self - organizational skills and the development of seizure interruption techniques correlated with a clinically significant drop of seizures and an increased sense of being in control of his seizures . The case exemplifies that motivational strategies may be applied to facilitate the regulation of lifestyle - related seizure precipitants . Future prospective studies are needed to further investigate the psychological mediators of an individual's increasing sense of seizure self - control and its actual relationship with seizure frequency.
Nowadays, new treatments for schizophrenia are more ambitious, aiming to improve not only psychotic symptoms, but also quality of life and social reinsertion . We briefly but critically outline advances in the treatment of schizophrenia from the mid-1970s up to the present . For many years, it was widely accepted that any effective drugs for schizophrenia would also induce extrapyramidal side effects (eps), and the term neuroleptic was originally used to describe such neurologic side effects . However, adverse effects, such as movement disorders and sedation, are problematic and can result in noncompliance with medication . Positive symptoms, such as delusions, hallucinations, and thought disorders, are more often experienced in the acute phases of the illness than are negative symptoms, such as poverty of speech, lack of motivation, apathy, and inability to express emotions.1 however, negative symptoms are probably the more disabling, and may not respond as well to typical antipsychotic drugs . In addition to efficacy issues, safety of medication also influences the choice of antipsychotic agent . Atypical antipsychotic drugs, by definition, differ from typical antipsychotic agents in producing significantly fewer eps and carrying a lower risk of tardive dyskinesia in vulnerable clinical populations at doses that result in comparable control of psychosis . Effects on neuronal survival and plasticity, together with decreased neurotoxicity, might also contribute to their clinical advantages over typical neuroleptic drugs.2 the atypical drugs differ from the typicals in their mechanism of action, but not all share the same mechanism (tables 1 & 2). Clozapine, the prototype of these agents, has been found to improve delusions and hallucinations in patients who fail to respond to other antipsychotic drugs, and to reduce the risk of suicide . These agents have been found to increase cortical dopamine and acetylcholine release, as well as to have a variety of effects on the glutamatergic system not shared by the typical agents.2 the term atypical was then accepted as including the characteristics common to those antipsychotic drugs developed more recently, including absence of hyperprolactinemia, greater efficacy in treating positive and negative symptoms as well as symptoms of disorganization, and absence of tardive dyskinesia or dystonia after being administered chronically.3,4 at least in clinical circles, most would agree that clozapine, risperidone, olanzapine, quetiapine, sertindole, ziprasidone, aripiprazole, and amisulpride are atypical, even though many of those agreeing to the above list may disagree on the criteria of definition . When compared with older antipsychotic drugs, atypical antipsychotics show fewer eps and require less concomitant anticholinergic use, even when controlling for the high doses of haloperidol that have been conventionally used in such studies.5 the second most commonly shared feature is that most of the newer atypical antipsychotics show either no, or only transient, prolactin elevation . The two notable exceptions in this regard are risperidone and amisulpride, and it is now understood that this exception may largely be attributed to these drugs having a higher peripheral / central distribution ratio, thereby leading to excessive dopamine blockade in the pituitary that lies outside of the blood brain barrier.6 conventional antipsychotics continue to be the first choice when just cost of treatment is considered, which remains important in poor regions . It is likely that the next generation of treatments will have to move beyond reliance on a single drug as the sole treatment for the multidimensional characteristics of schizophrenia . Most new antipsychotics introduced onto the market in the past two decades (eg, risperidone and olanzapine) have been multireceptor - acting agents, especially having concomitant 5-ht2 receptor antagonism.7 a notable exception to this has been amisulpride, a benzamide derivative that has high and similar affinities for the dopamine d2 and d3 receptor subtypes and is devoid of any significant affinity to other receptor systems.8 yet, amisulpride shows most of the attributes of atypicals, ie, a lower risk of eps, a somewhat greater improvement in positive and negative symptoms, and better overall outcome in longer - term follow - up studies compared with more conventional serotonin - dopamine or multireceptor atypical antipsychotics.9,10 amisulpride is a highly selective dopamine d2-like receptor antagonist (ki = 2.8 nmol / l for d2 receptors and ki = 3.2 nmol / l for d3 receptors), with several orders of magnitude higher affinity for d2/d3 receptors than any other receptor population.8 a positron emission tomography study of amisulpride - treated patients found no significant binding to 5-ht2 a receptors.10 in clinical trials, amisulpride has shown therapeutic benefit, with a profile of side effects similar to that of placebo.9 this and its highly specific receptor profile make it ideally suited to test whether antipsychotic efficacy and a low incidence of eps may be achieved purely by selective action at limbic cortical dopamine d2/d3 receptors in vivo.11 some meta - analyses have identified clozapine, amisulpride, risperidone, and olanzapine as being significantly more effective than first generation (typical) antipsychotics and other second - generation (atypical) antipsychotics.1012 clinically, amisulpride is characterized by a side effect profile most resembling that of an atypical antipsychotic due to its low eps burden.9 however, like risperidone and first - generation antipsychotic drugs, amisulpride causes large elevations in serum prolactin levels, most likely due to its potent d2/d3 antagonist properties.13 thus, despite having a pharmacologic profile reminiscent of a typical antipsychotic in that it exhibits high d2 affinity and low 5-ht2a affinity, amisulpride therapeutically resembles atypical antipsychotics . The identification of the 5-ht7a receptor as a target blocked by amisulpride suggests a plausible explanation for its antidepressant efficacy . Changes in 5-ht7 receptor function have been shown to result from chronic antidepressant treatment.14,15 the 5-ht7a receptor antagonism, and not d2/d3 receptor antagonism, likely underlies the antidepressant actions of amisulpride.16 moreover, 5-ht7 receptor antagonists and presently approved antidepressants also appear to have similar effects on hippocampal neurogenesis.17 patients with schizophrenia have been found to have increased somatic morbidity and mortality risks relative to the general population.18,19 weight gain might contribute to their risk of morbidity and mortality by leading to an increase in lipid dysregulation, hypertension, type 2 diabetes mellitus, cardiovascular disease, and other related diseases.20,21 in addition, being overweight usually leads to lower self - image and self - esteem, decreased quality of life, and social disadvantages, and is associated with medication noncompliance.2224 recently, metabolic syndrome in patients with schizophrenia has drawn enormous attention from researchers . Previous studies showed that approximately 28.7%60.0% of patients with schizophrenia - related disorders have metabolic syndrome.25,26 most studies show that the prevalence of metabolic syndrome in patients with schizophrenia or schizophrenia - related disorders is higher than that in the normal population.26,27 choosing the right antipsychotic is one of the most challenging issues when treating schizophrenia . Next to efficacy issues, safety of medication, including subjectively distressing side effects (sedation, hypersalivation or dry mouth, akathisia, sexual dysfunction) with negative medical consequences (weight gain, orthostatic hypotension, diabetes, hyperprolactinemia, corrected qt prolongation) and life - threatening adverse events (agranulocytosis, neuroleptic malignant syndrome), also influence the choice of medication.28,29 atypical is a term widely used to describe some antipsychotics with specific characteristics, such as minimal risk of acute and chronic movement disorders and less sedation.30 the atypical antipsychotic drugs are also thought to be more effective than conventional drugs in the treatment of negative symptoms in schizophrenia, although this has not yet been adequately established.31 at present, new antipsychotics are routinely investigated for their possible effect on negative symptoms . In spite of their better tolerability profile, catie (the clinical antipsychotic trials of intervention effectiveness) showed a high dropout rate with atypical antipsychotics because of either inefficacy or intolerable side effects.32 the atypical antipsychotic drugs are a class of agents that have become the most widely used to treat a variety of psychoses because of their superiority with regard to eps . The major concern regarding the safety of the atypical antipsychotics is related to their propensity to induce weight gain and alter glucose and lipid metabolism . Their main clinical advantage beyond low eps is their ability to improve cognition (to some extent), which is one of the key deficits in schizophrenia . Further study is needed to define their mechanism of action, particularly with regard to long - term effects on neuronal plasticity and survival . Several studies have found that amisulpride and risperidone are better tolerated than haloperidol with regard to eps.33,34 weight gain was also shown to be significantly greater with risperidone than with amisulpride (1.4 kg versus 0.4 kg, p = 0.026).35 in a six - month treatment period, significantly fewer amisulpride - treated patients presented a weight increase of 7% or higher than that of baseline compared with those receiving risperidone (18% versus 34%).36 additional evidence for decreased levels of weight gain in amisulpride - treated patients relative to olanzapine - treated patients comes from both an eight - week study (weight gain in the olanzapine versus the amisulpride group 2.7 + 3.9 kg versus 0.9 + 3.2 kg, respectively) and a six - month study (weight gain in the olanzapine versus the amisulpride group 3.9 kg + 5.3 versus 1.6 + 4.9 kg, respectively).37,38 recently, a meta - analysis of all randomized and double - blind studies demonstrated that amisulpride treatment was significantly associated with relatively low weight gain.39 collectively, these findings suggest that amisulpride is an atypical antipsychotic drug with a lower risk of weight gain . Both amisulpride and ziprasidone were preferred to olanzapine in patients who had recently experienced weight gain.40,41 this makes sense because second - generation antipsychotics do not appear to differ regarding efficacy, but both amisulpride and ziprasidone have been shown to cause less weight gain than other compounds.38,42,43 during the treatment course, the amisulpride - treated patients showed significantly decreased fasting triglyceride, total cholesterol, glucose, and insulin resistance levels, decreased diastolic blood pressure and pulse rate, and a significant increase in high - density lipoprotein cholesterol levels after switching to amisulpride (all with a p <0.05). The prevalence of metabolic syndrome in amisulpride - treated patients also decreased significantly from 65.2% to 30.4% (mcnemar test, p <0.0005). These findings suggest that switching to amisulpride could be an effective treatment of overweight or obese psychiatric patients treated previously with other second - generation antipsychotics.44 in addition to weight reduction, this study showed that the lipid profiles in these overweight or obese patients also improved significantly . A growing body of evidence indicates that use of some atypical antipsychotics, including clozapine and olanzapine, may be linked to impairment in some health - related lipid indices . For instance, in a prospective study, schizophrenia patients treated with olanzapine and clozapine for four weeks showed significantly elevated triglyceride and total cholesterol levels and decreased high - density lipoprotein cholesterol levels.45 amisulpride is a unique atypical antipsychotic that selectively blocks d2 and d3 receptors presynaptically in the frontal cortex, possibly enhancing dopaminergic transmission, and postsynaptically in the limbic areas, possibly reducing it . Thus, dopaminergic overactivity in the frontal cortex and underactivity in the limbic areas, can be treated simultaneously, alleviating both positive and negative symptoms of schizophrenia, respectively.46 additionally, the finding that amisulpride is a highly effective antidepressant via antagonism at 5-ht7 receptors would make its mechanism of action a unique one relative to other approved antidepressant drugs, and supports the development and/or testing of more selective 5-ht7 receptor antagonists to treat depression in humans,16 including their effects on negative symptoms, cognitive dysfunction, mood, morbidity and mortality, work and social function, quality of life, and family and societal burden . Other studies have demonstrated superiority over other antipsychotic agents, such as the atypical risperidone, in terms of social interactions and performance, as well as in terms of relevance of the therapeutic effect observed . In addition to low levels of eps, as with all atypicals, amisulpride also shows a low incidence of side effects, such as weight gain, that may contribute to improved compliance and enhanced long - term efficacy.46 schizophrenia is a chronic disorder that results in significant social, psychologic, and occupational dysfunction . Not surprisingly, schizophrenic patients score very poorly on subjective and objective measures of quality of life, even when compared with patients with other chronic psychiatric conditions, such as depression or anxiety disorders, and long - term functional impairment is very frequent.47 quality of life measures are especially important when treating patients with chronic conditions, such as schizophrenia, which significantly impair their way of life . Every aspect of everyday life is affected, including where they live and work, what activities they can perform, and how they interact with other people . Ideally, schizophrenia treatment should protect against relapse, which then becomes the foundation for improvements in quality of life and level of functioning.48 the atypical antipsychotics lack many of the problems associated with traditional treatments, and evidence suggests that they may be associated with a higher subjective quality of life (table 3).49 however, the atypical antipsychotics may also differ from each other on a whole range of factors . Amisulpride has a good safety and tolerability profile, with fewer eps than the conventional antipsychotics and a low incidence of anticholinergic side effects . As for other antipsychotics, corrected qt warnings are stated on the labeling for some countries, even though postmarketing surveillance for amisulpride shows no cause for concern.50 improvement in quality of life and social functioning, with consequent reintegration into society, is clearly a major goal of treatment for schizophrenia . The improved safety and tolerability profile of the atypical antipsychotics, combined with their benefits on negative symptoms and cognitive impairment, should help achieve this aim.51 the atypical antipsychotic, amisulpride, has an improved safety and tolerability profile, and has been shown to be significantly more effective than placebo and haloperidol on a number of quality of life and social functioning scales, including the global assessment of functioning, the quality of life scale, the functional status questionnaire, and the psychosocial aptitude rating scale.50 in conclusion, amisulpride, in addition to its proven clinical efficacy, may help reintegration of the schizophrenic patient back into social inclusion . The negative symptoms of schizophrenia are characterized by poverty of speech, blunted affect, lack of initiative, poor motivation, and a general slowness and underactivity, all of which result in social withdrawal . This may reflect the fact that new - generation antipsychotics have more distinct differences in their safety and tolerability profiles than in their efficacy characteristics . Although this knowledge helps to guide clinicians in drug choice, the translation of clinical trial findings into individual patient needs remains a daunting challenge . Recent data indicate that, in the case of the atypical antipsychotic amisulpride, these properties can be translated into a better quality of life, and enhanced social functioning and reintegration into society.
Asthma is a chronic lung disease which causes breathing difficulties because of chronic airway inflammation . Asthma is a common health problem around the world, and its prevalence also has been increasing in korea . The pathogenesis of asthma is unknown and there are no exact biomarkers to diagnosis asthma . In recent, several candidate genes for susceptibility to asthma were reported using advanced genetic technology and several genetic studies [36]. However, more candidate genes for asthma will be investigated in the context of personalized medicine . Secretoglobin family 3a member 2 (scgb3a2) gene is located on chromosome 5 (https:/www.ncbi.nlm.nih.gov / gene/117156). Previous studies reported that promoter polymorphisms of scgb3a2 gene result in susceptibility to asthma [79]. Scgb3a2 is a small molecular weight secreted protein in airway epithelial cells, which is also referred to as uteroglobin - related protein 1 (ugrp1). Several studies reported that it is involved in lung development and inflammatory reactions in the respiratory tract [8,1416]. Moreover, scgb3a2 has an anti - inflammatory function, and it is reported to be involved in asthma . Development of asthma may involve a series of influences on the individual development [1923], and the complex influences may determine scgb3a2 levels . Firstly, such effects may result in continued chronic inflammatory cytokine production, and scgb3a2 secretions in airway epithelium may be affected by the cytokines [2427]. However, scgb3a2 not only act downstream of such inflammation modulators, but also controls the inflammatory pathways [2830] and other hormones . Additionally, polymorphisms in scgb3a2 gene regions have been studied in regard to asthma or allergic diseases by many researchers [9,12,3235]. On the basis of this background, the present study was conducted to investigate whether single - nucleotide polymorphisms (snps) in scgb3a2 gene are associated with asthma in a korean population by case - control comparison of genomic dna . We selected 101 asthma patients (34 males, and 67 females; mean age standard deviation, years, 47.215.2] and 377 control subjects [186 males and 191 females; 49.211.4]) (table 1). The patients with asthma were recruited from among visitors at the departments of kyung hee university oriental medical center, seoul, korea . Patients with asthma were diagnosed according to a clinical history with current clinical symptoms, including episodic wheezing, chest tightness, dyspnea, and 15 or greater reversibility of forced expiratory volume at 1 second (fev1) spontaneously or after treatment with a nebulized beta2-agonist . The exclusion criteria were as follows: (1) abnormal chest x - ray; (2) patients who had tuberculosis; and (3) patients who had severe chronic obstructive pulmonary disease (fev1/fvc <70% and fev1<50% when using bronchodilator). This study was performed in accordance with the guidelines of the helsinki declaration and was approved by the ethics review committee of the medical research institute, kyung hee university medical center (irb number: 20040915). Written informed consent was obtained from each subject . Genomic dna samples were extracted using peripheral blood using a commercial dna kit (roche, indianapolis, in). The 3 examined snps were genotyped by direct sequencing after polymerase chain reaction (pcr). Pcr was performed with the primers for each snp: rs6882292 in scgb3a2 gene (forward, 5-aggacttctgctcacaaatgaag-3; reverse, 5-cccactcacacatctactatggt-3), rs1368408 (forward, 5-cttttcaatgttcttccaggag-3; reverse, 5-gcaggaagatagttaccagcttc-3), and rs151333009 (forward, 5-aaagggccagaggtagaagtttt-3; reverse, 5-cctgagattccaggatgtgcaa-3) (table 2). Final pcr products were sequenced by abi prism 3730xl analyzer (pe applied biosystems, foster city, ca). To determine whether individual snp was in equilibrium at each locus in the population, we evaluated the hardy weinberg equilibrium (hwe) using snpstats (http://bioinfo.iconcologia.net/index.php)., chicago, il) programs were used to analyze genetic data . The linkage disequilibrium (ld) block was measured using haploview version 4.2 (daly lab, cambridge, ma). To evaluate relationships, the odds ratio (or), 95% confidence interval (ci), and p value were analyzed using logistic regression method in each model [dominant (major homogenotype versus heterogenotype + minor homogenotype), recessive (major homogenotype + heterogenotype versus minor homogenotype), and log - additive (major homogenotype versus heterogenotype versus minor homogenotype) models] [3739]. To perform multiple correction, we selected 101 asthma patients (34 males, and 67 females; mean age standard deviation, years, 47.215.2] and 377 control subjects [186 males and 191 females; 49.211.4]) (table 1). The patients with asthma were recruited from among visitors at the departments of kyung hee university oriental medical center, seoul, korea . Patients with asthma were diagnosed according to a clinical history with current clinical symptoms, including episodic wheezing, chest tightness, dyspnea, and 15 or greater reversibility of forced expiratory volume at 1 second (fev1) spontaneously or after treatment with a nebulized beta2-agonist . The exclusion criteria were as follows: (1) abnormal chest x - ray; (2) patients who had tuberculosis; and (3) patients who had severe chronic obstructive pulmonary disease (fev1/fvc <70% and fev1<50% when using bronchodilator). This study was performed in accordance with the guidelines of the helsinki declaration and was approved by the ethics review committee of the medical research institute, kyung hee university medical center (irb number: 20040915). Written informed consent was obtained from each subject . Genomic dna samples were extracted using peripheral blood using a commercial dna kit (roche, indianapolis, in). The 3 examined snps were genotyped by direct sequencing after polymerase chain reaction (pcr). Pcr was performed with the primers for each snp: rs6882292 in scgb3a2 gene (forward, 5-aggacttctgctcacaaatgaag-3; reverse, 5-cccactcacacatctactatggt-3), rs1368408 (forward, 5-cttttcaatgttcttccaggag-3; reverse, 5-gcaggaagatagttaccagcttc-3), and rs151333009 (forward, 5-aaagggccagaggtagaagtttt-3; reverse, 5-cctgagattccaggatgtgcaa-3) (table 2). Final pcr products were sequenced by abi prism 3730xl analyzer (pe applied biosystems, foster city, ca). To determine whether individual snp was in equilibrium at each locus in the population, we evaluated the hardy weinberg equilibrium (hwe) using snpstats (http://bioinfo.iconcologia.net/index.php)., chicago, il) programs were used to analyze genetic data . The linkage disequilibrium (ld) block was measured using haploview version 4.2 (daly lab, cambridge, ma). To evaluate relationships, the odds ratio (or), 95% confidence interval (ci), and p value were analyzed using logistic regression method in each model [dominant (major homogenotype versus heterogenotype + minor homogenotype), recessive (major homogenotype + heterogenotype versus minor homogenotype), and log - additive (major homogenotype versus heterogenotype versus minor homogenotype) models] [3739]. To perform multiple correction, the genotype and allele frequencies of 2 promoter snps (rs6882292, 659 g / a and rs1368408, 112 g / a) and missense snp (rs151333009, stop codon) were selected in scgb3a2 in asthma patients and controls (table 3). The genotype distributions of examined snps in controls were in hwe (rs6882292, p=1.00; rs1368408, p=0.061; rs151333009, p=1.00) (data not shown). The genotype frequencies (g / g: g / a: a / a) of rs6882292 snp of scgb3a2 gene in the control group and in the asthma group were 91.5%: 8.2%: 0.3% and 81.2%: 18.8%: 0.0% . The differences showed significance [or=2.66, 95% ci=1.425.01, p=0.0033 in dominant model (g / g genotype vs. g / a genotype+a / a genotype); or=2.45, 95% ci=1.334.54, p=0.0055 in log - additive model (g / g vs. g / a vs. a / a), respectively]. The genotype frequencies (g / g: g / a: a / a) of rs1368408 snp of scgb3a2 gene in the control group and in the asthma group were 59.1%: the differences also showed significance [or=1.59, 95% ci=1.022.49, p=0.041 in dominant model (g / g genotype vs. g / a genotype+a / a genotype); or=3.02, 95% ci=1.157.90, p=0.03 in recessive model (g / g genotype+g / a genotype vs. a / a genotype); or=1.63, 95% ci=1.63, 95% ci=1.122.37, p=0.012 in log - additive model (g / g vs. g / a vs. a / a), respectively]. The minor a allele frequencies rs6882292 and rs1368408 snps of scgb3a2 gene were also associated with asthma (rs6882292, p=0.006, or=2.27, 95% ci=1.264.08; rs1368408, p=0.021, or=1.51, 95% ci=1.072.14). The a allele frequencies rs6882292 and rs1368408 snps of scgb3a2 gene were lower in the control group (rs6882292, 4.4% and rs1368408, 21.9%) than in the asthma group (rs6882292, 9.4% and rs1368408, 29.7%). These results suggest that a allele of rs6882292 and rs1368408 snps of scgb3a2 gene is a risk factor of asthma . Previous studies suggested that susceptibility to asthma differs by sex [4042]. According to sex analysis, there were significant associations between rs6882292 and rs1368408 snps of scgb3a2 gene and male asthma (table 4). The genotypic frequency of rs6882292 and rs1368408 snps of scgb3a2 gene was associated with male asthma [rs6882292, p=0.0011, or=5.60, 95% ci=2.0715.15 in dominant model (g / g genotype vs. g / a genotype); rs1368408, p=0.026, or=4.61, 95% ci=1.2816.57 in a recessive model (g / g genotype and g / a genotype vs. a / a genotype)]. After multiple correction using bonferroni s correction, the significant association remained (p<0.05). One ld block was made between rs6882292 and rs1368408 in the scgb3a2 gene (d=1.000 and r=0.218) (data not shown). There were 3 haplotypes in the ld block (gg haplotype frequency=0.765, ga haplotype frequency=0.181, and aa haplotype frequency=0.054). We observed differences between the control group and the asthma group in the haplotype analysis (gg haplotype, p=0.02 and aa haplotype, p=0.0051) (table 5). Scgb3a2, also referred to as ugrp1, is one of the susceptibility genes for asthma . In the present study, we evaluated the relationship between snps of scgb3a2 gene and susceptibility to asthma in a korean population . Two promoter snps (rs6882292, 659 g / a and rs1368408, 112 g / a) showed associations with asthma in allele, genotypic models, and haplotype . The minor allele distributions of rs6882292 and rs1368408 snps in the asthma group were higher compared to those of the control group, indicating the minor alleles are risk factor for asthma in a korean population . In analysis by sex, the association with asthma only showed in the male group, not in the female group . Scgb3a2 gene was found to be related to thyroid and lung cancer . In a previous study conducted in a chinese han population, the rs6882292 snp haplotype was composed of rs1368408 and rs6882292 snps, which were reported to be correlated with graves disease . The rs1368408 snp (also known as scgb3a2, 112g> a promoter polymorphism) showed the strongest association with graves disease among chromosome 5q31 - 33 in a chinese han population . A study of graves disease in the united kingdom also showed that rs1368408 was linked to common disease variation in 5q31 - 33 region . It is downstream - regulated by thyroid transcription factor 1 [ttf-1, also known as nk2 homeobox 1 (nkx2 - 1)], which also regulates the expression of other thyroid genes and lung surfactant genes . Moreover the rs1368408 snp has been previously studied in regard to asthma in a japanese population . Individuals with a allele of rs1368408 were about more 4.1 times more likely to have asthma compared to individuals with g / g genotype . Inoue et al . Showed that plasma scgb3a2 levels were associated with the g-112a scgb3a2 gene promoter polymorphism and the severity of asthma . However, batra et al . Found no association in an indian population, and rigoli reported not significant association in sicilian children . Among the snps reported that rs7726552 showed significant association with allergic rhinitis; however, no association was observed between asthma in their study . Regarding the function between the promoter polymorphisms and asthma, a allele of rs1368408 in scgb3a2 gene promoter decreases the affinity of a particular nuclear protein to the binding site around 112 bp, resulting in reduced transcriptional activity and ultimately leading to lower expression of scgb3a2 protein . Our results suggest that promoter snps (rs6882292 and rs1368408) in scgb3a2 gene may contribute to susceptibility to asthma in a korean population . However, the present study has some limitations, including sample size and function with asthma . Our results showing an association between the promoter polymorphisms of scgb3a2 gene and asthma need to be confirmed in studies with larger sample sizes or in other population, and functional studies are also needed.
In 2007, the world health organization (who) launched its initiative for the global elimination of congenital syphilis, with the goal that by 2015 at least 90% of pregnant women are tested for syphilis and at least 90% of seropositive pregnant women receive adequate treatment . Subsequently in september 2010, paho member states approved a strategy and plan of action for the elimination of mother - to - child transmission (mtct) of hiv and congenital syphilis by resolution 50/12 at the 50th directing council meeting [2, 3]. One of the three targets set was reduce the incidence of congenital syphilis to 0.5 cases or less per 1,000 live births by 2015 . The caribbean community (caricom) health ministers endorsed this initiative . In adults syphilis is a complex sexually transmitted disease that has a highly variable clinical course . Clinically the primary lesion (chancre) presents mainly as an anogenital ulcer that appears 990 days after exposure, although extra - anogenital sites such as the lip, tongue, and tonsils from oral sex and kissing, nipple from kissing or wet nursing of infected babies, and finger with minor abrasion from touching infectious lesions can occur . Secondary syphilis presents with generalised rash affecting the palms and soles, generalised lymphadenopathy, and orogenital mucosal lesions, including snail tract ulcers and condylomata lata . Gummatous syphilis (sometimes known as benign tertiary syphilis) can involve organs or supporting structures and can result in infiltrative or destructive lesions leading to granulomatous lesions or ulcers (e.g., skin) or perforation / collapse of structure (e.g., palate and nasal septum) or organomegaly . Late neurosyphilis can cause meningovascular syphilis leading to stroke syndromes and parenchymal involvement leading to general paresis and tabes dorsalis . Cardiovascular syphilis involves the aortic arch, which can lead to angina from coronary ostitis, aortic incompetence, and aortic aneurysm . There is sparse data reflecting the true occurrence of congenital syphilis (cs) in trinidad . In 1990 ali reported that during the period from january 1985 to december 1988, 28 cases of cs were diagnosed shortly after birth at one major hospital in trinidad with an average annual incidence of 1.5 per 1000 live births, seen at that particular institution . Subsequently paho reported 45 cases of congenital syphilis in 2009 for the entire country, a rate of 2.3 per 1000 live births; both pieces of evidence suggest that cs remains a public health challenge . Diagnosis and prevention of mother - to - child transmission of syphilis (mtct) are feasible, inexpensive, and cost - effective in nearly every situation evaluated . In fact congenital syphilis is preventable if a single dose of 2.4 million units of benzathine penicillin g is given to a pregnant woman with the infection during the first two trimesters of pregnancy [911]. The challenge is to find such women . In order to monitor progress towards the goals of the elimination initiative in the region, paho requested that member countries gather information on several key programmatic elements . In trinidad there are two tier systems of health care both operating independently of each other, a public health care system (phcs), and a private health care system (prhcs). The phcs is funded by the ministry of health (moh) and therefore all services are free as opposed to the prhcs which is based on a fee for service model . The largest provider for the diagnosis and treatment of sexually transmitted infections is the moh through a dedicated vertical program delivered at the queen's park counselling centre (qpcc). The laboratory services delivered by this program extend to prhcs and therefore offer a reliable source of data from which syphilis occurrence in trinidad and can be estimated . The aim of this study therefore is to describe the current status of acquired syphilis in trinidad, trends over the first decade of the 21st century, and a spatial analysis of syphilis cases, to inform strategies for achieving the elimination of syphilis . The qpcc is a repository for all clinical and laboratory data for syphilis for the entire population of 1.3 million . Thus all clinical cases and laboratory investigations associated with a diagnosis of syphilis or cs were eligible for entry into the study . We defined syphilis and cs using the cdc surveillance case definitions, which include clinical features as well as a laboratory diagnosis . In particular for syphilis clinical features included one or more of the following: chancres consistent with primary syphilis, localized or diffuse mucocutaneous lesions often associated with generalized lymphadenopathy and, a reactive serologic test (nontreponemal: venereal disease research laboratory (vdrl) or treponemal (fluorescent treponemal antibody absorbed)). Similarly for cs the clinical features occur in an infant or child such as hepatosplenomegaly, rash, condyloma lata, snuffles, jaundice (nonviral hepatitis), pseudoparalysis, anaemia, or oedema (nephrotic syndrome and/or malnutrition) and stigmata (e.g., interstitial keratitis, nerve deafness, anterior bowing of shins, frontal bossing, mulberry molars, hutchinson teeth, saddle nose, rhagades, or clutton joints) in older children . This was followed by laboratory confirmation using the treponema pallidum particle agglutination assay (tppa). The results of all serum samples tested by the laboratory for vdrl between 2009 and 2012 were reviewed . Vdrl positive samples using standard methods and quantitative vdrl testing were eligible for entry into the study . A positive vdrl supported by a positive confirmatory test was used to tract the clinical records to ensure that a case of syphilis met the case definitions . From the clinical records, data on age, gender, ethnicity, and address (without street number) we also used secondary data published by the moh for the period 19942009 to demonstrate trends . This data reports only the recorded number of cases for each calendar year and published by the moh in the annual reports of the moh . The street addresses of established syphilis cases diagnosed, between 01/01/2010 and 31/12/2012 only, were collected and mapped using arcmap 10.0 gis software (esri, redlands, ca, usa). The geocoded addresses were transformed into a density map, using the spatial analyst kernel density tool areas with the highest density of syphilis (defined as areas with greater than ten cases per square mile over the three - year period) and were designated as hot spots . In addition we calculated a standardized incidence ratio (sir) with 95% confidence intervals (ci) using the approach by vandenbroucke . All data was stored, retrieved, and analysed under strict confidential cover using spss versus 18 . Data published by the ministry of health (moh) for the period 20042009 revealed a decline in aggregate cases of syphilis during this period (figure 1). This decline was observed in both males and females . Since there were no published data by the moh for 20102012 we reviewed the laboratory records at the qpcc to determine the number of laboratory confirmed cases for the period (20102012). In addition in order to validate the most recent data published by the moh, that is, 2009, we also reviewed the clinical and laboratory records at the qpcc for 2009 . We found the number of cases of syphilis for 2009 was 507 and not 130 as reported by the moh . Overall the number of cases of syphilis for the period 200912 averaged 428, with cumulative incidence rates varying between 39 and 29 per 100 000 population for this period . There were 64 confirmed cases, 37 (57.8%) males and 27 (42.2%) females . More than half (14, 52%) of the females who tested positive came from samples received from prenatal clinics . For the first time data were collected on the sexual orientation of the positive cases . There were more cases of syphilis among heterosexuals (47, 73.4%) than homosexuals (11, 17.2%) or bisexuals (6, 9.4%). These numbers should be interpreted cautiously since it is reasonable to assume (although unknown) that the heterosexual population is much larger than bisexuals or homosexuals . In addition risk taking behaviour, attitudes, and practices among these groups are unknown . Using only data reported by moh in fact it appears that in 2009 trinidad had almost reached the target of 0.5 cases per 1000 live births . Three hot spots were identified (beetham gardens, san juan / laventille, and arima) using the kernel method (figure 3). Arima has the second highest population density of 2890 km on the island; both beetham gardens and san juan / laventille also have high population densities of> 1500 km . Hence all the areas identified as hot spots were urban and densely populated . The major finding of the study was the high levels of occurrence of syphilis still occurring in parts of trinidad . In fact between 2009 and 2012 the average number of cases per annum was 428 with an incidence rate as high as 39 per 100 000 population . The highest rates of syphilis were predominantly found in urban men and women in their sexually most active years, that is, between the ages of 15 and 35 . On average, women become infected at a younger age than men . Consequently, the prevalence of active syphilis is higher among young women than their male peers, a finding that has also been observed for hiv, herpes simplex virus type 2 (hsv-2), and other stds [1517]. However in developed countries such as the usa, for instance, there were 46 042 cases of syphilis in 2011 and the rate of primary and secondary syphilis increased by 3.8% among men (from 7.9 to 8.2 cases per 100,000 men) during 2010 - 2011 [18, 19]. On the other hand, the rate decreased to 9.1% among women (from 1.1 to 1.0 cases per 100,000 women), while in western europe rates have fell below 5 per 100 000 in the majority of countries [2123]. The implication of this finding is clearly that young women are at high risk, and this is of special concern as a high proportion of women become pregnant or commence childbearing before reaching 20 years of age, thus sustaining prenatal transmission and congenital syphilis . These findings support the implementation of educational programs among adolescents to encourage safer sexual behavior and improved treatment seeking behaviour . Based on this evidence we advocate for adolescent sexual health education programs to be implemented in the school curriculum . Another important finding of the study is the large discrepancy in data reported by the moh for 2009, that is, 130 reported cases versus 507 cases actually collected from a review of laboratory data . National health data are required for planning and evaluation of service delivery [2426]. This planning and evaluation is critical in developing countries where the majority of health services are provided through national programs and the limited funds must be used efficiently and effectively [24, 25, 27]. In these settings, high data quality is important to ensure that decisions reflect program needs and direct health professional education priorities [2528]. Poor data quality not only contributes to poor decisions and loss of confidence in the systems but also threatens the validity of impact evaluation studies . While the study did not focus on the reasons for this discrepancy, several studies have reported inconsistencies in data reporting as well as poor support mechanisms to ensure data quality as it traverses several levels of governmental bureaucracy [3032]. For example a study done in nepal found that data obtained from the facility registers were lower than the data reported at the district level, showing a tendency of overreporting to the higher levels . Other studies showed that errors in reporting were due to lack of supervision and feedback from the superior levels as well as inadequate incentives to health workers [3032]. The quality of data, and consequently of the information system, must be seen in a broader perspective focusing not only on technicalities (data collection tools and the reporting system) but also on support mechanisms . Another important finding was the widening gap in the occurrence of syphilis among men and women . Historically more men than women contracted the disease but by 1997 - 98 women began exceeding men and a decade latter this gap was the largest . This finding has two implications; first it is more likely for the disease to be sustained and propagated if women continue to be harbouring the infectious agent and are agents for transmission and secondly the risk of cs remains . While significant gains have been made with congenital syphilis, as of 2009 we are still above the targeted incidence of congenital syphilis, that is, 0.5 cases/1,000 live births . Three hot spots were identified using spatial analysis techniques, as well as a sir of 1.6 . The sir is generally calculated to provide an estimate of the likelihood that an excess of cases exists in the population of concern (hot spots) compared to the general or reference population . The measure is typically interpreted as an excess number of cases in this instance as much as 60% . There were several limitations to the study mainly the unavailability and difficulty to retrieve all data, which may hinder the exact burden of the disease . In addition because case definitions for congenital syphilis vary widely by country, measuring the attainment of the specific targets of the global initiative may be difficult . In a young child, the possibility of sexual abuse should be considered as a cause of acquired rather than congenital syphilis, depending on the clinical picture; this data could not be determined . Although congenital syphilis includes cases of syphilitic stillbirths we were unaware of the existence of such cases and hence it is not included in the study . In conclusion the occurrence of syphilis in trinidad continues to be high; this is against a background in which syphilis screening and treatment can cost less than us $1 per syphilis test and us $0.50 per penicillin dose, and health economists estimate that this is among the most cost - effective public health interventions in existence . In addition elimination of congenital syphilis as a public health problem by 2015 is an important and attainable component of global efforts to achieve the millennium development goals (mdgs) 4 (reduce child mortality), 5 (improve maternal health), and 6 (combat hiv / aids, malaria, and other diseases).
In recent years, several neuroimaging techniques have been employed to investigate the neural activity associated with motor imagery and the illusion of motion . The human brain is able to recognize changes in limb position and movement from both visual and somatosensory stimuli, and the information conveyed to the brain by limb position and musculoskeletal movement plays a vital role in forming a representational body image within the brain . Collectively, these senses are referred to as kinesthesia . In this context, it has been reported that the illusion of motion evoked by vibrating the tendon of a limb can be effective in stimulating motor control and that it can aid motor learning1 . The illusion of motion elicited by vibrating the tendon of a limb at the appropriate frequency is mediated by firing of ia afferent fibers that occurs in response to muscle spindle activity . The muscle spindle receptors are particularly sensitive to the direction and speed of limb movements; thus, during tendon vibration, subjects experience an illusion of motion, such as stretching of the affected muscles . Previous research has shown that the tendon vibration frequency optimal for eliciting the illusion of motion lies between 70 and 100 hz2,3,4,5 . One research group used magnetoencephalography (meg) to record brain activity while subjects experienced the illusion of motion evoked by vibrating the tendon of a limb6 and revealed that this type of stimulation activated regions within the primary sensorimotor cortex, supplementary motor area, and angular gyrus . Another research group used functional magnetic resonance imaging (fmri) to measure neural activity during the same illusion of motion1, 3 and reported neural activation in the contralateral primary sensory motor cortex, dorsal premotor cortex, supplementary motor area, cingulate motor cortex, and ipsilateral cerebellum . These motor areas are also known to be activated during both active limb movements and motor imagery7, 8 . With regard to clinical implications, gay et al . Reported that patients with complex regional pain syndrome (crps) type i experienced an improvement in both their pain symptoms and range of motion following vibration of the tendon of the affected limb and the associated illusion of motion9 . Goble et al . Reported an improvement in standing balance after vibration of the triceps tendon10 . Moreover, roll et al . Reported that the stimulation of illusory movements prevented the cortical disruption normally caused by immobilization in healthy people and that the illusion of motion evoked by vibrating the tendon of a limb could likely prove to be an effective prophylactic treatment following surgery and cast immobilization with conservative therapy11 . These basic and clinical research studies used a number of different stimulation devices, and the optimal vibration frequency used to evoke the illusion of motion varied between these studies . While the neural activation patterns occurring during the illusion of motion have been described previously, differences in brain activity associated with the use of different vibration stimulation devices, or with varying vibration frequencies, have not yet been investigated . In a clinical setting, it is important to determine the most effective method of stimulation, as well the optimal stimulation frequency to evoke a beneficial illusion of motion; if the therapy can be delivered in a simple and cost - effective manner, it can be made available to a larger number of patients . Therefore, in this study, we aimed to compare the effects of a conventional vibration stimulation device with those of 2 handy massagers, which are widely available at electronics stores . We used functional near - infrared spectroscopy (fnirs) to compare the patterns of neural activity occurring during the illusion of motion evoked by vibrating a tendon with these 3 devices . Twelve right - handed college students (7 women and 5 men; mean age, 21.6 years; range, 2022 years) with no previous history of neurological or other diseases participated in this study . All subjects provided written informed consent after being fully informed of the protocols and purpose of the study . Condition 1 was use of a vibration stimulation device (sl-0105 lp; asahi seisakusho co., ltd, saitama, japan) set at 80 hz, which was determined to be the optimal frequency in a previous study3; condition 2 was use of a handy massager (ycm-20; yamazen corporation, osaka, japan) at a frequency of 70 hz; and condition 3 was use of a handy massager (thrive md-01; thrive co., ltd, osaka, japan) set at a frequency of 91.7 hz . The frequency of the 2 massage devices were limited by their factory settings . The order in which the devices were used on each subject was randomized . During the trial, subjects were instructed to relax in a sitting position with their eyes closed . It has been reported that the illusion of motion is unlikely to occur until the muscle is relaxed1 . Subjects were also instructed not to open their eyes until instructed to do so, as visual information can disrupt the illusion of motion12 . The location selected for vibration stimulation was the common digital extensor tendon of the right wrist joint . The stimulation protocol consisted of 15 s of rest followed by 30 s of stimulation and was applied three times for each condition . The intensity of the illusion evoked was assessed by each subject using a visual analog scale (vas) immediately after each condition . The illusion of motion was confirmed to reproduce movement of the wrist, and the range of the illusion was measured using an electrical goniometer (sg150; biometrics ltd ., we defined the range of the illusion as the range of tendon vibration at which subjects experienced the illusion of motion . As a control, the skin surrounding the extensor tendon of the wrist was stimulated using the same protocol . This allowed us to subtract the brain activity evoked by skin irritation and excitement of meissner and pacinian receptors from the brain activity evoked by the illusory motion3, 4 . We measured neural activity in the brain by using an fnirs system (foire-3000; shimadzu corporation, kyoto, japan). The fnirs system, which had continuous wave laser diodes with wavelengths of 780, 805 and 830 nm, was used to record cortical activity at a sampling rate of 5 hz . In brief, we employed a 49-channel system with 30 optodes (15 light sources and 15 detectors). This system detects changes in cortical concentrations (mm mm) of oxygenated hemoglobin (oxyhb), deoxygenated hemoglobin, and total hemoglobin, by applying the modified beer - lambert law . The optodes were positioned according to the international 10/20 system, with cz located beneath the 7th light source and the other optodes located at intervals of 3.0 cm, centering around the 7th light source . The fnirs topographic map covered the front parietal area, which was divided into 8 different regions of interest (rois, fig . Fifteen light sources (red numbers) and 15 detectors (blue numbers) covered the frontoparietal area . Solid white numbers denote measuring channels, which were divided into 8 regions of interest . ), based on the functional anatomy of the parietal and prefrontal regions . The left sensorimotor cortex was covered by channels 17, 18, 21, 22, 26, and 27; the right sensorimotor cortex was covered by channels 14, 15, 19, 20, 23, and 24; the left and right premotor cortices were covered by channels 30, 31, 35, and 36, and by channels 28, 29, 32, and 33, respectively; the left and right prefrontal cortices were covered by channels 37, 38, 41, 42, 46, and 47, and channels 39, 40, 44, 45, 48, and 49, respectively; and the left and right parietal areas were covered by channels 3, 4, 8, 9, 12, and 13 and channels 1, 2, 5, 6, 10, and 1, respectively (fig . It has been reported that a delayed reaction is inherent in fnirs recordings; therefore, data were extracted beginning 5 s before the rest and task periods13 . Fifteen light sources (red numbers) and 15 detectors (blue numbers) covered the frontoparietal area . Solid white numbers denote measuring channels, which were divided into 8 regions of interest . To compare the range of the illusion of motion and the intensity of the illusion under each of the 3 conditions we used spearman s rank correlation coefficient to examine the relationship between the range of illusion of motion and the reported intensity of the illusion . In the fnirs analysis, we selected oxyhb levels as markers of cortical activity because oxyhb is the most sensitive indicator of locomotion - related changes in regional cerebral blood ow14,15,16 . Moreover, there are considerable individual differences in task - related changes in deoxyhb levels, probably due to variable neurovascular coupling in the elderly16,17,18,19 . Changes in the oxyhb levels were calculated during the task phases of rest and vibration, which were dened as follows: the rest phase was the 15 s before the beginning of the 30 s task (vibration) phase . Regional changes in the oxyhb level during the control and vibration phases were obtained from each channel in each subject . Data for 3 repetitions were averaged for each channel; then the value for each region of interest was obtained by averaging data from several channels (fig . 1) in each subject . To evaluate the effect of cortical activation during the control and vibration periods, we calculated the effect size (es) to adjust the inuence of differential path length factors among subjects and cortical regions on oxyhb levels20 . The es for the effect of the vibration task on activities was calculated by the following formula: mean oxyhb value during vibration task - mean oxyhb value during control task / standard deviation of oxyhb value during control task . We calculated es for each channel16, 21 and analyzed rois, including the right and left primary sensory motor area, premotor area, and parietal association area . Moreover, we employed roi analysis for the primary sensory motor area, premotor area, and parietal association area to compare the responses between the left and right hemispheres under each condition . For this analysis, we used two - way anova and performed multiple comparisons using scheffe s method . All statistical analyses were performed using the statistical package for the social sciences (spss) ver#17.0 (spss, chicago, il, usa). The threshold for statistical significance was set at p = 0.05 for all analyses . Under all 3 conditions, all 12 subjects experienced the illusion of motion . There was no significant difference in the range of illusion or in the intensity of the illusion between the 3 conditions (p> 0.05) (table 1table 1 . Range of illusion and illusion intensity under all conditionscondition 1condition 2condition 3range of illusion ()42.8 16.838.3 13.238.8 14.0illusion intensity (vas; mm)75.2 21.970 20.470.9 19.9mean sd . The illusion intensity and range of illusion were significantly correlated (p <0.05) (table 2table 2 . Correlation between range of illusion and illusion intensityrange of illusioncondition 1condition 2condition 3condition 1condition 20.83condition 30.850.95p<0.05; * p<0.01illusion intensity (vas)condition 1condition 2condition 3condition 1condition 20.83condition 30.870.92p<0.05; * p<0.01 . Vas: visual analog scale analysis of neural activity showed a significant increase in oxyhb level in the left premotor cortex (p <0.05), left and right sensory motor cortices, and parietal area (p <0.01) under all 3 conditions (table 3table 3 . Comparison of effect size in regions of interest (rois) under the 3 conditionsroiillusioncontrolright parietal association areacondition 10.133 0.317 * * 0.350 0.472condition 20.152 0.306 * * 0.330 0.454condition 30.119 0.318 * * 0.208 0.469right primary sensorimotor areacondition 10.030 0.369 * * 0.323 0.433condition 20.101 0.342 * * 0.349 0.432condition 30.003 0.345 * * 0.384 0.456right premotor areacondition 10.006 0.358 0.314 0.687condition 20.020 0.357 0.153 0.688condition 30.057 0.378 0.102 0.704left parietal association areacondition 10.149 0.360 * * 0.325 0.403condition 20.046 0.359 * * 0.202 0.398condition 30.106 0.328 * * 0.240 0.420left primary sensorimotor areacondition 10.118 0.278 * * 0.192 0.256condition 20.114 0.278 * * 0.164 0.229condition 30.188 0.295 * * 0.256 0.243left premotor areacondition 10.147 0.415 * 0.149 0.382condition 20.168 0.397 * 0.107 0.382condition 30.106 0.416 * 0.198 0.399mean sd . Multiple comparison analysis revealed no significant difference in brain activity among the different vibration stimulation devices used . In this study, we found no significant difference in the intensity of the evoked illusion or in the range of the illusion of motion between the 3 conditions; furthermore, the illusion intensity and range of illusion of motion were significantly correlated under all 3 conditions . This indicates that each one of the vibration stimulation devices used elicited the same illusory effect . We observed a significant increase in oxyhb concentrations in the left premotor cortex, left and right sensory motor cortices, and parietal area under each of the 3 conditions during the illusion of motion . We also observed neural activation in the same brain areas as previously reported1, 3, 6 . Previous studies investigating vibration stimulation of the tendon consistently reported the optimal frequency for eliciting the illusion of motion as being between 70 and 100 hz2,3,4,5 however, these studies used different vibration stimulation devices . The stimulation frequencies of the 2 handy massagers used in this study were between 70 and 91.7 hz, which is within the range reported to be optimal for eliciting the illusion of motion . In the current study, we demonstrated that these devices could reliably evoke not only the same illusion intensity and range of illusion of motion but also the same patterns of neural activity as that produced using more sophisticated vibration stimulation devices . Previous studies have shown that the illusion of motion evoked by vibration stimulation of the tendon activates the same brain areas as those activated during both active movement and motor imagery7, 8 . During active movement, efferent sensory information is input to the brain as the muscle contracts, and information from the muscle spindles plays an important role in the perception of movement and of changes in limb position . The primary motor cortex is crucial for kinesthetic information processing and perception of movement and position1, 22 . Here, we observed increased activity in the primary motor cortex during the illusion of motion . This was most likely due to afferent input from muscle spindles, as well as the illusion of motion caused by vibration stimulation of the wrist tendon . Thus, we think that active movement and illusion of motion are associated with similar patterns of brain activity . In addition, previous studies showed similar brain activity patterns for motor imagery and the illusion of motion evoked by vibration stimulation applied to a tendon8 . Notably, it has been reported that motor imagery can be effective in promoting functional recovery of the upper limb in patients with stroke28 . Further, the intensity of the illusion can be decreased or increased by actively evoking motor imagery and applying vibration stimulation to the appropriate tendon at the same time8, 26 . Thus, by employing a combination of the illusion of motion evoked by vibration stimulation and active motor imagery, the potential beneficial effects in a clinical setting can be maximized for both the techniques . Previous studies have also shown that illusory movements prevent the cortical disruption normally caused by immobilization in healthy people11 and that the pain symptoms and range of motion of patients with crps type i improved after they experienced the illusion of motion evoked by vibrating the tendon of the affected limb9 . Given the above findings, we believe that the illusion of motion evoked by vibration stimulation of a tendon could be effectively utilized in a clinical setting for prophylactic and rehabilitative purposes . Furthermore, our result showing that the illusion of motion can be reliably evoked using a handy massager within the optimal stimulation frequency indicates the possibility of making the technique easily accessible and affordable for a large number of patients in a variety of clinical settings.
