text
stringlengths
0
868k
Osteosarcoma (os) is a common histological form of bone cancer, which is most prevalent in children and adolescents . It was reported that os was the eighth most common childhood cancer, accounting for about 20% of all primary bone cancers and 2.4% of all malignancies in pediatric patients . Symptoms include pain at night, overt localized swelling, and bones that fracture easily . Various treatments, such as wide - excision surgery of tumors, radiotherapy, chemotherapy, and neoadjuvant chemotherapy, are usually adopted in os . Although significant improvements in the long - term outcome of os patients have been made, it is still not satisfactory . The best reported 10-year survival rate was 92%, and the protocol was an aggressive intra - arterial regimen that individualizes therapy based on arteriographic response . The 3-year survival rates ranged from 5075%, and 5-year survival rate ranged from 6085% . In addition, 3040% children died of it, and 2550% patients subsequently developed metastatic disease, which was the major cause of death . Recently, some biomarkers for os were selected, such as cd20, ecm, itga, and pmp22 . Hyperthermia therapy is a treatment approach in which a particular area or the whole body is heated above normal temperatures to achieve therapeutic effects . Hyperthermia has been used in cancer treatment since 1989, and currently it is used either for ablation purposes as an alternative to surgery, or, less frequently, in combination with chemotherapy or radiation therapy . It was reported that hyperthermia can activate various systemic anti - tumor immune responses, and leads to methamphetamine - induced toxicity . The principle may be as follows: heat alters membrane characteristics, leading to modification in cell morphology, intracellular sodium and calcium levels, and membrane potential [1517]. Some studies reported that hyperthermia can induce apoptosis and reduce migration of os . In this study, we aimed to screen gene expression changes of os induced by hyperthermia via integrating the chromatin immunoprecipitation with generation sequencing (chip - seq) and targetscan analysis, and further explored the related potential biomarkers and mechanism . The chip - seq dataset of gse60984 was downloaded from the gene expressed omnibus (geo) database (http://www.ncbi.nlm.nih.gov/geo/). In this dataset, there were 3 samples of os cell: one was treated with both anti - hsf1 antibody and heat shocked for 10 min, another was treated with anti - hsf1 antibody and was heat shocked for 20 min, and the last was treated with neither antibody nor hyperthermia (the control sample). Raw fastq read sequences were demultiplexed, and cutadapt was used to remove adapter sequences from dna high - throughput sequencing data . Afterwards, the expressed genes were aligned to a reference genome using bowtie, an ultrafast genome aligning tool that was used for the mapping of the raw reads to enesembl (http://www.ensembl.org/index.html) hg19 genome with maximum of 2 mismatches in every reads and those who had only 1 match were reserved . Model - based analysis of chip - seq (macs) was a computational algorithm that identified genome - wide locations of transcription / chromatin factor binding or histone modification from chip - seq data . The hsf1-binding sites (also known as peaks) were respectively obtained via macs2 in the os cells heat shocked for 10 and 20 min compared with the control samples, and recorded as peek-10 and peek-20, respectively . Based on the chipseeker package, their related genes, distance to the closest transcription start sites (tss), and genome features were assigned to the peaks . Moreover, some genes of peek-10 and peek-20 were separately selected out when hsf1-binding sites were located in the promoter regions, and their overlaps were found . The database for annotation, visualization and integrated discovery (david) (https://david.ncifcrf.gov/) is a widely used web - based tool for functional and pathway enrichment analysis . In this study it was used to perform gene ontology (go) and kyoto encyclopedia of genes and genomes (kegg) pathway enrichment analysis of the above overlaps . Moreover, the go terms and kegg pathways were selected out with the criteria of p value <0.05 . Targetscan is a widely used database that predicts biological targets of mirnas by searching for the presence of conserved 8mer, 7mer, and 6mer sites that match the seed region of each mirna . The mirna, which might regulate the overlaps, as well as the mirna - gene pairs, were screened out with targetscan . Furthermore, the mirna - gene - regulated network was constructed based on the above mirna - gene pairs . However, the selected mirna - gene pairs might be overwhelming, and the mirna - gene regulated network too complicated, so that it was not conducive to analyze and the accuracy was not high . Hence, module analysis of the network was conducted and the modules were visualized using cytoscape software . The chip - seq dataset of gse60984 was downloaded from the gene expressed omnibus (geo) database (http://www.ncbi.nlm.nih.gov/geo/). In this dataset, there were 3 samples of os cell: one was treated with both anti - hsf1 antibody and heat shocked for 10 min, another was treated with anti - hsf1 antibody and was heat shocked for 20 min, and the last was treated with neither antibody nor hyperthermia (the control sample). Raw fastq read sequences were demultiplexed, and cutadapt was used to remove adapter sequences from dna high - throughput sequencing data . Afterwards, the expressed genes were aligned to a reference genome using bowtie, an ultrafast genome aligning tool that was used for the mapping of the raw reads to enesembl (http://www.ensembl.org/index.html) hg19 genome with maximum of 2 mismatches in every reads and those who had only 1 match were reserved . Model - based analysis of chip - seq (macs) was a computational algorithm that identified genome - wide locations of transcription / chromatin factor binding or histone modification from chip - seq data . The hsf1-binding sites (also known as peaks) were respectively obtained via macs2 in the os cells heat shocked for 10 and 20 min compared with the control samples, and recorded as peek-10 and peek-20, respectively . Based on the chipseeker package, their related genes, distance to the closest transcription start sites (tss), and genome features were assigned to the peaks . Moreover, some genes of peek-10 and peek-20 were separately selected out when hsf1-binding sites were located in the promoter regions, and their overlaps were found . The database for annotation, visualization and integrated discovery (david) (https://david.ncifcrf.gov/) is a widely used web - based tool for functional and pathway enrichment analysis . In this study it was used to perform gene ontology (go) and kyoto encyclopedia of genes and genomes (kegg) pathway enrichment analysis of the above overlaps . Moreover, the go terms and kegg pathways were selected out with the criteria of p value <0.05 . Targetscan is a widely used database that predicts biological targets of mirnas by searching for the presence of conserved 8mer, 7mer, and 6mer sites that match the seed region of each mirna . The mirna, which might regulate the overlaps, as well as the mirna - gene pairs, were screened out with targetscan . Furthermore, the mirna - gene - regulated network was constructed based on the above mirna - gene pairs . However, the selected mirna - gene pairs might be overwhelming, and the mirna - gene regulated network too complicated, so that it was not conducive to analyze and the accuracy was not high . Hence, module analysis of the network was conducted and the modules were visualized using cytoscape software . A total of 19 626 and 18 015 hsf1-binding sites were obtained in the os cells heat shocked for 10 and 20 min, respectively, compared with the control samples (recorded as peek-10 and peek-20). Their distributions in the genome - wide are shown in figure 1, showing 10.017% peek-10 and 7.921% peek-20 located in the promoter regions . In other words, 1880 genes of peek-10 and 1283 genes of peek-20 were located in the promoter regions . Besides, 889 overlaps of them were found, and 40 of the overlaps are shown in table 1 . A total of 122 go terms were found to be enriched in the overlapped genes, and the top 10 most significant go terms are exhibited in figure 2 . The overlaps were enriched in 3 kegg pathways, namely p53 signaling pathway, methane metabolism and viral myocarditis . The mirna - gene regulated network of the overlaps was constructed, including 13 657 mirna - gene - regulated pairs . The network was divided into 4 modules, and they were recorded as module 1, module 2, module 3, and module 4 . A total of 19 626 and 18 015 hsf1-binding sites were obtained in the os cells heat shocked for 10 and 20 min, respectively, compared with the control samples (recorded as peek-10 and peek-20). Their distributions in the genome - wide are shown in figure 1, showing 10.017% peek-10 and 7.921% peek-20 located in the promoter regions . In other words, 1880 genes of peek-10 and 1283 genes of peek-20 were located in the promoter regions . Besides, 889 overlaps of them were found, and 40 of the overlaps are shown in table 1 . A total of 122 go terms were found to be enriched in the overlapped genes, and the top 10 most significant go terms are exhibited in figure 2 . The overlaps were enriched in 3 kegg pathways, namely p53 signaling pathway, methane metabolism and viral myocarditis . The mirna - gene regulated network of the overlaps was constructed, including 13 657 mirna - gene - regulated pairs . The network was divided into 4 modules, and they were recorded as module 1, module 2, module 3, and module 4 . Heat shock transcription factor 1 (hsf1) is localized to the cytoplasm as an inactive monomer, and heat shock can induce the activation of hsf1 . The active hsf1 leads to synthesis and cytoprotection of heat shock proteins (hsps). However, an increase in hsps might render hyperthermia less effective . In this study, the hsf1 binding sites in promoter regions were analyzed after 10 and 20 min of hyperthermia using the chip - seq approach . After the functional enrichment analysis, more overlapped genes were enriched in processes of regulation of programmed cell death and regulation of cell death (figure 2). Programmed cell death, especially the expressions of some receptors and ligands in the process, play critical roles in the progression and resistance to oncolytic adenovirus of os [3032]. Regulations the cell death processes of tumor cells and normal cells has become an important way to increase efficacy and reduce resistance to traditional treatments in os [3335]. Therefore, processes of programmed cell death and cell death might be involved in the mechanism of hyperthermia in os, and their rational regulation might contribute to a better curative effect . The overlaps were found enriched in 3 kegg pathways, p53 signaling pathway, methane metabolism, and viral myocarditis . The p53 signaling pathway was involved in many tumors, and os is no exception . It was reported that the p53 signaling pathway participates in cell proliferation, metastasis, and angiogenesis of os [3840]. Furthermore, the p53 pathway is closely associated with cell cycle and apoptosis, which are involved in the enriched go terms used in this study [4143]. Matsumoto et al . Found that nitric oxide is an initiator of intercellular signal transduction after hyperthermia in mutant p53 cells of human glioblastoma . Our results indicate that the p53 signaling pathway, methane metabolism, and viral myocarditis might play critical roles in gene changes of os regulated by hsf1 . However, further in - depth research is needed, especially on the relationships between os and pathways of methane metabolism and viral myocarditis . After targetscan analysis of the overlaps, the mirna - gene - regulated network was constructed, including 13 657 mirna - gene regulated pairs that might be unreliable . Module 1 contained the most nodes and pairs, and sgms2 and cggbp1 were regulated by more mirnas than other nodes . Therefore, sgms2 and cggbp1 are important nodes in the mirna - gene - regulated network of the overlapped degs . Sgms2 encoded sphingomyelin synthase 2 (sgms2), which is a risk factor of liver steatosis and atherosclerosis . Moreover, nfb signaling pathways is closely related to the proliferation and progression mechanism of many cancers, and targeting it has been used in cancer prevention and therapy [4850]. Cggbp1 encoded cgg triplet repeat - binding protein 1 (cggbp1), which is a nuclear and midbody protein regulating abscission . Cell cycle directly affects cell proliferation and apoptosis, which is important in the progression and prognosis of os . Although few studies have verified that sgms2 and cggbp1 are associated with effects of hyperthermia on os, the present study indicates that they might be key genes of os treated with heat shock . The gse60984 data set was provided by janus et al ., who mainly researched potential genes regulated by tnf- cytokine and heat shock based on chip - seq analysis, and explored functions of nf-b signaling pathways on os in the process of hyperthermia . In this article, some different methods were used and some novel findings were obtained . For example, functional and pathways enrichment analysis were performed, and some different biological processes (e.g., programmed cell death and cell death) and more pathways (e.g., p53 signaling pathway, methane metabolism, and viral myocarditis) were found to be involved in the effects of hyperthermia on os . Moreover, the mirna - gene network was constructed and analyzed with targetscan and cytoscape, which contained more interactions and thus might be more reliable . Sgms2 and cggbp1 might be biomarkers of heat shocked os, and programmed cell death and cell death might be involved in the mechanism of hyperthermia in os . The p53 signaling pathway, methane metabolism, and viral myocarditis might play critical roles in gene changes in os regulated by hsf1.
For thousands of years, ginseng (panax ginseng meyer) has been known to be a medicinal plant, showing a variety of effects on the human body and is a substance that helps maintain homeostasis in the living body through an " adaptogen effect " . In recent years the reported medicinal effects have been being supported by clinical studies in the fields of physiology, biology, biochemistry, pharmacology, and pathology . Saponin, the main active ingredient, is responsible for a variety of proven effects of ginseng, and is usually referred to as ginsenosides . This name refers to a glycoside isolated from ginseng, which distinguishes it from saponin and from other plants . There are close to 60 species of ginsenosides, and of those ginsenosides, rg1 belongs to the pt (protopanaxtriol) class and is one of the typical ginsenosides abundant in panax ginseng . According to previous or ongoing studies of the pharmacological activities of ginsenosides, rg1 treatment reportedly strengthens the hippocampus which plays an important role in memory and learning [16, 26]. It has also been reported to have various effects including enhancement of immune function, inhibition of platelet aggregation, stimulation of protein synthesis (mouse brain), anti - fatigue, anti - stress, anti - inflammation, promotion of hepatocellular proliferation and dna synthesis, promotion of nerve cell survival, stimulation of cholesterol (activating ldl receptor), and stimulation of adrenocorticotropin secretion . However, in the field of exercise science, there are few studies that have evaluated the effect of rg1 intake . Furthermore, previous studies reported that it is difficult to draw any clear conclusion on the relationship between ginseng and improvement of exercise capacity . The main limitations for the clinical study are harvest time, and varietal species caused by varying cultivation, which leads to frequently changing profiles of ginsenosides . A number of limitations were likely present because no specific dose and concentration of single or combined ginsenosides has been clearly validated . In order to solve these problems, it is necessary to examine the effect of each specific ginsenoside in ginseng which acts on human body in relation to exercise capacity and associated metabolic processes . Through this, medicinal or functional foods which can enhance physical health and function can be developed, and specific methods for an ergogenic aid can be presented . Anaerobic power has been observed, though there were positive effects on antioxidant enzymes, immune responses, and vo2max . In addition, the activity of citrate synthase (cs), which is a typical aerobic enzyme used as an indicator of mitochondrial function, increased . It is thought to be very difficult to make a clear conclusion of improved aerobic capacity based on the changes of only one indicator enzyme . Moreover, adverse effects of a long - term treatment with ginseng, such as high blood pressure, digestive disorders, insomnia, and nervousness have been reported . Thus, considering its use for long - term condition management or as a temporary coping mechanisms in athletes, short - term intake (1 - 3 times/24 hours) should be assessed . Compared with other tissues, skeletal muscle is the most able to adapt to changes or stimulation . It reacts in a variety of different morphological and biochemical ways by exposure to a certain environment, regular aerobic and anaerobic exercises, and nutritional or pathological stimuli . Because such changes rely on the mobilization pattern of the muscle fibers, it is necessary to selectively observe a muscle group . In this study, aerobic, plantaris muscle fibers from a dominant muscle group were chosen to observe bigger morphological and biochemical changes after 6 weeks of swimming . Endurance training was a 6-week course of swimming using sprague - dawley rats, followed by acute uptakes of rg1 three times within 24 hours . Immediately after the measurement, the plantaris was extracted and mass changes, cs encoding mrna production, and cs activity were analyzed . Through these results, the additive effects of a short - term intake of rg1 on enhanced aerobic exercise capacity acquired through a long - term swimming training were examined . Seven rats were assigned to each group and they went through adaptation periods for cage and swimming exercise for 10 days before the onset of treatment . After that, except for the subjects eliminated during the 6-week treatment period, the final 26 rats were divided into four groups, placebo (np, n=6), rg1 (nrg, n=6), exercise+placebo (ep, n=7), and exercise+rg1 (erg, n=7). The whole study was conducted after the animal care and the treatment procedures were approved by kyung hee university animal ethics committee (khuasp-15 - 21). Each swimming exercise was 50 minutes, five days a week, for 6 weeks, following a method used in a previous study with some modifications . The water bath was 43 cm in depth and was 102 cm in diameter and 47 cm in height, and the water temperature was between 28 - 32. rg1 was provided kyung hee hanbang bio, inc ., (korea) and used in a powder form . It was administered three times within 24 hours including once in the morning and once in the afternoon of the next day when the exercise groups (ep, erg) completed each of the exercises, and 30 minutes prior to measuring aerobic exercise capacity the following morning . In order to evaluate aerobic exercise capacity, swimming time to exhaustion the testing environment was the same as the environment used for the swimming exercise and a weight, corresponding to 3% of the body weight, was attached to the tail . Exhaustion was determined as the time when the animal was unable to rise to the surface within 10 seconds after sinking to the bottom . Immediately after completion of the aerobic capacity test its weight was measured immediately after isolation and was quick - frozen in liquid nitrogen and stored at -70 until analysis . 300 l purehelix rna extraction solution (nanohelix, korea) was added to a microtube to which approximately 80~100 mg muscle tissues were added and completely grinded . Then an additional 700 l purehelix rna extraction solution was added to the sample following 15~30 seconds of vortexing and stored at room temperature for 5 minutes . In order to remove non - homogenized materials, it was centrifuged at 12,000 rpm for 5 to 10 minutes at 4. 200 l chloroform was added to every 1ml rna extraction solution, followed by inversion for 15 to 30 seconds and the sample was kept for 2 - 15 minutes at room temperature and then centrifuged again at 12,000 rpm for 10 minutes at 4. 500 l of the upper layer of the supernatant containing rna was taken from the microtube which was separated by centrifugation and transferred to a new sterilized microtube . Isopropyl alcohol, corresponding to 0.6% of the volume transferred to the microtube, was added, and then it was kept on ice for 5 - 10 minutes, followed by centrifugation at 12,000 rpm for 10 - 15 minutes at 4. after centrifugation, the supernatant was discarded and the pellet was rinsed by vortexing with 75% ethanol made of rna free - water, followed by centrifugation at 12,000 rpm for 5 minutes at 4. for complete removal of ethanol, the sample was air - dried and then an appropriate amount of 0.1% diethyl pyrocarbonate (depc) water was added . Finally, it was kept at 55~60 for 10 - 15 minutes to extract the rna . The prepared samples were used to measure purity and concentration with a spectrophotometer using the absorbance at a260 and a280 . For measuring the expression level of cs mrna, helix cript one - step reverse transcription - polymerase chain reaction (rt - pcr) kit (nanohelix, korea) was used for cdna synthesis of each gene and rt - pcr was performed by mixing a fixed amount of primers, specimen samples and depc water, and placed the reaction mixtures in a pc3 - 20 primer thermal cycler (astec, usa). -actin, a housekeeping gene, was used as a reference gene for quantifying the amount between samples and the primer sequences used in the rt - pcr analysis are as shown in <table 1>. Analysis of cs activity in the plantaris was performed following the methods used in a previous study . Enzyme activity was calculated by the dilution factor and the molar extinction coefficient (13.6). A statistical software package spss pc for windows (version 22.0) was used in this study, and two - way anova was applied to each dependent variable to test for differences depending on rg1 intake and exercise status . If the primary effects among groups were statistically significant, the difference within each group was verified by conducting a t - test for independent samples . The level of statistical significance () for all statistical processes was set to less than 0.05 . Seven rats were assigned to each group and they went through adaptation periods for cage and swimming exercise for 10 days before the onset of treatment . After that, except for the subjects eliminated during the 6-week treatment period, the final 26 rats were divided into four groups, placebo (np, n=6), rg1 (nrg, n=6), exercise+placebo (ep, n=7), and exercise+rg1 (erg, n=7). The whole study was conducted after the animal care and the treatment procedures were approved by kyung hee university animal ethics committee (khuasp-15 - 21). Each swimming exercise was 50 minutes, five days a week, for 6 weeks, following a method used in a previous study with some modifications . The water bath was 43 cm in depth and was 102 cm in diameter and 47 cm in height, and the water temperature was between 28 - 32. it was administered three times within 24 hours including once in the morning and once in the afternoon of the next day when the exercise groups (ep, erg) completed each of the exercises, and 30 minutes prior to measuring aerobic exercise capacity the following morning . In order to evaluate aerobic exercise capacity, swimming time to exhaustion was measured by a method used in a previous study after modifications . The testing environment was the same as the environment used for the swimming exercise and a weight, corresponding to 3% of the body weight, was attached to the tail . Exhaustion was determined as the time when the animal was unable to rise to the surface within 10 seconds after sinking to the bottom . Immediately after completion of the aerobic capacity test, the animal was decapitated with a guillotine and the plantaris was sampled . Its weight was measured immediately after isolation and was quick - frozen in liquid nitrogen and stored at -70 until analysis . 300 l purehelix rna extraction solution (nanohelix, korea) was added to a microtube to which approximately 80~100 mg muscle tissues were added and completely grinded . Then an additional 700 l purehelix rna extraction solution was added to the sample following 15~30 seconds of vortexing and stored at room temperature for 5 minutes . In order to remove non - homogenized materials, it was centrifuged at 12,000 rpm for 5 to 10 minutes at 4. 200 l chloroform was added to every 1ml rna extraction solution, followed by inversion for 15 to 30 seconds and the sample was kept for 2 - 15 minutes at room temperature and then centrifuged again at 12,000 rpm for 10 minutes at 4. 500 l of the upper layer of the supernatant containing rna was taken from the microtube which was separated by centrifugation and transferred to a new sterilized microtube . Isopropyl alcohol, corresponding to 0.6% of the volume transferred to the microtube, was added, and then it was kept on ice for 5 - 10 minutes, followed by centrifugation at 12,000 rpm for 10 - 15 minutes at 4. after centrifugation, the supernatant was discarded and the pellet was rinsed by vortexing with 75% ethanol made of rna free - water, followed by centrifugation at 12,000 rpm for 5 minutes at 4. for complete removal of ethanol, the sample was air - dried and then an appropriate amount of 0.1% diethyl pyrocarbonate (depc) water was added . Finally, it was kept at 55~60 for 10 - 15 minutes to extract the rna . The prepared samples were used to measure purity and concentration with a spectrophotometer using the absorbance at a260 and a280 . For measuring the expression level of cs mrna, helix cript one - step reverse transcription - polymerase chain reaction (rt - pcr) kit (nanohelix, korea) was used for cdna synthesis of each gene and rt - pcr was performed by mixing a fixed amount of primers, specimen samples and depc water, and placed the reaction mixtures in a pc3 - 20 primer thermal cycler (astec, usa). -actin, a housekeeping gene, was used as a reference gene for quantifying the amount between samples and the primer sequences used in the rt - pcr analysis are as shown in <table 1>. Analysis of cs activity in the plantaris was performed following the methods used in a previous study . Enzyme activity was calculated by the dilution factor and the molar extinction coefficient (13.6). A statistical software package spss pc for windows (version 22.0) was used in this study, and two - way anova was applied to each dependent variable to test for differences depending on rg1 intake and exercise status . If the primary effects among groups were statistically significant, the difference within each group was verified by conducting a t - test for independent samples . The level of statistical significance () for all statistical processes was set to less than 0.05 . During the 6-week experimental period, the body weight of the experimental animals was measured once a week at the same time of the day and the results are shown in <fig . The mass of the plantaris was expressed as relative weight by incorporating body weight (mg / g). The effect of 6-week swimming exercise and short - term rg1 treatment on muscle mass was compared and are shown in <fig . 2>, the mean was 0.489mg / g and neither the effect of interaction nor the primary effect between groups was observed based on treatment . 3>. For the level of cs mrna expression in plantaris, the primary effect appeared in the exercise groups ep and erg (p<.001). The primary effect was analyzed and the results showed that ep and erg showed a significantly higher level of mrna expression than the placebo group np (p<.01, p<.001). For the level of cs activity, neither the effect of the interaction, nor the primary effect between groups, was observed depending on treatment <fig . 4>. The results of the swimming time to exhaustion test are shown in <fig . 5>, and the primary effect depending on treatment appeared in ep and erg (p<.001). Ep showed 1,65536sec and erg showed 2,21370sec, which exhibited 2.35 and 3.14 times longer exercise time, respectively, compared with np (p<.01, p<.001). During the 6-week experimental period, the body weight of the experimental animals was measured once a week at the same time of the day and the results are shown in <fig . The mass of the plantaris was expressed as relative weight by incorporating body weight (mg / g). The effect of 6-week swimming exercise and short - term rg1 treatment on muscle mass was compared and are shown in <fig . 2>, the mean was 0.489mg / g and neither the effect of interaction nor the primary effect between groups was observed based on treatment . 3>. For the level of cs mrna expression in plantaris, the primary effect appeared in the exercise groups ep and erg (p<.001). The primary effect was analyzed and the results showed that ep and erg showed a significantly higher level of mrna expression than the placebo group np (p<.01, p<.001). For the level of cs activity, neither the effect of the interaction, nor the primary effect between groups, was observed depending on treatment <fig . 5>, and the primary effect depending on treatment appeared in ep and erg (p<.001). Ep showed 1,65536sec and erg showed 2,21370sec, which exhibited 2.35 and 3.14 times longer exercise time, respectively, compared with np (p<.01, p<.001). In this study, the effect of acute uptake of rg1 following 6-weeks of swimming exercise on the capacity of aerobic exercise was examined in 8-week - old male sd rats . Body weight was measured once a week in the same time of the day during the 6-week experimental period except for the adaptation period, in which no significant difference between groups was found during the treatment period depending on treatment . Therefore, it is thought that 6-week swimming exercise and short - term intake of rg1 did not affect the total body mass of sd rat at all . Due to the muscle fiber type composition of the plantaris that it is mainly of type ii muscle fibers, it was expected that the changes in the capacity of aerobic exercise caused by long - term swimming were likely to be greater than other hind - limb muscles, which was the reason why the plantaris was chosen for this study . There was no significant difference in the mass of the plantaris relative to the total body weight based on treatment . The probability that the mass of the plantaris changed significantly by aerobic exercise, especially by the modified 6-week swimming exercise protocol employed in this study has never been suggested in the previous studies, which is consistent with our findings . No previous studies have reported changes in the mass of the plantaris caused by intake of ginsenoside including rg1 and in particular, it is thought that morphological changes including additional mass were unlikely to be induced by acute uptake of rg1 following swimming . In conclusion, long - term aerobic exercise, immediately followed by acute administration of rg1 did not result in morphological changes in the plantaris . And this result is grounds for an interpretation that the increase in the exercise duration time, which is to be discussed later, was caused by changes in biochemical factors . The level of cs mrna expression was measure by rt - pcr and the results showed that the level of mrna expression was significantly higher in ep and erg than in np . The increase of cs mrna expression in the plantaris caused by long - term aerobic exercise has been confirmed by a previous study . In addition, a tendency toward an increase of mrna expression caused by rg1-intake alone was observed, but without significance . So far, no previous study examined the level of cs mrna expression depending on rg1 treatment . However, the results presented in this study are consistent with previous studies that long - term exercise stimulated and increased cs mrna expression in the plantaris, which was detected even in six weeks after the exercise, and rg1-intake alone was likely to affect cs mrna expression . However, considering that there was a tendency of reduced or constant level of cs mrna expression after a certain amount of time as shown in previous studies, the point that the combined treatment did not bring additive effects can be interpreted as that it suggests the parts to be studied in the future . There was no significant difference in the cs activity in the plantaris muscle tissue depending on treatment . Cs activity has been used as a biomarker representing the mitochondrial capacity and naturally representative of the capacity for endurance exercise of the skeletal muscle caused by long - term endurance exercise in both animals and humans . In a previous study targeting human, rg1 (capsule 5 mg) isolated from panax notoginseng was treated two times, one hour before cycling and the previous night, and then the cs activity was shown to be elevated in the blood in three hours after cycling . However, in this study, which measured the cs activity in the plantaris muscle tissue, erg showed the highest activity, but it was lower than the activity shown in previous studies, and there was no significant difference between treatments . This suggests that though the dose of rg1 treated within 24 hours stimulated rg1 production, the protein synthesis caused by mrna production may have been affected by a time factor, thus it did not influence the enzyme activity enough . In swimming time to exhaustion, results showed that compared with np and nrg, ep and erg exhibited significance differences with swimming for longer periods of time (more than 2-folds and 3-folds longer, respectively). Erg showed the additive effect by acute intake of rg1 in addition to the changes caused by long - term exercise . A previous study conducted on cycling time to exhaustion in humans using rg1 treatment and the results of the study showed that the placebo group showed 31.85.0min and rg1 treatment group showed 38.36.7min, which was significant, and the short - term treatment of rg1 was found to give a positive effect on aerobic capacity . In another previous study on ginseng treatment, graded exercise was performed after 3-weeks of treatment with panax ginseng in humans, and the results showed that although no significant difference was observed, the panax ginseng treatment group showed longer exercise time . Apart from this, many previous studies related to ginseng and exercise reported that administration of ginseng or rg1 could give a positive impact on improvement of exercise capacity [3 - 7,17]. The results from many studies were obtained using long - term intake of ginseng or ginsenoside, whereas short - term administration studies like this one were extremely rare . To sum up, acute intake of rg1, showed an additive effect on improvement of aerobic exercise capacity, which suggests that many attempts for developing new methods for utilizing efficacy ingredients mainly from ginseng and ginsenoside are necessary in the future . Considering that there are few studies available, and that the reported results are not consistent, not only are the mechanisms of action of a single active ingredient such as rg1, but also the field research such as doses and timing are required additionally . In this study, whether acute uptakes of rg1 following 6-week swimming can give any additive benefit on aerobic exercise capacity in sd rats was examined . Although cs mrna production increased in exercise group (ep) and combined treatment group (erg), there was no significant differences in the cs activity, which indicated that production of a specific mrna and the protein it encodes do not have a direct relationship to the temporal and positional differences . However, acute uptakes of rg1 following long - term swimming was shown to provide an additive effect on aerobic exercise capacity when using the swimming time to exhaustion test . This posits that a short - term intake of rg1 can be used as ergogenic aids . It also notes the necessity of additional research on the mechanism of action and on the details of application protocols.
Diabetes mellitus is associated with aggressive vascular abnormalities in human subjects, and atherosclerosis is regarded as the leading cause of morbidity and mortality in diabetic patients . Microalbuminuria has a strong prediction of both the development of diabetic nephropathy and subsequent atherosclerotic vascular dysfunction [2, 3]. The previous epidemiologic study has proved the predictive value of microalbuminuria for atherosclerotic vascular disease in the patients of type 2 diabetes . Several biochemical parameters including soluble vascular cell adhesion molecule1, sialic acid, c - reactive protein, and fibrinogen have been proved to be significantly associated with microalbuminuria [57]. And these findings may support a hypothesis that microalbuminuria reflects generalized vascular damage which may promote atherosclerosis [8, 9]. High - frequency b - mode ultrasonography is a noninvasive method of detecting carotid artery wall and provides measurement of intima - media thickness (imt) and presence of plaques [10, 11]. The increased imt can predict future events of silent brain infarction and coronary heart disease in the patients of type 2 diabetes mellitus [13, 14]. But the previous reports showed the inconsistent associations among imt, plaque, risk factors, and clinical disease [1518]. And which one is a more powerful predictor of vascular outcomes, imt or plaque, is still in controversy [18, 19]. In addition, the reported results of the relationship between microalbuminuria and carotid imt is also different [20, 21]. Therefore, in this study we sought to clarify the relationship between microalbuminuria and markers of carotid atherosclerosis including imt and plaque in type 2 diabetic patients . The study included 250 patients of type 2 diabetes mellitus at the department of endocrinology of the second affiliated hospital of dalian medical university . The ethics committee of the second affiliated hospital of dalian medical university approved the study . All patients gave their informed consent to participate in the study . According to the level of urinary albumin excretion rate (uaer), 250 patients of type 2 diabetes mellitus were divided into two groups: normoalbuminuria group (uaer <30 mg/24 h; 130 cases, 66 males and 64 females; mean age, 56.45 9.35 years; age range, 2976 years; diabetes duration, 7.57 5.53 years; treatment with diet or oral drugs) and microalbuminuria group (30 mg/24 h <uaer <300 mg/24 h; 120 cases, 62 males and 58 females; mean age, 57.67 11.12 years; age range, 4180 years; diabetes duration, 8.00 5.12 years; treatment with diet or oral drugs). Medical history was obtained and physical examination was performed in all patients . Type 1 diabetes mellitus, hypertension, history of ischemic heart disease, renal impairment (serum creatinine> 150 the clinical conditions that could cause transient elevations in urinary albumin excretion, such as exercise, urinary tract infection, febrile illness, were also excluded . Carotid artery ultrasonography was performed by an experienced specialist physician who was specifically trained for the vascular ultrasonography . A real - time ultrasound scanner was used: hitachi eub 7500 with a linear 315 mhz probe (hitachi medical systems, tokyo, japan). The patients were examined in the supine position with the head turned 45 contralateral to the side of scanning . Imt was defined as the distance between the lumen - intima and the media - adventitia ultrasound interfaces . The imt on the far wall of the bilateral common carotid artery about 10 mm proximal to the bifurcation of the carotid artery was measured manually as previously described [22, 23]. Three measurements on both sides were performed for each patient and the mean value was obtained for analysis . A high degree of reproducibility (a mean difference in cimt: 0.020 mm) was shown in paired cimt measurements in the same arteries . The presence of plaque was defined as an area of focal wall thickening> 50% greater than surrounding wall thickness confirmed by marking and comparing plaque thickness with the thickness of the surrounding wall during scanning by electronic calipers . Furthermore, the plaques were classified into three types: calcified plaques (hyperechogenic), dense plaques (less hyperechogenic than calcified lesions), and soft plaques (isoechogenic in comparison with blood), based on their echogenic properties according to the criteria established by johnson et al . . The following laboratory parameters were obtained: total cholesterol (tc), triglyceride (tg), low density lipoprotein (ldl), high density lipoprotein (hdl), hemoglobin a1c (hba1c), fasting plasma glucose (fbg), and urinary albumin excretion rate (uaer). Serum concentrations of tc, tg, ldl, hdl, and fbg were measured by enzymatic method . Hba1c was measured by high performance liquid chromatography (bro - rad company, usa). Body mass index (bmi) was calculated as weight in kilograms divided by height in meter squared . Pearson's chi - square () test was used to compare groups regarding categorical variables . Correlation analysis including pearson's for continuous and spearman's for discrete variables and multiple linear stepwise regression analysis was used to show the influences of variables on imt . Patients of the microalbuminuria group with elevated uaer had higher fbg, bmi, waist and hip circumference, triglycerides, hba1c, and imt than those of the normoalbuminuria group with normal uaer (p <0.05 for all; table 1, figure 1). The plaque incidence rate and plaque type rate (soft, dense, and calcified plaques) between two groups were shown in table 2 . There were no significant difference in plaque incidence rate and plaque type rate between normoalbuminuria and microalbuminuria groups (p <0.05 for all). In both normoalbuminuria and microalbuminuria groups, and the rate of soft plaque was higher than that of dense and calcified plaques . In detail, in normoalbuminuria groups, soft plaques rate (66.67)> dense plaques rate (25)> calcified plaques rate (8.33), and in microalbuminuria group, soft plaques rate (68.42)> dense plaques rate (24.21)> calcified plaques rate (7.37) (table 2). In univariate analysis, imt was positively and significantly associated with age (r = 0.265, p <0.05), waist circumference (r = 0.263, p <0.05), body mass index (r = 0.285, p <0.05), systolic blood pressure (r = 0.276, p <0.05), uaer (r = 0.359, p <0.05), hba1c (r = 0.462, p <0.05), and duration of diabetes (r = 0.370, p <0.05). In multiple stepwise regression analyses, age, body mass index, systolic and diastolic blood pressure, waist and hip circumference, uaer, fbg, plasma hba1c concentration, serum concentrations of triglycerides and total, hdl and ldl cholesterol, current smoking, and duration of diabetes mellitus were included in the model as independent variables . Uaer and hba1c were appeared to be significantly associated with imt (p <0.05 for all) (table 3). In the present study, we found that the values of imt of type 2 diabetic patients with microalbuminuria was significantly higher than those without microalbuminuria . The results indicated that microalbuminuria was related to atherosclerosis in the early stage of diabetic nephropathy . But the mechanism underlying the relationship between microalbuminuria and atherosclerosis in type 2 diabetic patients is still unknown . Results showed that microalbuminuria was found to be associated with carotid atherosclerosis in middle aged individuals . But the subjects enrolled in this study were not only limited to the diabetic patients . There was a hypothesis that increased uaer could reflect a generalized vascular dysfunction which was caused by structural alterations, such as a reduction in the density of heparan sulfate - proteoglycan (hs - pg) and/or the sulphation of hs within the extracellular matrix of the glomerular basement membrane and vascular wall [8, 9]. It is a normal component of glomerular basement membrane, endothelial vascular surface, and basement membrane of vascular smooth muscle cells . Furthermore, many proteins, such as lipoprotein lipase, tissue factor pathway inhibitor, platelet factor 4, and antithrombin iii, are anchored to the vascular wall through interaction with the chains of hs - pg, which may enhance albuminuria and processes involved in atherogenesis [9, 2628]. Stehouwer et al . Found that microalbuminuria was linearly associated with impaired endothelium - dependent, flow - mediated vasodilation in elderly individuals without and with diabetes . It is possible that endothelial leakiness, as reflected by uae, is in part a primary and possibly genetically determined vascular risk factor, or that it mirrors the endothelial dysfunction featuring the atherosclerotic process or arises from the action of yet unknown risk factors . Also, the previous study results showed that endothelial dysfunction assessed by brachial artery flow - mediated dilation (fmd) was associated with urinary albumin excretion (uae) and was interrelated with carotid imt in type 2 diabetic patients with microalbuminuria . In the same time, our study showed that the value of hba1c in type 2 diabetic patients with microalbuminuria was significantly higher than that in patients with normoalbuminuria . The result indicated that hba1c maybe played an important role in the relationship between carotid atherosclerosis and microalbuminuria . Clinically, hba1c is now used to assess glycemic control in patients of diabetes mellitus, and it is regarded as a useful method of screening and diagnosing diabetes . And hba1c has been accepted as the best marker for diabetic microvascular complications . Moreover, hba1c is associated closely with advanced glycation end products (ages). The previous study showed that ages are widespread in the diabetic vascular system and contribute to the development of atherosclerosis . Ages contribute to many microvascular and macrovascular complications through the formation of bridging between molecules in the basement membrane of the extracellular matrix by joining the receptor for advanced glycation end products (rage). Concerning microalbuminuria, it was reported that the accumulation of ages in the glomerular and tubulointerstitial spaces correlates with the severity of diabetic nephropathy . In addition, the results showed that there were no significant difference in plaque incidence rate between normoalbuminuria and microalbuminuria groups . Our results showed that there were significant differences of plaque types in both normoalbuminuria and microalbuminuria groups . And the incidence rate of soft plaques was the most compared with dense plaques and calcified plaques . It is known that the presence of carotid plaques correlates with an increase in the risk of stroke and cerebral infarction, and softer plaques are more likely to be unstable or vulnerable plaques when compared to calcified plaques [3538]. Second, some type 2 diabetic patients have already been treated for diabetes and hyperlipidemia which may lead to inaccuracy of the results . Our data show that there is a significant association between microalbuminuria and imt which is regarded as the early sign of carotid atherosclerosis in type 2 diabetic patients . Routine screening of carotid artery imt and plaque presence in type 2 diabetic patients with microalbuminuria is necessary . It helps us not only to detect early atherosclerosis but to prevent further development of diabetic nephropathy and cardiovascular events by applying more intensive therapy
Digital radiograph or radiovisiography was first described in 1987 and was commercially introduced by trophy radiologie in collaboration with mouyen12 in 1993 . Three systems are employed for radiovisiography: the ccd sensor (charge - coupled device), cmos sensor (complementary metallic oxide sensor), and psps (psps phosphor storage plate optical plate); the latter includes the digora, digident, denoptix and den ortix systems11 . However, some doubts remain in the use of radiovisiography based on the optical plate system as to the durability of the plate3, image quality according to the processing delay1,2,14, and storage conditions10 . No study has yet investigated the influence of utilization of opaque cases on the quality of digital image . This ex vivo study evaluated the quality of digital radiographic images obtained with the digora system according to the processing delay and maintenance of optical plates in either opaque (supplied with the system) or transparent protective plastic cases during this period . The study was conducted on a dry human mandible fixed on an acrylic resin base . A plastic tube was fixed frontally to the mandible to standardize the position of the x - ray source, thus standardizing the vertical and horizontal angles (figure 1). A groove was prepared on this resin base to standardize the position of the optical plate . Radiographs were obtained from the mandibular molar region by utilization of optical plates with an x - ray unit (gnatus model xr 6010; gnatus, ribeiro preto, sp, brazil) set at 60 kvp and 10 ma, with open tube, total filtration of 1.5 mm al, exposure time of 0.3 s, and optical plate of the digora system (soredex, orion corporation, finland). Two groups were constituted for x - ray exposure: in group a, the optical plate was inserted and sealed in the opaque plastic case supplied by the manufacturer and kept as such until processing; in group b, the optical plate was stored in a transparent plastic case (figure 2). The optical plates were processed in the digora scanner immediately and 5, 60 and 120 min after x - ray exposure, and were transferred to the computer for analysis of digitized images . Analysis was performed directly on the computer screen by three examiners using the digora for windows software . The images were analyzed as to brightness, contrast and resolution of tooth structures (enamel, dentin, root and pulp cavity) and periapical structures (periodontal space, cortical bone, alveolar bone), which received scores 0 to 2, as follows: 0- poor image quality; 1- good image quality; 2- excellent image quality . Data were submitted to the kruskal - wallis non - parametric test, and comparison of results between opaque and transparent cases were submitted by the mann - whitney test . Table 1 presents the scores assigned by examiners to the images, according to processing delays and utilization of opaque or transparent plastic cases . There was statistically significant difference (p<0.05) regarding the processing delays, namely immediate, 5 and 60 min with utilization of opaque case (table 2). This difference was observed between the 120-min delay and the other periods (table 3). No statistically significant difference (p>0.05) was observed among processing delays with utilization of transparent case (table 4). Comparison of results between opaque and transparent cases did not reveal significant differences (p>0.05) (table 5). 10.05882; chi - square with 3 degrees of freedom; probability = 0.018072 (significant) u=5.00000000;exact probability = 0.150794; normal approximation: z=1.96396101; probability = 0.04953461 hc= 5.164999; chi - square with 3 degrees of freedom; probability = 0 . Digital radiography was introduced to dental practice with a view to replace the conventional radiography due to the shorter exposure to radiation, achievement of high - quality images, possibility of adjustments with aid of software, and comparable reliability to conventional radiography, for both endodontic diagnosis and treatment3,57, the main disadvantage of the optical plate system is the need of additional time for processing and possible loss of quality when the sensitized optical plate is exposed to light . Some authors have emphasized that, after exposure to x - ray, the optical plates should be processed within 1 h in order to avoid loss of image quality1,2 . Other authors believe that the plates can be processed within 6 h if stored in appropriate cases10 . In the present study, a processing delay of 120 min caused a mild reduction in image quality, yet without compromising the quality of diagnosis (table 1). It should be highlighted that the images were not altered as to the brightness and contrast provided by the system, being analyzed as produced on the computer screen . Together with the digora system, the manufacturer supplies opaque plastic cases that offer protection against contamination and the deleterious effect of light . Images of optical plates maintained in the original opaque cases after exposure to x - ray maintained their image quality up to 120 min (table 2), with significant difference between the 120- min processing delay and the other periods (table 3). When the optical plates were maintained in transparent cases, there was also a progressive reduction of image quality (table 1), which was more accentuated at 120 min (table 4), though without statistical difference among periods . This is due to the fact that the optical plate protected with transparent cases is subjected to the continuous action of light, with progressive loss of image quality . However, images obtained with optical plates protected with both opaque and transparent cases and with processing delays of up to 120 min provided good quality for diagnosis . The findings of the present study revealed that the processing delay of 120 min for the digora system caused a reduction in image quality, yet without interfering with the quality of diagnosis . The opaque case supplied by the system's manufacturer provided better protection to the optical plate than the transparent case.
The weissella species are gram - positive, non - spore - forming, heterofermentative, nonmotile, and irregular or coccoid rod - shaped organisms . Members of the genus weissella have been isolated from a variety of sources, such as fresh vegetables, fermented silage, meat, or meat products . Several lactic acid bacteria belonging to the genera weissella have been introduced to wheat sourdough baking for in situ production of exopolysaccharides . Weissella kimchii pl9023 was selected as a prebiotic as it mostly produced hydrogen peroxide which inhibited the growth and adherence of vaginal isolates of candida albicans, escherichia coli, staphylococcus aureus, and streptococcus agalactiae . Lactic acid bacteria (lab) that produce dextrans include various leuconostoc, streptococcus, and lactobacillus species . Patel et al . Reported the dextran - production ability of pediococcus pentosaceus for the first time . Additionally, dextran production has typically served as a phenotypic test in the identification of bacteria classified in the genus weissella . Reported industrially useful dextran - producing weissella confusa e392 which could be a suitable alternative to the widely used l. mesenteroides b512f in the production of linear dextran . First proposed by collins et al . On the basis of the results of 16s rdna phylogenetic analyses, the genus weissella encompasses a phylogenetically coherent group of lactic acid bacteria and includes twelve validated leuconostoc - like species, currently, including w. confusa (formerly lactobacillus confusus), w. minor (formerly lactobacillus minor), w. kandleri (formerly lactobacillus kandleri), w. halotolerans (formerly lactobacillus halotolerans), w. viridescens (formerly lactobacillus viridescens), weissella paramesenteroides (formerly leuconostoc paramesenteroides), w. hellenica, w. thailandensis, w. cibaria, weissella kimchii, weissella soil, and weissella koreensis . Alternative molecular biological approaches have been developed in place of classical phenotypic methods for the identification of weissella species . Such methods include soluble whole - cell protein pattern analyses, restriction pattern of ribosomal dna fatty acid analyses, random amplified polymorphic dna - pcr (rapd - pcr), denaturing gradient gel electrophoresis (dgge), and pcr targeting 16s/23s rrna gene spacer region . In the present study, a novel weissella species isolated from fermented cabbage was characterised up to genus and species level using 16s rdna - based sequence analyses . Its glucan formation capacity has been explored in detail and compared with that of leuconostoc mesenteroides nrrl b-512f . Fresh chopped cabbage was subjected to fermentation in 2.5% (w / v) nacl solution . One gram of fermented cabbage was ground to paste and mixed in 10 ml of saline (0.9% w / v) homogeneously in test tubes . One hundred microliter from all the dilutions of cabbage from 10 to 10 was taken and spread plated on petri plates of 1.7% (w / v) mrs agar with glucose as carbon source . Petri plates were incubated at 28c for 24 h. based on the higher - glucansucrase activity and glucan concentration determined (as described later), a microbe cab3 (named after its colony number) was isolated . The isolated bacterium was propagated as stab in mrs agar supplemented with sucrose as carbon source at 25c and stored at 4c . For long - term preservation, the colony morphology of isolates grown on mrs medium for overnight at 25c was observed directly and by light microscopy . Cell mobility and gliding movement were assessed by phase - contrast microscopy (1000x) using cells of mrs broth . The cell morphology of the selected isolate was examined by scanning electron microscopy (leo1430 vp, leo electron microscopy ltd ., cambridge, uk) operated at 10.0 kv . The catalase activity was determined by transferring fresh colonies from mrs agar to a drop of 5% (v / v) h2o2 on a glass slide . For the temperature tolerance of the microorganism, the growth of selected isolate was carried out using mrs broth at different temperatures, that is, 4c, 10c, 15c, 20c, 30c, 37c, and 42c for 2 days . For salt tolerance of the isolate, the growth was observed using mrs broth in the presence of 4.0% and 6.5% (w / v) of nacl incubated at 25c for 2 d. the production of glucan (slimy layer) by isolate cab3 from sucrose was observed on mrs agar in which glucose was replaced by sucrose . The strain cab3 was tested for its ability to ferment various carbohydrates using the method of kandler and weiss . From the overnight - grown mrs broth containing 2% (w / v) glucose as carbohydrate source, 50 l was inoculated in 5.0 ml liquid mrs medium lacking glucose but containing phenol red and other test carbohydrates to give a final inoculum to medium ratio of 1% (v / v). The acid production was recorded between 24 and 48 h. the acid production was indicated by a change in the colour of the phenol red indicator dye from red to yellow . The isolated strain cab3 was tested for susceptibility to 30 antibiotics using a standardized filter - paper disc - agar diffusion assay, to determine the drug susceptibility of microorganisms . The antibiotic tests were performed using commercially available antibiotic octadiscs containing amoxyclav (ac), cephalexin (cp), ciprofloxacin (cf), clindamycin (cd), cloxacillin (cx), erythromycin (e), tetracycline (t), ampicillin (a), carbenicillin (cb), cefotaxime (ce), chloramphenicol (c), co - trimazine (cm), gentamicin (g), norfloxacin (nx), oxacillin (ox), amikacin (ak), amoxycillin (am), bacitracin (b), cephalothin (ch), novobiocin (nv), oxytetracycline (o), vancomycin (v), penicillin - g (p), tobramycin (tb), cephaloridine (cr), kanamycin (k), lincomycin (l), methicillin (m), norfloxacin (nf), and oleandomycin (ol) from hi - media pvt . Ltd . The bacterial cell pellet was lysed using a solution containing guanidium thiocyanate (a chaotropic agent) and sds (a detergent), to extract dna . This lysis solution was used to disrupt the cell, remove proteins and polysaccharides, and partial hydrolysis of rna . The genomic dna was extracted by geneitm genomic dna extraction kit (bangalore genei pvt . Ltd . ). Dna was then precipitated using alcohol and washed with 70% (v / v) alcohol to remove contaminants . Dna pellet was solubilized in sodium acetate buffer at ph 5.5 added to a final concentration of 0.3 m in isopropanol at higher temperature (5055c), to increase the solubility of genomic dna . The extracted dna was purified using ultrapure prep kit (kt83b, bangalore genei, india). Genomic dna was purified in a gravity flow column using elution buffer, followed by treatment with lysozyme, proteinase k, and rnase a supplied with the kit . The quality of purified dna was evaluated on 1.2% agarose gel, a single band of high - molecular - weight dna was observed . The universal 16s rdna primers, forward primer 8f (5agttgatcctggctcag3), and reverse primer 1492r (5accttgttacgactt3) were used for the polymerase chain reaction (pcr). The pcr amplification was carried out in a reaction mixture containing ~10 ng genomic dna as template, 1 l dntp mix (2.5 mm each), 100 ng/l each of forward and reverse primer, 1x taq dna polymerase assay buffer (10x), 3u taq dna polymerase enzyme (bangalore genei ltd.,bangalore, india), and distilled water enough to make up the volume to 50 l reaction mixture . Amplification conditions were 5 min initial denaturation at 94c, 30 s denaturation at 94c, 30 s of primer annealing at 54c, 1 min elongation at 72c for 35 cycles, and a final extension of 10 min at 72c . The reactions were carried out in a thermal cycler (applied biosystems, model abi 2720). Fifteen l of pcr amplified product was electrophoresed on 1.2% (w / v) low - eeo agarose gel in 1x tbe buffer (45 mm tris - borate, ph 8.3, and 1 mm na 2 edta) at 100 v for 2 h. the gel was stained with ethidium bromide in a final concentration of 0.5 g / ml, visualized, and photographed under uv light . The amplified 16s rrna gene from the isolate was eluted and purified from the gel slice using the geneipure tm gel extraction kit (qiagen). Forward and reverse dna sequencing reaction of pcr amplicon was carried out with 8f and 1492r primers using bdt v3.1 cycle sequencing kit on abi 3730xl genetic analyzer . Consensus sequence of 1288 bp of 16s rdna gene was generated from forward and reverse sequence data using aligner software . The 16s rdna gene sequence of the isolate cab3 was used to carry out blast with the nr database of ncbi genbank database . Based on maximum identity score, first ten sequences were selected and aligned using multiple alignment software program clustalw . Distance matrix was generated using rdp database, and the phylogenetic tree was constructed using mega 4 . The enzyme assay was carried out in 1 ml reaction mixture containing 5% (w / v) sucrose, 20 mm sodium acetate buffer (ph 5.4), and 20 l cell - free supernatant . The enzyme activity was determined by estimating the released reducing sugar by nelson and somogyi method . The glucansucrase was produced in the enzyme production medium as described by tsuchiya et al . . Fermentations were carried out in triplicate sets of 60 ml enzyme production medium in a 250 ml erlenmeyer flask incubated at 25c under shaking condition at 180 rpm . The samples (1 ml) were withdrawn at indicated time intervals and centrifuged at 8000 g for 10 min at 4c to separate the cells . Weissella confusa was grown at various temperatures: 22c, 25c, 28c, 30c, 32c, 37c, and 40c in the flasks as described previously in an orbital shaking incubator at 180 rpm to determine the optimum incubation temperature for the maximum enzyme production . The culture (1.0 ml) was withdrawn at the indicated time intervals and centrifuged at 8000 g for 10 min at 4c to pellet out the cells . The production glucansucrase was compared under shaken - flask condition with the static flask culture at 25c in triplicate sets of 60 ml enzyme production medium in 250 ml erlenmeyer flasks . The samples (1.0 ml) were withdrawn at indicated time intervals and centrifuged at 8000 g for 10 min at 4c to pellet out the cells . The cell - free extract was analysed for enzyme activity and protein concentration as described earlier . The polysaccharide content of the isolated strain (cab3) was determined by phenol - sulphuric acid method in a microtitre plate . The isolated strain was grown in 60 ml liquid medium described by tsuchiya et al . At 25c and 180 rpm up to 32 h. the samples (1 ml) were withdrawn at regular intervals . To 200 l of the culture supernatant, three volumes of the prechilled ethanol were added and centrifuged at 12,000 g. the supernatant was discarded, and the precipitate was resuspended in 200 l distilled water . The crude 50 ml cell - free supernatant with enzyme activity 6 u / ml and specific activity 1 u / mg was subjected to purification by fractionation using peg-400 (33%, w / v). To confirm the existence of glucansucrase, the pas staining of the sucrose- and raffinose - incubated gel was carried out on 7% nondenaturing sds - page . The electrophoresis was performed on a mini gel unit (biorad) using 1.5 mm thick gels, following the method of . After run, the gel was treated thrice with a solution containing 20 mm sodium acetate buffer, ph 5.4, 0.1% (w / v) triton x-100, and 0.005% (w / v) calcium chloride for 20 min to remove sds . Then, the gel was incubated with 5% (w / v) sucrose / raffinose solution in 20 mm sodium acetate buffer, ph 5.4 for 1012 h. following incubation, the gel was washed twice with 75% (v / v) ethanol for 20 min and incubated in solution with 0.7% (w / v) periodic acid in 5% (v / v) acetic acid for 20 min at room temperature . The gel was then washed thrice with 0.2% (w / v) sodium bisulfate in 5% (v / v) acetic acid solution and finally stained with schiff's reagent (0.5% w / v basic fuchsin, 1% (w / v) sodium bisulfate, and 0.1 n hcl) until the discrete magenta bands appeared within the gel . The purified enzyme having 10.4 u / mg specific activity (1.0 mg / ml) was used for further optimization of assay conditions . The ionic strength of the buffer was varied from 10 mm to 400 mm . The assay was carried out in 1 ml reaction mixture containing 5% (w / v) final sucrose concentration, in sodium acetate buffer (ph 5.4) at 30c for 15 min . To study the effect of varied ph on enzyme activity, the ph of buffer was varied from 4 to 7 in 1 ml reaction mixture containing 5% (w / v) final sucrose concentration in 20 mm sodium acetate buffer at 30c for 15 min . The enzyme assay was done in 5% (w / v) sucrose solution in 20 mm sodium acetate buffer (ph 5.4) for 15 min . Based on higher glucansucrase activity and glucan concentration determined, a microbe cab3 was isolated from the fermented cabbage . The isolated culture was identified according to their morphological, cultural, physiological, and biochemical characteristics [37, 38]. The tests used were gram reaction, production of catalase and growth at different temperatures and salt concentrations, and acid production from carbohydrates (2% w / v). Lactococcus spp ., and leuconostoc spp . By its biochemical and physiological properties like arginine deamination, esculin hydrolysis, the microorganism was identified by comparing the results with those from the literature (table 1). The results of the comparison showed that the isolated strain cab3 has the same characteristics as w. confusa (table 1, column 5, which is, 4). From scanning electron microscopy, the isolate cab3 was found to be phenotypically homogeneous with irregular short rod cells in pairs or chains with a width and length of 0.5 - 0.6 m and 1.21.4 m, respectively (figure 1). The colony produced slimy layer when grown on mrs agar plate was supplemented with sucrose . The strain could grow in presence of 4.0%, 5.0%, 6.0%, and 6.5% (w / v) nacl, but not beyond 8.0% nacl . The strain very efficiently utilised cellobiose, galactose, maltose, ribose, sucrose, and xylose but poorly fermented mellibiose, raffinose, and trehalose which was in accordance with fermentation pattern of weissella confusa reported earlier . The cab3 did not utilize rhamnose which is also characteristic of weissella sp . . The isolate cab3 was sensitive to chloramphenicol, erythromycin, and tetracycline and moderately resistant to gentamicin, kanamycin, norfloxacin, and vancomycin which is characteristic of weissella confusa . 16s rrna gene sequence analyses after pcr amplification was performed for identifying the isolate cab3 . The profiles obtained by pcr amplification allowed the identification of the isolate at both genus and species levels . The amplified product of 16s rrna showed a single band of 1,500 bp (figure 2). Forward and reverse dna sequencing reaction of pcr amplicon was carried out with 8f and 1492r primers using bdt v3.1 cycle sequencing kit on abi 3730xl genetic analyzer . The consensus sequence of 1288 bp of 16s rdna gene was generated from forward and reverse sequence data using aligner software (figure 3). The 16s rrna sequence was compared with reference bacteria from the national centre for biotechnological information (ncbi) genbank (http://www.ncbi.nlm.nih.gov/) and ribosomal database project (rdp). The homology in sequences identified by the above methods was used to find out common ancestry . The bootstrap consensus tree inferred from 500 replicates was taken to represent the evolutionary history of the taxa analyzed . The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates) is shown next to the branches . The evolutionary distances were computed using the kimura 2-parameter method and are in the units of the number of base substitutions per site . All positions containing gaps and missing data were eliminated from the dataset (complete - deletion option). The isolate cab3 and the strain weissella confusa imau:10190 (genbank accession number gu 138518.1) clustered together (figure 4) which confirmed the isolate to be weissella confusa . Hence, the isolate cab3 was identified as weissella confusa and assigned the genbank accession number gu138518.1 . A bioinformatic tool, genedoc software, version 2.7.1, was used for more 16s rrna gene sequence investigation of the other closely related weissella sp . The partial sequence (1288 nucleotides) of 16s rdna of weissella confusa (cab3) was 100% similar to 16s rrna genes from other related strains of weissella sp . In ncbi (temperatures ranging from 22c to 40c were studied for the production of enzyme under shaking at 180 rpm (figure 5). At 25c, the activity achieved was maximum (6.2 u / ml), at a temperature lower than 25c, the cell growth was slow which might be the cause for lower enzyme activity as shown in figure 5 . At higher temperature, the enzyme activity decreased which might be due to the deactivation of the enzyme at higher temperatures . Shaking condition significantly favoured the enzyme production giving 6.1 u / ml enzyme activity which was 1.5 times higher than the enzyme activity observed under static condition (4.1 u / ml) as shown in figure 6 . The maximum enzyme activity was achieved 4 h later in case of static flask culture . Figure 7 shows a complete fermentation profile of the new strain of weissella confusa (cab3). The fermentation profile of the new strain of weissella confusa (cab3) was compared with other lactic acid bacterial strains using the same medium composition and the parameters compared are listed in table 2 . It was reported that 23c temperature under static flask culture condition was optimum for the production of dextransucrase from l. mesenteroides nrrl b-512f, and 25c temperature under shaking condition was found to be optimum for l. mesenteroides nrrl b-640, whereas, for weissella confuse, the temperature 25c and shaking conditions were optimum . From the results, it was clear that the enzyme activity (6.1 u / ml) from weissella confusa was 50%, 27%, and 65% higher than the enzyme activity from l. mesenteroides nrrl b-512f (4.1 u / ml), l. mesenteroides nrrl b-640 (4.8 u / ml), and p. pentosaceus, respectively, as shown in table 2 . The cell growth obtained in all strains after 12 h was similar . There was a sharp decrease in the ph of the broth with weissella confusa after 12 h (figure 7), when the maximum activity was achieved, whereas the ph drop was much lower from the point where the maximum enzyme activity was observed for l. mesenteroides nrrl b-512f . The ph range for maximum enzyme production for weissella confusa was narrow 5.25.6, whereas for l. mesenteroides nrrl b-512f, l. mesenteroides nrrl b-640, and p. pentosaceus, it was 6.06.5, 4.45.9, and 4.0 - 5.0, respectively . The cell - free supernatant of isolated strain weissella confusa (cab3) gave glucan concentration of 34 mg / ml (figure 7). This was very high as compared to other lactic acid bacteria such as from l. mesenteroides nrrl b-512f (6.9 mg / ml), l. mesenteroides nrrl b-640 (7.0 mg / ml), and pediococcus pentosaceus (10.2 mg / ml). The glucan concentration of the strain can be further increased by optimizing the medium composition and culture conditions . The enzyme was purified from cell - free supernatant with 1.0 u / mg specific activity . The fractionation by 33% (w / v) peg-400 gave 10.4 u / mg specific activity with 10-fold purification and 26% overall yield . The purified enzyme showed, approximately, 180 kda molecular size on the nondenaturing sds - page gel when stained with coomassie brilliant blue (figure 8; lane 2). The pas staining of the gel incubated in sucrose (figure 8; lane 3) showed that the activity band corresponded to the presence of active form of the purified glucansucrase (figure 8; lane 2). No activity band after pas staining appeared after the incubation of the nondenaturing sds - page gel in raffinose (figure 8; lane 4), thus excluding the presence of fructosyltransferase . The partially purified enzyme was maximally active at the temperature 35c, at ph 5.4 in 0.2 mm sodium acetate buffer ph 5.4 (figure 9). The results showed that the glucansucrase activity was stable within the range of 1020 mm (figure 9). The enzyme lost 41% of its activity at 50 mm . Beyond 50 mm, the decrease in the enzyme activity was not significant with the increase of ionic strength . At ph below and above 5.4, a sharp decrease in enzyme activity was observed, which has been observed with other glucansucrases [16, 17]. The isolated bacterium (cab3) was identified at species and genus levels based on 16s rdna sequencing to be weissella confusa imau:10190 (genbank accession number gu 138518.1). The isolated strain could be very promising candidate for glucan production at industrial level as it has high glucan concentration (34 mg / ml). The physiological and biochemical characterisation was carried out to distinguish the isolate from other closely related lactic acid bacteria . Based on biochemical and physiological studies, the strain showed its relation with other weissella sp . The isolate weissella confusa (cab3) could not ferment mellibiose, raffinose, and trehalose, a common trait of weissella confusa . The partially purified enzyme was confirmed as glucansucrase by pas staining of nondenaturing sds - page gel incubated with sucrose . The presence of fructosyltransferase was ruled out based on the absence of the band in raffinose - incubated nondenaturing sds - page gel . The partially purified enzyme showed highest activity at 35c, when assayed in 20 mm sodium acetate buffer (ph 5.4). The wide applications of glucan in food, pharmaceutical, and cosmetics industries emphasize the importance of exploration of the new strains and characterization of their traits . This study reveals a novel high glucan producing bacterial isolate which could be a good alternative for glucan - production in the future.
Attention - deficit / hyperactivity disorder (adhd) affects a large number of children . In the united states, rates range from 5% to 6% of school - age children (guevara et al 2002; lesesne et al 2003).the illness is characterized by a triad of symptom clusters which include inattention, hyperactivity, and impulsivity . Usually the illness is first detected during the early school years (goldman et al 1998), but can persist during adolescence and even adulthood . If left untreated, adhd can be associated with a number of poor outcomes including academic failure, delinquency, and problems with substance abuse (barkley 1990; biederman et al 1996; dulcan 1997; wilens et al 2004). Their effect on disruptive behavior was discovered in 1937, when these drugs proved to increase compliance, improve academic performance, and reduce motor activity in hyperactive children (bradley 1937). It has proven efficacy on adhd symptoms (kimko et al 1999; greenhill et al 2002). Until the introduction of the d - mph (d - threo-(r, r)-mph, d - mph) in 2002, all clinically used mph formulations contained a racemic (1:1) mixture of d - threo-(r, r)-mph and l - threo-(r, r)-mph isomers (figure 1). The development of d - mph was based on the findings that similar improvement on sustained attention was achieved after treatment with d - equivalent doses of d - mph and d, l - mph, but not after l - mph (srinivas et al 1992). It was found that clinical efficacy was highly correlated with plasma concentrations of d - mph . The elimination of the l - isomer does not diminish the efficacy of an acute dose of mph (quinn et al 2004). The efficacy of the d - isomer was equivalent to the racemic preparation in ameliorating the target symptoms of adhd and increasing academic productivity . Thus, it was thought that the efficacy of mph resides in the d - isomer (lim et al 1986; patrick et al 1987; srinivas et al 1987, 1992). Other research demonstrated that besides clinical effectiveness, the undesired pressor and anorexic actions of d, l - mph also appear to reside in the d - isomer (srinivas et al 1992; anonymous 2002; scheffler et al 2003; teo et al 2004). D - mph not only appears to be the more active of the two enantiomers, but also better absorbed; plasma concentrations of d - mph are many times higher than the l - enantiomer after oral dosing of racemic mph (hubbard et al 1989; ding et al 1997; kimko et al 1999; modi et al 2000) or intravenous administration (kimko et al 1999). This is seen with both immediate - release (kimko et al 1999) and sustained - released (hubbard et al 1989; kimko et al 1999) forms of racemic mph . The pre - systemic metabolism and metabolic clearance of d, l - mph is also an enantioselective process which, too, contributes to markedly higher plasma concentrations of d - mph relative to l - mph (markowitz et al 2003; patrick et al 2005). It was also found that equimolar doses of d - mph yielded similar pharmacokinetics as those noted with administration of the d, l - racemic mixture (srinivas et al 1992). As a result, the d - mph product was developed, and approved by the fda for clinical use on august 31 2001 . The d - mph product appears to double the therapeutic potency of the racemic d, l - mph; when only half dose of racemic d, l - mph was used, d - mph produced similar pharmacokinetic parameters (cmax, tmax, and half - life) (anonymous 2002; keating and figgitt 2002; markowitz et al 2003). The administration of d - mph with food has no significant effect on bioavailability, but with racemic mph, tmax was delayed by 1 hour (teo et al 2004). In addition, a number of studies (patrick et al 1981; arnold et al 2004; quinn et al 2004; silva et al 2004; wigal et al 2004) suggested that d - mph might have a longer duration of action than d, l - mph on tests measuring attention, hyperactivity, and impulsivity, the use of d - mph in adhd allows the administration of lower doses than those currently prescribed with d, l - mph . Molecules that are non - superimposable mirror images of one another are termed enantiomers and when equal amounts (1:1) of enantiomeric molecules are present together, the product is termed racemic . Most current commercial formulations of mph consist of the racemic mixture of the threo pair of mph isomers (d, l - threo mph). Although mph has two chiral centers, and therefore four isomers, a d, l - erythro - mph pair and a d, l - threo - mph pair, only the racemic mixture of the threo pair of enantiomers (d, l - threo - mph) is used therapeutically . This is due to the recognition that it has fewer side - effects than the erythro enantiomers . It should be noted that the phenethylamine moiety of d - mph is shared by dopamine and norepinephrine . It is the phenethylamine structure that provides the transporter receptor affinity and it competes with dopamine for binding (kimko et al 1999). The predominant metabolic pathway of mph is de - esterification to form pharmacologically inactive d- or l - ritalinice acid by the carboxyesterase - i isoform, ces1a1 (sun et al 2004). It was shown that d, l - threo - methylphenidate was stereoselectively metabolized in humans (lim et al 1986; srinivas et al 1987), with l - threo - mph being eliminated faster than d - threo - mph (srinivas et al 1992; sun et al 2004). In a double - blind, four - way, randomized, crossover study, l - mph showed no difference vs placebo in improving the sustained attention in humans . Moreover, a 5-mg dose of d - threo - mph has the same attention improvement effect as a 10-mg dose of d, l - threo - mph racemic mixture . Hence, the clinical effect of mph is attributed to the d - enantiomer (srinivas et al 1992). The brand name for d - mph is focalin . In terms of its chemical composition, d - mph hydrochloride is methyl -phenyl-2-piperidineacetate hydrochloride, (r, r)-(+)- . Although its mechanism is poorly understood, pharmacodynamic studies have suggested that the therapeutic effect of mph in the treatment of adhd appears to lie primarily in increasing the synaptic concentration of dopamine by blocking dopamine transporters (dat) (gatley et al 1996; ding et al 1997; davids et al 2002), as well as in blocking norepinephrine transporters . This is in agreement with recent reports that there is significantly increased expression of dat in adhd patients (volkow et al 2002) and the effects of mph administration is associated with a decrease in dat receptor concentration in the striatum (krause et al 2000). However, in methamphetamine abusers, the number of dat also are reduced (volkow et al 2001a, 2001b). Recovery of dat receptors is evident with protracted abstinence (volkow et al 2001a). The binding of d - mph to dat in the striatum is reduced by cocaine in a dose - dependent manner (fowler et al 1998). Studies in humans, baboons, and rats seem to indicate that the pharmacological specificity of mph resides predominantly in its d - isomer (srinivas et al 1992; ding et al 1997; anonymous 2002). Thus, in vivo binding measures of radiolabeled d - mph to dopamine transporter in the brain with positron emission tomography (pet) or microdialysis have not only become a valuable technique to analyze pharmacodynamics of mph and its enantiomers (ding et al 1995, 1997, 2004; gatley et al 1995; logan et al 1996, 2001; volkow et al 2002; kilbourn 2004), but also served as an effective tool to assess expression or density of dopamine transporters in tissues of humans and animals (volkow et al 1995, 1996b, 2001a, 2001b; fowler et al 1998; gatley et al 1999). Pet studies provide a quantitative measure of distribution volume ratios, which represent specific radioligand binding (volkow et al 1995; wang et al 1995). Measures of distribution volume ratios are based upon the following assumptions: (i) even if the plasma concentration of the radiolabeled tracer is unknown (for example, without blood samples from patients), non - invasive quantification is still possible using a reference region with graphical analysis (logan et al 1996); (ii) for neuroreceptor transporter modeling, no specific binding occurs in the reference region (volkow et al 2002); (iii) the distribution volume of the reference region is the same as the distribution volume of the first compartment (free and non - specifically bound tracer) in the target region . Since the basal ganglia of striatum expresses more dopamine transporters (dat), it is considered as the target region for d - mph, while the cerebellum does not express dat, so it usually is considered the reference region (volkow et al 2002; kilbourn 2004). Thus, the tissue distribution volume ratio of [c]d - mph in the basal ganglia containing the specific binding to that in the cerebellum which demonstrates non - specific binding should be considered to be a reflection of dopamine transporter availability . Recent results from pet and other imaging studies for the two enantiomers of racemic mph demonstrated that [c]d - mph bound to the dopamine transporter in the basal ganglia is highly specific and reproducible (ding et al 1997). However, there is no evidence of regional specific binding for [c]l - threo - mph in the brain . These results suggest that the binding of mph to dat in the striatum is enantiospecific . These data are also in agreement with those from basic and clinical studies showing that d - mph at therapeutic doses exerts much stronger effects than racemic mph or l - threo - mph on extracellular dopamine in rats and on improvement in sustained attention in children (srinivas et al 1992; patrick et al 1987). Moreover, d- and l - mph also undergo enantioselective metabolism (srinivas et al 1987; hubbard et al 1989; anonymous 2002; sun et al 2004), as evidenced by the following findings . First, as mentioned before, because of rapid pre - systemic metabolism, orally administered l - threo - mph is poorly absorbed in humans thus, the absolute bioavailability of d - mph is significantly greater than that of l - threo - mph (srinivas et al 1993; sun et al 2004). Second, because there is a correlation between plasma concentrations and dat occupancy, the plasma concentration could serve as an indicator for dat binding (srinivas et al 1992). However, dat binding by d - mph could also be obtained from calculated tissue distribution volume without patients blood samples (logan et al 1996). Third, while the rate of brain uptake for both enantiomers was not significantly different, the rate of clearance after 1.5 hours from the brain or plasma was much slower for d - mph than that of l - threo - mph (volkow et al 2002). Fourth, greater than 50% dat binding in the basal ganglia by d - mph may be required for therapeutic efficacy for adhd . However, despite greater than 50% dat occupancy by d - mph when administered intravenously or orally, the reinforcing effects were not perceived by patients receiving oral d - mph (volkow et al 2002). This phenomenon is possibly due to slower blockade of dat by oral d - mph and may explain why intravenous injection of mph may lead to addiction . Finally, there is no inter - conversion between the enantiomers after oral administration of pure d- and l - mph separately (volkow et al 2002). The recent in vitro binding study of markowitz et al (2005) found that d - mph exhibited prominent effects at the norepinephrine transporter site, even exceeding the activity at the dat . The result demonstrated that affinity for catecholaminergic sites largely resides in the d - isomer . Animal toxicology studies showed that the toxicity of d - mph and d, l - mph were comparable at equimolar doses (teo et al 2002). A recent comparative study assessing the acute behavioral toxicity of d - mph, l - mph, and d, l - mph in rats has revealed that females were more sensitive than males to some toxic behavioral effects of the l - isomer and d, l - mph (racemic), suggesting a possible sex difference in sensitivity (teo et al 2003d). In related studies, increased incidence of dilated pupils and vocalization was found with d, l - mph compared with the pure d - mph given at half the dose (teo et al 2002). In the same study, no other significant toxic effects were found in perinatal or postnatal rats at a dose 25 times the maximum daily human therapeutic dose (teo et al 2002). Another toxicology study in beagle dogs demonstrated that only minimal reversible toxicity such as reduced appetite and weight loss were found in male and female dogs receiving 10 mg / kg of d - mph and 20 mg / kg of d, l - mph for 90 days (teo et al 2003c). Neither d - mph nor d, l - mph were found to be carcinogenic or clastogenic in either in vitro or in vivo studies, although very high oral doses of the l - mph produce behavioral, and even lethal, effects in mice (teo et al 2003a). The authors believed that d - mph and d, l - mph do not present carcinogenic risk to humans . Animal studies in rats and rabbits also suggested that d - mph and d, l - mph were not teratogenic (teo et al 2003b). The same study suggested that some negative behaviors in pregnant animals may be attributed to l - mph because inclusion of the l - isomer, when comparing d, l - mph and d - mph at half the dose, resulted in repetitive pawing, dilated pupil, and aggressive behavior . A recent study, using pet and micropet to trace orally administered, as well as radiola - beled d- and l - mph, in the brain of baboons and rats, suggested that l - mph may not be pharmacologically active . Additionally, l - mph might contribute to the behavioral and side - effect profiles of d, l - mph during the treatment of adhd (ding et al 2004). The immediate - release (ir) d - mph product is deemed to provide effective management of adhd at half the dose of racemic mph products and was shown to be effective and well tolerated in clinical trials (swanson et al 2002; arnold et al 2004; quinn et al 2004; wigal et al 2004). An initial pharmacokinetic study showed that after an oral dose of d - mph, plasma d - mph concentration increased rapidly, reaching maximum levels at 11.5 hours post - dose in fasting states . Plasma pharmacokinetics of d - mph were similar to d, l - mph given the equimolar amounts of d - mph . The mean plasma elimination half - life for d - mph is approximately 2.2 hours (anonymous 2002). However, recent studies, including one post hoc analysis (weiss et al 2004), one open - labeled (silva et al 2004), and three placebo - controlled clinical studies (arnold et al 2004; quinn et al 2004; wigal et al 2004) in children with adhd, suggested that ir d - mph may produce a longer duration of therapeutic action (6 hours) which cannot be explained solely on the basis of the agent s pharmacokinetics . Some authors have postulated that the need for a midday dose for ir mph products may erode social functioning and sometimes the self - esteem of children with adhd . Thus, an extended - release form of d - mph (d - mph - xr) was designed, known as focalin xr, and approved by fda for clinical use in may 2005 . This product is a modified release capsule formulation of d - mph specifically engineered to deliver a bimodal (biphasic) release of d - mph that mimics a twice daily d - mph dosing (ie, two distinct peaks approximately 4 hours apart). The d - mph - xr product uses the same proprietary sodas (spheroidal oral drug absorption system) technology as one of the racemic mph products (ritalin - la) currently on the market . For each of these products, capsules are filled with a mixture of 50% immediate - release beads and 50% enteric - coated, delayed - release beads, thus providing immediate release and a second delayed - release component . After administration of d - mph - xr, the first peak concentration (cmax1) of d - mph occurs on average after 1.5 hours (typical range 14 hours). The mean time to the inter - peak minimum is slightly shorter, and time to the second peak (tmax2) is slightly longer for d - mph- xr given once daily (about 6.5 hours, range 4.57 hours) compared with the ir d - mph given in two doses 4 hours apart . The d - mph - xr product given once daily exhibits a lower second peak concentration (cmax2), higher inter - peak minimum concentrations, and fewer peak and trough fluctuations than the ir form of the agent, given in two doses 4 hours apart . The area under the plasma concentration - time curve (auc) after administration of d - mph - xr given once daily is equivalent to the same total dose of ir d - mph tablets given in two doses 4 hours apart (novartis pharmaceuticals corporation 2005). The clinical efficacy as well as safety of d - mph - xr in treating children with adhd was demonstrated in a randomized, double - blind, placebo - controlled clinical trial (greenhill et al 2005). In this study, flexible dosing schedules of between 5 and 30 mg of d - mph - xr were administered once daily over a 7-week period . Greenhill et al (2005) reported that d - mph - xr was associated with significantly improved attention and behavior in children with adhd . Silva et al (2005, 2006), in two separate studies, demonstrated that the therapeutic effect significantly differentiated from placebo during each time point of the 12-hour laboratory classroom studies . Both of these studies employed a double - blind, placebo - controlled, crossover design . The sample sizes were slightly more than 50 patients in each trial; all subjects satisfied dsm - iv criteria for adhd . In the two studies, swanson, kotkin, agler, m - flynn, and pelham (skamp) scales and math tests were administered . Significant differences were observed across all measures and in each of the subscales at each of the time points studied . Another noteworthy observation is related to the elapsed time at which efficacy was first detected . In the silva et al (2005) study significant differences were noted at the first time point measured, which was half an hour after medication administration . Based on the information we have reviewed it seems that d - mph is a useful agent in the treatment of adhd . Furthermore, it should be noted it is the only mph product approved for the treatment of this disorder in adults . The literature reviewed identified that there are meaningful differences in the clinical efficacy and pharmacokinetic profile between the d- and l - isomers of mph . When comparing the single isomer with the racemic compound, a consistently noted difference across studies is that d - mph has a longer duration of action than d, l - mph . Further study is required to more fully understand the side - effect differences between the d - isomer and its racemic counterpart.