Posterior chamber phakic intraocular lens (piol) implantation is generally accepted as an effective and reversible treatment method for high myopia with preservation of lens - regulating capability . In the ophthalmology clinic, the implantable collamer lens (icl, staar surgical, nidau, switzerland) is the main posterior chamber piols; it is designed to be placed between the iris and the anterior surface of the lens and is fixed to the ciliary sulcus by four haptics, thus preventing its contact with the lens . Although piol implantation has a good clinical efficacy in the correction of high myopia, some short - term and long - term complications have been reported . This complication may be caused by direct contact of the icl with the lens due to a low vault or insufficient circulation of the aqueous humor . The incidence of cataract after icl implantation ranges between 0.61% and 2.7%, depending on different follow - up periods in different studies [24]. High intraocular pressure is a major concern after icl implantation, particularly for early icl models [58]. To avoid postoperative elevation of intraocular pressure, peripheral iridectomy however, iridectomy may lead to pain and intraoperative bleeding and increase difficulty performing the operation . To avoid peripheral iridectomy, the v4c - icl model with a 0.36 mm central hole has been designed based on the v4-icl model . Because the central hole of the v4c - icl facilitates the outflow of the aqueous humor, peripheral iridectomy is not required . In addition, compared with the traditional v4-icl model, the v4c - icl model exhibits similar low-, middle-, and high - frequency contrast sensitivity and higher - order aberrations under the conditions of various pupil sizes, and the subjective symptoms such as glare or halo were also essentially equivalent, thus suggesting that the v4c - icl model has good safety and efficacy [9, 10]. Although studies have investigated the effect of v4c - icl implantation on patients' visual function status, to our knowledge, the effect of v4c - icl implantation on visual activity in the complex environment of the patients' daily lives has not been studied . It remains to be determined whether this subjective symptom can affect the patient's daily visual activity . Therefore, in this study, we conducted a questionnaire to investigate the effects of v4c - icl implantation on myopic patients' vision - related daily activities . This retrospective study collected data from 42 consecutive patients (82 eyes) with complete clinical data who underwent v4c - icl implantation at the affiliated hospital of zunyi medical college (zunyi, china) between november 2014 and november 2015 . All patients were followed up for more than 3 months (range, 3 to 6 months; mean, 4.62 1.23 months). The patients' average age was 24.04 4.75 years (range, 1835 years). The average preoperative sphere power was 10.21 3.02 diopter (d) (range, 4.0 d to 15.0 d), and the average cylinder power was 2.48 0.91 d (range, 1.25 d to 4.5 d). The average spherical equivalent (se) was 11.55 3.52 d (range, 5.75 d to 16.25 d). The preoperative and postoperative uncorrected visual acuity (ucva) and best corrected visual acuity (bcva) of the patients were recorded using the decimal method and converted into the logmar (logarithm of the minimal angle of resolution) equivalence . Ubm was used to detect the central and peripheral vault at 3 months after operation . Three months after operation, all patients were asked by the same doctor to evaluate the visual function . The questionnaire was designed based on the visual function evaluation questionnaire used by the corneal diseases and excimer laser research unit, university of dundee, scotland, with slight modifications . Since some patients complained of halos after v4c - icl implantation, we also investigated the effect on the visual functions of the presence of a halo in patients during the follow - up . This study was performed according to the declaration of helsinki, and all patients gave their informed consent after a comprehensive explanation of the possible risk of v4c - icl implantation . Inclusion criteria were bcva of 0.5 or above and refractive stability for more than 2 years . Exclusion criteria were age <18 years; anterior chamber depth <2.8 mm, ecd <2000/mm; corneal diseases; and a history of eye diseases affecting visual function such as glaucoma, cataract, retinal diseases, uveitis, and ocular trauma . The size of the v4c - icl was determined by the horizontal white - to - white corneal diameter and anterior chamber depth of the patients . The power of v4c - icl was calculated using the software provided by the manufacturer (staar surgical). Fifteen minutes before operation, compound tropicamide eye drops were applied to dilate the pupils, followed by topical anesthesia with 0.4% oxybuprocaine hydrochloride . For patients implanted with v4c - icl for astigmatism, the main incision site was created at the position of 135 and an auxiliary incision site was made at the position of 45. after introduction of viscoelastic materials to maintain the anterior chamber, the v4c - icl was slowly pushed into the anterior chamber using an injector cartridge . Then, the haptics of the icl was enclaved into the anterior chamber via the main and auxiliary incision sites using the manipulator . Numerical data are presented as mean sd . Analyses were performed using spss v17.0 software . Repeated analysis of variance was used to analyze the differences in intraocular pressure as well as ecd at different timepoints before and after the operation . Independent student's t - test was used to analyze the differences in the central vault and peripheral vault and the score of visual analog scale between different groups . The average preoperative spherical equivalent was 11.55 3.52 d (range, 5.75 d to 16.25 d). The average spherical equivalent was 0.12 0.33 d (range, 1.00 to 0.50 d) and the residual astigmatism was 0.18 0.32 d (range, 0.25 to 1.25 d) at 3 months after patients operations, excluding those patients with preexisting astigmatism who did not receive the implanted astigmatic v4c - icl model and required preservation of astigmatic power . The average preoperative ucva was 1.47 0.23 logmar (range, 1.15 to 2.0). The average ucva was 0.03 0.08 logmar (range, 0.18 to 0.30) at 3 months after operation . The uncorrected visual acuity had increased significantly at 3 months after operation compared with before operation (p <0.001). At 3 months after operation, ucva in 80 eyes (98%) was equal to or better than preoperative bcva . The average bcva at 3 months after operation was 0.03 0.07 logmar (range, 0.18 to 0.22), which was significantly better than preoperative bcva (average, 0.08 0.10 logmar; range, 0.08 to 0.40) (p = 0.029). The average preoperative intraocular pressure (iop) was 13.35 2.34 mmhg (range, 9.7 to 18.0 mmhg). One day after operation, the iop was slightly increased (average, 14.26 3.20 mmhg; range, 10.0 to 25.0 mmhg). Only one eye had an iop> 21 mmhg, and the iop returned to the normal level (14 mmhg) without any special treatment at the second day after surgery . At 1 month after operation, the iop was stable (average, 13.46 1.74 mmhg; range, 10.0 to 17.2 mmhg). At 3 months after operation, the average iop was 13.42 2.19 mmhg (range, 10.0 to 17.0 mmhg), which was not significantly different from that before (and at 1 month) and after operation (figure 1). Ecd was 2857.76 295.60 before operation, 2745.59 384.11 at 1 month after operation, and 2719.30 363.02 at 3 months after operation . Compared with the preoperative value, ecd at 1 month and 3 months after operation decreased by 3.92% (p = 0.144) and 4.83% (p = 0.065), respectively (figure 2). We investigated the peripheral vault (the perpendicular line between the end of suspensory ligament and the icl) and the central vault (the perpendicular line between the surface of the anterior lens capsule and the icl surface) at 3 months after icl implantation (figure 3). The peripheral vault was 0.25 0.17 mm (range, 0.03 to 0.92 mm) at 2 o'clock, 0.29 0.21 mm (range, 0.05 to 0.92 mm) at 4 o'clock, 0.23 0.12 mm (range, 0.06 to 0.64 mm) at 8 o'clock, and 0.22 0.13 mm (range, 0.01 to 0.80 mm) at 10 o'clock . The central vault was 0.42 0.22 mm (range, 0.13 to 0.90 mm), which was significantly higher than the peripheral vaults (p = 0.000, 0.003, 0.000, and 0.000, resp . ). In one eye, the peripheral vault at 2 o'clock and 4 o'clock was as high as 0.92 mm, and the peripheral vault at 8 o'clock and 10 o'clock was 0.46 mm and 0.44 mm, respectively . The high vault value may be due to icl tilt after implantation . During the 6-month follow - up, the patients had visual acuity of 0.08, normal iop (1116 mmhg), no endothelial damage, and normal daily visual activities . The patients were required to fill out a questionnaire about visual functions at 3 months after operation . Complete questionnaires were returned by 42 patients and all of these patients answered the questionnaire satisfactorily . In table 1, items 1 - 2 evaluated near vision, items 35 evaluated far vision, item 6 was for night vision, and items 711 were for middle - distance vision . We evaluated the daily activities associated with near vision, far vision, and middle - distance vision . Apart from one patient who had a difficulty reading computer screens, all patients had satisfactory or very satisfactory results . We also investigated whether the patients had a halo after operation . During the early postoperative follow - up period, halos occurred in 23 patients (54.8%). With time, halos gradually disappeared at 3 months after operation without any treatments . The patients were categorized into two groups: patients with halos and patients without halos . The average age in patients with halos was 25.5 4.3 years, which was not significantly different from those without halos (23.2 5.0 years) (p = 0.702). There were no significant differences in the scores of visual functions between the two groups (p> 0.05, table 2). Posterior chamber piol implantation is an effective refractive surgery that has been widely accepted . However, elevated intraocular pressure is a common postoperative complication after piol implantation, even in patients with preoperative or intraoperative iridectomy . To simplify the icl implantation procedure and improve postoperative aqueous circulation, clinical studies have shown that v4c - icl implantation is effective in the treatment of moderate and high myopia [9, 12, 13]. In the present study, we found that (after v4c - icl implantation) ucva was equal to or better than preoperative bcva in 80 eyes (98%) with high myopia . Almost all eyes had bcva equal to or better than preoperative bcva by one line or more . The postoperative ucva and bcva were 0.03 0.08 logmar and 0.03 0.07 logmar, respectively . The efficacy index and safety index were 1.27 and 1.28, respectively, which were consistent with previous studies [9, 1214]. These findings suggest that v4c - icl is a safe and effective treatment for high myopia, and it significantly simplifies the icl implantation procedure . During postoperative follow - up periods, intraocular pressure was stable and only slightly increased on postoperative day 1 . Due to the presence of the central hole, v4c - icl implantation avoids preoperative or intraoperative peripheral iridectomy, thus reducing iop elevation caused by surgical stimulation, depigmentation, and pupillary block . In the present study, we found that the ecd at 1 month and 3 months after operation were reduced by 3.92% and 4.83%, respectively . Compared with the preoperative value, postoperative ecd was not significantly decreased, which was consistent with the results reported by shimizu et al . . Although we found that v4c - icl implantation did not produce a short - term effect on ecd, it remains to be determined whether aqueous outflow through the central hole of the v4c - icl has a long - term effect on ecd . Further studies with long - term follow - ups and large sample sizes should be performed . Vault is one of the most important indices for evaluating the postoperative effect of the icl implantation . In the present study, we performed ubm to observe the relative position between the v4c - icl and the lens and found that no v4c - icl was in direct contact with the lens . The peripheral vault at each measured site was significantly lower than the central vault . This may occur because the center of the v4c - icl is designed to be thinner than the periphery . Evaluation of visual quality is a comprehensive method to evaluate the effect of refractive surgery and has been widely used . It has been reported that there is no significant difference in visual outcome between v4c - icl and v4-icl implantation [9, 10]. However, these studies only investigated the effect of v4c - icl and c4-icl implantation on contrast sensitivity and higher - order aberration . There were no reports about whether it affects the daily visual functions after implantation of v4c - icl . In the present study, we investigated the effect of v4c - icl implantation on vision - related daily activities during follow - up . We found that apart from one patient (2.4%) who had a difficulty in reading computer screen, all patients had satisfactory or very satisfactory results . In addition, we found that there were tilt icl in one eye of another patient . During the 6-month follow - up, the patients with tilt icl had visual acuity of 0.08, normal iop (1116 mmhg), no endothelial damage, and normal daily visual activities . In our short - term follow - up, even the tilt of the v4c - icl could not bring a serious impact on the patient . Of course it was necessary to observe the patient for a long term . During the early postoperative follow - up period, halos occurred in more than 50% (54.8%, 23 patients) of patients . With time there were no significant differences in the scores of visual functions between patients with or without halos . These findings suggest that halos do not affect postoperative vision - related daily activities . In conclusion, we investigated the vision - related daily activities at 3 months after v4c - icl implantation . We found that the patients were satisfied with their vision - related daily life activities, and the presence of central hole of v4c - icl did not affect vision - associated daily activities . Postoperative intraocular pressure was stable, and no vision - associated complications were found during the follow - up period . However, because v4c - icl implantation alters aqueous circulation, it remains to be determined whether v4c - icl implantation produces long - term effect on intraocular pressure and ecd.
Since the middle of the 1990s, numerous mergers and consolidations have taken place in the health insurance industry . In fact, the annual number of mergers among managed care companies averaged 43 during the 19942005 period and ranged from a low of 27 in 1995 to a high of 66 in 1996 (kaiser family foundation). Economic theory suggests that mergers among companies may confer net benefits upon society because of cost efficiencies that result from scale and scope economies . However, economic theory also indicates that horizontal mergers may allow the newly combined company to enjoy the advantage of increased market power . The increased market power may translate into higher prices received for products and/or lower prices paid for inputs . Theory suggests that the unbridled exercise of market power in output or input markets can generate net social losses . In a series of annual reports, the american medical association (ama 2003, 2004, 2005, 2006) has collected and reported information on the concentration of health insurers in various metropolitan areas of the united states . Based on this data, the ama finds a health insurance industry that is characterized by a few dominant health insurers and believes that these dominant firms may engage in monopoly and monopsony behavior . Hence, this organization warns that health insurers may raise insurance premiums and thereby reduce the number of insured individuals . In addition, the ama stresses that health insurers may lower reimbursement rates paid to health care providers and, as a result, cause contrived shortages of medical care . Governor rendall of pennsylvania claims that a merger between the state s two largest health insurers, highmark inc . And the governor notes that employers in pennsylvania would be less likely to secure low premiums for health insurance if the merger is allowed . Moreover, nurses at landmark medical center in rhode island recently protested outside the office of blue cross / blue shield of rhode island because of the health insurer s failure to pay provider rates that sufficiently compensates for the quality of medical care delivered at the health care facility (malinowsky 2006). But are these concerns about the market power of health insurers truly justified on efficiency grounds or do they represent a situation where health care providers are attempting to protect their monopoly rents? Specifically, it is unclear if lower health care provider reimbursement rates by health insurers reflect the exercise of monopsony or monopoly - busting power . If the former, economic theory suggests that the lower price results in efficiency losses . But if the latter, efficiency gains occur from lower prices according to theory . Pauly (1998) and, subsequently, feldman and wholey (2001) explain that the only way to determine if health insurers exercise monopsony or monopoly - busting power is by empirically examining the impact of health insurer buying power on the utilization rate of medical services, an input in the production of health insurance . If it can be shown empirically that greater buying power of health insurers is related to lower (increased) utilization of medical services, then the evidence provides support for monopsony (monopoly - busting) behavior . Feldman and wholey (2001) provide the only empirical test, to date, for the monopsony versus monopoly - busting theories of health insurer buying power . Specifically, they investigate if health maintenance organizations (hmos) possess monopsony power in the markets for ambulatory and inpatient hospital services . Using a data set containing all hmos in the u.s . Over the period from 1985 to 1997 and multiple regression analysis, they investigate the importance of an individual hmo, as a single buyer, on the price paid and utilization of inpatient and ambulatory care . Buying power for hospital services is measured by the percentage of inpatient days in the market area purchased by each hmo . Ambulatory buying power is measured by the number of ambulatory visits purchased by each hmo per 1,000 active physicians in the market area . Feldman and wholey control for a host of supply and demand factors in the regression equation and find thathmobuying power lowers hospital price and increases hospital output . Thus, their evidence suggests that hmos use their buying clout to bust the monopoly power of hospitals . In addition, they determine that hmo buying power has no statistical impact on the price or output of physician care, perhaps because the physician services market is much more fragmented than the hospital services industry . Overall, feldman and wholey conclude that hmos do not exercise monopsony power and that they may have improved efficiency in the hospital services industry through their monopoly - busting power . While the study by feldman and wholey offers valuable insights, it is already dated and fails to consider the role of preferred provider organizations (ppos). Feldman and wholey s study covers the years from 1985 to 1997 but many consolidations among health insurers have taken place since that time . The increased consolidations may have conferred greater buying clout such that a single health insurer can more easily exploit its monopsony position . Also, feldman and wholey do not consider if ppos possess monopsony power . As a result, this study uses more recent data to explore the monopsony power of hmos and ppos in the hospital services market . The analysis is conducted at the metropolitan level over the years from 2001 to 2004 . Six different measures of hospital output are employed and the buying power of the two types of mcos is measured by the herfindahl / hirschman index (hhi) of market concentration based on the health insurers enrollment shares in the various metropolitan areas . An instrumental variables approach is employed to control for the possibility that health insurer concentration is endogenous at the industry level . The empirical results consistently and strongly suggest that hmos and ppos do not exercise monopsony power in the typical hospital services market . Indeed, some evidence is found to support the monopoly - busting theory of health insurer concentration . The sample used to investigate the impact of mco buying power on various measures of output in the hospital services industry has its roots in the series of reports issued by the ama . The ama began collecting and disseminating information on the concentration of health insurers at the state and metropolitan levels in 2001 . Since that time the ama has issued three additional reports . Each report contains data for the hhi separately for the hmo and ppo segments of the health insurance industry in various metropolitan statistical areas (msas) of the u.s.1 the number of msas covered in the ama reports has increased over time, growing from 40 in 2001 to 294 in 2004 . Several reasons have been offered for treating hmo and ppo plans as distinctly different health insurance products (us v. aetna 1999). First, the two plans differ in terms of benefit design, costs, and other factors . For example, hmo plans are more restrictive with features such as gatekeepers and tighter provider networks . In addition, hmos are known to provide greater preventive care benefits and place limits on treatment options . Second, employers and employees often perceive ppo and hmo plans as different products that meet different needs and appeal to different types of enrollees . In fact, enrollees who drop an hmo plan are disproportionately more likely to choose another hmo plan . Finally, the price elasticity of demand for hmo plans has been found to be relatively low suggesting that very few consumers may switch to ppo plans given an increase in price . As a result, hmo and ppo plans are considered as two different insurance products in the empirical analysis . The relevant geographical market (rgm) for health insurance is assumed to be the msa in the ama reports because kopit (2004), and others, have argued that the health insurance marketplace is local in nature since employers and consumers / patients want access to nearby health care provider networks . For example, an employer in philadelphia would be unlikely to switch to a health insurer with an established network of providers in boston . In their research on the impact of competitive behavior on the profitability of hmos, pauly et al . (2002) assume that the metropolitan area represents the relevant geographical market for health insurance . In the forthcoming empirical analysis, the msa is also treated as the rgm for hospital services . While this definition of the rgm is not without its weaknesses (dravove and white 1994), urban hospital markets are commonly defined in this manner for empirical work (joskow 1980; manheim et al . But because msas like chicago, los angeles, or new york city may be too large for an individual hospital services market, the empirical test is also performed using a subset of msas that contain fewer than 2 million people to check the sensitivity of the results . (2006) argue that treating the metropolitan hospital services industry rather than the individual hospital as the unit of analysis offers a benefit to the econometrician . They note that quality of care and patient case - mix both differ considerably across hospitals within a given geographical area as a result of individual hospitals specializing in the delivery of certain services . 485) write; hospital a admits more fevers of unknown origin and performs more combined liver kidney transplants, hip replacements, and coronary by - pass grafts and hospital b has more tooth extractions, vaginal deliveries without complications, and circumcisions, it is an unfair comparison . By focusing on the msa as the unit of analysis, these supply - side differences across individual hospitals within a given geographical area are averaged out to some degree, thereby allowing a cleaner isolation of the relationship between market factors and hospital services at the msa level (keeler and ying 1996). As the msa level, the distribution of treatments and quality of care is likely to be more comparable because of closer similarities in the underlying types and severities of illnesses across areas . Because a panel data set helps to control for unobservable heterogeneity, the sample is defined as those msas with at least 2 years of health insurer concentration data over the period from 2001 to 2004 . That restriction results in a total maximum sample size of 344 msa observations over the 4 year period with a maximum cross - sectional sample of 86 msas . While the total number of observations seems relatively small, the 86 msas account for over 50% of the population in the u.s . Thus, the panel data set potentially conveys a considerable amount of useful information on the behavior of health insurers and health care providers . Health forum (various years) provides data for six indicators of hospital output . Four direct measures of hospital services are employed: total admissions, total inpatient days, total surgeries, and total outpatient visits . Revenue data necessary for determining price are unavailable so only the impact of health insurer buyer power on output can be empirically observed . Because the monopsony and monopoly busting theories both predict that insurers buying power should reduce providers prices, it seems perfectly acceptable to examine the impact of insurer concentration on quantity without examining its impact on price . To check the consistency of the findings, the total number of hospital personnel and labor costs are specified as indirect indicators of hospital services . The expectation is that total labor costs and number of personnel change in the same direction as the direct measures of hospital output given the derived nature of medical inputs such as labor in production . To isolate the pair - wise correlation between the various measures of health insurer concentration and each indicator of hospital services, it is important to control for as many supply and demand factors as possible . However, the lack of consistent time - series / cross - sectional data forced us to be parsimonious in our selection of independent variables . Control variables in the basic model are population, per capita income, and the number of hospitals in the msa along with a set of time and metropolitan dummy variables . Data for population and income come from the bureau of economic analysis and health forum (various years) provides the data for the number of hospitals . No expectations are made regarding the sign of the estimated coefficients on population and income per capita because they simply control for a host of factors influencing hospital services that relate to scale or physical environment and socioeconomic conditions . However, the sign of the estimated coefficient on the number of community hospitals is expected to be positive for two reasons . Market demand is not perfectly inelastic, the greater supply will be associated with an increased quantity of hospital services . Second, a single hospital is likely to hold less market power when more hospitals exist in the market area so the quantity of services is expected to be higher . In an alternative specification, but with fewer observations, the following are specified as additional control variables: the percentage of the population under 15, the percentage of the population over 65, the percentage of the population with a bachelors degree, the percentage of the population that is white, the percentage of the population that is poor, the unemployment rate, and median value of housing in each msa during each year . These variables should help control for the impact of age distribution, education, wealth, and health insurance coverage, among other effects, on the demand for hospital services . Based upon a review of the literature, scanlon et al . (2006) conclude that the omission of market characteristics such as these affect the conclusions drawn from empirical studies concerning the effects of health insurance competition . As a final test, the alternative model is estimated with a sample of msas with fewer than 2 million people because the true rgm for hospital services may be less broadly defined in practice than some of the very large msas . That is, both the level of hospital services, variously measured, and the degree of health insurer concentration may be jointly influenced by some unobservable factors . For example, the expansion decisions of both hospitals and health insurers may be jointly influenced by the health status of people in their market areas . Therefore the concentration of the hmo and ppo submarkets is modeled in the first stage of the two stage multiple regression analysis . Because employer - sponsored health insurance remains the dominant form of private health insurance in the u.s ., the number of firms in the msa serves as one instrument to capture the size of the employer market . Experimentation shows that this variable fits the first stage model best when specified in quadratic form (in logs). Indicators of firm size distribution have previously been used as instrumental variables in the prediction of the number or market penetration of health insurers (dranove et al . The size distribution of firms in the msa is captured in the estimation equation by the average number of employees per firm . Data for the number of firms and employees are obtained from the msa business patterns website at the u.s . Census bureau (various years). Finally, the penetration rate of hmos at the state level in the previous year is specified as an additional instrument . The prior year state hmo penetration may indicate the extent to which state regulations such as guarantee issue, community - rated premiums, and state insurance mandates hinder the entry and scale of health insurers . The expectation is that a greater hmo penetration at the state level is associated with a lower level of insurer concentration (more health insurers) at the msa level . All of these variables are likely to be correlated with health insurer concentration but not the level of hospital output a necessary property for a good instrumental variable . All variables are expressed in log - form in both the first and second stage regression equations . Notice that the average hhi for the hmo and ppo product markets exceeds the threshold for a highly concentrated market of 1,800 as set by the department of justice and federal trade commission . Also notice that the hhi varies considerably across msas, with the index ranging from just over 1,000 to well over 9,000 . Interestingly, the mean hmo - hhi increased from 3,651 in 2001 to 4,323 in 2003 but declined to 4,244 in 2004 (data not shown). Also, the mean ppo - hhi increased from 4,115 in 2001 to 4,599 in 2001 but declined to 4,179 in 2004 . Given that the ama increased the number of msas in their sample from 1 year to the next, it is not possible to draw any meaningful implications about the overall trend in industry concentration from their data . Table 1descriptive statisticsvariablemeanstandard deviationminimum valuemaximum valuenumber of observationsadmissions187,613228,6645,0701,341,277344inpatient days1,047,5091,399,99739,4709,884,548344surgeries139,169156,6784,698981,518344outpatient visits2,694,4643,487,177110,06823,545,341344personnel21,58227,618855181,500344labor expenses2,482,7203,367,97257,03425,139,710344population1,869,6732,739,524108,68018,754,585344per capita income30,5046,10314,38549,276344number of community hospitals16.517.91102344hhi for hmos40432065112710000262hhi for ppos4322157913709363265number of firms (employers)43,64462,8732,797533,528338employees per firm16.102.4710.6123.04338hmo state penetration rate in previous year30.0113.826.5053.50344percent young0.0710.0120.0440.112233percent old0.1220.0360.0720.274233percent white0.7320.1110.4910.936233percent with bachelor degrees0.1080.0320.03670.226233percent unemployment7.4671.831414233percent poverty13.5365.527644233median value of owner - occupied housing178,007125,97556,087689,276233 descriptive statistics the descriptive statistics in table 1 also indicate that that a sizeable amount of variation exists in the degree of seller concentration in the various metropolitan hospital services industries . According to the data, although an hhi would be preferred to measure seller concentration for the sake of consistency, the data source provides only the number of community hospitals in each metropolitan area . (2005) show that inferences regarding the broad effect of competition are not sensitive to whether the number of hospitals or hhi is used to measure the intensity of seller competition in the hospital services industry . Table 2 provides the regression results for the first stage predicting the hmo and ppo hhis . According to the results, hmo concentration declines with metropolitan size, as measured by population, whereas ppo concentration increases with metropolitan size . Interestingly, hmo and ppo concentration both first decline and then increase at some point with respect to the number of firms in the msa . Also, greater hmo market penetration at the state level in the previous year tends to be associated with lower hhi and ppo concentration, as expected . Finally, the average number of employees per firm evidently influences the number and size distribution of ppos but not hmos . More importantly, the set of instruments in each first stage equation has a statistically significant impact on the hhi as determined by a wald test . In addition, the f - statistics exceeds the threshold value of 10, as set by staiger and stock (1997), for detecting weak instruments . Table 2first stage results for hmo and ppo concentrationlog of hmo - hhilog of ppo - hhiconstant39.11(3.93)2.954 (0.16)log of population0.265 (2.39)1.679 (4.45)log of per capita income0.901 (1.16)0.988 (0.87)log of number of hospitals0.066 (0.90)0.047 (0.31)log of number of firms3.026 (3.92)2.320 (1.95)log of number of firms squared0.130 (3.76)0.104 (1.94)log of employees per firm0.151 (0.46)2.826 (5.25)log of state hmo penetration rate in previous year0.336 (2.92)0.546 (1.59)number of observations256259adjusted r0.8980.261f - test for instrumental variables10.96 (prob.=0.0000)17.91 (prob.=0.0000)notes: coefficient estimates with t - statistics reported in parenthesescross - section seemingly unrelated standard errors and covarianceall specifications include msa and time fixed effects indicates statistical significance at the 5% level indicates statistical significance at the 10% level first stage results for hmo and ppo concentration notes: coefficient estimates with t - statistics reported in parentheses cross - section seemingly unrelated standard errors and covariance all specifications include msa and time fixed effects indicates statistical significance at the 5% level indicates statistical significance at the 10% level selected findings for the second stage results are reported in tables 3 and 4 . Recall that monopsony theory predicts a negative coefficient estimate on the hmo - hhi, and ppo - hhi . In contrast, positive coefficient estimates on these concentration variables provide empirical support for the monopoly - busting theory . Looking first at the results for the basic equation reported at the top of table 3, we can see that the estimated coefficient on the hmo - hhi has a negative sign in only two of the six equations . In addition, the hmo - hhi possesses a positive and statistically significant coefficient estimate in the inpatient days equations . While the coefficient estimates on the ppo - hhi are negative in 4 of the 6 equations, they are not different from zero at conventional levels of statistical significance . In addition, the ppo - hhi has a positive and statistically significant coefficient estimate in the outpatient visits equation . Taken alone these regression results indicate that health insurers do not possess monopsony power on the buyer side of the hospital services market . Table 3abbreviated two stage least square resultsmeasure of outputestimated coefficient (t - statistic) on hmo - hhiestimated coefficient (t - statistic) on ppo - hhiadjusted rnumber of observationsbasic modeladmissions0.059(0.82)0.021(0.41)0.998252inpatient days0.150(2.81)0.015(0.22)0.997252surgeries0.003(0.02)0.030(0.38)0.995252outpatient visits0.091(0.52)0.238(2.25)0.987252hospital personnel0.110(1.17)0.093(1.60)0.990252labor expenses0.020(0.18)0.056(0.81)0.997252alternative modeladmissions0.081(0.92)0.010(0.18)0.997172inpatient days0.181(2.71)0.003(0.04)0.996172surgeries0.008(0.08)0.033(0.67)0.995172outpatient visits0.220(0.82)0.199(2.20)0.989172hospital personnel0.015(0.34)0.024(0.46)0.996172labor expenses0.069(0.65)0.005(0.07)0.997172 all continuous variables expressed as logs . Control variables include population, per capita income, number of hospitals, and a set of metropolitan dummy variables same as above plus percent young, percent old, percent white, percent with bachelor degrees, percent unemployed, percent poverty, and median value of owner - occupied housing (in logs) cross - section seemingly unrelated standard errors and covariance indicates statistical significance at the 5% level indicates statistical significance at the 10% leveltable 4abbreviated two stage least square results for msas with fewer than 2 million peoplemeasure of outputestimated coefficient t - statistic) on hmo - hhiestimated coefficient (t - statistic) on ppo - hhiadjusted rnumber of observationsalternative modeladmissions0.041(0.59)0.052(0.67)0.992118inpatient days0.186(2.92)0.042(0.47)0.989118surgeries0.147(1.13)0.114(0.75)0.984118outpatient visits0.097(0.67)0.015(0.19)0.985118hospital personnel0.056(0.59)0.017(0.16)0.989118labor expenses0.006(0.07)0.002(0.02)0.992118 control variables include population, per capita income, number of community hospitals, percent young, percent old, percent white, percent with bachelor degrees, percent unemployed, percent poverty, median value of owner - occupied housing (all in logs), and msa and time fixed effectscross - section seemingly unrelated standard errors and covariance indicates statistical significance at the 5% level indicates statistical significance at the 10% level abbreviated two stage least square results all continuous variables expressed as logs . Control variables include population, per capita income, number of hospitals, and a set of metropolitan dummy variables same as above plus percent young, percent old, percent white, percent with bachelor degrees, percent unemployed, percent poverty, and median value of owner - occupied housing (in logs) cross - section seemingly unrelated standard errors and covariance indicates statistical significance at the 5% level indicates statistical significance at the 10% level abbreviated two stage least square results for msas with fewer than 2 million people control variables include population, per capita income, number of community hospitals, percent young, percent old, percent white, percent with bachelor degrees, percent unemployed, percent poverty, median value of owner - occupied housing (all in logs), and msa and time fixed effects cross - section seemingly unrelated standard errors and covariance indicates statistical significance at the 5% level indicates statistical significance at the 10% level once additional control variables are added to the basic model, not much change occurs in the magnitude and statistical significance of the estimated coefficients on the hhis, as shown in the bottom panel of table 3 . Moreover, no statistical evidence is found to support a monopsony view of health insurer concentration . The number of inpatient days is directly related to greater hmo concentration and a direct relationship exists between ppo concentration and the number of outpatient visits . Table 4 shows the multiple regression findings when the sample is limited to msas with fewer than 2 million people . The concern is that the rgm for hospital services market may be too broadly defined in the larger msas . These results closely mirror the results for the larger sample of msas . Like before, hmo concentration is directly related to the number of inpatient days . The only difference is that ppo concentration is no longer associated with an increased number of outpatient visits.2 all in all, the empirical results strongly suggest that health insurers do not possess monopsony power . Greater hmo concentration is shown to be associated with an increased amount of inpatient services and some evidence indicates that higher ppo concentration and outpatient visits are directly related . More specifically, the estimated elasticities suggest that a 10% increase in hmo concentration is associated with about 1.51.9% more inpatient days . Using sample averages, that percentage difference means 3 more patients per day are treated at the typical hospital on an inpatient basis because of 10% greater hmo concentration . It also may mean that hospitals are less likely to release patients quicker and sicker when health insurers are more influential in their market areas . The results also imply a 10% increase in ppo concentrationmay be associated with 2% more outpatient visits . That percentage translates into nearly 9 more outpatient visits per day at the typical hospital . The implication is that hospitals typically reduce some services and thereby raise price in the absence of health insurer buying power.3 following the suggestion of pauly (1998) and lead of feldman and wholey (2001), this paper revisits the question of whether health insurers possess monopsony power . The test is conducted by observing the impact of health insurer concentration on the quantity of hospital services . Monopsony (monopoly - busting) theory predicts an inverse (direct) relation between health insurer concentration and hospital services . This paper extends the literature on this topic by investigating the impact of hmo and ppo concentration on six different measures of services offered by metropolitan hospitals during the period 20012004 . Taking all of the empirical results together the relationships between buyer concentration and the six different measures of hospital services are either direct or statistically insignificant . Consequently, it appears that much of the attention being paid to consolidations among health insurers may largely reflect that health care providers are trying to protect their monopoly rents . In fact, the empirical findings suggest that health insurers, when they possess more buyer clout, can negotiate additional inpatient days and outpatient visits without necessarily raising the number of personnel and labor expenses (2006) who find empirically that metropolitan hospitals are more efficient when health insurers dominate the health insurance industry at the state level . One intriguing aspect of the results concerns the finding that hospital services may be influenced differently depending on whether greater buyer concentration shows up in the hmo or ppo segments of the hospital services industry . It appears that increased buyer concentration from hmos puts pressure on hospitals to increase inpatient services whereas ppos may impact the amount of outpatient services . That discrepancy likely reflects that ppo enrollees use outpatient hospital facilities more often than hmo enrollees because the latter typically must obtain prior authorization from their gate - keeper primary care givers . Because price data are unavailable for the test, we cannot be sure if the ineffectiveness of hmos and ppos, with regard to influencing the provision of some types of hospital services like admissions or surgeries, holds because these buyers could not secure price discounts or because they were unable to affect health care provider behavior.4 or it may be the case that inpatient days and outpatient visits are more discretionary at the margin than the other types of services.
Polycystic ovary syndrome (pcos), a heterogeneous condition associated with irregular menstrual cycles and androgen excess, is a common gynecological endocrine disorder affecting 6%-12% of premenopausal women . Since the national institutes of health (nih) sponsored conference on pcos in 1990, it has become appreciated that the syndrome encompasses a broader spectrum of signs and symptoms of ovarian dysfunction than those defined by the original diagnostic criteria . The 2003 rotterdam consensus workshop concluded that pcos is a syndrome of two of three criteria: oligo- or anovulation; clinical and/or biochemical signs of hyperandrogenism; polycystic ovaries on ultrasonography (excluding other etiologies). Pcos can be suspected if only one of the following two criteria is met: (i) clinical signs of hyperandrogenism or biochemical hyperandrogenism; () polycystic ovaries on ultrasonography . Even with these clinical requirements, pcos cannot be confirmed until other factors that give rise to hyperandrogenism and ovulation failure have been excluded . Hyperandrogenism is a complex and variable syndrome that has not been clearly defined in pcos . Hirsutism is a common manifestation of hyperandrogenism; other clinical signs of androgen excess include acne, seborrhea, androgenic alopecia and virilization . Virilization, including clitoromegaly, deepened voice, increased muscle mass and decreased breast size, is less uncommon . These clinical signs are usually associated with markedly elevated levels of circulating androgen from ovarian or adrenal tumors, but controversies remain, including racial differences . There is considerable heterogeneity in clinical studies among women with hyperandrogenism and there could be multiple clinical phenotypes, even in a single patient at different age . Andy et al ., in a study of 716 patients diagnosed with pcos, found that the prevalence of hyperandrogenemia, acne and hirsutism [modified ferriman gallwey (mf - g) score> 6] in pcos was 75.3%, 14.5% and 72.2%, respectively . Reilly et al . Found a significantly higher prevalence of acne and signs of hyperandrogenism in women with polycystic ovaries compared with those with normal ovarian morphology . The prevalence of acne in women with pcos has been estimated to be 10%-34%, which is significantly higher than that in normal women . Found no correlation between serum total testosterone levels and the prevalence of hirsutism in patients with pcos . Moreover, about 50% of normal women with acne do not have clinical or biochemical evidence of hyperandrogenism . Inferred that acne is not associated with hormonal variables, but that hirsutism has a positive association with total testosterone in pcos . These issues have led to confusion and reflect lack of understanding about hyperandrogenism in pcos, and asynchronicity between clinical metabolic signs and hyperandrogenism needs to be explained . This study was designed to investigate the complex symptoms of hyperandrogenic disorders and correlations between metabolism and hyperandrogenism in patients with pcos from an outpatient reproductive medicine clinic in china . We studied 125 chinese adult women with pcos diagnosed according to rotterdam criteria and 130 women with regular menses as controls . The subjects were prospectively recruited among outpatients at center for reproductive medicine of jiangsu province hospital from october, 2013 to december, 2014 . The study protocol was approved by the institutional review board of the research institute for endocrine sciences . The diagnosis of pcos was based on the revised criteria of the 2003 european society of human reproduction and embryology / american society for reproductive medicine: (1) oligomenorrhea and/or anovulation (eight or fewer menstrual cycles in 1 year or menstrual cycles> 35 days in length); (2) clinical and/or biochemical signs of hyperandrogenism; (3) polycystic ovaries (presence of 12 or more follicles in each ovary measuring 29 mm in diameter and/or increased ovarian volume> 10 ml) and exclusion of other etiologies (e.g. Congenital adrenal hyperplasia, androgen secreting tumors, cushing's syndrome). Patients who had received hormone therapy in 3 months before initiation of our study were excluded to avoid sex hormone interference . The clinical data of 130 reproductive - aged women with normal menses period were collected as control . We used questionnaires to obtain information of their medical history, family history, lifestyle, hormone levels and clinical signs of hyperandrogenism (e.g. Hirsutism, acne). Body mass index (bmi) was calculated as weight (kg)/height (m). According to the asia pacific criteria of bmi for obesity, bmi 25 kg / m waist: hip ratio (whr) was calculated as waist circumference (cm)/hip circumference (cm) and used to measure abdominal obesity . We divided the pcos patients into 2 subgroups: hyperandrogenism (ha)/non - hyperandrogenism (nha) and the groups with hyperandrogenism signs (hs) /non - hyperandrogenism signs (nhs) according to their serum total testosterone and clinical signs of androgen excess . Hyperandrogenism was defined as total testosterone (nmol / l) higher than the 95% confidence interval (ci) of the control group (2.67 nmol / l), patients with higher total testosterone belonged to the ha group . Clinical signs of hyperandrogenism were acne, hirsutism, seborrhea, androgenic alopecia and virilization . Patients with one of clinical hyperandrogenic signs were assigned to the hs group, and others were in the nhs group . The amount of excess terminal hair growth was assessed using the mf - g method, scoring the presence of terminal hairs over nine body areas (upper lip, chin, chest, upper and lower abdomen, thighs, upper and lower back, and upper arms) from 0 to 4, hirsutism was defined as mf - g score 6 . The presence of acne and seborrhea was also recorded, though there is no specific scoring system for this factor . Clinical variables including waist circumference, hip circumference, body weight and height were assessed in all subjects . Whole blood was sampled on day 23 of the menstrual cycle or during amenorrhea in pcos patients . Basal sex hormone levels were measured in all pcos and control subjects, including serum luteinizing hormone (lh), follicle stimulating hormone (fsh), estradiol, prolactin and total testosterone . Total testosterone and sex hormone binding globulin (shbg) were measured by radioimmunoassay (north institute of biological technology, beijing, china) and analyzed using an automatic clinical chemistry analyzer (olympus au5400). Free androgen index (fai = total testosterone / shbg 100%) was used to evaluate free testosterone levels . To evaluate glucose metabolism in pcos, we calculated the homeostasis model assessment - estimated insulin resistance (homa - ir) value correlations between age and pcos related parameters were evaluated using pearson's correlation coefficients with two - tailed significance tests . Chi - square analyses were used to compare the prevalence of acne, hirsutism and obesity between pcos subgroups . We calculated prevalence and 95% cis for the various groups, and odds ratio (or) was determined for symptoms . Categorical variables were compared by the chi - square or fisher's exact test as appropriate . We studied 125 chinese adult women with pcos diagnosed according to rotterdam criteria and 130 women with regular menses as controls . The subjects were prospectively recruited among outpatients at center for reproductive medicine of jiangsu province hospital from october, 2013 to december, 2014 . The study protocol was approved by the institutional review board of the research institute for endocrine sciences . The diagnosis of pcos was based on the revised criteria of the 2003 european society of human reproduction and embryology / american society for reproductive medicine: (1) oligomenorrhea and/or anovulation (eight or fewer menstrual cycles in 1 year or menstrual cycles> 35 days in length); (2) clinical and/or biochemical signs of hyperandrogenism; (3) polycystic ovaries (presence of 12 or more follicles in each ovary measuring 29 mm in diameter and/or increased ovarian volume> 10 ml) and exclusion of other etiologies (e.g. Congenital adrenal hyperplasia, androgen secreting tumors, cushing's syndrome). Patients who had received hormone therapy in 3 months before initiation of our study were excluded to avoid sex hormone interference . The clinical data of 130 reproductive - aged women with normal menses period were collected as control . We used questionnaires to obtain information of their medical history, family history, lifestyle, hormone levels and clinical signs of hyperandrogenism (e.g. Hirsutism, acne). Body mass index (bmi) was calculated as weight (kg)/height (m). According to the asia pacific criteria of bmi for obesity, bmi 25 kg / m waist: hip ratio (whr) was calculated as waist circumference (cm)/hip circumference (cm) and used to measure abdominal obesity . We divided the pcos patients into 2 subgroups: hyperandrogenism (ha)/non - hyperandrogenism (nha) and the groups with hyperandrogenism signs (hs) /non - hyperandrogenism signs (nhs) according to their serum total testosterone and clinical signs of androgen excess . Hyperandrogenism was defined as total testosterone (nmol / l) higher than the 95% confidence interval (ci) of the control group (2.67 nmol / l), patients with higher total testosterone belonged to the ha group . Clinical signs of hyperandrogenism were acne, hirsutism, seborrhea, androgenic alopecia and virilization . Patients with one of clinical hyperandrogenic signs were assigned to the hs group, and others were in the nhs group . The amount of excess terminal hair growth was assessed using the mf - g method, scoring the presence of terminal hairs over nine body areas (upper lip, chin, chest, upper and lower abdomen, thighs, upper and lower back, and upper arms) from 0 to 4, hirsutism was defined as mf - g score 6 . The presence of acne and seborrhea was also recorded, though there is no specific scoring system for this factor . Clinical variables including waist circumference, hip circumference, body weight and height were assessed in all subjects . Whole blood was sampled on day 23 of the menstrual cycle or during amenorrhea in pcos patients . Basal sex hormone levels were measured in all pcos and control subjects, including serum luteinizing hormone (lh), follicle stimulating hormone (fsh), estradiol, prolactin and total testosterone . Total testosterone and sex hormone binding globulin (shbg) were measured by radioimmunoassay (north institute of biological technology, beijing, china) and analyzed using an automatic clinical chemistry analyzer (olympus au5400). Free androgen index (fai = total testosterone / shbg 100%) was used to evaluate free testosterone levels . To evaluate glucose metabolism in pcos, we calculated the homeostasis model assessment - estimated insulin resistance (homa - ir) value . Correlations between age and pcos related parameters were evaluated using pearson's correlation coefficients with two - tailed significance tests . Chi - square analyses were used to compare the prevalence of acne, hirsutism and obesity between pcos subgroups . We calculated prevalence and 95% cis for the various groups, and odds ratio (or) was determined for symptoms . Categorical variables were compared by the chi - square or fisher's exact test as appropriate . Of the 125 pcos patients, 5.6% were obese (bmi 30 kg / m), 9.6% overweight (bmi 25 - 30 kg / m) and 66.4% underweight (bmi <25 kg / m). Fifty - six patients had a family history of metabolic disease . Among them, 14.4% (13/125) had type 2 diabetes, 4.8% (6/125) had cardiac or cerebrovascular disease, 25.6% (32/125) had hypertension, 2.4% (3/125) had malignant tumor and 1.6% (2/125) had pcos . Bmi, total testosterone, lh / fsh, shbg and fai of pcos patients were significantly higher than those of the control group . Bmi: body mass index; tt: total testosterone; lh: luteinizing hormone; fsh: follicle stimulating hormone; shbg: sex hormone binding globulin; fai: free androgen index . As shown in table 2, there was no significant difference in mf - g score or whr between the ha and the nha groups . Compared with the nha group, ha: hyperandrogenism; nha: non - hyperandrogenism; hyperandrogenism is defined as tt (nmol / l) higher than the 95% confidence interval of the control group (2.67 nmol / l); bmi: body mass index; tt: total testosterone; shbg: sex hormone binding globulin; fai: free androgen index . Whr: waist - hip circumference rate; homa_ir: homeostasis model assessment - estimated insulin resistance . * p<0.05, * * p <0.001, * * * p <0.0001 . Our data indicated that pcos patients with general clinical signs of hyperandrogenism tended to have a higher bmi than patients without clinical signs (p = 0.002), whereas total testosterone, shbg and whr showed no significant differences between these two groups (table 3). Homa - ir was similar in pcos patients with signs of hyperandrogenism (hs group) to that in patients without signs (t = 0.026, p = 0.967). Bmi: body mass index; tt: total testosterone; shbg: sex hormone binding globulin; fai: free androgen index . Whr: waist - hip circumference rate; homa_ir: homeostasis model assessment - estimated insulin resistance . As shown in table 4, the ors for hirsutism was 1.866, but there was no significant correlation between these clinical signs of androgen excess and pcos . The or of acne was significantly lower in pcos patients with hyperandrogenism (p = 0.01). The or was 2.27 (95%cis: 1.22 - 4.2, p = 0.009) for overweight, which suggested that women with a high bmi had a significantly higher risk of pcos . As shown in table 5, pcos patients with hyperandrogenism showed no significant increase in acne or hirsutism (p = 0.72, or = 3.36, 95%ci: 0.5420.9; p = 0.25, or = 0.61, 95%ci: 0.261.41, respectively). The ha group had higher bmi and lower shbg than the nha group (p = 0.017, p = 0.018, table 2) and a higher risk of overweight (or = 4.41, 95%ci: 1.789.67, p = 0.001). However, hirsutism, acne and abdominal obesity were not significantly more common in the ha group than in the nha group . The standard deviation of the mean value of shbg in both pcos patients and controls was high (31.48, 52.18), representing a large range of variation . About 30% of women with pcos have hyperandrogenism a clinical and/or biochemical excess of androgens . More than 90% of plasma testosterone is bound to shbg, so fai level in plasma is a more sensitive indicator of hyperandrogenism than total testosterone . Obesity significantly affects the circulating concentrations of total testosterone and shbg . In adult women with hirsutism and pcos, obesity is associated with increased total testosterone and decreased shbg, which results in significantly elevated free and bioavailable testosterone . In this study, we found that pcos patients with clinical signs of hyperandrogenism tended to have a higher bmi than pcos patients without signs . However, the differences in serum total testosterone and shbg were insignificant between pcos patients with and without the symptom of hyperandrogenism . Clinical symptoms of hyperandrogenism include acne, hirsutism, seborrhea, androgenic alopecia and virilization . In pcos patients, acne, seborrhea and hirsutism are the most common signs, because the areas where these occur express the androgen receptor (ar). Reported the expression of ars in keratinocytes within pilosebaceous ducts and concluded that androgen directly influences keratinization in the acne process . Acne is a chronic inflammatory disorder of the pilosebaceous unit resulting from increased sebum production induced by androgen, altered keratinization, inflammation and bacterial colonization of hair follicles on the face, neck, chest and back . Hirsutism is the presence of excess hair growth in women and may indicate an underlying disorder of androgen production; in most cases, hirsutism results from a combination of mildly increased androgen production compared with non - hirsute women and increased skin sensitivity to androgens . The sensitivity of hair follicles to androgen is governed largely by 5-reductase activity in the skin . Androgen - independent hirsutism can be a familial trait (familial hypertrichosis) and is caused by several drugs . Following a prospective controlled study, slayden reported that hyperandrogenemia was evident in most non - hirsute, acneic patients, regardless of age . Several studies have shown that there is no correlation between serum total testosterone and the prevalence of hirsutism in patients with pcos, which is similar to our results . Although we did not find any significant results in our homa - ir analysis, another study has demonstrated that hyperandrogenism carried a significant risk of hyperinsulinemia because of stimulation of ovarian androgen secretion and inhibition of hepatic shbg production . Limitations of our study such as sample size and the sensitivity of our evaluation method may explain the lack of significant findings . Our data show that bmi is potentially related to the endocrine environment of patients with pcos . Pcos patients with higher bmi seemed more likely to suffer hyperandrogenism or to exhibit the clinical signs of androgen excess . Especially, it is necessary to explore the pathogenesis of acne and hirsutism in women with high bmi . Increased adipose mass is associated with the production of numerous factors including aromatase, leptin, plasminogen activator inhibitor 1, insulin resistance and dyslipidemia, all of which can lead to tissue damage . Obese patients with pcos have been shown to exhibit significantly more severe insulin resistance than obese women . Insulin increases 17-hydroxylase and 17 - 20 lyase (both are components of the p450c17 enzyme system) activity and stimulates the expression of 3-hydroxysteroid dehydrogenase in human luteinized granulosa cells . However, insulin decreases shbg, which results in concomitant elevation of free androgen tissue availability . In a study of 265 cases, obese women with pcos had a significantly higher prevalence of hirsutism than non - obese subjects, and our results are similar to this finding . However, following a study including 627 women in taiwan, china, yang et al . Reported that obese women, regardless of serum testosterone level, had a lower incidence of acne than non - obese women . We observed that some pcos patients with normal bmi also presented clinical / biomedical hyperandrogenism . Lin et al . Have concluded that ar gene polymorphism influences androgen metabolism, which might explain this phenomenon . In summary, serum testosterone and shbg levels did not differ between pcos patients with and without androgen excess . Moreover, we prove that bmi is a more sensitive, at least an important supplementary, diagnostic criterion of clinical / biomedical hyperandrogenism in pcos than total testosterone . It is therefore critical for pcos patients with clinical signs of androgen excess to maintain a normal body weight.
Pancreatitis is a major well - known complication of endoscopic retrograde cholangiopancreatography (ercp) with reported incidence ranging from 1% to 10% in various series [1 - 3]. But the most accepted theory is mechanical trauma to papilla or pancreatic sphincter causing transient obstruction to outflow of pancreatic juice . Another theory suggests the increased hydrostatic pressure in pancreatic duct caused by injection of contrast or saline cause injury to parenchyma . Regardless of mechanism, the cascade of events is initiated resulting in activation of proteolytic enzymes causing autodigestion of pancreas and impaired acinar secretion . This results in activation of inflammatory cascade causing both local inflammation and systemic effects [5, 6]. Non - steroidal anti - inflammatory drugs (nsaids) are potent inhibitor of phospholipase a2 which is thought to play a critical role in early inflammatory cascade . Rectal diclofenac is a cheap, widely available agent with easy method of administration and favorable side effect profile makes it an attractive option . There are limited data on efficacy of nsaids in prevention of post - ercp pancreatitis . Rectal diclofenac has been evaluated in few trials earlier but most trials included low - risk patients and sample size of these trials was very small . Till date, sparse indian data are available which evaluated rectal diclofenac in prevention of post - ercp pancreatitis . We conducted a prospective, single - center, open - labeled, randomized placebo - controlled trial evaluating role of rectal diclofenac in prevention of post - ercp pancreatitis in high - risk patients and whether it has any implications on severity of post - ercp pancreatitis . This study was performed at a tertiary care center between august 2011 and june 2014 . Inclusion criteria involved only those patients with high risk of developing post - ercp pancreatitis . Patients were considered having high risk of development of post - ercp pancreatitis if they had one or more major risk factors: suspected sphincter of oddi dysfunction (sod), prior history of post - ercp pancreatitis, difficult or failed cannulation (more than five attempts), repeated pancreatic cannulation, pancreatic duct injection with acinarization, pancreatic sphincterotomy, precut sphincterotomy, biliary sphincterotomy for suspected sod, and ampullectomy; or if they had two or more minor risk factors for development of post - ercp pancreatitis: female gender, young age, history of recurrent acute pancreatitis, normal serum bilirubin, lack of choledocholithiasis, pancreatic brush cytology, and balloon dilatation of intact biliary sphincter . Those patients not fitting the high - risk criteria, acute pancreatitis at the time of ercp, contraindications to the use of nsaids (active peptic ulcer disease or s. creatinine> 1.4 mg / dl), and who had ingested nsaids in last 1 week were excluded from the study . One hundred twenty - six patients were excluded from the study depending on the exclusion criteria . One group (n = 200) received rectal diclofenac suppository (containing 100 mg of diclofenac) immediately prior to or during the procedure . Other group (n = 200) received glycerine suppositories as placebos . Injection hyoscine was given for control of bowel motility . During the procedure, an assistant recorded the details of the procedure like timing of procedure, number of pancreatic duct cannulation and injection, difficulty in cannulation, and whether precut, pancreatic sphincterotomy, and balloon sphincteroplasty were done . Patients in rectal diclofenac or placebo group received rectal suppository immediately prior to or during the procedure . Pancreatic duct stents were placed in those patients in which pancreatic cannulation occurred more than two times or pancreatic injection with contrast or saline during the procedure . Patients were subjected to testing of serum amylase at 2 and 32 h post - procedure . Those patients who had no abdominal pain, vomiting, back pain and 2 h serum amylase levels less than two times upper limit of normal were started on oral liquids 3 - 4 h after ercp . Post - ercp pancreatitis was defined as rise in serum amylase more than three times upper limit of normal 24 h after ercp with associated clinical feature of severe abdominal pain requiring persistent hospitalization . Primary endpoint of the study was to detect number of patients developing post - ercp pancreatitis in both groups . Patients were subjected to routine biochemical investigations, imaging modalities like ultrasound abdomen and contrast - enhanced computed tomography to detect complications of pancreatitis . The severity of pancreatitis was graded as mild, moderate and severe according to days of hospitalization required and complications of pancreatitis . Mild post - ercp pancreatitis was defined as requiring an unplanned admission or prolongation of hospitalization by 2 - 3 days . Moderate post - ercp pancreatitis was defined as requiring hospitalization of 4 - 10 days and severe post - ercp pancreatitis was defined as requiring hospitalization of greater than 10 days or requiring intensive care or intervention for local complications of pancreatitis . The secondary endpoint of the study was to assess the severity of post - ercp pancreatitis in both groups ., we used fisher exact test to analyze the difference in proportion of patients with post - ercp pancreatitis in rectal diclofenac and placebo groups with p value <0.05 indicating significant difference . Patients demographic and clinical factors were compared using fisher exact test or x test as appropriate . For the analysis of primary endpoint, we used fisher exact test to analyze the difference in proportion of patients with post - ercp pancreatitis in rectal diclofenac and placebo groups with p value <0.05 indicating significant difference . Patients demographic and clinical factors were compared using fisher exact test or x test as appropriate . A total of 400 patients entered the study; 200 patients received rectal diclofenac, while 200 patients received glycerine suppository (control group). There were 128 (64%) female patients in rectal diclofenac group while 123 (61.5%) in placebo group . The mean age in rectal diclofenac group was 45.44 years while in placebo group was 47.86 years . The patients in both groups were well matched for the indication of ercp as depicted in table 1 . We compared various risk factors prior to or during the procedure which might increase the risk of post - ercp pancreatitis like pancreatic cannulation, precut sphincterotomy, suspected sod, pancreatic sphincterotomy, pancreatic duct injection, balloon sphincteroplasty in patients with suspected sod, and difficulty of failed cannulation in both groups . The baseline characteristics of the patients in both groups were identical as depicted in table 2 . A total of 23 patients, 12 in placebo group and 11 patients in rectal diclofenac group, received pancreatic stents due to recurrent pancreatic duct cannulation or pancreatic duct injection with acinarization . Twenty - nine out of 400 (7.2%) patients developed post - ercp pancreatitis . Six out of 200 (3%) patients in rectal diclofenac group developed post - ercp pancreatitis compared to 23 out of 200 (11.5%) patients in placebo group (fig . The difference was statistically significant with p value <0.05 . In a subgroup analysis, incidence of post - ercp pancreatitis in patients with suspected sod in rectal diclofenac group was 6% (4/66) while in placebo group was 18.8% (13/69). Among patients who received pancreatic stent, only one patient in rectal diclofenac group (1/11) developed post - ercp pancreatitis compared to two patients in placebo group (2/12); however, the number of patients in which pancreatic stenting was performed was low in our study . The secondary endpoint of the study was to assess the severity of post - ercp pancreatitis in both groups . The severity of post - ercp pancreatitis in rectal diclofenac group was mild in all six patients (100%), while in placebo group, it was severe in four patients (4/23, 17.3%), moderate in five patients (5/23, 21.7%) and mild in 14 patients (14/23, 60.8%) (fig . The difference in severity of pancreatitis in rectal diclofenac and placebo groups was statistically significant . Two out of four patients in placebo group who had severe post - ercp pancreatitis developed pancreatic pseudocyst, but were managed conservatively . One out of four patients in placebo group with severe post - ercp pancreatitis developed right - sided pleural effusion requiring therapeutic pleural tapping . One out of four patients in placebo group with severe post - ercp pancreatitis developed subacute intestinal obstruction . Two deaths occurred in the placebo group, both with severe post - ercp pancreatitis, one with right - sided pleural effusion and the other with subacute intestinal obstruction . Adverse events like bleeding while ercp in sphincteromized patients were noted in 16 patients, six in placebo group and eight patients in rectal diclofenac group but responded to adrenaline injection and coagulation . Rectal diclofenac suppository was well tolerated in all the patients with no adverse event noted with use of rectal diclofenac . Our study has shown that single dose administration of rectal diclofenac prior to or during the procedure has reduced the incidence of post - ercp pancreatitis ., our study has shown that rectal diclofenac was also effective in this group of patients in reducing post - ercp pancreatitis . Rectal diclofenac is a cheap drug, easily available and with a favorable side effect profile . Pancreatic stents are of proven benefit in preventing post - ercp pancreatitis [8, 9] but difficult to use in routine practice because of difficulty in pancreatic duct cannulation and requirement of operator expertise . But most accepted theory is trauma of thermal injury to papilla causing transient obstruction to pancreatic secretion . Another accepted theory is hydrostatic pressure due to contrast or saline injection into pancreatic duct . This injury initiates an inflammatory cascade leading to activation of proteolytic enzymes intraductally causing pancreatic autodigestion and impaired secretion . Diclofenac inhibits phospholipase a2 which is an important mediator of various reactions in this inflammatory cascade breaking this cycle [5, 6]. Peak concentration of rectal diclofenac occurs between 30 and 90 min after insertion with complete bioavailability . The elimination half life is 2 h. rectal diclofenac has been evaluated in different randomized clinical trials . In a study by murray et al, 220 patients with high risk of post - ercp pancreatitis were randomized in two groups, rectal diclofenac vs. placebo . In these patients there was significant reduction in incidence of post - ercp pancreatitis in rectal diclofenac group as compared to placebo which was similar to our study . However, in this study, there was no significant difference in patients with sod in rectal diclofenac vs. placebo group . Our study demonstrated that there is significant reduction in incidence of post - ercp pancreatitis even in patients with suspected sod . Khoshbaten et al evaluated the use of rectal diclofenac in patients with extrahepatic cholestasis undergoing ercp . This study also reported significant reduction in incidence of post - ercp pancreatitis in rectal diclofenac group similar to our study . However, this study has reported very high incidence of post - ercp pancreatitis (26%) in the control group . Oral diclofenac has been evaluated for prevention of post - ercp pancreatitis by cheon et al, but was found to be of no benefit . Though rectal diclofenac is such an attractive option in prevention of post - ercp pancreatitis, it is still underutilized . There are very few trials evaluating its use in prevention of post - ercp pancreatitis . This prospective single - center, open - labeled, randomized placebo - controlled trial has shown that use of single dose of rectal diclofenac immediately prior to or during the ercp in high - risk patients is effective in not only reducing the incidence but also severity of post - ercp pancreatitis . The major limitation of this study was severity of pancreatitis was graded according to the consensus guideline depending on days of hospitalization and complications . Various scoring systems like ranson s score and apache ii score were not utilized . However, similar guidelines were followed in previous studies . Rectal diclofenac prior to or during ercp in high - risk patients reduces the incidence as well as severity of post - ercp pancreatitis compared to placebo . Rectal diclofenac prior to or during ercp in high - risk patients reduces the incidence as well as severity of post - ercp pancreatitis compared to placebo.
Systemic lupus erythematosus (sle) is a systemic autoimmune disease with manifestations in multiorgans that are induced by the deposition of circulating autoantibody - autoantigen complexes (immune complexes, ic) and amplified by subsequent infiltration of different types of leukocytes promoting the inflammation . Lupus nephritis (ln), a major cause of morbidity and mortality in up to 60% sle patients, is characterized by inflammation of the kidney . Ic and subsequent complement activation both induce the activation and damage of renal cells that further release inflammatory factors leading to the infiltration of leukocytes into glomerular, tubulointerstitial, and perivascular regions of the inflamed kidney to amplify the renal inflammation and damage . Therefore, leukocyte recruitment to the inflamed kidney is a critical step in the development of ln . Chemokines are a group of cytokines with small molecular weight whose main action is the recruitment of leukocyte subsets under homeostatic and pathological conditions . Through interacting with chemokine receptors that are expressed on the cell surface as 7-transmembrane proteins coupled with g - protein for signaling transduction, chemokines can induce firm adhesion of targeted cells to the endothelium and direct the movement of targeted cells to their destination according to the concentration gradient of a given chemokine . Through this mechanism chemokines chemokines are classified into four subfamilies according to the first two cysteines and the amino acid residues in between at n - terminal end of the polypeptide . Based on whether the first two cysteines are adjacent, separated by one residue, or separated by three residues, a chemokine is classified into ccl, cxcl, or cx3cl family, respectively . Chemokine receptors are named corresponding to the subfamilies of chemokines as ccr, cxcr, cx3cr, or xcr, respectively . Individual chemokines and chemokine receptors discovered to date have been reviewed elsewhere with summarized tables [58]. Homeostatic chemokines and chemokine receptors are those important for the homing of progenitor cells and mature immune cells into the primary / secondary immune tissues for the development of the immune system and into peripheral nonimmune tissues for the tissue - specific functions and immune surveillance [5, 9]. Examples are ccr7 that is expressed on nave lymphocytes and dendritic cells for recruitment into lymph nodes by ccl19 and ccl21 as part of the normal immune system development; cxcl12 that is important for the retention of cxcr4 hematopoietic stem cells (hscs) in hsc niches in the bone marrow; ccl2 that is critical for ccr2 monocytes emigration from the bone marrow; and cx3cl1 that is essential for cx3cr1 monocytes patrolling along the blood vessels . On the other hand, when there is an infection or injury - induced inflammation, activated immune cells will upregulate some chemokine receptors and migrate into inflamed immune and nonimmune tissues by recognizing correspondingly increased inflammatory chemokines . For example, upon the stimulation of pathogen - associated molecular pattern molecules (pamp) or danger - associated molecular pattern molecules (damp), resident mast cells, macrophages, and dendritic cells will release cytokine signals to induce the upregulation of several inflammatory chemokines expressed by activated endothelial and epithelial cells, such as ccl2, ccl3, ccl4, ccl5, cxcl1, cxcl2, cxcl3, cxcl5, and cxcl8 . Consequently, circulating immune cells such as neutrophils, monocytes, and effector t cells will migrate into inflamed tissues using related chemokine receptors such as ccr2, ccr1, and cxcr2 . Chemokines, unlike adhesion molecules broadly shared by different types of immune cells, are selectively used by specific cell populations and have been found to be involved in the migration of leukocytes to nephritic kidney of both sle patients and lupus - prone mice . Studies have shown that several immune cell populations are accumulated in the kidney in ln, including various t cell subsets, b cells, plasma cells, nk cells, monocytes / macrophages, dendritic cells (dc), and neutrophils [10, 11]. In this review, we summarize recent studies on the chemokines that are increased in the kidney as ln progresses and the corresponding chemokine receptors used by renal - infiltrating leukocytes in response to the chemokines . We focus on those highlighted by multiple studies, including the chemokines cxcl13, cxcl12, cxcl9, cxcl10, cxcl11, ccl2, ccl3, ccl4, ccl5, and cx3cl1 and chemokine receptors cxcr5, cxcr4, cxcr3, ccr1, ccr2, ccr5, and cx3cr1 . Inflammatory factors inducing the expression of chemokines, as well as chemokines that may be used as biomarkers for the diagnosis of ln, are also discussed . Some chemokines are more commonly related to ln than others based on both studies of lupus - prone mouse models and sle patients, which have been summarized in tables 1 and 2, respectively . To interact with specific chemokine receptors expressed on particular cell populations, these chemokines have diverse biological effects by influencing the migration of different cell populations in both healthy and disease situations . In ln disease, animal model studies suggest that these chemokines contribute to systemic autoimmune responses in immune tissues thus indirectly promoting ln and are involved in local renal inflammation with direct effects . Evidence from human studies, on the other hand, suggests the clinical involvement of these chemokines in the development of ln . In the following sections we will discuss each of these ln - related chemokines regarding their biological effects, roles in mouse models of ln, and clinical evidence from studies of lupus nephritic patients . Cxcl13, also known as b cell - attracting chemokine 1 (bca1) or b lymphocyte chemoattractant (blc), is the chemokine recognized by cxcr5 . Cxcl13 is important in directing the trafficking of cxcr5 cells, including b cells, follicular helper cd4 t cells (tfh), cxcr5cd8 t cells, and cxcr5 dc, all involved in humoral immune responses [1214]. Both b cells and tfh critical for the formation of germinal centers (gc) depend on cxcr5 to migrate into the b cell follicles in secondary immune tissues [12, 1517]. Circulating cxcr5 central or effector memory - like tfh have also been discovered that could migrate to and function in immune and nonimmune tissues [1821]. Besides tfh, cxcr5cd8 t cells and cxcr5 dc are also found to facilitate b cell responses [13, 14]. Therefore, by attracting different types of cxcr5 immune cells, cxcl13 contributes to b cell responses, especially the generation of high affinity antibody - producing cells in gc . In two commonly used lupus - prone mouse models, nzb / w f1 and mrl / lpr, transcript levels of renal cxcl13 and cxcr5 are consistently increased in aged lupus nephritic mice compared to nonlupus control mice or young mice prior to disease onset [2225], suggesting their involvement in the development of ln . Renal macrophages and dc in lupus - prone mice may be the source of cxcl13 in the nephritic kidney [24, 2629], leading to increased migration of cxcr5 b cells and tfh - like cells into the inflamed kidney towards cxcl13 [24, 26, 30]. Further studies with nzb / w f1 mice have shown that, among b cell populations, b1 cells compared to b2 cells express much higher cxcr5 and migrate towards cxcl13 more efficiently in vitro [22, 30], and preferentially migrate into the kidney and lung of diseased mice instead of lymphoid tissues . Functionally, b1 cells isolated from nzb / w f1 mice, but not b2 cells, can activate t cells in allogeneic mixed lymphocyte reaction . Cxcr5 cd4 t cells, on the other hand, have been shown to promote igg production from b1 cells in vitro, suggesting potential interaction of b1 and t cells in situ in the nephritic kidney . However, another study found most renal - infiltrating b cells to be non - class - switched b2 cells in nzb / w f1 mice, leaving the role of renal cxcr5 b in ln an open question . While further studies are required, these results suggest important functions of cxcr5 and its ligand in the development of ln . The critical roles of cxcl13 and cxcr5 cells in the pathogenesis of ln are also evidenced by studies of anti - cxcl13 neutralizing antibodies in mrl / lpr lupus - prone mice and cxcr5-deficiency in b6/lpr lupus - prone mice [31, 32]. Renal pathology, including proteinuria and serum creatinine levels, glomerular and perivascular scores, deposition of ic and complement c3, and renal il-1, il-6, il-33, and il-17 protein levels, was significantly lower in the neutralizing antibody - treated mice than controls . Systemic autoimmune responses such as the level of circulating anti - double stranded dna (anti - dsdna) antibodies and the ratio of splenic th17/treg were reduced as well, suggesting that the pathogenic role of cxcl13/cxcr5 may not be kidney - specific . As the administration of anti - cxcl13 neutralizing antibodies is not tissue - specific, it is difficult to say if reduced renal pathology is due to the secondary effect of decreased systemic autoimmune responses or the direct effect of blocking cxcl13/cxcr5 signal in the kidney . Similar to the cxcl13 blockade study, cxcr5-knockout in b6/lpr mice also downregulated systemic autoimmune reactions, including reduced lymphadenopathy and splenomegaly with reduced gc, b cells, plasma cells, and double negative (dn) t cells in secondary lymphoid organs, as well as reduced circulating igg . Importantly, this study also showed reduced infiltration of adoptively transferred dn t cells from cxcr5-deficient b6/lpr mice compared to wild type b6/lpr mice into the kidney of rag1 recipient mice, indicating direct contribution of cxcl13/cxcr5 signal to local renal inflammation in ln . Therefore, cxcl13/cxcr5 contributes to the development of ln both systemically in immune tissues and locally in the kidney of lupus - prone mice . Evidence from the studies of sle patients with ln further suggests the clinical involvement of cxcl13/cxcr5 in the development of ln . In sle patients with ln, but not in healthy controls (hc), cxcl13 and cxcr5 are highly expressed in the cortex of the kidney . In addition, b cells and tfh - like cells that express cxcr5 have been indicated to infiltrate the nephritic kidney of sle patients and are colocalized with cxcl13-expressing regions . Besides chemoattractant functions, cxcl13 may also contribute to ln by activating cxcr5 renal nonimmune cells such as human podocytes to produce proinflammatory molecules . Cxcl12, also known as stromal cell - derived factor 1 (sdf-1), is the ligand of chemokine receptor cxcr4 . It is involved in the homing, retaining, and survival of cxcr4 hematopoietic stem cells, b cell precursors, and plasma cells in the bone marrow . In addition, cxcl12 maintains the homeostasis of neutrophils, t cells, and b cells in immune and nonimmune tissues [3638]. Studies have shown possible involvement of cxcl12 and cxcr4 in ln development . In lupus - prone mouse models, cxcr4 is consistently increased in various immune cell populations including b cells, plasma cells, t cells, neutrophils, and monocytes in the circulation and spleen of diseased mice, suggesting enhanced chemotaxis of these cells towards cxcl12 [3941]. Importantly, both cxcl12 and cxcr4 expressions are increased in the kidney of diseased lupus - prone mice, indicating migration of cxcr4 cells into the kidney as ln progresses [23, 24, 40, 42]. In particular, studies have shown the increased accumulation of cxcr4 cells in the kidney of diseased mice, including plasma cells, foxp3 cd4 regulatory t (treg) cells, foxp3 cd4 conventional t cells, and inflammatory monocytes and neutrophils [40, 41, 43]. Besides promoting leukocyte infiltration, cxcl12/cxcr4 may also deteriorate ln by directly affecting renal tissue cells . Studies have shown that activated parietal epithelial cells (pecs) as glomerular progenitor cells are involved in proliferative glomerulonephritis . Normally, pecs possess regenerative potential for the repair of injured kidney [45, 46]. However, in glomerulonephritis, cxcr4 is overexpressed on pecs upon inflammatory stimulation, whereas autoantibodies and inflammatory mediators stimulate cxcl12 production on injured podocytes [42, 44, 47]. Consequently, through the interaction between cxcl12 and cxcr4, pecs migrate into the glomerular tuft during the development of ln, where they predominately form hyperplastic lesions in proliferative glomerulonephritis and lead to glomerulosclerosis by secreting extracellular matrix [3, 44]. Blocking the interaction of cxcl12/cxcr4 in lupus - prone mice reveals their contributions to both systemic autoimmune responses in secondary lymphoid organs and local renal inflammation . Administration of anti - cxcl12 neutralizing antibodies in nzb / w f1 mice led to increased survival rate and reduced renal inflammation including decreased proteinuria and igg deposition . This may be at least partially due to decreased systemic autoimmune reactions, since circulating anti - dsdna igg and b1a subset in the peritoneal cavity and the spleen were reduced, as well as reduced activated cd4 t cells in the spleen and lymph nodes . The direct role of cxcl12/cxcr4 network to recruit immune cells in the lupus nephritic kidney is demonstrated in another study with administration of a cxcr4 antagonist in b6.sleyaa lupus - prone mice . Similar to anti - cxcl12 neutralizing antibodies, cxcr4 antagonist ameliorated ln with decreased renal pathological scores and proteinuria and prolonged lifespan . Early administration before severe proteinuria also led to reduced splenomegaly and circulating ana igg, suggesting a systemic effect . Splenic monocytes, activated t cells, and b cells in marginal zone and follicular and germinal center were similarly reduced . However, late administration after the onset of severe proteinuria did not influence systemic autoimmune responses but led to reduced infiltration of monocytes, neutrophils, and cd4 t cells into the kidney, suggesting a direct effect of cxcl12/cxcr4 in the kidney . In patients with ln, it has been consistently demonstrated that cxcl12 expression is significantly increased in tubules and glomeruli of the kidney, while most circulating cd4 t cells and b cells express cxcr4 in sle patients [6265]. Although it is debatable whether its level on b cells is reduced or increased [62, 65], cxcr4-expressing b cells are found to be accumulated in the renal biopsy samples of patients with ln, suggesting involvement of cxcl12/cxcr4 in the kidney of patients with ln . Cxcr3 is a chemokine receptor interacting with three interferon - inducible chemokines, cxcl9 (monokine induced by gamma - interferon, mig), cxcl10 (interferon - induced protein of 10 kda, ip-10), and cxcl11 (interferon - inducible t cell alpha chemoattractant, i - tac). Several immune cell populations have been reported to express cxcr3, including nk cells, plasmacytoid dc (pdc), conventional dc (cdc), b cells, and activated t cells . Among activated t cells, t helper 1 (th1) cells and effector cd8 t cells t helper 17 (th17) cells have also been reported to express cxcr3, although ccr6 is the predominant chemokine receptor on their surface . Since the expression of cxcr3 is induced upon activation of immune cells, especially in effector t cell populations, activated immune cells can migrate into inflamed peripheral tissues where cxcr3 ligands are induced . The three cxcr3 ligands under different circumstances have shown redundancy, dominance, collaboration, or antagonism to one another . Therefore, cxcr3 and its ligands are mainly associated with the effector stage of immune response and are regulated in a more complex fashion than single paired chemokines / chemokine receptors . Cxcr3 and its ligands are involved in the pathogenesis of sle . In lupus - prone mice, most commonly nzb / w f1 mice and mrl / lpr mice, cxcr3-expressing t cells and plasma cells as activated effector populations in the secondary lymphoid organs are increased during the development of ln [41, 48, 66, 74]. Importantly, studies have shown that cxcr3 and its ligands are increased in the nephritic kidney of lupus - prone mice, suggesting migration of cxcr3-expressing effector cells from the secondary lymphoid organs into the inflamed kidney [23, 24, 49, 66, 7476]. Detailed studies with mrl / lpr and nzb / w f1 mice reveal that cxcr3 is expressed on different renal - infiltrating cells with varied proportions, including cd4 t cells (1533%), cd8 t cells (1033%), b220 cells (including both b cells and pdc, 25%), plasma cells (40%), and macrophages (5%) [23, 48, 49]. All renal cxcr3 t cells are confirmed as cd44 activated t cells, while cd44 nave t cells are cxcr3-negative . In addition, renal - infiltrating cxcr3 plasma cells can secrete igg instead of igm, indicating their pathogenic role in promoting ln . While both cxcr3 and its ligands are increased in the kidney of lupus - prone mice with ln, their deficiencies in lupus - prone mice have shown inconsistent or even contradictory results . However, cxcr3- or cxcl9-deficiency in the nephrotoxic serum nephritis (nsn) model showed reduced nephritic disease with decreased igg deposits and activated t cells and macrophages in the kidney . This suggests that cxcl9 rather than cxcl10 may be critical for cxcr3-dependent cellular infiltration of the kidney in ln . Consistent with this, another study showed that cxcl9 in the kidney of diseased mrl / lpr mice was the most abundant chemokine for t cell trafficking . However, circulating antigen - specific igg was also reduced in cxcr3- or cxcl9-deficient nsn model, suggesting that cxcr3/cxcl9 interaction may influence systemic immune responses and indirectly affect kidney pathology . Further studies with cxcr3-knockout mrl / lpr and nzb / w f1 mice have shown different effects on the development of ln . With cxcr3-deficiency in mrl / lpr mice, glomerular pathology score was reduced with decreased t cells and macrophages infiltration around glomeruli, ameliorated renal lesion, and decreased proteinuria . Ifn-producing t cells and il-17-producing t cells were also reduced in the kidney but not in the spleen or lymph nodes of cxcr3-knockout mrl / lpr mice . Importantly, renal igg and c3 deposits and circulating total igg and anti - dsdna igg were not different between cxcr3-knockout and wild type mrl / lpr mice, suggesting a direct effect of cxcr3 and its ligands on the kidney by recruiting activated effector t cells and macrophages . However, in nzb / w f1 mice, cxcr3 deficiency did not change either the infiltration of plasma cells and t cells to the kidney or the course of ln . Therefore, further studies are required to determine whether cxcr3 is important for ln development and which ligand(s) are critical for the infiltration of cxcr3 cells to the kidney of lupus - prone mice . Despite controversial results from studies of lupus - prone mice, evidence from sle patients still suggests the possible involvement of cxcr3 and its chemokine ligands in the development of ln . Patients with active sle compared to hc or patients with inactive disease have reduced cxcr3 cd4 t cells in the circulation, suggesting infiltration of the cells into peripheral tissues . In addition, several studies have shown that, in sle patients with ln, compared to hc or patients without nephritic involvement, cxcr3 cells (mostly t cells) are increased in the kidney and urine, which is correlated with increased expression of renal cxcr3 ligands [26, 66, 67]. Moreover, it has been found that cxcr3 cells are accumulated in tubulointerstitial regions and around glomeruli in the kidney of lupus nephritic patients, account for 60% of total infiltrating cells, and are positively correlated with proteinuria . Among the three cxcr3 ligands, cxcl10 is most increased in sle patients and localized in the same region as cxcr3 cells in the nephritic kidney . Besides cxcr3-expressing t cells, a group of pathogenic cd19 b cells also express cxcr3 at a high level in sle patients and migrate towards cxcl9 in vitro, suggesting their potential to migrate into inflamed peripheral tissues such as the kidney . Ccr1 and ccr5 share the same ligands, ccl3 (macrophage inflammatory protein 1-alpha, mip-1) and ccl5 (regulated upon activation, normally t - expressed, and presumably secreted, rantes). Ccr1 is expressed on cd34 bone marrow progenitor cells, monocytes, nk cells, t cells, and preferentially on cd45ro activated / memory t cells [50, 77]. Ccr5 is expressed on monocytes / macrophages and t cells (both cd4 and cd8 subsets), especially on th1 cells [50, 79]. Interestingly, monocytes express a high level of ccr1 but low ccr5, while the expression pattern is the opposite in activated / memory t cells, suggesting selective expression of ccr1 and ccr5 in monocytes and activated t cells, respectively . Ccr1 or ccr5 knockout mice have been developed to study their functions in different disease models . Even though ccr1 and ccr5 share the same chemokine ligands, studies with unilateral ureteral obstruction and renal ischemia - reperfusion injury models have shown that ccr1 but not ccr5 is essential for t cells, macrophages, and neutrophils infiltration in the tubulointerstitial region of the kidney [8183]. Moreover, ccr1-deficient mice have enhanced macrophage and t cell infiltration to the glomerular region of the kidney in a nephrotoxic nephritis model, suggesting that such infiltration is ccr1-independent . Ccr1-deficient mice also exhibit increased circulating antigen - specific, th1-biased, pathogenic igg2a response, indicating that ccr1 is also involved in th1-dependent systemic humoral immune response . However, in a host versus graft disease (hvgd) model, ccr1-deficiency shows a protective effect by inhibiting chronic cardiac allograft rejection, which makes the role of ccr1 complicated in different diseases possibly depending on whether humoral immune responses are involved and/or which tissues and immune cell populations are involved . Regarding ccr5 deficiency, macrophages from ccr5-knockout mice have reduced ability to produce inflammatory cytokines including il-6, il-1, and tnf, rendering defective bacteria clearance in a listeria monocytogenes infection model . Ccr5-deficient t cells, on the other hand, have elevated production of ifn, granulocyte macrophage colony - stimulating factor (gm - csf), and il-4 with enhanced delayed - type hypersensitivity reaction and humoral immune responses following antigen challenge in ccr5-deficient mice . Ccr5 also contributes to the recruitment of treg in lymphoid