Fractures among patients infected with human immunodeficiency virus (hiv) have been the focus of an increasing number of studies since 2000.117 such fractures have been documented to occur more frequently than in people not infected by hiv6 and to involve longer healing times and an increased risk of infection.18 the large us prospective cohort hiv outpatient study (n = 5826) reported that, in 2006, the frequency of all fractures among hiv - infected patients aged 2554 years was over two - fold higher than in the us general outpatient population (84.2 versus 35.6 fractures per 10,000 people, adjusted for gender).6 hiv - infected patients have been shown to be at particularly high risk for developing fractures if they are aged 47 years (compared with 35 years), have a history of cd4 cell count below 200/mm, have diabetes or hepatitis c coinfection, or are an intravenous drug user.6 because combination antiretroviral therapy has allowed more and more hiv - infected people to live well beyond 50 years, when osteoblastic activity significantly declines,1 the occurrence of fractures is expected to increase in this population in the future . The higher prevalence of fractures among hiv - infected patients compared with the general population is due in part to their lower bone mineral density, which makes their bones more fragile and susceptible to breaking.1,4,6,13 this is reflected in their six - fold higher rate of osteopenia and nearly four - fold higher rate of osteoporosis.6 for every one standard deviation reduction in vertebral bone mineral density, there is a two - fold increased risk of vertebral fracture.1 hiv itself appears to lower bone mineral density due to the presence of increased levels of certain proinflammatory cytokines (interleukin-1, interleukin-6, and tumor necrosis factor) that directly accelerate bone loss.13 many antiretroviral and nonantiretroviral drugs are also known to contribute to low bone mineral density through a variety of mechanisms, including enhanced osteoclastic activity, reduction in osteoblastic activity, impaired calcium absorption, and renal phosphate wasting.8,13 of the reverse transcriptase inhibitors, the nucleotide, tenofovir disoproxil fumarate, has been most documented to produce significant reductions in bone mineral density following initiation of therapy.10,1925 in clinical trials that have directly compared tenofovir with the nucleoside reverse transcriptase inhibitors, ie, stavudine, zidovudine, and abacavir, tenofovir was found to reduce bone mineral density to a greater degree.22,26,27 in a cross - sectional observational study by guillemi et al10 in 285 unselected adult hiv patients (80% caucasian, 85% male, median age 48 years), multivariate analysis revealed that tenofovir exposure for at least three months and lower body mass index, but not exposure to other nucleosides or protease inhibitors, were risk factors for low bone mineral density . To date, studies of fractures in hiv - infected patients have focused primarily on fractures of the hip and spine, as confirmed by dual energy x - ray absorptiometry (dexa) or magnetic resonance imaging.4,14,18,21,28 fractures of the feet have rarely been mentioned in any publication . Considering their weight - bearing role, feet would be expected to be highly vulnerable to fracture in hiv patients, especially those with reduced bone mineral density and the common hiv - associated peripheral neuropathy . The purpose of the present study was to describe the clinical, laboratory, and medical history characteristics of all male hiv - infected patients diagnosed with foot fractures within a one - year period at a private practice rheumatology clinic in los angeles, and to differentiate these characteristics in tenofovir - treated versus non - tenofovir - treated patients . In this retrospective case series study (col109415), a rheumatologist (aah) and podiatrist (rjj) reviewed the medical records for all male hiv - infected patients in los angeles area outpatient podiatry and rheumatology clinics who had been diagnosed as having foot fractures confirmed by magnetic resonance imaging (n = 30) over a one - year period (20062007). In most cases, the patients had been seen initially in private podiatry clinics in los angeles and were referred to the center for rheumatology . However, some patients were seen first at the center for rheumatology and were then referred to rjj s private podiatry practice for foot fracture assessment . Female fracture patients were excluded from the study because it was felt that their greater fracture risk due to lower bone mineral density and bone mass,29 and the complication of premenopausal and postmenopausal estrogen use (oral contraceptives and estrogen supplements,30 respectively) could lead to data that would not be comparable with that from a solely male population . Fracture data were included for analysis only for patients whose fractures had occurred either in the absence of trauma or after only trivial trauma . Medical records for patients with fractures due to highenergy traumatic injury (eg, a motor vehicle accident) were excluded from analysis . Excel sheets were used to capture data pertaining to the patients demographics, hiv history, comorbidities, alcohol intake, smoking history, highly active antiretroviral therapy (haart)/non - hiv drug prescription history, bone mineral density scores by dexa, fracture type, and laboratory values (especially serum calcium, phosphorus, alkaline phosphatase, thyroid - stimulating hormone, 25-hydroxyvitamin d, and parathyroid hormone). The investigators also noted the characteristics of the foot fracture events, which included the situation surrounding the fracture, location / type of fracture, the presence of concurrent fractures in other body regions, the time between hiv diagnosis and foot fracture occurrence, the time between the start of a particular treatment and foot fracture, and how fractures were managed . Statistical analysis was primarily descriptive, although stepwise logistic regression analyses were performed to evaluate a correlation between the category variables, ie, femur dexa t scores <1.5 or 1.5 or spine dexa t scores <1.5 or 1.5, and independent variables (baseline demographic characteristics, hiv-1 rna, cd4 cell count, laboratory values, comorbidities, and concurrently administered drugs). These fractures were marked by pain, often of the pinpoint type when the fracture area was touched, with concomitant swelling and little or no bruising . Proportionally more patients with foot fractures had received tenofovir - containing antiretroviral (17 [57%]) than non - tenofovir - containing antiretroviral (13 [43%]) drugs prior to the fracture . Median time from tenofovir initiation until fracture was 2.57 (range 1.175.69) years . At the time fracture was diagnosed, the tenofovir and non - tenofovir groups did not differ significantly in median or mean age (49 versus 48 years and 50.0 versus 54.2 years, respectively). Although there were outliers in age in each of these groups, ie, a 63-year - old in the tenofovir group and an 80-year - old in the non - tenofovir group, most of the patients were in their mid to late forties . The tenofovir and non - tenofovir groups were also similar with respect to baseline viral load (2.1 versus 2.4 log10 copies / ml), time between hiv diagnosis and foot fracture (both 17.0 years), proportion of fractures affecting the metatarsophalangeal area (12% versus 15%), incidence of concurrent vertebral fracture (12% versus 15% of all foot fracture cases), and family history of osteoporosis (24% versus 23% of cases, table 1). No between - group differences were observed regarding presence of most comorbidities, including hypogonadism, hypertension, malabsorption syndrome, renal failure, calcium deficiency, or vitamin d deficiency, nor were differences seen in serum laboratory values for calcium, albumin, potassium, blood urea nitrogen, sodium, creatinine, chloride, glucose, liver enzymes, and hematocrit . More patients in the tenofovir group than in the non - tenofovir group were osteoporotic, smoked cigarettes regularly, and had truncal obesity and wasting syndrome . Fewer tenofovir - treated patients had a history of alcoholism and anemia secondary to chronic disease . Iu / l versus 72 iu / l), parathyroid hormone (41 pg / ml versus 32 pg / ml), 25-hydroxyvitamin d (37 ng / ml versus 26 ng / ml), and a lower median white blood cell count (5.5 10/mm versus 6.3 10/mm). Evaluation of prior nucleoside reverse transcriptase inhibitor, non - nucleoside reverse transcriptase inhibitor, and protease inhibitor use showed that more patients in the tenofovir group had taken lopinavir / ritonavir (53% versus 23%) and ritonavir (24% versus 8%), whereas more patients in the non - tenofovir group had taken abacavir / lamivudine (31% versus 6%). No between - group differences were observed in the frequency of use of any other individual antiretroviral agents . Logistic regression analyses showed a significant relationship between femur dexa t - scores <1.5 and decreased body weight (p = 0.036) and increased serum glucose (p = 0.03). No relationship was seen between femur or spine dexa t scores <1.5 and alendronate use or testosterone use, serum creatinine, serum blood urea nitrogen, electrolytes, or 25-hydroxyvitamin d levels . The fractures were treated with immobilization of the foot, often with the aid of a casted stiff - soled shoe to be worn to prevent pressure or bending of the fracture area . Surgery was not required, and crutches were generally needed only for metatarsal base injuries . With these precautions, fractures usually required 46 weeks to heal fully . In tenofovir - treated patients, custom orthotics were created for the patients for insertion into shoes to reduce pressure on the previously fractured foot areas . For patients whose bone mineral density values demonstrated osteoporosis or osteopenia, treatment with supplemental calcium, vitamin d, bisphosphonates, or teriparatide was considered . This small pilot study suggests that foot fractures may occur more often in hiv - infected patients treated with tenofovir - containing haart than non - tenofovir - containing haart . Concern about an association of tenofovir with fractures was initially raised by preclinical studies that showed a higher risk of spontaneous fractures and bone abnormalities in rhesus monkeys with simian immunodeficiency virus infection administered supratherapeutic doses of tenofovir (30 mg / kg / day) subcutaneously for one week to 24 months (mean, 14 months) compared with no treatment . 31 these bone effects were associated with elevated alkaline phosphatase levels and decreased serum phosphorus levels . Histomorphometric assessment of the tibial diaphyses in tenofovir - treated monkeys revealed increased osteoid seam width, consistent with defective mineralization of new bone, despite reduction or reversal of tibial bone resorption . A further preclinical study reported completely unmineralized secondary osteons in the tibia of a 16-month - old rhesus monkey whose mother had received high doses of tenofovir while pregnant.32 clinical trials evaluating tenofovir have also demonstrated the adverse effect of the drug on bone . In gs-99 - 903, a clinical registration trial that compared tenofovir / lamivudine / efavirenz (n = 299) with stavudine / lamivudine / efavirenz (n = 303) in antiretroviral - nave patients, tenofovir - treated patients experienced a significantly greater mean percentage decrease from baseline in lumbar spine bone mineral density at week 144 (2.2% versus 1.0% stavudine, p = 0.001) and a trend for greater bone mineral density reduction at the hip (2.8% versus 2.4% stavudine, p = 0.06).26 two subsequent clinical trials similarly showed that tenofovir, whether combined with emtricitabine or lamivudine, caused significantly greater bone mineral density reduction than comparator nucleoside reverse transcriptase inhibitor backbones.21,28 however, none of these clinical trials reported a significantly higher frequency of fractures in tenofovir - treated patients despite the tenofovir - associated reduction in bone mineral density . This underscores clinical evidence demonstrating that reduced bone mineral density is just one contributor to fractures and that bone mineral density alone cannot serve as the only predictor of fracture . In fact, reduced bone mineral density alone generally imparts less than 25% increased risk of vertebral fractures.33 the effect of decreased bone mineral density on foot fracture risk has yet to be investigated . Where fracture data have been reported previously in hiv - infected patients receiving haart, these have dealt primarily with vertebral fractures rather than foot fractures . In fact, in an assessment of patient medical records of approximately 8600 hiv - infected patients (78% male, 70% caucasian, median age 45 years, 46% smokers, 81% of the haart regimens including one protease inhibitor and 22% including tenofovir) at nine us hiv clinics, 55% of 55 fractures observed were vertebral, only one of which occurred with a concurrent foot fracture.14 the other most frequent sites of fracture were the lower extremities (27%, which could have included foot fractures, although these were not specified), upper extremities (6%), and clavicle (4%)., patients who had fractures generally remained on the antiretroviral treatment they had been receiving at the time fracture occurred, and remediation similarly consisted of immobilization of the fracture areas, with institution of calcium, vitamin d, and bisphosphonates if osteoporosis had been detected by bone mineral density measurements . Foot fractures believed to be related to tenofovir were previously reported in several hiv - infected patients, aged 3762 years, 1217 months after tenofovir was added to their haart regimens.24,34,35 their regimens also included either ritonavir - boosted atazanavir or lopinavir . In these cases, bone scintigraphy revealed concurrent fissure fractures in multiple body areas, especially the legs, ribs, pelvis, and femur . Laboratory work confirmed osteomalacia that was likely due to tenofovir - related proximal renal tubular dysfunction, which was marked by phosphaturia, proteinuria, glycosuria, and calciuria . Tenofovir was discontinued, remedial oral 25-hydroxyvitamin d3, neutral sodium - potassium phosphate, and/or calcitriol treatment was initiated, and the condition of the patients resolved and laboratory values and renal function usually normalized within 12 weeks . Generalized fractures in 12 of 22 patients who had developed proximal renal tubular dysfunction secondary to tenofovir were also reported by woodward et al.25 in these patients, phosphaturia led to hypophosphatemia, which in turn led to osteomalacia and fracture . In the tenofovir - treated patients in our study, osteomalacia could not be ruled out as a potential cause of, or prodromal condition for, foot fractures because we did not have serum phosphate data, or urinary phosphate, glucose, or protein data . Our tenofovir cohort did not present with a greater number of symptoms suggestive of generalized osteomalacia (diffuse body pain and muscle weakness) than did the non - tenofovir group . However, it did have more stress - type and concurrent fractures and higher parathyroid hormone and alkaline phosphatase levels, all of which are often associated with osteomalacia.36 both the tenofovir and non - tenofovir groups in our study had several factors that could have influenced the occurrence of foot fractures . A larger proportion of tenofovir - treated patients took the protease inhibitor lopinavir / ritonavir concurrently . Because lopinavir / ritonavir increases tenofovir blood levels by inhibiting the efflux of tenofovir out of renal proximal tubule cells and reduces tenofovir renal clearance, the increased tenofovir blood levels during concurrent use could have potentially increased fracture risk, in view of animal studies linking higher tenofovir concentrations with greater demineralization.31,32 in addition, lopinavir / ritonavir in the absence of coadministered tenofovir has been linked with low bone mineral density and cases of accelerated osteoporosis,37 and with vertebral fractures.38 more of our tenofovir - treated cohort took oral corticosteroids, were chronic cigarette smokers, and had truncal obesity or wasting syndrome, all of which have been implicated in reducing bone mineral density.3942 these factors could have contributed to the higher frequency of osteoporosis or osteopenia in the tenofovir group, and hence greater likelihood of foot bone fragility and fracture . These risk factors were likely partially counterbalanced by the greater frequency of use of calcium supplements, vitamin d, testosterone, and teriparatide, ie, drugs that could increase bone mineral density, in the tenofovir group.4347 it was not clear in some cases when these were started with respect to the timing of a diagnosis of osteopenia or osteoporosis . Although fewer patients in the non - tenofovir group had as many of these bone mineral density - reducing factors, more non - tenofovir - treated patients were alcoholics or had cd4 counts <200/mm, both of which can lower bone mineral density.43,46 our study was limited by its small population and its lack of information about the dietary habits and exercise patterns of the patients, both of which could have potentially impacted bone strength, and hence, foot fracture risk . The study involved hiv - infected patients who were diagnosed over a one - year period (20062007) after having received tenofovir on average for about 2.5 years . Thus, they were prescribed tenofovir at a time when the nucleoside backbones popularly used in practice were lamivudine / zidovudine, abacavir / lamivudine, and abacavir / lamivudine / zidovudine . It is noteworthy that tenofovir is currently prescribed much more often as a backbone in combination haart regimens . Thus, if foot fractures were to be evaluated over the past year in haart - treated patients, the attributability of the fracture to tenofovir use could be debatable because more fractures might only reflect greater prevalence of tenofovir use in current clinical practice . Our study had several attributes, including the fact that the patients were well matched for severity of hiv condition, family history of bone abnormalities, and time between hiv diagnosis and foot fracture diagnosis . Most of the patients were not elderly, and so the effects of older age on bone fragility were negligible . The same data - gathering tool and questions were used in evaluating patient medical charts . Lastly, only males were evaluated because women have a notably higher frequency of low bone mineral density due to smaller body weight and hormonal factors . In conclusion, this small pilot study suggests a greater incidence of foot fractures in hiv - infected patients on tenofovir - containing than non - tenofovir - containing haart . When choosing antiretroviral agents for inclusion in haart regimens, it is important for clinicians to consider the potential for drugs to increase the risk of fracture, especially in hiv - infected patients in whom bone mineral density is already diminished.
It is found in up to 40% of patients at surgery or autopsy.1) the aortic valve and its adjacent ring are more susceptible to abscess formation and paravalvular extension compared to the mitral valve.1) we report a case of staphylococcal endocarditis involving the tricuspid valve complicated by a para - aortic abscess that ruptured into the aortic sinus diagnosed by trans - thoracic echocardiogram . His medical history was unremarkable, except left ankle trauma three months prior to presentation . On admission, the blood pressure was 100/50 mmhg, pulse rate was 111/min, respiratory rate was 22/min and body temperature was 39.7. auscultation revealed clear breathing sounds and a faint diastolic regurgitant murmur (1 - 2/6) at the left sternal border . In addition, reddish, painful left ankle edema, suggestive of cellulitis in addition to small erythematous macular lesions suggestive of janeway lesions on the soles were present . Electrocardiogram showed sinus tachycardia (107 beats / minute) without st - t segment abnormality . Laboratory tests revealed a white blood cell count of 17,000/l with elevated neutrophils (85.4%), a hemoglobin level of 13.2 g / dl, an elevated erythrocyte sedimentation rate (esr) (23 mm / hour), a c - reactive protein 10.48 mg / dl and abnormal liver function with aspartate aminotransferase / alanine aminotransferase of 39/66 iu / 1) revealed mild aortic regurgitation, bicuspid aortic valve and an oval echolucent area near the aortic valve adjacent to the right bicuspid aortic valve commissure with direct communication to the aortic sinus . An echolucent cavity was visible on the right side of the aortic valve annulus, and was thought to represent paravalvular ring abscess . A diastolic color flow jet into the abscess cavity indicated a communication with the aortic sinus . Examination of the tricuspid valve demonstrated a 1.4 cm mobile vegetation on the septal leaflet of the tricuspid valve associated with trivial tricuspid regurgitation . However, cardiac systolic function was normal with a 63% ejection fraction . Transesophageal echocardiography was performed on the fourth hospital day to further investigate the oval echolucent area near the aortic valve, which confirmed a bicuspid aortic valve along with a para - aortic abscess that communicated directly with the aortic sinus (fig . 2). Computed tomography scan of the abdomen demonstrated multiple hypodense lesions in the spleen and the left kidney, considered to be abscesses secondary to septic emboli . Staphylococcus aureus (s. aureus), sensitive to ciprofloxacin, gentamicin, oxacillin, rifampin, teicoplanin, tetracycline, trimthoprim / sulfamethoxazole, and vancomycin, was isolated from peripheral blood cultures according to susceptibility test performed by the disc diffusion method . Ultimately, a diagnosis of acute staphylococcal endocarditis was made according to the duke criteria, which included three positive blood culture results of s. aureus, the presence of vegetation on the tricuspid valve and para - aortic abscess as demonstrated by echocardiogram, in addition to clinical and laboratory features, such as left ankle cellulitis, fever, and janeway lesion . The patient was empirically treated with a combination of nafcillin (1 g/12 h) and gentamicin (60 mg/8 h) before blood culture results were known . Over the subsequent 48 hours, the patient's cellulitis improved markedly as evidenced by reducing erythema, swelling, and pain of the left ankle . Initially, the patient responded well, but after 7 days of intravenous antibiotic administration, laboratory results showed signs of increasing inflammation . A new rise in leukocytes counts from 9,400/l to 10,000/l, with elevated neutrophils from 73% to 79%, was observed . Esr increased from 21 mm / h to 24 mm / h at the time . Because the infection site was critical, we replaced intravenous nafcillin with intravenous vancomycin (1 g/12 h) and persisted with gentamicin (60 mg/8 h), with the suspicion of nafcillin resistance . Repeat transthoracic echocardiography demonstrated bicuspid aortic valve along with a persistent para - aortic abscess communicating with the aortic sinus . The size of tricuspid valve vegetation reduced from 15 mm to 7 mm after the first 14 days of antibiotic therapy . Repeated blood cultures were negative during antibiotic therapy . However, vancomycin therapy was discontinued after 21 days due to leukopenia (leukocyte count of 2,900/l and neutrophil count of 14.4%). Antimicrobial therapy was discontinued because the patient showed no signs of active infection, and repeated blood cultures were negative . One week after discontinuing antibiotic therapy, blood analysis demonstrated a normal leukocyte count of 7,600/l, a neutrophil of 66.6% and an esr of 6 mm / h . Ultimately, the patient received 4 weeks of antibiotics with various regimens: nafcillin / gentamicin for 1 week followed by vancomycin / gentamicin for 1 week, followed by 2 weeks of vancomycin therapy . The patient made a recovery, as the tricuspid valve vegetation disappeared and the abscess cavity showed no significant change in size on the follow - up echocardiogram performed one month after discharge . Staphylococcal tricuspid valve endocarditis with para - aortic abscess in a patient with bicuspid aortic valve is rare . It is quite unusual for coagulase - negative staphylococci to cause endocarditis in a young, otherwise healthy person who was not an intravenous drug user, and who had no other risk factors predisposing to infective endocarditis . Perivalvular abscess is an ominous development in patients with endocarditis, because it is associated with valvular and perivalvular destruction, leading to serious complications, such as heart block, pericarditis and acute valvular insufficiency.2) in patients with native valve endocarditis, the risk is increased when the valve is bicuspid . Ellis et al.3) described signs suggestive of the presence of perivalvular abscesses on transthoracic echocardiogram, e.g., rocking motion of the prosthetic valve, aneurysm of the sinus of valsalva, increased subvalvular intraventricular septum thickness (13 mm), and thickening of the aortic root wall (10 mm). If any of these abnormalities is seen on transthoracic echocardiogram, or if there are clinical manifestations of abscess, transesophageal echocardiography is indicated . It remains unclear whether detection of root abscess in the disease course of aortic valve endocarditis is an indication for surgery . Surgery in patients with active infection and perivalvular abscess carries a high risk of death, and is associated with significant risk of recurrent infection and periprosthetic leak postoperatively.4 - 8) due to the patients' preoperative conditions secondary to sepsis, treatment of complex aortic valve endocarditis is a surgical challenge, with a reported mortality rate that ranges from 9% to 23%.9) annular abscesses or intracardiac fistulae increase the technical difficulties and risks associated with surgical treatment.10) the long - term outcome of these patients has not been well defined.7)8) a small number of patients with periannular extension of infection or myocardial abscess may be treated successfully without surgical intervention.11)12) these patients potentially include those who have smaller (<1 cm) abscesses, and who do not have complications such as heart block, echocardiographic evidence of progression of abscess during therapy, valvular dehiscence or insufficiency . Cases of successful medical treatment of perivalvular abscess have been reported,11)13 - 15) but there have been no published series of consecutive patients and no comparison has been conducted with surgically treated patients . Surgical versus conservative treatment in patients with infective endocarditis and paravalvular abscess were associated with similar survival in another study.2) in a retrospective study of 233 cases of perivalvular abscess from 42 french hospitals over a 5-year period, medically treated patients who constituted 9% of the study population, had a survival rate similar to surgically treated patients.8) the findings of these study suggest that the main impetus for surgery is severe heart failure despite medical treatment, and that surgery may be deferred or avoided in patients whose heart failure is well controlled.2)8) in most patients, the abscess led to aortic pseudoaneurysm development secondary to cavitation and drainage into the aorta with control of the infection.6)16) the evolutional process was identical irrespective of the species of the infecting microorganism . Such patients should be monitored closely with serial transesophageal echocardiography, which should be repeated every 2, 4, and 8 weeks following completion of antimicrobial therapy . Jeang et al.17) report a case of aortic root abscess detected with magnetic resonance imaging and echocardiography, and the patient was successfully treated medically . Our patient was treated medically for 4 weeks . For susceptible strains of s. aureus, vancomycin was more rapidly bactericidal than penicillin, nafcillin, and cefazolin.18) in a rabbit model of s. aureus endocarditis, sterilization of vegetations was more rapid with vancomycin.18) combination of vancomycin and gentamicin resulted in more rapid clearing of organisms in animal models,19) and in some in vitro models of endocardial vegetations.20) in our patient, antimicrobial therapy was changed to vancomycin from nafcillin due to increasing inflammatory signs in the laboratory findings, suggestive of nafcillin resistance . Although the abscess cavity is still present and showed no significant change in size, the patient has no current signs of infection . Infective endocarditis is a serious medical condition, and its management, especially regarding surgical intervention, should be individualized . In summary, we report a case of staphylococcal infective endocarditis involving tricuspid valve complicated by para - aortic abscess in a 15-year - old man with bicuspid aortic valve . The patient received 4 weeks of antibiotics therapy and had a good quality of life at 5-month follow - up without surgical treatment.
We conducted a nonconcurrent longitudinal study using secondary data analysis of electronic medical record information linked to medicare claims . We studied 3,766 medicare beneficiaries with diabetes, attributed by the centers for medicare & medicaid services (cms) to the university of michigan faculty group practice based on their participation in the physician group practice demonstration (10), who were entered into the university of michigan diabetes registry from 2005 through 2008 . Patients in the diabetes registry are adults (aged 18 years) who have met the following three criteria: have a diagnosis of diabetes in the problem summary list or a diagnosis of diabetes in the past 3 years with at least two face - to - face encounters in an ambulatory care setting or one face - to - face encounter in an acute care setting such as the emergency department;have received antihyperglycemic medication, diabetic supplies (strips / lancets / glucometer), have a hba1c> 6.4% or two or more glucose results 200 mg / dl; andwere seen by a primary care physician, geriatric, or an endocrinology specialist at least twice in the past 2 years, with one of those visits in the past 395 days . Have a diagnosis of diabetes in the problem summary list or a diagnosis of diabetes in the past 3 years with at least two face - to - face encounters in an ambulatory care setting or one face - to - face encounter in an acute care setting such as the emergency department; have received antihyperglycemic medication, diabetic supplies (strips / lancets / glucometer), have a hba1c> 6.4% or two or more glucose results 200 mg / dl; and were seen by a primary care physician, geriatric, or an endocrinology specialist at least twice in the past 2 years, with one of those visits in the past 395 days . Cms provided complete claims data each year for the beneficiaries assigned to the physician group practice demonstration project . National claims history files contained information on beneficiary diagnoses, utilization of services, and medicare payments made to providers for these services . The diabetes registry is a central repository for clinical data from various systems related to disease management and preventive care services . During the study period, registry information was updated between every day and monthly (varying by data element), and patient - centered summary reports were produced every 6 months . Eight reporting cycles occurred from 2005 through 2008, two for each of the 4 years . Accordingly, patients in the study may have had as many as eight bp reports . To study trends longitudinally, patients must have had at least two reports to be included in this study cohort . Data used for this analysis included age, sex, race, medicaid insurance, height and weight, medications (statins, insulin, ace inhibitors, angiotensin receptor blockers [arb]), and the most recent hba1c and ldl cholesterol levels . Comorbidities were obtained from medicare claims, and included specific diseases as well as the annual medicare assignment of hierarchical condition categories (hccs), which were used to derive the overall burden of disease (i.e., severity scores) (11). Individual comorbid conditions included congestive heart failure (chf), renal failure or dialysis, severe malignancies (digestive tract, lung, and other severe cancers; acute leukemia; metastatic cancer), liver disease (end - stage liver disease, cirrhosis of the liver, or chronic hepatitis), and stroke (cerebral hemorrhage, ischemic or unspecified stroke, or hemiplegia / hemiparesis). The bp measurements included in this study were the last bp recorded within each of the 6-month reporting periods . Bp measurements during hospitalization or emergency department visits were excluded . For each patient, bp was determined by usual clinical practice during the outpatient office visit . Therefore, the procedure for measuring bp was similar to that used for clinical decision making at the point of care and was based on individual clinic processes and the judgment of the providers . The participants represented a fluid cohort because various patients entered and/or left the study at various calendar times during the 4-year period . Bp was recorded in 1,195 of the 3,766 subjects (32%) at each 6-month period during the course of the entire 4-year study (i.e., eight recorded bps); bp was recorded at two periods for 410 (11%), with the remaining subjects observed for three to seven periods . To ensure that we were comparing a similar period before death for the patients who died, the bps recorded before death were aligned (i.e., right - justified); thus, bp trajectories reflected the series of last bps recorded before death . The main results are presented as right - justified for all patients, and sensitivity analyses were conducted using left - justification (i.e., bps recorded as the patients entered the cohort). The likelihood ratio test for nested models was used to assess the significance of random intercepts and random coefficients (i.e., slopes). Trajectories were calculated using the fixed - portion linear predictor plus the contribution determined by the predicted random effects . Age of the patient at the time of the report, ace inhibitors or arb drugs, statins, insulin, values of hba1c and ldl cholesterol, bmi, and disease severity score (hcc) were treated as time - varying covariates in the final regression models . Some data were missing on various 6-month reports for hba1c (5%), ldl cholesterol (16%), hcc score (22%), bmi (23%), and insulin (35%) during the course of the 4-year study . Because this was a large group, we chose not to impute values . Rather, we conducted a sensitivity analysis that included these additional variables in a fully adjusted regression model . This study was approved by the university of michigan irb and conducted under a data use agreement with cms . We conducted a nonconcurrent longitudinal study using secondary data analysis of electronic medical record information linked to medicare claims . We studied 3,766 medicare beneficiaries with diabetes, attributed by the centers for medicare & medicaid services (cms) to the university of michigan faculty group practice based on their participation in the physician group practice demonstration (10), who were entered into the university of michigan diabetes registry from 2005 through 2008 . Patients in the diabetes registry are adults (aged 18 years) who have met the following three criteria: have a diagnosis of diabetes in the problem summary list or a diagnosis of diabetes in the past 3 years with at least two face - to - face encounters in an ambulatory care setting or one face - to - face encounter in an acute care setting such as the emergency department;have received antihyperglycemic medication, diabetic supplies (strips / lancets / glucometer), have a hba1c> 6.4% or two or more glucose results 200 mg / dl; andwere seen by a primary care physician, geriatric, or an endocrinology specialist at least twice in the past 2 years, with one of those visits in the past 395 days . Have a diagnosis of diabetes in the problem summary list or a diagnosis of diabetes in the past 3 years with at least two face - to - face encounters in an ambulatory care setting or one face - to - face encounter in an acute care setting such as the emergency department; have received antihyperglycemic medication, diabetic supplies (strips / lancets / glucometer), have a hba1c> 6.4% or two or more glucose results 200 mg / dl; and were seen by a primary care physician, geriatric, or an endocrinology specialist at least twice in the past 2 years, with one of those visits in the past 395 days . Cms provided complete claims data each year for the beneficiaries assigned to the physician group practice demonstration project . National claims history files contained information on beneficiary diagnoses, utilization of services, and medicare payments made to providers for these services . The diabetes registry is a central repository for clinical data from various systems related to disease management and preventive care services . During the study period, registry information was updated between every day and monthly (varying by data element), and patient - centered summary reports were produced every 6 months . Eight reporting cycles occurred from 2005 through 2008, two for each of the 4 years . Accordingly, patients in the study may have had as many as eight bp reports . To study trends longitudinally, patients must have had at least two reports to be included in this study cohort . Data used for this analysis included age, sex, race, medicaid insurance, height and weight, medications (statins, insulin, ace inhibitors, angiotensin receptor blockers [arb]), and the most recent hba1c and ldl cholesterol levels . Comorbidities were obtained from medicare claims, and included specific diseases as well as the annual medicare assignment of hierarchical condition categories (hccs), which were used to derive the overall burden of disease (i.e., severity scores) (11). Individual comorbid conditions included congestive heart failure (chf), renal failure or dialysis, severe malignancies (digestive tract, lung, and other severe cancers; acute leukemia; metastatic cancer), liver disease (end - stage liver disease, cirrhosis of the liver, or chronic hepatitis), and stroke (cerebral hemorrhage, ischemic or unspecified stroke, or hemiplegia / hemiparesis). The bp measurements included in this study were the last bp recorded within each of the 6-month reporting periods . Therefore, the procedure for measuring bp was similar to that used for clinical decision making at the point of care and was based on individual clinic processes and the judgment of the providers . The participants represented a fluid cohort because various patients entered and/or left the study at various calendar times during the 4-year period . Bp was recorded in 1,195 of the 3,766 subjects (32%) at each 6-month period during the course of the entire 4-year study (i.e., eight recorded bps); bp was recorded at two periods for 410 (11%), with the remaining subjects observed for three to seven periods . To ensure that we were comparing a similar period before death for the patients who died, the bps recorded before death were aligned (i.e., right - justified); thus, bp trajectories reflected the series of last bps recorded before death . The main results are presented as right - justified for all patients, and sensitivity analyses were conducted using left - justification (i.e., bps recorded as the patients entered the cohort). The likelihood ratio test for nested models was used to assess the significance of random intercepts and random coefficients (i.e., slopes). Trajectories were calculated using the fixed - portion linear predictor plus the contribution determined by the predicted random effects . Age of the patient at the time of the report, ace inhibitors or arb drugs, statins, insulin, values of hba1c and ldl cholesterol, bmi, and disease severity score (hcc) were treated as time - varying covariates in the final regression models . Some data were missing on various 6-month reports for hba1c (5%), ldl cholesterol (16%), hcc score (22%), bmi (23%), and insulin (35%) during the course of the 4-year study . Because this was a large group, we chose not to impute values . Rather, we conducted a sensitivity analysis that included these additional variables in a fully adjusted regression model . This study was approved by the university of michigan irb and conducted under a data use agreement with cms . In this cohort, 32% of patients were aged <65 and 30% were 75 years at the time of the initial visit (table 1). At the time of entry into the study, 68% of patients were receiving ace / arb therapy, and 66% were receiving statin medications . There were 404 patients (10.7%) who died, half of whom were aged 75 years at the initial visit . Increasing age and male sex were risk factors for death, whereas statin therapy was protective . Chf, dialysis or renal failure, stroke, liver disease, and malignancy were significant predictors of death . Characteristics of patients with diabetes at baseline and mortality during the study period data are presented as n (%). Systolic and diastolic bp both significantly declined before death in patients with diabetes . In an unadjusted model, mean systolic bp declined 3.1 mmhg (95% ci 1.94.3) and mean diastolic bp declined 1.6 mmhg (0.92.3) annually before death . In the adjusted model (table 2), systolic pressure decreased by 3.2 mmhg / year (p <0.001) in those who died and by 0.7 mmhg / year (p <0.001) in those who did not die (p <0.001 for the difference in slopes between trajectories). Diastolic pressure declined by 1.3 mmhg / year for those who died (p <0.001) and by 0.6 mmhg / year for those who did not die (p <0.001); the difference in slopes remained significant (p = 0.021). The addition of a quadratic term to detect a nonlinear change in slope was not significant for systolic (p = 0.965) or diastolic bp (p = 0.761) in the adjusted models . . 2, with stratification by mortality . Annual mean change in bp in patients with diabetes, by mortality * adjusted for age, sex, race, medicaid, ace inhibitors or arbs, statins, congestive heart failure, dialysis or renal failure, malignancies, liver disease, and stroke . Adjusted for age, sex, race, medicaid, ace inhibitors or arbs, statins, congestive heart failure, dialysis or renal failure, malignancies, liver disease, stroke, bmi, hba1c, ldl cholesterol, insulin, and disease severity score (hcc). Mean systolic and diastolic bp trajectories for patients with diabetes mellitus, by age and mortality . Mean systolic and diastolic bp trajectories for patients with diabetes mellitus, by sex and mortality . In the fully adjusted model, mean systolic bp significantly increased with age (0.23 mmhg for each year; p <0.001), female sex (1.57 mmhg; p = 0.004), african american race (3.14 mmhg; p <0.001), bmi (0.11 mmhg for each kg / m increase; p = 0.001), and for those with renal failure or receiving dialysis (5.08 mmhg; p <0.001). Mean systolic bp significantly decreased with medicaid insurance (2.05 mmhg; p = 0.006) and in those with chf (4.03 mmhg; p <0.001). Mean diastolic bp significantly increased with african american race (2.58 mmhg; p <0.001) and bmi (0.07 mmhg; p = 0.001). Mean diastolic bp significantly decreased with age (0.19 mmhg; p <0.001), female sex (1.09 mmhg; p = 0.001), and in those with chf (1.27 mmhg; p = 0.003). 2; the increased systolic bp with older age can be seen by the shift in the bp trajectories on the y - axis . Systolic bp is greater in older patients, whereas diastolic bp is lower in older patients . Women have higher systolic but lower diastolic bp than men . In secondary analyses, the addition of hba1c, ldl cholesterol, bmi, insulin, and severity risk score did not substantially change the major findings (table 2, fully adjusted model). The decline in systolic bp was particularly evident (6.2 mmhg / year) in those who died . We also evaluated potential differences in the slope of bp trajectories for those with and without chf (regardless of mortality); the interaction term was not significant for systolic bp (p = 0.951) or diastolic bp (p = 0.056). Similarly, there was no effect modification by younger age (<65 years) versus older age (65 years); the interaction terms for differences in slope were not significant for systolic (p = 0.184) or diastolic bp (p = 0.979). We repeated the statistical analyses using left - justification of the bp measurements; the results did not appreciably change . The rate of decline of bp was greater in those patients who died than in patients who remained alive (p <0.001 for systolic bp; p = 0.013 for diastolic bp). Systolic bp decreased by 2.7 mmhg / year (95% ci 1.73.7) and diastolic bp decreased by 1.5 mmhg / year (95% ci 0.92.1) in those who died . Systolic bp declined by 0.7 mmhg / year (95% ci 0.50.9) and diastolic bp declined by 0.7 (95% ci 0.60.9) in the patients who remained alive . Of the 404 patients who died, 62 (15%) died between the last clinic visit and the end of the reporting period, 86 (21%) died within 8 weeks of the last reporting period, 158 (39%) died within 8 to 24 weeks of the last reporting period, and 98 (24%) died> 24 weeks from the last reporting period . Mean systolic and diastolic bp both declined in the years before death in patients with diabetes . This annual rate of decline was significantly more marked (3.2 mmhg systolic and 1.3 mmhg diastolic) than in the patients who remained alive . Moreover, the decline was evident after adjustment for major organ failure heart, kidney, and liver as well as for common causes of death such as malignancies and stroke . These findings may signal an underlying population of vulnerable patients, although it is unclear whether the bp decline is merely a symptom of this vulnerability or is one of several physiologic contributors to the dying process . The rate of change in bp has been of lesser significance than threshold values that serve as guides to initiation or adherence to antihypertensive therapy (12). Studies of outcomes in those who experience significant changes (either increases or decreases) in bp would be appropriate . Although hypertension in middle age is a risk factor for death, it is not clear whether there is a point at which therapy should be re - evaluated in the very old or in those with a marked rate of bp decline . A similar phenomenon has been found in cohorts evaluated for the incidence of dementia: elevated bp in earlier life increases the risk, but a decline in bp is evident in the 5 years just before diagnosis (13). Maddox et al . (14) plotted bp trajectories over time in patients with diabetes and/or chronic kidney disease who were newly diagnosed with coronary artery disease . Their results indicated that good control of bp decreased the risk of myocardial infarction and the risk of revascularization, although overall mortality did not improve . Analysis of a cohort monitored for a median of 9.8 years showed the risk of death in patients with type 2 diabetes increased by 15% for every 10-mmhg decrease in systolic bp and increased by 22% for every 10-mmhg decrease in diastolic bp (15). (16) reported that low systolic and diastolic bp predicted elevated all - cause and cardiovascular deaths in patients with type 2 diabetes during a median follow - up of 9.5 years . The action to control cardiovascular risk in diabetes (accord) trial demonstrated that intensive hypertensive therapy did not reduce mortality in patients with type 2 diabetes; the hazard ratio for intensive versus standard bp therapy was 1.07 (95% ci 0.851.35) for all - cause mortality (3). (17) found that tight control of systolic bp in patients with diabetes and coronary artery disease did not improve mortality . The hazard ratio for all - cause mortality was 1.20 (95% ci 0.991.45); again, suggesting a nonsignificant excess of deaths in patients with tight bp control compared with those receiving usual care . They also showed that systolic bp of <110 mmhg was associated with an increase in all - cause mortality compared with systolic bp of 125 to 130 mmhg . The uk prospective diabetes study group found that tight bp control reduced diabetes - related deaths by 32% without a significant reduction in all - cause mortality after a median follow - up of 8.4 years (18). However, the appropriate blood pressure control in diabetes (abcd) trial demonstrated a decrease in all - cause mortality (p = 0.037) for intensive versus moderate bp therapy in patients with type 2 diabetes during a period of 5.3 years, despite showing no statistically significant differences in myocardial infarction, cerebrovascular, or congestive heart failure events (19). Previous authors have noted a concern regarding aggressive treatment in older patients (20,21). A meta - analysis of randomized controlled trials showed treatment of hypertension did not yield a significant reduction in all - cause mortality in patients aged 80 years (20). Moreover, a nonsignificant relative excess of all - cause death was noted in those who received antihypertensive treatment . (21) reported similar findings in an open pilot trial of patients aged 80 years, although the proportion with diabetes was not stated . In contrast, antihypertensive treatment in mostly nondiabetic individuals aged 80 years aimed to a bp target of 150/80 mmhg significantly reduced the rate of death from any cause by 21% (22). Our investigation did not determine the reason for the declining bp before death, and therefore, we advise caution in the interpretation . We have little evidence to indicate whether treatment intensification played a role or whether declining bp is a harbinger of the dying process in certain patients . Our results suggest that the decrease in bp is not merely due to the presence of chf or increased age . It is important to recognize that the decline was observed in the mean pressures in a population and was not observed in all individuals . Because this was a registry - based study, the findings should be investigated in a large, population - based cohort of patients with diabetes . It is unclear whether declining bp could be a reliable predictor of mortality or whether the patients in this registry differ from the overall population in ways that this investigation did not capture . In conclusion, it may be useful to plot bps over time in populations, similar to what many physicians do for individual patients with diabetes . The trajectory of bp leading up to death can be revealing . Our results suggest that a significant decline occurs in both systolic and diastolic bp several years before death in populations of patients with diabetes.
Restoration of endodontically treated teeth is one of the problems in dentistry . When there are no sufficient tooth tissues and retention of the core is questionable, posts would be indicated . Some advantages of fiber posts over metal posts are improvement of esthetics, bonding to dentin, resistance to corrosion and minimizing the root fracture risk . This layer and residual guttapercha and sealer may decrease the bond strength between the cement resin and intraradicular dentin . It has been shown that removal of the smear layer and diffusion of resin within the dentin affect the efficacy of the dentin adhesive . Various methods have been introduced for post space treatment, such as application of h2o2, naocl, chlorhexidine, 17% edta, etching with acids and using ultrasonic files in the root canal [1113]. Demiryurek showed that treatment of root dentin with sikko tim, 37% orthophosphoric acid and 10% citric acid considerably increased the bond strength to dentin . Zhang et al.14 reported that application of 35% phosphoric acid and edta / naocl irrigation with ultrasonic file improved adhesion between resin and dentin . Serafino demonstrated that using ultrasound agitation in combination with etching removed the smear layer from the root canal surface . Another study revealed that edta cleaned root canal walls and subsequently increased bond strength at different regions of the roots . Recent studies have measured bond strength under an immediate load . Since teeth usually withstand the forces during mastication and parafunctional habits, performing in vitro studies which simulate situations similar to the oral environment provide relevant results . Albaladejo reported that micro - tensile bond strength decreased when the specimens underwent load cycling, while bolhuis reported that fatigue loading had no effect on the retention strength of carbon fiber post to composite core . To our knowledge, only limited data are available on the effect of cyclic loading on the bond strength of fiber posts to root canal dentin after different post space treatments . Therefore, the aim of this study was to evaluate the influence of cyclic loading on the bond strength of quartz fiber posts to different regions of root canal dentin after different surface treatments of the canal dentin . The null hypothesis stated that load cycling and regions of the root had no effect on the bond strength of fiber posts to treated root canal dentin . Forty - eight straight, single - rooted, human maxillary central incisors and canines were selected for this study . The teeth were placed in 1.23% chlorhexidine for 2 hours and then stored in 0.9% saline solution at room temperature until use . The roots did not display cracks, caries, resorption, or canal calcification and had closed apices . The crowns of the teeth were cut at the cementoenamel junction using a low - speed water - cooled diamond disc (910 d; diatech; goltene ag, altstatten, switzerland). To standardize the root canal diameter, the mean diameter () of the root canal at the coronal portion of all roots was measured under a light microscope (leica m 10 wild, heerbrugg, switzerland), considering = (buccolingual + mesio - distal)/2 . After endodontic access, the root canals were instrumented with k - files (mani inc, tochigi, japan) using the step - back technique . The coronal portion of each canal was enlarged with #2 to #4 gates - glidden drills (mani inc ., the root canals were irrigated with normal saline and then dried with absorbent paper points (maillefer dentsply, ballaigues, switzerland). Seoul, korea) and ah - plus sealer (ah - plus; dentsply de trey gmbh, konstanz, germany) using the lateral condensation technique . Temporary filling material (cavit g, 3 m espe, seefeld, germany) was used to seal the coronal cavity . After storage in distilled water for 1 week at room temperature, the sealing material was removed with a 2 peeso reamer (mani inc, tochigi, japan). Then, gutta - percha was removed with a low - speed #3 drill from the dt light - post system (bisco, schaumburg, il, usa) to a depth of 9 mm . The roots were divided into four groups (n=12) according to the surface treatment used: group 1: no canal treatment (control group).group 2: the canals were treated with a synthetic chemical solvent in organic chemistry laboratory with compositions of acetone, 33%; ethanol, 33%; and ethyl acetate, 34%, for 15 seconds.group 3: the canals were etched with 37% phosphoric acid (total etch, lvoclar vivadent, usa) for 15 seconds.group 4: the canals were treated with a 15 ultrasound file (piezon master 400; ems, nyon, switzerland) using 10 ml of normal saline as irrigant . Group 2: the canals were treated with a synthetic chemical solvent in organic chemistry laboratory with compositions of acetone, 33%; ethanol, 33%; and ethyl acetate, 34%, for 15 seconds . Group 3: the canals were etched with 37% phosphoric acid (total etch, lvoclar vivadent, usa) for 15 seconds . Group 4: the canals were treated with a 15 ultrasound file (piezon master 400; ems, nyon, switzerland) using 10 ml of normal saline as irrigant . In this study, quartz fiber posts 2 (rtd, post spaces were dried with absorbent paper points (maillefer, dentsply, ballaigues, switzerland). For the application of adhesive resin cement (panavia f2.0, kuraray co. ltd, osaka, japan), one drop of each of ed primer liquid a and b then, the mixture was applied to post space walls with a microbrush for 10 seconds . Excess primer solution was removed with paper points, and the primer was then gently air - dried . Equal amounts of a dual - polymerized resin - luting agent paste base and catalyst (panavia f 2.0; kuraray co. ltd, osaka, japan) were mixed and applied to the post space according to the manufacturers instructions . The posts were then seated to full depth in the prepared spaces using finger pressure and excess luting agent was removed with a sponge pellet . Subsequently, the bonding margins were light polymerized with a light - curing unit (hilux led 550; benlioglu dental, ankara, turkey) for 20 seconds . The tip of the polymerization unit was placed in direct contact with the coronal end of the posts and the specimens were irradiated . Core was built up around the fiber post with a light - cured composite resin (filtek p60, 3 m espe, usa) to a height of 4 mm . Then, the specimens were subjected to 2500 thermal cycles between 55c and 5c using a digital thermocycling machine (willytec / sd, mechatronik gmbh, munich, germany), with a dwell time of 60 seconds and a transition time of 15 seconds . For cyclic loading procedure, in each group, half of the prepared teeth (n=6) were mounted in acrylic blocks at an angle of 45 and were placed in a universal testing machine (zwickroll, z050, zwick gmbh, ulm, germany) for mechanical cycling . The upper rod of the cycling machine could apply load pulses from 15 n to 45 n at a frequency of 3 hz onto the core buildup . During cycling, the teeth were irrigated with water at 37c, as regulated by a thermostat . The specimens were cycled 100000 times at a crosshead speed of 1 mm / min . The other teeth from each group, which were not subjected to cyclic loading, were stored in distilled water until load cycling was completed . Each root was sectioned perpendicular to its long axis from the coronal to the apical direction under water cooling using a high - speed machine (meccatom t201a; persi co., france). Two slices, each 1-mm thick, were obtained from the root apical and cervical regions and 4 slices were finally prepared from each root . The thickness of each slice was measured by a digital gauge (mitutoyo cd15, mitutoyo co., kawasaki, japan). For each final slice, push - out bond strength was performed using a universal testing machine (zwickroll, z050, ulm, germany) at a crosshead speed of 0.5 mm / min until failure occurred . Push - out bond strength values were calculated in mpa by dividing this force by the bonded interface of the post segment, which was calculated with the following formula: a = n/2rhwhere is 3.14, r is the post radius, and h is the thickness of the slice in mm . After the push - out test, failure modes of the samples were assessed using a stereomicroscope (nikon eclips e600, tokyo, japan) at 20 and recorded as follows: cohesive, if the fracture occurred in the post or dentinadhesive, if the fracture occurred at post dentin interfacemixed, when a combination of adhesive and cohesive failure occurred cohesive, if the fracture occurred in the post or dentin adhesive, if the fracture occurred at post dentin interface mixed, when a combination of adhesive and cohesive failure occurred data were analyzed using statistical software (spss 13.0, spss inc ., mean and standard deviation of the studied groups for push - out bond strength are presented in table 1 . Results of three - way anova indicated that bond strength of fiber post to root dentin was not affected by the factors of mechanical cycling (p=0.549), surface treatment of root canal dentin (p=0.279) and their interactions (p=0.774); whereas, region of the root canal as the main factor showed significant differences (p=0.004). Push - out bond strength for cervical regions was higher in comparison with the apical regions (p=0.004). The interactions of mechanical cycling and region of the root canal and also surface treatment and region of the root canal was not significant (p>.05). The results showed that the adhesive failure was the most predominant mode of failure (fig 1). The results showed that the adhesive failure was the most predominant mode of failure (fig 1). In order to increase retention of fiber posts in the root canal, it is necessary to improve their clinical performance and long - term service . In vitro studies that simulate the clinical situations might be useful in this respect . To focus on these issues, the aim of the present study was to evaluate the effect of cyclic loading on the bond strength of quartz fiber posts to different regions of the root canal dentin after different surface treatments of the root canal dentin . The results indicated that mechanical cycling did not decrease the bond strength of quartz fiber posts to root canal dentin significantly, consistent with the results of studies focusing on stress distribution [1921]. This finding might be attributed to the better stress distribution of fiber posts due to similarity of their elastic modulus to root dentin . Concluded that mechanical loading has no adverse effects on the adhesion between two fiber posts and root dentin . In contrast, the results of a study by galhano revealed that the bond strength of zirconium post to root dentin is compromised when specimens are subjected to cyclic loading . Rigidity and high modulus of elasticity of zirconia posts concentrate stresses at the post - dentin interface . Reported that flexibility of the post plays an important role in the bond strength of the post to root dentin after load cycling . The results of this study showed that chemical solvent application, phosphoric acid etching and treatment with ultrasound file did not significantly increase the bond strength of fiber posts to root dentin . Pretreatment of root dentin with acid removes the smear layer and smear plug, opens dentinal tubules, demineralizes intertubular and peritubular dentin and exposes the collagen fibers . Inter - diffusion zone forms on the etched dentin substrate by penetration of adhesive resins . However, the present study demonstrated that the bond strength did not significantly increase after treatment with phosphoric acid . . Demonstrated that application of phosphoric acid could significantly increase bond strength . An explanation could be that the applied bonding system and resin cement used in their study was different . Application of a chemical solvent did not significantly increase the bond strength of fiber posts . Conversely, demiryurek et al . Showed that the bond strength of fiber posts significantly increased after treatment with sikko tim (chemical solvent). The chemical solvent removes the remnants of resin sealer and gutta - percha and increases the bond strength between the resin cement and dentin . In this study, treatment with ultrasound file did not significantly improve the bond strength . Zang et al . Demonstrated that ultrasonic agitation in combination with edta / naocl irrigation improved the push - out strength of the fiber post . In their study, a chemical irrigant was applied in combination with ultrasonic agitation and this may explain the negative results . In addition, a previous study reported that treatment with ultrasound file increased the bond strength of fiber posts . A combination of etching and ultrasound file was applied in that study, while we used only ultrasound files . The results of push - out bond strength for different root regions in this study revealed that the bond strength was significantly affected by the region of the root canal . Push - out bond strength for the cervical segments in this study was higher than that for the apical segments . An explanation for this could be low - density tubules and orientation of tubules in the apical regions of the root canal . A favorable handling in the cervical rather than the apical region leads to better achievements and higher bond strength . The results of the present study were consistent with the studies conducted by ohlmann et al . And kalkan et al . It was found that adhesive fracture was the most common mode of failure, confirming that the weakest area was the post - dentin interface . In this study, the specimens were loaded 100000 cycles under 1545 n, representing the recorded occlusal forces during mastication and swallowing . In the present study, the push - out test was used for measuring the bond strength of the cemented fiber posts . Application of the thin - slice design of specimens in this test provides uniform distribution of the stresses . In addition concluded that a push - out test is more accurate than a microtensile technique and there is a narrow spread for data distribution . Moreover, in measuring the bond strength with the micro - tensile test, more premature failures occurred compared with the push - out test . It is necessary to carry out further studies to reinforce bond in post - cement - dentin interfaces . In this study, only various treatments on dentin surface with an adhesive system and a luting cement were evaluated; it is recommended to assess different adhesive systems and luting cements . Based on the results presented in this research, push - out bond strength for the cervical region was higher than that for the apical region . It was shown that the bond strength of fiber post to root dentin was not affected by the mechanical cycling and different surface treatments of root canal dentin.