and nonlymphoid tissues, which is important in suppressing effector responses in graft versus host disease- (gvhd-) targeted organs . Therefore, ccr5 deficiency in different diseases leads to different outcomes depending on which cell types are critical and whether the initial immune response (in lymphoid organs) or the effector phase (in nonimmune tissues) is involved . In lupus - prone mice, ccr1, ccr5, and their ligands are increased in the kidney during ln development [24, 25, 28, 4952, 54, 75, 76]. Studies have shown that, in nephritic nzb / w f1 mice, both renal t cells and monocytes / macrophages have elevated ccr1 expression on the surface . In mrl / lpr mice, the administration of a ccr1 antagonist at late stage improved ln with reduced interstitial lesions including decreased infiltration of t cells and monocytes / macrophages, reduced inflammation - induced proliferating and apoptotic cells, and reduction of tubular atrophy and interstitial fibrosis . However, glomerular igg deposits and different isotypes of circulating anti - dsdna igg reflecting systemic humoral autoimmune response did not change, suggesting a direct effect of ccr1 antagonism on preventing renal infiltration of t cells and macrophages . This was confirmed by reduced renal infiltration of adoptively transferred t cells and macrophages pretreated with the ccr1 antagonist . The role of ccr1 in ln was limited in interstitial region, as glomerular injury and proteinuria were not improved by ccr1-antagonist administration in mrl / lpr mice . In nzb / w f1 mice, the effect of ccr1 antagonist administration at late stage has also been studied . Besides the similar effects of ccr1 blocking t cells and macrophage infiltration, the study with nzb / w f1 mice also showed prolonged lifespan and improved glomerular injury including reduced proteinuria . In mrl / lpr mice, the extent of ccr5 expression is debated, as over 50% of renal t cells express ccr5 in one study, whereas only 1% of t cells are shown to express ccr5 in another study [49, 52]. Renal - infiltrating macrophages, on the other hand, are ccr5-positive in mrl / lpr mice . Contrary to the effects of ccr1 blocking, ccr5 knockout in mrl / lpr mice deteriorated ln with increased proteinuria and tubulointerstitial infiltration of total cd3 t cells and f4/80 macrophages in the kidney . Foxp3 tregs were also increased in the kidney of ccr5-knockout mrl / lpr mice, but ln progression was not reversed by the increase of treg cells . Systemic humoral immune responses were not affected by ccr5 deficiency, as the circulating anti - dsdna igg and renal igg / c3 deposits were not different between ccr5-knockout and wild type mrl / lpr mice . However, ccr5-knockout mrl / lpr mice exhibited increased splenomegaly and elevated circulating / renal ccl3, suggesting that renal - infiltrating immune cells may use alternative chemokine receptors responding to ccl3 such as ccr1 to migrate into the kidney and promote ln . This study reveals possible roles of ccr5 in negatively regulating ln progression by modulating ccl3 production and controlling lymphoproliferation in the spleen . Therefore, it appears that ccr1 and ccr5 may, respectively, promote or attenuate the development of ln in lupus - prone mice . In sle patients, ccr1, ccr5, and their ligands are also increased in the kidney during the development of ln [69, 70, 86, 87]. Evidence from sle patients further shows that most ccr1 cells infiltrating in the kidney are cd68 macrophages [63, 69], while ccr5, on the other hand, is expressed on both circulating and renal - infiltrating t cells in sle patients, particularly interstitial infiltrating t cells . Ccr2 is expressed on a fraction of monocytes, dendritic cells, nk cells, and t cells, and one of its ligand is ccl2 (monocyte chemoattractant protein-1, mcp-1) [50, 88]. Ccr2 expression on monocytes is important for both their egression from bone marrow and extravasation into inflamed tissues . Besides chemoattractant function for monocytes, ccr2 and ccl2 t cells from ccr2-deficient mice produce less ifn upon stimulation, while ccl2 is associated with th2 cell polarization and enhances il-4 production by t cells . In lupus - prone mice, ccr2 and ccl2 are increased in the kidney during the development of ln, suggesting the recruitment of ccr2 leukocytes into the inflamed kidney by ccl2 [24, 25, 5456, 89]. Using mrl / lpr mice, studies have shown that most renal - infiltrating ccr2 cells are macrophages and not t cells [52, 54]. In addition, ccl2 is mainly expressed in the tubulointerstitial regions of the kidney in lupus - prone mice [55, 89]. By blocking the interaction between ccr2 and ccl2 in mrl / lpr lupus - prone mice, studies have shown that ccl2/ccr2 network contributes to ln development through both systemic and local mechanisms . In both ccl2/ccr2 antagonist experiments and ccl2/ccr2-knockout models, animal lifespan was consistently prolonged with reduced ln including less glomerular and tubulointerstitial infiltration of t cells and macrophages, although severe proteinuria in old mice was not improved [5559]. In addition, the pathology and inflammation in the lung and skin of ccl2/ccr2-deficient mrl / lpr mice were reduced, suggesting the systemic involvement of ccl2/ccr2 in multiperipheral tissues . By further comparing the differences between antagonist and knockout models, it was evident that ccl2/ccr2 antagonists did not improve splenomegaly, lymphadenopathy, and circulating total / autoantibodies, suggesting the local involvement of ccl2/ccr2 in autoimmune target tissues, such as the kidney [56, 58, 59]. In contrast, ccl2/ccr2-knockout mrl / lpr mice exhibited reduced circulating anti - dsdna igg, diminished lymphadenopathy, and decreased percentage of circulating cd8 t cells, suggesting ccl2/ccr2 network also contributes to systemic autoimmune reactions in the immune tissues, through which ln progression was indirectly promoted [55, 57]. Interestingly, anti - ccl2 spiegelmer, a ccl2 antagonist, blocked the emigration of monocytes from the bone marrow of mrl / lpr mice, which suggested an additional mechanism of how ccl2/ccr2 may promote ln by facilitating monocytes migration from the bone marrow into the kidney . Together, these results suggest the importance of ccr2 and ccl2 in promoting ln . In sle patients, ccr2 and ccl2 expression same as shown in lupus - prone mice, ccl2 is mainly expressed in the tubulointerstitial region of the kidney in sle patients . Renal endothelial cells, epithelial cells, and infiltrating leukocytes could be the source of ccl2 . In patients with active sle, a small proportion of t cells (both cd4 and cd8) express ccr2 and are reduced in the blood circulation, suggesting their migration from the blood to inflamed peripheral tissues such as the kidney . Cx3cl1, also known as fractalkine, is the only chemokine with cx3c - motif discovered to date that interacts with its unique chemokine receptor, cx3cr1 . Cx3cr1 is expressed on a fraction of monocytes / macrophages, dendritic cells, nk cells, t cells, and particularly cd8 cytotoxic t cells [9093]. Different from other chemokines, cx3cl1 possesses a soluble form and a transmembrane form, which function to induce chemotaxis and adhesion of cx3cr1 leukocytes, respectively . Cx3cr1/cx3cl1 interaction also provides antiapoptotic signals to sustain the survival of cx3cr1 leukocytes [50, 94, 95]. Studies have shown possible involvement of cx3cl1 and cx3cr1 leukocytes in the development of ln . In mrl / lpr mice, cd16 cells in glomeruli are increased with lupus development, with increased protein level of cx3cl1 detectable in glomeruli, interstitial microvasculature, and arterial regions . Unlike mrl / lpr mice, cx3cr1 and cx3cl1 expression in the kidney of nzb / w f1 mice do not change with lupus progression, suggesting differences between various lupus - prone mouse models [23, 24, 61, 96]. Administration of nh2-terminally truncated cx3cl1 analogs blocked cx3cl1/cx3cr1 interaction and significantly ameliorates glomerular and vascular lesions in mrl / lpr mice, reducing the infiltration of macrophages and cx3cr1 cells to the glomerular, interstitial, and perivascular regions . T cells, however, were only reduced in the interstitial regions . With cx3cr1 blockade, the levels of circulating anti - dsdna igg and igg - containing ic were otherwise not affected, which, together with unchanged splenomegaly and lymphadenopathy, suggested a direct function of cx3cl1/cx3cr1 in the kidney that promotes ln progression in mrl / lpr mice . In sle patients, cx3cl1 expression is significantly increased in the glomeruli in class iv glomerulonephritis compared to other classes . In addition, glomerular cx3cl1 expression is positively correlated with the infiltration of glomerular cd16 cells that express cx3cr1, which deteriorates lupus disease, suggesting the clinical involvement of cx3cl1/cx3cr1 in ln development . Aside from the t cell - related chemokine receptors discussed above, cxcr6, ccr4, and ccr6 that are associated with the recruitment of th1, th2, and th17/treg, respectively, have been also studied in sle [16, 97, 98]. Cxcr6 and its ligand cxcl16 have been shown to be involved in autoimmune diseases such as rheumatoid arthritis . Blockade of cxcl16 in mice also attenuates glomerulonephritis induced by antiglomerular basement membrane antibodies . In both mrl / lpr and nzb / w f1 mice, the expression of cxcr6 and cxcl16 while the lack of available blocking antibodies has hindered the investigation of the role of cxcr6/cxcl16 in ln, cxcr6 has been shown to facilitate the infiltration of activated cd8 t cells to the inflamed liver . It is thus possible that cxcr6 cd8 t cells may be recruited into the inflamed kidney in ln through a cxcl16-dependent mechanism . Moreover, it has been shown that the level of soluble cxcl16 (scxcl16) in the serum of sle patients is significantly higher compared to hc and is positively correlated with sle disease activity index (sledai) of patients . In addition, the concentration of scxcl16 drops with disease remission . Therefore, cxcl16 may be involved in ln development by recruiting cxcr6 t cells into the nephritic kidney . Ccr4 has two chemokine ligands, ccl17 (thymus and activation - regulated chemokine, tarc) and ccl22 (macrophage - derived chemokine). The expression of renal ccr4 and its two ligands is increased in mrl / lpr mice as ln progresses . Interestingly, blockade of ccl22, but not ccl17, in mrl / lpr mice led to reduced proteinuria and serum creatinine with improved renal function [56, 103]. Moreover, the number of ccr4 t cells is reduced in the peripheral blood of sle patients compared to hc, suggesting increased migration of these cells into inflamed tissues . Accordingly, ccr4 cells are found in the kidney of sle patients that colocalize with cd4 cells . Thus, ccr4 t cells may selectively use ccl22 to migrate into the lupus nephritic kidney . Ccr6 is the chemokine receptor for ccl20 (liver and activation - regulated chemokine, larc, or macrophage inflammatory protein 3, mip-3). Ccr6 is expressed on t cells, preferentially on th17 and treg cells [40, 104110]. The interaction of ccr6 and ccl20 can recruit treg and th17 cells into the kidney in murine nephrotoxic nephritis [98, 111]. Whether this interaction can recruit th17 cells into the kidney to promote ln, or recruit treg cells to attenuate ln, remains to be explored . In nzb / w f1 mice, the expression of ccr6 and ccl20 these results suggest that ccr6 and ccl20 may function to regulate ln by recruiting th17 and treg cells . As summarized above, in the kidney of both sle patients and lupus - prone mice, many chemokines rarely expressed at steady state are induced or significantly increased with ln progression, suggesting that local and/or systemic inflammatory factors may trigger the upregulation of these chemokines . As summarized in table 3, targeting both renal parenchymal cells and renal - infiltrating immune cells, nucleic acid - containing antigens and autoantibodies are considered to be the major inflammatory stimulators initiating and/or accelerating chemokine release in the lupus nephritic kidney . Mesangial cells and other intrinsic renal cells like glomerular capillary endothelial and proximal tubular epithelial cells that express several toll - like receptors (tlrs) have the potential to be activated by different antigens to produce inflammatory factors including chemokines . Polyi: c rna that mimics viral dsrna can induce mesangial cells from mrl / lpr mice to produce ccl2, whereas mesangial cells from humans can be activated by polyi: c to produce cxcl1 through the tlr3 signaling pathway [112, 113]. Mesangial cells from lupus - prone mice, compared to nonlupus mice, were more sensitive to lipopolysaccharide (lps) stimulation as shown by the higher tlr4, myd88, and nfb expression and higher ccl2 production, suggesting a mechanism of how bacterial infections accelerate lupus disease . Besides exogenous factors, primary mesangial cells isolated from nzb / w f1 mice, upon self - nucleosome or nucleosome - containing ic stimulation in vitro, have been shown to produce several chemokines including ccl2, ccl7, ccl20, cxcl2, and cxcl5, suggesting self - antigen and autoantibody - mediated mesangial activation . Regarding autoantibody - induced mesangial activation, it has been shown that pathogenic anti - dsdna igg can upregulate cxcl1 and cx3cl1 transcripts and the secretion of cxcl1 from mesangial cells isolated from mrl / lpr mice through both fc receptor- (fcr-) dependent and independent pathways . Further studies have shown that fcr - independent pathway is dependent on tlr2/4 and the receptor for advanced glycation end products (rage) but independent of dna / tlr9, as pathogenic anti - dsdna igg clone 1a3f can bind high mobility group box 1, an endogenous ligand for tlr2/4 and rage, through which 1a3f activates tlr2/rage - myd88-nfb pathway in mesangial cells, leading to the production of several chemokines including cxcl1, cxcl2, cxcl5, cxcl16, ccl7, and ccl20 [96, 116]. Autoantibodies can also indirectly activate intrinsic renal cells . When incubated with immobilized igg mimicking ic deposition in the kidney, lymphocytes isolated from human pbmc can be activated in a fcr - dependent way to produce il-1 that in turn stimulates human mesangial cells, glomerular capillary endothelial cells, and proximal tubular epithelial cells to further produce ccl2 . Moreover, a transcription factor, fli1, has been shown to directly bind the promoter region of ccl2 and ccl5 genes to promote their expression in primary endothelial cells of the kidney in nzm2410 lupus - prone mice [118, 119]. In addition to the activation of renal parenchymal cells, renal - infiltrating macrophages and dendritic cells have been shown to produce several chemokines upon stimulation by tlr2/4, tlr3, tlr7, and tlr9 ligands . Biglycan, an endogenous stimulator of tlr2/4, is increased in the serum and kidney of both sle patients and mrl / lpr mice . An in vitro study further shows that macrophages and dendritic cells produce cxcl13 upon biglycan activation of tlr2/4-ros signaling pathway that is independent of inflammasome . Polyi: c rna mimicking viral dsrna and a tlr7 agonist mimicking viral ssrna can induce macrophages and dendritic cells isolated from mrl / lpr mice to produce ccl2 through the tlr3 and tlr7 signaling pathways, respectively [112, 121]. In addition, it has been shown that tlr7 and tlr9 are mostly detected in renal - infiltrating macrophages and dendritic cells rather than intrinsic renal cells of mrl / lpr mice [26, 121]. Cpg, mimicking bacterial dna or self - dsdna, can induce ccl2, ccl5, and ccr5 in the kidney through the tlr9 pathway when injected into mrl / lpr mice . Detailed studies have shown that exogenous cpg or bacterial dna particularly bind to infiltrating macrophages and dendritic cells in the glomerular and tubulointerstitial regions of the kidney in mrl / lpr mice . Chloroquine - blocked tlr9 pathway abolishes ccl5 induction in spleen monocytes, further demonstrating tlr9-dependent chemokine induction in renal - infiltrating innate immune cells upon cpg - dna triggering . Finally, mirna-125a has been shown to indirectly downregulate ccl5 production by activated t cells through targeting kruppel - like factor 13 (klf13). It has been demonstrated that mirna-125a is downregulated while klf13/ccl5 are upregulated in pbmc of sle patients compared to healthy controls, suggesting that dysregulation of ccl5 in sle patients is dependent on mirna-125a . To date, renal biopsy is still the gold standard for accurate diagnosis and classification of ln and for the prognosis of ln activity and chronicity in patients upon treatment . However, chemokines in the urine of lupus nephritic patients have been studied according to established diagnosis of ln classes that suggest their potential use as noninvasive biomarkers for ln activity monitoring, treatment responses, and remission / flare prediction after the biopsy diagnosis . Urine chemokines can be used to supplement renal biopsy diagnosis of ln . In both adult and juvenile sle patients, urinary ccl2 (uccl2) concentration is significantly higher in nephritic patients than nonnephritic patients and healthy controls [123, 124]. Moreover, both protein and mrna levels of uccl2 are significantly higher in sle patients with active ln compared to those with inactive ln [77, 125130]. Further studies have shown that uccl2 alone or combined with other factors can distinguish different classes of ln, as uccl2 concentration is positively correlated to progressive ln classes and significantly increased in diffuse proliferative group compared to focal proliferative and mesangioproliferative groups [123, 131, 132]. Ln, it is important to monitor uccl2 whose level is high during interstitial inflammation in moderate - severe sle patients . Besides uccl2, urinary cxcl10 (ucxcl10) concentration is also significantly higher in nephritic patients than nonnephritic sle patients . A cut - off value 93 pg / dl of ucxcl10 has been proved to be a good prediction of nephritis with high sensitivity and specificity . Also, ucxcl10 concentration is positively correlated with renal activity score and renal biopsy grade . In addition, ucxcl10 and cxcr3 mrna levels from class iv nephritic patients are increased compared to other classes . Similarly, the urinary cxcl16 level can also distinguish inactive and active ln in sle patients . During the treatment of ln uccl2 has been shown to be a good biomarker to predict juvenile ln improvement . In this study, the cut - off uccl2 concentration is 343 pg / ml, with a value lower than that predicting an improved renal disease activity . Two other studies have also shown that uccl2 is reduced in sle patients with complete or partial ln remission, while its level is maintained in nonremission patients, suggesting uccl2 as a good marker for prognosis [129, 132]. Similarly, ucxcl10 is reduced in sle patients upon remission into inactive ln in a longitudinal follow - up study, suggesting ucxcl10 is also a good biomarker for monitoring ln improvement of sle patients following the treatment . After the remission, the elevation of uccl2 can be detected 2 to 4 months prior to another ln flare, and changes of uccl2 concentration can distinguish different levels of ln flare severity, suggesting that uccl2 may be a good marker for predicting recurring ln flares [129, 132]. As chemokines and chemokine receptors are important in the recruitment of leukocytes to the kidney in the development of ln, one would naturally think of developing new treatments for ln that target the interaction between chemokines and chemokine receptors . However, the design of such treatments should take into consideration the potential limitations (discussed below), as many commercial drugs designed to target chemokines / chemokine receptors in different diseases have unfortunately failed in clinical trials (summarized tables in references) [138, 139]. The complexity of chemokine and chemokine receptor system and possible redundancy are a challenge for the development of new drugs to block leukocyte infiltration [139, 140]. Some chemokines, such as ccl5, can recognize several chemokine receptors (ccr1, ccr3, and ccr5), whereas some chemokine receptors, such as cxcr3, can interact with different chemokines (cxcl9, cxcl10, and cxcl11). Current drugs including small chemical molecules and monoclonal antibodies are designed to simply block the interactions between chemokines and chemokine receptors by neutralizing either chemokines or chemokine receptors, which is insufficient to pinpoint the specific function of each chemokine / chemokine receptor pair . Thus, detailed studies on the dynamic interactions and functions of each particular chemokine / chemokine receptor pair in the specific diseases are critical for successful drug development . In addition, the chemokine and chemokine receptor redundancy is reflected in a situation where one chemokine receptor may function in compensation of another if the other chemokine receptor is blocked . Leukocytes always express more than one type of chemokine receptors on the surface, so blocking the ligation of one chemokine receptor may not completely or efficiently prevent the infiltration of leukocytes . For example, while both ccr5 and cxcr3 have been shown to promote organ transplantation rejection by inducing t cells infiltration in the transplanted organ, their functions seem to be redundant . Ccr5 and cxcr3 double blocking compared to either single blocking makes a much greater prolonged allograft survival in a murine heterotopic heart transplantation model . Another challenge for ln drug development that involves chemokines and chemokine receptors is to achieve cell - specific targeting . To this end, studies of chemokine receptor expression at the single cell level may help identify the cell type of interest . For example, renal - infiltrating t cells have been shown to express ccr1, ccr4, ccr5, cxcr3, and cxcr5 [24, 50, 67, 70, 87]. However, it is unknown whether the chemokine receptors are expressed on the same t cell subsets or differentially expressed on distinct t cell subsets . If we can define t cell subsets by using different combinations of chemokine receptors, we may be able to more specifically target pathogenic t cells by blocking the corresponding chemokine receptors . An additional limitation is the use of lupus - prone mice where most of the mechanistic studies are performed to better understand the pathogenesis of ln . The differences between human patients and mouse models make it difficult to translate the results of mouse studies to successful clinical trials . Therefore, it is important to study the differences and similarities between sle patients and lupus - prone mice regarding their use of chemokines and chemokine receptors . An example is cxcl9, which is preferentially used in mice but not in humans, versus cxcl10, which appears to be the predominant chemokine in the kidney of sle patients [23, 67]. Finally, how to specifically deliver chemokine - based drugs into the kidney is another important question . It is difficult to find a kidney - specific chemokine or chemokine receptor critical for the development of ln . Systemically blocking a chemokine or chemokine receptor will likely lead to many outcomes other than attenuating ln, causing negative side effects such as an increased chance of infection or cancer . Therefore, while targeting the interaction between chemokines and chemokine receptors is a promising avenue, further studies are required to dissect and better understand the mechanisms behind such interactions before a chemokine - based drug can be developed to treat ln . Although many commercial chemokine receptor antagonists failed to reach expectations in treating different diseases, targeting chemokines / chemokine receptors may still be a promising strategy in ln . First, studies using sle patient cells / tissue and animal models summarized in this review have demonstrated the involvement of chemokines / chemokine receptors in ln progression, suggesting the potential of targeting this system in ln treatment . Second, the failure of previously designed drugs is due to our insufficient understanding of the complicated chemokine / chemokine receptor system, which can be improved by further studies . Third, with better understanding of chemokine / chemokine receptor system, future drugs designed to more specifically target particular chemokine and chemokine receptor interactions will minimize the off - target effects and side effects commonly observed for immunosuppressive drugs and monoclonal antibodies, which are nonspecific . Finally, we may be able to learn from pathogens that are known to specifically target chemokine / chemokine receptor pairs to design better drugs with improved specificity.
Bowel endometriosis occurs in approximately 10% of all patients with endometriosis and usually arises from the rectum and sigmoid colon at a rate of approximately 80% . Conservative treatment with hormonal therapy is usually performed . However, if the patient hopes to become pregnant, an alternative to long - term hormonal therapy must be found . We report a case of lower rectal endometriosis performed using laparoscopically assisted low anterior resection of the lower rectum . A 34-year - old woman presented with pain during menstruation and was diagnosed with endometriosis of the lower rectum . Despite treatment with an lh - rh agonist, she was unable to become pregnant and surgical removal of her endometriosis was recommended . On admission, tumor markers such as cea, ca-125 and ca-19 - 9 were 1.7 ng / ml, 31.9 u / ml and <2.0 u / ml, respectively . On lower gastrointestinal series, poor extensibility of the lower rectum with irregular elevation and mucosal irregularity was observed . The portion of the rectum involved with endometriosis was approximately 35 mm from the anal verge (fig . Colonoscopic findings showed tumor - like submucosal tumor in the anterior wall of the lower rectum (fig . 2). Abdominal computed tomography findings revealed a 2-cm mass without contrast enhancement in the lower rectum . Concerning abdominal magnetic resonance imaging (mri), a mass which was slightly enhanced and demonstrated mass effect on the surrounding organs was shown on gadolinium - enhanced t1-weighted images (fig . There were adhesions to the right lower abdominal cavity, and a small amount of ascites was found in the pouch of douglas . Exfoliation was started from the presacral region to the right side of the rectum and the rectococcygeus ligament was cut . Exfoliation was continued to the levator ani muscle and mobilization of the left side of the rectum was performed . In front of the rectum, exfoliation was performed from the posterior wall of the vagina, but because the layer of exfoliation was unclear and tissue was solid around the tumor, the exfoliation was difficult . Since the left hypogastric nerve was involved by inflammation surrounding the tumor, the nerve was cut, and subsequently the left lateral ligament was cut . After the inferior border of the tumor was confirmed by colonoscopy, the rectum was cut 1 cm distal to the inferior border of the tumor . Then a 3-cm skin incision was made in the lower abdomen, the specimen was pulled up and the rectum was cut 5 cm distal to the superior border of the tumor . Postoperatively, a rectovaginal fistula occurred on the 9th postoperative day, and an ileostomy was performed . After that, the patient's postoperative course was uneventful and she left the hospital on the 25th postoperative day; 4 months later the ileostomy was closed . Endometriosis affects approximately 15 - 20% of women of child - bearing age, and bowel endometriosis occurs in 5% of all endometriosis cases . Athmanathan et al . Reported that 80% of the cases of bowel endometriosis arise from the rectum and sigmoid colon . Symptoms of rectal endometriosis include dysmenorrhea in 57 - 85.3% of patients, dyspareunia in 55 - 57%, rectal pain in 41.2%, rectal bleeding in 14%, and tenesmus in 8.8% . In our case, the patient had rectal pain during menstruation . Physical examination, computed tomography, mri and endorectal sonographic evaluation are useful in making the diagnosis . However, the sensitivity of mri for the diagnosis of colorectal endometriosis is much higher, at between 80 and 92.6% with a positive predictive value of approximately 89% . Endorectal sonographic evaluation is noninvasive and its sensitivity and positive predictive value are both 100% . Endorectal sonography was indicated in our case due to its high feasibility and lower cost compared to mri . Significant resistance to the surgical treatment of colorectal endometriosis currently exists because of major complications such as colo- or rectovaginal fistulae . Reported that rectovaginal fistulae occurred in 10.3% of patients . On the other hand, fleisch et al . Reported the utility of surgical treatment for patients with persistent pain and found that 21 (91.3%) of 23 patients reported improvement in their symptoms . For patients who desire to become pregnant, long - term hormonal therapy for endometriosis is contraindicated; therefore, surgery is needed . Bailey et al . Reported that the pregnancy rate following surgery was 49%, strongly supporting the surgical treatment of rectal endometriosis . Reported that all the items on the sf-36 health status and quality of life scores were significantly improved after laparoscopic colorectal resection for endometriosis . Reported that the probability of requiring further surgery was 36% in patients with deep endometriosis, and furthermore, 38.6% of patients had residual or recurrent endometriosis . Reported that the incidence of adhesion - related obstruction after laparoscopic colorectal surgery was 1.3%, which was lower than for open laparotomy; therefore, laparoscopic surgery for colorectal endometriosis is recommend if further surgery is needed . For patients whose lesions are located on the lower part of the rectum, exfoliation is needed up to the levator ani muscle; therefore, the laparoscopically assisted approach is more useful in providing a good operative field compared to open laparotomy . In our case, a rectovaginal fistula occurred on the 9th postoperative day and ileostomy was required, but intraabdominal adhesions were mild and ileostomy was performed easily using a laparoscopic approach . In conclusion, for patients with lower rectal endometriosis for whom hormonal therapy is contraindicated, laparoscopically assisted low anterior resection is recommended for its visual amplification effect, minimal invasiveness and palliation of symptoms.
The treatment of hepatitis c virus (hcv) infection has evolved from peginterferon alfa (pegifn) plus ribavirin (rbv)based regimens to combinations of alloral, directacting antivirals (daa), including daclatasvir a pangenotypic ns5a inhibitor (hcv genotypes 16 in vitro) and the ns3 protease inhibitor, asunaprevir (active against hcv genotypes 1, 4, 5, and 6 in vitro). The efficacy and safety of daclatasvir and asunaprevir in combination has been assessed in multiple phase 3 studies, including the multicohort hallmarkdual study in treatmentnaive and pegifn / rbvineligible / intolerant hcv genotype 1binfected patients from 18 countries, including israel 1 . The sustained virologic response rate at posttreatment week 12 (svr12) in the overall population of hallmarkdual following treatment with daclatasvir 60 mg once daily in combination with asunaprevir 100 mg twice daily administered orally for 24 weeks was 84% (542/643) and a comparable rate in patients from israel was observed (overall, 82% [9/11]; prior null responders, 3/3; pegifn / rbv ineligible / intolerant, 6/8). Svr12 rates were enhanced in patients without ns5a resistanceassociated variants (ravs; l31 and/or y93) in both the overall population (92%) and patients from israel (7/8), and agree with similar findings from a pooled analysis of five studies in hcv genotype 1b infection 2 . Among the patients from hallmarkdual (ai447028; clinicaltrials.gov number nct01581203) who did not achieve svr12 was a cirrhotic 58yearold caucasian female from israel who had a null response to prior pegifn / rbv therapy and was ineligible for retreatment with pegifn / rbv for reasons of anemia and neutropenia . The patient had hcv rna at baseline of log10 5.43 iu / ml, no baseline ns5a or ns3 ravs shown to result in resistance to daclatasvir or asunaprevir, and 100% compliance with respect to daclatasvir and asunaprevir dosing and treatment duration . Pretreatment clinical laboratory abnormalities were graded according to division of aids criteria v1.0 . Prior to initiating therapy with daclatasvir and asunaprevir, grade 3 elevations in total bilirubin were observed from pretreatment through ontreatment week 2, with subsequent fluctuations between grades 12 from week 4 to resolution at followup week 4 . Elevations in direct bilirubin were also observed from pretreatment (9.6 upper limit of normal [uln]) that decreased or remained consistent at all ontreatment assessments (week 2, 7.0 uln; end of treatment, 3.3 uln) and at followup week 4 (3.0 uln). A pretreatment grade 2 aspartate aminotransferase elevation resolved by week 2, and a subsequent grade 1 elevation during week 4 resolved by week 6 . A pretreatment grade 1 alanine aminotransferase elevation resolved prior to the initiation of therapy . Alkaline phosphatase levels were elevated (grade 1) from pretreatment until followup week 4 . During treatment with daclatasvir and asunaprevir, the patient experienced rapid viral decline and achieved detectable levels of hcv rna below the lower limit of quantification (25 iu / ml) at week 4 . The patient then had undetectable hcv rna at week 6 that remained undetectable until relapse occurred at posttreatment week 12 (hcv rna was assessed at ontreatment weeks 1, 2, 4, 6, 8, 10, and 12; and posttreatment weeks 4, 12, and 24); hcv rna at posttreatment week 12 was log10 6.2 iu / ml (fig . 1). Viral decline during initial treatment (daclatasvir plus asunaprevir) and retreatment (sofosbuvir plus simeprevir). Initial treatment with daclatasvir and asunaprevir for 24 weeks; retreatment with sofosbuvir and simeprevir for 12 weeks . Bl, baseline; eot, end of treatment; fu, followup week; hcv, hepatitis c virus . Populationbased sequencing of the patientderived hcv ns5a region from plasma samples collected at followup week 12 revealed the emergence of signature ravs in ns5a (l31 m, y93h [with baseline polymorphisms r30q and p58s]) and ns3 (d168v); these substitutions confer 44,000 and 357fold resistance to daclatasvir and asunaprevir in vitro, respectively . At followup week 24 (last available sample for testing), these ravs were still present . On july 15, 2014, approximately 6 months after initial treatment relapse, the patient was retreated with sofosbuvir 400 mg once daily administered in combination with simeprevir 150 mg once daily administered orally for 12 weeks . An assessment of ravs prior to retreatment was not conducted because plasma samples were not available . Sofosbuvir and simeprevir is a combination therapy that is equipotent in wildtype hcv replicons representative of hcv genotype 1b and variants with signature ns5a (l31 m, y93h) and ns3 (d168v) ravs 3 . Retreatment baseline hcv rna was log10 5.39 iu / ml . Retreatment with sofosbuvir in combination with simeprevir resulted in a rapid viral decline (detectable hcv rna below the lower limit of quantification at week 2) that resulted in undetectable hcv rna at retreatment week 4 . The patient experienced an adverse event of mild rash between retreatment weeks 4 and 6 that resolved without sequelae . Grade 3 elevations in total bilirubin were observed during retreatment weeks 4, 10, and 12; a grade 2 elevation was observed during postretreatment week 6 . Elevations above the uln of direct bilirubin were observed during treatment weeks 4 (3.9 uln), 10 (4.4 uln), 12 (3.6 uln), and postretreatment week 6 (2.7 uln). Alanine and aspartate aminotransferase levels remained within normal limits through the treatment and followup periods . Elevations in thyroidstimulating hormone were also observed during treatment week 4 (1.2 uln), at end of retreatment (1.4 uln), and during postretreatment week 6 (1.6 uln). Overall, treatment with daclatasvir plus asunaprevir in the hallmarkdual study achieved high rates of svr12 in hcv genotype 1binfected patients without ns5a ravs and with or without ns3 ravs at baseline . This case demonstrates that in the infrequent cases of virologic failure, successful retreatment can be achieved with other alloral, daa regimens, even when the retreatment regimen contains the same class of drug . Important considerations of this case report are the retreatment of a protease inhibitorexperienced patient with a second protease inhibitorcontaining regimen, the absence of rav testing prior to retreatment, and the timing of retreatment with respect to the persistence of ravs that emerged during initial treatment . Current european recommendations for the retreatment of patients who have failed a regimen containing one or more secondwave daas are based on indirect evidence (hcv genotype, resistance profiles, the number of drugs administered, use of rbv, and treatment duration) and state intuitively, patients who failed on a daacontaining regimen should be retreated with an ifnfree combination including a drug with a high barrier to resistance (currently, sofosbuvir), plus one or two other drugs, ideally with no crossresistance with the drugs already administered . Based on results in difficulttocure patient populations, retreatment should be for 12 weeks with ribavirin, or extended to 24 weeks with or without ribavirin (no data available comparing these approaches) 4 . Treatment guidelines from the american association for the study of liver disease suggest that ns5a and ns3 rav screening should be conducted prior to retreatment . It is recommended that patients without ns5a ravs should receive retreatment with ledipasvir / sofosbuvir with rbv for 24 weeks, those with ns5a ravs but without ns3 ravs receive simeprevir / sofosbuvir with rbv for 24 weeks, while sofosbuvir combined with either elbasvir / grazoprevir or paritaprevir / ritonavir / ombitasvir / dasabuvir may be efficacious in patients with ns5a and ns3 ravs (data are limited) 5 . These recommendations are based, in part, on the observations that ns5a ravs are known to persist in the viral population for> 1 year, whereas ns3 ravs are less stable and have been shown to be gradually replaced with pretreatment ns3 sequence over time 6 . Although guidelines from both the eu and usa generally do not recommend retreating protease inhibitorexperienced patients with a second protease inhibitorcontaining regimen, successful retreatment with such regimens has been reported . Examples include daclatasvir / asunaprevir for the retreatment of ifn / rbv / telaprevirexperienced patients (svr, 95.5%) 7, grazoprevir / elbasvir / rbv for the retreatment of ifn / rbv plus either telaprevir, boceprevir, or simeprevirexperienced patients (svr, 96.2% [91.2% in patients with baseline ns3 ravs and 66.7% in patients with both ns3 and ns5a ravs at baseline]) 8, and sofosbuvir / simeprevir with or without rbv for the retreatment of patients with experience of either telaprevir, boceprevir, paritaprevir, or gs9451 (svr 93%) 9 . In the study of sofosbuvir / simeprevir with (n = 10) or without (n = 5) rbv for the treatment of protease inhibitorexperienced patients, an overall svr rate of 93% (n = 14/15) was achieved after a 12week treatment duration in a patient population that was considered to have difficult to cure characteristics for this regimen (hcv genotype 1a, high baseline viral levels, and prior nonresponse to protease inhibitors). The single patient who did not achieve svr12 received sofosbuvir / simeprevir plus rbv and did not have ns3 ravs associated with resistance 9 months prior to treatment . Of note, no patients had evidence of significant ns3 ravs (three patients had ns3q80k, all of whom, including one recipient of sofosbuvir / simeprevir without rbv, achieved svr12) and the majority of patients received prior protease inhibitorbased therapy> 1 year prior to retreatment 9 . This study and the current case report demonstrate that high rates of retreatment svr can be achieved without the use of rbv or extending retreatment duration to 24 weeks . The addition of rbv and extension of treatment duration to 24 weeks is recommended in treatment guidelines as mechanisms to increase response, and delay or prevent the emergence of ravs, particularly when low barrier daas (e.g., protease inhibitors) are used 4, 5 . The studies described above show that retreatment of proteaseexperienced patients with a second protease inhibitorcontaining regimen can be successful in carefully considered cases, despite no clear guideline support for this approach . Central factors in the success of this approach are the absence of significant crossresistance between the two regimens, and the timing of retreatment with respect to rav fitness and survivability . As previously noted, plasma samples prior to retreatment for rav screening were not available, and retreatment with sofosbuvir plus simeprevir occurred 7 months after the initial treatment failure with daclatasvir plus asunaprevir . This delay in retreatment may have allowed ns3 ravs to be replaced with pretreatment ns3 sequence over time 6; thus enabling a successful virologic outcome with a regimen containing the same hcv inhibitor class as asunaprevir (such as simeprevir). In hcv genotype 1b replicon in vitro assays, the presence of the ns3 d168v rav, which was detected at treatment failure, results in a 280fold loss of asunaprevir activity (ec50, 241 nm) 10 and 2591fold loss of simeprevir activity (ec50, 17,917 nm) 11, compared with wildtype hcv genotype 1b replicons; when tested in parallel using the same assay, the ec50 of asunaprevir and simeprevir in the hcv genotype 1b ns3d168v replicon were 200 nm and 5900 nm, respectively (unpublished data). The successful retreatment of this case study suggests that if ns3 ravs were present at the initiation of retreatment, the efficacy of sofosbuvir was sufficient to compensate for reduced simeprevir activity . In summary, this case study demonstrates that hcv genotype 1binfected patients experiencing virologic failure with daclatasvir plus asunaprevir therapy have potential retreatment options, including regimens containing a component with a shared mechanism of action as the initial treatment . R. safadi is an academic member at the hadassah medical organization and served as an advisory consultant of bristolmyers squibb.
Andropause, androgen decline in the aging male (adam), or testosterone deficiency syndrome (tds) is a true clinical entity characterized by symptoms of erectile dysfunction, decreased libido, osteoporosis, and general weakness . However, its occurrence is still poorly documented and most literature is from european or american continents . Three questionnaires have been developed to detect tds in adult men: (1) st . Louis university's adam; (2) the aging male survey (ams); and (3) massachusetts male aging study (mmas) questionnaire . We report a study in a small number of men to determine the prevalence of tds in healthy individuals above 40-years of age using the st . In order to assess by a standardized questionnaire and obtain blood sample for serum testosterone estimation in working men population, a general health check - up camp was advertised and mandated for all male workers (surgical technicians, peons, and ward assistants with regular working duration not exceeding 8 h) between 40 and 60 years of age for the departments of surgical sciences comprising of the departments of general surgery, department of urology, department of plastic surgery, department of neurosurgery, department of plastic surgery, department of pediatric surgery, and department of cardiothoracic surgery . Ethical clearance for the study was obtained from the institutional ethics committee and in accordance with the declaration of helsinki . All participants were asked to fill a proforma in which the volunteers were asked to fill personal information like age, occupation, co - morbid conditions, drug intake, and past illnesses . After physical examination, some investigations like urine examination, hemogram, serum creatinine estimation, liver function tests, electrocardiogram, and ultrasonography of the abdomen were performed as part of the free camp on all volunteers . All the participants were also invited to participate in a study on andropause after signing an informed consent . Serum testosterone (total and free) level estimation was performed simultaneously using elisa (drg international, inc ., usa . Fax: (908)233 0758, e - mail: corp@drg-international.com) in the department of pathology, the sample for which was withdrawn between 8 a.m. and 11 a.m. all tests were performed in duplicate and quality assessment was done with the help of a third party quality control sera . Within - assay variability was determined and was found to be 6% . To calculate the sample size, the prevalence of tds was taken as 10% . To detect this prevalence in indian men with a precision of 5% and alfa level of 0.05, univariate analysis was done to assess the distribution of baseline variables . To assess association of tds or low - serum testosterone levels, chi - square test and t - test the androgen deficiency in aging male questionnaire: a positive answer represents yes to question 1 or question 7 or any 3 other questions of the 180 listed male workers between ages 40 and 60 years, 170 participated in the study . Twenty - three volunteers had other co - morbid conditions like diabetes (12 cases), hypertension (12 cases), and tuberculosis (1 case). The mean body weight was 64.3 kg (range 5478) and the mean height was 167.4 cm (range 158180 cm). On the basis of st . Louis questionnaire, of the 157 subjects, 106 (67.5%) tested positive for symptoms of tds (mean age 53.5 years; range 4060). Of these 106 symptomatic cases, 41 and 32 subjects were found to have less than normal serum - free (mean serum - free testosterone 5.55 pg / ml; range 3.097.08) and total testosterone (mean serum - total testosterone 1.5 ng / ml; range 1.12.5) levels . The other 65 symptomatic subjects had normal total - and free - testosterone levels (mean age 51.8 years, range 4060). Eleven asymptomatic subjects (mean age 55.1 years; range 4660) were found to have low free - serum testosterone levels (6.4 pg / ml; range 4.17.4) and in 6 of these cases low total - serum testosterone was identified (mean 1.4 ng / ml; range 1.22.5). The risk of tds was 70% significantly lower in the age group of 4050 years as compared to 5160 years (rr = 0.3, 95% ci = 0.10.8). The risk of tds was 2.9 times higher in those having at least one symptom as compared to those not having any symptom (rr = 2.9, 95% ci = 1.84.6) and this was statistically significant . The response to various questions in men with biochemically confirmed tds in shown in table 2 . The association of different variables between andropause and non - andropause patients is shown in table 3 and table 4 . A scatter plot for free - serum testosterone levels is shown in figure 1 and bar diagram of serum free testosterone [figure 2]. Responses according to andropause / non - andropause association between different variables with andropause and non - andropause patients * significant, values in the parentheses are the percentage, rr = relative risk, ci = confidence interval mean sd of height, weight, and bmi of studied patients scatter plot of free testosterone for each patient bar diagram of serum free testosterone the massachusetts male aging study reported a crude incidence rate of 12.3 per 1000 person - years, leading to a prevalence of 481 000 new cases of adam per year in american men aged between 40 and 69 years . The prevalence of tds has not been reported from most asian countries. [24] to estimate the prevalence of this condition in india, we performed a pilot study in a small number of healthy volunteers working in the surgical departments of our hospital . The volunteers were asked to attend a free health checkup camp and before attending the camp they did not even know that they will be evaluated for tds too . However, when they reported for the checkup, they were invited to participate in tds study . In this way, we were able to avoid the bias that would have appeared had we advertised that it will be an so the chances of selection bias that volunteers with some sexual problems would attend the camp were minimized . Louis university's questionnaire, the validity of which has been tested and reported previously. [57] the adam questionnaire in the original validation had a sensitivity and specificity of 88 and 60%, respectively, against the serum bioavailable testosterone levels . The sensitivity and specificity of ams has been reported to be 83 and 39%, respectively; however, in another study from europe none of the three ams domains correlated significantly with serum levels of total, bioavailable, or free testosterone in men older than 70 years . These questionnaires are useful as screening tools but fall short of expectation for diagnostic purposes . Morley et al ., compared the adam, ams, and mmas questionnaires using bioavailable testosterone as the biochemical gold standard for diagnosis of hypogonadism . The sensitivity for adam, ams, and mmas was found to be 97, 83, and 60%, respectively and the specificity for adam, ams, and mmas was 30, 39, and 59%, respectively . In our study, an unusually high number (67.5%) of volunteers reported symptoms of adam on the basis of st . Louis university's questionnaire . This could be because of the nature of the questionnaire . The questionnaire was structured on a yes / no format and the volunteers did not have the scope of saying that they had only mild symptoms . Many volunteers who had mild symptoms could have been picked up as symptomatic for androgen deficiency on the basis of this questionnaire . Of interest, 58.5, 95 no answer to questions number 4, 5, 6, 8, 9, and 10, respectively . For possible explanation of this finding, a larger study in a more heterogenous group of people is required . Some questions like have you noticed a recent deterioration in your ability to play sports? May not be relevant in some countries like india where most people above 40-years of age do not play sports . Similarly, many of our volunteers reported that answers to questions 2, 3, 8, and 10 were quite close to each other [table 1]. Some investigators have, therefore, developed shorter versions of adam questionnaire . Due to the low specificity of the st . Louis questionnaire, a substantial number of men tested positive for andropause symptoms based on this questionnaire but did have low - serum androgens . It is therefore likely that the population of men with symptoms of tds but who did not meet the criteria for the diagnosis had some other medical or psychological co - morbidity that was contributing to the symptoms . On the basis of biochemical evaluation, 52 subjects (33.1%) however, the total - serum testosterone levels were found to be low in 32 subjects only . This is because the normal total - serum testosterone levels have a wide normal range and do not decline as rapidly as do free and bioavailable (free and albumin - bound) testosterone. [1417] the more pronounced decrease in free than in total testosterone is explained by the age - dependent increase in the binding capacity of shbg (1.2% per year). Many investigators recommend measurement of bioavailable or free testosterone as a better predictor for diagnosing andropause . The ideal test in men suspected of hypogonadism is the measurement of free testosterone by the equilibrium dialysis method . This method, however, is difficult to perform, not automated, and largely inaccessible to most clinicians . Measurement of we have evaluated serum testosterone levels using the elisa, which is a reliable method . The reported prevalence of biochemical hypogonadism is about 7% of the age group less than 60 years old but increases to 20% in those over 60 years of age . Our study in a small group of healthy men revealed symptoms of tds in 67.5% and biochemical hypogonadism in 33.1% . However, symptomatic hypogonadism was seen in only 26.1% (in 41 out of 157 cases). The prevalence of biochemical hypogonadism found in our study (26.1%) is similar to that found in a study of 316 canadian physicians aged 4062 years . Low bioavailable testosterone levels (<70 ng / dl) were present in 25% of these men; the questionnaire identified this group with a sensitivity of 88% and a specificity of 60% . However, our incidence is much higher than prevalence of 69.5% reported for community - dwelling men aged 4070 years from france . Serum testosterone levels show diurnal variation and there is also substantial variation (~20%) from week - to - week . Therefore, two testosterone measurements at least a week or two apart are recommended for diagnosing tds and starting treatment . We measured serum testosterone at a single point which may have overestimated or underestimated this condition . The relationship between symptoms of tds and hormonal levels in complex are still not fully understood and there is a lack of correlation between the clinical picture and the most commonly used biochemical confirmatory tests . Additional questionnaires (ces - d, beck depression inventory, etc) for depression and additional biochemical data (like thyroid hormone levels) that may influence the response to adam questionnaire were not done . The population selected for this study was men working in hospital and is unlikely to be a representative sample of the general male population in india . Another study using other validated questionnaires such as the ams scale or mmas and more detailed measurement of testosterone levels in a larger number of men is required to determine the prevalence of this condition in indian men . Symptomatic hypogonadism was found to be at least as common as that reported in the western literature . The higher prevalence of patients with symptoms of hypogonadism but with normal serum testosterone found in our patients could be because of the nature of the adam questionnaire.