Peri - implantitis is inflammation of the peri - implant supporting tissue, which can lead to progressive loss of supporting bone, if untreated . A history of periodontitis, poor oral hygiene, and smoking are considered risk factors for peri - implant diseases . It is of paramount importance to treat periodontitis of the residual dentition prior to implant placement . A higher implant failure rate and elevated number of sites with peri - implant bone loss were documented in periodontally compromised patients who did not adhere to comprehensive supportive periodontal therapy . Customized and correctly performed supportive periodontal therapy is essential to enhance the long - term outcome of implant therapy . The outcome of non - surgical periodontal treatment (nspt) of peri - implantitis is unpredictable . Although minor beneficial effects of laser therapy on peri - implantitis have been shown, this method requires further evaluation . The diode laser is not an ablative instrument and can directly contact the implant surfaces without inducing melting, cracking, or crater formation . The 810-nm diode laser, when used in accordance with appropriate parameters, does not damage titanium surfaces, which is useful when uncovering submerged implants, and can be used to treat bacterial induced peri - implantitis . The use of laser treatment in periodontal therapy is an emerging therapeutic option, although little reliable evidence suggests that it can effectively treat peri - implantitis . A 45-year - old male presented with pain and swelling at a mandibular implant site (nobel biocare, sw). Clinical examination revealed a deep pocket [7-mm pocket depth (pd)] and bleeding on probing [figure 1], with suppuration and gingival inflammatory edema at the implant site . The patient was in good general health, did not take any medications, and was an occasional smoker (4 - 5 cigarettes / day). Clinical examination revealed 7-mm probing depths, circumferentially around a mandibular implant, bleeding on probing, and the presence of exudate and gingival inflammatory edema no occlusal trauma or parafunctional habits were detected . A periapical radiograph demonstrated bone loss of five fixture threads on the most distal mandibular left implant, when compared to the original radiograph [figure 2]. Periapical radiography shows bone loss for five fixture threads on the most distal mandibular left implant the patient was eventually scheduled for periodontal surgery to treat the inflammatory lesion, but emergency intervention was indicated to disinfect the area by removing the bacterial biofilm and alleviating pain using an 810-nm diode laser [figure 3]. The patient was treated using an 810-nm diode laser to disinfect the area and facilitate bacterial biofilm removal by mechanical and manual periodontal instrumentation the patient was asked to rinse with undiluted chlorhexidine 0.2% for 1 min . After insertion of the optical fiber parallel to the long axis of the implant 1 mm from the most apical portion of the pocket, the diode insert was moved in an apico - coronal and mesio - distal direction for 30 sec at each inflamed implant site . It was used at a power of 0.5 w in a continuous wave (cw) [equivalent to 1 w in pulsating mode (pw) for 30 s] in duplicate on each site, for a total time of 360 sec with a fluence of 1.96 j / cm . Non - surgical periodontal instrumentation was performed with hand instrumentation using a titan curette (roncati implant care, by martin kls) and a piezoelectric ultrasonic device with plastic fused to a metal insert (piezon master 700, ems, pi insert), as needed . Finally, a 0.5% chlorhexidine gel was deposited into the sulcus with a disposable syringe and a blunt needle . The area was checked for plaque removal and home care compliance for the first month on a weekly basis and was followed by routine supportive periodontal therapy at 3-month intervals . The adjunctive use of the diode laser was included in the conventional periodontal maintenance every 6 months for the following 3 years . Periodontal indices were documented and intraoral periapical radiographs were taken at the 1-year [figure 4], and 2-, 3-, 4-, and 5-year [figures 5 and 6] follow - up recall appointments . Periapical radiograph: 1-year post - non - surgical treatment periapical radiograph: 5-year follow - up clinical probing depth: 5-year follow - up satisfactory results were obtained by the application of laser - assisted non - surgical peri - implant therapy . Periodontal pocket depth was reduced from 7 to 3 mm with no bleeding upon probing . Intraoral periapical radiographs, taken for up to 5 years post - non - surgical treatment, provide evidence of some improvement of the bone level . The reduction of periodontal pockets is probably due to re - epithelialization, with formation of a long junctional epithelial attachment . At the 6 european workshop on periodontology, it was reported that mechanical non - surgical therapy with an adjunct of local antibiotics or laser application was effective longitudinally to reduce bleeding on probing and pds over a period of 6 - 12 months . However, the outcome is unpredictable due to possible re - infection related to the inability to completely remove bacterial deposits from titanium implant surfaces, thus interfering with new histological bone - to - implant contact . The primary objective of non - surgical treatment for peri - implantitis is to remove bacterial contaminants to allow resolution of the inflammatory lesion . To date, no critical probing depths in the therapy of peri - implant diseases have been defined to guide selection of a non - surgical or surgical approach . Laser treatment may serve as an alternative or adjunctive treatment to conventional periodontal mechanical therapy or peri - implantitis . Diode lasers have a bactericidal effect due to a localized increase in temperature, which has been verified in vivo using dna probes that detect periodontal pathogens . Threaded implants have a different morphology than root surfaces; therefore, debridement instruments might be different . The laser may be a valuable tool to detoxify the implant surface [figure 7], and significant bacterial reduction should lead to a more satisfactory recovery . It is possible to point the diode laser insert toward the wall of the ulcerated pocket epithelium to kill virulent periodontal pathogens . Vaporization of granulomatous tissue seems to result in a more favorable effect compared to that of solo instrumentation . Threaded implants have a different morphology than root surfaces; therefore, debridement instruments may differ . The laser may facilitate detoxification of the implant surface the diode laser detoxifies root and implant surfaces by inactivating bacterial endotoxins . The thermal effect weakens calculus chemical adhesion to the root and/or implant, facilitating its removal by curette or ultrasonic devices . The diode laser also stimulates fibroblasts and osteoblasts, which, in turn, cause increased production of rna messengers, leading to significant collagen production during periodontal tissue healing . The patient experienced no postoperative discomfort and he was able to comply with home care procedures, such as debridement, after the surgery . In contrast, patients often have post - treatment discomfort, and compliance with home care procedures decreases because the recommended home care protocols for plaque control are painful; this results in impaired healing . Important changes were also detected in the patient: bleeding, a marker of inflammation with a high prognostic value, was compared at baseline and at 1 year after laser - assisted periodontal therapy, and was reduced significantly to <20% . Absence of bleeding has a negative predictive value . Besides laser therapy, the following therapeutic interventions all of these combined may have contributed to healing, complicating isolation of the most effective modality . The laser has been used as an adjunct to many periodontal treatments, but it is not a replacement for conventional non - surgical treatment or proper home care with adequate patient compliance . The absence of attached gingiva may be an etiological factor in the development of peri - implantitis; this issue is controversial . Traditional protocols of non - surgical periodontal therapy, in conjunction with the use of an 810-nm diode laser, can be an effective alternative treatment modality for peri - implantitis . Other treatment options may successfully enhance resolution of peri - implant soft and hard tissue inflammation, and preserve long - term periodontal health . Regardless of the method used, correctly performed supportive periodontal therapy is a key factor in successful implant therapy.
The amyloid- (a) peptide is believed to play a key pathogenic role in alzheimer s disease (ad). In vivo, a is characterized by a distribution of isoforms, mostly varying in length from 38 to 43 residues . The most prominent isoform, a40, typically occurs in a 10:1 ratio to the more amyloidogenic isoform, a42 . Knowledge of the origin of the a isoform distribution, and its dependence on sequence, environment, and cofactors, is critical to our understanding of the etiology of ad . A is the product of cleavage of app - c99 (c99), the 99 amino acid c - terminal fragment of the amyloid precursor protein (app), by -secretase . C99 consists of a single transmembrane (tm) helix flanked by less structured extra- and intracellular domains . Processive cleavage is initiated in the c - terminal tm helical region and proceeds toward the n - terminus . Cleavage of c99 has been correlated with a number of factors, including peptide sequence and stability of the tm helix . While the degree of homodimerization of c99 has also been discussed as a potentially important factor in c99 processing, the cleavage of c99 dimers has not yet been definitively demonstrated . Environmental influences such as membrane composition, membrane curvature, and the presence of cholesterol may also play critical roles . It has been openly debated whether a quantitative description of c99 homodimerization structure is essential to a complete understanding of the mechanism of cleavage of c99 by -secretase and the genesis of the a isoform distribution . Multhaup and co - workers first recognized that modifications in sequence that reduced homodimer affinity impacted cleavage of c99 by -secretase . Subsequently, studies of homodimer formation in wt and mutant c99 congeners have provided support for the view that c99 homodimerization is critical to c99 processing by -secretase and a formation . However, it has also been argued that c99 homodimerization is weak and may be largely irrelevant in vivo, suggesting that -secretase acts on c99 monomer only as substrate in the production of a. additionally, while tycko and co - workers suggest that the structure of the tm region of c99 depends on membrane composition, recent work by sanders and co - workers supports the view that at least the backbone structure of c99 is largely independent of membrane lipid composition . In contrast, smith and co - workers suggest that the a product distribution following cleavage of c99 by -secretase may depend on the specific structure assumed by the c99 homodimer, which may depend on sequence and membrane composition . Although there is debate over the relevance of c99 homodimer in the processing of c99 to form a, there is little doubt that c99 homodimer is an essential species in the overall ensemble of c99 structures . The earliest proposed structures for the homodimer of the tm region of c99 (figure 1) were right - handed coiled - coils stabilized by favorable interactions at the interpeptide interface facilitated by the gxxxg motif . This motif promotes a right - handed crossing in the -helices by providing a good surface for packing and permitting close helix proximity . In contrast, one recent nmr structure suggests that the structure of gs- c991555 (c991555 plus two non - native amino acids at the n - terminus) consists of a left - handed coiled - coil structure stabilized by interpeptide contacts facilitated by a heptad - repeat motif involving g38 and a42 . A more recent nmr structure of c992355 homodimer finds a right - handed coiled - coil stabilized by interpeptide contacts in the c - terminal region . Depiction of c991555 dimer in a popc lipid bilayer (left) and in a dpc micelle (right). The phosphocholine group is shaded orange (popc) or yellow (dpc). These contrasting results suggest that a number of fundamental questions related to the structure and processing of c99 in the production of a, including the structure of c99 monomer and homodimer, the sensitivity of monomer and homodimer structure to sequence and membrane, and the relevance of homodimer formation to c99 processing, remain open and require further scrutiny . Here we address a number of critical questions regarding the nature of the c99 homodimer strucure and its dependence on membrane or micelle characteristics . What is the structural ensemble of the c99 homodimer in a micelle environment? How well do structures of c99 homodimer in a micelle represent the structural ensemble in a lipid bilayer? To answer these questions, we carried out multiscale simulations of c991555 dimer in popc bilayers and dpc micelles building on our previous successful predictions of the monomer structures . We used coarse - grained (cg) simulations with the martini force field of a broad sampling of the peptide dimer and lipid / surfactant ensemble . Our model is benchmarked against the well - studied glycophorin a (gpa) dimer and used to develop novel predictions for the c991555 dimer . Following the identification of the predominant structural states through cg simulations, representative conformations in all - atom molecular dynamics simulations were used to refine the atomistic structure and characterize the detailed peptide peptide, peptide the major finding of our work is that the structural ensemble in a bilayer is heterogeneous, consisting of multiple states, whereas in a micelle only one state is predominantly selected . Globally the curvature of the bilayer and micelle is different, which has a profound influence on the conformational heterogeneity . More generally, our study demonstrates that the chemical environment imposes a selection on the nature of the app dimer ensemble . The environmental selection of the structure is yet another variable, besides sequence, which can affect the plasticity of app, and hence the product distribution upon cleavage by secretases . Initial conditions for the cg parametrization were taken from the experimentally derived structures determined by nmr in dodecylphosphocholine (dpc) micellar environment (pdb 2loh) using the martinize.py script and the martini 2.2 force field for proteins . To build the popc cg systems, two spatially separated c991555 monomers were overlapped with the pre - equilibrated lipid systems taken from the marrink web site (http://md.chem.rug.nl/cgmartini/). All lipid and water residues within 1.5 of the cg peptide were removed . For the dpc cg systems the same dimeric 2loh structure was used . A dimer was embeded in a pre - equilibrated dpc cg micelle box also taken from the marrink web site . The cg bilayer system consisted of a c991555 dimer, 256 popc lipids, 3863 water particles, and 6 cl ions to neutralize the system . The cg micelle system contained c991555 dimers, 54 dpc lipids, 5597 water particles, and 6 cl ions . Additional cg simulations were performed using 70 and 108 dpc surfactant molecules (see supporting information). For the cg simulations a total of 50 replicas with 1.5 s of md were performed on each system in order to see convergence in the computed distribution of homodimer structures (see figures s1 and s2). Nonbonded interactions were truncated using shift functions (between 0.9 and 1.2 nm for lennard - jones interactions and between 0 and 1.2 nm for electrostatics). The temperature of the systems was set to 303 k using the berendsen weak coupling method with a coupling time of 0.1 ps . The pressure was set to 1 bar using a semi - isotropic coupling for popc and isotropic coupling for dpc using the berendsen algorithm . A cg structure from each of the different states in the popc bilayer and dpc micelle (gly - in, gly - side, and gly - out) was randomly selected and reconstructed into an all - atom representation using pulchra . The structure with its orientation were resolvated in popc lipids or dpc surfactant using the charmm - gui membrane and micelle builder and modeled using the charmm36 all - atom lipid and protein force field and tip3p water model . The bilayer systems consisted of the c991555 dimers reconstructed from cg models, 128 popc lipids, tip3p water molecules extending 15 on each side of the bilayer, and 6 cl ions to neutralize the systems . The micelle systems contained c991555 monomer, 53 dpc molecules, tip3p waters to solvate a box extending 20 from the dpc surfactant and protein, and 6 cl ions to neutralize the system . For simulations in the popc bilayer a total of 100 ns of md were performed on each system (following minimization and a short nvt and npt equilibration with protein backbone fixed). The pressure was set to 1 bar using a semi - isotropic coupling scheme with lateral and perpendicular pressures treated separately with coupling time 0.1 ps using the parrinello the temperature of the system was set to 303 k and regulated using the nos the nonbonded interactions were truncated using shift functions (between 0.9 and 1.2 nm for lennard - jones interactions and between 0 and 1.2 nm for electrostatics). Long - range electrostatic interactions were calculated using the particle mesh ewald (pme) method with a fourier grid spacing of 0.12 nm . The linear constraint solver (lincs) method was used to constrain all bond lengths, with a 2 fs integration step . All - atom simulations in a dpc micelle were carried out under the same conditions using an isotropic coupling scheme to control the pressure . The simulations were carried out using gromacs (v4.5.1) and the analyses were performed using the gromacs package, the dssp program, and tailored scripts using python and md analysis libraries . The helanal program was used to calculate the kink angle along the tm helix between residues k28 and v50 . C991555 homodimer was simulated using cg molecular dynamics in a popc bilayer and dpc micelle (see figure 2). Multiple independent dynamical trajectories were initiated from the experimentally determined left - handed coiled - coil structure in a dpc micelle . All simulated replicas were observed to undergo conversion to a distribution that strongly favors right - handed helical packing (see figure 2). Simulated distributions for a cg model of the c991555 homodimer in popc membrane (left panel) and dpc micelle (right panel) projected onto the order parameters 4 g and dgg . 4 g is the dihedral angle formed by g29a - g37a - g37b - g29b, where a and b label the two c991555 monomers, and dgg is the interhelical distance between g33a - g33b . The system sequence is shown below the panels where g29, g33, and g37 are highlighted and the tm helical domain is shaded . The black triangles depict the values of 4 g and dgg obtained from the experimentally derived nmr structure of c992355 . The structure of the homodimer is conveniently characterized in terms of an interhelical distance, dgg and a dihedral angle, 4 g that differentiates the handedness of the coiled - coil . The 4 g order parameter is positive for left - handed structures and negative for right - handed structures . Structures stabilized by interpeptide interactions facilitated by the gxxxg repeat region are characterized by small values of the dgg parameter . The first experimentally derived solution phase nmr structure of the c991555 homodimer in a micelle is characterized by a left - handed coiled - coil geometry with 4 g = + 31 and dgg = 20, forming an x - like homodimer configuration with minimal interpeptide contact in the g38xxxa42 region . In contrast, a more recent experimentally derived nmr structure of the shorter c992355 homodimer in a a micelle is characterized by a right - handed coiled - coil geometry with 4 g 25 and dgg 14 . The simulated homodimer distribution in popc bilayer and dpc micelle environments are dominated by right - handed coiled - coil conformations . However, the broad distribution of homodimer conformations as a function of dgg (see figure 2) reflects the existence of distinct conformational states, implying considerable heterogeneity in the structural ensemble . Structural ensembles of two c991555 monomers in a popc bilayer, derived from 50 independent cg replica simulations (see above), are presented in figures 2 and 4 . Interestingly, the c991555 homodimer assembled spontaneously on the time scale of a few hundred nanoseconds . This suggests that the sampling achieved with the cg model effectively represents the equilibrium homodimer structural ensemble in this single - component popc lipid bilayer . Although there are three characteristic states in the popc bilayer, a significant shift in population between substates is observed in the dpc micelle environment . In particular, while the homodimer in a popc bilayer is predominantly found in the gly - in substate, in the dpc micelle the homodimer is dominanted by gly - side and gly - out conformations . Analysis of the dimer ensemble (see figures 2 and 4) clearly shows the existence of multiple conformational state populations . Crick identifies the location of a residue relative to the axis between the two helices (figure 3). Smaller values (between 0 and 60) identify residues closer to the dimer interface, while larger angles (close to 180) denote residues on opposite sides of the interface . For the competing structural states, we find (1) gly - in configurations with close interpeptide contacts facilitated by exposure of backbone carbonyls in the gxxxg repeat region (small dgg, small crick), (2) gly - out configurations characterized by glycine repeats facing the outside of the homodimer interface (large dgg, large crick), and (3) gly - side configurations characterized by out - of - phase values of crick (intermediate dgg, small / large or large / small crick). Similar observations have been made in past computational studies of c99 homodimerization employing simplified models . Our results are consistent with those general observations, while providing a more detailed analysis of the homodimer ensemble and its dependence on environment . Definition of crick corresponding to the angle between (1) the vector connecting the axis points of the two helices and (2) the vector connecting the c of a given residue to its corresponding -helical axis point . We define crick to be the average of the g33 and g37 dimer crick angles in order to characterize the g33xxxg37 interface . Most representative structure is a gly - in state for the popc bilayer (top left) and gly - out state for the dpc micelle (top right). Simulated distributions for a cg model of the c991555 homodimer in popc membrane (bottom left) and dpc micelle (bottom right) projected onto the crick angles characterize the relative orientation of peptides within a homodimer . The black triangles depict the values of crick obtained from the experimentally derived nmr structure of c992355 . The atomic coordinates of the most representative structures (gly - in, gly - side and gly - out) have been deposited as supporting information . Figure 5 shows the distance between residues ak28 and bk28 (kk28) or ak54 and bk54 (kk53) where a and b indicate different monomers . The two distances represent the separation between the interfacial residues of the tm helices, and is a good measure to characterize the global topology of the dimer structure . Parallel or ll - like structures are characterized by both smaller kk28 and kk54 distances (5), -like structures show smaller kk28 distances and larger kk54 distances, x - like structures show large kk28 and kk54 distances (15), and y - like structures have small kk54 and large kk28 distances . Simulations in popc adopt predominantly ll - or -like conformations consistent with our previous computational predictions of c992355 homodimer in a membrane environment . We predicted a -like right - handed helical dimer structure in agreement with solid state nmr studies with a predominantly gly - in orientation between the helices . In contrast, the dpc micelle simulations show larger populations of y- or x - like structures with a predominantly gly - out orientation between the helices (figure 4). Distance between ak28 and bk28 (kk28) and ak54 and bk54 (kk54) in popc bilayer (left) and dpc micelle (right) colored by the most populated 4 g: red, green, and blue correspond to gly - in, gly - side, and gly - out conformations for data of cg simulations . The spot size corresponds to the number of structures for that particular kk28 and kk54 conformation . The black triangles are the values of kk28 and kk54 obtained from the experimentally derived nmr structure of c992355 . On the lower section the most representative -like (far left) and ll - like (center left) conformations for the simulations in popc bilayer x - like (center right) and y - like (far right) conformations for the dpc micelle environment are shown in red . The k28 and k55 residues are indicated with orange spheres . Results of additional cg simulations performed using 70 and 108 dpc surfactant molecules are shown in figure 6 . Qualitatively, we see that the x - like strucures are dominant for all micelle sizes . As the number of surfactant molecules is increased, there is a broadening of the distribution of x - like states . These results suggest that the micelle environment suppresses the sampling of gly - in conformations and favors x- and y - like structures, largely independent of the size of the micelle . Left: distance between ak28 and bk28 (kk28) and ak54 and bk54 (kk54) colored by the most populated 4 g: red, green, and blue correspond to gly - in, gly - side, and gly - out conformations for data of cg simulations in 70 dpc surfactant molecules . The right panel corresponds to kk28 and kk54 for the c991555 system in 108 dpc surfactant molecules . The spot size corresponds to the number of structures for that particular kk28 and kk54 conformation . We performed all - atom simulations using charmm36 in popc bilayer and dpc micelle environments, starting from representative cg structures from the gly - in, gly - side and gly - out homodimer conformational states . Experimental data suggest that the average stability of the tm helix is similar for monomeric peptide and peptide associated as a homodimer . Average helicity of each peptide in the micelle and bilayer is shown in figure 7 . We also show results for the simulated helicity of c991555 monomer in dpc micelle and popc lipid for comparison, along with experimentally derived helicity values for monomeric c99 in a micelle . The average helicity in the tm domain of the simulated peptide is in good agreement with the experimentally measured helicity, while helicity in the juxtamembrane (jm) domain is somewhat larger in the simulated structures . This could result from differing size of the hydrophobic core in the micelle versus the bilayer, as the higher water accessibility in the micelle is expected to impact the stability of the helix structure, as well as the differing head groups and interfacial environments of the dpc (zwitterionic, simulation) and lmpg (anionic, experiment) micelles . Average helicity over the three different states (gly - in, gly - side, and gly - out) calculated from all - atom simulations of c991555 homodimer in a popc bilayer (above) and dpc micelle (below). Thin black lines show results for helicity of c991555 monomer in the corresponding micelle or bilayer . The gray shadow shows experimentally determined helicity based on c nmr chemical shift measurements for monomeric c99155 in an lmpg (lysomyristoylphosphatidylglycerol) micelle . Structural fluctuations in the kink angle are enhanced and less symmetric in the c991555 homodimer in a dpc micelle relative to the homodimer in a popc bilayer, while fluctuations in homodimeric c991555 are smaller in magnitude than those observed for the c991555 monomer (see figure 8). In particular, in the vgsn region we found more substantial fluctuations in the helicity that can be related to the surface curvature of the micelle environment . Our results indicate that a structural kink appears near g37/g38 in the c991555 monomer in a popc bilayer and dpc micelle, as has been proposed for the monomer structure based on experimental results for c99155 in a lpmg micelle . A structural kink is also observed near g37/g38 in the c991555 homodimer in the dpc micelle environment . However, simulations of c991555 in dpc micelles show additional structural kinks in the tm helix . Greater kink angles are induced in an attempt to match the hydrophobic length of the tm helix with the hydrophobic thickness of the small dpc micelle . Gly - in conformations that destabilize the tm - c domain show a large kink at t43, while gly - out structures that destabilize the tm - n helix show a large kink at g33 . Measurement of the observed kink angle for each peptide of the all - atom simulations of c991555 homodimer in a popc bilayer (top) and dpc micelle (bottom). For the three different systems, gly - in (dark pink), gly - out (blue) and gly - side (green), the filled curve represents the difference a bkink = akink bkink, where akink and bkink are the kink angles of peptides a and b, respectively . The hinge angle in the c991555 monomer is shown in black for popc bilayer and dpc micelle simulations . Densities of the lipid phase of the popc bilayer and dpc micelle were computed using all - atom simulations of the c991555 homodimer (figure 9). Superimposed on the density profiles are distributions of key peptide residues . Importantly, although the density profiles of the lipophilic phase of the bilayer and surfactant micelle are similar, the solvent distributions in the two environments are dramatically different . In addition, the relative positions of key residues, including the -cleavage site, are significantly shifted relative to the center of the lipophilic phase in the dpc micelle when compared to the popc bilayer . Density distribution of the lipid phases (shadow) for the all - atom simulations of the popc bilayer (above) and dpc micelle (below). Superimposed are the distributions of c positions of key residues along the z - axis for dimer a (solid lines) and dimer b (dashed lines) of c991555 for gly - in (red), gly - out (blue), and gly - side (green) conformations . The number of waters molecules (nw) within 4 of each amino acid of the dimers are indicated by blue bars . The epr power saturation data derived from experimental measurements is shown for comparison (black dashed line). A recent study involving h / d exchange experiments on the c99 peptide, complemented by molecular dynamics simulations of c992855 in a popc bilayer, provided insight into the stability of helical regions of c99 including the tm helix . Considering the hinge at g37/38 to be a flexible divider in the tm helix, the n - terminal region of the tm domain (tm - n helix) showed enhanced h / d exchange relative to the c - terminal portion (tm - c helix). Our simulation results for the c991555 homodimer in a dpc micelle, in which a dominant hinge and less stable tm - n domain are observed, are consistent with those experimental and computational results . Studies have indicated that membrane protein structure in micelles and membranes can be similar for certain systems . The gpa homodimer has been extensively studied in micelle and bilayer environments, through both experimental and computational approaches, making it an excellent reference system for understanding environmental effects on the c991555 homodimer . Homodimerization of gpa in a micelle has been explored using all - atom molecular dynamics simulation, yielding good agreement with known experimental structures . Moreover, simulations employing an all - atom model of the gpa homodimer in dpc surfactant micelle and dmpc / dhpc lipid bicelles found the general topology of the homodimer to be similar in both environments . In contrast, other studies have noted a dependence of protein structure and association on the differing structural environments of micelles and bilayers, as well as the particular detergent composition of micelles or lipid composition of membrane bilayers . There is substantial evidence that for a particular membrane system, a careful choice of detergent must be made to create a micellular environment in which the protein conformational ensemble is similar to that in a membrane bilayer . It has been observed that dimerization of gpa can be modulated by detergents, with variations in alkyl chain length and headgroup nature (ionic, zwitterionic, and nonionic) potentially influencing helix stability and helix dimerization . As a result, variations in detergent may impact helix dimerization while having little impact on helix stability . Finally, it is known that tm helical structure and stability can show a strong dependence on lipid composition in membrane bilayers . As in the case of c99, dimerization of the gpa tm domain has been proposed to be a consequence of favorable intermolecular interactions facilitated by gxxxg motif repeats . We have simulated the sequence of gpa62101 using the same multiscale simulation approach employed in our study of c99 . The gpa62101 sequence includes a tm helical domain and n - terminal juxtamembrane domain, as is the case in c991555 . Good order parameters for the homodimer structures in gpa (c99) are (1) dihedral angle gt formed by g18a - t26a - t26b - g18b, where a and b label the two gpa62101 monomers, (2) interhelical distance dgg between g22a and g22b, and (3) the crick angle crick of the gxxxg motif . The gt order parameter is positive for left - handed structures and negative for right - handed structures . Structures stabilized by interpeptide interactions facilitated by the gxxxg repeat region are characterized by small values of the dgg parameter and small values of gt . Experimentally derived nmr structures are found to agree well with the simulation predictions in terms of (gt, dgg). Differences of 15 are observed in the comparison of crick angles between experimentally derived and computationally predicted structures . The observed differences may result from inherent limitations in the spatial resolution of both the coarse - grained model employed in our study and experimental data . Left: simulated distributions for a cg model of the gpa62101 homodimer in a popc bilayer projected onto the order parameters gt and dgg (top), and onto the crick angles crick (bottom). The panels on the right corresponds to gt and dgg (top) and crick angles (crick) (bottom) for the gpa62101 system in 56 dpc surfactant molecules . Triangles represent nmr structures derived from gpa62101 in dpc micelles (1afo, black), gpa7098 in dpc micelles (2kpe, green), and gpa6198 in dmpc / dhpc bicelles (2kpf, red). Our simulations results suggest similarities between between the dpc micelle and popc bilayer simulations of gpa62101 and c991555 homodimers, as well as sequence specific effects differentiating the two dimer ensembles . (1) the strucural distribution of c991555 dimer is signficantly more diverse than in the case of the gpa62101 homodimer . (2) in both gpa and c99 homodimers, the structural ensembles are found to be significantly more diverse in the bilayer environment, relative to the micelle, consisting of multiple distinct conformational substates . In the dpc micelle, only one of the substates tends to be represented as it is selectively stabilized by the micelle geometry and surface curvature . It is useful to note that while gpa explores gly - side and gly - out homodimer conformations in a bilayer environment, the distribution is substantially more focused and dominated by right - handed gly - in structures than in the case of c991555 homodimer . The results of this study, showing a clear dependence of c991555 homodimer structure on micelle and bilayer environment, are consistent with this understanding . The earliest predicted structures for the c992355 fragment, containing the tm helical domain, proposed a right - handed coiled - coil structure consistent with the gly - in topology described in this work . A recent nmr structure of the c992355 homodimer in a dpc micelle environment is also a right - handed coiled - coil, although of the gly - out topology . An earlier nmr structure for the c991555 homodimer in a dpc micelle environment led to the proposal of a left - handed coiled - coil of the gly - out topology . However, it was noted the homodimer ensemble may well contain right - handed and left - handed coiled - coil structures . It is expected that both the length and sequence of the c99 fragment are critical to the ultimate homodimer structure . While dimers formed from the wt tm domain alone are almost certainly right - handed coiled - coils in most environments, it is possible that introducing mutations within the tm domain or the addition of the jm domain could lead to a shift in the relative population of one of the various dimer states (gly - in, gly - side, or gly - out) or a change in the handedness of the homodimer . It has been observed that small changes in sequence can strongly impact binding affinities for tm homodimers . Our study has focused on the c991555, while the work of the arseniev laboratory is based on gs - c991555, in which two non - native amino acids (gs) have been added to the n - terminus . It is possible that the addition of these residues, not included in our computational study, could impact the structure of the jm domain and also the handedness of the resulting homdimer relative to c991555 . In this context, it is important to note that our study focuses on c991555 rather than full - length c99 . Therefore, our results must be considered to provide insight into, but not fully represent, the properties of the full - length peptide . Additional analysis shows good agreement between chemical shifts computed from our simulated homodimer structures and experimentally derived chemical shifts (see figures s3 and s4). However, the experimentally derived noe data provide unambiguous support for a left - handed coiled - coil structure of gs- c991555 homodimer in dpc micelle . This suggests that the chemical shifts are largely determined by the secondary structure of the peptide and local environment and are weak reporters on the nature of the tertiary coiled - coil geometry . The findings of this paper provide a complete and self - consistent framework for organizing the existing experimental and computational results . For structures of the tm domain represented by the c992355 peptide, computational and experimental results suggest that in most membrane and micelle environments the structure is a right - handed coiled coil . The particular homodimer topology will depend on the membrane thickness or micelle size and curvature, with thinner environments (dmpc bilayer) and those with substantial surface curvature (dpc micelle) selecting gly - out topologies, with thicker environments (popc bilayer) selecting gly - in structures . Evidence from this study as well as the available nmr structures suggest that the handedness of the coiled - coil structure adopted by c991555 is ultimately primarily determined by (1) a preference of the tm domain of the wt protein to form a right - handed coilded coil, (2) characteristics of the membrane or micelle thickness and surface curvature, and (3) the secondary structure and relative position of the jm domain . In our study of the wt c991555 in popc bilyaer and dpc micelle, we have largely assumed that the jm domain is helical, leading to a preference for a right - handed coiled - coil structure . However, fluctuations in the structure of the jm domain and its orientation relative to the tm domain may lead to a relative stabilization of left - handed coiled - coil strutures . Overall, the homodimer ensemble must be considered to consist of left- and right - handed coiled coils, representing gly - in, gly - side, and gly - out topologies . The handedness and topology of the dominant homodimer structure will be determined by the protein sequence and the bilayer or micelle . We find the c991555 homodimer structural ensemble in popc micelles and dpc bilayers consists of multiple conformational states that are structurally distinct and largely characterized by the relative orientation of the peptide helices . A dynamic hinge near g37/g38 is observed to divide the tm helix, with structural fluctuations being greater in the micelle than in the popc bilayer environment . Dimerization results in little change in helix stability in the popc bilayer, but a measurable decrease in helix stability is observed in the dpc micelle . Although the dimer ensemble in either environment is characterized by multiple conformational states, the dominant structures observed in our simulations in both the dpc micelle and popc bilayer are consistently right - handed coiled - coil structures, supporting the conclusions of earlier experimental and computational studies . The relative importance of particular states is modulated by the c991555 homodimer environment . The gly - in substate (stabilized by interpeptide contacts facilitated by the gxxxg motif repeats) is predominant in a popc bilayer environment, while the gly - out conformation (stabilized by interpeptide contacts consistent with a heptad repeat motif including g38 and a42) is dominant in a dpc surfactant micelle environment . Our results suggest the dpc micelle environment suppresses interactions mediated by gxxxg repeats in the tm region, leading to an x - shaped structure that best satisfies the boundaries of the surfactant / solvent interface . In this way, the environment selects a predominant substate through membrane thickness, interfacial curvature, and peptide - lipid interactions . Past computational studies of homodimers of the tm domain of c99 have noted similar heterogeneity in the homodimer ensemble . Moreover, it has been proposed that the tm domain of c99 may be processed to the sites depending on its dimerzation state and on the orientation of the tm helices in the dimers . Our findings support these prior studies suggesting a role for membrane in modulating the formation of specific c99 homodimer structures for processing by secretases, as well as our interpretation of structures derived in diverse micelle environments.