Early detection of metastasis is one of the aims of follow - up examination in patients with malignant melanoma since once metastasized, despite a variety of therapeutic options e. g. chemo- and/or immunotherapy, patients suffering from malignant melanoma show an unfavorable prognosis . Therefore, it would be most desirable to identify patients with high risk of disease progression as early as possible . Since laboratory tests are easy to handle and modestly expensive, a variety of different serum factors has been investigated for their potential relevance as prognostic markers in malignant melanoma [2 - 4]. To date, none of these markers is routinely used in the clinical setting . The most promising one at present, s100-protein, has been demonstrated in several studies to be a valid and reliable predictive marker for clinical progression and response to therapy in melanoma patients with advanced stages of disease . However, a major disadvantage of s100-protein is its poor prognostic impact in early - stage melanoma patients [6 - 8]. The identification of new prognostic markers may help to better distinguish low from high risk disease apart from the classical histopathologic and clinical criteria and may unravel new targets for therapy . The mechanism of malignant transformation of melanocytes is poorly understood, but growth factors and their receptors play an important role in the progression of melanoma . Moreover, alterations in the mitogen - activated protein kinase pathway are almost uniformly present in melanoma . While ras itself is only infrequently mutated in melanoma the downstream braf gene of the mitogen activated protein kinase pathway is mutated in 60% to 70% of superficial spreading melanomas . On the other hand, a genetic host factor may offer a better stratification of patients into more refined risk categories without the need for tumor tissue . For example, the a61 g single nucleotide polymorphism (snp) in the egf gene which operates via ras and braf in melanocytic tumors has recently been associated with risk for metastasis in melanoma patients . We have recently shown that the t393c polymorphism in the gene gnas1, which encodes the g_s subunit of heterotrimeric g protein, is significantly associated with the clinical outcome of patients suffering from bladder cancer, colorectal cancer, chronic lymphocytic leukaemia, and renal cell carcinoma . We also demonstrated that the t allele of gnas1 t393c polymorphism is associated with increased gs mrna expression in a variety of tissues, including tumor tissue . In vitro experiments suggest that an increased expression of gs is associated with enhanced apoptosis and that the second messenger camp, which functions downstream of g proteins, plays a major role in this pro - apoptotic process [17 - 20]. Hence, an increased gs expression with concomitantly enhanced apoptosis may be also associated with better survival in melanoma patients with tt genotypes . This study comprises a total of 328 consecutive malignant melanoma patients (with a mean age of 54.2 16.4 years) treated at the department of dermatology and allergology, ruhr - university bochum (bochum, germany) between 1995 and 2000 with disease progression being continuously documented . The clinical staging was performed according to the american joint committee on cancer (ajcc 1997). Briefly, stages i and ii included patients with primary melanoma, stage iii included patients with regional lymph node and/or in - transit metastases and stage iv included patients with distant metastases . Patients were treated according to therapy protocols of the dermatologic cooperative oncology group (decog) including cytostatic drugs (dacarbacine, cis - platinum, temozolomide, vincristine) and immunomodulatory agents [interferon(ifn)] in different combinations and schedules . Follow - up was performed in at least 3-months intervals including physical examination, x - ray of the chest, ultra- sound of the abdomen and lymph nodes as well as blood chemistry . Patients in advanced disease stages additionally underwent computer tomography of the brain and szintigraphy of the skeleton . The retrospective analysis and genotyping of dna from paraffin - embedded tissues in an anonymous form was approved by the ethical committee of the university hospital essen (essen, germany). M; male; f, female; ssm, superficial spreading melanoma; nm, nodular melanoma; lmm, lentigo maligna melanoma; alm, acral lentiginous melanoma; ucm, unclassified melanoma dna was extracted from paraffin - embedded tissue samples using a commercially available kit (qiaamp, qiagen, hilden, germany). Genotypes of the t393c polymorphism were determined by pcr using the following primers: forward primer 5'-ctcctaactga catggtgcaa-3' and reverse primer 5'-taaggc cacacaagtcggggt-3' . After denaturation at 94c, 35 cycles of dna amplification were performed using taq pcr mastermix (eppendorf, hamburg, germany) at 94 for 45 sec, 58c for 40 seconds, and 72 for 45 seconds . The 345 bp pcr products were digested using the restriction enzyme foki and analyzed on a 2% agarose gel . The unrestricted products (345 bp) represented the tt genotype; the completely restricted products (259 and 86 bp) represented the cc genotype . The clinical outcome analyzed in this study was survival, and metastasis dependent on uicc stages, melanoma subtypes, and t393c genotypes . Kaplan - meier plots and the log - rank test were used to evaluate the relationship between uicc stages, melanoma subtypes or t393c genotypes, and clinical outcome from the date of the primary diagnosis to the end of follow - up . The effects of gender, age at diagnosis, uicc stages, and t393c genotypes as prognostic factors for the clinical outcome were analyzed by stepwise multivariate cox regression analysis . Hazard ratios and 95% confidence intervals (95% ci) were calculated from the cox regression model including all factors for multivariate analysis and for the indicated factor for univariate analysis . Contingency tables and the pearson's chi - square test were used for categorical variables using t393c genotypes . All statistical analyses were done using spss 13.0 (spss, chicago, il) or graphpad prism 4.0 (graph - pad software, san diego, ca). This study comprises a total of 328 consecutive malignant melanoma patients (with a mean age of 54.2 16.4 years) treated at the department of dermatology and allergology, ruhr - university bochum (bochum, germany) between 1995 and 2000 with disease progression being continuously documented . The clinical staging was performed according to the american joint committee on cancer (ajcc 1997). Briefly, stages i and ii included patients with primary melanoma, stage iii included patients with regional lymph node and/or in - transit metastases and stage iv included patients with distant metastases . Patients were treated according to therapy protocols of the dermatologic cooperative oncology group (decog) including cytostatic drugs (dacarbacine, cis - platinum, temozolomide, vincristine) and immunomodulatory agents [interferon(ifn)] in different combinations and schedules . Follow - up was performed in at least 3-months intervals including physical examination, x - ray of the chest, ultra- sound of the abdomen and lymph nodes as well as blood chemistry . Patients in advanced disease stages additionally underwent computer tomography of the brain and szintigraphy of the skeleton . The retrospective analysis and genotyping of dna from paraffin - embedded tissues in an anonymous form was approved by the ethical committee of the university hospital essen (essen, germany). M; male; f, female; ssm, superficial spreading melanoma; nm, nodular melanoma; lmm, lentigo maligna melanoma; alm, acral lentiginous melanoma; ucm, unclassified melanoma dna was extracted from paraffin - embedded tissue samples using a commercially available kit (qiaamp, qiagen, hilden, germany). Genotypes of the t393c polymorphism were determined by pcr using the following primers: forward primer 5'-ctcctaactga catggtgcaa-3' and reverse primer 5'-taaggc cacacaagtcggggt-3' . After denaturation at 94c, 35 cycles of dna amplification were performed using taq pcr mastermix (eppendorf, hamburg, germany) at 94 for 45 sec, 58c for 40 seconds, and 72 for 45 seconds . The 345 bp pcr products were digested using the restriction enzyme foki and analyzed on a 2% agarose gel . The unrestricted products (345 bp) represented the tt genotype; the completely restricted products (259 and 86 bp) represented the cc genotype . The clinical outcome analyzed in this study was survival, and metastasis dependent on uicc stages, melanoma subtypes, and t393c genotypes . Kaplan - meier plots and the log - rank test were used to evaluate the relationship between uicc stages, melanoma subtypes or t393c genotypes, and clinical outcome from the date of the primary diagnosis to the end of follow - up . The effects of gender, age at diagnosis, uicc stages, and t393c genotypes as prognostic factors for the clinical outcome were analyzed by stepwise multivariate cox regression analysis . Hazard ratios and 95% confidence intervals (95% ci) were calculated from the cox regression model including all factors for multivariate analysis and for the indicated factor for univariate analysis . Contingency tables and the pearson's chi - square test were used for categorical variables using t393c genotypes . All statistical analyses were done using spss 13.0 (spss, chicago, il) or graphpad prism 4.0 (graph - pad software, san diego, ca). Demographic characteristics and tumor stage in the whole patient group and by t393c genotypes are displayed in table 1 . The frequency of the c allele in the patient group was 0.52 and genotype distribution was compatible with the hardy - weinberg equilibrium . Genotypes and allele frequency of patients were comparable with those of healthy white blood donors; details of this control group have been published previously . This argues against an association of t393c genotypes with an increased susceptibility for malignant melanoma . Moreover, genotypes were not significantly associated with tumor localization, uicc classification, or tumor thickness (table 1). During follow up, 85 patients (25.9%) experienced metastases and 88 (28.1%) died . In order to confirm that our sample was representative for patients with malignant melanoma we calculated kaplan - meier curves for overall survival depending on the uicc stages and tumor subtype . As shown in figure 1a - b, overall survival was significantly dependent upon ajcc stage and tumor type . Five - year survival rates were 90.4% for uicc i, 77.1% for uicc ii, 52.4% for uicc iii, and 28.6% for uicc iv . Regarding tumor types, 5-year survival rates were 83.4% for ssm, 73.3% for nm, 87.3% for lmm, 75.0% for alm and 79.4% for ucm . Kaplan - meier curves for overall survival in 328 patients with malignant melanoma based on the uicc stage (a) and tumor subtype (b). Ssm, superficial spreading melanoma; nm, nodular melanoma; lmm, lentigo maligna melanoma; alm, acral lentiginous melanoma; ucm, unclassified melanoma . Concerning genotypes of the t393c polymorphism gnas1 393c allele carriers displayed a higher risk for metastasis (c versus tt: 2.2, 95% ci 1.1 - 3.2, p = 0.017) compared to t393 homozygous patients kaplan - meier curves for metastasis - free survival in 328 patients with malignant melanoma based on t393c alleles . In the multivariable analysis with gender, age at diagnosis, tumor stage, and melanoma subtype, the hazard ratio for patients with c - alleles was 2.55 for metastasis compared to homozygous 393 t allele carriers (table 2). Multivariable cox proportional hazard model for metastasis in 328 patients with malignant melanoma * reference group . Ssm, superficial spreading melanoma; nm, nodular melanoma; lmm, lentigo maligna melanoma; alm, acral lentiginous melanoma; ucm, unclassified melanoma demographic characteristics and tumor stage in the whole patient group and by t393c genotypes are displayed in table 1 . The frequency of the c allele in the patient group was 0.52 and genotype distribution was compatible with the hardy - weinberg equilibrium . Genotypes and allele frequency of patients were comparable with those of healthy white blood donors; details of this control group have been published previously . This argues against an association of t393c genotypes with an increased susceptibility for malignant melanoma . Moreover, genotypes were not significantly associated with tumor localization, uicc classification, or tumor thickness (table 1). During follow up, 85 patients (25.9%) experienced metastases and 88 (28.1%) died . In order to confirm that our sample was representative for patients with malignant melanoma we calculated kaplan - meier curves for overall survival depending on the uicc stages and tumor subtype . As shown in figure 1a - b, overall survival was significantly dependent upon ajcc stage and tumor type . Five - year survival rates were 90.4% for uicc i, 77.1% for uicc ii, 52.4% for uicc iii, and 28.6% for uicc iv . Regarding tumor types, 5-year survival rates were 83.4% for ssm, 73.3% for nm, 87.3% for lmm, 75.0% for alm and 79.4% for ucm . Kaplan - meier curves for overall survival in 328 patients with malignant melanoma based on the uicc stage (a) and tumor subtype (b). Ssm, superficial spreading melanoma; nm, nodular melanoma; lmm, lentigo maligna melanoma; alm, acral lentiginous melanoma; ucm, unclassified melanoma . Gnas1 393c allele carriers displayed a higher risk for metastasis (c versus tt: 2.2, 95% ci 1.1 - 3.2, p = 0.017) compared to t393 homozygous patients . Kaplan - meier curves for metastasis - free survival in 328 patients with malignant melanoma based on t393c alleles . In the multivariable analysis with gender, age at diagnosis, tumor stage, and melanoma subtype, the hazard ratio for patients with c - alleles was 2.55 for metastasis compared to homozygous 393 t allele carriers (table 2). Multivariable cox proportional hazard model for metastasis in 328 patients with malignant melanoma * reference group . Ssm, superficial spreading melanoma; nm, nodular melanoma; lmm, lentigo maligna melanoma; alm, acral lentiginous melanoma; ucm, unclassified melanoma although uicc stages generally correlate with outcome in a large percentage of cancer patients, refined prediction of the individual disease course would facilitate clinical decision making, e.g. Early requirement of adjuvant therapy . The familial melanoma syndromes are associated with germ line mutations in three highly penetrant gene products: p16, alternate reading frame, and cyclin - dependent kinase 4 . Certain variants in a low - penetrance gene, mc1r, the melanocortin 1 receptor gene, increase melanoma risk to a lesser extent and act as genetic modifiers when cosegregating with a deleterious p16 gene . Since the immune response against malignant melanoma cells can be influenced by cytokines with potentially inhibitory effects on tumor cell growth, snps in cytokine genes associated with reduced cytokine production are expected to influence susceptibility to cancer, including malignant melanoma . Genotypes associated with reduced production of pro - inflammatory and immunomodulatory tnf - alpha, ifn - gamma, and il-6, and anti - inflammatory il-10 and tgf - beta1 could be involved in mechanisms of cancer progression and escape from immunosurveillance . Genotypic variations in the il10 promotor are significantly associated with an increased risk for malignant melanoma and may be associated with a poor outcome . One of the aims of the present study was, therefore, to investigate whether the common t393c snp in the gene gnas1, may be predictive for survival or disease - free survival in patients with malignant melanoma . The mean age of the patients of the present malignant melanoma series was 54.2 years and the median follow - up time was 80 months . Distribution of tumor stage and subtype of the whole series were compatible with data reported in the literature . Results of the german central register of malignant melanoma showed a mean age of 58.1 year and a similar distribution of subtypes as reported here . Beside the role of tumor stage and tumor thickness as the most important prognostic factor in patients with malignant melanoma, our data suggest a potential predictive use of the gnas1 t393c snp as an independent prognostic factor in malignant melanoma . C - allele carriers have an increased risk for tumor progression when compared to patients with the homozygous 393tt genotype, the latter group showing both a longer relapse - free survival and a later requirement for secondary therapy . Together with our previous observations showing that the t393c snp is a predictive marker for outcome in bladder cancer, renal cell carcinoma and colorectal cancer, the present results confirm the potential role of this snp as a universal genetic marker for predicting tumor progression . The gnas1 tt genotype is associated with increased gs mrna expression in different tissues14 which led us to hypothesize that the t393c exchange itself could have an effect upon mrna stability . Interestingly, determinants of mrna stability have been described in the coding region of some other genes [27 - 29]. Different in vitro experiments suggest that increased expression of gs is associated with enhanced apoptosis [17 - 19]. The second messenger cyclic amp, which is generated subsequently to activation of gs, seems to play a major role in this proapoptotic process . As an example, craf is inhibited by protein kinase a, which is one of the downstream effectors of camp . Cyclic amp is produced in response to melano cytic agonists such as -melanocyte - stimulating hormone acting through the melanocortin 1 receptor resulting in activation of gs . Although this is only able to weakly stimulate proliferation, camp is closely associated with melanocyte differentiation (e. g. stimulation of melanin synthesis). A recent report has shown that camp blocks craf activity in melanocytes resulting in suppression of the oncogenic activity of craf in these cells . This process could be of particular importance in tt genotypes in which gs expression is increased . However, craf is not required for mek / erk signalling in melanoma cells when braf is mutated . Late mutations in the braf gene could, therefore, mitigate the t393c genotype effect which may explain the lack of genotype - dependent differences in overall survival . This hypothesis is supported by observations from studies in different types of cancer in which braf mutations are rarely events and in which then the t393c snp affects overall survival . The goal of ongoing studies is to unravel both the detailed molecular mechanisms by which the silent c393 t snp contributes to differential gs expression in human tissues and how this may change the phenotype of different tumor cells.
One problem may be that it is difficult to present a comprehensive picture of the scope of the problem assessable to other than clinical experts . Resistance is a global phenomenon involving many types of infections, bacteria and substances and data are scarce, particularly so in developing countries . Nevertheless, using data from the european antimicrobial resistance surveillance system (earss), the european centre for disease prevention and control (ecdc) and the european medicines agency (emea) issued a report in 2007 on the situation in the eu, norway and iceland for six commonly isolated, often multi - resistant, bacteria (4). For the us, information on resistance in, more or less, the same bacteria are available from intensive care units (11, 13). Though the figures for the eu and the us are not quite comparable, table 1 gives an indication of the prevalence of resistance in these two regions . Shares of resistant isolates in selected bacteria in the eu, norway and iceland and in the us sources: data for the eu, norway and iceland are from earss and refer to 2007 (cf . Data for the us are from cdc national nosocomial infections surveillance system and refer to 2002/2003 (cf . References 11 and 13). It should be noted that, for the european countries, there are large differences in the shares of resistant isolates in table 1 . In particular, there seems to be a north - south gradient, suggesting that they are less frequent in the scandinavian countries and iceland, and more frequent in the mediterranean countries . It has been suggested that these differences can be partly explained by differences in antibiotic use between countries (9). As to trends in resistance, the findings in the ecdc / emea joint technical report indicate that, for europe as a whole, shares of resistant isolates, despite some variation from one year to another, have been fairly constant over time for most of the bacteria in table 1 . Exceptions are mrsa, which declined from 2004 to 2007, and 3rd generation cephalosporin - resistant escherichia coli isolates, which have been rising steadily since 2002 . Again, there are differences between countries . For instance, despite the decline in the overall european share of mrsa isolates, two of the 28 countries reported increasing shares . The ecdc / ema - report also presents estimates of the consequences of resistance in terms of annual number of infections, additional deaths, extra hospital days and societal costs (direct health care costs and the value of productivity lost) caused by the selected bacteria (cf . Number of infections, deaths and hospital days caused by resistant bacteria in the eu, norway and iceland 2007 source: earss (cf . Reference 4). Societal costs of infections caused by antibiotic resistant bacteria in the eu, norway and iceland 2007 (million) source: earss (cf . Reference 4). Data for the us are more scattered and often concern effects of all infections caused by resistant bacteria in singular hospitals (14) or, alternatively, the consequences of all hospital acquired infections (which may not necessarily have been caused by resistant bacteria) (15). However, there are studies reporting that mrsa caused 250,000300,000 hospital acquired infections, about 2.7 million hospital days, and 12,000 deaths annually, resulting in annual costs of about us $9.5 billion (10.1 billion) in the early 2000s and that vre caused about 26,000 infections in us hospitals in 2004 (16, 17). Regarding the development of new antibiotic substances, the ecdc / emea joint technical report (4), as well as successive reports from the infectious diseases society of america (idsa) (1, 11, 13) and institute of medicine of the national academies (iom) (12), moreover, most of them do not represent a novel mode of action associated with a new chemical structure (18). Iii), ecdc / emea and idsa concluded that expectations for a rapid change are low . In particular there seems to be a lack of new antibiotics expected to be effective in resistant gram - negative bacteria (3rd generation cephalosporin resistant e. coli and klebsiella pneumonia, and carbapenem resistant pseudomonas aeruginosa). A further cause for concern is the fact that pharmaceutical firms seem to have reduced investment in r&d for antibiotics in favour of other drugs with more promising financial incentives (1, 1825). Thus, although the data above do not present an encompassing picture of the resistance problem, they do suggest that it is significant and causes substantial societal costs . On a general level, there seems to be consensus that there is a need for doing two things (1) preserve the efficiency of present substances by restricting use and, (2) increase the supply of new substances brought to the market (1, 4, 12). Unfortunately, as preserving the efficiency of present substances entails restricting use, the two objectives are partly opposing and not easy to achieve simultaneously . The discussion below uses examples from human medicine and there are concerns that the use of antibiotics in veterinary medicine may be an equally large problem . Moreover, resistance to drugs used in veterinary medicine may potentially affect resistance to drugs used in human medicine, and vice versa . However, as the problem is similar, the measures to address it will also be similar . To preserve the efficiency of existing drugs, the need for guidelines for good antibiotic stewardship has been emphasised . Such guidelines have also been developed in several countries, although their implementation is not straight forward (2630). They include, inter alia, recommendations to increase hygienic measures to control resistance in hospitals and community homes, to condition all use of antibiotics on prescription, to restrict use to bacterial infections only, and emphasise the importance of choosing the optimal therapy with regard to substance, administration, dosage and duration (2735). However, hygienic measures to control resistance in the institutional setting are not without costs to hospitals and nursing homes . Restricting use to bacterial infections and choosing the optimal therapy requires access to quick and reliable diagnostic facilities which may be a problem outside the hospital setting . Thus, faced with concerned patients presenting symptoms not easily diagnosed, physicians may have incentives to prescribe broad spectrum antibiotics with potential adverse effects on resistance . Informing the public on the issues involved might make a decision not to prescribe (until test - results are available) more acceptable, but this is by no means certain as the individual patient, while gaining the full benefit if treatment is effective, will not bear the full (societal) costs of increased resistance if it is not (3638). Note that the opposite problem applies to hospitals and other institutions when determining if the implementation of stricter hygienic procedures is worthwhile (i.e. The institution will bear the full costs of the procedures in question while sharing the benefits with society at large). To provide patients and institutions with incentives to consider the full societal costs of antibiotic use, it has been suggested that a fee corresponding to the expected costs of resistance should be levied on the use of antibiotics (1, 38). One problem with this solution is that the fee's demand - constraining effect may be limited if expenses for antibiotics are covered by insurance- or other third party payer systems . . However, that could raise concern regarding the access to antibiotics for less affluent patients (and countries) and, therefore, not be acceptable to policy makers . The optimal fee should equal the expected marginal costs of resistance caused by antibiotic use (39). If it is set higher, demand will be reduced by too much (i.e. The health benefits from a marginal increase in use will exceed the expected costs of resistance caused by that marginal increase in use) and, if it its set lower, demand will be reduced by too little (health benefits from a marginal increase in use will be smaller than the expected costs of resistance caused by that marginal increase in use). As the effects of use on resistance are not fully understood, and may differ between substances, optimal fees cannot be expected . One might consider determining the fee on the basis that it, for a given antibiotic, should generate enough returns to finance the development of a successor during the period it takes until resistance becomes a problem for that substance . This requires information on development costs and time until resistance becomes a problem which is likely to depend on the antibiotic in question . However, some knowledge may be gained from past experience . While development costs are the property of pharmaceutical firms and, therefore, not easily accessible, some estimates do exist (4044). Similarly, there are estimates of the time from introduction to detection of resistance for several substances (45). To determine the fee per unit of substance required to raise the necessary funds, information on the annual amounts consumed of different substances would also be needed . A fee determined in this way is of course unlikely to be optimal in the sense defined above . However, it is also unlikely to be too high since one result from studies estimating development costs is that these have been rising continuously since the 1970s . Accordingly, while it may not be large enough to achieve an optimal reduction in antibiotic consumption from the perspective of preserving efficiency, it may at least go part of the way . On the other hand, if the consumption of antibiotics is reduced, this could increase the problem of achieving the other objective increasing the supply of new antibiotics . The supply of new antibiotics is dependent on research and development (r&d) to discover and market them . The outcome of this process depends on how difficult it is to identify substances with the desired characteristics . This, in turn, is a function of our understanding of the biological mechanisms involved, and of the requirements of the approval procedure . The less that is known about the biological mechanisms, the more resources are needed to uncover the issues involved . Similarly, the stricter the requirements for approval, the more resources are needed to satisfy them . Our understanding of the biological mechanisms is imperfect (not least regarding the mechanisms causing resistance), suggesting that r&d costs may be substantial . However, the literature does not indicate that they are significantly higher than for other types of pharmaceuticals (46). The bulk of the r&d work is carried out by pharmaceutical firms that depend on sales revenues for financing their operation . Of course, the larger the costs of r&d are in relation to the (expected) revenues, the smaller the incentives for pharmaceutical firms to engage in the process . The revenues are a function of the amounts sold and the price of the drug in question . Here, there are indications that revenues from antibiotics may be lower than those from other classes of pharmaceuticals that are prescribed for longer periods (18, 20, 25). Accordingly, it appears that insufficient financial incentives to engage in r&d is an important reason for the paucity of new antibiotic substances . Several measures to increase the supply of antibiotics by changing incentives, ranging from changing the requirements for approval of new drugs, over tax - credits for research and public - private partnerships, to prolongation of patent duration, have therefore been discussed and suggested (1, 13, 18, 19, 46). There certainly appears to be good reason to make adjustments in the requirement for approval . For instance, it is not clear why clinical trials for each infection pneumonia, urinary tract infection, skin and soft tissue infection, etc . Should be required for approval of the use of a certain drug in their treatment if these infections are caused by the same bacteria . Thus, one suggestion is to condition approval on demonstrated efficacy towards specific organisms rather than specific infections (13, 19). This might also increase incentives for pharmaceutical firms to invest in developing drugs with a narrow spectrum relative to broad spectrum drugs, which would reduce resistance caused by the use of antibiotics . The evidence is mixed in that, while they do increase incentives, effects appear to be limited since taxes only constitute a small part of the development costs . Public - private partnerships in r&d for antibiotics may be a solution for specific drugs with very limited markets (xdr / pdr acineobacter and kleibsella) but could not, and should not, replace the efforts of private firms in r&d to replace antibiotics not facing these market limitations . A patent excludes the holder from competition from generic substances which provides a monopoly position with the potential of gaining larger revenues from higher prices . However, patents are often sought early in the development process and, due to the longevity of this process, they may only last for a short period after the drugs are approved and marketed . Increasing the duration of patents for antibiotics might, therefore, provide better incentives for their development . However, the higher prices charged by the monopolist will also affect demand, and it has been shown that this may restrict the use of antibiotics by too much from the societal perspective (4750). In addition, the revenues obtained may not necessarily be invested in the development of new antibiotics as they compete for resources with other pharmaceuticals that may be perceived to have better net present earnings (18, 20, 25). Finally, strengthening the monopoly position of patent holders may have detrimental effects on competition which could reduce incentives to develop new substances . An alternative strategy may be subsidies targeted directly at the development of new antibiotics as this would compensate for lower expected sales revenues in comparison to other pharmaceuticals, particularly if measures to constrain the use of antibiotics are successfully applied . These subsidies of course needs finance which may be difficult to secure given tight government budgets . However, as noted above, if a fee is levied on the consumption of antibiotics as a measure to preserve the efficiency of existing drugs by containing their use, the proceeds from this fee could be used to finance such targeted subsidies . In this context, it may be noted that the demand - constraining effects of the fee would be less of a problem (i.e. If the fee does not reduce the use of antibiotics very much, the revenues raised and available for the financing of subsidies to develop new substances would be larger). That is, the responsible body must have the competence to evaluate the potential of different research ideas, which is a very demanding task . To preserve the efficiency of existing drugs, the need for guidelines for good antibiotic stewardship has been emphasised . Such guidelines have also been developed in several countries, although their implementation is not straight forward (2630). They include, inter alia, recommendations to increase hygienic measures to control resistance in hospitals and community homes, to condition all use of antibiotics on prescription, to restrict use to bacterial infections only, and emphasise the importance of choosing the optimal therapy with regard to substance, administration, dosage and duration (2735). However, hygienic measures to control resistance in the institutional setting are not without costs to hospitals and nursing homes . Restricting use to bacterial infections and choosing the optimal therapy requires access to quick and reliable diagnostic facilities which may be a problem outside the hospital setting . Thus, faced with concerned patients presenting symptoms not easily diagnosed, physicians may have incentives to prescribe broad spectrum antibiotics with potential adverse effects on resistance . Informing the public on the issues involved might make a decision not to prescribe (until test - results are available) more acceptable, but this is by no means certain as the individual patient, while gaining the full benefit if treatment is effective, will not bear the full (societal) costs of increased resistance if it is not (3638). Note that the opposite problem applies to hospitals and other institutions when determining if the implementation of stricter hygienic procedures is worthwhile (i.e. The institution will bear the full costs of the procedures in question while sharing the benefits with society at large). To provide patients and institutions with incentives to consider the full societal costs of antibiotic use, it has been suggested that a fee corresponding to the expected costs of resistance should be levied on the use of antibiotics (1, 38). One problem with this solution is that the fee's demand - constraining effect may be limited if expenses for antibiotics are covered by insurance- or other third party payer systems . However, that could raise concern regarding the access to antibiotics for less affluent patients (and countries) and, therefore, not be acceptable to policy makers . The optimal fee should equal the expected marginal costs of resistance caused by antibiotic use (39). If it is set higher, demand will be reduced by too much (i.e. The health benefits from a marginal increase in use will exceed the expected costs of resistance caused by that marginal increase in use) and, if it its set lower, demand will be reduced by too little (health benefits from a marginal increase in use will be smaller than the expected costs of resistance caused by that marginal increase in use). As the effects of use on resistance are not fully understood, and may differ between substances one might consider determining the fee on the basis that it, for a given antibiotic, should generate enough returns to finance the development of a successor during the period it takes until resistance becomes a problem for that substance . This requires information on development costs and time until resistance becomes a problem which is likely to depend on the antibiotic in question . While development costs are the property of pharmaceutical firms and, therefore, not easily accessible, some estimates do exist (4044). Similarly, there are estimates of the time from introduction to detection of resistance for several substances (45). To determine the fee per unit of substance required to raise the necessary funds, information on the annual amounts consumed of different substances would also be needed . A fee determined in this way is of course unlikely to be optimal in the sense defined above . However, it is also unlikely to be too high since one result from studies estimating development costs is that these have been rising continuously since the 1970s . Accordingly, while it may not be large enough to achieve an optimal reduction in antibiotic consumption from the perspective of preserving efficiency, it may at least go part of the way . On the other hand, if the consumption of antibiotics is reduced, this could increase the problem of achieving the other objective increasing the supply of new antibiotics . The supply of new antibiotics is dependent on research and development (r&d) to discover and market them . The outcome of this process depends on how difficult it is to identify substances with the desired characteristics . This, in turn, is a function of our understanding of the biological mechanisms involved, and of the requirements of the approval procedure . The less that is known about the biological mechanisms, the more resources are needed to uncover the issues involved . Similarly, the stricter the requirements for approval, the more resources are needed to satisfy them ., our understanding of the biological mechanisms is imperfect (not least regarding the mechanisms causing resistance), suggesting that r&d costs may be substantial . However, the literature does not indicate that they are significantly higher than for other types of pharmaceuticals (46). The bulk of the r&d work is carried out by pharmaceutical firms that depend on sales revenues for financing their operation . Of course, the larger the costs of r&d are in relation to the (expected) revenues, the smaller the incentives for pharmaceutical firms to engage in the process . The revenues are a function of the amounts sold and the price of the drug in question . Here, there are indications that revenues from antibiotics may be lower than those from other classes of pharmaceuticals that are prescribed for longer periods (18, 20, 25). Accordingly, it appears that insufficient financial incentives to engage in r&d is an important reason for the paucity of new antibiotic substances . Several measures to increase the supply of antibiotics by changing incentives, ranging from changing the requirements for approval of new drugs, over tax - credits for research and public - private partnerships, to prolongation of patent duration, have therefore been discussed and suggested (1, 13, 18, 19, 46). There certainly appears to be good reason to make adjustments in the requirement for approval . For instance, it is not clear why clinical trials for each infection pneumonia, urinary tract infection, skin and soft tissue infection, etc . Should be required for approval of the use of a certain drug in their treatment if these infections are caused by the same bacteria . Thus, one suggestion is to condition approval on demonstrated efficacy towards specific organisms rather than specific infections (13, 19). This might also increase incentives for pharmaceutical firms to invest in developing drugs with a narrow spectrum relative to broad spectrum drugs, which would reduce resistance caused by the use of antibiotics . The evidence is mixed in that, while they do increase incentives, effects appear to be limited since taxes only constitute a small part of the development costs . Public - private partnerships in r&d for antibiotics may be a solution for specific drugs with very limited markets (xdr / pdr acineobacter and kleibsella) but could not, and should not, replace the efforts of private firms in r&d to replace antibiotics not facing these market limitations . A patent excludes the holder from competition from generic substances which provides a monopoly position with the potential of gaining larger revenues from higher prices . However, patents are often sought early in the development process and, due to the longevity of this process, they may only last for a short period after the drugs are approved and marketed . Increasing the duration of patents for antibiotics might, therefore, provide better incentives for their development . However, the higher prices charged by the monopolist will also affect demand, and it has been shown that this may restrict the use of antibiotics by too much from the societal perspective (4750). In addition, the revenues obtained may not necessarily be invested in the development of new antibiotics as they compete for resources with other pharmaceuticals that may be perceived to have better net present earnings (18, 20, 25). Finally, strengthening the monopoly position of patent holders may have detrimental effects on competition which could reduce incentives to develop new substances . An alternative strategy may be subsidies targeted directly at the development of new antibiotics as this would compensate for lower expected sales revenues in comparison to other pharmaceuticals, particularly if measures to constrain the use of antibiotics are successfully applied . These subsidies of course needs finance which may be difficult to secure given tight government budgets . However, as noted above, if a fee is levied on the consumption of antibiotics as a measure to preserve the efficiency of existing drugs by containing their use, the proceeds from this fee could be used to finance such targeted subsidies . In this context, it may be noted that the demand - constraining effects of the fee would be less of a problem (i.e. If the fee does not reduce the use of antibiotics very much, the revenues raised and available for the financing of subsidies to develop new substances would be larger). That is, the responsible body must have the competence to evaluate the potential of different research ideas, which is a very demanding task . The previous review has, while by no means being exhaustive, pointed at some of the problems in addressing the challenge from antibiotic resistance . Basically, they arise from the fact that the two objectives preserving the efficiency of existing substances and increasing the supply of new antibiotics are partially opposing . Thus, while several measures to achieve either one of them have been proposed in the literature, each with their own pros and cons that need to be considered, the problem remains that the more successful measures are in achieving one of the objectives, the more difficult will it be to achieve the other . Notwithstanding, the idea of levying a fee on antibiotics and use the proceeds to finance targeted subsidies may, at least partly, reconcile them . Also, measures aimed at facilitating the approval process do not necessarily limit the possibilities of containing the use of antibiotics . This suggests that more resources should be directed to the further development of these two strategies . A further problem is that, ideally, measures to address antibiotic resistance should be applied on a global basis . This, of course, requires international cooperation which has proved to be complicated in other circumstances . Given the global nature of the resistance problem, as well as the fact that pharmaceutical firms operate on a global basis, the who seems to be a natural candidate for shouldering the responsibility of developing solutions to the implementation of the measures suggested in the literature . However, national governments may be reluctant to give up legislative power (which might be called for if principles of good antibiotic stewardship should be equally enforced in all countries) or the control of funds (which may be the implication of using the proceeds from a fee on antibiotics strictly for the development of new substances). Nevertheless, actions taken by national governments may go a long way to reduce the resistance problem, as visualised by the differences between countries in the eu in the magnitude of the problem . Lack of incentives and awareness are important reasons for why the problem of antibiotic resistance is difficult to overcome . Increasing incentives for supplying new antibiotics requires funding to subsidise r&d costs . To increase awareness, this funding could, at least partially, be provided by a fee levied on the use of antibiotics . As the fee would raise the price of antibiotics, it would also serve as an incentive to reduce antibiotic consumption, thereby contributing to preserving the efficiency of present substances . The author has not received any funding or benefits from industry or elsewhere to conduct this study.
The delicate catheter ablation of atrial fibrillation (af) involves a relevant risk of major complications although mortality is less than 1 in 2000,, . Patients undergoing catheter ablation for af are required to lie motionless on the procedure table for several hours, and repeated stimuli from ablation are sometimes painful . For these reasons, the safety of deep sedation in this procedure has already been tested, and high - frequency jet ventilation during general anesthesia has also proved to be a safe technique . Aid for anesthetic management in these setting can be non - invasive ventilation (niv), first used in acute respiratory failure, sometimes during sedation, subsequently used outside of the intensive care unit and in cardio - surgical procedures,,, . The aim of our study was to evaluate the usefulness of niv during sedation in catheter ablation of use af instead of atrial fibrillation compared to deep sedation . In the study period (24 months), conducted in a single high - volume electrophysiology procedure center, consecutive patients undergoing catheter ablation for paroxysmal / persistent atrial fibrillation were retrospectively revised (fig . 1). Exclusion criteria for the procedure were left ejection fraction less than 40%, moderate - to - severe mitral valve disease, severe heart failure (new york heart association functional class iii or iv), expected surgery for structural heart disease, secondary af (due to cardiac surgery, infection or hyperthyroidism), severe copd with concomitant respiratory insufficiency (pao2 <60 mmhg), presence of inducible myocardial ischemia or other acute illness underway, or contraindications to anesthesia . Complications and recurrence of af occurring within 48 h of the electrophysiological procedure were also examined . Perioperative anesthesia visits and sedation procedures were performed according to siaarti (societ italiana di anestesia analgesia rianimazione e terapia intensiva) guidelines,, including pulmonary function tests in the anesthetic assessment . Routine monitoring (electrocardiography, pulse oximetry, invasive arterial pressure, seriate arterial blood gas analysis and apnea monitor) were performed . Sedation and niv were performed after trans - septal puncture in order to rule out left - sided emboli through neurologic assessment . Midazolam 0.010.02 mg / kg iv was administered immediately before monitoring, fentanyl (2.55 g / kg) was administered as analgesic and sedation was performed by propofol infusion (bolus dose 11.5 mg / kg, maintenance 24 the infusion rate was carefully titrated to achieve a target sedation level of a ramsay sedation scale of 23 . Mean arterial pressure was maintained above 75 mmhg during the entire procedure . During deep sedation, the patients were breathing spontaneously and were given supplemental oxygen (fio2 80100%) to maintain the oxygen saturation level above 92% . In patients undergoing niv ventilation the procedure was performed with a respironic latex - free total face mask connected to garbin ventilator (linde inc ., herrsching, germany) in spontaneous / temporized mode applying incorporated algorithms to improve patient - ventilator synchrony by adjusting to changing breathing patterns and dynamic leaks . I - pap, e - pap and respiratory rate were modified according to the clinical response, tolerance of the patient to obtaining exhaled tidal volume of 68 ml / kg; fio2 requirement was 40% or less to maintain oxygen saturation above 92% . The ventilator settings were adjusted on the basis of pulse oximetry and serial measurement of arterial blood gases . Sedation was halted when the mechanical ventilation was discontinued or at the end of the catheter ablation procedure . At the end of the procedure, patients were transferred, according to hospital protocol, to the intensive care unit for monitoring . Oral anticoagulation with stable international normalized ratio (inr) superior to 2.0 was ensured for at least 3 weeks before ablation . Transesophageal echocardiography was performed within 24 h before the procedure, to rule out the presence of left atrial thrombi . Local anesthesia (lidocaine 1%) after septal puncture of interatrial septum, intravenous heparin was administered according to institutional standards . Minneapolis, mn, usa or carto-3 mapping system, biosense webster, diamond bar, ca, usa) with image integration using computer tomography or magnetic resonance reconstruction of the left atrium . Catheter ablation procedure was performed using radiofrequency energy or cryoablation balloon ablation catheter (arctic front, medtronic, minneapolis, mn, usa). The electroanatomic mapping systems and the energy sources used during the procedure were selected by the electrophysiology team in relation to clinical characteristics of the patient . Categorical variables were represented as percentages, continuous variables as mean standard deviation . Comparisons between groups were performed by unpaired samples two - sided t - test or chi - square test, with continuity correction, where appropriate . Intra - procedural changes of arterial blood gas variables were expressed as percentage variation of their basal values . A p - value less than 0.05 was considered statistically significant . During the study period 72 electrophysiology procedures carried out in deep sedation were evaluated; 41 (57%) procedures were performed with niv (niv group) and the other 31 (43%) with - out niv (deep sedation group). The clinical characteristics of the patients and the procedural details are shown in table 1 . The two groups of patients showed no differences in these fields, but between the two groups, a significant variation was present in the basal paco2 (p = 0.008) with values in the physiological range and in intra - procedural blood gas parameters (ph p = 0.001, pao2 p = 0.004, paco2 p = 0.002 respectively (fig . Analysis of the percentage change between basal to intraprocedural blood gas parameters (fig . 3) shows a statistical variation in the changing of ph and paco2 (p = 0.002 and 0.001, respectively). During niv procedures there were no problems due to mask - related difficulties, gastric distention, niv discomfort or significant hemodynamic alterations related to positive pressure ventilation . In the deep sedation procedure there were two episodes of respiratory complications with severe hypercapnia (achieved a paco2 greater than 60 mmhg) treated with application of niv . Adverse events, focused on periprocedural complications, were reported in 26 patients (36%). Among the complications, vascular access complications occurred in nine cases (iatrogenic femoral pseudoaneurysms that required percutaneous treatment in 5 cases and femoral hematoma with decrease in hemoglobin levels greater than 2 g / dl in four cases); none of these cases required transfusion support . Pleuro - pericardial effusion was documented in 8 cases; exacerbation of bronchial asthma in three cases; bradyarrhythmia requesting definitive pacemaker implantation in two cases; pulmonary embolism in one case; procedural myocardial infarction in one case; post - procedural stroke in one case and permanent paralysis of the phrenic nerve in one case . The recurrence of af within 48 h of the electrophysiological procedure was recorded in 21 patients (29%) and was treated by electrical or pharmacological cardioversion . Deep sedation for catheter ablation of af is feasible and safe while maintaining spontaneous ventilation . In our sedation procedures in catheter ablation of af the niv was safe as well, and maintained (although with respiratory parameters in the physiological range) a better homeostasis in these parameters compared to deep sedation in breathing spontaneously . Data shown in fig . 2, fig . 3 confirmed a lower impact of niv on arterial blood gas tensions and hematic ph balance compared to deep sedation . While statistically significant differences were found, the absolute value differences had a clinically limited benefit; using niv made it possible to reduce the flow of oxygen administered to the patient during the procedure and maintain better respiratory dynamics . These conditions allowed us to maintain effective co2 elimination with minimum impact on the ph compared to the deep sedation group . Furthermore, in the 2 cases of patients who developed severe hypercapnia during deep sedation, the application of niv was effective in solving the respiratory problem without the need for endotracheal intubation . This data shows an important and clinically relevant difference between the groups, although the small sample size does not allow to compare this end point between the two arms of the study . Deep sedation requires frequent control and titration by anesthesiologist due to minor problems such as requiring high oxygen dose, great difference between basal and intraprocedural gas properties and occasional hypercapnia . Furthermore, niv allows to reduce the risk of hemodynamic, respiratory or neurological problems secondary to improper ventilation . We didn't have problems related to mask - related difficulties, gastric distention, niv discomfort or significant hemodynamic alterations related to positive pressure ventilation . Also, consideration must be given to the demographic characteristics of own patients: our population had a high number of overweight patients (overweight 39%, obese 25%) and with a history of smoking (44%). In relation to these conditions, even when outside the guidelines,, our patients' baseline respiratory function characterization was performed . A limit of our study is the relatively small number of patients evaluated, which did not arrive at the number of patients evaluated in other studies that assessed the safety of deep sedation or high - frequency jet ventilation . As previously described, af catheter ablation procedure has substantial procedural risks,, . Most of the complications (12/26 cases) that we reported were due to the difficult balance between bleeding (due to systemic anticoagulation) and thrombotic (ablation procedure and recurrence of af) processes . In our cases pleuro - pericardial effusion is due to the irritation of the serosa secondary to the ablation procedure as well as paralysis of the phrenic nerve and the damage occurring to the conduction system . Incidence of major procedural complications (5/26 cases) was comparable to the previous reports,, do not show differences in the two groups and are imputable to electrophysiological procedure rather than anesthetic management . Of the minor complications, the only one related to anesthetic management was exacerbation of bronchial asthma . We did not find significant differences between the two anesthetic regimens tested (two cases in niv group vs one case in the deep sedation group). These patients responded rapidly to treatment with inhaled 2-agonists and showed no alterations in chest x - ray compatible with bronchopneumonia . Own data on the early recurrence of af are in line with the literature, and this event was not related to the long - term success but was due to edema and inflammation of the myocardium subjected to ablation . In relation to the thromboembolic risk of early relapse of af, international guidelines recommend oral anticoagulation therapy in the first few months post - ablation . In conclusion, our study suggests that in catheter af ablation, niv proved to be a safe practice in anesthesiological management, as it can treat respiratory depression induced by sedation and maintain better respiratory homeostasis and better arterial blood gas balance when added to deep sedation . Furthermore, during the procedure patient safety was also ensured by a ventilator, which allowed continuous control of tidal volume, amount of ventilation lost to leak and effective minute ventilation.