Mammography is the primary imaging modality for the early detection of breast cancer . Despite advances in mammographic techniques (digital), mammography still has its limitations with regard to both sensitivity (65.685.5%) and specificity (87.794.3%). Mammograms are coded using the ordered categories of the american college of radiology (acr) breast imaging reporting and data system (bi - rads) lexicon: category 1, negative; 2, benign finding; 3, probably benign; 4, suspicious finding; 5, highly suggestive of malignancy . The diagnostic work - up of breast lesions depends on the bi - rads classification of the breast lesions . The guideline for non - invasive diagnostic tests for breast abnormalities of the agency for health care research and quality in the united states (ahrq) states that breast lesions classified as bi - rads 1 and 2 require no further work - up or follow - up other than routinely called for . The chance of a bi - rads 4 lesion being malignant varies from 2% to 95%, whereas this chance is over 95% for a bi - rads 5 lesion . This biopsy procedure cannot be replaced by breast magnetic resonance imaging (mri), because histology is obligatory in these cases . The most difficult mammographic lesions are the lesions that are classified as bi - rads 3 . The probability of a bi - rads 3 lesion being cancer is considered to be less than 2% . For the work - up of a bi - rads 3 lesion, biopsy or follow - up, the decision on the work - up of bi - rads 3 lesions depends on the possibilities for biopsy procedures, the wishes of the patient and the preference of the radiologist . Most patients who are referred for a biopsy have benign disease because of the low predictive value of both physical examination and mammography . The value of breast mri in bi - rads 3 lesions is not yet clear . Breast mri is emerging as a clinically useful additional diagnostic tool and has an excellent sensitivity and negative predictive value (npv), which usually exceeds 90% . The diagnostic accuracy of breast mri varies with the expertise of the radiologist and the particular patient population studied . It is important that breast mri is used for those groups of patients for whom there is evidence of acceptable diagnostic accuracy . Breast mri as a first - line imaging modality is performed by screening women at increased risk for breast cancer . As a second - line modality, breast mri can be used for the following indications: inconclusive findings in conventional imaging, preoperative staging, axillary node malignancy and unknown site of primary tumor, the evaluation of therapy response in the neoadjuvant chemotherapy setting, imaging of the breast after conservative therapy, prosthesis imaging, nipple discharge and mr - guided biopsy and lesion localization . Although the npv of mri in breast cancer is the highest of all imaging techniques and in most cases a negative breast mri excludes malignancy, it is not yet common practice to use breast mri as a problem - solving modality in excluding patients for further diagnostic work - up . Therefore, in this meta - analysis, the usefulness of breast mri as a problem - solving modality in patients with mammographic bi - rads 3 lesions is investigated . A computerized search was performed to identify relevant studies in medline and embase up to 2010 . The following strategy was followed in medline: magnetic resonance imaging [mesh term] or magnetic resonance imaging [text word] or mri [text word] or mr imaging [text word] and probably benign lesions [text word] or microcalcifications [text word] or inconclusive findings [text word] and mammography [mesh term] or mammography [text word] and sensitivity and specificity [mesh term] or specificity or sensitivity [text word]. In embase medline and embase were searched for studies that used breast mri as a problem - solving modality in mammographic bi - rads 3 lesions . Studies were included if the following inclusion criteria were met: (1) all patients underwent a mammography and breast mri; (2) the study population had mammographic bi - rads 3 lesions or mammographic bi - rads 3 microcalcifications; (3) accuracy, sensitivity, specificity, positive predictive value (ppv) and/or npv was / were measured; (4) studies with original data that were published in peer - reviewed journals . Forty - one out of the 52 studies were excluded based on the title . From the 11 remaining studies the abstract or full paper was reviewed . Four studies were excluded because no bi - rads classification was used and 2 studies were reviews . A computerized search was performed to identify relevant studies in medline and embase up to 2010 . The following strategy was followed in medline: magnetic resonance imaging [mesh term] or magnetic resonance imaging [text word] or mri [text word] or mr imaging [text word] and probably benign lesions [text word] or microcalcifications [text word] or inconclusive findings [text word] and mammography [mesh term] or mammography [text word] and sensitivity and specificity [mesh term] or specificity or sensitivity [text word]. In embase medline and embase were searched for studies that used breast mri as a problem - solving modality in mammographic bi - rads 3 lesions . Studies were included if the following inclusion criteria were met: (1) all patients underwent a mammography and breast mri; (2) the study population had mammographic bi - rads 3 lesions or mammographic bi - rads 3 microcalcifications; (3) accuracy, sensitivity, specificity, positive predictive value (ppv) and/or npv was / were measured; (4) studies with original data that were published in peer - reviewed journals . Forty - one out of the 52 studies were excluded based on the title . From the 11 remaining studies the abstract or full paper was reviewed . Four studies were excluded because no bi - rads classification was used and 2 studies were reviews . In the 5 selected studies, 376 breast lesions were reported, of which 213 were microcalcifications, 110 were asymmetric mammographic findings, 36 were non - calcified regular - shaped lesions, 12 were architectural distortion and 5 were scar lesions . In 2 studies, mammographic bi - rads 3 lesions were included; one only included category 3 lesions, the other also included bi - rads 0 and 4 lesions . In the other 3 studies, mammographic bi - rads 3 microcalcifications were included but microcalcifications that were classified as bi - rads 4 and 5 were also included (table 1). Table 1study characteristicsstudy (first author, year of publication)moy 2009gokalp 2006akita 2009cilotti 2007uetmatsu 2007no . Of patients11543535596study designr, cp, cnrnrp, cno . Of lesions115565055100mammographic findingsasymmetry9812architectural distortion12scar lesion5non - calcified regular - shaped lesions36generalized calcifications7a cluster of tiny calcifications1microcalcifications5055100mammographic bi - rads0781231556923554224125275718gold standardpathologypathology, follow - up 6 monthspathologypathologypathologymammographysensitivity (%) nrnr10077nrspecificity (%) 80.7nr2459nrppv (%) 8.7nrnr6367npv (%) nrnrnr7493accuracy (%) 78.3nr4467.2nrmrisensitivity (%) 1001008573nrspecificity (%) 91.796.410076nrppv (%) 4033.3nr7386npv (%) 100100nr7697accuracy (%) 92.296.49674.5nrc, consecutive; nr, not reported; p, prospective; r, retrospective.in the analysis of moy et al ., cilotti et al . And uematsu et al . Bi - rads 3 lesions were considered as benign and bi - rads 4 and 5 as malignant.mg+mri . Study characteristics c, consecutive; nr, not reported; p, prospective; r, retrospective . In the analysis of moy et al ., cilotti et al . And bi - rads 3 lesions were considered as benign and bi - rads 4 and 5 as malignant . In one study, the role of mri in the evaluation of mammographic bi - rads 3 lesions was investigated . Mri was performed on 56 lesions described as bi - rads 3 by mammography in 43 patients . The 56 mammographic bi - rads 3 lesions were distributed into non - calcified regular - shaped lesions (64.3%), focal asymmetric densities (21.4%), generalized microcalcifications (12.6%) and a cluster of tiny calcifications (1.7%). The sensitivity, specificity, accuracy, ppv and npv of mri in the determination of malignancy in these mammographic bi - rads 3 lesions were calculated as 100%, 96.4%, 96.4%, 33.3% and 100%, respectively . Concluded that mri may be helpful in the evaluation of focal asymmetric densities as mri confirmed that 9 of the 12 mammographic focal asymmetric densities were breast tissue and the other 3 were masses . Another study evaluated the usefulness of breast mri in cases of inconclusive mammographic or sonographic findings . In this study, not only mammographic bi - rads 3 lesions (n = 15) were included but also bi - rads 4 lesions (n = 22) and mammographic bi - rads 0 lesions (n = 78). In total, 115 breast mri scans were used as an adjunctive tool and the findings were correlated with pathology . The equivocal mammographic findings for which mri was performed were asymmetry without associated microcalcifications (85.2%), architectural distortion (10.4%) and change in the appearance of the site of a previous benign biopsy finding (4.3%). Mri had a sensitivity of 100%, npv of 100% and compared with mammography had significantly higher specificity (91.7% versus 80.7%, p = 0.029), ppv (40% vs 8.7%, p = 0.032), and overall accuracy (92.2% vs 78.3%, p = 0.00052). Concluded that breast mri can be a useful adjunctive tool when equivocal findings at conventional mammography are asymmetry or architectural distortion . Three published studies evaluated the role of mri in patients with mammographic bi - rads 3 microcalcifications . Also included mammographic bi - rads 4 microcalcifications and cilotti et al . And uetmatsu et al . Included mammographic bi - rads 4 and 5 microcalcifications . In the study of akita et al . The clinical value of additional breast mri in patients with microcalcifications on mammography and negative ultrasound findings was evaluated . Fifty patients with mammographic microcalcifications (9 bi - rads category 3 and 41 bi - rads category 4) were included . Mammography had a sensitivity of 100%, a specificity of 24% and an accuracy of 44%, whereas mammography plus mri had a sensitivity of 85%, a specificity of 100% and an accuracy of 96% . They concluded that breast mri significantly improved the rate of diagnosis of malignancy in breast lesions that were detected as mammographic bi - rads 3 or 4 microcalcifications compared with mammography alone . In the study of uematsu et al ., breast mri was performed in 100 microcalcifications detected at screening mammography in 96 patients . Ppvs and npvs were calculated on the basis of a bi - rads category and the absence or presence of contrast uptake in the area of microcalcifications . Npv of bi - rads mammography 3 was 93% versus 97% npv of mri (p = 0.167). The ppv of contrast uptake of mri was 86%, which is significantly higher than the 67% ppv of bi - rads mammography 4 and 5 (p = 0.033). Concluded that the imperfect ppvs and npvs of mri in the evaluation of microcalcifications detected at screening cannot replace stereotactic vacuum - assisted biopsy . Concluded that the ppv and npv of mri in the characterization of microcalcifications are not high . In their study, 55 patients with mammographic calcifications classified as bi - rads categories 3, 4 or 5 underwent mri and stereotactic vacuum - assisted biopsy . The sensitivity, specificity, ppv, npv and diagnostic accuracy were 73%, 76%, 73%, 76% and 74.5%, respectively . Their conclusion is that mri cannot be considered a diagnostic tool for evaluating microcalcifications . In one study, the role of mri in the evaluation of mammographic bi - rads 3 lesions was investigated . Mri was performed on 56 lesions described as bi - rads 3 by mammography in 43 patients . The 56 mammographic bi - rads 3 lesions were distributed into non - calcified regular - shaped lesions (64.3%), focal asymmetric densities (21.4%), generalized microcalcifications (12.6%) and a cluster of tiny calcifications (1.7%). The sensitivity, specificity, accuracy, ppv and npv of mri in the determination of malignancy in these mammographic bi - rads 3 lesions were calculated as 100%, 96.4%, 96.4%, 33.3% and 100%, respectively . Concluded that mri may be helpful in the evaluation of focal asymmetric densities as mri confirmed that 9 of the 12 mammographic focal asymmetric densities were breast tissue and the other 3 were masses . Another study evaluated the usefulness of breast mri in cases of inconclusive mammographic or sonographic findings . In this study, not only mammographic bi - rads 3 lesions (n = 15) were included but also bi - rads 4 lesions (n = 22) and mammographic bi - rads 0 lesions (n = 78). In total, 115 breast mri scans were used as an adjunctive tool and the findings were correlated with pathology . The equivocal mammographic findings for which mri was performed were asymmetry without associated microcalcifications (85.2%), architectural distortion (10.4%) and change in the appearance of the site of a previous benign biopsy finding (4.3%). Mri had a sensitivity of 100%, npv of 100% and compared with mammography had significantly higher specificity (91.7% versus 80.7%, p = 0.029), ppv (40% vs 8.7%, p = 0.032), and overall accuracy (92.2% vs 78.3%, p = 0.00052). Concluded that breast mri can be a useful adjunctive tool when equivocal findings at conventional mammography are asymmetry or architectural distortion . Three published studies evaluated the role of mri in patients with mammographic bi - rads 3 microcalcifications . Also included mammographic bi - rads 4 microcalcifications and cilotti et al . And uetmatsu et al . Included mammographic bi - rads 4 and 5 microcalcifications . In the study of akita et al . The clinical value of additional breast mri in patients with microcalcifications on mammography and negative ultrasound findings was evaluated . Fifty patients with mammographic microcalcifications (9 bi - rads category 3 and 41 bi - rads category 4) were included . Mammography had a sensitivity of 100%, a specificity of 24% and an accuracy of 44%, whereas mammography plus mri had a sensitivity of 85%, a specificity of 100% and an accuracy of 96% . They concluded that breast mri significantly improved the rate of diagnosis of malignancy in breast lesions that were detected as mammographic bi - rads 3 or 4 microcalcifications compared with mammography alone . In the study of uematsu et al ., breast mri was performed in 100 microcalcifications detected at screening mammography in 96 patients . Ppvs and npvs were calculated on the basis of a bi - rads category and the absence or presence of contrast uptake in the area of microcalcifications . Npv of bi - rads mammography 3 was 93% versus 97% npv of mri (p = 0.167). The ppv of contrast uptake of mri was 86%, which is significantly higher than the 67% ppv of bi - rads mammography 4 and 5 (p = 0.033). Uematsu et al . Concluded that the imperfect ppvs and npvs of mri in the evaluation of microcalcifications detected at screening cannot replace stereotactic vacuum - assisted biopsy . Concluded that the ppv and npv of mri in the characterization of microcalcifications are not high . In their study, 55 patients with mammographic calcifications classified as bi - rads categories 3, 4 or 5 underwent mri and stereotactic vacuum - assisted biopsy . The sensitivity, specificity, ppv, npv and diagnostic accuracy were 73%, 76%, 73%, 76% and 74.5%, respectively . Their conclusion is that mri cannot be considered a diagnostic tool for evaluating microcalcifications . The ahrq guideline states that the work - up for mammographic bi - rads 3 lesions should be biopsy or follow - up imaging after 6 months . There is not yet a role for breast mri, because ultrasonography- or mammography - guided core or vacuum biopsy can obtain histological proof of a bi - rads 3 lesion . A variety of minimally invasive procedures are widely available, relatively safe, inexpensive and provide a diagnosis without surgical intervention . Furthermore, breast mri has its limitations, which include higher costs, longer examination time, and lower availability compared with mammography and ultrasound . If breast mri is to be an effective addition to the work - up of a mammographic bi - rads 3 lesion, the npv of breast mri must be sufficiently high to definitively rule out further work - up with biopsy . Although there were only 5 studies that investigated the usefulness of mri as a problem - solving modality in mammographic bi - rads 3 lesions, the npv was 100% in non - calcified mammographic bi - rads 3 lesions and 7697% in mammographic bi - rads 3 microcalcifications . On the other hand, kuhl indicated that the evidence for the effectiveness of breast mri is relatively weak in helping to solve mammographic problems, because in a multicenter trial of bluemke et al . The npv was not high enough to exclude malignancy with sufficient confidence in the case of an equivocal or suspicious lesion seen at conventional imaging . The diagnostic accuracy of mri was studied in 821 patients with a suspicious mammographic bi - rads 4 or 5 lesion (85%) or a suspicious clinical finding with a negative or benign conventional work - up (15%) before biopsy . Mri had an npv of 85% with cancer missed in 48 of 329 negative mri examinations . This npv is not sufficiently high to avoid biopsy in suspicious mammographic bi - rads 4 or 5 lesions . This widely referenced multicenter study was performed in 14 hospitals from 1998 to 2001 and therefore used now outdated mr equipment . Furthermore, the study of bluemke et al . Included patients with microcalcifications of the breast, which have a negative influence on the npv . In this meta - analysis, 3 studies assessed the role of mri in mammographic bi - rads 3 microcalcifications . Therefore, mri cannot be implemented as a problem - solving modality in mammographic microcalcifications at this time . Mri can be useful as an additional tool in patients with calcifications; it can be helpful in demonstrating or excluding underlying invasive cancer, because mri has a high npv for invasive cancer . An important application of mri in patients with associated with suspicious microcalcifications could be to evaluate disease extension . However, the studies that comply with the inclusion criteria of the meta - analysis, i.e. Non - calcified mammographic bi - rads 3 lesions, reported an npv of 100% and concluded that mri can be a useful tool in mammographic bi - rads 3 lesions, especially when mammographic findings are asymmetry or architectural distortion . Although there are sparse data, the first solid data indicate that breast mri might be useful as a problem - solving modality to exclude patients with non - calcified mammographic bi - rads 3 lesions from further diagnostic work - up.
Bone - density depleting disorders including osteoporosis (ops) and osteopenia (opn) are age - related disorders characterized by low bone mineral density (lbmd) and destruction of bone tissue micro - architecture, resulting in susceptibility to the pathologic fracture (1). Osteoporosis and opn are commonly expected in postmenopause women over fifty years of age because of hormonal imbalance . Bone micro - architecture remodeling is continuous and natural process containing bone resorption and new bone formation . These regular processes also control the calcium homeostasis, and replacement of bone tissue affected by microfractures (2). Therefore, ops can cause several major skeletal problems, such as pathologic fracture and thereby put at risk the general health . Osteoporotic fractures (vertebral or hip) as pathologic fractures are associated with significant mortality and morbidity . These complications can affect the health - related quality of life (hr - qol). Previous studies showed that hr - qol (estimated by the sf-36 questionnaire) was affected two years after vertebral and hip fractures (3). Low bone density (lbd) is one of the most challenging worldwide therapeutic problems, particularly in the developed country (2, 4). Different therapeutic agents have been recommended for ops and opn that they purpose to prevent the disease progression or reduce the risk of fractures . Calcitonin is an antiresorptive agent, which has been confirmed for the treatment of ops since 2 decades ago (5 - 8). Calcitonin (nasal or injection form) via inhibiting the osteoclastic activity can reduce the risk of osteoporotic fracture . Previously, the therapeutic effects of calcitonin on ops and lbd were investigated by using bmd (9). This study aimed to evaluate the effect of nasal calcitonin on qol in postmenopause women with lbd . We evaluated postmenopause women who had referred to the general clinic of rheumatology in baqiyatallah university of medical sciences, tehran, iran during a 1-year period between 2009 and 2010 . Finally, one hundred and fifteen cases met the inclusion criteria: (1) bmd at any site of measurement with a t score <-1 sd which is accepted as an international criterion of lbd (osteopenia) in postmenopause women; (2) no evidence for secondary opn; (3) no sufficient response to the pharmacological doses of vitamin d within the past 6 months . Patients were overruled if they had present or previous history of nasal polyps or a nasal septal perforation and previous treatment episode with prednisone or other medication which interfering bone metabolism such as estrogen or progesterone, bisphosphonates, and calcitonin . The presence of secondary opn, other bone disorders or other important medical conditions such as hyperparathyroidism, hyperthyroidism, neoplastic disorders and other were left out based on the patient s history, whole body physical examination, routine laboratory tests, and, if necessary, hormone assessment and additional assessment for suspected patients . The patients received 200 iu nasal calcitonin with 2 word brand names (nasocalcin nasal spray 200 iu, sinadaru, tehran, ir iran and miacalcic 200 iu nasal spray, novartis, uk) once a day along with calcium tablet (1000 mg) and vitamin d (400 iu) for 6 months . The suspected adverse effects were explained for every participant and all patients were visited every 2 months for adverse effect and efficacy of treatment on clinical manifestation . Also, bmd was evaluated by a dual - energy x - ray absorptiometry (norland company, usa) at the femoral neck and lumbar spine (l2 - l4). Bone mineral density was assessed at the end of the study on last visit and compared with the baseline . Urine and blood samples were collected for the biochemical bone marker assessment at the first and 6 months after the beginning of the treatment . Calcium homeostasis was observed by measuring serum and 24-hour urinary calcium and phosphorus levels, parathormone (pth) serum levels and serum alkaline phosphatase (alp). Other laboratory parameters, which were assessed during the treatment, were as follow: cell blood count, serum calcium, serum phosphorus, creatinine (cr), albumin, blood urea nitrogen (bun), electrolyte (na and k) and liver aminotransferases . Serum and urine samples were collected on the morning without fasting and avoidance from tobacco . At this clinical survey, a detailed hr - qol questionnaire including the validated persian version of short - form 36 (sf-36) questionnaire was used (10). We used the persian version of the sf-36 questionnaire which was extensively evaluated in both reliability and validity base on persian conditions (10 - 12). Also, the sf-36 has been confirmed under swedish conditions and in several other countries (13 - 15). Moreover, the quantitative variables distribution was assessed using the kolmogorov - smirnov test and then represented as mean sd (standard deviation) and qualitative variables frequency is presented as a percentage . The paired t - test and pearson correlation were used to compare the impact of calcitonin on the quantitative variables . Also, the mantel - hanzel and two - tailed wilcoxon tests were used to compare between qualitative variables and nonparametric variables . Finally, linear regression model was used to justify the effect of the confounding factors . Spss version 16 (illinois, usa) was used to analyze the data and p values 0.05 were considered statistically significant . One hundred and fifteen postmenopause women were included (age range, 47 - 84 years). All patients completed the two steps of the study (failure to follow: 0%). This difference in bmd of lumbar spine was statistically significant but not significant in femur s bmd . C - telopeptide of type i collagen (ctx; as a bone resorptive marker) over the 6-month treatment was decreased significantly (3.203 2.24 vs. 2.497 1.657, p value <0.001). At the baseline, 55.3% of the patients suffered from low back pain although the frequency of the low back pain during the study changed to 3.5%, 1.8% and 0%, which is statistically significant (p <0.001). The 24-hour urine ca level was increased significantly compared to the baseline (from 216.96 114.68 to 270.87 155.47, p <0.001). The 24-hour urine cr level raised from 0.93 0.35 to 1.08 0.37 that this change was significant . Moreover, bun at the baseline was 17.08 4.07 and the amount was significantly increased at the end of the study to 18.17 4.35 (p = 0.043). Serum levels of pth, ca, ast, alt and alp total were not changed significantly (p value> 0.050). Also, the changes in femur bmd amount were significantly correlated with weight (p = 0.014, r = -0.244) and bmi (p = 0.022, r = -0.301). At baseline measurement, the total qol score were 88.05 15.63, and also 6 months after the treatment the sf-36 score was 92.15 13.22 . This difference in hr - qol score was statistically significant (p <0.001) (table 2). By using partial correlation, although the probable confounding role of age, age at menopause number of pregnancy, the amount of exercise per day and bmi were adjusted, the difference between baseline and final total score of hr - qol was statistically significant (p <0.001). Regarding to the univariate test and by using the multivariate analysis, we adjusted the hr - qol score changes regarding to the role of demographic variables . Also, changes in the hr - qol score had a significant correlation only with educational level (p = 0.010, f = 4.252, power = 97.5%); however, other demographic characteristics such as age at menopause, age, bmi, number of pregnancy and the amount of exercise per day had no significant correlation with hr - qol (p> 0.050). Changes in hr - qol domains over the 6-month treatment period are presented in table 3 . Changes in hr - qol domains only in general health (gh) and the short form 36 health survey (sf-36) were not statistically significant (0.309 and 0.917, respectively). By using the linear regression model, all of the hr - qol s domains changed significantly compared to the changes in total hr - qol score (p <0.001) and also affected by other domains . Table 4 demonstrates the median change in sf-36 score over follow - up for each domain according to its correlation with together and it seems that mental health (mh) was the most effective item, which affected the total sf-36 score change (p <0.001, t = 26.13). Abbreviations: bp, bodily pain; gh, general health; mh, mental health; pf, physical function; er, emotional role functioning; p, p value; r, correlation coefficient; rp, physical role functioning; sf, social function; vt, vitality . Statistically significant . The changes in hr - qol domains score during the study were assessed according to the bmd changes and we found that only t - score of spine s bmd and total t - score s changes were significantly correlated with the hr - qol total score changes (p = 0.003 and p = 0.028, respectively). By using the multivariate analysis, we adjusted the changes in the score of hr - qol domains regarding to the role of demographic variables and we found that only changes in mh score were significantly correlated with total bmd score changes (p = 0.037), bp score was significantly correlated with bmi (p = 0.049) and rp score was also significantly correlated with bmi and age at menopause (p = 0.009 and p = 0.013, respectively). Osteoporosis and the decrease in bmd is a major health problem throughout the world and its prevalence is increasing especially in developed countries because of increasing in the community age (16). Osteoporosis is the main cause of pathologic hip and vertebral fractures in elderly (17). Also, ops and decrease in bone mass can increase mortality and morbidity rate substantially (1, 17, 18). Previous study demonstrated that the osteoporotic cases have lower qol due to limitation in physical activity, chronic mild pain and etc . In spite of the comorbidity and fracture, individuals who affected by lower bone density had poorer qol (19). The preventive, analgesic and therapeutic impact of nasal calcitonin on the spinal fracture and therefore back pain in the osteoporosis was declared (20). Also, qol improvement (regarding to the improvement in spine bmd) was coordinated by significant reduction in the frequency of low back pain, which is match with previous reports in osteoporotic patients without the obvious bone fracture (21). Therefore, it is expected that an effective treatment protocol can improve the hr - qol of these patients . Calcitonin is bone resorptive inhibitors, which has approved for treatment of osteoporosis, low bone density and other disorder involving increased bone turnover since 25 years ago . The present study is the first from iran to assess the effectiveness of nasal calcitonin on hr - qol in osteopenic postmenopause women . However, the present study showed a raise in spine bmd more than femoral bmd that this is similar to previous trial studies . Also, bmd by dual - energy x - ray absorptiometry (dxa) is a reliable method for tracking the response to treatment in patients with ops . Changes in bmd score when appear that the bone density be increased at least 3 - 5% from the baseline (22). Alike confirmed the efficacy of 200 iu daily intranasal calcitonin on improvement of lumbar bmd (7). However, we found that changes in the spine t - score were correlated with changes in the total hr - qol score, especially mh . In addition, patients with higher grades of spinal bone density loss showed lower qol score, recommending that the results of vertebral fracture are related to qol (23). Also, regarding to the findings, mh was most effective domain, which significantly influenced the total score of hr - qol . By contract, dennison et al . Demonstrated that in osteoporotic women, mh, sf and re are related with total femur bone density (19). Also, the mh field is that most of the other areas are affected by confounding factors and it is important to consider all characteristics before interpreting the changes (19). Moreover, mh was considered as major domain of hr - qol compared to other domains for predicting the qol worsening in progression of bone density loss (24). Moreover, femoral neck bmd changes were significantly correlated with bmi and weight and in the other hand physical activity and somatic - related domain of hr - qol such as bp and rp were correlated with bmi; however, they were not significantly correlated with femoral bmd score changes . According to our findings, previous studies confirmed that exercise provide modest benefits for post - menopaus women with opn such as increasing in bmd and also improved the hr - qol of these patients (25). Overall, it can be assumed that mental health - related qol are more likely related with spinal bmd changes and physical health - related qol domains are more likely related with femoral neck bmd changes . In contrast, dennison et al . Demonstrated that they have not found any relationships between the lumbar spine bone loss rate and hr - qol in any domain . Previously, calcitonin has been certified for treatment of symptomatic ops although the recent studies clarified the efficacy of nasal form of calcitonin (26, 27). In this study bodily pain and physical role functioning (pr) had significant changes over the 6-month treatment period with calcitonin, which these findings are consistent with each other . Level of education was identified as an effective factor on the progression of ops and response to the treatment according to the bmd improvement and in this study, educational status was correlated with hr - qol changes (28). Education can enhance the patients insight and improve the life style and thus assist to the plan of therapy . Also, in the present study, we found that bmd t - score of femoral neck was significantly associated with weight and bmi, which it is relatively supported by the previous studies (23, 28). The limitation of this study was short - term duration of follow - up and we have not observed long - term effects of nasal calcitonin on hr - qol . Moreover, we did not have a control group to exclude the role of race or nationality although no patients had past history of psychiatric disorders . Finally, to confirm the analgesic role of nasal calcitonin on the back pain and also qol in nonfractured opn, we recommend using a quantitative scale such as visual analogue scale (vas) along with the qol questionnaire . According to the results of this study, it seems intranasal calcitonin can effectively improve qol of women with low bone density via improving in bone density and bmd and also decreasing bone turnover . Furthermore, it seems that hr - qol changes were not influenced by demographic or clinical characteristics.
The coffee berry borer, hypothenemus hampei (ferrari) (coleoptera: curculionidae), an insect endemic to central africa, is considered to be the most serious pest of coffee throughout the world, causing hundreds of millions of dollars in losses on a yearly basis . The insect has been reported in most coffee producing countries throughout the world and presents a tremendous management challenge due to its cryptic life cycle that occurs inside the coffee berry (bustillo et al ., 1998). Among the many biocontrol methods being explored for use against this insect, the fungal entomopathogen beauveria bassiana (balsamo) vuillemin (ascomycota: hypocreales) remains one of the most promising . Pascalet (1939) was the first to record b. bassiana infections in h. hampei in cameroon . Subsequently, the pathogenicity of b. bassiana against the coffee berry borer as a biocontrol agent has been studied in brazil (fernndez et al ., 1985), honduras (lazo, 1990), mexico (mndez, 1990), colombia (jimnez, 1992), nicaragua (barrios, 1992), ecuador (sponagel, 1994) and india (haraprasad et al ., 2001). These studies have been aimed at the development of a sustainable pest control method against the coffee berry borer that does not rely on chemical insecticides such as endosulfan, a product that has been banned in colombia and to which the insect has developed resistance (brun et al ., 1989). Thus, there is a great interest in coffee producing countries in developing commercial formulations of b. bassiana . The first step in the process leading to commercialization is to conduct standard bioassays to select the more promising isolates . Butt and goettel (2000) reviewed the bioassays used for entomopathogenic fungi and outlined the different procedures to conduct the bioassays, which will depend upon the type of insect and fungi . In these bioassays, percent mortality and average survival time and, in a few cases, lc50 are the only parameters that have been taken into consideration for isolate evaluation . Our objective was to develop a novel method for selecting fungal entomopathogens aimed as biocontrol agents against insects in general . This method involves the estimation of several parameters, including percent insect mortality, average survival time, mortality distribution, percent spore germination, fungal life cycle duration, and spore production on the insect . Measuring these parameters provides a better idea of which isolates would have higher potential for success in a biological control program; these isolates can then be used for scaling up production, formulation, and subsequent field application studies leading to commercialization . Fifty b. bassiana isolates originating from coffee berry borers collected in africa, central and south america were used (see table 1 for strain identity). Most of the isolates were kindly provided by r. humber, curator of the u. s. department of agriculture, agricultural research service, collection of entomopathogenic fungi in ithaca, new york . All isolates were individually applied to coffee berry borers using a potter tower (burkard manufacturing, www.burkard.co.uk). After sporulation on the insect cuticle, single spore cultures for each isolate were initiated on potato dextrose agar (becton dickinson, www.bd.com) and stored in 10% glycerol at 80 c. adult coffee berry borers reared on artificial diet (villacorta, 1985; portilla, 2000) were obtained from the biological control and mass rearing research unit (usda, ars, stoneville, ms). Before they were used, to kill fungal spores present on the cuticle, insects were washed in a 0.5% sodium hypochlorite solution with 0.01% triton x-100 (sigma chemical co., www.sigmaaldrich.com) and gently shaken for two minutes . Afterwards, they were rinsed three times in sterile distilled water and dried in a container lined with sterile paper towels . No food was provided throughout the experiment to avoid problems with fungal contamination from the artificial diet and also because the insects burrow into the diet which would make it impossible to observe them . The insects can survive for extended periods of time without food (posada, 1998). To produce the spores necessary to run the bioassay the single spore isolates stored in 10% glycerol at 80 c were grown in sabouraud's dextrose agar (becton dickinson sparks, md) and incubated at 25 c. all cultures were less than 30 days old when used in the bioassays . Spores were collected with a spatula and placed in sterile tubes containing 10 ml of sterile distilled water plus 0.01% triton x-100 (sigma chemical co., st . Spore concentrations were adjusted to about 110 spores ml using a hemacytometer, which is the baseline concentration used to evaluate b. bassiana against coffee berry borers at the national coffee research center (cenicaf) in colombia (gonzlez et al ., 1993; marin et al ., 2000). Spore germination was determined by plating a 10 l low concentration b. bassiana aliquot on 2.5% noble agar (becton dickinson sparks, md). The spore suspension was spread on the medium with a sterile spatula and incubated at 27 c. germination was assessed only at 24 h by taking 3 samples of the media and placing them individually on slides, followed by counting 100 spores . Spores were deemed to have germinated when the longitude of the germ tube was longer than half the size of the spores . After finding that at 24 h some isolates had zero germination but caused 100% mortality, indicating germination had occurred post initial 24 h, a second germination test was done to examine spore germination at 24, 48 and 72 hours . The coffee berry borers assigned to the treatments were dipped in 10 ml of a b. bassiana suspension with 110 spores ml plus 0.1% triton x-100; control insects were dipped in sterile distilled water plus 0.1% triton x-100 (our reasons for using dipping vs. spraying are presented in the discussion). Insects were gently shaken for two minutes while dipped in their respective treatments and then placed in a sterile container from which they were taken individually with a paintbrush and placed in a vial containing two pieces of sterile whatman #1 filter paper (2.1 cm diameter) moistened with 100 l of sterile distilled water . The vials were closed with caps and sterile distilled water was added to the filter paper as needed . All treatments were incubated in the dark at 25 c in a growth chamber (model e-36l, percival scientific, inc . The experiment was conducted as a completely randomized design, with each isolate replicated 40 times and beetles individually placed in separate vials . For statistical purposes, mortality was analyzed by grouping the experimental units as 4 replicates with 10 beetles each (each beetle in a separate vial). Isolates were evaluated at different times (15, 15, 14 and 6 isolates each time) due to the same person being in charge of examining the insects and recording variables on a daily basis to reduce bias . Percent spore germination and percent insect mortality was analyzed using proc mixed (sas, 2001). Average insect survival time was analyzed using survival analysis that includes all individuals (jmp sas, 2000), in contrast to lt50 that only includes those that have died . Our assessment of the saprophytic phase for b. bassiana isolates was based on the time it takes for four events to occur after the insect has died (fig . 1). The first event is the number of days after death until mycelium is first observed on the insect corpse . The second event is number of days from the first formation of mycelium until the mycelium has reached a maximum coverage of the corpse . The third event is based on the time it takes from maximum mycelium coverage until conidiophores are first seen . The fourth and final event consists of the time it takes from first observation of conidiophores until spores begin to discharge . Observations were made every 24 h and in cases where a certain event seemed to be already advanced at the time of the observation, indicating it had been initiated shortly after the previous observation, the time to the specific event was back - estimated 12 h. the data for each event were analyzed using proc mixed (sas, 2001). Spore production was determined by randomly selecting 5 beetles (out of 40) within each treatment for which there was spore production . Each beetle was washed with 5 ml of sterile distilled water with 0.1% triton x-100 and sonified for one minute . A diluted spore suspension was placed in three different hemacytometers and eight 16 square grids were counted in each one . The data were analyzed using a one - way analysis of variance (anova proc mixed; sas, 2001). In all tests, p<0.05 was considered significant . Fifty b. bassiana isolates originating from coffee berry borers collected in africa, central and south america were used (see table 1 for strain identity). Most of the isolates were kindly provided by r. humber, curator of the u. s. department of agriculture, agricultural research service, collection of entomopathogenic fungi in ithaca, new york . All isolates were individually applied to coffee berry borers using a potter tower (burkard manufacturing, www.burkard.co.uk). After sporulation on the insect cuticle, single spore cultures for each isolate were initiated on potato dextrose agar (becton dickinson, www.bd.com) and stored in 10% glycerol at 80 c. adult coffee berry borers reared on artificial diet (villacorta, 1985; portilla, 2000) were obtained from the biological control and mass rearing research unit (usda, ars, stoneville, ms). Before they were used, to kill fungal spores present on the cuticle, insects were washed in a 0.5% sodium hypochlorite solution with 0.01% triton x-100 (sigma chemical co., www.sigmaaldrich.com) and gently shaken for two minutes . Afterwards, they were rinsed three times in sterile distilled water and dried in a container lined with sterile paper towels . No food was provided throughout the experiment to avoid problems with fungal contamination from the artificial diet and also because the insects burrow into the diet which would make it impossible to observe them . The insects can survive for extended periods of time without food (posada, 1998). To produce the spores necessary to run the bioassay the single spore isolates stored in 10% glycerol at 80 c were grown in sabouraud's dextrose agar (becton dickinson sparks, md) and incubated at 25 c. all cultures were less than 30 days old when used in the bioassays . Spores were collected with a spatula and placed in sterile tubes containing 10 ml of sterile distilled water plus 0.01% triton x-100 (sigma chemical co., st . Spore concentrations were adjusted to about 110 spores ml using a hemacytometer, which is the baseline concentration used to evaluate b. bassiana against coffee berry borers at the national coffee research center (cenicaf) in colombia (gonzlez et al ., 1993; marin et al ., 2000). Spore germination was determined by plating a 10 l low concentration b. bassiana aliquot on 2.5% noble agar (becton dickinson sparks, md). The spore suspension was spread on the medium with a sterile spatula and incubated at 27 c. germination was assessed only at 24 h by taking 3 samples of the media and placing them individually on slides, followed by counting 100 spores . Spores were deemed to have germinated when the longitude of the germ tube was longer than half the size of the spores . After finding that at 24 h some isolates had zero germination but caused 100% mortality, indicating germination had occurred post initial 24 h, a second germination test was done to examine spore germination at 24, 48 and 72 hours . The coffee berry borers assigned to the treatments were dipped in 10 ml of a b. bassiana suspension with 110 spores ml plus 0.1% triton x-100; control insects were dipped in sterile distilled water plus 0.1% triton x-100 (our reasons for using dipping vs. spraying are presented in the discussion). Insects were gently shaken for two minutes while dipped in their respective treatments and then placed in a sterile container from which they were taken individually with a paintbrush and placed in a vial containing two pieces of sterile whatman #1 filter paper (2.1 cm diameter) moistened with 100 l of sterile distilled water . The vials were closed with caps and sterile distilled water was added to the filter paper as needed . All treatments were incubated in the dark at 25 c in a growth chamber (model e-36l, percival scientific, inc ., www.percival-scientific.com). The experiment was conducted as a completely randomized design, with each isolate replicated 40 times and beetles individually placed in separate vials . For statistical purposes, mortality was analyzed by grouping the experimental units as 4 replicates with 10 beetles each (each beetle in a separate vial). Isolates were evaluated at different times (15, 15, 14 and 6 isolates each time) due to the same person being in charge of examining the insects and recording variables on a daily basis to reduce bias . Percent spore germination and percent insect mortality was analyzed using proc mixed (sas, 2001). Average insect survival time was analyzed using survival analysis that includes all individuals (jmp sas, 2000), in contrast to lt50 that only includes those that have died . Our assessment of the saprophytic phase for b. bassiana isolates was based on the time it takes for four events to occur after the insect has died (fig . 1). The first event is the number of days after death until mycelium is first observed on the insect corpse . The second event is number of days from the first formation of mycelium until the mycelium has reached a maximum coverage of the corpse . The third event is based on the time it takes from maximum mycelium coverage until conidiophores are first seen . The fourth and final event consists of the time it takes from first observation of conidiophores until spores begin to discharge . Observations were made every 24 h and in cases where a certain event seemed to be already advanced at the time of the observation, indicating it had been initiated shortly after the previous observation, the time to the specific event was back - estimated 12 h. the data for each event were analyzed using proc mixed (sas, 2001). Spore production was determined by randomly selecting 5 beetles (out of 40) within each treatment for which there was spore production . Each beetle was washed with 5 ml of sterile distilled water with 0.1% triton x-100 and sonified for one minute . A diluted spore suspension was placed in three different hemacytometers and eight 16 square grids were counted in each one . The data were analyzed using a one - way analysis of variance (anova proc mixed; sas, 2001). In all tests, p<0.05 was considered significant . Spore germination at 24 h, for the first germination test, ranged from 095% (table 1). There were significant differences in b. bassiana spore germination due to isolates (f = 47.7, d f= 103, p = 0.001). In the second germination test, there were significant differences in percent germination among the isolates at 24 hours (f = 62.2, df = 49, p = 0.001), 48 hours (f = 62.2, df = 49, p= 0.001), and 72 hours (f = 39.1, df = 49, p = 0.001) and among the three evaluation times (f = 462.2, df = 2, p = 0.001). The repetition of the germination at 24 h showed a similar tendency as the first germination test with some exceptions (table 1). In the first 24 h germination test 2689 and ivory coast 5460 exhibited 0% germination while in the second test germination was 17% and 16%, respectively . Ivory coast 5486, which had reached 36% germination at 24 h in the first test, had not germinated at 24 h in the second test . In the first test only two isolates (togo 5451 and mexico 3818) reached over 90% germination at 24 h, while in the second test only one showed over 90% germination (togo 5458). At 48 h all isolates had germinated (table 1), and seven had reached over 90% germination, while three presented less than 50% germination . The other 40 isolates exhibited 65% - 89% germination . At 72 h, germination for 42 of the isolates tested was above 90%; however, none had reached 100% germination . Germination rates were not assessed post-96 h due to production of new spores after 48 h in the isolates exhibiting high germination rates . This production of new spores, if not taken into consideration, could result in an underestimate of germination if confused with the original spores or in an overestimation of germination if they have started to germinate . Thus, it is essential to be able to distinguish between the original spores and subsequent spore production; a careful examination of the mycelium and the presence of conidiogenous cells enable discrimination between original and new spores . The spores in the first and second germination tests were handled the same way, counted using the same protocol, and kept under the same environmental conditions . The same medium was used and the source of cultures was the same (single spores maintained at 80c .) Spore suspensions of 110 spores ml caused high coffee berry borer mortality with 47 of the isolates reaching 100% mortality, two isolates causing 97.5% mortality and one causing 67.5% mortality (table 1). There were significant differences in mortality due to isolates used (f = 5.7, df = 150, p = 0.001). Mortality distribution ranged from 311 days post application (table 1). In 13 of the isolates tested there was a high mortality (up to 100%) within 2 days after the first insect died (table 1). Thirty - one isolates caused 100% coffee berry borer mortality within 3.2 and 4.0 days, while 17 took between 4 - 6 days; two isolates took longer than 6 days to kill the insects . 1), was completed in 7.7 - 16.0 days, and 55.1% of the isolates completed their life cycle in less than 10 days (table 2). The pathogenesis phase ranged between 3.1 to 9.1 days and 63.3% of the isolates completed the pathogenicity stage in less than four days . The saprogenesis life cycle ranged between 4.1 to 9.9 days and 49.0% of the isolates completed this step in less than six days (table 1). For representative purposes, we selected three b. bassiana strains based on fast (kenya 2687), medium (ivory cost 5486), and long (brazil 1480) life cycles (fig . 1). Some of the isolates caused rapid mortality shortly after exposure (fig . Fourteen isolates produced more than 110 spores per beetle (table 1). Other isolates produced between 110 and 110 spores per beetle one isolate (kenya 2686) produced 2.5 10 0.7 spores per beetle . There were significant differences in spore production (f = 128.6, df = 1550, p = 0.001). Various spore application methods can be used when conducting coffee berry borer bioassays with fungal entomopathogens, such as dipping the insects in the spore suspension and spraying either the berries or leaves for subsequent spore pickup by the insect, or spraying the insects directly (gonzlez et al ., 1993; de la rosa et al ., 1997 first, spore concentrations are uniform and thus pathogenicity can be easily compared across isolates . Second, dipping provides a massive spore concentration to the insect and results in faster mortality than spraying . Previous studies have shown that coffee berry borer mortality caused by b. bassiana is just over three days using the dipping method (fernndez et al ., 1985; gonzlez et al ., 1993; varela and morales, 1996; de la rosa et al ., 1997; marin et al ., 2000), while spraying and exposing the insects to the droplet deposit can take more than 10 days (posada, 1998; posada et al . This has important implications when using the methodology for spore quality control due to the reduced time required for labor when assessing the effectiveness of the isolates . The dipping method also reduces labor when screening multiple fungal strains due to only one concentration being used in contrast to multiple doses that would result in enormous bioassay tests . We realize that this methodology does not mimic application methods that would be used in the field, but it is a valuable tool for assessing what strains should be studied in more detail . In the present study, there was no mortality in the controls due to fungal growth either by b. bassiana or fungal contaminants . This is a major improvement over other bioassay techniques used in the past (gonzlez et al ., 1993) and is the result of using beetles reared in artificial diet in which the original parents are well disinfected . The spore germination results indicate that even though the isolates came from the same host and were cultured as single spore isolates, they still respond differently . Spore germination at 24 h in the first test ranged from 0 to 95%, with isolates exhibiting no germination still causing 100% mortality, thus indicating that measuring germination at 24 h, which is what is usually done in bioassay tests (goettel and inglis, 1997; legaspi et al . 2004), could be misleading in terms of assessing potential virulence for fungal pathogens . When compared to spores that germinate quickly, slow germinating spores are at a disadvantage due to them being exposed to potentially adverse conditions that might reduce their viability in the field . Spore germination rates are known to have very important consequences for insect infection (vega et al ., 1999 and references therein). Our results indicate that germination assessments at only 24 h might not yield the entire picture of fungal performance . We also examined the life cycle of b. bassiana on the insect, which includes pathogenesis and saprogenesis phases . Pathogenesis begins with the formation of a germ tube, cuticle penetration and invasion throughout the insect followed by death . The saprogenesis phase begins after the insect has died and has four steps: (1) mycelium begins to appear through the cuticle; (2) the mycelium covers most of the corpse; (3) spores form; and (4) spores are discharged . The isolates with a fast kill are usually selected for subsequent assessment and possible field use even though fast kill per se does not tell how long it takes for the fungus to cycle through the insect and what the subsequent level of spore production might be . If a low number of spores or no spores at all are produced on the cadaver, then a fast kill strain is not likely to increase the fungal inoculum load in the field thus requiring additional field applications which would result in increased pest control costs . Future studies should compare pest mortality across time in situations where fungal isolates result in high spore production in cadavers versus isolates that do not sporulate on the cadaver . Bassiana infected coffee berry borers per plant (a very conservative estimate) and 5000 plants per hectare would contribute 110 spores per ha, which can be equal to what is applied in a commercial application . Thus, b. bassiana production on the cadaver could provide a fresh source of fungal inoculum directly in the coffee agroecosystem . Furthermore, the fungus is passing through the host, which is known to be necessary to maintain the virulence of the isolates (tanada and kaya, 1993; lomer et al ., 2001). Screening of fungal isolates to select promising biocontrol agents should consider possible recycling of the spores in the field, which might lead to new natural infections (lomer et al ., 2001). In addition, this information needs to be taken into account in order to select the more productive isolates in order to undertake fungal mass production . Based on the parameters we measured, we developed a scoring system to rate the potential of the various b. bassiana strains used in the bioassays . In this scoring system + was assigned when the isolate fulfilled minimum values for each parameter as follows: insect mortality of 100%; fungal spore germination> 85%; average insect survival time 3.5 days; insect mortality distribution 2 days; fungal life cycle duration 8 days; and spore production 110 spores per insect . Thus, the higher the number of + signs, the better the isolate with six + being optimal; five + being good; four + average; and below four + unacceptable (table 1). Thus, the protocol we have developed can be used to narrow down the number of strains to be assessed in more cumbersome or traditional spraying bioassay studies using various doses, and should result in a more efficient use of time and financial resources . The low prices being paid to coffee growers throughout the world have resulted in a reduction of coffee pest management inputs, and thus the development of sustainable pest management strategies is a priority . Fungal entomopathogen isolates that provide a fast kill and produce a high number of spores in the insect cadaver can play an important role in causing natural epizootics, thus reducing coffee berry borer populations and leading to a more sustainable agricultural system (lacey et al ., 2001). Any investment in fungal entomopathogen production in coffee producing countries aimed at the coffee berry borer should be based on use of a strain with the highest potential for causing high mortality and for being recycled in coffee fields which, if growing under shade, have high humidity conditions favorable for b. bassiana (staver et al ., an assessment of percent insect mortality and average survival time presents only a partial view of pathogenicity and does not provide adequate information to select the best fungal isolates . In this paper we present a novel method to evaluate candidate fungal entomopathogens based on six parameters: percent insect mortality, average survival time, mortality distribution, percent spore germination, fungal life cycle duration, and spore production . This information provides a more complete picture to determine which fungal isolates should be considered for subsequent mass production, formulation and possible commercialization . We have developed a screening method that should be useful in future studies aimed at assessing the potential use of fungal entomopathogens in insect pest management programs . Life cycle for three beauveria bassiana single spore isolates on coffee berry borer, including short (top), medium (center) and long (bottom) life cycles . Coffee berry borer percent mortality based on days after exposure to 50 different beauveria bassiana fungal isolates . Notice how as one scans from left to right, some strains result in high mortality shortly after exposure, in contrast to others that take a long time to cause high mortality . Parameters used for scoring of 50 beauveria bassiana fungal isolates:% insect mortality,% spore germination, average survival time (days), mortality distribution (days), b. bassiana life cycle (days), and spore production (spores per insect). Duration of the life cycle of beauveria bassiana on the coffee berry borer (days).
Five provinces in afghanistan were selected as a convenience sample (accessibility) that included both affected and unaffected areas . Two accessible districts in each province were randomly selected by using a random number generator . Random transects were used to select 10 households per village . To give an approximately equal male: female ratio, either the head of household, spouse (woman), or the oldest person available at the time was selected . Ethical approval was provided by the institutional review board, ministry of public health, afghanistan . A standardized, structured questionnaire collected information on demographic and socioeconomic measures, avian influenza information sources and knowledge of appropriate preventive measures, poultry and animal handling, food and generic hygiene, and human influenza knowledge and treatment seeking . The questions were ranked for importance in preventing avian influenza transmission in poultry or reducing human exposure and awarded 5 points, 3 points, or 1 point for correct answers . For each respondent, the sum of scores for correct answers divided by the sum of available points generated a percentage score . Data were double - entered by using microsoft access (microsoft, redmond, wa, usa) and analyzed by using stata 8 software (stata corporation, college station, tx, usa). Percentage scores for each respondent were ranked and classified as above or below the median . The primary analysis was conducted to compare factors (age, sex, socioeconomic status, provincial exposure to avian influenza iec campaigns, and poultry ownership) associated with knowledge above the median . Socioeconomic quintiles (seqs) were defined by principle components analysis using employment, education, and household assets as indicators (3). Factors independently associated by univariate regression at the 95% confidence level were included in a stepwise multivariate logistic regression model . To numerically evaluate kap levels, a secondary analysis assessed differences between mean percentage scores, stratified by factors identified by logistic regression analysis . Data for 304 respondents were included in the analysis . Of the 5 provinces, kabul and nangahar had had influenza outbreaks in poultry in 2007 . Median age of respondents (38 years) was high, but it reflected the age of heads of households and spouses . Poultry ownership was reported by 65.2% of households (> 95% backyard ownership) and differed significantly between seqs (poorest 53/62 [85.5%] vs. least poor 20/55 [36.4%]; 30.0, p<0.001). Provinces exposed to avian influenza and intensive information, education, and communication campaigns (kabul, march 2007, and nangahar, february 2007). Seq was positively associated with kap score above the median (lowest vs. highest: adjusted odds ratio [aor] 14.3, 95% confidence interval [ci] 5.239.9), as was provincial exposure to avian influenza iec campaigns (aor 9.5, 95% ci 4.918.6). Backyard poultry ownership (nonowners vs. owners: aor 0.3, 95% ci 0.20.7) and older age group (1520 years vs.> 40 years: aor 0.3, 95% ci 0.10.8) were both negatively associated . For secondary analysis, mean kap score differed between seq (p<0.001, by analysis of variance) and was higher in provinces previously exposed to iec campaigns (50.2% vs. 40.1%; p<0.001, by t test). Reporting of sick or dead poultry to authorities was less frequent among lowest seq (8/47 [13%]) than highest seq (20/49 [37%]; 6.6, p = 0.02) where selling poultry in the event of a local outbreak was more commonly reported (21/66 [66%] vs. 10/51 [18%]; 27.2, p<0.001). Presence of coops was less frequent in lowest seq (9/49 [18.4%]) than in highest seq (21/46 [45.6%]; 8.2, p = 0.004). Human cases of avian influenza (h5n1) have resulted from contact between humans and infected backyard poultry (4). Risk to humans is also related to frequency of disease occurrence in the avian population (5). Recently, human - to - human transmission has been reported in the neighboring northwest frontier province of pakistan (2). Overall knowledge was low, although in provinces exposed to intensive iec campaigns, kap scores of the population were higher . The level of concern generated by the campaign, government response, media reports, and proximity to the outbreak are all likely to contribute to this association . Despite this encouraging evidence, level of knowledge was far higher among persons with higher socioeconomic status . Our results can be broadly generalized to the population, although we did not have access to unsafe districts (most of the districts in southern and eastern afghanistan). This limitation may introduce selection bias, which would underestimate the effect of socioeconomic status because those living in inaccessible areas likely have a lower status than persons in accessible areas . Preintervention and postintervention surveys would provide a more robust measure of effectiveness . In the immediacy of an outbreak, although there are limitations to the study design in concluding intervention effectiveness, the results provide evidence to support further intensive campaigns as a response to influenza outbreaks in poultry . Several reports have examined kaps and behavior related to avian influenza (h5n1) (69). Similar to the finding in the lao people s democratic republic (6), our study suggests that conventional education and behavior change messages have a limited effect in populations with highest exposure . Efforts to ensure that iec messages are suitable for lower socioeconomic groups should be adopted, specifically by improving the knowledge of community leaders, designing messages in a suitable format for the poor and illiterate, and ensuring that the most accessible channels are used . Messages should carefully balance the risk for human disease against potential nutritional and economic consequences of high population concern (e.g., food scares). Successfully promoting behavior change is a lengthy process and requires frequent reinforcement . The acuteness of avian influenza (h5n1) outbreaks requires a concerted effort to enhance knowledge and change behavior among those most at risk in low - income countries.
Determinar os pontos de corte de resposta ao broncodilatador do vef1, vef0,75, vef0,5 e fef25 - 75% em crianas pr - escolares saudveis e gerar valores de referncia para o vef0,75 . Foi realizado um estudo transversal de base comunitria em crianas de 3 - 5 anos de idade . Foram definidos os pontos de corte dessa resposta como o percentil 95 de variao em cada parmetro . Foram recrutadas 266 crianas, e 160 (60,0%) foram capazes de gerar manobras expiratrias aceitveis e reprodutveis antes e depois do uso de broncodilatador . As mdias de idade e estatura dos participantes foram 57,78 7,86 meses e 106,56 6,43 cm, respectivamente . A taxa de sucesso para o vef0,5 foi de 35%, 68% e 70%, respectivamente, nos participantes com 3, 4 e 5 anos de idade . O percentil 95 de variao percentual do valor previsto na resposta ao broncodilatador foram, respectivamente, de 11,6%, 16,0%, 8,5% e 35,5%, para vef1, vef0,75, vef0,5 e fef25 - 75% . Nossos resultados definiram pontos de corte de resposta ao broncodilatador para o vef1, vef0,75, vef0,5 e fef25 - 75 em crianas pr - escolares saudveis . Os achados deste estudo podem melhorar a avaliao fisiolgica da funo respiratria em pr - escolares . Although spirometry with bronchodilator testing is routinely used in order to investigate respiratory diseases in children and adults, it is rarely used in preschool children . In children, only a few studies have defined bronchodilator response cut - off points (for fev1), the established change in baseline fev1 and in percent predicted fev1 in response to bronchodilator use having varied across studies, from 9% to 14% and from 9% to 10%, respectively . The american thoracic society (ats) and the european respiratory society (ers) have yet to determine the best cut - off points for children . In addition, given the lack of studies, the ats and the ers have not been able to determine cut - off points for preschool children . One obstacle is that only a low proportion (34 - 90%) of preschoolers are able to exhale for 1 s or more . Therefore, measurements of fev during the first 0.5 s of fvc (fev0.5) or during the first 0.75 s of fvc (fev0.75) can be used as surrogates for fev1 . According to the ats and the ers, fev0.5 and fev0.75 several reference equations for fev0.5 and fev0.75 have been established in various populations . In a case - control study, bronchodilator response cut - off points of 14%, 14%, and 33% were found for baseline fev1, fev0.75, and fef25 - 75%, respectively . In another study, cut - off points of 10%, 11%, and 25% were found for baseline fev1, fev0.5, and fef25 - 75%, respectively; however, their sensitivity for the diagnosis of asthma was found to be low (12%, 30%, and 41%, respectively), their specificity being 84%, 90%, and 80%, respectively . Given that spirometry is a low - cost and noninvasive test, and given that several studies have demonstrated that preschool children can perform acceptable and reproducible fev0.5 and fev0.75 measurements, there is a need to determine bronchodilator response cut - off points for children in this age group so that spirometry can be used in daily clinical practice . Only two studies have assessed bronchodilator response using spirometry exclusively in preschool children . In the present study we sought to determine bronchodilator response cut - off points for fev1, fev0.75, fev0.5, and fef25 - 75% using the 95th percentile of the change in each parameter and establish reference values for fev0.75 in healthy preschool children (i.e., preschoolers without respiratory symptoms). This was a community - based study of preschool children 3 - 5 years of age selected from among those attending any one of 18 public day care centers and schools in the city of recife, brazil . We selected a convenience sample, giving priority to the schools and day care centers attended by the highest number of children and located in central, northern, and western recife . We calculated the sample size required to achieve a mean increase in fev0.75, after bronchodilator use, of 4.5% and a standard deviation of 5.1%, a value found in a study by borrego et al ., with 95% confidence, assuming an estimation error of 1%, in accordance with the sample size calculation of pardos et al . The minimum sample size was calculated to be 100 . In order to characterize the study sample, we used the ats and division of lung diseases questionnaire for the diagnosis of asthma - designated ats - dld-78-c - previously adapted and validated for use in brazil in children 4 months to 13 years of age . The inclusion criteria were as follows: being 3 - 5 years of age; having been a full - term infant; having had a birth weight 2,500 g; and having no respiratory symptoms, i.e., having no symptoms of asthma (dyspnea, wheezing, recurrent cough, or exertional dyspnea) or other respiratory diseases . The exclusion criteria were as follows: respiratory disease at birth requiring the use of oxygen for more than 24 h; chronic respiratory disease (including bronchopulmonary dysplasia, cystic fibrosis, and bronchiolitis obliterans); thoracic and pulmonary malformations; acute viral bronchiolitis in the last 6 months; acute nasopharyngitis; heart disease; and other severe diseases (including immunodeficiencies, neurological diseases, and genetic syndromes). A questionnaire administered up to one week before testing was used in order to determine whether prospective participants met any of the aforementioned criteria . Testing was not performed if there were signs of acute nasopharyngitis at the time of testing . All tests were performed by the principal investigator, having been performed in the morning in all participating schools and day care centers . A back - extrapolated volume of <80 ml or 12.5% of fvc was accepted, as recommended for preschool children . The objective was to obtain two acceptable maximal expiratory curves, the variation between the two highest values of fvc, fev1, and fev0.75 being equal to or less than 10% and the variation between the two highest values of fev0.5 being equal to or less than 5% . Curves with a forced expiratory time (fet) of at least 0.5 s were accepted regardless of whether or not they ended abruptly . Encouragement screens were used, and each session of testing was preceded by a brief (5-min) session of training . Spirometry was repeated 15 min after administration of 400 g of albuterol delivered by a metered dose inhaler, as recommended by the ats / ers . An aluminum spacer with a face mask was used (inal - air; rsmed, belo horizonte, brazil). No nose clips were used in the present study, because the use of nose clips in children undergoing spirometry has been shown to have no clear advantage . Testing was performed with a portable spirometer validated by the ats (koko; ferraris respiratory, louisville, co, usa). Calibration was performed at the testing site, before each session of testing, with the use of a 3-l syringe, within the acceptable range of volume and flow . Room temperature and humidity were measured, and the data collected were entered into the software . In order to obtain acceptable maneuvers, testing sessions were suspended after an average of eight attempts or, before that, if the child showed fatigue or disinterest in continuing . The following spirometric parameters were assessed: fvc; fev1; fev0.75; fev0.5; and fef25 - 75% . The values of the aforementioned parameters were obtained from the two best flow - volume curves, both of which were acceptable and reproducible . The criteria for determining the values of fef25 - 75% were as follows: for curves with a maximum fet of <0.75 s, fef25 - 75% was obtained from the curve with the highest fev0.5 value and the highest fev0.5 + fvc value; for curves with a maximum fet of <1 s, fef25 - 75% was obtained from the curve with the highest fev0.75 value and the highest fev0.75 + fvc value; for curves with a maximum fet 1 s, fef25 - 75% was obtained from the curve with the highest fev1 value and the highest fev1 + fvc value . The variables used in order to determine bronchodilator response cut - off points for fev1, fev0.75, fev0.5, and fef25 - 75% were the percent change regarding the predicted values, the percent change regarding the baseline values, and the change in absolute values . Statistical analysis was performed with the ibm spss statistics software package, version 21 (ibm corporation, armonk, ny, usa). The reproducibility of the spirometric measurements was tested by the intraclass correlation coefficient (icc). The student's t - test for paired samples was used in order to compare mean baseline and post - bronchodilator values of all spirometric parameters . The changes in response to bronchodilator use were calculated by the following formulas: (post - bronchodilator value baseline value) 100/baseline value (post - bronchodilator value baseline value) 100/predicted value the predicted values were derived from a reference equation for preschool children developed by our research group in a previous study . Because the aforementioned equation does not include reference values for fev0.75, they were calculated in the present study by linear regression . In order to determine bronchodilator response cut - off points for fev1, fev0.75, fev0.5, and fef25 - 75%, the 95th percentile of the change in each parameter was calculated for baseline, predicted, and absolute values . Spearman's correlation coefficient was calculated in order to evaluate the correlation of the bronchodilator response indices tested with age, height, and baseline fevt (fev1, fev0.75, and fev0.5). The study project was approved by the research ethics committee of the professor fernando figueira institute of integrative medicine (protocol no . The parents or legal guardians of all participating preschoolers gave written informed consent, and the researchers signed a statement of responsibility . Of those 447 children, 41 (9%) met the exclusion criteria and 34 (8%) constituted losses: 26 for missing school on the day of testing and 8 for declining to undergo testing . Of the remaining 372 preschoolers, 266 (71%) those 266 children, 56 (21.0%) failed to perform spirometry correctly and 50 (19.0%) failed to perform bronchodilator testing correctly . The final sample consisted of 160 asymptomatic preschool children (60% of the initial sample of 266 asymptomatic children). The demographic characteristics of the sample are presented in table 1 . Of the children who performed acceptable measurements, 19 (12%) were 3 years old, 74 (46%) were 4, and 67 (42%) were 5 . Curves with a back - extrapolated volume 5% were obtained in 99% of the tests, and, in 95% of those, the difference between the two highest fvc, fev1, fev0.75, and fev0.5 values was <5%, demonstrating a high reproducibility . Table 1sociodemographic characteristics of the study population, recife, brazil, february - december of 2014 . Variableresultmale gender84 (52.5)age, months57.8 7.8race white33 (20.6)black11 (6.9)mulatto116 (72.5)weight - for - age (z score) 0.20 1.18height - for - age (z score) 0.38 1.03bmi (z score) 0.65 1.20avalues expressed as n (%) or mean sd . We calculated the iccs for the two highest values of each of the spirometric variables tested . Mean iccs (and their respective 95% cis) for fvc and fev1 were 0.994 (0.990 - 0.996) and 0.993 (0.989 - 0.996), respectively . Mean iccs (and their respective 95% cis) for fev0.75, fev0.5, and fef25 - 75% were 0.993 (0.990 - 0.995), 0.992 (0.990 - 0.994), and 0.935 (0.913 - 0.951), respectively . Among the 3-year - olds in the initial sample of 266 children, fvc, fev1, fev0.75, and fev0.5 measurements were considered acceptable and reproducible in 5%, 7%, 9%, and 37%, respectively; among the 4-year - olds, they were considered acceptable and reproducible in 23%, 29%, 39%, and 68%, respectively; and among the 5-year - olds, they were considered acceptable and reproducible in 23%, 26%, 44%, and 70%, respectively . Spirometry was considered unacceptable in 63% of the 3-year - olds, in 32% of the 4-year - olds, and in 30% of the 5-year - olds . Bronchodilator response testing was considered inadequate in 19% of the 3-year - olds, in 20% of the 4-year - olds, and in 20% of the 5-year - olds, proportions that were very similar . Mean baseline and post - bronchodilator fvc, fev1, fev0.75, fev0.5, and fef25 - 75% values are shown in table 2 . There were significant differences between mean pre- and post - bronchodilator values of the aforementioned parameters (p <0.005). Proportionally, mean and median pre- and post - bronchodilator changes in fvc, fev1, fev0.75, fev0.5, and fef25 - 75% with non - normal distribution can be seen in table 2 . Table 2means and dispersion of baseline and post - bronchodilator spirometric parameters in the preschoolers studied . Variablebaseline post - bd change (pre- and post - bd),% p * nmean sdnmean sdmean sd (median) fvc, l941.06 0.21521.09 0.182.3 4.3 (0.71) <0.001fev1, l931.00 0.18611.06 0.174.5 4.7 (2.67) <0.001fev0.75, l940.94 0.17921.00 0.175.6 5.6 (4.32) <0.001fev0.5, l1600.80 0.161600.86 0.166.8 6.4 (5.47) <0.001fef25 - 75%, l / s941.52 0.40921.79 0.4220.0 20.2 (15.48) <0.001bd: bronchodilator; fev0.5: fev during the first 0.5 s of fvc; and fev0.75: fev during the first 0.75 s of fvc . Amean and median of the changes observed after bronchodilator use (variables with non - normal distribution). The greatest differences between mean and median values are due to a lower n of fvc and fev1 measurements after bronchodilator use . * bd: bronchodilator; fev0.5: fev during the first 0.5 s of fvc; and fev0.75: fev during the first 0.75 s of fvc . Mean and median of the changes observed after bronchodilator use (variables with non - normal distribution). The greatest differences between mean and median values are due to a lower n of fvc and fev1 measurements after bronchodilator use . * student's t - test for paired samples . In order to calculate reference values for fev0.75, the equation and the lower limit (ll) are as follows: fev0.75 = height 0.013 + weight 0.010 ll = predicted value 0.21(5th percentile of the residual) for females, the equation and the ll are as follows: fev0.75 = height 0.008 + age 0.008 + weight 0.013 ll = predicted value 0.19 the dispersion of fev0.75 values is shown in figure 2 . Figure 2scatter plots of fev during the first 0.75 s of fvc (fev0.75) in relation to height and weight in male preschoolers (a and b) and in female preschoolers (c and d). Table 3 shows all cut - off points established by the 95th percentile of the change in fev1, fev0.75, fev0.5, and fef25 - 75% in response to bronchodilator use . Table 3percentiles of the changes in fev1, fev0.5, fev0.75, and fef25 - 75% in response to bronchodilator use, the parameters being expressed as percentages of the predicted values, percent changes from baseline, and absolute changes in the preschoolers studied . Fev0.5: fev during the first 0.5 s of fvc; and fev0.75: fev during the first 0.75 s of fvc . Fev0.5: fev during the first 0.5 s of fvc; and fev0.75: fev during the first 0.75 s of fvc . Table 4 shows the spearman's correlations of the bronchodilator response cut - off points for baseline, percent predicted, and absolute values of fev0.5 and fev0.75 with age, height, and baseline fevt (fev0.5 and fev0.75). Table 4spearman's coefficients correlating the bronchodilator response indices with age, height, fev during the first 0.5 s of fvc (fev0.5), and fev during the first 0.75 s of fvc (fev0.75) in the study sample . Variableabsolute change from baseline fev0.5 after bronchodilator use, lpercent change from baseline fev0.5 after bronchodilator usechange in percent predicted fev0.5 after bronchodilator use scc (p)scc (p)scc (p)age, months0.04 (0.60)0.1 (0.28)0.05 (0.50)height, cm0.11 (0.17)0.05 (0.50)0.03 (0.70)baseline fev0.5, l0.16 (0.47)3.27 (0.00)0.25 (0.02) absolute change from baseline fev0.75 after bronchodilator use, lpercent change from baseline fev0.75 after bronchodilator usechange in percent predicted fev0.5 after bronchodilator use scc (p)scc (p)scc (p)age, months0.17 (0.11)0.24 (0.02)0.23 (0.03)height, cm0.53 (0.62)0.05 (0.66)0.01 (0.89)baseline fev0.75, l / s0.06 (0.60)0.18 (0.10)0.17 (0.11)scc: spearman's correlation coefficient . This is the first study to establish, by means of spirometry, bronchodilator response cut - off points in preschoolers, the cut - off points being expressed as the change in percent predicted fev1, fev0.75, fev0.5, and fef25 - 75% . Of the 4-year - olds in the study sample, 67% were able to perform fev0.5 measurements and 39% were able to perform fev0.75 measurements . Of the 5-year - olds in the study sample, 70% were able to perform fev0.5 measurements and 44% were able to perform fev0.75 measurements . Therefore, in preschoolers, fev0.5 measurements are more useful than fev0.75 measurements because the proportion of children who can perform the former is higher . In community - based samples, spirometry is not useful in 3-year - olds due to the high rate of unacceptable tests . The low proportion of children who were able to perform acceptable and reproducible pre- and post - bronchodilator measurements of fvc, fev1, fev0.75, and fef25 - 75% can be explained by the fact that ours was a community - based sample, the children therefore being more inexperienced in performing such measurements; in general, children selected from among those treated at respiratory outpatient clinics have previously been evaluated by their physicians regarding their motor coordination to perform such tests . Given that it is difficult for children to perform pre- and post - bronchodilator spirometry, the proportion of preschoolers who can perform it is lower . The high iccs for the spirometric parameters tested in the present study constitute evidence of the low variability and high reproducibility of the measurements performed, as well as of the technical skills of the professional who performed the tests . The mean changes in the percentage of the predicted values of fvc, fev1, and fev0.75 in response to bronchodilator use in the present study were 2.3%, 4.5%, and 5.6%, respectively, being similar to those found in another study (2.5%, 4.7%, and 4.5%, respectively). For fef25 - 75%, borrego et al . Found a change of 11.7%, compared with 20.0% in the present study . This difference can be explained by the difference in study sample between the two studies: ours was a community - based sample, whereas that in the study by borrego et al . In addition, the high reproducibility and, consequently, low variability of fef25 - 75% measurements in the present study increase the power to detect differences between pre- and post - bronchodilator values . In the present study, the mean post - bronchodilator percentage changes of fev1, fev0.5, and fef25 - 75% were 4.5%, 6.8%, and 20.0%, respectively, whereas, in another study, they were 8.9%, 2.9%, and 8.1%, respectively . The type of sample used in ours and in that study (community - based and case - control samples, respectively), as well as the fact that dose of albuterol was lower in that study (200 g), might have contributed to those differences . For fev1, the cut - off point found in the present study (a change of 13% from baseline in response to bronchodilator use) was similar to that found in another study (14%) but different from that found by linares et al . (10%, with a sensitivity of 12% and a specificity of 84%). This low sensitivity suggests that there were no significant differences between the groups regarding bronchodilator response or that the administered dose of albuterol (200 g) was insufficient to produce a bronchodilator effect . Because the aforementioned study was a case - control study involving patients with moderate to severe persistent asthma, it is more likely that the administered dose of albuterol was insufficient to provide effective bronchodilation . With regard to the change in the percentage of the predicted fev1 in response to bronchodilator use in the present study (i.e., 11.6%), we found no other studies evaluating this parameter in samples composed exclusively of preschool children . For fev0.5, the cut - off point found in the present study (a change of 20% from baseline in response to bronchodilator use) differs from that found by other authors (11%, with a sensitivity of 30% and a specificity of 90%). The high iccs for the measurements performed in the present study increase its power regarding the reliability of those measurements . It should also be taken into account that the cut - off points for a community - based study should be higher than those for studies comparing patients and healthy controls, as was the case of the two aforementioned studies . With regard to the change in the percentage of the predicted fev0.5 in response to bronchodilator use in the present study (16%), the fact that there have been no studies evaluating this parameter makes it impossible to make comparisons . For baseline fev0.75, the bronchodilator response cut - off point found in the present study (18%) was higher than that found in another study (14%). This difference might be due to the type of study (a case - control study) and how the cut - off point was calculated (mean + 2 standard deviations after bronchodilator use in healthy participants). With regard to the change in the percentage of the predicted fev0.75 in response to bronchodilator use in the present study (8.5%), the lack of evidence in the literature makes it impossible to make comparisons . Although some studies have included fef25 - 75% in the analysis of bronchodilator response, fef25 - 75% is not given weight in studies evaluating bronchodilator response, because it varies widely . For fef25 - 75%, the cut - off point found in the present study (a change of 61% from baseline in response to bronchodilator use) is different from those found by borrego et al . (33%) and other authors (25%, with a sensitivity of 41% and a specificity of 80%). Unlike the present study, the aforementioned studies were both case - control studies, and this might explain these discrepancies . The high icc for fef25 - 75% in the present study indicates good reproducibility . With regard to the change in the percentage of the predicted fef25 - 75% in response to bronchodilator use in the present study (35.5%) the use of this parameter in the evaluation of bronchodilator response in preschool children will require further studies . Some studies have shown that, in children, it is best to express bronchodilator response as a percentage of the predicted values, because percent predicted values do not depend on age, height, or baseline fev1 . However, for preschool children, the present study showed correlations of baseline fev0.5 with the percent change from baseline after bronchodilator use and the percent change in the predicted value after bronchodilator use . With regard to fev0.75, regarding this age group, age correlates with the percent change from baseline after bronchodilator use and the percent change in the predicted value after bronchodilator use . Therefore, in preschool children, there is no difference between the percent change from baseline after bronchodilator use and the percent change in the predicted value after bronchodilator use for the two parameters . One of the strengths of the present study is that it was a community - based study, the results of which are more generalizable than are those of studies conducted in secondary or tertiary care settings . Another strength of the present study is that we used predicted values that had been derived from preschoolers in the same region as those in the present study, thus increasing the reliability of the results obtained . The high reproducibility of the spirometric measurements in the present study shows that they are reliable . To our knowledge, this is the first study to determine, in preschool children, bronchodilator response cut - off points for fev1, fev0.75, fev0.5, and fef25 - 75%, expressed as percentages of the predicted values . That fev0.5 is reproducible and that fev0.5 measurements can be performed by a higher proportion of preschoolers, it is the most useful of all of the parameters studied here . In community - based samples, spirometry is not useful in 3-year - olds due to the high rate of unacceptable tests . For clinical practice, the recommended bronchodilator response cut - off points for percent predicted fev1, fev0.75, and fev0.5 are 12%, 8%, and 16%, respectively; for baseline fev1, fev0.75, and fev0.5, the recommended cut - off points are 13%, 18%, and 20%, respectively . For percent predicted and baseline fef25 - 75%, the recommended cut - off points are 35% and 61%, respectively . Given that fef25 - 75% showed good reproducibility, it might be useful in the evaluation of bronchodilator response . Further studies are needed in order to test the utility of these cut - off points in samples of patients with respiratory symptoms treated at respiratory outpatient clinics.
The objective of root canal treatment is thorough cleaning and shaping of all the pulp spaces to be filled with an inert filling material . A major cause of failure of the root canal treatment is the inability to locate, debride, or adequately fill all canals of the root canal system . A successful root canal treatment depends on the diagnosis, treatment planning, good knowledge of the root canal system, and its frequent variations . There are numerous studies that examine the root and root canal anatomy of different populations using different methods like sectioning, canal sectioning, and tooth clearing techniques, conventional radiography, digital radiographic techniques, contrast medium - enhanced radiography, and computed tomographic scanning . The tooth clearing methods have generally been considered the gold standard for analyzing the root canal anatomy, which involves making the tooth transparent and staining the canals for study, but these ex - vivo methods require the extraction of a tooth . There are case reports of the incidence of second mesiobuccal (mbi) canals ranging between 18 and 96.1% . The incidence of five canals is reported to be 2.25 2.4%, and the incidence of six canals is reported to be 0.31 0.88% . The incidence of a second distobuccal (dbi) canal in the maxillary first molars has been reported to be as low as 1.7 and 1.25% . Case reports with more than four root canals have also been reported in three - rooted maxillary first molars [table 1]., reported one maxillary first molar out of 140 samples having three roots and seven canals . Kottoor et al ., reported the endodontic management of the maxillary first molars with seven and eight canals, respectively . Incidence of multiple canals in maxillary first molars this case report discusses the endodontic management of an unusual root canal configuration in a maxillary first molar showing three roots and seven canals . This unusual morphology was confirmed with the help of cone beam computerized tomography (cbct) scans . An 18-year - old male patient reported to the department of conservative dentistry and endodontics, sinhgad dental college and hospital, pune, with the chief complaint of spontaneous pain in the upper left posterior region of the jaw for the past five days . The patient gave a history of intermittent pain for the last two months, which had increased in intensity in the preceding five days . On clinical examination, a deep disto - occlusal carious lesion, which was tender on percussion, with no mobility, was seen in tooth 14 . Vitality testing of the involved tooth with heated gutta - percha (dentsply maillefer, ballaigues, switzerland) caused an intense lingering pain, whereas, an electronic pulp tester (parkell, usa) gave an early response . A preoperative radiograph revealed disto - occlusal radiolucency approaching the pulp space, with the periodontal ligament space widening in relation to the mesiobuccal root . From the clinical and radiographic examination, a diagnosis of symptomatic irreversible pulpitis with symptomatic apical periodontitis was made and nonsurgical endodontic treatment was recommended . Radiographic evaluation of the involved tooth did not indicate any variation in the root canal anatomy . Local anesthesia was induced using 1.8 ml of 2% lignocaine and adrenaline (aqua fine injecta pvt . Ltd ., pune, india). After caries excavation, the distal surface of the tooth was built up with composite resin (matrix, medicept dental prod, uk) to enable optimal isolation . Initially, the mb1, db1, and two palatal canals (mesiopalatal (mp) and the distopalatal (dp)) were located . When viewing the floor of the pulp chamber under a dental operating microscope (dom) (moller wedel, germany), three additional root canal orifices (mb2, mb3, and db2) were located and conventional triangular access was modified to a trapezoidal shape, to improve access to the additional canals [figure 1a and b]. The patency of the canal was confirmed with iso #10 k - files (mani, japan). To confirm this unusual morphology, it was decided to perform cbct imaging of the tooth . A sterile cotton pellet was placed in the pulp chamber and cavit g (3 m espe dental products, st paul, mn) was used to seal the access cavity . Informed consent was obtained from the patient, and a multislice cbct scan of the maxilla was performed with a tube voltage of 100 kv and a tube current of 8 ma . The involved tooth was focused and the morphology was obtained in the transverse, axial, and sagittal sections, of 0.5 mm thickness . The cbct scan slices revealed seven canals (three mesiobuccal, two palatal, two distobuccal) in the left maxillary first molar [figures 2a and b, 3a and b]. (a) access opening (b) access opening (a) coronal section (b) coronal section (a) apical section (b) apical section the cbct images provided valuable information regarding the canal configuration and confirmed the seven canals that were not clearly seen in the conventional radiograph . At the next appointment, after two weeks, the patient was asymptomatic . The working lengths were determined with the help of an apex locator (root zx, j morita, tokyo, japan), under rubber dam isolation, and intraoral periapical radiographs of the mesiobuccal, distobuccal, and palatal root were taken to confirm the working lengths [figure 4a and b]. Cleaning and shaping were performed using nickel - titanium rotary instruments (m2, dentsply vdw, germany) using the crown - down technique . During root canal preparation, final rinsing of the canals was performed using 2% chlorhexidine digluconate (asep rc, stedman anabond, chennai, india) together with passive ultrasonic agitation . The canals were dried with absorbent points (dentsply maillefer, ballaigues, switzerland) and obturation was performed using cold lateral compaction of the gutta - percha (dentsply maillefer, ballaigues, switzerland) and ah plus resin sealer (dentsply detrey, konstanz, germany). A radiograph was taken to establish the quality of the obturation [figure 5a and b]. After completion of root canal treatment, the tooth was restored with a posterior composite filling (matrix, medicept dental products, uk) and the patient was advised to have a full coverage porcelain crown . Mb root (a) obturation (b) clinical view of the pulp chamber post obturation before undergoing root canal treatment, prior knowledge of the roots and root canal anatomy of the teeth is required . In the maxillary molars, anatomic variations are not uncommon, with the number of canals, from one to eight . Recently, 14 new additional canal types were reported by sert and bayirli, highlighting the complexity of the root canal systems . In this case, it helped to confirm the presence of multiple canals, which were otherwise not able to be identified, except through the microscope . The tenet of as low as reasonably achievable (alara) was considered, but the advantage of using cbct outweighed the risks of additional exposure . A cbct scan and surgical operating microscope confirmed the diagnosis of three roots and seven canals in the left maxillary first molar, namely, mb1, mb2, mb3, db1, db2, mp, and dp . The cbct axial images showed the mesiobuccal root had a sert and bayirli type xv canal configuration . The mb2 and mb3 joined together to exit as one and the db1 and db2 joined to exit as one . In clinical conditions, conventional periapical radiographs and digital radiographs taken in different angulations are an essential part of endodontic treatment for the identification of root and canal configuration . However they are taken in a buccal - lingual direction and give only two - dimensional information about a three - dimensional object . In recent years, advanced techniques like computed axial tomography scanning are being used to evaluate root canal morphology, as a three - dimensional image . It allows the operator to view the tooth roots and their root canal systems at different levels, which helps to identify a larger number of morphological variations than in the conventional radiographs . Cbct images are reconstructed using significantly lower radiation doses when compared with the alternative conventional computed tomography scanning . This is because, with cbct scanning, the raw data are acquired in the course of a single sweep of a cone - shaped x - ray source and reciprocal detector around the patient's head . Of the various comprehensive maxillary first molar ex - vivo studies in dental literature, of the 140 extracted maxillary first molars evaluated, only one tooth showed seven root canals, which contained three mesiobuccal, three distobuccal, and one palatal canal . The frequency of the mb2 canals in the mesiobuccal root was reported to be 92.85% (based on ex - vivo results), 95.63% (based on clinical results), and 95.45% (based on cbct results), whereas, the corresponding figures for the distobuccal root (db2) were 1.15% (ex - vivo) and 3.75% (clinical), and those for the palatal root (second palatal canal) were 2.05% (ex - vivo), 0.62% (clinical), and 4.55% (cbct). Three canals in the mesiobuccal root were reported by various authors [table 1]. Additional mesiobuccal canals were commonly found in the age group of 20 to 40 years . In the present case, the use of a dental operating microscope helped in the location and identification of additional canal orifices . As an additional finding, the contralateral maxillary first molar had additional root canals, which were clearly appreciable in the cbct . Thorough knowledge of the root canal anatomy is an essential pre - requisite for endodontic success . The knowledge that aberrant canals are more common than earlier assumed is increasingly being proven . The clinician should use increased magnification and advanced diagnostic aids similar to cbct, to ensure identification and location of additional canals.
This project was developed for the second semester of a two - semester, two - credit introductory organic chemistry laboratory course sequence for chemistry and related majors; the project was first implemented in spring 2012 and successfully improved for spring 2013 . The course is separate from the pre- or co - requisite organic lecture course and meets twice weekly for 3-h sessions, in sections each led by a graduate teaching assistant (ta). Typically, the student: ta ratio is less than 12:1, and the course consists of 5070% second - year students, with the remainder being composed primarily of third - and fourth - year students . Over the two years this project has been implemented, 40 students have participated . For many students, the project could also be appropriate for an upper - division undergraduate organic laboratory course . In developing the research module, a primary goal was to introduce students to authentic organic chemistry practice a goal to which student attention was explicitly drawn . This goal could be achieved by requiring students to find, adapt, and optimize procedures directly from the literature to develop and carry out a multistep synthesis . In so doing, a secondary goal of exposure to modern synthetic techniques, including microwave - accelerated synthesis and affinity chromatography, in particular, chromatography is an important part of the everyday life of synthetic organic chemists, but relatively little chromatography is carried out in organic teaching labs . Reasons for this omission may include the safety issues of packing and running columns with standard silica gel (inhalation hazard) in pressurized glassware (explosion hazard), as well as the cost of the silica gel and solvent disposal for single - use columns . The use of fluorous affinity chromatography with prepacked columns could make a chromatography process more feasible in teaching labs: the preparation issues are avoided, and the columns can be reused multiple times . Moreover, an understanding of affinity chromatography and noncovalent interactions is particularly relevant for students who go on to pursue work in biochemistry and areas of biology where it is a common technique . Fluorous chemistry is a rapidly growing subfield of organic chemistry that has also gained attention in the context of green chemistry . This is due in part to the recyclability of many fluorous - tagged reagents and catalysts, as well as the fact that product isolation and purification using fluorous tags is greatly facilitated . The crux of the project reported herein was to synthesize a brightly colored molecule bearing a fluorous tag and then to use that product to explore fluorous solid - phase extraction (fspe) so that the separation process could be easily followed visually and understood conceptually . The project described is, to the best of our knowledge, the first reported implementation of fluorous synthesis and solid - phase extraction chemistry in the undergraduate organic teaching laboratory . In preliminary development, ways were sought to attach a fluorous tag to fluorescein derivatives; a recent fluorescein experiment from this journal has already been successfully adopted in this course . After encountering difficulty early in the development phase for such a project, a fluorous aminoanthraquinone target was selected (scheme 1). The rationale for this selection drew upon the precedent that compounds of type 1a (r = ch2rf, x = f, where rf is perfluoroalkyl) are known to be useful molecules for visualizing fluorous separations, whereas aminoanthraquinones of type 1b (r = alkyl or aryl, x = ots) are known to be easily accessed from a readily available, inexpensive starting material (quinizarin, 2). Once the target was selected, a route was devised that would require students to engage in multistep synthesis . After debate on how best to frame the experience for the students, it was ultimately decided to provide them with scheme 2 in its entirety to facilitate their search for literature procedures to attempt directly or to modify to their needs . Although explicitly told that they could deviate from the provided scheme if desired, students generally opted to follow the sequence shown . Several features of this route are noteworthy:all of the intermediates except the final product are known compounds, facilitating the literature search process;it combines familiar, textbook chemistry with challenging chemistry not typically found in traditional undergraduate laboratory or lecture;the literature procedures that are found as precedents for individual steps require modification for use in the teaching laboratories due to constraints of time, equipment, or reagent safety requiring students to think critically about them and to come up with viable alternatives . All of the intermediates except the final product are known compounds, facilitating the literature search process; it combines familiar, textbook chemistry with challenging chemistry not typically found in traditional undergraduate laboratory or lecture; the literature procedures that are found as precedents for individual steps require modification for use in the teaching laboratories due to constraints of time, equipment, or reagent safety requiring students to think critically about them and to come up with viable alternatives . It was anticipated that such a project design would provide ample opportunity for students to develop their own chemistry and attempt to establish alternative reaction conditions for given transformations, while minimizing the time, logistical, and safety issues that typically accompany more open - ended projects . Early in the semester, students began using scifinder scholar, were introduced to the project, and were provided with scheme 2 . Students were told that they would, on an individual basis, have to submit a proposal before they began . The proposal would contain literature procedures for their reactions as well as their proposed modifications thereof (based on the rules below, vide infra). After several weeks of planning outside of class, students would be given six consecutive lab periods in which to carry out their individual synthesis . In the interim, students would continue to do typical laboratory experiments, as well as inquiry - based mini - projects that served to prepare them for the capstone project . Additionally, students were given two lab periods interspersed through the early part of the semester to ease into the project and practice the literature search and independent work process prior to the dedicated block of project time . Students were free to explore any chemistry that they had found as precedent, within the following constraints: (1) they would be allowed to leave reactions unattended or heating over extended time periods, if desired, provided that they were properly labeled and that no reflux condenser was required when the laboratory was unoccupied; (2) particular reactions that would require equipment that was unavailable to all students (a parr hydrogenation bottle) and specific reagents (such as bu3snh) were labeled off - limits; (3) their scale would be limited to a few attempts at the use of one gram of perfluorooctyl iodide in the conversion of 4 5 in scheme 2; and (4) their procedures would be vetted by the teaching staff after an inspection for safety considerations . It was anticipated that these few rules would force students to be creative and to think critically about reaction design . At the same time, students would be able to experience a modicum of freedom and thus take ownership of their project . Students were informed that another way that the project mirrors the typical practice of organic chemistry research is that the key intermediate, perfluorooctylpropyl amine 7, is commercially available but at high cost . A small amount would be available to them if necessary to use on the final day of the project, so that they could still perform the final synthetic step and explore the fspe technique . Rather than diminish their motivation or make them believe that this was an exercise in futility, this served to ease the pressure they felt that they must be able to make it to the end on their own in the time allotted (eight total lab periods). This is fortuitous, because, to date, the long - term objective of students unaided synthesis of this compound has not been achieved . However, we strongly believe that the success of the project described herein is not contingent upon student synthesis of the final target, but, as in many graduate dissertations, the experience gained and growth undergone en route . A secondary goal guiding module development was to produce a module that could be easily modified and adopted; this goal was part of the rationale to constrain the activity in such a way as to minimize the logistical issues perceived to be significant obstacles to the widespread adoption of project - based approaches . It is believed that, with a few modifications, this approach could be useful at other institutions . For example, although students worked on the project individually, the project is also amenable for small groups of 23 students with division of the workload; groups working together would also allow a more systematic approach for the exploration of modified reaction conditions . Easily modifiable background documents for various aspects of the project are available for adaptation . For example, if an instructor would simply like to demonstrate fspe, many modifications of this project could be made to illustrate the technique using commercial reagents or shorter synthetic sequences . Although some of these compounds are relatively expensive, costs can be kept low by the use of small scales (50 mg) and grouping students . The targeting of strongly colored dye molecules means that only a small amount of product must be obtained to achieve a dramatic visual effect . The current approach made heavy use of a laboratory microwave to give students practice with another modern, rapidly growing technique . Indeed, the microwave was another tool that students often thought to employ when dealing with the constraints of a traditional 3-h time block for a laboratory session . Fortunately, much of this chemistry was developed outside of the microwave and can also work well in departments without this equipment . If a microwave is available, a student to microwave ratio of about 6:1 is optimal to minimize bottlenecks in the sharing of this equipment resource . Although the microwave is equipped to handle multiple samples at a time, if students have proposed different conditions of time and temperature, this can result in a bottleneck . General laboratory safety procedures, including wearing appropriate personal protective equipment, must be followed at all times . All organic chemicals involved in these experiments are considered hazardous, and direct physical contact with them should be avoided . Students were required to find the msds sheets of all reagents used and note particular hazards in their laboratory notebooks prior to use of the chemical . Use of aibn (as in the conversion of 4 5) produces nitrogen gas during the course of the reaction, and therefore, precautions need to be taken for pressure build - up if this reagent is used under sealed vessel conditions . A research module has been developed and successfully implemented in a second - semester introductory organic teaching laboratory for chemistry majors . Key features of the approach were an outlined route to a target that necessarily forced students to think critically about the procedures they planned to use to reach the targeted molecule and to propose modifications to known procedures . The module exposed students to modern chemistry through the use of microwaves and fluorous techniques, and engaged them in the process of organic chemistry as practiced in many laboratories across the world . While full details of the project evaluation and assessment will likely be reported upon additional data collection, the initial response to the project from the majority of students has been positive . Although some students resisted the extra work and others struggled with the frustration of failed experiments, students generally appreciated the chance to take ownership of their work, as well as the fact that this represented a departure from canned experiments . This project or a slight modification thereof can be used to introduce students to authentic organic chemistry practice including modern synthetic techniques and should be easily adaptable to other settings.