The study was conducted at an intensive 4-day teaching program for final - year ophthalmology residents, held at hubli, karnataka state, south india, in january 2014 . The questionnaire used in this survey was developed and validated in consultation with the division of research and patents of the parent institute of the chief author . The questionnaire contained 21 questions (appendix 1), eliciting information from the students about orientation and wet lab training received, operation theatre (ot) facilities for training, free surgical camps and detailed information about numbers and types of surgeries observed and performed; also, questions about what factors influenced the student to pursue ophthalmology residency, about future plans after finishing residency, and if considering fellowship training after residency, which sub - specialties were preferred . Identity information like name was not solicited, and the students were free to not participate in the survey by simply not returning the form . To ensure increased response rate, the students were counseled about the objectives and importance of the survey during the training program . Repeated announcements were made on each day of the training program requesting students to return completed forms . One hundred and thirteen residents participated in the survey by returning completed forms (72.9%). Six respondents were found to be 1 year postgraduates (number of completed months of residency being <12) and were excluded from further analysis in the survey . The state - wise break - up of students was 76 from karnataka (71.02%), 16 maharashtra (14.95%), 8 tamil nadu (7.47%), 5 andhra pradesh (4.67%) and 2 kerala (1.86%). The results of this survey, therefore, present a picture mainly from karnataka state and southern india . Twenty - four students were from a government medical college (22.42%), 38 from private medical colleges (35.51%), 22 from private eye hospitals (20.56%) and 23 from other hospitals (21.49%). Residents (39.25%), 35 were dnb (32.71%) and 30 were diploma residents (28.03%). Thirty - nine students (36.5%) chose got seat in the subject through entrance examination as the most important factor which influenced the decision to pursue ophthalmology residency . Thirty - six students (33.6%) mentioned offers chance of combined medical and surgical practice as the most important factor . Eleven students (10.3%) mentioned workload predictability / flexibility, while positive undergraduate experience made seven students (6.5%) choose ophthalmology . (5 students, 4.6%) and earning potential (2 students, 1.8%). Forty - one students (38.31%) received orientation / training about ophthalmic surgery / ot . Sixteen of the 41 students (39.02%) had received such orientation from their senior postgraduate / resident, 11 students (26.82%) from senior faculty and 4 students (9.75%) from junior faculty . Sixty - one students (57.00%) had undergone wet lab / simulation lab training . Fifty - six students (52.33%) had attended the wet lab training in their own college / hospital, and five had attended wet lab training in conferences . Eighteen students (16.82%) mentioned that the ot in their center had no closed - circuit television facility for relaying surgical procedures while 37 students (34.57%) mentioned that their ot did not have a microscope with observer arm . Seventy students (65.42%) did their first surgery in ophthalmic residency within the first 6 months, and 34 (31.77%) students did so before the end of the 1 year . Twenty - six students (24.29%) mentioned that free ophthalmic surgical camps were not held in their center . On an average, 45 students (42.05%) went to the ot 2 times a week and 43 students (40.18%) went 3 times a week . The details of number of different types of surgeries done per week in the training center of the student, and median and range of number of surgeries done by the student so far are given in tables 1 and 2 . The number of surgeries done per week in the training center of the students median and range of number of surgeries done per month at training centers and median and range of number of surgeries done by the students so far . Median has been used as measure of central tendency instead of mean, as there are outlier values eighty - eight students (82.2%) mentioned join fellowship (or further training) as the future plan after finishing residency . Six students (5.6%) wanted to join government service and 3 (2.8%) students wanted to join private service after finishing residency . Joining medical college in the teaching profession and start own practice was chosen as the next step after residency by two students (1.8%) each . Of the 88 students considering fellowship / further training, 37 students (42.5%) mentioned cataract surgery as the most preferred subject and 17 students (19.5%) mentioned cornea / anterior segment . Thirteen students (14.9%) preferred vitreoretina / posterior segment and seven students (8.0%) were considering further training in general ophthalmology . Glaucoma and orbit / oculoplasty were being considered by 6 (6.9%) and five students (5.7%) respectively . Strabismus / pediatric ophthalmology was the first choice for two students (2.2%) while none mentioned uveitis as the preferred subject for further training . The final question of the survey regarded satisfaction of the student with the surgical training during residency . Six students (5.6%) were very satisfied and 20 students (18.7%) were satisfied with their surgical training while 37 students (34.6%) found their surgical training during residency to be fair / average . Totally, 29 students (27.1%) were not satisfied with their surgical training and 15 students (14.0%) rated their surgical training as poor . This survey with completed responses from 107 final - year residents provides us with a wealth of knowledge on the present status of surgical training in residency, especially in karnataka state and southern india, and on the immediate future plans of these residents . The residents surveyed in this study were from all types of training institutes in the region, including government and private medical colleges, and private eye hospitals and general hospitals . Less than a quarter of the students had received formal orientation training about ophthalmic surgery from their faculty . Teachers, in their personal capacity, may be teaching students and explaining surgical principles while in the ot, but a formal orientation / training before the student enters the ot will be of benefit and is also desired by the student, as documented by a survey published in indian journal of ophthalmology . Ophthalmic conferences across india have been providing wet lab training for residents, but only a few students in this survey had attended one such . More students can be encouraged to undergo such training and training institutes can help improve ophthalmic surgical training by establishing wet labs in their centers . More than a third of the students were training in centers, where the ot did not have a microscope with observer arm (beam - splitter and assistant scope). The value of such equipment in the ot of a training institute would be immensely beneficial . The vast majority of training centers conducted free ophthalmic surgical camps for patients, as per this survey . Most of the residents surveyed in this study went to the ot more than once a week . These can be termed as desirable statistics . Another statistic which could be termed desirable would be that nearly every student performed his / her first ophthalmic surgery before the end of the 1 year of residency . This compares favorably with the results of a survey of 129 ophthalmology residency directors in the united states, which had reported that 40% of residents gained experience as primary surgeons during their 1 year and 43% performed only part of the surgery . When exactly a resident starts his first surgery is dependent on many factors, including personality, temperament and natural, surgical aptitude of the resident, as well as the trainer's considered judgment about the resident's readiness to operate . In this regard, both residents and trainers will find extremely informative kirby's excellent treatise on surgical technique for residents in ophthalmology, published in 1983, but still relevant in this era for its sheer wisdom and understanding of teaching and learning methods of ophthalmic surgical techniques . Approximately a third of the respondents indicated that the total number of surgeries done per week in their center is <20 . Increasing the number of operations per week is as much an administrative and logistic issue as a medical issue and lies under the purview of the respective training institutions, but higher numbers would obviously be desirable for the broader experience and exposure that would be provided . In our country, conducting free ophthalmic camps for the needy can be a win - win situation for ophthalmic care - givers and patients . Needy patients receive quality medical care at the hands of the teachers, which they may not otherwise be able to access, and they act as the providers of exposure and experience to the resident training under the teacher . Conducting such camps will also help increase number of operations done per week in the training center . Most of the students had performed manual small incision cataract surgery (msics), and this was also the surgery performed most commonly by the students table 2 . An analysis of table 2 shows that the median value of students responses to performance of surgeries other than msics was zero for all surgeries excluding pterygium (5), dacryocystectomy (2) and trauma repair (5). Increasing the number of noncataract surgeries done by residents questions 19 and 20 of the survey attempted to read the mind of the student regarding his / her immediate future . A huge majority planned to undergo further training, with cataract surgery and cornea / anterior segment being the most sought after subjects . It appears that most of the students would prefer to delay further the decision on practice till they are confident of their surgical skills . A quarter of the respondents in this survey were satisfied with their surgical training while a significant number, more than 40%, were not satisfied with the surgical training during their residency . A brazilian study published in 2013 on recent ophthalmology graduates reported 93.4% satisfaction with the acquisition of surgical skills during residency . Improving satisfaction of residents with their surgical training should become an important goal of trainers . More than a third of the students in this survey indicated that the most important factor influencing their decision to pursue ophthalmology residency was that they were allotted to the subject through the entrance examination . A survey of junior residents in saudi arabia had found that the main factor influencing the decision to pursue ophthalmology training (97% of the respondents) was the ability to combine medicine and surgery . This meant that in our survey, a significant chunk of the students were doing residency in ophthalmology but had not come in desiring the subject specifically . If a student has come in because he had no perceived better choice, and subsequently, if he also feels that training being received is unsatisfactory, he may then find it difficult to involve himself in the subject, understand the subject and develop a liking for it . This can prevent the student from reaching his full potential, as he simply does not like what he is doing . Training accomplished with modern standards with an aim to also satisfy the students expectations, positive under - graduate experience, family influence and earning potential . Improving the experience of under - graduate medical students in their ophthalmology training may motivate more students to take up the field; such motivated students are also likely to strive to improve their own personal learning and satisfaction . Finally, though the study achieved a fairly good response rate (72.9%), the nonresponse fraction may have an influence on the inferences and conclusions . The limitations of this study include selection bias owing to purposive sampling, which might influence the results and subsequent conclusions . Ophthalmology residents in the region of karnataka and southern india are performing surgeries on a live human eye within the 1 year of residency and are entering the ot for surgery multiple times a week . Further efforts from trainers can concentrate on adding to the quality of surgical training along with the quantity, by establishing more wet labs / simulation training programs, conducting formal orientation programs for residents before they start surgery and by promoting microscopes with observer arms and closed - circuit television facility . Increasing the numbers of noncataract surgeries performed by residents and enhancing satisfaction levels of residents with their surgical training
Failure to achieve satisfactory weight loss has been reported in several series of morbidly obese patients who underwent bariatric procedures . The result of inferior weight loss after roux - en - y gastric bypass (rygb) in high body mass index (bmi) patients has led to the development of biliopancreatic diversion with duodenal switch (bpd / ds). The technical complexity of bpd / ds and its significant perioperative risks in the supermorbidly obese patients have resulted in a two - stage approach . In this method, a vertical sleeve gastrectomy (vsg) is initially performed, followed by a second - stage malabsorptive procedure after the initial weight loss and resolution of the obesity - related comorbidities . In the early era of minimally invasive surgery, laparoscopic vsg was proposed as a staged approach to the bpd / ds for high - risk super morbidly obese patients . In the last decade, however, laparoscopic vsg has been increasingly considered by many bariatric surgeons as definitive procedure because of its promising early and midterm outcomes . The technical simplicity and more modest learning curve of laparoscopic vsg have contributed to its rapid adoption among bariatric surgeons . As techniques in minimally invasive surgery improve, the previously high - risk bpd / ds is now performed as a single - stage operation with minimal complications and excellent outcomes . To our knowledge, there have been no reports that compare the complications and outcomes between laparoscopic vsg and laparoscopic single - stage bpd / ds . In this study, we investigated the outcomes of laparoscopic vsg as a stand - alone procedure and compare them with those of single - stage laparoscopic bpd / ds in morbidly obese patients . A prospectively maintained database of 100 consecutive patients who underwent laparoscopic vsg (group 1) and 100 consecutive patients who underwent laparoscopic bpd / ds (group 2) by two bariatric surgeons in a large independent teaching hospital was retrospectively reviewed . Patient demographics (age, gender, bmi, and number of obesity - related comorbidities), intraoperative details, perioperative complications, length of hospital stay (los), weight loss outcome at 1-, 3-, 6-, 9-, 12-, 18- month intervals, and mortality were compared . Major complications were defined as potentially life - threatening events that were directly related to the operation . These include anastomotic or staple line leak, hemorrhage, intestinal obstruction, inadvertent injury to other organs, venous thromboembolism, and all events that required return to the operating room . Minor complications were defined as nonlife - threatening events that result in prolongation of the typical postoperative recovery course . These include superficial skin or soft tissue infection, minor incisional hematoma, urinary tract infection, or musculoskeletal problems . The standard criteria for bariatric surgery selection included bmi above 40 kg / m without comorbidities, or bmi above 35 kg / m with at least one obesity - related comorbidity . All patients underwent comprehensive preoperative medical evaluation, detailed psychological assessment, relevant laboratory, and radiologic testing, as well as esophagogastroduodenoscopy . A sleep apnea test was performed in patients with clinical suspicion of obstructive sleep apnea . All patients were counseled about other surgical options, including laparoscopic rygb and laparoscopic adjustable gastric banding . Postoperatively, patients were encouraged to maintain an exercise program and regularly attend the bariatric patient - support group meetings . Standard postoperative follow - up included visits to the outpatient clinic at 1-, 3-, 6-, 9-, 12-, 18- month intervals and then annually thereafter ., statistical analysis was performed using student's t - test with p 0.05 considered statistically significant . Patients in group 1 were older than those in group 2 (50.8 vs. 46.4 years; p <0.05), although gender distribution (female predominance), average bmi (48.8 vs. 51.9 kg / m; p> 0.05), and number of obesity - related comorbidities (7.1 vs. 6.8; p> 0.05) were comparable [table 1]. Patients demographics one patient in each group required open conversion because of dense intraabdominal adhesions from prior laparotomy . Compared to the bpd / ds group, the vsg group had a significantly shorter mean operative time (107 vs. 296.8 min, p <0.05). Average blood loss was minimal (<50 ml) in both groups, without intraoperative complications . In the bpd / ds group, one patient developed a staple line leak, which resulted in perigastric air - fluid collection 14 days postoperatively . This patient experienced significant postoperative nausea and hematemesis, which required placement of a decompressive nasogastric tube and blood transfusion . The bleeding resolved on postoperative day 2, without the need for endoscopic or surgical intervention [table 2]. 30-day perioperative outcomes and complications one patient in the vsg group was returned to the operating room for surgical hemostasis, related to a port - site hemorrhage . In the bpd / ds group, two patients were returned to the operating room, one on postoperative day 1 for an endoscopic release of a nasogastric tube that had been inadvertently sutured during the robotically - assisted creation of the duodenoileal anastomosis, and the other patient returned on postoperative day 2 because of port - site infection . The average los after vsg and bpd / ds was statistically comparable . In the vsg group, two patients had an extended hospital stay because of prosthetic heart valve complications, as well as urologic complications related to recurrent hematuria and urinary retention . In the bpd / ds group, two other patients stayed longer in the hospital because of the exacerbation of carpal tunnel syndrome and skin / soft tissue infection at one of the trocar insertion sites (9 and 13 days, respectively). In the first 3 months postoperatively, patients in the vsg group and bpd / ds group achieved a comparable percentage of excess weight loss . The weight loss, however, promptly reached statistical difference at the 6-month interval (45.4 vs. 52.4%, p <0.05), with the bpd / ds served as the more effective weight loss operation . The difference became even more significant at 9, 12, and 18 months, postoperatively [table 3]. Percentage of patients who reached bmi <35 kg / m at 18-months postoperatively (final weight loss) was 60% in the vsg group and 85% in the bpd / ds group . At the end of study (18 months postoperatively), approximately 35% of vsg patients were lost to follow - up . In the bpd / ds group, it is a modification of the original biliopancreatic diversion operation described by scopinaro et al ., in 1979 and the ds operation described by demeester et al ., in 1987 . Ideally, bariatric procedure should be technically simple with acceptable low morbidity and mortality, sustained weight loss, as well as excellent resolution of obesity - related comorbidities . Greater technical challenges and perioperative risks associated with the bpd / ds have led to the adoption of vsg as the initial and potentially definitive procedure for treatment of morbid obesity . Patients with unsatisfactory weight loss and poor resolution of obesity - related comorbidities after vsg then proceeded with the ds during a second operation . Many of the superobese and high - risk patients underwent the second stage within 2 years with improved comorbidities and surgical risk status . In contrast, patients with sufficient weight loss and excellent resolution of obesity - related comorbidities after vsg do not require the second stage of the bpd / ds . The primary goal of bariatric surgery is to find a technically simple, safe, and effective operation for the treatment of morbid obesity . When perioperative variables were compared between the two groups, the vsg group had a significantly shorter operative time, which correlated to its technical simplicity . Literature showed that the operative mortality rate in the first reported laparoscopic bpd / ds series was 2.5% and specifically in a subgroup of patients with preoperative bmi greater than 60 kg / m, the mortality rate reached 6.5% . When compared to the 0% mortality rate reported by mukherjee et al ., after laparoscopic vsg, bpd / ds was clearly a procedure with significant risks of death . Additionally, in two large open bpd / ds series in 1993 and 2007 by marceau et al ., the anastomotic leak rate was 2.7% and 3.75%, respectively . In our series of vsg and bpd / ds, however, the overall morbidity (1% staple line leak and 1% bleeding rate after bpd / ds, vs. 0% after vsg) and mortality (0% after both procedures) are significantly lower, compared with those reported in the literature . These findings suggested that in the current era of widely used minimally invasive approach, both vsg and single - stage bpd / ds can be performed laparoscopically, with a low complication rate and a relatively equal safety profile . Our patients experienced excess weight loss of 18% and 31.4% at 1 and 3 months after the vsg, respectively . This early result was comparable with that achieved after the bpd / ds . At 6 months postoperatively, however, the bpd / ds group showed a significantly higher percentage of weight loss compared with the vsg . This difference may represent the role of malabsorptive component in medium and long - term weight reduction in postbariatric surgery patients . The third national health and nutrition examination survey 1999 reported that morbidly obese patients with bmi greater than 35 kg / m were found to have relative risks (rrs) of 1.97, 6.16, and 3.77 to experience heart diseases, diabetes mellitus, and hypertension, respectively, when compared to the nonobese population . In addition to a higher prevalence of obesity - related medical comorbidities, a significant increased risk of mortality was observed in patients with bmi> 35 kg / m (rr = 1.36, p <0.05). This information led us to conclude that although modest weight loss has been shown to improve many of the metabolic complications of obesity, greater degree of weight loss (target bmi <35 kg / m) is necessary to achieve all of the benefits of bariatric surgery . Our study demonstrated that the vsg group experienced a 64% excess weight loss, while bpd / ds group experienced 79.6% excess weight loss at 18 months postoperatively . There have been different opinions among bariatric surgeons on the degree of postoperative excess weight loss to be considered adequate, but we believe that bmi should fall below 35 kg / m, in order to optimally benefit from a bariatric operation, based on the published third national health and nutrition survey data . Hypothetically, if a morbidly obese male with bmi of 57 kg / m and body weight of 400 lbs were to undergo a laparoscopic vsg, his bmi would only fall to 36 kg / m at 18 months postoperatively . With this degree of weight loss (postoperative bmi still above 35 kg / m), the patient will continue to have an increased risk for developing heart disease, diabetes mellitus, and hypertension, compared to their nonobese counterparts, as mentioned above . When the same patient were to undergo laparoscopic bpd / ds, his bmi would fall to 31 kg / m postoperatively, which gives him the maximum benefit of the bariatric surgery . In this study, we found that after bpd / ds, a significantly higher percentage of patients were able to reach final bmi of <35 kg / m compared with the vsg group (85% vs. 60%, respectively). Therefore, we believe a higher percentage of excess weight loss to achieve final bmi less than 35 kg / m using bpd / ds, should be sought in an appropriate clinical setting . There are several limitations in this study, such as its retrospective nature with relatively small sample size . Our follow - up rate at 18 months postoperatively was only approximately 65%-70%, as described previously ., where 22% of their patients were unavailable for medium - term follow - up, even in a country using socialized medical care system . Laparoscopic vsg is a lower - risk and a technically simpler operation with promising weight loss outcome . The single - stage laparoscopic bpd / ds, however, produces superior weight loss with acceptable complication rates . The statistically significant difference in weight loss between the two operations became evident at 6 months postoperatively and persisted thereafter . We, therefore, recommend single - stage laparoscopic bpd / ds in patients with a high bmi, in an attempt to achieve the target bmi of less than 35 kg / m postoperatively.
The ewing sarcoma family of tumors, including ewing sarcoma and the more differentiated counterpart, primitive neuroectodermal tumor, are the second most common primary malignancies of bone in childhood and adolescence but can also occur in the soft tissues . Systemic chemotherapy is aimed at treating known or micrometastatic disease as well as improving local control of the cancer . The intergroup ewing sarcoma study (int-0091) demonstrated that a regimen of alternating cycles of vincristine - doxorubicin - cyclophosphamide and ifosfamide - etoposide was superior to vincristine - doxorubicin - cyclophosphamide alone, leading to a 5-year event - free survival of 69% versus 54% in the standard arm . More recently, a randomized trial evaluated dose intensification by interval compression (administering cycles every 2 weeks) and found that approach to be superior, with a 4-year event - free survival of 76% in the dose - dense arm compared with 65% in the standard 3-week chemotherapy arm . This is now considered by pediatric oncologists to be the standard chemotherapy regimen for patients with ewing sarcoma, although it has not been adequately evaluated in patients older than 18 . Although there have been improvements in the outcome for patients with localized disease, the outcome for patients with metastatic disease and for those who relapse is poor, with survival rates of 20% for those with metastases and 10 - 20% following a recurrence . Therefore, in addition to standard chemotherapeutics, future clinical trials will need to incorporate novel biologic agents in an effort to achieve further survival improvements . The insulin - like growth factor (igf) system has two principal ligands: igf-1 and igf-2 . These ligands mediate their stimulatory effects via the igf-1 receptor (igf-1r), a transmembrane receptor tyrosine kinase . Under normal physiologic circumstances, igf-1 and igf-2 are stimulated by growth hormone and function in a negative feedback loop to control growth hormone release . The insulin growth factor - binding proteins (igfbps) regulate the available free igf proteins available for igf-1r activation [7 - 9]. Upon ligand binding, autophosphorylation of the igf-1r tyrosine kinase initiates activation of the mitogen - activated protein kinase and phosphoinositide 3-kinase / akt pathways, leading to proliferation, survival [10 - 13], and enhanced angiogenesis via downstream induction of vascular endothelial growth factor . The igf-2 receptor is a monomeric transmembrane protein with no kinase activity and has not been shown to play a role in the development of ewing sarcoma . The pathway also has a role in promoting neuronal survival, myelination, and postnatal mammary development and lactation . In addition, metabolic pathways use the igf system to help integrate signals from nutrition and stress in order to shift appropriately between anabolic and catabolic states . High circulating levels of igf-1 have been associated with the risk of developing prostate, breast, or colorectal cancer . In addition, igf-1r expression is known to be necessary for cellular transformation and for signal transduction pathways stimulated by the igf-1r to enhance tumor cell growth and proliferation . Furthermore, igf-1r gene expression is regulated by a number of tumor suppressors, including wt1, brca1, and p53 . There are also data to suggest that signaling through the igf-1r enhances resistance to cytotoxic chemotherapy . Therefore, inhibition of the igf-1r is a potentially important therapeutic target against a variety of tumors . The insulin - like growth factor (igf) system has two principal ligands: igf-1 and igf-2 . These ligands mediate their stimulatory effects via the igf-1 receptor (igf-1r), a transmembrane receptor tyrosine kinase . Under normal physiologic circumstances, igf-1 and igf-2 are stimulated by growth hormone and function in a negative feedback loop to control growth hormone release . The insulin growth factor - binding proteins (igfbps) regulate the available free igf proteins available for igf-1r activation [7 - 9]. Upon ligand binding, autophosphorylation of the igf-1r tyrosine kinase initiates activation of the mitogen - activated protein kinase and phosphoinositide 3-kinase / akt pathways, leading to proliferation, survival [10 - 13], and enhanced angiogenesis via downstream induction of vascular endothelial growth factor . The igf-2 receptor is a monomeric transmembrane protein with no kinase activity and has not been shown to play a role in the development of ewing sarcoma . The pathway also has a role in promoting neuronal survival, myelination, and postnatal mammary development and lactation . In addition, metabolic pathways use the igf system to help integrate signals from nutrition and stress in order to shift appropriately between anabolic and catabolic states . High circulating levels of igf-1 have been associated with the risk of developing prostate, breast, or colorectal cancer . In addition, igf-1r expression is known to be necessary for cellular transformation and for signal transduction pathways stimulated by the igf-1r to enhance tumor cell growth and proliferation . Furthermore, igf-1r gene expression is regulated by a number of tumor suppressors, including wt1, brca1, and p53 . There are also data to suggest that signaling through the igf-1r enhances resistance to cytotoxic chemotherapy . Therefore, inhibition of the igf-1r is a potentially important therapeutic target against a variety of tumors . The igf signaling pathway and, in particular, the igf-1r play a major role in the development and proliferation of ewing sarcoma . Early studies documented the major autocrine role of the igf-1 and igf-1r pathways in ewing sarcoma, and expression of igf-1r has been shown to be a requirement for ews / fli-1 transformation in fibroblasts . A variety of approaches in vitro and in animal models have been undertaken to disrupt the igf-1r signaling pathway, including the development of small - molecule tyrosine kinase inhibitors (tkis) and anti - igf-1r antibodies . In preclinical testing, there was an initial difficulty in obtaining specific small - molecule kinase inhibitors of the igf-1r due to a very - high - sequence homology with kinase and atp - binding domains of the insulin receptor . After initial attempts, the tki nvp - aew541 was shown to have a 27-fold increased selectivity for the igf-1r over the insulin receptor . This small - molecule tki has shown promise in preclinical models, where inhibition of migration, metastasis, and angiogenesis was seen in vitro and a significant reduction in tumor growth was seen in xenograft models . Further elucidation of the metabolic alterations related to the use of tkis will be necessary prior to entry into clinical trials . More recently, targeted antibodies have been shown not only to disrupt ligand - receptor binding, but also to decrease surface igf-1r expression by internalization and degradation of the antibody - bound receptor . Human monoclonal anti - igf-1r antibodies have been produced by many pharmaceutical companies: imc - a12 (imclone systems, new york, ny, usa), amg 479 (amgen, thousand oaks, ca, usa), r1507 (roche, basel, switzerland), cp-751,871 (pfizer inc, new york, ny, usa), sch717454 (schering - plough corporation, kenilworth, nj, usa), mk-0646 (merck), and ave1642 (immunogen, inc, waltham, ma, usa / sanofi - aventis, paris, france). These antibodies have been tested in preclinical settings and ongoing early - phase adult studies [30,32 - 36]. The sch717454 igf-1r antibody was tested against a panel of pediatric tumors by the pediatric preclinical testing program, a comprehensive program to systematically evaluate new agents against childhood solid tumor and leukemia models . Intermediate or high activity was demonstrated in two of five ewing sarcoma xenografts, including one complete response . In addition, the imc - a12 antibody is currently under investigation in a phase ii children's oncology group (cog) trial, with a stratum available for patients with ewing sarcoma . Through the sarcoma alliance for research through collaboration (sarc), the r1507 antibody has been tested in two phase i studies in adults . The first study assessed the administration of the antibody on a 3-week basis and was well tolerated, without any dose - limiting toxicity or serious adverse events; 11 of 26 patients were found to have stable disease, although none had ewing sarcoma . In the second study, four of eight heavily pretreated patients with ewing sarcoma demonstrated stable disease, with two of eight patients demonstrating durable partial responses . The igf signaling pathway and, in particular, the igf-1r play a major role in the development and proliferation of ewing sarcoma . Early studies documented the major autocrine role of the igf-1 and igf-1r pathways in ewing sarcoma, and expression of igf-1r has been shown to be a requirement for ews / fli-1 transformation in fibroblasts . A variety of approaches in vitro and in animal models have been undertaken to disrupt the igf-1r signaling pathway, including the development of small - molecule tyrosine kinase inhibitors (tkis) and anti - igf-1r antibodies . In preclinical testing, there was an initial difficulty in obtaining specific small - molecule kinase inhibitors of the igf-1r due to a very - high - sequence homology with kinase and atp - binding domains of the insulin receptor . After initial attempts, the tki nvp - aew541 was shown to have a 27-fold increased selectivity for the igf-1r over the insulin receptor . This small - molecule tki has shown promise in preclinical models, where inhibition of migration, metastasis, and angiogenesis was seen in vitro and a significant reduction in tumor growth was seen in xenograft models . Further elucidation of the metabolic alterations related to the use of tkis will be necessary prior to entry into clinical trials . More recently, targeted antibodies have been shown not only to disrupt ligand - receptor binding, but also to decrease surface igf-1r expression by internalization and degradation of the antibody - bound receptor . Human monoclonal anti - igf-1r antibodies have been produced by many pharmaceutical companies: imc - a12 (imclone systems, new york, ny, usa), amg 479 (amgen, thousand oaks, ca, usa), r1507 (roche, basel, switzerland), cp-751,871 (pfizer inc, new york, ny, usa), sch717454 (schering - plough corporation, kenilworth, nj, usa), mk-0646 (merck), and ave1642 (immunogen, inc, waltham, ma, usa / sanofi - aventis, paris, france). These antibodies have been tested in preclinical settings and ongoing early - phase adult studies [30,32 - 36]. The sch717454 igf-1r antibody was tested against a panel of pediatric tumors by the pediatric preclinical testing program, a comprehensive program to systematically evaluate new agents against childhood solid tumor and leukemia models . Intermediate or high activity was demonstrated in two of five ewing sarcoma xenografts, including one complete response . In addition, the imc - a12 antibody is currently under investigation in a phase ii children's oncology group (cog) trial, with a stratum available for patients with ewing sarcoma . Through the sarcoma alliance for research through collaboration (sarc), the r1507 antibody has been tested in two phase i studies in adults . The first study assessed the administration of the antibody on a 3-week basis and was well tolerated, without any dose - limiting toxicity or serious adverse events; 11 of 26 patients were found to have stable disease, although none had ewing sarcoma . In the second study, four of eight heavily pretreated patients with ewing sarcoma demonstrated stable disease, with two of eight patients demonstrating durable partial responses . Human monoclonal antibody therapy directed against the igf-1r holds great promise for improving the prognosis for children, adolescents, and adults with ewing sarcoma . The recent data demonstrating responses in heavily pretreated patients with refractory ewing sarcoma bring a wave of excitement to move these therapies to the forefront . Clinical trials are under way to assess the feasibility and efficacy of combining anti - igf-1r therapy with multiagent chemotherapy . Over the next 5 years, feasibility testing will be completed, and if successful, phase iii studies will assess whether the addition of these new agents will result in therapeutic improvements.
Telomeres are specific sections of dna at the end of chromosomes comprised of tandem dna repeats (ttaggg). Their biological role is to prevent dna shortening, protect chromosomes from inappropriate dna fusions, as well as dna breaks in order to maintain genomic integrity and stability (1). Importantly, upon each cell division, telomere length (tl) decreases by 50200 base pairs, which together with cell aging, ultimately results in a crucial tl point which triggers chromosomal fusions and/or apoptosis (2). Telomerase, consists of two subunits, an enzymatic protein component, telomerase reverse transcriptase (tert), that adds the telomeric dna repeats onto the end of chromosomes, and an telomerase rna template component (terc), that serves as a template for telomeric dna synthesis (3). Due to the fact that tert is responsible for telomerase activity (ta), its expression is tightly regulated, being highly expressed only in periodically or continuously renewing tissues, such as in cells of the hematopoietic system, germ cells, the epidermis and tumors . Contrary to tert, terc is widely expressed in all types of cells, but is unable to induce ta (4). The complex cell aging system regulates the longevity of cells, as well as senescence . Without functional telomerase, a typical' dividing' cell will exhibit progressive telomere shortening, which upon reaching a' critically' short tl, results in telomere - dependent replicative senescence and in an inability to divide further (4). It is interesting to note that although the word' aging' is usually associated with old age, aging in the sense of telomeres is a life - time phenomenon that begins even before birth . Age - related diseases manifest mostly in old age; however, the aging process at the cellular level can be viewed as a lifelong progression (5). Importantly, premature aging phenotypes, collectively termed' telomere syndromes' (6), can be induced by rare mutations in human tert (htert). Furthermore, htert overexpression in normal human fibroblasts has been shown to protect the cells from apoptosis and necrosis (7). Nonetheless, some adverse factors which have been established to cause telomere dysfunction, telomere uncapping or other types of dna damage, such as oxidative stress, can induce premature cell senescence without the presence of critically short telomeres (8). Telomerase and telomeres functions, due to their roles in apoptosis and senescence, have been examined in many aspects of reproduction biology, such as fertilization, placental development, stress and hypoxic conditions during pregnancy, as well as premature aging following intrauterine growth restriction (iugr). It is well established that female human fertility declines with increasing maternal age and that various adverse factors can contribute to aging - associated infertility in women (9). Oocyte defects, such as chromosome abnormalities (aneuploidy), are a major cause of age - related decline in female fertility as they severely impair embryo implantation and development (10). Numerous studies have focused on ta and its correlation with mammalian fertilization, as well as following the cleavage, and pre - implantation development processes . Importantly, wright et al (11) demonstrated that ta exists in fetal, newborn, and adult testes and ovaries, but not in mature spermatozoa or oocytes . In human somatic cells grown in vitro or during replicative aging in vivo, telomeres erode to shorter and shorter lengths and continually decreasing levels of ta are detectable (12). According to liu et al (13), aberrant cleavage and increased cytofragmentation are significantly higher in homozygotic telomerase knockout (tr) eggs as compared to wild - type eggs . From both in vivo and in vitro fertilization (ivf) experiments, it appears that the absence of ta leads to telomere dysfunction, which in turn results in aberrant fertilization and the cleavage of tr gametes (13). Luteinized granulosa cells (gcs) surround the oocyte and are major somatic cell components of the ovarian follicle . Ta is further evidence of the stemness of normal, non - cancer cells in the ovaries (13,14). Successful maturation, fertilization and pre - implantation embryonic development depends on a regulated programme of oocyte growth and differentiation coordinated with the development and differentiation of the surrounding gcs (15). Importantly, it has been demonstrated that tert is expressed by gcs at all stages of ovarian follicle development (16,17). However, tert mrna expression and ta in gcs have been found to decrease with age and basal serum follicle stimulating hormone levels (18). Indeed, the low level of ta in the human ovaries was found to be related to the age - related primordial follicle depletion and it was suggested that ta may be used as a marker of the ovarian functional age (19). Importantly, studies have demonstrated that oocyte development is related to the ta of peripherally residing gcs . Gcs play an important role in the maturation of oocytes and are closely associatd with their reproductive quality (20,21). Interestingly, ta was found to be highest in the gcs of the small preantral follicles, and to decrease subsequently through different stages of antral development (22). Moreover, it was shown that the relative tl was longer in gcs from mature oocytes compared with gcs from immature oocytes in humans (23). Upon measuring ta in human gcs obtained from ivf and intracytoplasmic sperm injection cycles, it was demonstrated that the rates of oocyte maturation and good - quality embryo generation increased in a ta level - dependent manner (24). Indeed, the same authors postulated that women with a high level of ta had a greater likelihood of becoming pregnant than those with non - detectable or low levels of ta (24). Along the same lines, the lack of ta in gcs is associated with occult ovarian insufficiency (25). Finally, in gcs obtained from the same individuals, it was shown that ta predicts ivf treatment outcomes better than tl (26). Importantly, tl in human eggs was found to predict cytoplasmic fragmentation in embryos suggesting that telomere shortening induces apoptosis in human prei - mplantation embryos, well in accordance with a telomere theory of reproductive senescence in women (27). This data collectively suggest ta / tl of luteinized gcs is positively correlated with clinical pregnancy rate and, indicate that ta of ovarian luteinized gcs could help health workers to predict the clinical outcomes of ivf treatment . During normal pregnancies, a decrease in ta activity when comparing the early gestation period (<10 weeks), with the late gestation period (> 10 weeks), is observed (28). Thus, placenta and chorionic villi specimens from the first trimester of gestation exhibit significantly more ta than placenta and chorionic villi specimens from the second and third trimester during gestation (29,30). Specifically, a high ta was identified in trophoblast cell fractions of the chorion, suggesting that this fraction is a major source of ta activity (31). Additionally, the expression of htert was observed in chorions from early stages of gestation, but not in the placenta at the late stages of gestation, with a close correlation between ta and htert expression (31). Iugr is a common pregnancy complication, which can be defined as the failure of the fetus to reach the size for which it is genetically programmed . Delayed growth puts the fetus at risk during pregnancy and is associated with adverse outcomes during delivery and to neonate health problems . These may include a low birth weight, difficulty in handling the stress of vaginal delivery, decreased oxygen levels, hypoglycemia, low resistance to infection, low apgar scores (a test given immediately after birth to evaluate the newborn's physical condition and determine the need for special medical care), breathing problems associated with meconium aspiration (inhalation of stools passed while in the uterus), difficulties in maintaining body temperature, an abnormally high red blood cell count, long - term growth problems, and in the most severe cases, iugr can lead to still birth (33). Interestingly, only weak ta was detected in the placenta and chorionic villi specimens from women with pregnancies complicated by iugr (34,35). Indeed, htert mrna expression was detected in the placenta and chorionic villi specimens during the first, second and third trimester of gestation in normal pregnancies, whereas copy numbers of htert were significantly lower in placenta specimens from women with pregnancies complicated by iugr (21). The expression of hterc was observed in chorions obtained during early and late gestation and was not linked to ta (31). On the other hand (36), an analysis of the terc telomerase subunit gene copy number in placentas from pregnancies complicated by iugr revealed that the terc gene copy number was decreased in trophoblasts in placentas from women with pregnancies complicated by iugr, and it was thus suggested that this may promote senescence in trophoblasts in placentas from pregnancies complicated by iugr . In accordance with these data, a decreased tl was observed in placenta samples collected from women with pregnancies complicated by iugr (37). Furthermore, a decreased ta in placentas from women with pregnancies complicated by iugr was associated with increased apoptosis (34). Twins affected by growth discordance exhibit significant differences in their growth rate and size even though they develop in the same intrauterine environment (38). Importantly, birth weight discordance amongst twins is closely correlated to perinatal morbidity and mortality (39). Thus, specimens from placental tissues from twins affected by growth discordance (> 20% weight difference) or not (<20% weight difference) were collected after birth, and ta was analyzed (40). The results revealed that in the growth discordant group, ta was significantly higher in the larger twin than in the smaller twin (40). Oxygen is a necessity for life; yet, it is toxic to cells when dysregulated . Thus, both high and low levels of oxygen are deleterious to developing embryos . In normal pregnancies, in early gestation, the fetus and placenta exist in a relatively hypoxic environment with an ambient po2 <20 mm hg (41). The low oxygen tension favors cell proliferation and angiogenesis in the placenta, whereas it simultaneously supports vasculogenesis, hematopoiesis and chondrogenesis of the developing fetus (42,43). Upon establishing intervillous circulation at approximately 1012 weeks of gestation, oxygen tension rises to 4080 mmhg and remains in this range throughout the second and third trimesters . In order to support normal placental function and fetal development, the placenta adapts to the alterations in oxygen levels by the modulation of hypoxia inducible factor-1 (hif-1) expression and by increasing cellular antioxidant defenses (44). Thus, restricted oxygen availability is normal and necessary in utero; however, excessive fetal hypoxia leads to adverse outcomes, including fetal death, iugr and low birth weight (45). Indeed, intrauterine hypoxia may be due to a variety of causes, including prolapse or occlusion of the umbilical cord, placental infarction, hypertension, anemia, pulmonary disease, preeclampsia, as well as maternal smoking (46). Importantly, intrauterine hypoxia can cause cellular damage within the central nervous system and is associated with a reduced total brain volume and altered cortical volume and structure, a decrease in the total number of cells and myelination deficits (47). This results in an increased mortality rate, including an increased risk of sudden infant death syndrome (sids). Moreover, oxygen deprivation in the fetus and neonate have been implicated as either a primary or as a contributing risk factor in numerous neurological and neuropsychiatric disorders such as epilepsy, attention deficit hyperactivity disorder (adhd), eating disorders and cerebral palsy, as well as in the later development of neurodegenerative diseases (48). Hif-1 is a transcription factor of major importance in the cellular response to oxygen deficiency with specific roles during embryogenesis (49). Hif-1 is a heterodimeric complex composed of the two basic helix - loop - helix pas domain (bhlh - pas) subunits hif-1 and hif-1 (50). The hif-1 gene is constitutively transcribed under hypoxic conditions and determines hif-1 biological activity (51), whereas the hif-1 subunit dimerizes with several different bhlh - pas proteins and is continuously expressed (50). Hif-1 targets genes that encode proteins which regulate oxygen homeostasis and are critical for developmental and physiological processes in hypoxic environments (51). Indeed, hif-1 activity is critical for normal fetal development, as it has been shown that murine embryos lacking functional hif-1 die on / or before e10.5 (52). An important issue to resolve is the existence of a correlation between hif-1 and ta . Indeed, hif-1 expression was detectable, as demonstrated by western blot analysis, in first trimester placenta samples, but not in placental samples from the second and third trimester (53,54). Accordingly, htert protein expression was increased in placental tissues before 10 weeks than in placental tissues after 10 weeks of gestation (54). In vitro studies thus, tl distribution in huvecs under hypoxic conditions seems to be regulated by a balance between telomere attrition by hypoxia and telomere elongation by enhanced ta acting on telomeres (55). Indeed, coussens et al (56) demonstrated that hif-1 affects telomerase regulation in murine embryological stem cells and these authors suggested that hif-1a may have a physiologically relevant role in the maintenance of functional levels of telomerase in stem cells (56). Furthermore, it was demonstrated that the htert promoter region contains two hif-1 consensus motifs, which are essential for htert transactivation by hif-1 . The introduction of an antisense oligonucleotide for hif-1 diminishes htert expression during hypoxia, indicating that the upregulation of htert under hypoxic conditions is directly mediated through hif-1 (54). Thus, nishi et al (54) suggested that the regulation of htert promoter activity by hif-1 represents a mechanism for trophoblast growth during hypoxia according to the previous data; there are two possibilities about the association between hypoxia induction and ta . Dna damage in the telomere region can be induced by hypoxia, which would result in hif-1-induced telomerase expression in order to heal the damaged chromosome ends; or an anti - apoptotic response may be triggered by the hypoxic induction of telomerase (5658). A rapidly growing body of empirical evidence suggests that a major burden of disease can be traced back to the intrauterine period of life . Importantly the sensitive biological functions of fetal cell proliferation, differentiation and maturation respond to, or are affected by conditions in the internal or external environment . The result of these responses are structural and/or functional changes in cells, tissues and organ systems that have important long - term consequences for subsequent health and disease susceptibility (59). Exposure to psychosocial stress and/or biological stress mediators during gestation has been identified as a condition that may modulate the long - term programming effects of the intrauterine environment (60). Indeed, exposure to psychosocial stress during gestation appears to be an important risk factor for the earlier onset of complex, common age - related diseases (60). Studies on humans have demonstrated links between chronic or excessive psychosocial stress exposure and telomere biology (5,61,62). These data suggest that stress - related changes in telomere integrity may be a possible mechanism linking psychosocial stress and age - related disease (63). Indeed, accelerated telomere shortening reflects stress - related oxidative damage to cells and increased aging (64). Substantial evidence supports the hypothesis that depression creates abnormalities in stress - related biological outcomes . Thus, individuals with mood disorders have a significantly shorter tl compared with stable individuals, representing as much as 10 years of accelerated aging (64). Furthermore, it has been demonstrated that exposure to a major stress hormone, such as cortisol, is associated with the downregulation of ta in activated human t lymphocytes (65). This is highly relevant, as leukocyte tl is a predictor of age - related disease onset and mortality (66). There is also the question of whether cellular aging is related to patterns of allostasis (66). Telomeric dna quantity, dna damage and heat shock protein gene expression have been used as physiological stress markers in chickens (67). Exposure to maternal psychological stress during intrauterine life appears to induce not only adverse birth and neonatal outcomes, but also subsequent health and disease risk - related outcomes over the lifespan of an individual . The relevant outcomes include metabolic, endocrine, immune and cognitive processes (5). One important question that has yet to be addressed is whether exposure to stress during intrauterine development can produce variations in tl, thereby potentially setting up a long - term trajectory at birth that defines or contributes to individual susceptibility for complex and common age - related diseases . Entringer et al (59) examined the tl in leukocytes of individuals whose mothers had experienced a high level of psychological stress during pregnancy . These authors demonstrated that exposure to maternal psychosocial stress during intrauterine life was associated with a significantly shorter tl in young adulthood (59). Additionally, it has been suggested that maternal psychological stress during pregnancy may exert a' programming' effect on the developing telomere biology system that is already apparent at birth, as reflected by the setting of newborn tl (5). The association between ta and maternal stress exposure during pregnancy, has not yet been investigated and may shed further light on telomere biology . Indeed, it was postulated by shalev et al (5) that a' better understanding of the mechanisms that govern and regulate telomere biology throughout the lifespan may inform our understanding of etiology and the long - term consequences of stress and mental illnesses on aging processes in diverse populations and settings' . Importantly, nutrition is a key factor supporting normal pregnancy and refers to the consumption of nutrients and the diet of the mother before, during and after pregnancy . Thus, the nutritional status of the pregnant women is important as early as conception, and continues to be important throughout gestation and after birth during breastfeeding . It has been demonstrated that the nutrition of the mother is crucial as it may have an effect on the future health of the child; poor nutririon during pregrancy may lead to health complications in the later life of the child, and may lead to the development of cancer, cardiovascular disease, hypertension and diabetes (68). An inadequate or excessive amount of certain nutrients may lead to malformations or medical problems in the fetus and in the life of the developint child . Indeed, neurological disorders and handicaps of the fetus are more common in pregnant women who are malnourished (69). As 23.8% of babies worldwide are estimated to be born with lower than optimal weights at birth due to the lack of proper and sufficient nutrition, malnutrition poses a major risk to the health of the fetus (70). In particular, personal habits, such as smoking, excessive alcohol and caffeine consumption, the use of certain medications and illegal drugs can negatively and irreversibly affect the development of the fetus, and these negative effects can take place during the early stages of pregnancy . Specifically, a diet low in protein during gestation has no effect on placental weight, but results in a decreased weight of the offspring (72). Importantly, malnutrition in female rats has been shown to increase the production of the superoxide free radical (o2) (73). It is well established that oxidative damage is a major feature of the aging process and can lead to telomere shortening (74), which is associated with cellular senescence in vitro and in vivo (75,76). These data lead to the conclusion that increased cell apoptosis in the offspring can be caused by maternal protein restriction (75). Importantly, maternal diet was found to influence tl in the rat offspring (77,78). Thus, the offspring of mothers who consumed a diet low in protein during gestation had significantly shorter telomeres compared to the controls . In addition, maternal protein restriction during lactation increased longevity and reduced renal telomere shortening compared with offspring that were maternally protein - restricted in utero and then suckled by normally fed dams (79). The nutritional programming of coenzyme q was found to be relevant to aortic tl in rats with different gestational regimes of this coenzyme (80). The functions of telomerase and telomeres have been examinedin many aspects of reproduction biology, such as fertilization, placental development, stress and hypoxia conditions during pregnancy, as well as premature aging following iugr . Importantly, varying ta activity has been shown during the progression of normal pregnancies; ta activity being significantly higher in the early as compared to the late gestation period . It is noteworthy that under pregnancy - related pathological conditions, ta is decreased or absent, which results in significantly shorter telomeres . In depth studies on telomere biology during reproduction can improve our understanding of the significance of telomerase in fetal development and lifelong consequences on illnesses and aging processes in different populations . This understanding may lead to better prevention policies and may perhaps reveal novel therapeutic strategies.