Cardiovascular disease (cvd) is the leading cause of death among patients with type 2 diabetes mellitus (t2 dm) even with earlier detection and treatment of t2 dm as has occurred during the past decade . This patient population has a 2- to 3-fold higher risk of cvd relative to their nondiabetic counterparts . Yet, the relationship between plasma glucose concentration and cvd in t2 dm remains poorly understood . Several in vitro and in vivo studies have documented that hyperglycemia alters cellular biochemistry within the vasculature, ultimately inducing endothelial dysfunction and abnormalities in vascular structure and biology predisposing t2 dm patients to cvd (reviewed in). Nonetheless, large randomized clinical studies evaluating the impact of improving glycemic control on cvd outcomes [36] failed to demonstrate an effect of improvement in existing hyperglycemia from hba1c levels> 7.0 to 7.0 to reduce cvd outcomes over the duration of the trials . Posttrial follow - up and post hoc analyses of some of these trials suggest that early reductions in hba1c may be coupled to modest long - term improvements in cvd outcomes [7, 8]. In addition, epidemiological studies indicate that the risks of vascular complications are strongly associated with glycemic exposure, such that the cvd event rate increases over time as the mean hba1c increases above 7.0% prior to the first event [914]. In aggregate, these studies suggest that the effect of reducing existing hyperglycemia to reduce cvd event rate may require a long time to be expressed and is of moderate impact . Apparently, progression of t2 dm, with its multifactorial pathological components of the insulin resistance syndrome, including loss of glycemic control, predisposes to increased incidence of cvd that cannot then be easily, quickly, and largely reversed by merely reversing the hyperglycemia . Moreover, even in t2 dm subjects with good glycemic control, increased risk of cvd is evident . Clearly, more effective approaches outside of managing dysglycemia are required to ameliorate these macrovascular complications of t2 dm . In this regard, several lines of evidence suggest that other mechanisms such as increased vascular sympathetic tone and/or endothelial dysfunction may be strong potentiators of cvd in insulin resistant states [1621]. Elevated sympathetic tone contributes significantly to hypertension, cardiac autonomic neuropathy, insulin resistance, dyslipidemia, vascular reactive oxygen species generation, inflammation, and endothelial dysfunction that each in turn contributes to cvd [1621]. A current unmet goal of clinical research and practice in t2 dm is the identification of safe and effective therapies that maintain good glycemic control, preventing progression of disease, while also reducing the long - term cvd risk, independent of their impact upon glycemic control . Bromocriptine - qr, a quick release formulation of bromocriptine, a sympatholytic dopamine d2 receptor agonist [22, 23] (approved by the u.s . Food and drug administration for the treatment of hyperglycemia in patients with t2 dm in 2009) may offer a therapy with the potential to maintain glycemic control and reduce cvd risk [2428]. Once daily, morning administration of bromocriptine - qr has been shown to improve glycemic control when used as either monotherapy or add - on therapy (0.5 to 0.9 hba1c reduction relative to placebo control) in t2 dm subjects with poor glycemic control (hba1c 7.5) [27, 28]. In addition, in a large t2 dm study population (cycloset safety trial (cst); n = 3070) comprised of subjects across a wide range of glycemic control status (a1c range: 5.510.5; median [25th75th percentile]: 6.8 [6.27.6]) whose hyperlipidemia and hypertension were well controlled and yet with preexisting cvd history (33% of population), intervention with this agent resulted in a 40% hazard risk reduction of a prespecified composite cvd endpoint over a period of one year . Available evidence suggests that bromocriptine - qr may work through restoration of the daily morning peak in central circadian dopaminergic neural activities [2932] to reduce the major cvd risk factors of hyperactive sympathetic tone at the vasculature, endothelial dysfunction, and vascular oxidative and nitrosative free radical generation [33, 34], each independently of any effect on fasting plasma glucose or lipid levels . These neuroendocrine aberrations are operative in progression of cvd over the entire continuum of glycemic control in t2 dm patients, including those with good glycemic control, as they are also present in the prediabetic state [3538]. Therefore, we hypothesized (1) that even in t2 dm subjects with good glycemic (and lipid and blood pressure) control with standard of care, the cvd event rate may still be high due to the presence of these underlying etiological neuroendocrine pathologies and (2) that such subjects would benefit from administration of bromocriptine - qr to produce a potent and rapid reduction in cvd event rate via its beneficial effects on the above neuroendocrine pathologies, irrespective of such existing good glycemic (lipid and blood pressure) control . However, the antidiabetes and cvd protective effects of bromocriptine - qr in this specific cohort of t2 dm subjects with well - controlled glycemia have never been investigated . Hence, to test this hypothesis, we analyzed the data from the cycloset safety trial (cst), which had enrolled subjects across a wide spectrum of glycemic control status ranging from very good to very poor control and afforded the unique opportunity to investigate, for the first time, the effects of bromocriptine - qr on progression of both dysglycemia and cvd in a relatively large population of subjects with well - controlled t2 dm (hba1c 7.0; median [25th75th percentile]: 6.4 [66.7] in contradistinction to cst subjects with hba1c> 7.0; median [25th75th percentile]: 7.8 [7.48.5]). The current study population was derived from those subjects within the cst with a baseline hba1c 7.0 . Of the 3070 subjects randomized 2: 1 to treatment with bromocriptine - qr versus placebo in cst, 1834 subjects (1219 receiving bromocriptine - qr and 615 receiving placebo) had baseline hba1c 7.0 . Briefly, this was a 12-month, multicenter, placebo - controlled, double - blind, parallel - group safety and efficacy study in outpatient t2 dm subjects recruited from general practice and diabetes clinics across 74 clinical centers in the united states and puerto rico . Subjects were between the ages of 30 and 80 years and had a body mass index <43 kg / m and an hba1c 10.0% . Subjects with new york heart classifications i and ii congestive heart failure (chf) were allowed to participate, as were subjects with a history of myocardial infarction (mi) or coronary revascularization occurring> 6 months before enrollment . Subjects were required to have maintained a stable diabetes treatment regimen for 30 days prior to randomization, consisting of either lifestyle interventions of medical nutrition therapy and appropriately prescribed physical activity, oral antihyperglycemic agents (2), or insulin either alone or in combination with 1 oral antihyperglycemic agent . The study drug was titrated by adding 1 tablet (0.8 mg bromocriptine - qr per tablet) per week until a maximum tolerated daily dose between 2 and 6 tablets (1.6 to 4.8 mg / day) was achieved . The study drug was taken once daily with the morning meal, within 2 hours of waking . Subjects were required to continue their established antihyperglycemic treatments during the first 3 months of the study . However, the dosages of the oral agents or insulin could be modified as deemed appropriate by the study site investigator . After 3 months, alterations in the diabetes treatment regimen were allowed, if deemed necessary by the study site investigator, as long as these changes did not result in a final regimen that exceeded 2 oral agents or insulin plus 1 oral agent, exclusive of the study drug . The study protocol was approved by site - specific or central institutional review boards and all subjects provided written informed consent to participate in the study before enrollment . This current study and analyses are original and different from any previously reported results from the cycloset safety trial . The same prespecified cvd endpoint of the cst (a composite of major cardiovascular events, defined as a composite of first mi, stroke, coronary revascularization, or hospitalization for angina or chf that occurred after randomization) was also used in this new study and analysis . An independent event adjudication committee consisting of two cardiologists and an endocrinologist, blinded to treatment assignment and medical dictionary for regulatory activities coding of events by the study team, made the final serious adverse event (sae) system organ class (soc) classifications and assignment of an sae as a cvd endpoint . Intention - to - treat (itt) and on - treatment (ot) analyses were conducted . Itt analysis included all patients receiving at least one dose of the study drug with exposure time being one year or time to event . To account for any possible influence of weighted early termination among bromocriptine - qr versus placebo treated subjects that might artificially impact the itt analysis, an ot analysis restricting exposure time to time on study drug was also conducted . Superiority between bromocriptine - qr and placebo for the cvd endpoint was defined as the upper bound of the two - sided 95% confidence limit being <1.0 and the superiority analysis of cvd endpoint was based on the cox proportional - hazards regression, adjusted for baseline covariates including history of stroke, revascularization, and center, with two - sided p values calculated . The cumulative incidence rate of the cvd endpoint was analyzed by log - rank test . The impact of bromocriptine - qr versus placebo on the progression of diabetes was described as the odds of losing glycemic control while on therapy and determined by evaluating the percent of subjects completing 52 weeks of therapy, whose hba1c progressed above 7.0% . The odds of requiring treatment intensification to maintain hba1c 7.0% during the study period of 52 weeks were also analyzed . To eliminate potential confounding arising from intensification of concomitant antidiabetes medications, the analyses were also performed in only those subjects completing 52 weeks without requiring any concomitant antidiabetes treatment intensification . The above analytical approach was also conducted on the entire study population using a last observation carry - forward analysis . Statistical analyses of the primary endpoints and safety measures were conducted independently by everest inc . (ontario, canada) using sas software version 8.2 (cary, nc). Safety analyses were conducted as previously described for the cst . There were no significant differences in baseline demographics between the bromocriptine - qr and placebo study arms although the hba1c level was not considered as a stratification factor in the cst (table 1(a)). The study population carried multiple risk factors for cvd and was comprised of individuals among whom 74% were hypertensive, 75% were hyperlipidemic, greater than 50% were prior or current smokers, approximately 33% had preexisting cvd who were obese on population average with an average bmi of> 32 (table 1(a)). Fasting plasma glucose, lipids, and blood pressure were well controlled in both groups . Majority of the subjects were receiving cardioprotective medications (see table 1(b) for details). 1834 patients (1219 receiving bromocriptine - qr and 615 receiving placebo) from the cst trial had baseline hba1c 7.0% and were included in this study . In total, 92% of the planned person - year cv outcome ascertainment was observed in this trial (1772 of 1920 possible total person - years), with 77% of bromocriptine - qr subjects and 83% of placebo subjects providing a week 52 plus 30-day follow - up outcome assessment . The number of subjects with hba1c assessment at week 52 was 1203 (750 bromocriptine - qr and 453 placebo). Details of subject disposition and delineation of person - year cv outcome ascertainment are shown in figure 1 . In the itt analysis, the composite cvd endpoint occurred in 19 bromocriptine - qr - treated (1.6%) and 19 placebo - treated (3.1%) subjects, resulting in a 48% cvd hazard risk reduction (hazard ratio [hr] 0.52, ci 0.280.98) (table 2). The ot analysis revealed a 52% cvd risk reduction (hr: 0.48; ci: 0.240.95) (table 2). Figure 2 depicts the kaplan - meier curve of the cumulative incidence rate of the composite cvd endpoint by treatment and demonstrates a significant difference at 1 year (log rank p = 0.041). There were no significant changes in plasma lipid levels or heart rate in either treatment group . Compared to placebo, the bromocriptine - qr treated group exhibited a mild reduction in blood pressure (change from baseline blood pressure (mean sd; mmhg): 2.81 16.27 systolic and 1.89 9.76 diastolic in the bromocriptine group; 0.54 14.86 systolic and 0.56 9.54 diastolic in the placebo group; between group difference (ci): 1.76 (3.09, 0.42) systolic (p = 0.0099) and 1.19 (2.00, 0.38), (p = 0.0038) diastolic). Among study subjects whose hba1c remained 7.0 during the study period, bromocriptine - qr intervention reduced the fraction of subjects that required intensified concomitant antidiabetes therapy to do so by 47%for the completer population and by 58% for the itt population (see table 3 for details). Analyzing all subjects who had a 52-week hba1c measurement, irrespective of changes in concomitant diabetes therapy and adjusting for baseline hba1c, the odds of losing glycemic control (hba1c> 7.0% after 52 weeks of treatment) were significantly lower with bromocriptine - qr therapy (or (95% ci): 0.63 (0.470.85), p = 0.002). The odds of requiring treatment intensification to maintain hba1c 7.0% over the course of the study were also significantly lower with bromocriptine - qr therapy (or (95% ci): 0.46 (0.310.69), p = 0.0002). On repeating the analysis including only those subjects who did not have a change in the intensity of their concomitant diabetes regimen, bromocriptine - qr was still associated with significantly lower odds of losing glycemic control compared with placebo (18% versus 26%, resp .) (or (95% ci): 0.56 (0.390.80), p = 0.002). These differences between the treatment groups were unaffected and remained significant (p = 0.001) after adjusting for body weight changes during the study . The same results described above were observed using a last observation carry forward analysis among all subjects with a screening hba1c value 7.0% (itt population, n = 1834) (see table 3 for details). For the itt population, the between - group difference in change from baseline hba1c (6.3 0.5) was 0.17 (ci 0.23, 0.11; bromocriptine - qr: 0.18, placebo: 0.35; p <0.0001). Adverse events (aes) that were most commonly reported (occurring in greater than 5% of subjects in either group) are shown in table 4 and were similar to those previously reported for the cst . Among the aes occurring at a higher rate in the bromocriptine - qr group, the between - group difference was significant (p <0.0001) for nausea (31.7% versus 8.0%), dizziness (15.5% versus 8.6%), fatigue (13.9% versus 7%), and vomiting (8.7% versus 3.4%), with the severity reported as being mild - moderate in> 90% of all cases in each of these categories . The increased rate of nausea, the most common adverse event reported, was transient and confined to the initial 6-week drug titration period with an average weekly rate of approximately 6% and decreasing to <1% thereafter (see figure 3). Hypoglycemic episodes occurred infrequently (5.5% bromocriptine - qr versus 4.2% placebo) with no significant between - group difference in the rate . Arthralgia was reduced by 39% in the bromocriptine - qr group (p = 0.03). In the bromocriptine - qr treated group 105 subjects (8.6%) reported 149 serious adverse events (sae) while the placebo - treated group had 58 subjects (9.4%) reporting 80 serious adverse events . In the cardiac disorders body system class there were 33 events reported in 28 subjects (2.3%) in the bromocriptine - qr group and 25 events reported in 21 subjects (3.4%) in the placebo group . No other body system classes had sae occurring in greater than 2% of either group . There was no between group difference in change from baseline body weight (bromocriptine - qr: 0.386 versus placebo: 0.366, p = 0.97). The findings of this study demonstrated that, in metabolically well - controlled t2 dm subjects (baseline hba1c 7.0%), adding bromocriptine - qr treatment to their baseline established diabetes treatment regimen significantly aided in maintaining good glycemic control, with a lower likelihood of progressing above an hba1c of 7.0% or requiring intensification of treatment over the ensuing year to maintain hba1c 7.0% . Furthermore, bromocriptine - qr treatment was also associated with a 48% cvd event rate reduction within the 1-year study duration in this population of t2 dm subjects, with excellent baseline glycemic control (hba1c 6.3 0.5). The study population had multiple cardiometabolic risk factors for cardiovascular disease at baseline (table 1(a)) and the placebo - arm of the study population had a relatively high event rate (3.1%) for the prespecified serious cardiovascular adverse event endpoint while being well controlled pharmacologically for dysglycemia and on population average for dyslipidemia and hypertension as well . These findings suggest that, in this t2 dm subject population demographic, (1) there are biochemical pathological factors beyond hyperglycemia, hyperlipidemia, and high blood pressure predisposing this population to cvd events and (2) there likely are significant mechanisms beyond glycemic control contributing to the observed cvd risk reduction with this therapy . Although epidemiological evidence [914] supports an adverse role of poor glucose control on cvd risk, intervention trials have been less conclusive . Of the earlier studies, the united kingdom prospective diabetes study (ukpds) demonstrated that intensive glycemic control in individuals with newly diagnosed t2 dm reduced the risk of microvascular complications . Further, longer - term follow - up of these individuals for 10 more years after the end of the intervention trial demonstrated continued reductions in microvascular disease risk and statistically significant benefits on both cvd endpoints and total mortality in the intensive therapy arm, despite the mean hba1c between the groups having converged soon after the randomized phase of the trial had concluded . The action to control cardiovascular risk in diabetes (accord) study, the action in diabetes and vascular disease (advance) study, and the veterans affairs diabetes trial (vadt) that were shorter in duration than ukpds enrolled older patients, with more advanced and poorly controlled diabetes, and known cad or at high risk for cvd and found no significant decrease in cvd endpoints with intensive glucose control . However, the evidence from / post hoc analyses of these large trials [810] and the longer - term ukpds follow - up suggests long - lasting benefits of tighter glycemic control in patients that are younger and earlier in the course of their diabetes or with lower hba1c values (at about 7.0) at treatment intensification . In these individuals, maintaining hba1c <7.0% remains a reasonable target and may have important benefits in reducing the future burden of macrovascular and microvascular disease . The bromocriptine - qr effect to slow progression of dysglycemia in these individuals as demonstrated herein may therefore offer cvd benefits over the long - term; however, the rapid response to bromocriptine - qr respecting the reduction in cvd outcomes observed in the present study begs for other mechanisms operative in the manifestation of this effect . Moreover, although bromocriptine has been shown to reduce hypertriglyceridemia and elevated blood pressure, these effects cannot be responsible for the observed cvd event rate reduction as these parameters were well controlled at baseline and minimally affected by the intervention . Prior studies of the neuroendocrine impact of timed bromocriptine administration in insulin resistant animals and humans however may offer insights into a possible mechanism for the observed cvd (and metabolic) response to the therapy as follows . Bromocriptine - qr therapy is a circadian - timed administration of a quick - release, high absorbing, and short half - life formulation of bromocriptine . It has been formulated and administered in the morning within 2 hours of waking to provide a discrete and brief daily interval of circulating bromocriptine [2428, 39], thereby providing a timed pulse of increased dopaminergic activity centrally at the time of day that studies suggest is the natural daily peak of central dopaminergic activity in healthy individuals [32, 40]. Studies indicate that disturbed circadian rhythmicity of the biological clock (hypothalamic suprachiasmatic nucleus (scn)) and a reduced dopaminergic tone within the central nervous system are associated with the development of insulin resistance, obesity, and diabetes [26, 29, 32, 35, 4147]. A diminution of the daily circadian peak in dopaminergic activity at the scn at the onset of the daily locomotor activity rhythm (e.g., waking from night - time sleep in humans) is coupled to increases in hypothalamic ventromedial and paraventricular nuclei drive for increased sympathetic and hypothalamic - pituitary - adrenal (hpa) axis activities (reviewed in). These increased sympathetic / hpa activities potentiate increases in adipose lipolysis and subsequent plasma free fatty acid levels, increases in hepatic glucose and lipid output and decreases in hepatic glucose storage, and increased peripheral insulin resistance [33, 35], particularly during the postprandial state . When bromocriptine is administered at the appropriate time of day to restore normal scn dopaminergic activity in insulin resistant states, it normalizes such aberrant hypothalamic functions and elevated sympathetic tone and the hpa axis circadian activity . When administered to humans in the early morning upon waking in an effort to restore the normal waking rise in central dopaminergic activity that is diminished in insulin resistant states [32, 35], bromocriptine - qr improves insulin resistance and other metabolic abnormalities [2628, 39, 42]. While the mechanisms by which timed bromocriptine - qr therapy produces the observed effects on cvd outcomes are yet to be fully delineated, available evidence suggests important cvd - protective roles for its modulation of central nervous system and circadian hypothalamic functions to reduce elevated sympathetic nervous system (sns) (and hpa axis) activities (as described above) that directly and indirectly potentiate vascular inflammation, endothelial dysfunction, and arterial stiffening [1618] and that are coupled to increased cvd risk if overactive [16, 48]. Such sns influences on adipose and liver potentiate their increased secretion of ffa / lipid and inflammatory cytokines that in turn cause vascular inflammation and reactive oxygen species generation that are damaging to the vasculature [1921]. Increases in sns activities can also induce a proinflammatory response in various arms of the immune system itself that can also predispose to vascular damage . Additionally, and likely much more importantly, increased sns activity can produce adverse cardiometabolic effects directly upon the vasculature to potentiate vasoconstriction, generation of vascular reactive oxygen and nitrogen species, increased inflammation, endothelial dysfunction, and arteriosclerosis [1618, 50]. Furthermore, changes in vascular inflammation and endothelial function (positive or negative) can manifest changes in vascular pathology / physiology quickly [1621, 37, 38]. Importantly, circadian timed treatment of spontaneously hypertensive rats (shr) with bromocriptine has demonstrated improvements in metabolic syndrome parameters including elevated sns tone, fatty liver, and hepatic inflammation, as well as reductions in arterial stiffness and endothelial nitric oxide synthase uncoupling, two phenomena commonly observed in patients with t2 dm and strongly linked to progression of macrovascular disease [1921]. Others have reported similar hepatic and vascular findings in response to bromocriptine therapy in other animal models [51, 52]. Also, beyond normalizing (resetting) hypothalamic control of elevated sympathetic tone and vascular dysfunction, bromocriptine has direct sympatholytic activity due to its neurotransmitter receptor modulation capacity [22, 23, 53]. Endothelial dysfunction, vascular inflammation, and elevated sympathetic tone are early pathological events in the progression of cvd and precede the onset of t2 dm [1621, 37, 38]. As such, these pathologies may well have contributed to the 3.1% cvd event rate observed in this study placebo population that was well controlled for hyperglycemia, hyperlipidemia, and high blood pressure with standard of care therapy . That is to say, such t2 dm subjects whose dysglycemia, dyslipidemia, and hypertension are well controlled with standard of care pharmacotherapy still remain in need of therapy for their underlying substantive cvd risk due to these above described neuroendocrine pathologies . Therefore, if these pathologies are the targets of this bromocriptine - qr therapy, as available evidence suggests, then the present findings suggest that early intervention with this therapy in the course of t2 dm may potentially provide longer - term benefit of cvd risk reduction . The limitations of this study include the relatively small number of cvd events and the short duration of the trial . Other limitations include the lack of mechanistic information relating to bromocriptine - qr impact on sympathetic tone or endothelial dysfunction in the study population . Therefore, caution should be exercised when evaluating these cvd findings and their full potential clinical ramifications . The abovementioned mechanisms proposed to be operative in the observed cvd outcome results of this study need to be further investigated in human studies (e.g., impact of bromocriptine - qr on vascular inflammation, endothelial dysfunction, vascular and systemic reactive oxygen species status, and aortic compliance) before definitive conclusions on such mechanisms can be made . It should be appreciated though that the study subjects had multiple risk factors for cvd at baseline and the prespecified cvd endpoint occurred in the placebo arm at a relatively high rate despite well - controlled hyperglycemia, hyperlipidemia, and blood pressure and that the reduction in cvd events with bromocriptine - qr intervention was evident within the short duration of this study in such a population of t2 dm subjects . Similarly, in this regard, it should be noted that the incidence rate for the prespecified cvd endpoint among subjects in the cst with baseline hba1c> 7.0% was 16/830 (1.9%) and 12/400 (3.0%) in the bromocriptine - qr and placebo arms, respectively, comprising approximately half of the total events in the original cst and yielding a hazard ratio of 0.74 (ci: 0.351.56) for this subset (hba1c> 7.0%). Although this reduction in cvd events in this subset was not statistically significant likely due to the small n number, these findings suggest an operative impact of this therapy in cvd risk reduction across the continuum of glycemic control status . Cvd is the leading cause of death in t2 dm subjects and yet there are currently no antidiabetes medications available with proven cardioprotective benefits . Consequently, the cvd outcome findings described herein along with those from other bromocriptine - qr intervention studies of t2 dm subjects [24, 25] suggest that bromocriptine - qr should be considered for further investigation in larger, longer term studies to establish or not the validity of its potential use early in the course of t2 dm as an cardioprotective agent . In conclusion, the findings of this study support that bromocriptine - qr therapy among t2 dm subjects in good glycemic control (hba1c 7.0) reduced progression of dysglycemia and reduces cvd event rate within one year of therapy . Reducing cvd remains a major unmet medical need in t2 dm . While reducing hyperglycemia may contribute to such an outcome, the overall effects are modest . Other major vascular risk factors such as vascular sympathetic tone and endothelial dysfunction are present early in t2 dm disease progression (e.g., obesity / prediabetes) and represent important therapeutic targets for cvd event rate reduction even in subjects with good glycemic and metabolic control . Bromocriptine - qr is a sympatholytic dopamine d2 receptor agonist that appears to reduce these vascular risk factors via the neuroendocrine axis and reduce progression of cvd in t2 dm even in the setting of good glycemic control . The present findings suggest that further larger, longer term studies to assess the value of early intervention with bromocriptine - qr during the chronology of t2 dm to provide unique long - term cardiovascular health benefits are warranted.
A 3-year - old girl was admitted to our hospital with unexplained fever and paroxysmal abdominal pain that had persisted for three days . Her body temperature at the time of admission was 39.5. physical examination showed abdominal tension, though there was no obvious tenderness and rebound tenderness . The blood platelets count (24010/l) was normal, and the c - reactive protein (> 1.6 mg / dl), the white blood cell count (13.910/l) and eosinophil count (4%, 0.5810/l) were elevated, while hepatic glutamic oxalacetic transaminase (24 u / l) and glutamate pyruvate transaminase (21 u / l) were normal . However, the level of cholinesterase (2,395 the abdominal non - contrast ct obtained on the fifth hospital day revealed diffusely hypodense nodular lesions in the hepatic parenchyma with marked hepatomegaly, retroperitoneal lymphadenopathy and ascites in the pelvic cavity . Eight days after admission, an abdominal mri revealed marked hepatomegaly with diffuse high intensity of the homogeneous nodular lesions (2 - 4 mm diameter) throughout the hepatic parenchyma and retroperitoneal lymphadenopathy . In addition, disseminated miliary nodules of high signal intensity were located on the peritoneum on the t2-weighted images, as well as a group of diffuse, low intensity nodular lesions were seen throughout the hepatic parenchyma on the axial t1-weighted images (fig ., a chest ct showed multiple small hyperdense nodules (2 - 4 mm in diameter) in both lungs (fig . After the small intestinal wall and peritoneal biopsy, histological examination revealed parenchymal tubercles containing several larvae of pentastomids and a large amount of inflammatory cell infiltration surrounding them (fig . At this point, it was revealed by the patient's parents that the patient had consumed snake meat several months prior to her admission . Following the diagnosis, she was administered praziquantel (0.5 g, tid, per day) and albendazole (0.75 g, bid, per day) in order to expel the intestinal worms . The patient's temperature began to slowly decrease two days after the start of the therapy, and after 10 days of the therapy the fever had disappeared and the abdominal pain was diminished . On examination, pentastomid worms were observed in a stool (fig . The patient made an uneventful recovery after a half a month of therapy and she was discharged from our hospital . Human pentastomiasis is divided into two types: the more common visceral pentastomiasis (which is the main portion of the cases of pentastomiasis) and nasopharyngeal pentastomiasis (1). Visceral pentastomiasis is an unusual parasitic zoonosis that is caused by the larval stages (nymphs) of several species of pentastomes (' tongue worms'), and these are parasites that form a unique phylum with characteristics of both arthropods and annelids (2). At present, there are ten known pathogenic species of pentastomid parasites and six known kinds of human pentastomiasis . The latter include armilliferosis, linguatulosis, porocephalosis, raillietiellosis, leiperiosis and sebekiosis (3). The species that affect humans belong to the families linguatulidae, armilliferidae and porocephalidae, and all of which have different geographic distributions . More than 90% of the human cases are caused by the nymphs of only two species, l. serrata and a. armillatus (4). The infection develops in humans when parasite ova are ingested from the respiratory secretions or feces from the final hosts (dogs and other carnivores for linguatula, several species of large snakes for armillifer and porocephalus). In the digestive tract of the human host, the minute four - legged primary larvae hatch and invade the viscera of the digestive tract in the human host (5, 6). The nymphs involve many organs, including the liver, esophagus, stomach, duodenum, jejunum, ileum, colon, appendix, rectum, mesentery, gallbladder, lung, pleura, broad ligament, pancreas, omentum, bladder, adrenal gland, heart (pericardium), lymph nodes, skin, epididymis, eye, brain, inguinal hernia sac, etc; however, the liver is the most common site (7). Visceral pentastomiasis causes the majority of asymptomatic infections in humans, but a small number of cases are fatal, and the severity of symptoms is related to the organs that are infected and the degree of infection by the nymph (8). The patients with a heavy infestation showed chronic fever, ascites, abdominal pain, diarrhea, mild anemia, hepatosplenomegaly, eosinophilia in the bone marrow and blood, and multiple polyps in the whole colon . The pathologic features of the liver biopsy are degeneration and necrosis of hepatocytes, along with obvious infiltration of eosinophils . As was demonstrated in this study, praziquantel or mebendazole is a medical treatment for this disease (9). Only a few cases of pentastomiasis infections have been reported in humans around the world, and there is limited literature about the imaging features of pentastomiasis infection . We report here a case where the patient had a history of eating snake meat several months prior to her hospital admission, and her main symptoms were a high fever and abdominal pain . An abdominal mri demonstrated diffuse nodules throughout the liver, an enlarged liver, a little ascites, diffuse retroperitoneal lymphadenopathy and disseminated miliary nodules of high signal intensity on the peritoneum . The laparoscopy revealed that the liver was diffusely enlarged, as well as there were diffusely scattered micro - cyst nodules of varying sizes on the surface of the liver and the peritoneum . Microscopically, the small intestinal wall and peritoneal biopsy showed several larvae of pentastomids in the cyst nodules . The parasite worms were surrounded by a group of macrophages, inflammatory cells and fibrosis . When liver enlargement and diffuse hepatic hypodense nodular lesion is seen on a t1-weighted image, it is necessary to differentiate pentastomiasis hepatic involvement from other diseases that present with diffuse liver enlargement, high fever and abdominal pain (10, 11) such as diffuse liver metastasis, diffuse hepatocellular carcinoma, lymphoma and diffuse granulomatosis (12). Biopsy or autopsy is necessary to determine the cause of the symptoms . In this report we studied the patient with magnetic resonance imaging . Due to the spatial resolution of the current t2-weighted mr imagers, the detection of these microcysts and larvae within the microcysts was well accomplished in tandem with the clinical features and epidemiology, which aided in making the differential diagnosis (13). In summary, we have presented a rare case of pentastomiasis infection that involved many organs, including the liver, small intestine, peritoneum, lung and retroperitoneal lymph nodes . The patient's symptoms consisted of high fever, abdominal pain, abdominal tension and anemia . The imaging features of the abdominal mri revealed marked hepatomegaly with diffuse homogeneous nodular lesions throughout the hepatic parenchyma, diffuse retroperitoneal lymphadenopathy and disseminated miliary nodules on the peritoneum . The chest ct showed scattered small nodules in both lungs . When liver enlargement and hepatic disseminated miliary nodules are identified, it is necessary to differentiate pentastomiasis hepatic involvement from other diseases . Pentastomiasis infections should be considered in the diagnoses of patients with a history of such abdominal symptoms and who have consumed snake meat, though the definite diagnosis depends on the pathology report.
Polymyalgia rheumatica (pmr) and giant cell arteritis (gca) are common inflammatory conditions that almost exclusively affect patients older than 50 years . 1826% of patients with pmr have gca while 2753% of patients with gca have also pmr at the same time . Pmr primarily presents with stiffness and pain in the proximal muscle including neck, shoulders, buttocks, and thighs that causes severe disability without suitable treatment . Gca is the most common vasculitis in older persons and involves medium to large artery . Older age, female sex, and northern european descent are the most important risk factors for both conditions . Temporal artery biopsy should be performed in gca cases [1, 2], patients with cranial symptoms, and when either diagnosis is suspected as proposed by the national danish guidelines . Glucocorticoids (gc) are the mainstay of treatment in patients with pmr and gca . One of the important complications amongst pmr and gca patients who received gc in the long term (> 3 months) is glucocorticoid - induced osteoporosis (gio) that leads to an increased risk of fracture . This is due to impairment of calcium absorption in the intestine and reabsorption in the tubular system of kidneys . Inflammation, reduced mobility, and older age which characterize this group of patients further contribute to an increased risk [2, 4, 5]. According to several studies bisphosphonates, vitamin d, and calcium are effective for preventing gio [2, 4, 610]. The american college of rheumatology suggests use of 12001500 mg / day calcium plus 8001000 u / day vitamin d to prevent gio . Furthermore lifestyle modification and regular weight bearing exercise can improve outcomes . To prevent loss of bone mass, all of our patients with pmr and gca were prescribed calcium and vitamin d supplements and depending on the bone density, evaluated with a dxa - scan (dual energy x - ray absorptiometry), received additional treatment with bisphosphonate (if t - score <1). Previous studies showed that the level of adherence to osteoporosis preventive medications is poor, leading to increased risk of fracture and hospitalization [1116]. Several factors may contribute to nonadherence including concern of potential side effects, inconvenience, cost of medication, or lack of understanding of the benefits of therapy [12, 16, 17]. The aim of the current study is to estimate adherence to oral calcium and vitamin d supplementation as well as bisphosphonate amongst patients with pmr and gca receiving long - term treatment with gc and identify factors associated with nonadherence . In addition we evaluated patients' adherence when responsible physician referred the patients to a dxa - scan . We used patient interview to measure adherence to prescribed medication in a cross - sectional study . All patients with the diagnosis of pmr and/or gca diagnosed according to the danish national guideline, registered in the department of rheumatology, svendborg hospital, in december 2013 were identified and contacted by phone and were asked if they wanted to participate in the study . They were requested to answer a set of previously defined questions (see adherence interview form) about medication and adherence . All telephone interviews were performed by registered physicians or nurses who the patients knew . For each patient information on gc treatment, calcium, and vitamin d supplements and bisphosphonate was obtained using patients' records . Patients' records were also evaluated individually for previous laboratory tests, imaging studies including dxa - scan, positron emission tomography, and biopsy of temporal artery to ensure accurate diagnosis and if relevant diagnostic tests were performed . A patient was considered to be adherent if medication was taken as prescribed in the records . Finally the patients were asked about the reasons for nonadherence if they had discontinued the medications . The study was approved by the danish data protection agency (file number 2008 - 58 - 0035, 14/4017). Adherence interview form (1) patient code number:(2) age:(3) diagnose: pmr gca (4) smoking status yes no (5) do you take prednisolone tablet daily: yes no (6) prednisolone dosage:(7) are you prescribed calcium and vitamin d supplements with start of prednisolone: yes no (8) do you always remember to take your calcium, vitamin d supplements? 100% 50100% <50% never (9) if yes, which type of calcium and vitamin d supplements do you take? (10) number of calcium and vitamin d tablets per day:(11) if no, why don't you take your medication? Fear of side effects i don't take much medication i don't have more pills side effects (nausea, constipation) i don't think it is necessary a doctor or nurse have told me not to eat it i cannot afford it i don't know others (12) do you eat dairy products or fish daily: yes no do you take prednisolone tablet daily: are you prescribed calcium and vitamin d supplements with start of prednisolone: do you always remember to take your calcium, vitamin d supplements? 100% 50100% <50% never if yes, which type of calcium and vitamin d supplements do you take? Number of calcium and vitamin d tablets per day: if no, why don't you take your medication? Fear of side effects i don't take much medication i don't have more pills side effects (nausea, constipation) i don't think it is necessary a doctor or nurse have told me not to eat it i cannot afford it i don't know others i don't take much medication i don't have more pills side effects (nausea, constipation) i don't think it is necessary a doctor or nurse have told me not to eat it do you eat dairy products or fish daily: (13) do you take vitamin supplements yes no (14) have you previously done dxa - scan: yes no (15) if yes, date / year of previous dxa - scan:(16) do you take prophylactic osteoporosis medication for example fosamax, alendronate, bonviva, aclasta: yes no (17) if yes, name of your prophylactic osteoporosis medication:(18) do you take always your preventive medication: 100% 50100% <50% never (19) why do not you take your preventive medication: fear of side effects i don't take much medication i don't have more pills side effects i cannot afford it i don't think it is necessary i don't know others do you take vitamin supplements have you previously done dxa - scan: if yes, date / year of previous dxa - scan: do you take prophylactic osteoporosis medication for example fosamax, alendronate, bonviva, aclasta: if yes, name of your prophylactic osteoporosis medication: do you take always your preventive medication: 100% 50100% <50% never why do not you take your preventive medication: fear of side effects i don't take much medication i don't have more pills side effects i cannot afford it i don't think it is necessary i don't know others i don't take much medication i don't have more pills twelve patients subsequently received an alternative diagnosis, in most cases rheumatoid arthritis, three patients could not be reached on the phone, two did not want to participate in the study, and three were not contacted, because it was clear from the records that they were demented . In total 118 patients were included (figure 1). The mean of prednisolone dosage was 10.5 9.4 mg with a range between 2.5 and 50 mg . 117 patients (99.2%) had prescribed calcium and vitamin d and 88.9% of them were adherent to their prescription . Only 2 patients (1.7%) did not take calcium and vitamin d at all, and 10 patients (8.5%) took their medication infrequently, 9 and 1 out of 10 patients took the medication 50100% of the time and less than 50% of the prescribed dose, respectively (figure 2). The reasons for incomplete adherence were forgetfulness in 42.9% of patients, 35.7% of patients could not explain the reason, one patient did not want to eat so many pills, one patient claimed of side effects, and one patient thought prophylactic calcium and vitamin d supplement was unnecessary (figure 3). From the 118 patients 113 (95.7%) were referred to a dxa - scan, of which 103 had been scanned and 10 were awaiting scan results . All patients who were referred for dxa - scan were involved in the study . In 61 patients bisphosphonate the remaining 3.4% of the patients did not take the medication at all (figure 2). Glucocorticoid - induced osteoporosis is an important side effect of treatment with gc amongst patients with pmr and gca . The frequency of osteoporosis ranges between 14.9 and 85% in patients . Risk of fracture in patients who received long - term gc is about 3350% which depends on daily and cumulative dose . Low body mass index, smoking, intake of more than two standard alcoholic drinks per day, and history of hip fracture in parents are related with higher risk for gio . As a result treatment with calcium and vitamin d should be started to prevent bone loss . Bisphosphonates are generally indicated in patients receiving long - term gcs . As in any medical treatment, adherence to prescribed medication results of recent studies showed that adherence to osteoporosis preventive medications is relatively poor [1113]. However, there has been some controversy regarding adherence to osteoporosis preventive medications . A cross - sectional study by castelo - branco et al . In spain showed that out of 7888 patients aged 45 or over, who received calcium and vitamin d supplementation, only 31.2% were adherent . Fatigue due to long - term therapy was the main reason for nonadherence amongst the patients . . Carried out on 9851 postmenopausal women revealed that adherence to treatment with osteoporosis preventive medications was poor . Additionally, the authors concluded that the most important reasons of nonadherence are fear of side effects and lack of motivation . On the contrary, recent study by tafaro et al . Showed high adherence to osteoporosis preventive medications if therapies less than 30 days were excluded . Out of 6930 patients who were included in the study 43.8% were adherent to the treatment . The most frequent reasons of nonadherence were included side effects and misinformation given by the physician . Contrary to what we expected this study found that adherence to preventative osteoporosis medications in patients with pmr and gca was high and the most frequent causes for nonadherence were forgetfulness and side effects . One of the reasons of our patients' high adherence to the osteoporosis preventive medications is patients' awareness of gcs side effects and osteoporosis . This is due to the fact that all physicians are responsible to inform patients about the side effects of gc treatment . In the same way responsible physicians and nurses are asked to update the patient medical status at each visit and specifically ask whether the patients prescribed osteoporosis preventive medication while they receive gc treatment . When patients pick up their prescribed gc from the drugstore they will also be reminded that they should take calcium and vitamin d. in addition the important patient association, the osteoporosis associations in denmark with 24 local subdivisions, gives useful information about osteoporosis to the patients who are at risk of osteoporosis as well as entire population . This is in line with previous findings [14, 16, 18], suggesting that the deficit in patient awareness is related with low adherence and physicians support is an important factor to achieve better adherence . On the other hand, most of our patients (96%) are referred to carry out dxa - scan which stressed the importance of treatment . Another important factor for the high adherence in our patient group could be that pmr / gca can be very painful conditions, where the prescribed prednisolone treatment causes rapid freedom from symptoms . This can underpin confidence in the physician's treatment and why adherence to the additional prophylactic treatment might be higher . The limitation of our study was that there was no way to control patients' answers as well as medications intake . Moreover the accuracy of results was dependent on patients' memory to report their adherence level retrospectively . We cannot rule out information bias, as there will probably be a tendency for the patients to provide what they believe to be socially accepted answers rather than the truth, especially with regard to behavioral aspects and health conditions associated with taboos . In our situation a taboo might be the fact that the patient had not followed the doctor's advice . Since the patients were asked the name of the formulations and since the patients in a friendly tone were told that lack of adherence is a common and understandable state, we believe that we have predominantly received correct answers from our patients . We think that our concept of giving thorough information concerning the side effects of gc to the patients at each visit in the clinic followed by a prescription of dxa - scan is advisable for all departments to increase patients' adherence . We also think that our patient population with well characterized and initially painful diseases were more motivated for prophylaxis than otherwise healthy postmenopausal osteoporotic patients, where the adherence is described to be low [1113]. A possible way for evaluation whether the patients pick up the medicine at the pharmacies might be to check this on the electronic journals medication module, which is possible, but it requires an additional permission from the danish data protection agency as well as from the patient . There is probably little doubt that this would astonish patients much and give them a feeling that we do not trust them, which would make cooperation with the patients difficult in the future . More studies in this field are needed to confirm our results, but we see already a problem in a prospective design, because this cannot be done without patients knowing it will be checked, if they collect the medication, thereby inducing a relative risk for another information bias.