Progressive neurologic deterioration or back and leg pain in children with a history of myelomeningocele (mmc) surgery may be due to cord tethering or growth of an intradural inclusion tumor . Loss of motor function in the lower extremities, gait abnormality, back or leg pain, scoliosis, and foot deformity are common findings in postsurgical tethering . Here, we report a child who developed progressive neurological deterioration and severe back and leg pain subsequent to large infected dermoid tumor extending underneath the skin to the spinal canal and intramedullary area . A 3-year - old boy was referred to neurosurgical department because of severe back and leg pain and motor regression . He was a known case of lumbar mmc and was operated at 8 months of age . He could sit at 11 months of age and stand at age of 2 years on his knees, but could not move the distal part of his legs at all . His back pain had started 3 months ago, which was severe at night and made him unable to sit . Subsequently, he experienced severe leg pain, which prevented him from moving the proximal part of his lower extremities and his mother faced difficulty while cleaning him after urination or defecation . On physical examination, the child was afebrile, but very irritable, with good mental performance, and normal neurological examination of upper limbs . Both lower extremities had lost any movement in proximal and distal parts (0/5). A small tender bulging was identified in his back under the mmc repair incision for one week before admission, but no dermal sinus was found inside or around the incision . Spinal magnetic resonance imaging (mri) was performed one month before surgery, which revealed cord tethering (cord at l4- l5level). Distal cord was attached to a mass, which was isointense in t1- and hypointense in t2-weighted images . It was extending from distal cord through the bony defect to the extraspinal canal space . The cord was dilated from the level of tethering to l1level with a lesion, which was isointense to hypointense in t1- and hyperintense in t2-weighted images, dissimilar to the intensity of cerebrospinal fluid [figures 1 and 2]. Notice the hypointense signal inside the expanded cord compatible with infected dermoid tumor found during surgery hypointense mass in t2-weighted image is extending from distal cord through the bone defect to the extraspinal canal space and the prior mmc surgery field the child underwent surgery with the suspicion of tethered cord associated with an inclusion tumor . In the prone position, the prior midline vertical incision was opened . During the dissection of subcutaneous tissue, dura mater, cord and dermoid tumor were attached to each other at the depth of previous surgical field, and the tumor was extending from the extraspinal area to the intramedullary space between l4 and l1 vertebral levels . Microsurgical release of all intradural adhesions was performed to achieve circumferential untethering of spinal cord associated with gross total resection of intramedullary mass . Complete excision of the dermoid cyst and capsule were performed, which was followed by primary closure of the dura . On histopathological examination, specimen had the characteristic features of a dermoid cyst, with simple squamous epithelium, hair follicles, and cholesterol - containing debris . He could move proximal part of his lower extremities with score of 1 - 2/5, but was unable to stand on his knee as he could do before . Children with mmc are born with a wide range of neurological deficits that will remain after primary repair of lesion . Any new changes in the previous neurological, urological or orthopedics status warrant an extensive investigation to rule out the possible causes, especially tethered cord syndrome . Tethered cord is a common complication following mmc surgery, which may be found in most patients when they are evaluated with spinal mri, but symptomatic tethering occurs only in 10 - 30% of them . Tethered cord may present with subtle changes in prior neurophysical situation, which become progressive and disabling if neglected . Spinal cord tethering due to dermoid cyst subsequent to mmc surgery has been reported so far, which can occur decades after closure. [58] all patients with symptomatic tethered cord have attachment of spinal cord to the prior closure site, which can be associated with inclusion tumors in 16% of instances . Dermoid tumors following mmc surgery may result from inadequate excision of dermal elements during dissection of placode or dura mater from the skin or with implantation of dermal elements inside the repair site ., this tumor can be an associated abnormality with mmc, which was undiagnosed or neglected because of very small size at the time of primary repair, especially during surgery without magnification . Cases of dermoid tumor in mmc children who were operated during the intrauterine period have been reported, suggesting a higher potential for rapid growth of this tumor in lesions that were closed in utero rather than after birth . Dermal sinus tract as a rare congenital abnormality is accompanied by inclusion tumors in 43% of instances, wherein most tumors are dermoids . Intramedullary spinal abscess without sinus tract is extremely rare, but a devastating condition in children. [1216] intramedullary abscess and dermoid tumor without dermal sinus have been reported before; however, not following mmc repair and especially not associated with tethered cord . In order to explain infected dermoid tumor in this patient with prior mmc repair, we propose several explanations implantation of bacteria during closure of mmc sac can lead to abscess formation but occurence three years after the first surgery seems to be unusual . Microscopic sinus tract through the preceding mmc surgery incision can be a way for bacteria to reach the subcutaneous space . Hematogenous superinfection of the dermoid cyst during repeated urinary tract infections in mmc patient is another possiblity for abscess formation in this case . Dermoid tumors, even infrequent, should be considered in the differential diagnosis of the causes of neurological deterioration in patients with a history of mmc repair . Along with tethered cord syndrome, dermoid tumor can complicate the prior neurological and physical status of the child, and should be searched vigilantly during evaluation of these patients . Because of rapid growth of dermoid tumors and associated infection, these can deteriorate the previous neurological status in a more aggressive and destructive manner as compared to tethered cord per se . Awareness of such pathology in patients with previous history of myelomeningocele repair, early diagnosis and surgical intervention can provide better result with less disability . Tethered cord syndrome should be investigated in any patient with a history of mmc repair if one finds neurological, orthopedics, or urological deterioration . Dermoid tumor is considered as an important differential diagnosis during thorough evaluation of the causes of worsening . In order to minimize the risk of dermoid tumor development following mmc surgery, any residual epidermal or dermal elements the operative field should be explored accurately proximal and distal to the sac to find any associated anomaly or minute inclusion tumor and prevent late inclusion tumor formation and tethered cord.
Insulin resistance is a key feature of obesity and is involved in the development of type 2 diabetes, fatty liver disease, cardiovascular disease, and cancer,,, . Insulin resistance is associated with altered production of several adipokines (i.e. Bioactive secreted products from adipocytes) that regulate insulin sensitivity and energy metabolism,, . These adipokines include interleukin 6 (il6), nicotinamide phosphoribosyltransferase (nampt, also called visfatin), leptin (lep), angiotensinogen (agt), lipocalin 2 (lcn2), adiponectin (adipoq), resistin (retn), and serpine1 (also called plasminogen activator inhibitor type 1),, . These adipokines have been shown to induce insulin resistance in rodents,, . In both human and mice obesity, hypoxia indeed, visceral adipose tissue (vat) from obese subjects is characterized by impaired blood flow, defective capillary density, and impaired o2 partial pressure, . Exposing mouse adipocytes to hypoxia leads to reduced expression of adipoq, agt, lep, nampt, and retn, and, in contrast, to increased expression of serpine1, il6, and lcn2, . However, the molecular mechanisms causing impaired adipokine production associated with hypoxia are still elusive . We postulate that both camp response element (cre) binding protein activity in (creb) and histone deacetylases are involved in these mechanisms . In support of this working hypothesis adipocyte creb activity is increased in obesity, leading to increased abundance of the activating transcription factor 3 (atf3), . This increased atf3 activity hampers the expression of adipoq and glucose transporter glut4, ultimately leading to impairment in insulin - induced glucose uptake, . The creb - dependent activation mechanism is initiated by reduction in the content of inducible camp early repressor (icer), a natural antagonist of creb and other camp - dependent transcription factors . Reduction of icer was found in adipocytes of human obese individuals and mice fed a high fat diet (hfd) for 16 weeks . In this study, therefore, we hypothesized that defective deacetylase activity may account for the collapse in the icer level in obesity . Indeed, the expression of icer is reported to be positively regulated by histone deacetylase activity (hdacs) in pc12 cells . Overall, hdacs are pivotal in epigenetic mechanisms that permit gene expression adaptation to environmental changes . Class ii hdacs is divided into subclass iia (hdac4, hdac5, hdac7, and hdac9) and subclass iib (hdac6 and hdac10). Additionally, there is emerging evidence implicating hdac activity in the control of energy metabolism, thus opening an avenue for future targets in metabolic diseases . In the hypothalamus of obese mice fed a hfd, the expression of hdacs, including hdac5, is modified when compared to that of mice fed a chow diet, . Hdac5 is required for hypothalamic leptin signaling and food intake, as hdac5 knockout mice display defective hypothalamic leptin signaling and are more prone to diet - induced obesity compared to wild - type mice . Given the role of hdacs in obesity, we hypothesized the contribution of hdacs to the changes in adipokine expression elicited by hypoxia and obesity - associated adipocyte dysfunction . Trichostatin (tsa), tubastatin and lmk293 were obtained from sigma - aldrich (st . Louis, mo). Total rna was extracted from epididymal white adipose tissue (wat) of mice fed a hfd (n = 10) or normal chow diet (n = 10). Wat isolation was performed in euthanized animals in accordance to the swiss legislation for animal experimentation . Approximately 5 cm of vat was obtained at the level of the omentum from five obese caucasian women (bmi> 35 kg / m) who were referred for weight reduction surgery and five non - obese caucasian women (24 <bmi <28 all patients provided informed consent, and the study was approved by the institutional review board . Total rna was isolated from adipose tissues and different cell fractions with the tripure isolation reagent (roche) as previously described . Procedure for preparation of adipocytes and svf fractions was done as described . Culture and differentiation of 3t3-l1 cells 3t3-l1 cells were grown and maintained in dulbecco's modified eagle's medium high glucose containing 50 units / ml penicillin, 50 g / ml streptomycin, and 10% fetal calf serum (fcs) in a 10% co2 environment . At postconfluency (2 days), the cells were differentiated by adding to the culture medium, isobutylmethylxanthine (500 m), dexamethasone (25 m), and insulin (4 g / ml) for 3 days and then only with insulin for 3 more days . The medium was then changed every 3 days until the cells were fully differentiated, typically by 10 days . The 19-nt small interfering rna (sirna) duplex against icer (siicer) is described elsewhere . The sirna duplexes, targeting the gfp (5-cgctgaccctgaagttcat-3), the mouse hdac5 (5-gcaagcattctacaacgat-3), and hdac6 (5-ccaggacgatctccaagat-3) were purchased from microsynth (balgach, switzerland). For silencing icer, hdac5, and hdac6, on day 7 post - differentiation, 3t3-l1 adipocytes were electroporated with sirnas using the genepulser xcell (bio - rad) as previously described . Protein extracts, western blotting, and real - time quantitative pcr were conducted as previously described . Pcr assays were carried out on a biorad myiq single - color real - time pcr detection system using the biorad iq sybr green supermix, with 100 nm primers and 1 l of template per 20 l of pcr and an annealing temperature of 60 c . Ci / mmol) uptake assays were conducted on fully differentiated 3t3-l1 adipocytes (days 7 and 8) as previously described . Adipocytes were treated without (basal) or with insulin 10 nm for 10 min . 2-[h]dog (0.1 ci; final concentration, 0.01 mmol / l) and 5 mm cold 2-dog were then added for an additional 10 min at 37 c . 2-dog uptake was terminated by washing the cells three times with ice - cold pbs containing 10 mm glucose . Subsequently, cells were lysed in 1% (wt / vol) sds and 0.2 m naoh . The experiments including two groups were analyzed by t - test or with the non - parametric equivalent wilcoxon . Trichostatin (tsa), tubastatin and lmk293 were obtained from sigma - aldrich (st . Louis, mo). Total rna was extracted from epididymal white adipose tissue (wat) of mice fed a hfd (n = 10) or normal chow diet (n = 10). Wat isolation was performed in euthanized animals in accordance to the swiss legislation for animal experimentation . Approximately 5 cm of vat was obtained at the level of the omentum from five obese caucasian women (bmi> 35 kg / m) who were referred for weight reduction surgery and five non - obese caucasian women (24 <bmi <28 kg / m). All patients provided informed consent, and the study was approved by the institutional review board . Total rna was isolated from adipose tissues and different cell fractions with the tripure isolation reagent (roche) as previously described . Briefly, 3t3-l1 cells were grown and maintained in dulbecco's modified eagle's medium high glucose containing 50 units / ml penicillin, 50 g / ml streptomycin, and 10% fetal calf serum (fcs) in a 10% co2 environment . At postconfluency (2 days), the cells were differentiated by adding to the culture medium, isobutylmethylxanthine (500 m), dexamethasone (25 m), and insulin (4 g / ml) for 3 days and then only with insulin for 3 more days . The medium was then changed every 3 days until the cells were fully differentiated, typically by 10 days . The 19-nt small interfering rna (sirna) duplex against icer (siicer) is described elsewhere . The sirna duplexes, targeting the gfp (5-cgctgaccctgaagttcat-3), the mouse hdac5 (5-gcaagcattctacaacgat-3), and hdac6 (5-ccaggacgatctccaagat-3) were purchased from microsynth (balgach, switzerland). For silencing icer, hdac5, and hdac6, on day 7 post - differentiation, 3t3-l1 adipocytes were electroporated with sirnas using the genepulser xcell (bio - rad) as previously described . Protein extracts, western blotting, and real - time quantitative pcr were conducted as previously described . Pcr assays were carried out on a biorad myiq single - color real - time pcr detection system using the biorad iq sybr green supermix, with 100 nm primers and 1 l of template per 20 l of pcr and an annealing temperature of 60 c . 2-deoxy - d-[1,2-h]glucose (2-[h]dog, 26.2 ci / mmol) uptake assays were conducted on fully differentiated 3t3-l1 adipocytes (days 7 and 8) as previously described . Adipocytes were treated without (basal) or with insulin 10 nm for 10 min . 2-[h]dog (0.1 ci; final concentration, 0.01 mmol / l) and 5 mm cold 2-dog were then added for an additional 10 min at 37 c . 2-dog uptake was terminated by washing the cells three times with ice - cold pbs containing 10 mm glucose . Subsequently, cells were lysed in 1% (wt / vol) sds and 0.2 m naoh . The experiments including two groups were analyzed by t - test or with the non - parametric equivalent wilcoxon . The total hdac activity was monitored in wat of mice that were fed a chow diet or a hfd for 16 weeks . We and others have shown previously that mice gain more weight, develop more adipose tissue, and develop systemic insulin resistance when fed a hfd . The total hdac activity was significantly decreased in the wat of hfd mice (figure 1a). Decreased hdac activity was associated with a significant drop of classes iia and iib, hdac5 and hdac6 expression, respectively (figure 1c, d). The level of all hdac mrna as well as the reduction of hdac5 and hdac6 expression was confirmed while the qrt - pcr analyses were normalized against the tata box binding protein mrna, for which we found that the level was also stable among the mice . In contrast, hdac9 expression was significantly increased whereas the expression of class i hdacs (hdac1 - 3 and hdac8) was unchanged in obese vs control mice (figure 1b). The diminution of the two hdacs had originated in the mice adipocyte fraction (figure 1e, f), whereas the increased expression of hdac9 was observed only in the adipose stromal - vascular fraction (svf) of obese mice (figure 1 g). Similar results were found in human adipocytes and in svf fractions of vat from obese individuals (figure 1h k). The collapse of total hdac activity (figure 1h) was associated with a decrease in hdac5 and hdac6 expression in human adipocyte fraction (figure 1i, j). As observed in mice, the hdac9 expression was augmented in svf (figure 1k). These results indicate a decrease in adipocyte expression of hdac5 and hdac6 in human and mice obesity we hypothesized that the reduction of hdac activity and mrna level of hdac5 and hdac6 in adipocytes is produced by hypoxia . Hypoxia results in increased lactate release, which is associated with an increase of mrnas of monocarboxylate transporters 1 and 4 (mct1 and mct4, respectively). Here, we confirmed that mct1 and mct4 levels were increased in 3t3-l1 adipocytes cultured under hypoxia for 24 h (figure s1). Consistent with the induction of lactate metabolism by hypoxia, the expression of both lactate dehydrogenase gene (ldha) and pyruvate dehydrogenase kinase 1 gene (pdk1) were augmented (figure s1). These hypoxia - induced changes were associated with decreased expression of both hdac5 and hdac6 (figure 2a). Consistently, the reduction of both hdac5 and hdac6 in response to hypoxia was associated with a diminution of the total hdac activity (figure 2b). The expression of hypoxia - sensitive genes has been shown to rely on the increase of creb activity, . Alteration of icer level expression may account for defective adipokine gene expression and increased creb activity caused by hypoxia . The expression of icer, therefore, was quantified in 3t3-l1 cells exposed to hypoxia . We found that hypoxia alleviated the expression of icer mrna under non - stimulatory conditions and in response to ibmx and forskolin (figure 2c). Parallel to the diminution of icer expression, as expected, the creb target atf3 level was increased (figure 2d), confirming an increase of creb transcriptional activity by hypoxia . This result further suggested that reduced icer expression modifies the expression of hypoxia - inducible adipokines . Indeed, hypoxia affects the expression of numerous genes encoding key adipokines involved in insulin resistance, including il6, nampt, agt, lep, adipoq, lcn2, retn, and serpine1,,,,,, . Culture of 3t3-l1 adipocytes under hypoxia significantly increased the level of il6, serpine1, and lcn2, whereas it reduced the mrna of retn, agt, lep, nampt, and adipoq (figure 2e). The expression of these adipokines was monitored in 3t3-l1 adipocytes in which the expression of icer was silenced by small interfering rnas (siicer). The efficiency and specificity of siicer for reducing icer abundance in 3t3-l1 adipocytes has been reported in our previous study . Here, we showed that icer silencing significantly increased the expression of il6, lcn2, and serpine1, whereas that of retn, agt, lep, nampt, and adipoq was significantly reduced (figure 2f). In humans, similar changes in adipokine levels were observed in the vat of obese subjects (figure s2), in whom we previously found a reduction in icer activity . Altogether, these data support a role for adipocyte hdac5 and hdac6 in the control of icer level and thereby in hypoxia - sensitive adipokine expression in obesity . The efficient silencing of both hdac5 and hdac6 in 3t3-l1 adipocytes using small interfering rnas duplexes (sih5 and sih6) was shown by western blotting analyses (figure 3a). The reduction of hdac5 or hdac6 level diminished the expression of icer in 3t3-l1 adipocytes (figure 3b). The induction of icer by camp raising agents ibmx and forskolin was also attenuated upon silencing of both hdacs (figure s3a). The pan - hdac inhibitor trichostatin (tsa) attenuated basal icer expression (figure s3b) and the induced expression of repressor in response to camp raising agents ibmx and forskolin in 3t3-l1 adipocytes (figure s3c). Lmk 235 and tubastatin a are highly selective hdac5 and hdac6 inhibitors, respectively, . Culture of 3t3-l1 adipocytes with either lmk 235 or tubastatin a reproduced the effects of tsa on the expression of icer (figure s3c). In agreement with the decrease of icer level by sih5 or sih6, we observed that the expression of atf3 and glut4 was increased (figure 3c, d). As anticipated, we found that the reduction of icer by sih5 or sih6 was accompanied by an impairment of insulin - induced dog uptake in 3t3-l1 adipocytes (figure 3e), thus supporting a role for hdac5 and hdac6 in the glucose transport in a mechanism involving icer (figure 4). The total hdac activity was monitored in wat of mice that were fed a chow diet or a hfd for 16 weeks . We and others have shown previously that mice gain more weight, develop more adipose tissue, and develop systemic insulin resistance when fed a hfd . The total hdac activity was significantly decreased in the wat of hfd mice (figure 1a). Decreased hdac activity was associated with a significant drop of classes iia and iib, hdac5 and hdac6 expression, respectively (figure 1c, d). The level of all hdac mrna as well as the reduction of hdac5 and hdac6 expression was confirmed while the qrt - pcr analyses were normalized against the tata box binding protein mrna, for which we found that the level was also stable among the mice . In contrast, hdac9 expression was significantly increased whereas the expression of class i hdacs (hdac1 - 3 and hdac8) was unchanged in obese vs control mice (figure 1b). The diminution of the two hdacs had originated in the mice adipocyte fraction (figure 1e, f), whereas the increased expression of hdac9 was observed only in the adipose stromal - vascular fraction (svf) of obese mice (figure 1 g). Similar results were found in human adipocytes and in svf fractions of vat from obese individuals (figure 1h k). The collapse of total hdac activity (figure 1h) was associated with a decrease in hdac5 and hdac6 expression in human adipocyte fraction (figure 1i, j). As observed in mice, the hdac9 expression was augmented in svf (figure 1k). These results indicate a decrease in adipocyte expression of hdac5 and hdac6 in human and mice obesity we hypothesized that the reduction of hdac activity and mrna level of hdac5 and hdac6 in adipocytes is produced by hypoxia . Hypoxia results in increased lactate release, which is associated with an increase of mrnas of monocarboxylate transporters 1 and 4 (mct1 and mct4, respectively). Here, we confirmed that mct1 and mct4 levels were increased in 3t3-l1 adipocytes cultured under hypoxia for 24 h (figure s1). Consistent with the induction of lactate metabolism by hypoxia, the expression of both lactate dehydrogenase gene (ldha) and pyruvate dehydrogenase kinase 1 gene (pdk1) were augmented (figure s1). These hypoxia - induced changes were associated with decreased expression of both hdac5 and hdac6 (figure 2a). Consistently, the reduction of both hdac5 and hdac6 in response to hypoxia was associated with a diminution of the total hdac activity (figure 2b). The expression of hypoxia - sensitive genes has been shown to rely on the increase of creb activity, . Alteration of icer level expression may account for defective adipokine gene expression and increased creb activity caused by hypoxia . The expression of icer, therefore, was quantified in 3t3-l1 cells exposed to hypoxia . We found that hypoxia alleviated the expression of icer mrna under non - stimulatory conditions and in response to ibmx and forskolin (figure 2c). Parallel to the diminution of icer expression, as expected, the creb target atf3 level was increased (figure 2d), confirming an increase of creb transcriptional activity by hypoxia . This result further suggested that reduced icer expression modifies the expression of hypoxia - inducible adipokines . Indeed, hypoxia affects the expression of numerous genes encoding key adipokines involved in insulin resistance, including il6, nampt, agt, lep, adipoq, lcn2, retn, and serpine1,,,,,, . Culture of 3t3-l1 adipocytes under hypoxia significantly increased the level of il6, serpine1, and lcn2, whereas it reduced the mrna of retn, agt, lep, nampt, and adipoq (figure 2e). The expression of these adipokines was monitored in 3t3-l1 adipocytes in which the expression of icer was silenced by small interfering rnas (siicer). The efficiency and specificity of siicer for reducing icer abundance in 3t3-l1 adipocytes has been reported in our previous study . Here, we showed that icer silencing significantly increased the expression of il6, lcn2, and serpine1, whereas that of retn, agt, lep, nampt, and adipoq was significantly reduced (figure 2f). In humans, similar changes in adipokine levels were observed in the vat of obese subjects (figure s2), in whom we previously found a reduction in icer activity . Altogether, these data support a role for adipocyte hdac5 and hdac6 in the control of icer level and thereby in hypoxia - sensitive adipokine expression in obesity . The efficient silencing of both hdac5 and hdac6 in 3t3-l1 adipocytes using small interfering rnas duplexes (sih5 and sih6) was shown by western blotting analyses (figure 3a). The reduction of hdac5 or hdac6 level diminished the expression of icer in 3t3-l1 adipocytes (figure 3b). The induction of icer by camp raising agents ibmx and forskolin was also attenuated upon silencing of both hdacs (figure s3a). The pan - hdac inhibitor trichostatin (tsa) attenuated basal icer expression (figure s3b) and the induced expression of repressor in response to camp raising agents ibmx and forskolin in 3t3-l1 adipocytes (figure s3c). Lmk 235 and tubastatin a are highly selective hdac5 and hdac6 inhibitors, respectively, . Culture of 3t3-l1 adipocytes with either lmk 235 or tubastatin a reproduced the effects of tsa on the expression of icer (figure s3c). In agreement with the decrease of icer level by sih5 or sih6, we observed that the expression of atf3 and glut4 was increased (figure 3c, d). As anticipated, we found that the reduction of icer by sih5 or sih6 was accompanied by an impairment of insulin - induced dog uptake in 3t3-l1 adipocytes (figure 3e), thus supporting a role for hdac5 and hdac6 in the glucose transport in a mechanism involving icer (figure 4). Adipose reduction of icer may be instrumental in the link between obesity and systemic insulin resistance . In the present study, we showed that the reduction of icer in adipocytes of both obese mice and obese human subjects is the consequence of impaired hdac5/hdac5 and hdac6/hdac6 expression . Indeed, among the 11 hdacs expressed in adipose tissue, only these two enzymes were down regulated, which was sufficient to lead to an overall reduction of hdac activity and a reduction of icer expression . This result was further supported by the silencing of hdac5 or hdac6 in 3t3-l1 adipocytes that also hampered icer expression . We speculate that the defective activity of the two hdacs in adipocytes leads to re - acetylation and thereby inhibition of some transcription factor(s) required for the icer expression . In this case, increased icer expression may result from silencing the transcriptional repressor . This mechanism has been suggested for the positive regulation of icer by hdac activity in pc12 cells . We speculate that hdac5 and hdac6 activate the expression of icer in adipocytes via a similar mechanism . The two hdacs may be co - localized in the nucleus within the gene coding for icer . Hdac5 and hdac6 can translocate from the nucleus to the cytosol depending on the cell type and stress condition,, this was shown for hdca6 and hdac9 in gnrh neuronal cells for modulating cell movement and survival . Therefore, it is possible that hdac5 and hdac6 act in concert for positively regulating the expression of icer via an indirect mechanism involving similar nuclear or cytoplasmic targets in adipocyte . In contrast to adipocytes, in svf of obese subjects and mice, icer / icer expression is increased . We show in this study that increased icer / icer is associated with the elevation of hdac9/hdac9 expression . Future studies are needed to determine whether hdac9 accounts for the increase of icer and thereby impacts cell function in svf . Icer is a passive transcriptional repressor that prevents binding of the creb transcriptional activator within cre, leading to gene silencing . The antagonistic effect of icer is a major mechanism that permits cells to return to their basal state upon camp - raising conditions such as fasting and glucagon and beta - adrenergic stimulation . In obesity, the decrease of icer / icer in adipocytes increases the binding of creb within the cre of its target genes,, increasing the transcriptional activity of creb increases and the expression of its target atf3, . Herein, we showed not only atf3 but also il6, serpine1, and lcn2 are increased, providing further evidence for a defective creb pathway in obesity . In contrast, the expression of retn, agt, lep, nampt, and adipoq were decreased upon icer silencing . The dysregulation of adipokines and altered hdac5 and hdac6 levels in obesity are mimicked by hypoxia . We showed in 3t3-l1 adipocytes that the changes in adipokine levels caused by hypoxia are associated with impaired expression of the two hdacs . We also found that adipokine dysregulation caused by hypoxia is the consequence of defective icer activity . Silencing icer in 3t3-l1 adipocytes mimicked the effect of hypoxia on the expression of adipokines . Finally, we propose that the reduction in icer expression couples defective hdac5 and hdac6 activities to perturbed expression of adipokines and adipocyte dysfunction caused by hypoxia and/or obesity (figure 4). Global methylation of histones and dna is modified in adipose tissue from obese subjects, . Moreover, each hdac can have several targets . A reduction in hdac5 and hdac6 expression, therefore, may lead to re - acetylation of several cytosolic and/or nuclear proteins . In other words, some nuclear re - acetylated proteins may contribute directly or indirectly to the deregulation of icer and thereby to impaired adipokine production, adipocyte dysfunction, and, ultimately, systemic insulin resistance in the context of obesity . Our study supports the requirement of maintaining hdac5 and hdac6 levels for optimal adipose function including glucose uptake and adipokine genes expression . Appropriate expression of hdac5 has been shown to be required for energy metabolism in mice . Genetic and pharmacological inhibition of hypothalamic hdac5 impairs leptin signaling and has deleterious effects on food intake and body - weight control . Inhibition of some hdacs, therefore, may be detrimental for energy metabolism in human . While inhibition of the class i hdac hdac3 has been seen as a promising therapeutic strategy for diabetes,,,,, inhibition of hdac8, in contrast, may cause insulin resistance . Moreover, there is a large spectra of class ii hdac inhibitors that are currently used for the treatment of cancers . For example, belinostat, abexinostat, and trichostatin target several hdacs including hdac5 and hdac6, . Therefore, it is possible that inhibitors targeting hdac5 and hdac6 affect adipose function and ultimately lead to insulin resistance . For optimal therapeutic metabolic impact, our study suggests the need of refining highly specific hdac inhibitors with low affinity for hdac5 and hdac6 . We have identified altered adipocyte hdac5 and hdac6 expression in obesity and associated hypoxia . Modeling the defect of the two hdacs in adipocytes by genetic silencing and selective inhibitors mimicked the effect of hypoxia and obesity on the expression of key adipokines and of icer, the key regulator of adipokine transcription . We believe that our findings provide a significant hint for better understanding the mechanism responsible of adipose dysfunction, obesity related insulin resistance, and metabolic complications.
Radiotherapy has been proven to successfully treat local and regional neoplasic lesions but it may adversely impact on normal tissues . High vulnerability to irradiation was already documented in various bone tissues (pelvis, sternum, vertebra, clavicle, femoral head, and mandible) with subsequent deleterious effect on the bone metabolism and healing leading thereafter to infection, atrophy, pathological fractures, and osteoradionecrosis . For instance, the incidence of osteoradionecrosis after conventional radiotherapy ranges from 0.9% to 35%, with an increased risk when doses given to the mandible exceed 60 gy . Thus, irradiation of the mandible represents the most devastating radiotherapy - induced complication and might sometimes lead to surgical resection . Since vascular ischemia is one of predictors of postirradiation degeneration, the inception of angiogenesis by implantation of bone marrow mesenchymal stem cells (bmscs) might represent a therapeutic approach for rehabilitating the irradiated bone tissue . Such potentiality was already documented in diverse ischemic pathologies such as hindlimb ischemia or myocardial infarction [7, 8]. Previous data regarding the role of bmscs in the bone reconstruction have outlined their active contribution in the bone formation when seeded on various scaffolds [9, 10]. In a dog model of mandible segmental defect, the feasibility of bone reconstruction using morphologic and 3-d beta - tricalcium phosphate scaffold seeded with autologous bmscs was highlighted by both bone formation and bone vascularization . Experiments with bmscs in the treatment or the prevention of radio - induced damage were reported on intestine [11, 12] and skin [1315] using systemic [1416] or local [11, 13] delivery . Little is known however about the effect of bmscs in irradiated bone tissue, and especially, the bioavailability and biodistribution of these cells within the targeted areas since their in vivo monitoring is now mandatory to further understand their benefice . The study was designed to explore, in a rat model of hindlimb irradiation, the feasibility of rehabilitating irradiated tibial bone tissue by intramedullary implanted bmscs . The assessment of bmscs' retention and distribution were conducted up to 7 days following transplantation using in - oxine - labeling technique . Therapeutic effect on bone perfusion and metabolism this study was conducted in 14 wistar rats (initial body - weight of 410 g460 g). All experimental procedures were in accordance with our local ethical committee and with the regulations of the animal welfare act of the national institutes of health guide for the care and use of laboratory animals (nih publication no . Three months after experiencing a hindlimb irradiation with a monodose of 30 gy a tc - hdp scintigraphy was performed . Thereafter, animals were referred into 2 groups: a control sham - operated group (n = 6) and a treated group (n = 8) in which in - labelled bmscs (2 10 cells) were intramedullary injected in irradiated tibial diaphysis; bmscs being harvested before irradiation were cultured until passage 4, and their mesenchymal phenotypes were evidenced by flow cytometry . To evaluate changes in bone blood flow and metabolism, serial tc - hdp planar scintigraphy was scheduled at 3 months after irradiation and at 2 months after the cell therapy . The early cell retention after the cell therapy was assessed by additional dual recordings of tc / in activities done at 2 hours, 48 hours, and 168 hours after the cell injection . Briefly, the animals were placed in prone position upon a thick polystyrene phantom and their hindlimb was immobilized by adhesive tape . The focus skin distance was 70 cm, and the field size was 20 30 cm . The collimating block was positioned on a 0.5 cm thick acrylic platform to shield the body and only irradiated the exposition of the left hindlimb without the pelvis . Radiation with co was delivered in a vertical beam from a theratron 780c x - ray machine delivering gamma rays of 1.25 mev energy and dose rate of 1.4 gy / min . After the intravenous injection of 9 mci of tc - hdp and under general anesthesia, the acquisition was recorded using a single - head gamma camera (sopha dsx, smv - ge) equipped with a 1.5 mm pinhole collimator (165 mm focal length, 44 mm radius of rotation) and with the following parameters: 256 256 matrix, 1.14 zoom, and 140 (20%) kev energy window . Two acquisitions were performed: a dynamic hdp uptake (blood flow) consisted of images obtained at 1 second intervals for 60 seconds reflecting vascularity and a delayed (3 hours after) acquisition of hdp uptake reflecting osteoblastic metabolism . Changes in accumulation of the tracer in irradiated bone and surrounding tissues were evaluated by measuring uptake within regions of interest (roi) on the computer - processed images software (dysplay, console vision, general electric). Planar scintigraphic images of the body distribution of in - labeled bmscs were provided by the same single - head gamma camera (sopha dsx, smv - ge) already described [8, 19]. Two 20% energy windows centered on the 172 kev and 246 kev photopeaks of in were applied . The initial image was recorded 2 h after cell transplantation during a 15-min period and then at day 2 (48 h) and day 7 (168 h) during time periods of 20 and 40 min, respectively . In activity from each image was expressed relative to the total injected activity (total body activity determined at 2 h) and after additional corrections for the physical decay of in (2.9 days). Autologous bone marrow cells, harvested from the left tibias by punction, were cultured and expanded as previously described in detail elsewhere [19, 20]. Briefly, aspired whole bone marrow cells were suspended in iscove's modified dulbecco's culture medium (life technologies, cergy pontoise, france) containing 10% fetal bovine serum (life technologies, cergy pontoise, france), 0.1 mmol / l mercaptoethanol (sigma, france), 100 u / ml penicillin, and 100 g / ml streptomycin . The cells were grown in a 5% humidified co2 atmosphere at 37c, and the medium was changed every 2 days . To ascertain the mesenchymal phenotype of transplanted bmscs, the expression of cd34, cd44, cd45, and cd90 surface antigens of cells prior to implantation (passage 4) was analysed using flow cytometry method (facscalibur; becton dickinson, meylan, france) and the cellquest software (becton dickinson, meylan, france). As already described [7, 8], bmscs (2 10 cells / ml) were trypsinised and incubated at 37c with 15 mbq of in - oxine (mallinckrodt medical b.v ., holland) during a 10-min period, the labelling process being stopped by 5-min centrifugation at 950 g. this 10-min incubation period was previously found to result in both a sufficiently high labeling efficiency (69%) and absence of significant deterioration of cell viability (96%). After stab incision, a 1 mm diameter drill hole was performed perpendicularly to the orientation of the tibial cortical bone . The in - labelled cells were conditioned in a 1 ml syringe (2 10 cells in 50 l) and were injected through the mini - invasive perforation into the bone marrow of the left tibia . To prevent leakage of transplanted cells in the surrounding tissues a biocompatible bandage (irm dentsply 78467 konstanz germany) the statistical analysis was carried out with the statistical package spss version 14.0 (spss, inc ., we used mann - whitney tests for the unpaired comparisons and wilcoxon tests for the paired comparisons in each group . For each test, a p value <0.05 was considered to be indicative of a significant difference . The 30-gy irradiation induced 3 - 4 weeks later a persisting alopecia in the irradiated hindlimb (figure 1(a)) without affecting however the daily locomotor activities of those animals . At 2-mo scintigraphic imaging, radiation - induced bone defects appear as areas of attenuation of signal intensity covering the irradiated lower limb, with pronounced effect in the tibia (see figure 1(b), e.g.,). The pretherapeutic data of the group control and the cell - treated group were resumed in the table 1 . In both groups, compared with the total body activity, irradiation of the hindlimb produced similar alteration in tibial values of bone perfusion blood flow (early uptake of tc - hdp) and bone osteoblastic metabolism (late uptake of tc - hdp). For example, bone perfusion blood flow was 3.2 0.8% at the irradiated tibia compared to 3.8 1.0% found in the healthy one (p <0.05). A slight decrease in bone metabolism of circa 10% was found in irradiated tibias, but values did not reach statistical significance (2.0 0.3% versus 2.3 0.6% found in healthy counterparts). Flow cytometry analyses (figure 2(a)) showed that the engrafted bmscs of passage 4 expressed strong expression of cd44 and cd90 surface antigens (> 80%). Thus, these cells were negative for cd45 and cd34 (percentage of positive cells were 2.41 2.47% for cd45 and 1.99 2.72% for cd34). These data were consistent with our previous studies and in accordance with criteria defined by the international society for cellular therapy (isct). 99mtc - hdp scintigraphic examinations performed after intramedullary implantation of bmscs have documented, especially in the tibial area, a significant rise in both bone blood flow and bone metabolism during the posttherapeutic first week (table 2 and figure 5). At 48 hours, the bone blood flow found in cell - treated tibias was 4.7 0.7% corresponding to an enhancement of 62% compared to basal pretherapeutic values (p <0.01). Similarly, the bone metabolism was 35% higher than that measured before treatment, values were 2.7 0.5% (p <0.01 versus pretherapeutic data). These effects persisted at 7 days, bone blood flow was 4.5 1.0% (p <0.01 versus pretherapeutic data), and bone metabolism was 2.6 0.6% (p <0.05 versus pretherapeutic data). At 2-mo followup, these uptake values were found to be down to 3.1 1.4% for the bone blood flow and 1.7 0.3% for the bone metabolism . Damage of normal tissue secondary to radiotherapy is still a major problem in cancer treatment . Stem cell therapy seems to be a new treatment option in radio - induced tissue abnormalities [2224], providing a mean to reduce related side effects and to improve the quality of life of patients . In this study, we investigated the feasibility of bmscs when injected intramedullary in an experimental rat model of radio - induced degeneration recently described by our group . In the present study, in - oxine labelling of bmscs was successfully used to follow bone retention and body distribution of bmscs when injected intramedullary within irradiated bone . In - labelled cells have been widely used in humans in localizing areas of inflammation by imaging the leukocyte distribution . Furthermore, in - labelling techniques have been applied in various experimental settings in animal to analyse the migration of dendritic cells, the biodistribution of transplanted hepatocytes, and of injected mscs in animals model of heart or lung disease [7, 28]. As previously described, the technique used here reached a high efficiency (69%) with a low toxicity (viability> 95%). In addition, it has been previously demonstrated that the leakage of in from labelled cells resulted in a high in uptake in the liver and spleen and usually had hepatobiliary and renal excretion pathways [7, 29]. This is in accordance with our observations, and no in radioactivity was found in bones outside the area of injection . Approximately 70% of grafted cells could be estimated to be retained within bone damaged area 2 hours after transplantation . The disappearance of radiolabeled grafted cell may be explained by the method used for bmscs injection which could be associated with a leakage of bmscs from the injection site before bandage and residual bmscs in the injection syringes . These data are fully consistent with those of the study of tran et al ., where approximately 60% of in labeled bmscs were still present 2 hours after direct transplantation in a necrotic rat myocardium and were retained within the heart throughout the 7 days of followup . In the present study, after 48 hours, bmscs number decreased to approximately 40% and remained unchanged until the 7th day . The mechanism responsible for cell loss during the first two days remains to be explored . These results highlighted that at short term, the engrafted bmscs remain localized within the area of injection into irradiated bone . Many studies of cell therapy using mesenchymal stem cells [14, 16], used the systemic injection as modality of administration . In comparison, using local injection, cells engraftment seems to be better . For example, in franois et al . 's study, rats were transplanted with a dose of 5 10 bmscs 24 hours after irradiation of the hindlimb at a single dose of 26.5 gy . Fifteen days later, the implantation rates of bmscs in bone and bone marrow were, respectively, approximately 12.5% and less than 0.25% . The major limitation of this approach is constituted by the very low number of bmscs that home to the site of injury . A possible reason for the inefficient engraftment and homing could be the entrapment of bmscs in the lungs moreover, vascular ischemia and fibrosis, characteristic injury of irradiated tissue [1, 32], may prevent homing and engraftment of bmscs . After cell therapy, the bone blood flow and bone metabolism evolved similarly, and a significant increase of these values was observed during the seven days following the bmscs engraftment . The influence of the surgical procedure used in the present study would require further investigation, especially regarding the role of the inflammation cells response and the local recruitment of mesenchymal stem cells that should have been induced by the wound healing after drilling the cortical bone . However, the benefit obtained seems to be transient since 2 months after cell therapy, blood flow time and bone uptake of tc - hdp did not differ significantly from data measured in ungrafted animals irradiated at 30 gy . This result slightly differs from those achieved in our previous study, in which autologous fat was used as source of mesenchymal stem cell and grafted within irradiated area, inducing clinical benefit that appeared to be linked to the improvement of vascular network and disappearance of necrotic area . Additional results demonstrating the potency of bmscs therapy in irradiated tissues were recently reported describing a case of regenerative reconstruction of a terminal stage of osteoradionecrosis with bmscs and progenitor cells . Another explanation that stands for the short effect of engrafted bmscs might be related to the native hypoxic microenvironment of the medullar area target of the bone . The bmscs used here were expanded according to most of the conventional cell culture procedures, that is, in normoxic condition (21% o2). Although they have mesenchymal characteristics, recent works from our group and others have suggested that bmsc, when cultured under 5% o2 rather than under 21% o2, had better growth advantage in long - term cell expansion . Thus, the hypoxic bmsc expressed more adhesion and extracellular matrix molecules and displayed more plasticity features . It is then possible that different in vitro conditions during the cell selection and expansion might lower their ability to repair when reimplanted in native environment . In conclusion, the present study shows the feasibility of the intramedullary implantation of bmscs in the attempt to rehabilitate the irradiated bone . Our data suggested that bmscs appear to remain around the injection site, without evident body redistribution, for at least a 7-day period along with a transient benefice on bone blood flow and bone metabolism.
Recent advances in obstetrical and neonatal intensive care management have increased the survival rates of very low birth weight infants . In these infants, artificial ventilation is related to potential iatrogenic lung damage and therefore reduced to a minimum . The introduction of new strategies of surfactant therapy includes a very short period of mechanical ventilation (insure) or even avoidance of endotracheal intubation in newborns with respiratory distress syndrome . As a consequence, noninvasive respiratory therapy has become increasingly important and is used in even the youngest neonates . In these infants, apnoea has emerged as a major clinical problem, manifested by an unstable respiratory rhythm reflecting the immaturity of the respiratory control systems . Methylxanthines, such as theophylline and caffeine, are the mainstay pharmacological treatment for apnoea and have proven to reduce chronic lung disease and long - term outcome [5, 6]. In line with current international consensus in the 2 reporting nicus, caffeine base is given with a loading dose of 10 mg / kg and a maintenance dose of 5 mg / kg / day . Published very reassuring data [7, 8] on short - and long - term outcome of high dose caffeine, more data are needed to change the existing caffeine dosing protocol . If apnoea persists under methylxanthines, doxapram may be considered as the therapy of last resort before endotracheal intubation and mechanical ventilation . Doxapram is a respiratory stimulant that encourages breathing by stimulating both peripheral and central chemoreceptors [911]. Doxapram was introduced more than 25 years ago into neonatology to treat neonates struggling with persistent idiopathic apnoea of prematurity [12, 13]. Some randomized controlled trials studied doxapram, but none were placebo controlled [1719]. A number of observational trials suggested potential short - and long - term side effects such as hypertension and irritability . The most devastating, however, were the suggested negative effects of doxapram on cerebral oxygenation and long - term mental development [2022]. These concerns about long - term outcome and important improvements of neonatal care such as the introduction of surfactant therapy and maternal corticosteroids pushed the use of doxapram in preterm infants to the background . Nevertheless, we recently noticed a reintroduction of doxapram use in our departments in premature infants with superficial breathing patterns and apnoeas that are unresponsive to methylxanthines . In this situation of persistent apnoea and imminent neonatal respiratory insufficiency, doxapram is used as rescue medication . Doxapram is administered in order to prevent preterm neonates from endotracheal intubation and mechanical ventilation . However, doxapram is still off - label in premature infants and evidence about efficacy and safety is lacking . We therefore performed an audit on doxapram use and the effects of doxapram use in two dutch tertiary nicus during the last 5 years . Due to the retrospective nature of our audit, the committee of medical ethics of lumc and the medical ethical committee of vu university medical center have declared that formal approval was not required . Data of patients who received doxapram were analyzed from two tertiary neonatal intensive care units (leiden university medical center, leiden, center 1; vu university medical center amsterdam, center 2) in the netherlands . From prospectively collected drug databases all eligible patients from 2006 till 2011 were selected in both centers . Data on total numbers of patients admitted per gestational age group in both centers were also collected . In both centers, neonates were treated with caffeine base formulations . A loading dose of 10 mg / kg was given, with daily subsequent doses of 5 caffeine was occasionally switched to theophylline with a dose of 68 mg / kg / day . Although promising data regarding higher daily caffeine doses were published in 2004 and 2011, both nicus chose to use standard dosing regimens [7, 8]. The doxapram treatment policies of both centers were different during the study period . In center 1, intravenous and oral doxapram were used until 2011 and dosed based on personal experience of the attending physician . During doxapram treatment,, doxapram was incorporated into a written apnoea policy from 2010 . Before 2010, it was used and dosed based on personal experience of the attending physician . The written policy advised intravenous use of doxapram with a starting dose of 0.5 mg / kg / hr that could be increased every the protocol advised to consider the use of doxapram after persistent apnoea with maximal noninvasive ventilatory support and caffeine therapy . Data about pregnancy, delivery, and baseline patient characteristics were analysed in order to determine which group of patients received doxapram . The use of doxapram was evaluated by its duration, dosage, route of administration and efficacy . Doxapram therapy was defined as successful if no endotracheal intubation due to apnoea was necessary . No criteria for respiratory insufficiency or endotracheal intubation were included in the protocols of both centers . Outcome of patients was analyzed by collecting data about mortality, short - term morbidity (incidence of necrotizing enterocolitis, intraventricular hemorrhage, periventricular leukomalacia, retinopathy of prematurity, and persistent ductus arteriosus) and pulmonary condition . Background characteristics; doxapram data and morbidity of patients who were successfully and unsuccessfully treated with doxapram were compared using chi - square and fisher's exact tests as well as non - parametric mann - whitney u statistical tests wherever appropriate . From 2005 to 2010, 122 out of 1,501 admitted premature infants with a gestational age less than 32 weeks in the two centers received doxapram (8.13%). All neonates received caffeine with a loading dose of 10 mg / kg and daily maintenance doses of 5 mg / kg . Until 2010, doxapram was most often used in the youngest neonates with 26.7%, 21.4%, and 26.6% of all preterms born after 24, 25, and 26 weeks of gestation, respectively . Doxapram was more frequently used in center 1 (84/802; 10.5%) than in center 2 (38/699; 5.4%). There was a wide variation in the doxapram doses used and in the duration of therapy (table 2). Median postconceptional age at the start of doxapram therapy was 27.3 weeks with the youngest infant being 24 4/7 weeks and the oldest being 31 3/7 weeks at the start of doxapram therapy . Doxapram was initiated at a median postnatal age of 13.5 days (iqr 11 days) and patients received doxapram for a median duration of 108 hrs (iqr 147 hours). Nine patients (7.4%) received a doxapram loading dose (median 2.5 mg / kg). In all other patients, the cumulative dose of doxapram ranged from 0.33 mg to 781.5 mg doxapram per kg bodyweight . Twenty - nine newborns (24%) received 2 courses of doxapram; 2 patients (1,6%) received a third course of doxapram therapy . Outcomes of the patients who received doxapram are shown in table 3 . In 6 cases, it could not be determined if doxapram was successful, as it was unclear if the patient was intubated because of persistent apnoea or because of other reasons, such as infection . In 79 out of 116 neonates (64.8%), baseline characteristics were comparable between patients in whom doxapram was successful compared to those with unsuccessful treatment (table 1). If doxapram treatment was successful, it was used longer (median (iqr): 5.5 (5.7) days versus 1 (4.65) day; mann - whitney u 722, p <0.001) but in lower average dosages (median (iqr): 0.97 (0.62) mg / kg / hr versus 1.38 (0.94), mann - whitney u 952, p <0.003). Patients who received doxapram therapy for a long period of time, incidence of necrotizing enterocolitis, intraventricular hemorrhage, periventricular leukomalacia, retinopathy of prematurity, persistent ductus arteriosus, or worsening of pulmonary condition did not increase . Their stay at the neonatal intensive care unit was shorter (median (iqr): 33 (26) versus 42 (34) days; mann - whitney u 815, p = 0.002). Off all the included patients, 49.2% received doxapram intravenously, 41.5% received doxapram orally and 9.3% received doxapram via both routes . If intravenous doxapram was effective and the neonates did not need an intravenous route anymore, doxapram was given through the nasogastric tube in center 1 only . Doxapram therapy was successful in 67% of intravenously treated and 70% of orally treated neonates . If both routes were used subsequently, the success rate was 55% (chi - square test: p = 0.63). Almost two third of all treated newborns did not progress to ventilatory support although they were suffering from frequent apnoea before treatment with doxapram . These data suggest a potential important role for doxapram in the treatment of apnoea of prematurity . However, it is remarkable that underlying evidence about the efficacy and safety from well - designed clinical trials is almost completely lacking . For 50 years, doxapram has been used as an emergency agent in adults suffering from life - threatening respiratory insufficiency . It was the anesthesiologist gupta who first reported the successful administration of doxapram in newborns with breathing difficulties after birth and from the 1980s on doxapram became popular for the treatment of neonates struggling with persistent idiopathic apnoea of prematurity [12, 13]. In the past 30 years, only three randomized controlled trials compared doxapram with other therapeutic strategies in a total of 86 neonates . Peliowski and finer compared doxapram with theophylline and placebo in a crossover design in 31 preterm newborns with apnoea . They found a short - term doxapram treatment success rate of 64 percent in neonates with a mean gestation of 31 weeks . Eyal et al . Found success rates of, respectively, 53 and 55 percent comparing doxapram monotherapy with aminophylline monotherapy . If doxapram was used in addition to aminophylline, it was successful in 8 out of 10 patients compared to 0 out of 9 placebo treated newborns . Studied the effects of doxapram after extubation and found a reintubation rate of 21% compared to 47% of placebo treated newborns . In analogy with our data, they suggested that doxapram is successful in treating apnoea of prematurity in at least a considerable part of the premature neonates . A wide variation in used doxapram dosages varying from 0.18 up to 4 milligram per kg bodyweight per hour was found in the current study . As suggested by barrington et al ., most patients started with a dose of 0.5 mg / kg / hr . The same study also showed increasing success rates of doxapram with increasing dosages up to 2.5 mg / kg / hr . A dose effect relationship might be apparent but has until now not been studied sufficiently . A prospective doxapram dose finding study and randomised placebo controlled analysis of the effectiveness of doxapram with a sufficient number of patients is needed to determine the actual efficacy and effective dosages of doxapram on apnoea in premature newborns . As this was not a randomized controlled trial, hard conclusions cannot be drawn . However, retrospectively, we found positive results in almost 65% of infants treated with doxapram . Response to doxapram therapy seemed to be associated with a shorter stay in the neonatal intensive care unit without serious side effects . Protecting newborns from reintubation and ventilation might theoretically protect them against bronchopulmonary dysplasia but the doxapram responders merely depict the neonates who initially had less severe lung problems . The most important and potentially dangerous suggested side effect consists of decreased cerebral oxygenation and blood flow velocity . This might result in decreased cerebral perfusion and damage to the developing brain leading to long - term developmental delay [20, 21]. As our study was not a randomised controlled trial doxapram is given to a specific category of preterm neonates with pulmonary problems, therefore no representative control could be found in the rest of the patients on our wards during the study period . Routine follow - up of the doxapram treated premature infants has not shown long - term safety issues at this time . The reintroduction of doxapram can be explained by the introduction of new techniques aimed at minimizing invasive ventilation of premature neonates . Techniques such as insure, cpap, nasal intermittent mandatory ventilation, and surfactant without intubation may ultimately lead to an increased use of doxapram as pointed out by kribs et al . . Surfactant administration through a nasogastric tube resulted in doxapram use in 28 percent of the surfactant treated neonates via a nasogastric tube compared to 17 percent of patients receiving standard surfactant therapy . In the coming years therefore, this study shows that doxapram as off - label drug is frequently used in premature neonates in neonatal nurseries and especially in the youngest infants . As increased use of doxapram is to be expected, prospective well - designed studies are needed to address the issues of short- and long - term safety . Until then, doxapram should be used with caution.
Hemophagocytic lymphohistiocytosis (hlh) secondary to infectious disease is an important entity especially in tropics where infectious diseases are rampant and still pose a major threat . A timely diagnosis and prompt treatment can improve the clinical outcome of this otherwise potentially fatal condition! This article aims to alert the clinicians that in persistent unresolved fever especially in tropics, a diagnosis of secondary hlh should be given due consideration and we present 6 cases in this paper . All patients presented between march 2012 and march 2013 (details shown in table 1) and fulfilled the revised criteria of hlh as listed in table 2 . Of them, the mean age at diagnosis was 33.83 years (range: 20 to 64 years), with a male: female ratio of 2:1 . Three patients presented with evidence of hepatomegaly and/or splenomegaly . All of the patients had at least a bi- or trilineage cytopenia, elevated liver enzymes and hyperferritinemia . Two of the cases were secondary to dengue fever and one secondary to disseminated tuberculosis, one secondary to pulmonary tuberculosis, one secondary to malaria (falciparum) and one secondary to leptospirosis . All patients had good recovery and none of them relapsed at a median follow up of 4 months . Characteristics of secondary hlh patients m male; f female, y yes; n no; csa cyclosporine; na not available proposed hlh diagnostic criteria, 2009 ravenous macrophage - hemophagocytosis of rbcs by macrophage seen hlh is a hyper - inflammatory condition which may be familial or occur secondary to autoimmune diseases or infection, malignancy or other triggers . Despite advances in the diagnostic work up of febrile patients, hlh remains elusive from the diagnostic capabilities of many clinicians and continues to be a potentially fatal disease entity . The underlying pathophysiology of the disease constitutes an unrestrained immune activation with defective macrophage function regulation . An excessive activation of macrophages leads to a cytokine storm in the host and leads to host tissue damage and organ dysfunction associated with the syndrome . Excessive pro - inflammatory or defective anti - inflammatory responses leading to this cytokine storm can be triggered by host factors or environmental agents . Accordingly, a hlh arising in the setting of an underlying genetic mutation is termed familial hlh, in the setting of an underlying rheumatologic disease like rheumatoid arthritis is termed as macrophage activation syndrome (mas) and in the setting of an underlying infection it is termed as reactive or secondary hemophagocytic syndrome (hps) or secondary hlh . Case reports describing mas post bone marrow transplant in patients with juvenile rheumatoid arthritis, or secondary to sle or dermatomyositis or other autoimmune diseases have been reported . Macrophage and neutrophil activation is a hallmark in conditions like stills disease which can lead to hyperinflammatory condition with hlh . Overproduction of proinflammatory cytokines, uncontrolled activation of t cells, and macrophages associated with decreased natural killer cell and cytotoxic cell functions seem to be the hallmarks of the immunologic abnormalities in mas . Recent human and murine investigations suggest that all hpss should be differentiated based on etiology and pathogenesis as treatment strategies for each may vary . However, all etiologies lead to a state of hyper ferritin levels . The precise mechanism of ferritin as a trigger or a bystander in pathogenesis needs to be explored . The reactive or infection - associated hlh remains a relatively important and yet unfortunately an underdiagnosed entity especially in the tropical world . Various combinations of high grade fever sometimes a second spike of fever after a brief period of recovery which coincides with fresh cytopenias, unresponsiveness to broad - spectrum antibiotics, new onset organomegaly or sudden increase in size of organomegaly in the setting of an infectious disease are some of the diagnostic clues for this disease . In case of infections, a simple blood investigation that shows elevated levels of serum ferritin should raise the suspicion of a coexisting hlh . A tentative diagnosis of hlh for initiation of immunosuppressive therapy can be done when clinical and lab abnormalities exist as defined in revised 2009 hlh protocol . Also, in the resource poor settings, a single value of ferritin more than 10,000 in the absence of iron overload conditions like hemochromatosis and thalassemia syndromes can act as a surrogate marker for hlh with a sensitivity of 90% and specificity of 96% . Hps secondary to infections has been classified as a separate entity under international classification of diseases by world health organization . Other viruses like dengue, herpes, cmv, hiv have been reported to have hps secondary to them . Secondary hps has frequently been associated with intracellular pathogens that stimulate th1 immune response . Of the bacterial infections, other reports with organisms like salmonella, leptospirosis, malaria, toxoplasmosis, leishmenia, rickettsia and other organisms have been postulated in secondary hlh . Although case reports and case series have frequently reported the reactive hlh secondary to infectious causes especially in the tropical countries, it continues to remain as an under diagnosed and under - reported entity . The treatment of secondary hlh includes aggressive treatment of underlying condition along with immunosuppressive therapy . However, recent data suggest to a less intense immunosuppressive therapy . As opposed to the familial hlh, where allogenic stem cell transplant is the only curative treatment, most of the infection associated hlh cases respond to a course of corticosteroids . Some patients may need additional treatment with drugs like etoposide and cyclosporine; however, a full course of hlh 2004 protocol is rarely required in them . In our case series, all patients were initiated with dexamethasone at a dose of 10 mg / m / day . Three patients with hlh secondary to underlying tuberculosis, malaria and leptospirosis [case 2, 5, 6 in table 1] each responded to steroid monotherapy . Within 2 days of starting steroids their fever reduced with improvement in cytopenias . One patient with dengue fever had a ferritin values more than 100,000 along with severe pancytopenia . She was given two doses of etoposide iv at a dose of 100 mg / m (reduced dose) at weekly intervals . Other two patients were given one single dose of etoposide following which they became symptomatically better . One patient with dengue and one with tuberculosis however had delayed recovery of platelet count and they were started on oral cyclosporine . Csa was given for duration of three months following which it was tapered and stopped . This is in tune with the other case reports and case series of secondary hlh . One possible explanation for this is removal of inciting agent by means of effective antibacterial therapy . Because of its powerful proapoptotic activity describe their unique experience with stem cell transplant in treating secondary hlh in an adolescent . Srinivas et al . In their systemic review of hemophagocytosis syndrome (hps) in tropics found infectious trigger as the cause in 51% of the adult patients . Leishmenia was seen in 40.6%, rickettsia in 18.8% malaria in 15.6% and enteric fever in 9.4% . 56% patients were secondary to viruses, 26% secondary to dengue virus, 17.3% were secondary to ebv and 8.7% each to cmv and parvovirus b 19 . Most of the literature on hlh in tropics is centered on few hospitals and includes case reports and case series . Larger studies and trials are required to throw more light on this potentially fatal condition and unfold the mysteries of ravenous macrophages . In india, hlh associated with dengue fever and malaria with a high parasite index has been documented . In one study from india, the dengue virus has been found to be the most common agent causing hlh in children . Many of the previous case reports of hlh are reported in complicated dengue fever like dengue hemorrhagic syndrome . Crohn's disease and immunosuppression are associated with an increased risk for developing secondary hlh, although none of our patients had underlying disease or immunosuppressed status .. however, cases with classical dengue syndrome have also been reported from indian subcontinent . In our series also, we report two cases of classical dengue fever with secondary hlh . Our cases add to the existing literature of handful of cases of hlh in dengue . Although more common in tropics a case of elderly female has been described by cdc, usa in which hlh secondary to possible dengue infection proved fatal and physicians in west need to be alerted about possible travel acquired dengue which can have fatal complications like secondary hlh . Describe the time - lines of six cases of confirmed dengue with varying severities of hemophagocytosis . Both our patients presented with fever, pancytopenia, organomegaly, high ferritin and fulfilled the criteria of hlh and responded to corticosteroids and etoposide . Hlh secondary to malaria was reported in a young man (case number 5) who had persistent fever, falling counts despite treatment with antimalarials . Had described one of the first cases of hemophagocytosis secondary to malaria (falciparum) which resolved with antimalarials . Park et al . Discusses four case reports of hlh secondary to vivax malaria all of which resolved with antimalarials . However, studies in the pediatric population show degree of parasitemia is associated with severity of disease . Similarly our case was secondary to p falciparum malaria with severe parasitemia seen on peripheral smear . The patient responded to corticosteroids .. hlh secondary to disseminated tuberculosis has been described in past . Pristilla et al . In their review analyzed 36 cases of tuberculosis with secondary hlh . They found fever to be the most common presenting symptom and evidence of extra - pulmonary tuberculosis was found in 83% of cases . In our series, case number 2 a young boy with fever, weight loss, military tuberculosis and choroid tubercles was diagnosed as a case of disseminated tuberculosis . No significant improvement with anti tubercular treatment prompted us to look for other causes and was diagnosed as secondary hlh based on clinical features, high ferritin and bone marrow evidence of hemophagocytosis . Steroids were added to his treatment course and he showed significant improvement within 2 weeks . Similarly an elderly female was diagnosed to have hlh secondary to pulmonary tuberculosis and was started on steroids . However, she did not improve and was further treated with iv etoposide and oral cyclosporine and showed complete remission of symptoms and evidence of hemophagocytosis on follow up after 4 week . This is consistent with earlier studies which showed negative tuberculin test should never preclude the possibility of overwhelming tubercular infection in hlh . Leptospirosis is a spirochete which is commonly prevalent in coastal belt of south india . To the best of our knowledge, no case of hlh secondary to this disease in adult has been reported . The diagnostic challenge in making appropriate diagnosis has been discussed in one of the previous case reports from taiwan in a young male who presented with shock and had evidence of reactive hemophagocytosis . Our patient was a fisherman from the endemic area who presented with fever and oliguria . In due course he developed hepatosplenomegaly, severe cytopenia, esr of 5, high ferritin and bone marrow evidence of hemophagocytosis . In conclusion with limited experience and lack of guidelines for treatment of tropical hlh, a high index of suspicion is something clinicians should bear in mind.
The management of patients with coagulopathic disorders undergoing orthopaedic surgery requires a dedicated, multi - disciplinary team with detailed perioperative planning . Bernard - soulier syndrome (bss) is an extremely rare disorder, affecting 1 in 1 million individuals worldwide . It is caused by a deficiency in glycoprotein 1b - v - ix which is required for normal platelet - mediated clot formation . A 40 year old, female with known bss and developmental dysplasia of her left hip (ddh) was referred to us for consideration of left total hip arthroplasty (tha). Consultation with her haematologist for pre - operative optimization of platelets and related clotting times together with detailed discussions of her intended anaesthesia protocol and surgery resulted in a successful operation with less than anticipated blood loss . Bss is an extremely rare bleeding disorder that puts patients at very high risk of blood loss following surgery . This is the first report that we are aware of describing a bss patient undergoing a tha . A cohesive, highly specialized, multi - disciplinary team is crucial to the success of these patients . Bernard - soulier syndrome (bss) is a rare, inheritable (autosomal recessive) platelet disorder affecting an estimated 1 in every 1 million individuals . A mutation involving glycoprotein complex 1b - v - ix renders platelets unable to bind von willebrand factor (vwf) and form clots . Bss patients require rigorous perioperative planning, however, the literature is devoid of reports describing bss patients undergoing orthopaedic surgery . We present a young female patient with bss that underwent total hip arthroplasty (tha) for her dysplastic left hip . A 40 year old, 83 kg female with developmental dysplasia of her left hip (ddh) was referred to us for consideration of left tha having suffered increasing left hip pain over the past three years . Her diagnosis of ddh was not made until adulthood despite her left leg being shorter than her right leg by 2.5 cm . She was diagnosed with bss at the age of 18, and her haematology reports confirm 2 prior hospital admissions related to delayed bleeding following wisdom- teeth extraction at the age of 20 and cervical cone biopsy; the latter of which required transfusion with platelets and packed red blood cells (prbc). Prior to this, she had been taking birth control pills from the age 14 for heavy menstruation . Pre - operative cross - match and group and screen of blood was conducted confirming blood type a+ . Blood work also confirmed that she was not factor xiii deficit as initially suspected (fxiii activity, 1.04 u / ml). Her glycoprotein 1b level was 15% with an estimated platelet count of 12 (x109/l) and inr 0.9 . We consulted our thrombosis, haemophilia and internal medicine teams for pre - operative optimization . Having a clinical nurse specialist tranexamic acid (ta) 1 g po tid was initiated 24 hours prior to surgery and continued until 14 days post - operatively . 20 mcg of ddavp (desmopressin) diluted into 50 ml of normal saline was given intravenously over a period of 30 minutes, 1 hour prior to surgery . Immediately following this, she received 1 adult dose (4 units/318 ml) of pooled, buffy - coat platelets which elevated her platelets to 79 (x109/l) along with 1 unit of prbc to bring her haemoglobin (hb) to 135 (table 1). Intravenous antibiotics (ancef, 2 g) were given within 30 minutes of surgery . Induction of general anaesthesia was conducted using a mixture of intravenous propofol (170 mg), sufentanil (20 mcg), versed (2 mg) and rocuronium (50 mcg). A glidescope (verathon inc ., anaesthesia maintenance comprised isoflurane (1.8%) with 58% o2 at 1.2l / min and air at 1.3l / min . Once sedate, our patient was positioned in a standard right lateral decubitus position, supported by a stulberg frame (innomed inc ., particular attention was taken to avoid undue tension through soft tissues during dislocation of the hip . Similarly, bone bleeding following transection of the femoral neck and reaming of the acetabulum and femoral canal was addressed immediately ., ny, usa, 2 g in 10 ml sterile normal saline) was packed into the femoral canal and acetabulum for a period of 3 - 4 minutes prior to placement of implants . The femoral component (accolade ii; stryker canada, hamilton, on, ca) was impacted into the femoral canal in the typical fashion . To optimize functional range, we used an anatomic dual mobility (adm), bearing hip system from stryker (fig 1). Bleeding was minimal following impaction of either the femoral or acetabular prostheses . Muscle and surrounding fascial layers were infiltrated with 0.5% marcaine / epinephrine (1:1000; 40 ml). The incision was meticulously closed in multiple layers followed by steri- strips and mepore dressings . Pre- (a) and post- (b) operative radiographs showing the new implant . Post - operatively, daily transfusions of platelets were given up to post - operative day (pod) 14 . Transfusions comprised 2 single donor (232 ml), 4 plateletpharesis (208 44 ml) and 8 pooled, buffy coated platelets (345 15ml). Platelet counts dropped by 40% post - operatively but recovered by pod 6 (see table 1). Serum sodium levels remained stable; the lowest reading was 128 mmol / l on pod 2, recovering to 136 mmol / l by pod 6 . Systolic blood pressures were also stable at 103 14 mmhg, the lowest (98/59) occurring pod 1 . Her blood work was recorded daily, a summary of which is shown in table 1 . Her pain was controlled effectively with oral hydromorphone contin (6 mg, bid) and tylenol (975 mg, q4h). Patient entered into rehabilitation pod 7 and was discharged home on pod 19 following complete review by our haematology and medicine teams . Pre - operative blood work results; estimated counts; hb: haemoglobin; hct: haematocrit . The overall leg length discrepancy was improved from 2.5 cm to 1 cm without the need for additional soft tissue release . Bernard - soulier syndrome, first described in 1948, is an inheritable bleeding disorder affecting 1:1,000,000 individuals [1 - 3]. Patients have prolonged bleeding times and are at high risk for spontaneous bleeding with the membrane - bound glycoprotein 1b / v / ix found on platelets have been described to explain this phenomenon . Transfusions of allogeneic platelets remain the definitive treatment for patients with bss although intravenous injection of recombinant activated factor vii (rfviia) is also effective . The potential for developing anti - platelet antibodies with repeat platelet transfusions remains true although mansour et al suggest that this risk may be lessened for patients with bss since the 1b / v / ix complex is not associated with a platelet - specific antigen site . Total hip arthroplasty is a major surgery with significant risks of blood loss, deep vein thromboembolism (dvt), pulmonary embolism (pe) and infection . Estimates of blood loss following tha in patient without a bleeding disorder vary considerably within the literature; from 300 - 1500 ml with 20 - 30% risk of dvt or pe [5 - 7]. Tranexamic acid (ta) is an anti - fribinolytic that inhibits the activation of plasminogen to plasmin with an established role in joint arthroplasty and good evidence to support reduced blood loss with no increased risk of dvt or pe . We provided oral ta peri - operatively and topical ta through the open wound intra - operatively with doses equivalent to 12 mg / kg po tid and 24 mg / kg respectively . A prospective randomized control trial using topical ta (2g/100 ml 0.9% saline) ddavp binds v2 receptors found on endothelial cells to increase vwf release and promote factor viii . We saw a slight drop over the peri - operative period, however values quickly corrected after the ddavp was stopped . Importantly, the inhibitory effect of propofol on platelets is not evident at clinically relevant doses and its ease of induction outweighs this theoretical risk . Epidural or lumbar spine blocks and/or controlled hypotension can also reduce potential blood loss by 30 - 50% . Nevertheless, the potential risk for bleeding in and around the spinal cord cannot not be ignored . We strived for a systolic blood pressure of 100 mmhg intra- operatively and our total intra - operative blood loss was comparable to what we expect in patients without bss . Furthermore, we only used 1l of 0.9% saline intra - operatively so avoided haemodilution which could potentially exacerbate our existing coagulopathy . We experienced no adverse transfusions reactions despite multiple platelet transfusions post - operatively and hb remained stable . We avoided use of non - steroidal anti - inflammatories which are known to increase peri - operative blood loss following tha . Similarly, conservative use of narcotics is warranted to avoid extreme hypotensive episodes . We found long acting hydromorphone with extra - strength tylenol to be most effective for pain control allowing the patient to mobilize quickly after surgery . We made no special concessions regarding the patient s ddh other than use of the adm implant and minimal acetabular reaming . This is the first report of a successful tha on a young adult with bernard - soulier syndrome . Strict intra - operative haemostasis with limited soft tissue perturbation, limited reaming of the acetabulum and tight, multi - layered closure are instrumental to limit blood loss . The utility of anti - fibrinolytics and ddavp in bss patients is clearly borne out in this study . The management of coagulopathic patients in orthopaedics is a very specialized area of medicine requiring an in depth understanding of the risks of the surgery inherent to these patients . Specific algorithms continue to be refined with regards to the use of perioperative agents to minimize intraoperative blood loss just as surgical technique and technology continues to evolve to minimize perturbation of soft tissues and converse bone and in doing so limit the need for postoperative transfusion.
It is known that such exacerbation is typically associated with an increase in neutrophilic (and, to a lesser extent, eosinophilic) airway inflammation.1,2 however, copd exacerbations are heterogeneous in terms of both airway inflammation and etiology . As expected, the bacterial cluster was the largest, but the eosinophilia - predominant cluster constituted 28% of all exacerbations.3 inhaled or systemic steroids are used to minimize the symptoms of eosinophilic airway inflammation in patients with severe copd exacerbations.4 however, treatment failure is more common in noneosinophilic (compared to eosinophilic) copd patients receiving systemic steroids.5 ultimately, eosinopenia is associated with acute infection and inflammation; these conditions, combined with leukocytosis, are predictive of further bacterial infection.6 eosinopenia is known to be an independent predictor of in - hospital mortality in patients with copd exacerbations.7,8 treatment outcomes differ by the cause of exacerbation . Thus, phenotyping of copd exacerbations is clinically important . Several biomarkers of eosinophilic copd exacerbations have been developed.3,911 of these, the peripheral blood eosinophil percentage is a simple and sensitive biomarker of sputum production and bronchial eosinophilia.3,12 a cutoff of 2% peripheral blood eosinophilia accurately identifies a sputum eosinophilia of> 3% upon exacerbation.3 in the present study, we classified copd patients into eosinophilic and neutrophilic exacerbation (at the time of hospital admission) groups, using data from complete blood cell counts . This was a multicenter retrospective study conducted in six university hospitals in the republic of korea from 2010 to 2014 . The study was approved by the institutional review boards of all participating centers (the catholic university of korea bucheon st mary s hospital, the catholic university of korea seoul st mary s hospital, the catholic university of korea yeouido st mary s hospital, the catholic university of korea st paul s hospital, the catholic university of korea incheon st mary s hospital, the catholic university of korea st vincent s hospital; irb no xc16rimi0030). Was waived by the institutional review boards because the study was based on retrospective chart reviews . Patients previously diagnosed with copd using the international classification of diseases version 10 codes j440, j441, j448, and j449 and who were hospitalized with exacerbations were included . Patients with underlying lung cancer, who chronically used steroids, who were admitted because of other medical problems, who did not fulfill the global initiative for chronic obstructive lung disease criteria (not having results of spirometry without bronchodilator or forced expiratory volume in 1 second [fev1]/forced vital capacity 0.70), who lacked pulmonary function test (pft) data, and who exhibited definite pneumonic infiltrations on chest x - ray at the time of admission were excluded . Only the most recent hospitalization event was considered . A copd exacerbation was defined as an event developing during the natural progress of disease featuring aggravation of symptoms such as dyspnea and increased purulence of respiratory secretions, requiring a change in regular treatment.13 an eosinophilic exacerbation was defined as a serum eosinophil count> 2%.5 a neutrophilic exacerbation was defined as a leukocyte count> 11,000 leukocytes / ml or a neutrophil proportion> 65% . Cases that met both eosinophilia (serum eosinophil count> 2%) and neutrophilia (neutrophil proportion> 65% or leukocyte count> 11,000 leukocytes / ml) were categorized as eosinophilic exacerbations . We extracted the following data from medical records: patient demographics; any history of comorbid disease such as hypertension, diabetes mellitus, myocardial infarction, congestive heart failure (chf), or cerebrovascular accident; smoking history; the number of hospital or emergency room (er) admissions in the previous year; the types of regular copd medications taken; laboratory data (including those pertaining to arterial blood gas analysis and c - reactive protein [crp] level); pft results; hospital days; admission to the intensive care unit (icu); length of icu stay; any need for mechanical ventilation (mv); the duration of mv; any need for noninvasive ventilation; and treatment results . Nebular forms of salbutamol (2.5 mg/2.5 ml nebules) and budesonide (500 g/2 ml nebules) were given every 6 hours and 12 hours, respectively . Based on laboratory data, copd patients were classified into two groups: eosinophilic and neutrophilic exacerbation groups . Clinical parameters and treatment outcomes, including icu admission and in - hospital mortality, were compared between the two groups . Severe copd exacerbations requiring icu admission have a major impact on mortality.14,15 in view of the differences in disease severity between the two groups, copd patients were further classified into icu and non - icu admission groups . Baseline demographics and clinical outcomes were compared between patients with eosinophilic and neutrophilic exacerbations . We used pearson s chi - squared test to compare discrete variables and student s t - test to compare continuous variables . Multiple logistic regression analysis was used to identify significant independent factors associated with icu admission . All statistical analyses were performed using spss for windows software (version 20.0; ibm corporation, armonk, ny, usa). Patients previously diagnosed with copd using the international classification of diseases version 10 codes j440, j441, j448, and j449 and who were hospitalized with exacerbations were included . Patients with underlying lung cancer, who chronically used steroids, who were admitted because of other medical problems, who did not fulfill the global initiative for chronic obstructive lung disease criteria (not having results of spirometry without bronchodilator or forced expiratory volume in 1 second [fev1]/forced vital capacity 0.70), who lacked pulmonary function test (pft) data, and who exhibited definite pneumonic infiltrations on chest x - ray at the time of admission were excluded . Only the most recent hospitalization event was considered . A copd exacerbation was defined as an event developing during the natural progress of disease featuring aggravation of symptoms such as dyspnea and increased purulence of respiratory secretions, requiring a change in regular treatment.13 an eosinophilic exacerbation was defined as a serum eosinophil count> 2%.5 a neutrophilic exacerbation was defined as a leukocyte count> 11,000 leukocytes / ml or a neutrophil proportion> 65% . Cases that met both eosinophilia (serum eosinophil count> 2%) and neutrophilia (neutrophil proportion> 65% or leukocyte count> 11,000 leukocytes / ml) were categorized as eosinophilic exacerbations . We extracted the following data from medical records: patient demographics; any history of comorbid disease such as hypertension, diabetes mellitus, myocardial infarction, congestive heart failure (chf), or cerebrovascular accident; smoking history; the number of hospital or emergency room (er) admissions in the previous year; the types of regular copd medications taken; laboratory data (including those pertaining to arterial blood gas analysis and c - reactive protein [crp] level); pft results; hospital days; admission to the intensive care unit (icu); length of icu stay; any need for mechanical ventilation (mv); the duration of mv; any need for noninvasive ventilation; and treatment results . Nebular forms of salbutamol (2.5 mg/2.5 ml nebules) and budesonide (500 g/2 ml nebules) were given every 6 hours and 12 hours, respectively . Prescription of antibiotics and systemic steroids was at the discretion of attending clinicians . Based on laboratory data clinical parameters and treatment outcomes, including icu admission and in - hospital mortality, were compared between the two groups . Severe copd exacerbations requiring icu admission have a major impact on mortality.14,15 in view of the differences in disease severity between the two groups, copd patients were further classified into icu and non - icu admission groups . We used pearson s chi - squared test to compare discrete variables and student s t - test to compare continuous variables . Multiple logistic regression analysis was used to identify significant independent factors associated with icu admission . All statistical analyses were performed using spss for windows software (version 20.0; ibm corporation, armonk, ny, usa). Overall, 1,688 copd patients with severe exacerbations were admitted to the hospital over the study period, of whom 1,083 met the exclusion criteria of underlying lung cancer, definite pneumonia at the time of admission, admission because of other medical problems, absence of pft data, and/or chronic use of steroids . Of these, 177, 380, and 48 patients were classified into the eosinophilic, neutrophilic, and paucigranulocytic copd exacerbation groups, respectively . The proportion of males was lower, and the mean age higher, in the neutrophilic group (p<0.001). The frequencies of comorbidities and self - reported history of allergy or asthma were similar in the two groups . The proportions of patients who had experienced one or more hospital or er admissions in the previous year did not differ significantly between the two groups . In terms of regular medications prescribed at the outpatient clinics, patients with neutrophilic exacerbations used significantly more phosphodiesterase 4 inhibitors than did those with eosinophilic exacerbations (p=0.026). The crp level was higher in the neutrophilic group . On the pft, fev1 and forced vital capacity were higher in the eosinophilic group (p<0.001 and p=0.009, respectively), but the severity of airway obstruction (based on the global initiative for chronic obstructive lung disease criteria) did not differ between the two groups . The treatment strategies, icu admission data, approaches toward mv, and mortality are summarized in table 3 . In terms of treatment strategies, steroid - only prescription was more common in the eosinophilic group (p<0.001), and steroids combined with antibiotics were prescribed more often in the neutrophilic group (p<0.001). The proportion of patients who used nebulizers only (ie, who did not take steroids or antibiotics) was higher among those with eosinophilic exacerbations (p=0.028). The length of hospital stay did not differ between the two groups, but the rates of icu admission and mv were higher in the neutrophilic group (4.5% vs 12.4%, p=0.004; 2.8% vs 9.5%, p=0.005, respectively). Both total and early mortality were higher in the neutrophilic group (1.1% vs 4.5%, p=0.043; 0.0% vs 2.9%, p=0.022, respectively). The study groups were subgrouped in terms of icu admission . Upon univariate analysis, age, body mass index, chf, and neutrophilic exacerbation were associated with icu admission (table 4). Chf (odds ratio [or] = 3.40, 95% ci 1.289.01, p=0.014) and neutrophilic exacerbation (or = 2.81, 95% ci 1.216.52, p=0.016) were independent risk factors for icu admission (table 5). We compared the clinical characteristics and treatment outcomes of copd patients with neutrophilic and eosinophilic exacerbations based on complete blood count . We found that 29.3% of hospitalized copd patients with acute exacerbations had peripheral eosinophilia exceeding 2% . Patients with eosinophilic copd exacerbations had better clinical outcomes than did those with neutrophilic exacerbations . Patients with eosinophilic exacerbations had a lower early mortality rate than did those with neutrophilic exacerbations . One possible explanation for the association between poor prognosis and neutrophilic exacerbation is that neutrophilia is known to be a marker of bacterial infection.16 most copd exacerbations are associated with such infections, and copd exacerbations caused by bacteria are associated with longer hospital stays and more frequent exacerbations.3,8,17 also, neutrophilia was associated with a greater probability of hospital admission in patients visiting ers with copd exacerbations.16 in patients with neutrophilia, the crp level is a useful serum biomarker of bacteria - associated exacerbation.3,18 a higher crp level at admission increases the risk of treatment failure.19 in our present study, the crp level was significantly higher in patients with neutrophilic than eosinophilic exacerbations . Traditionally, copd exacerbation has been associated with neutrophilic airway inflammation . However, one study found that eosinophilic airway inflammation accounted for a considerable proportion (nearly 30%) of copd exacerbations,3 which is consistent with our data . In patients with copd exacerbations, airway eosinophilia is evident upon bronchial biopsy.20 sputum eosinophil levels increase during copd exacerbations.4,11 furthermore, bronchial hyperresponsiveness and reversibility may be evident in certain subgroups of copd patients; these characteristics are associated with airway eosinophilia.21 bronchoalveolar lavage and endobronchial biopsies have been performed and sputum collected for decades to examine the nature of airway inflammation in copd patients.20,22 however, these methods are difficult to apply to copd patients exhibiting acute exacerbations . Sputum induction can trigger additional bronchoconstriction, and invasive techniques such as bronchoscopy are difficult in patients in poor condition.23 measurements of interleukin-15 and fractional exhaled nitric oxide levels can identify eosinophilic airway inflammation . However, these methods are difficult to apply in routine clinical practice.911 recently, a peripheral blood eosinophil proportion> 2% has been suggested to be a simple and useful marker of sputum eosinophilia.3 blood eosinophilia is associated with increased all - cause mortality in general populations with asthma and copd.24,25 eosinophilia is associated with frequent exacerbations only among copd patients who are not currently smoking.26 in copd patients with eosinophilic exacerbations, as revealed by peripheral blood eosinophil levels, the length of hospital stay and readmission rate were shorter and lower, respectively, than in those with noneosinophilic exacerbations.27 patients with copd exacerbations featuring acute respiratory failure (and who thus required icu admission) had better outcomes in terms of a lower median length of icu stay and lower icu mortality than did patients with peripheral eosinophilia.28 high doses of bronchodilators and systemic steroids are the mainstay of management of copd exacerbations.29,30 antibiotics are beneficial if the sputum is purulent, but routine antibiotics are only marginally efficacious.30,31 in clinical practice, most copd patients with acute exacerbations receive antibiotics.32 however, only 20%30% of copd patients with exacerbations exhibited positive sputum bacterial cultures; indiscriminate prescription of antibiotics triggers antibiotic resistance.30 although systemic corticosteroids are well known to be effective in copd patients with acute exacerbations, corticosteroids can influence bacterial clearance, rendering pathogen eradication incomplete, thereby triggering relapses and clinical failure.33 thus, copd phenotypes must be characterized and treatment individualized . As mentioned earlier, neutrophilic and eosinophilic copd exacerbations exhibit different characteristics and treatment outcomes, indicating that different treatment strategies are required . First, the work was retrospective in nature . Nonetheless, this was a multicenter study, with a large sample size, which yielded valuable clinical information on eosinophilic and neutrophilic exacerbations . The rates of use of steroids only and steroids combined with antibiotics were higher in patients with eosinophilic and neutrophilic exacerbations, respectively . Prescription of steroids and/or antibiotics was at the discretion of pulmonologists treating exacerbations in each hospital . A prospective study is thus needed to clarify appropriate phenotype - specific therapies for subgroups of copd patients with peripheral eosinophilia or neutrophilia . Despite these limitations, second, although several comparative studies on eosinophilic and non - eosinophilic copd exacerbations requiring hospital admission have appeared, few studies have directly compared eosinophilic and neutrophilic exacerbations in copd patients.27,28,34,35 in addition, the cited studies included copd patients taking steroids prior to enrollment, and those with histories of steroid use were unknown . Corticosteroids affect eosinophils and induce eosinopenia; we thus excluded patients who had taken steroids prior to possible enrollment.36 finally, our work suggests that peripheral neutrophilia evident on admission is a risk factor for icu admission . This information will aid clinicians who must evaluate, and predict the clinical course of patients hospitalized with copd exacerbations . Copd patients with neutrophilic exacerbations experienced poorer clinical outcomes than did those with eosinophilic exacerbations . The peripheral blood eosinophil count may be a useful marker for predicting clinical progress in copd patients exhibiting acute exacerbations during hospitalization . Prospective studies are needed to clarify the utility of peripheral eosinophilia in terms of the classification of copd phenotypes and individualization of treatment.
Nephrotic syndrome with the deposition of non - amyloidal fibril structures in the glomeruli was first reported in 1977 by rosenmann et al ., and the term fibrillary glomerulonephritis (fgn) has been used since 1987 . Fgn is a rare glomerular deposition disease and accounts for approximately 0.51.0% of all adult glomerulonephritis cases on renal biopsy [3, 4, 5, 6]. It is characterized by the deposition of microfibrils 1030 nm in diameter in the mesangial and/or glomerular capillary walls . Congo red stain shows a negative reaction [3, 4, 5, 6]. On immunofluorescent study, immunoglobulin g (igg) and c3 igg4 is predominantly positive in the staining for subclasses of igg [1, 3, 4, 5, 6]. Fgn usually develops at middle or older age [5, 6], and the typical clinical findings are proteinuria, which often reaches the nephrotic range . Treatment with steroids and immunosuppressive agents is not effective, and the renal outcome is generally poor [3, 4, 5, 6, 7]. Although a few familial cases have been reported in the past [8, 9], the clinical and pathological features were not fully evaluated . Herein, we report a patient with fgn and a family history of renal disease, and we compare the histological and clinical features with those of previous familial fgn . Their father (case 3) had already died of nephrotic syndrome but did not undergo renal biopsy . In the pedigree analysis (fig . 1), case 1's children had no medical history on routine school medical checkup . The brothers paternal uncle was diagnosed with rheumatoid arthritis, and their paternal grandfather had a history of cerebral infarction . Case 1 was originally healthy, and there was no abnormality in urinalysis at a young age . Proteinuria (1 + on dipstick test) was detected annually thereafter, but the patient was not referred to the hospital for specialist evaluation at that time . He was referred to a nearby hospital at 40 years of age and underwent a more detailed examination by renal biopsy at our department . His urine protein excretion was 1.33 g / g cr without microscopic hematuria, and serum creatinine was 66.3 serological tests for hepatitis b or c virus were both negative . On light microscopy, 90 glomeruli were observed, and no global or segmental sclerosis was detected . All glomeruli showed mild mesangial expansion and segmental thickening of the glomerular capillary wall (fig . 2). Elastofibrosis in the interlobular arterial tissue was observed, whereas arteriolar hyalinosis was not observed . Congo red staining was negative, and positive apple green color was not detected under polarized light . Immunofluorescence showed igg and c3 depositions in the mesangium and glomerular capillary walls; additionally, the vessel walls showed strong igg and c3 depositions and mild igm and c1q depositions . Iga and lambda were negative, and kappa was very slightly positive in the glomeruli . Electron microscopy revealed electron - dense deposits with randomly arranged nonbranching fibrils, measuring approximately 20 nm in diameter in the mesangial lesion and glomerular basement membranes (fig . The patient was diagnosed with fgn, and treatment with 50 mg of oral losartan potassium once daily was initiated . Serum creatinine was stable, and the excretion of urine protein was decreased to 0.53 g / g cr 7 months after the start of therapy . Case 2 had no significant medical history in his annual medical checks . At 34 years of age the dipstick test for occult blood was also positive at a later annual urinalysis; thus, he was admitted to a nearby hospital for renal biopsy . He had no hypertension or edema at the time of admission and urine protein excretion was 2.0 g / day without microscopic hematuria . Immunological tests including antinuclear antibody, complements, and immunoglobulins were not specific, and hepatitis b or c viral tests were also negative . On light microscopy, 49 glomeruli were observed but no global or segmental sclerosis was observed, and there was diffuse mesangial matrix expansion, along with partial double contour of the glomerular basement membranes (fig . Tubular atrophy and interlobular arterial sclerosis were very mild, whereas arteriolar hyalinosis was negative . On immunofluorescence, mild igg and igm, and strong c3 depositions were observed in the mesangium and capillary walls . He was diagnosed with membranoproliferative glomerulonephritis (mpgn) and treated with prednisolone and cyclophosphamide . Two years later, this combination therapy was discontinued because the treatment was ineffective, and imidapril 5 mg / day was prescribed after that . Five years after his biopsy, his urine protein excretion was 1.68 g / day, and serum creatinine was 70.7 he did not undergo renal biopsy, and, unfortunately, the medical records have been lost . Case 1 was originally healthy, and there was no abnormality in urinalysis at a young age . Proteinuria (1 + on dipstick test) was detected annually thereafter, but the patient was not referred to the hospital for specialist evaluation at that time . He was referred to a nearby hospital at 40 years of age and underwent a more detailed examination by renal biopsy at our department . His urine protein excretion was 1.33 g / g cr without microscopic hematuria, and serum creatinine was 66.3 serological tests for hepatitis b or c virus were both negative . On light microscopy, 90 glomeruli were observed, and no global or segmental sclerosis was detected . All glomeruli showed mild mesangial expansion and segmental thickening of the glomerular capillary wall (fig . 2). Elastofibrosis in the interlobular arterial tissue was observed, whereas arteriolar hyalinosis was not observed . Congo red staining was negative, and positive apple green color was not detected under polarized light . Immunofluorescence showed igg and c3 depositions in the mesangium and glomerular capillary walls; additionally, the vessel walls showed strong igg and c3 depositions and mild igm and c1q depositions . Iga and lambda were negative, and kappa was very slightly positive in the glomeruli . Electron microscopy revealed electron - dense deposits with randomly arranged nonbranching fibrils, measuring approximately 20 nm in diameter in the mesangial lesion and glomerular basement membranes (fig . The patient was diagnosed with fgn, and treatment with 50 mg of oral losartan potassium once daily was initiated . Serum creatinine was stable, and the excretion of urine protein was decreased to 0.53 g / g cr 7 months after the start of therapy . Case 2 had no significant medical history in his annual medical checks . At 34 years of age the dipstick test for occult blood was also positive at a later annual urinalysis; thus, he was admitted to a nearby hospital for renal biopsy . He had no hypertension or edema at the time of admission and urine protein excretion was 2.0 g / day without microscopic hematuria . Immunological tests including antinuclear antibody, complements, and immunoglobulins were not specific, and hepatitis b or c viral tests were also negative . On light microscopy, 49 glomeruli were observed but no global or segmental sclerosis was observed, and there was diffuse mesangial matrix expansion, along with partial double contour of the glomerular basement membranes (fig . Tubular atrophy and interlobular arterial sclerosis were very mild, whereas arteriolar hyalinosis was negative . On immunofluorescence, mild igg and igm, and strong c3 depositions were observed in the mesangium and capillary walls . He was diagnosed with membranoproliferative glomerulonephritis (mpgn) and treated with prednisolone and cyclophosphamide . Two years later, this combination therapy was discontinued because the treatment was ineffective, and imidapril 5 mg / day was prescribed after that . Five years after his biopsy, his urine protein excretion was 1.68 g / day, and serum creatinine was 70.7 he did not undergo renal biopsy, and, unfortunately, the medical records have been lost . The unique point was the deposition of microfibrils with 20 nm in diameter in the basement membranes of the arteriolar wall . Fibrils of fgn are typically found in the mesangium and glomerular basement membranes with or without subepithelial and subendothelial electron - dense deposits [4, 5, 6, 10, 11, 12]. In a few previous reports, fibril structures were noticed in the tubular basement membranes by electron microscopy, whereas arteriolar deposition was not confirmed [4, 5, 6, 10, 11, 12]. Although the pathophysiology of the fibrillary deposition is still unknown, the histopathological features suggest that the fibrils might be derived from immunoglobulins and have an affinity to the extracellular matrix [4, 5, 9, 13]. It may be natural that fibrils deposit in the basement membrane of the arteriolar wall in fgn . Fgn exhibits various glomerular changes, including mpgn, mesangial proliferative glomerulonephritis (mespgn), and membranous glomerulonephritis [34, 5, 6]. Some individuals with fgn have background diseases such as hepatitis c virus infection, polyclonal gammopathy, and lymphoproliferative disorders [5, 6, 14, 15]. From the above table 1 shows previously published familial cases [8, 9]. In this summary, the histological patterns comprised mgpn, mespgn, and membranous glomerulonephritis . In our cases as well as in previous familial cases, there were no comorbidities such as infectious, autoimmune, or malignant diseases in their history . The glomerular changes of case 1 and case 2 were thought to be more comparable to mespgn than mpgn, and there were no secondary causes that would induce mespgn . Therefore, fgn was presumed to be the clinical diagnosis in the case of the elder brother (case 2), although electron microscopy was not performed and this is a limitation in our report . The variety of inherited pathways, including father to son, father to daughter, and mother to son, was confirmed in the previous reports [8, 9]; therefore, an autosomal dominant genetic form is suspected . Fgn develops at 4060 years of age; thus, patients with fgn could procreate in their reproductive years . Herein, we reported a very rare case of fgn with fibril deposition in the arteriolar wall and possible cases of familial incidence . To clarify the etiology and effective therapy for fgn

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.