The world health organization defines abc as an expansive osteolytic lesion consisting of blood - filled spaces and channels divided by connective tissue septa that contains osteoid - like tissue and osteoclast - like giant cells . Abc commonly occur in the long bones (50%), vertebral column (20%), but in maxillofacial region, two - thirds were located in mandible (body of the mandible 40%, the ramus 30% and the angle 19%) and one - third in the maxilla representing about only 1.5% of all nonepithelial cysts of the jaws . It usually occurs in young persons, below 20 years of age, and shows no gender predilection . This case represents unusual mandibular condylar pathology (abc) which was treated by resection and metallic condylar head add - on system (ortho max, india) as a primary reconstructive option . An 18-year - old female reported to our center with the chief complaint of swelling in the region just in front of right ear from 5 months with no history of previous trauma to the region . Clinical examination revealed a smooth, firm, but diffuse swelling of size 4 cm 4 cm (approximately) was present in the right preauricular region [figure 1]. On examination, there was the presence of mild tenderness, deviation of mandible on opening, and nerve of facial expression was unaffected . Mouth opening was mildly reduced to 26 mm . Swelling and facial asymmetry present on right side of face on investigation, hemogram showed hb 12 g%, total leukocyte count 8200 cells / cmm, total platelet count 2.2 lac / cmm and dc showed polymorphs 74%, lymphocytes 20%, eosinophils 6% . The serum alkaline phosphates 177 iu / l, serum phosphorus 3.5 mg / dl and serum calcium (ionized) 1.09 mmol / l were within normal limits . On panoramic examination, there was a radiolucent lesion in the area of right mandibular condyle . Further imaging with computed tomography (ct) revealed a 3.4 cm 3.3 cm sized expanded, cystic lesion of the right mandibular condyle with septa and fluid levels, suggesting a diagnosis of abc [figure 2]. Computed tomography view of the condylar pathology extraoral approach was used for gross condylar resection with the articular disk in place and alloplastic metallic condylar head add - on system [figure 3] as a primary reconstructive option . Histopathological examination of resected condyle revealed a wide fibrous stroma with cystic spaces lined by uneven band of fibroblasts, stromal cells, and osteoclastic giant cells with hemorrhage in lumina of cysts suggestive of abc [figures 4 and 5]. Fourty - eight hours postoperatively, an active mouth exercise was conducted for 34 times a day for 2 weeks . On postoperative evaluation, all the branches of facial nerve were functioning normally [figure 6]. The patient has been reviewed on a monthly basis for 1-year without any signs of discomfort and recurrence [figure 7] with the satisfactorily functioning condylar head add - on system, normal mouth opening [figure 8], and mandibular border movements . Metallic condylar head add - on system in place after resection low magnification view showing cystic spaces lined by fibroblasts with hemorrhage in lumina (h and e stain) high magnification view showing uneven band of fibroblasts, stromal cells, and osteoclastic giant cells (h and e stain) normal facial nerve function postoperatively panoramic view of condylar prosthesis after 1-year satisfactorily working temporomandibular joint after 1-year the abc is a benign solitary osseous lesion recognized as a distinct clinicopathological entity by jaffe and lichtenstein in 1942 . Various theories where put forward like trauma, alteration of local hemodynamics, subperiosteal intraosseous hematoma, and secondary phenomena occurring in primary cystic lesions of bone and tumors but, the etiology of abc still remains elusive and unclear . The abc has been classified as primary and secondary were primary may be divided into congenital or acquired type . Histopathologically, the vascular variant is more common and consists of about 95% of total cases of abc while the solid type is rare, occurring in only 58% cases . The clinical signs and symptoms of abc are nonspecific and do not lead to any clinical diagnosis . Similarly in this case also, there was presence of swelling, asymmetry and associated pain secondary to temporomandibular joint dysfunction, ct scan showing different fluid levels and histologically, blood - filled spaces within connective tissue stroma, and osteoclastic multinucleated giant cells which is pathognomonic of abc together has led to the definitive diagnosis of abc . Concluded that block resection has shown comparatively good results with minimal recurrence (20% comparing to 60% in curettage) and also recommended close postoperative follow - up of at least 12 months especially on condylar involvement as recurrence of condylar abcs (40%) was comparatively higher than noncondylar jaw abcs (13%). In this case also after following similar protocol, the outcome was satisfactory at the end of 1-year . Comparing the results of 8 cases of reconstruction in abc condyle including this case [table 1] we found that, 62.5% cases has gone for costochondral graft either as a primary or in recurrence cases as an reconstructive option, while 25% cases has taken condylar prosthesis as an reconstructive option . Used condylar head add - on system in recurrence case with satisfactory results over a period of 8 months . Replacement reported the complication rate of 10.6% over a minimum follow - up period of 3 years . Our results matched with these studies [table 2] represent the postoperative 1-year status of the patient . Reconstruction review of abc condyle resected cases postoperative 1-year patient status findings from this cases states that, bypassing the risk and morbidity of donor site especially in female patients were donor site is a surgical dilemma for surgeon and patient both; metallic condylar prosthesis can be used as a satisfactory alternative to autograft in primary condylar reconstruction . However, we recommend a longer follow - up for better evaluation of function and complications if any . Condylar head add - on system has shown promising and satisfactory results with avoiding obvious disadvantages of autograft like surgical risk and donor site morbidity . It can be considered as a preferred primary reconstructive option, reserving the autograft for recurrence cases . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Ceftriaxone sodium is a long acting, broad - spectrum cephalosporin antibiotic for parenteral use . It exerts in vitro activity against a wide range of gram - negative and gram - positive microorganisms . It is highly stable to most beta - lactamases, both penicillinases and cephalosporinases, of gram - positive and gram - negative bacteria . A thorough literature survey has revealed that hplc method for ceftriaxone sodium with combination of other drugs and individually in dosage forms [215], microbial bioassay methods [16, 17], and spectrophotometric methods in dosage forms [1822] have been reported for analysis of ceftriaxone sodium . Costlier and volatile solvents were used as mobile phase solvent system and the time of analysis was more in some reported methods . Some spectrophotometric methods are recently described in the literature for analysis of drugs in raw material and finished products such as ceftazidime [2325], cefuroxime, and cefazolin . These spectrophotometric methods involve the use of no toxic organic solvents, which do not contribute to the generation of this kind of waste by the chemicals or industries . In this context therefore, the trend is that the industries look for ways to reduce the impacts of their activities on the environment . So, the principle objective of this study was, therefore, to develop a simple, selective, precise, less time consuming, and economical method with a wide linear range and good sensitivity for assay of ceftriaxone sodium in the powder for injection dosage forms . The parent drug stability guidelines issued by the international conference of harmonization (ich) require that analytical test procedure should indicate stability . Therefore, the present study was extended to establish the inherent stability of ceftriaxone sodium under different stress conditions such as, alkaline, acidic, oxidative, and photolytic conditions . Thus, this method can be utilized to compare the results for the content analysis of stability samples, since the purpose of stability studies is to monitor possible changes to a product or a material over a time at different storage conditions . Spectrophotometric analysis was carried out on a systronics 2201, uv - visible double - beam spectrophotometer with matched 1 cm path - length quartz cells . Absorption spectra were recorded on a medium scan speed, setting slit width to be 1 nm . Ceftriaxone sodium was obtained as a gift sample from orchid chemicals and pharmaceutical ltd ., the other chemicals like sodium hydroxide, hydrochloric acid, and hydrogen peroxide used were of merck - ar grade and double distilled water was used throughout the experiment . A stock solution was prepared by dissolving 100 mg of ceftriaxone sodium pure drug in 100 ml of distilled water to get standard stock solution (1 mg / ml). To a set of 10 ml volumetric flasks, aliquot volumes containing the drug were quantitatively transferred from standard stock solution and made up to the mark with distilled water to obtain final concentrations of 550 g / ml of ceftriaxone sodium . The absorbance was measured at 241 nm and calibration graph was constructed by plotting the absorbance versus the concentration of the drug . The validity of the method was tested regarding linearity, specificity, accuracy, and precision according to ich q2b recommendations . Accuracy and precision of the method were evaluated with the help of percent recovery, standard deviation (sd), and percent relative standard deviation (rsd) by using standard addition method . Three levels of standard drug (10%, 20%, and 30%) were spiked individually with the 100 mg equivalent of powder for injection dosage form ceftriaxone sodium and analysed in six replicates during the same day (intraday precision) and six consecutive days (interday precision). A linear correlation was found between absorbance at max and various concentrations of ceftriaxone sodium . The linearity graph obeyed beer's law in the range from 5 to 50 g / ml and it was described by regression equation (y = mx + c) and correlation coefficient (r) which were displayed on the graph . Molar absorptivity, sandell's sensitivity, standard error on slope, confidence limit of slope (95%), standard error on intercept, confidence limit of intercept (95%), lod, and loq were calculated . For the determination of lod and loq, the method is based on residual standard deviation of regression line and slope . To determine lod and loq, the specific calibration curve was studied using the sample containing analyte in the range of detection limit and quantitation limit . Robustness was studied by evaluating the influence of small but deliberate variations in the experimental condition like storing the similar concentration (20 g / ml) of drug solution at two different temperatures (20c and 30c) for 1 h and performing the stability of the sample solution at various time intervals (after 1 h and after 6 h) on the analytical performance . A 2 ml aliquot of standard stock solution of ceftriaxone sodium (1 mg / ml) was taken in four replicates in a volumetric flask (100 ml) and mixed with 10 ml of 0.1 n hcl (acid hydrolysis) or 0.1 n naoh (alkaline hydrolysis) or 5% h2o2 (oxidative degradation) and set aside for 1 h at room temperature . A solution of drug (20 g / ml) was prepared as per the procedure under construction of the calibration graph and was exposed to uv radiation of wavelength 254 nm and of 1.4 flux intensity for 24 h in a uv chamber . For thermal degradation solid drug was kept in an oven at 100c for 24 h. after cooling to room temperature, 20 g / ml concentrated drug solution was prepared as per above said method . Finally, absorbance of all the solutions resulted from acid and alkaline hydrolysis, and oxidative degradation, photolytic degradation, and thermal degradation were measured at 241 nm against respective solvent as blank in each case . For the estimation ceftriaxone sodium from injection (by procuring three brands from market), a portion of powder equivalent to 100 g of the drug from each brand was accurately weighed and transferred into 100 ml volumetric flask . The drug was dissolved by adding 70 ml of distilled water and sonicated for 15 min . Aliquot containing suitable concentration (20 g / ml) of ceftriaxone sodium was analyzed as described under construction of the calibration graph . The nominal content of the drug in injection for each brand was determined using the corresponding regression equation and results of% rsd of drug content were statistically compared with reported method . Aqueous solution of ceftriaxone sodium showed absorbance maximum (max) at 241 nm (figure 2), and at this wavelength distilled water did not show any significant absorbance . Least square regression equation of ceftriaxone sodium in aqueous medium has shown that the r value very close to 1 indicated high degree of correlation between two variables, such as absorbance and concentration (figure 3). Beer's law was obeyed over the range of 550 g / ml; high values of molar absorptivity and low values of sandell's sensitivity and lod revealed that proposed methods are highly sensitive . Lod and loq values for the drug were found and all the parameters of calibraration curve were displayed in table 1 . To check accuracy and precision, assays were carried out for six times within a day (intraday precision) and in six consecutive days (interday precision) by adding three different levels of analyte to the formulation .% rsd values were 0.5 (intraday) and 1.18 (interday) indicating high precision of developed method . Accuracy of the method was ascertained as mean% recovery between measured actual concentration and taken concentration for ceftriaxone sodium . The values of% recovery, very close to 100%, demonstrate high accuracy of the proposed method (table 2). Robustness studies assumed that the small variations in any of the variables did not significantly affect the results (table 3). Ceftriaxone sodium sterile formulations were analysed by proposed method and by reported method, which involved the analysis of analyte with 0.1 m sodium hydroxide and absorbance measured at 258.8 nm . Results were compared by student's t - test and variance - ratio f - test . Calculated t - values and f - values did not exceed tabulated values of 2.776 (t) and 6.39 (f) at 95% confidence level and for four degrees of freedom (table 4) which indicates close similarity between proposed and reported method . Ceftriaxone sodium was subjected to various stress conditions like acid, alkaline, hydrogen peroxide induced degradation, and thermal and photolytic condition . Analysis was performed by measuring absorbance of ceftriaxone sodium after subjecting it to stressed conditions at max of pure drug . Percentage degradation was calculated by the formula:% degradation = (expected concentrationactual concentration)/expected concentration 100, and percentage recovery also was calculated for each case (table 5). Results revealed no change in absorbance of drug solution at alkaline hydrolysis, so its percentage recovery is very close to 100% which indicates the drug stability . But there was significant change in absorbance after acid and hydrogen peroxide treatment, confirming that ceftriaxone sodium is susceptible to acid hydrolysis (% degradation of 11.0%) and oxidation (% degradation of 7.95%). Analyte undergoes significant degradation under acid hydrolysis and oxidation, whereas it is stable under alkaline treatment . Proposed method was validated for linearity, accuracy, precision, and robustness and method was applied to various formulations and results were statistically compared with reference method which showed that there were no significant changes in the result . So, method can be utilized for determination of purity of drug available from various sources without any tedious procedure and also used in analysis of stability study samples.
Chiral alcohols occur as natural products and frequently as intermediates in the synthesis of chiral molecules, most of them in the field of synthetic pharmaceuticals possessing chiral centres [13]. In pharmacy the use of enantiopure new drugs will certainly increase due to the often well - documented different biological activities of enantiomers . Moreover, the pharmacokinetics or toxicology of each enantiomer with regard to the drug dosage or side effects is significantly different and consequently so are the resulting regulatory requirements [4, 5]. The determination of the enantiomeric excess (% ee) is therefore critical to the progress of these fields, so many methods have been developed for determining the degree of enantiomeric purity of chiral alcohols in the yield of chromatography and electrophoresis [612]. Nowadays, gas - liquid chromatography on chiral stationary phases, especially per-0-modified cyclodextrins, plays the dominant role for the chiral separation of a wide range of volatile compounds due to its ease of use and the commercial availability of columns . However, many of these methods for determining the degree of enantiomeric purity of chiral alcohols are improved when these compounds are converted into volatile esters, such as acetate or trifluoroacetate . Acylation reduces polarity and enhances the separation of chiral compounds in the chromatographic column, as well as conferring better volatility . Typically, only derivatization with acetyl groups or with fluorinated acyl groups up to heptafluorobutyryl improves volatility . Although different methods are described in the literature [1520], some of them are less effective or ineffective for secondary and tertiary alcohols, others are moisture sensitive or highly expensive, and they may even be potentially explosive (e.g., perchlorates or perchloric acid). Ramalinga and coworkers described iodine as a lewis catalyst for the esterification and transesterification of acids using an excess of alcohol under reflux conditions . Chavan and coworkers described the transesterification in toluene of -ketoesters with some primary, secondary alcohols and phenols using iodine as a catalyser in the presence of zinc as a mediator . Afterwards, they described that even iodine acts as an efficient catalysts for transesterification reactions; however, phenols did not undergo transesterification . A procedure for the acetylation of alcohols, amines and phenols with isopropenyl acetate and iodine as a catalyser under solvent - free conditions were described by ahmed and van lier . Recently, jereb and coworkers have demonstrated that iodine is an efficient catalyst for esterification under solvent - free conditions for several alcohols . We describe herein a simple and convenient procedure for acylation of chiral alcohols under solvent - free conditions in the presence of a catalytic amount of iodine with no by - products formation and using near equimolar amounts of alcohol and carboxylic acid (scheme 1). Initially, a systematic study was carried out for catalytic evaluation of iodine in the acetylation of 2-heptanol . Further, the optimized method was applied to (r)-2-heptanol and cis-1,3-cyclohexanediol to determine that no isomerization occurred with acetylation or trifluoroacetylation . All the esters were analyzed by gas chromatography on a cp chirasil - dex cb column in order to provide optimum resolution for a chiral alcohol of a particular structural type . 3-hexanol (4), 4-methyl-2-pentanol (5), 3-methylcyclopentanol (9), 3-methylcyclohexanol (10), 2-tert - butylcyclohexanol (11), 2-methylcyclopentanol (12), 4-methylcyclohexanol (13), 2-chlorocyclohexanol (14), 2,6-dimethylcyclohexanol (15), 4-tert - butylcyclohexanol (16), 3,3,5-trimethylcyclohexanol (17), 2-phenylcyclohexanol (18), dl - menthol (19), 1,2-cyclohexanediol (20), 1,3-cyclohexanediol (21), iodine, and acetic acid were all from acros organics, barcelona, spain . 2-butanol (1), s-2-butanol, 2-hexanol (3), s-2-hexanol, trans - s, s-1,2-cyclohexanediol, trans - r, r-1,2-cyclohexanediol, 2-heptanol (6), r-2-heptanol, (+) -menthol, and tert - butanol were purchased from fluka, madrid, spain . 2-octanol (7), 3-octanol (8), and cis-1,2-cyclohexanediol were from sigma - aldrich, madrid, spain . 1-methylhexyl acetate was obtained by stirring at 100c for 48 h in a screw - cap vial a mixture of 2-heptanol (20 mmol), acetic acid (200 mmol), iodine (0.6 mmol) and anh . The organic solution was washed with saturated sodium thiosulfate solution, saturated nhco3 solution, and water . Hexane was stripped off by distillation at 69c at atmospheric temperature and the 1-methylhexyl acetate was obtained . The product was characterized by nmr h and c. mixtures of 2-heptanol (2 mmol), acetic acid at different molar ratios (2, 3, 4, 12, and 20 mmol) containing iodine (0.06 mmol) and tridecane (4 mmol) as internal standard, anh . Na2so4 (0.02 mmol) either without solvent or dissolved in 0.5 ml (7 mmol) tert - butanol were stirred at different temperatures (100, 120, and 140c) for different reaction times (4, 8, 24 and 48 h) in 3 ml amber screw - cap vials . The filtrate was used for gc analysis directly and analysed in a db - wax capillary column as described in the following . Reactions were carried out in triplicate . A mixture of alcohol (2 mmol), either acetic acid or trifluoroacetic acid (3 mmol, iodine (0.06 mmol), and anh . Na2so4 (0.02 mmol)) were stirred at 100c for 48 h in a 3 ml amber screw - cap vial . The reaction product was dissolved in 1 ml dichloromethane, filtered and analysed by both gc / ms and chiral phase gc analysis as described in what follows . (1) no chiral - phase gc analysisgc - fid analyses were carried out in a trace 2000 series (thermoquest) gc with a db - wax (polyethylene glycol) capillary column of 30 m 0.25 mm diameter, 0.25 m film thickness . The gc temperature was programmed at 70c and ramped first at 5c / min to 160c and later at 10c / min to 200c . Gc - fid analyses were carried out in a trace 2000 series (thermoquest) gc with a db - wax (polyethylene glycol) capillary column of 30 m 0.25 mm diameter, 0.25 m film thickness . The gc temperature was programmed at 70c and ramped first at 5c / min to 160c and later at 10c / min to 200c . (2) chiral - phase gc analysisthe column used was cp chirasil - dex cb varian (modified -cyclodextrins bonded to a dimethylpolysiloxane) (25 m 0.25 mm diameter, 0.25 m film thickness). The column used was cp chirasil - dex cb varian (modified -cyclodextrins bonded to a dimethylpolysiloxane) (25 m 0.25 mm diameter, 0.25 m film thickness). H and c nmr spectra were recorded on a varian as400 spectrometer, operating at 400 mhz . Linear model analysis of variance (anova) and the tukey - kramer pairwise differences adjustment method was carried out by the sas software version 9.0 (sas institute, inc). All the statistical tests applied in this work were employed to determine the statistical differences among 1-methylhexyl acetate yields when reaction optimizations were carried out . First of all, the acetylation was studied with the presence of a tertiary alcohol, tert - butanol, or without solvent, at various molar ratios alcohol: acetic acid with 1 equiv . Of acetic acid in the presence of 3 mol% of iodine at 100c for 24 and 48 clearly, tert - butanol makes the reaction slower, needing a 1: 6 molar ratio and 48 h (entry 11). We obtained the maximum yield at a 1: 2 molar ratio for 24 h without using any solvent (entry 1). Similar behaviour has also been described by jereb and coworkers using dichloromethane as solvent . They carried out the same reaction with other alcohols using a 1: 3 molar excess of acetic acid in a free solvent system . Then, we investigated the influence of lower molar ratios alcohol: acetic acid and different reaction times in a solvent - free system (table 2). With a 1: 1 molar ratio alcohol: acid the best yield was obtained after 48 h reaction (entry 2). With 1: 1.5 and 1: 2 molar ratios acetylation only required half the time (24 h) to obtain no statistically different results (entries 4, 8). Remarkably in terms of atom economy, a 1: 1 molar ratio was sufficient, but a longer reaction time was needed to reach a high yield . In order to shorten the reaction times, complementary studies were carried out, increasing the reaction temperature (table 3). We decided to carry out the subsequent reactions using a 1: 1.5 molar ratio alcohol: acid at 100c for 24 h in a solvent - free system . However, considering that the main target was to determine the% ee of a chiral alcohol, it could be not necessary to achieve a high yield of acetylation . Therefore, an equimolecular molar ratio alcohol: acid at 100c for 4 h could be sufficient . This method is a simple and greener alternative to conventional methods that typically are performed with activated carboxylic acid derivatives such as acid anhydrides, acid chlorides, acyl imidazoles, or acylureas, which need the presence of tertiary amines such as triethylamine, pyridine, or dmap [1520]. Moreover, any solvent was needed [28, 29], there were not any byproducts formation, and an equimolar amount of reactives can be used . According to these results, we proved the stability of the chiral carbons in the selected conditions . Figures 1 and 2 show the results obtained after acetylation of racemic 2-heptanol and (r)-2-heptanol . Similar results were obtained using trans-1,3-cyclohexanediol and cis-1,3-cyclohexanediol (figures 3, 4, and 5), indicating that the derivatization process did not cause any isomerization of the chiral carbons of the two molecules . Jereb and coworkers also studied the stereochemical behaviour of some secondary cyclic aliphatic alcohols and 1-phenylethanols in their acetylation reactions with iodine as a catalyst . The aliphatic cyclic alcohols studied yielded esters with retention of stereochemistry, but a loss of stereochemical integrity was observed in chiral 1-phenylethanols . No data was provided about the behaviour of acyclic secondary alcohols or diols in these conditions . Moreover, we also studied the stability of these chiral carbons using trifluoroacetic acid instead of acetic acid . In this case, a partial isomerization was observed making unsuitable this acid for acylation (results not showed). Afterwards, three series of alcohols were tested with this acylation method to determine the applicability of the method to study the stereochemical ratio between isomers . The improvement in the separation factors () related to the free alcohols was determined . A resolution factor of 1.5 or greater indicates baseline enantiomeric resolution . The best was obtained with 2-pentyl acetates that have a separation factor value of 3.00 compared with the 1.07 corresponding to the free alcohols . To our knowledge no better higher increases were also observed for 2-butanol acetate derivatives (1.44 compared with 1.05), 2-hexanol acetate derivatives (1.95 compared with 1.05) and 2-octanol acetate derivatives (1.50 compared with 1.02). Smith and simpson investigated the separation of enantiomers of these acyclic alcohols on a -trifluoroacetylated cyclodextrin phase at 35c, showing for the majority of them an value similar to or lower than those obtained in our -cyclodextrin column and lower than our corresponding acylated derivatives . The elution order of the acetylated enantiomers of some alcohols, entries 2, 4, 6,7, and 8, was assumed from the literature [34, 35]. We would remark that the elution order of ()-enantiomers and (+) -enantiomers depends on some factors such as cyclodextrin type (,,: on a -cd derivative all ()-enantiomers eluted before the (+) -enantiomers), the stereoconfiguration of the product (it can have a dominant influence on chiral interactions, leading to the reversal of the elution order), cyclodextrin derivative types, and temperature . Moreover, acylation with acetic acid allows the four stereoisomers of 3-methyl-1-cyclopentanol (entry 1), 3-methyl-1-cyclohexanol (entry 2), and 2-tert - butyl-1-cyclohexanol (entry 3) to be separated . Moreover, acetylation of 2-chloro-1-cyclohexanol (entry 6) and 4-tert - butyl-1-cyclohexanol (entry 7) increases the separation factor . When the acylation method was applied to polysubstituted cyclic alcohols, the results were not as good as previous ones . Now, only acetylation of d, l - menthol produced an increase in the separation factor value of the two enantiomers . They have already demonstrated that any isomerization was provoked in both compounds when acetylated separately . The value was higher than the obtained in some,, and permethylated cyclodextrins [13, 33] and in stationary gc phases of other cyclodextrin derivatives [3941]. Finally the acylation method was applied to three diols: 1,2-octanediol, 1,2-cyclohexanediol, and 1,3-cyclohexanediol (table 6). Now, one or both hydroxyl groups can be acetylated . In order to determine the retention time of the mono and diacetylated stereoisomers, two acylations reactions were carried out, one with a 1: 4 molar ratio alcohol: acid and the other with a 1: 1.5 molar ratio . When the molar ratio alcohol: acid was 1: 1.5, there were more molecules with only one hydroxyl group acetylated than with the two hydroxyl groups acetylated (figures 3, 4 and 5). However, when the molar ratio was 1: 4, the numbers of diacetylated molecules were higher than the monoacetylated molecules . The samples were also analysed by nmr and the h and c spectra were in concordance with the chromatograms . The acetylation of one hydroxyl group increased the value, compared with their corresponding alcohols; moreover, the value was higher when both hydroxyl groups were acetylated . Thus, the diacetylation of 1,2-octanediol produced an increase in the separation factor value of the two enantiomers (1.03 for the diol and 1.34 for the diacetylated derivative). Li et al . Obtained a similar value (1.05) for the 1,2-octanediol on a -2,6-di - o - pentyl-3-o - trifluoroacetylated cyclodextrin but lower than the separation of mono- and diacetates in our column . The acetylation of trans-1,3-cyclohexanediol allowed the separation of its stereoisomers and the two sets of 1,2-cyclohexanediol stereoisomers were separated when acetylation of one of the hydroxyl groups took place . However, when one of the hydroxyl groups was acetylated one chiral carbon was formed and the enantiomers could be separated in the column . When both hydroxyls groups were acetylated, the compound was again a meso - form . Finally, we would like to point out the simple handling of the reaction carried out prior to the gc analysis . Any further treatment is not needed once the reaction is finished but dilution and filtration of the reaction crude . Any loss of resolution capacity has not been observed in the chromatographic column after carrying out all of the described studies . We have demonstrated that the present procedure with iodine / carboxylic acid without adding solvent provides a very efficient method of esterification of numerous acyclic and cyclic chiral alcohols . The main advantages of this method are its operational simplicity, the ready availability, and nontoxic nature of the reagent, and its general applicability . Near equimolar amounts of alcohol and carboxylic acid are typically used, thus avoiding waste and providing very simple experimental and workup procedures . Furthermore, acetylation of acyclic and cyclic alcohols usually increases the separation factor of the isomers . 1-ethylbutyl acetate h nmr (400 mhz, acetone) 4.814.72 (m, 1h), 1.99 (s, 3h), 1.631.44 (m, 4h), 1.411.22 (m, 2h), 0.89 (t, j = 7.47, hz 3h), 0.85 (t, j = 7.47 hz, 3h). C nmr (101 mhz, acetone) 170.08, 74.31, 35.71, 26.85, 20.14, 18.35, 13.33, 9.02 . H nmr (400 mhz, acetone) 4.814.72 (m, 1h), 1.99 (s, 3h), 1.631.44 (m, 4h), 1.411.22 (m, 2h), 0.89 (t, j = 7.47, hz 3h), 0.85 (t, j = 7.47 hz, 3h). C nmr (101 mhz, acetone) 170.08, 74.31, 35.71, 26.85, 20.14, 18.35, 13.33, 9.02 . 1-methylheptyl acetate h nmr (400 mhz, acetone) 4.894.76 (m, 1h), 1.96 (s, 3h), 1.601.43 (m, 2h), 1.28 (m, 8h), 1.16 (d, j = 6.27 hz, 3h), 0.88 (t, j = 6.8 hz, 3h). C nmr (101 mhz, acetone) 169.65, 70.17, 35.73, 31.59, 29.15, 25.19, 22.34, 20.28, 19.35, 13.43 . H nmr (400 mhz, acetone) 4.894.76 (m, 1h), 1.96 (s, 3h), 1.601.43 (m, 2h), 1.28 (m, 8h), 1.16 (d, j = 6.27 hz, 3h), 0.88 (t, j = 6.8 hz, 3h). C nmr (101 mhz, acetone) 169.65, 70.17, 35.73, 31.59, 29.15, 25.19, 22.34, 20.28, 19.35, 13.43 . 1-ethylhexyl acetate h nmr (400 mhz, acetone) 4.76 (dt, j = 7.2, 6.2 hz, 1h), 1.98 (s, 3h), 1.631.46 (m, 4h), 1.371.21 (m, 6h), 0.88 (t, j = 7,46 hz, 3h), 0.86 (t, j = 7, 46 hz, 3h). C nmr (101 mhz, acetone) 169.86, 74.64, 33.46, 31.52, 26.80, 24.83, 22.30, 20.14, 13.37, 9.01 . H nmr (400 mhz, acetone) 4.76 (dt, j = 7.2, 6.2 hz, 1h), 1.98 (s, 3h), 1.631.46 (m, 4h), 1.371.21 (m, 6h), 0.88 (t, j = 7,46 hz, 3h), 0.86 (t, j = 7, 46 hz, 3h). C nmr (101 mhz, acetone) 169.86, 74.64, 33.46, 31.52, 26.80, 24.83, 22.30, 20.14, 13.37, 9.01 . Cis-3-methylcyclopentyl acetate h nmr (400 mhz, acetone) 3.90 (m, 1h), 1.93 (s, 3h), 1.98 (m, 1h), 1.68 (m, 1h), 1.591.49 (m, 3h), 1.29 (m, 1h), 1.16 (m, 1h), 0.98 (d, 3h). C nmr (101 mhz, acetone) 169.70, 76.14, 41.16, 32.76, 32.36, 32.30, 20.27 ch3, 20.24 . H nmr (400 mhz, acetone) 3.90 (m, 1h), 1.93 (s, 3h), 1.98 (m, 1h), 1.68 (m, 1h), 1.591.49 (m, 3h), 1.29 (m, 1h), 1.16 (m, 1h), 0.98 (d, 3h). C nmr (101 mhz, acetone) 169.70, 76.14, 41.16, 32.76, 32.36, 32.30, 20.27 ch3, 20.24 . Trans-3-methylcyclopentyl acetate h nmr (400 mhz, acetone) 5.07 (m, 1h), 1.94 (s, 3h), 1.831.72 (m, 2h), 1.641.53 (m, 2h), 1.431.30 (m, 2h), 1.221.11 (m, 1h), 1.02 (dd, j = 5.3, 4.0 hz, 3h). C nmr (101 mhz, acetone) 169.75, 76.16, 40.78, 32.84, 32.38, 32.33, 20.11, 19.52 . H nmr (400 mhz, acetone) 5.07 (m, 1h), 1.94 (s, 3h), 1.831.72 (m, 2h), 1.641.53 (m, 2h), 1.431.30 (m, 2h), 1.221.11 (m, 1h), 1.02 (dd, j = 5.3, 4.0 hz, 3h). C nmr (101 mhz, acetone) 169.75, 76.16, 40.78, 32.84, 32.38, 32.33, 20.11, 19.52 . Trans-2-methylcyclopentyl acetate h nmr (400 mhz, acetone) 4.62 (dt, j = 6.8, 4.6 hz, 1h), 1.96 (m, 1h), 1.96 (s, 3h), 1.711.61 (m, 3h), 1.591.49 (m, 2h), 1.20 (m, 1h), 0.97 (d, j = 6.9 hz, 3h). C nmr (101 mhz, acetone) 169.94, 82.07, 39.86, 31.56, 31.04, 22.06, 20.21, 17.53 . H nmr (400 mhz, acetone) 4.62 (dt, j = 6.8, 4.6 hz, 1h), 1.96 (m, 1h), 1.96 (s, 3h), 1.711.61 (m, 3h), 1.591.49 (m, 2h), 1.20 (m, 1h), 0.97 (d, j = 6.9 hz, 3h). C nmr (101 mhz, acetone) 169.94, 82.07, 39.86, 31.56, 31.04, 22.06, 20.21, 17.53 . Cis-2-methylcyclopentyl acetate h nmr (400 mhz, acetone) 4.81 (m, 1h), 1.97 (m, 1h), 1.97 (s, 3h), 1.681.57 (m, 3h), 1.531.43(m, 2h), 1.17 (m, 1h), 0.96 (d, j = 6.9 hz, 3h). C nmr (101 mhz, acetone) 169.92, 80.21, 39.38, 32.43, 332.17, 22.22, 20.19, 17.52 . H nmr (400 mhz, acetone) 4.81 (m, 1h), 1.97 (m, 1h), 1.97 (s, 3h), 1.681.57 (m, 3h), 1.531.43(m, 2h), 1.17 (m, 1h), 0.96 (d, j = 6.9 hz, 3h). C nmr (101 mhz, acetone) 169.92, 80.21, 39.38, 32.43, 332.17, 22.22, 20.19, 17.52 . Cis-3-methylcyclopentyl acetate h nmr (400 mhz, acetone) 4.98 (m, 1h), 1.98 (s, 3h), 1.931.86 (m, 2h), 1.651.35 (m, 2h), 1.301.13 (m, 2h), 1.02 (m, 1h), 0.86 (d, j = 6.6 hz, 3h), 0.87 (m, 2h). C nmr (101 mhz, acetone) 169.44, 69.51, 38.12, 33.89, 31.20, 30.51, 26.87, 21.54, 20.40 . H nmr (400 mhz, acetone) 4.98 (m, 1h), 1.98 (s, 3h), 1.931.86 (m, 2h), 1.651.35 (m, 2h), 1.301.13 (m, 2h), 1.02 (m, 1h), 0.86 (d, j = 6.6 hz, 3h), 0.87 (m, 2h). C nmr (101 mhz, acetone) 169.44, 69.51, 38.12, 33.89, 31.20, 30.51, 26.87, 21.54, 20.40 . Trans-3-methylcyclopentyl acetate h nmr (400 mhz, acetone) 4.61 (tt, j = 11.3, 4.3 hz, 1h), 1.94 (m, 3h), 1.931.87 (m, 2h), 1.681.12 (m, 5h), 0.91 (d, j = 6.6 hz, 3h), 0.89 (m, 2h). C nmr (101 mhz, acetone) 169.42, 72.49, 40.36, 35.36, 33.80, 31.13, 23.69, 21.68, 20.32 . H nmr (400 mhz, acetone) 4.61 (tt, j = 11.3, 4.3 hz, 1h), 1.94 (m, 3h), 1.931.87 (m, 2h), 1.681.12 (m, 5h), 0.91 (d, j = 6.6 hz, 3h), 0.89 (m, 2h). C nmr (101 mhz, acetone) 169.42, 72.49, 40.36, 35.36, 33.80, 31.13, 23.69, 21.68, 20.32 . Trans-4-methylcyclohexyl acetate h nmr (400 mhz, acetone) 4.57 (tt, j = 11.2, 4.4 hz, 1h), 1.94 (s, 3h), 1.771.66 (m, 2h), 1.451.24 (m, 5h), 1.100.99 (m, 2h), 0.88 (d, j = 6.5 hz, 3h). C nmr (101 mhz, acetone) 169.49, 72.65, 32.48, 31.52, 31.45, 21.25, 20.33 . H nmr (400 mhz, acetone) 4.57 (tt, j = 11.2, 4.4 hz, 1h), 1.94 (s, 3h), 1.771.66 (m, 2h), 1.451.24 (m, 5h), 1.100.99 (m, 2h), 0.88 (d, j = 6.5 hz, 3h). C nmr (101 mhz, acetone) 169.49, 72.65, 32.48, 31.52, 31.45, 21.25, 20.33 . Cis-4-methylcyclohexyl acetate h nmr (400 mhz, acetone) 4.89 (s, 1h), 1.98 (s, 3h), 1.921.84 (m, 2h), 1.821.68 (m, 2h), 1.52 (m, 3h), 0.95 (m, 2h), 0.90 (d, j = 6.4 hz, 3h). C nmr (101 mhz, acetone) 169.45, 69.01, 32.22, 31.52, 31.14, 21.25, 21.45 . H nmr (400 mhz, acetone) 4.89 (s, 1h), 1.98 (s, 3h), 1.921.84 (m, 2h), 1.821.68 (m, 2h), 1.52 (m, 3h), 0.95 (m, 2h), 0.90 (d, j = 6.4 hz, 3h). C nmr (101 mhz, acetone) 169.45, 69.01, 32.22, 31.52, 31.14, 21.25, 21.45 . Cis-4-tert - butylcyclohexyl acetate h nmr (400 mhz, acetone) 4.55 (m, 1h), 1.94 (s, 3h), 1.81 (m, 2h), 1.360.98 (m, 7h), 0.86 (s, 9h). C nmr (101 mhz, acetone) 169.48, 72.97, 68.63, 47.03, 36.06, 31.95, 27.00, 20.32 . H nmr (400 mhz, acetone) 4.55 (m, 1h), 1.94 (s, 3h), 1.81 (m, 2h), 1.360.98 (m, 7h), 0.86 (s, 9h). C nmr (101 mhz, acetone) 169.48, 72.97, 68.63, 47.03, 36.06, 31.95, 27.00, 20.32 . Trans-4-tert - butylcyclohexyl acetate h nmr (400 mhz, acetone) 4.92 (m, 1h), 1.99 (s, 3h), 1.89 (m, 4h), 1.541.40 (m, 2h), 1.200.98 (m, 3h), 0.86 (s, 9h). C nmr (101 mhz, acetone) 169.45, 72.97, 69.95, 47.42, 36.01, 31.89, 26.86, 20.82 . H nmr (400 mhz, acetone) 4.92 (m, 1h), 1.99 (s, 3h), 1.89 (m, 4h), 1.541.40 (m, 2h), 1.200.98 (m, 3h), 0.86 (s, 9h). C nmr (101 mhz, acetone) 169.45, 72.97, 69.95, 47.42, 36.01, 31.89, 26.86, 20.82 . Cis-3,3,5-trimethylcyclohexyl acetate h nmr (400 mhz, acetone) 4.83 (tt, j = 11.6, 4.4 hz, 1h), 1.94 (s, 3h), 1.931.89 (m, 1h), 1.781.62 (m, 1h), 1.35 (ddt, j = 13.1, 3.8, 2.0 hz, 2h), 1.08 (m, 2h), 0.94 (s, 6h), 0.90 (d, j = 6.5 hz, 3h), 0.960.78 (m, 1h). C nmr (101 mhz, acetone) 169.60, 70.21, 47.23, 43.82, 40.25, 32.45, 31.79, 26.91, 24.88, 21.74, 20.37 . H nmr (400 mhz, acetone) 4.83 (tt, j = 11.6, 4.4 hz, 1h), 1.94 (s, 3h), 1.931.89 (m, 1h), 1.781.62 (m, 1h), 1.35 (ddt, j = 13.1, 3.8, 2.0 hz, 2h), 1.08 (m, 2h), 0.94 (s, 6h), 0.90 (d, j = 6.5 hz, 3h), 0.960.78 (m, 1h). C nmr (101 mhz, acetone) 169.60, 70.21, 47.23, 43.82, 40.25, 32.45, 31.79, 26.91, 24.88, 21.74, 20.37 . Trans-3,3,5-trimethylcyclohexyl acetate h nmr (400 mhz, acetone) 5.02 (s, 1h), 1.96 (s, 3h), 1.90 (m, 1h), 1.781.61 (m, 2h), 1.471.39 (m, 1h), 1.060.77 (m, 3h), 0.89 (d, j = 6.5 hz, 3h), 0.88 (s, 6h). C nmr (101 mhz, acetone) 169.34, 70.17, 47.81, 40.87, 38.08, 33.38, 30.26, 26.76, 23.22, 21.93, 20.49 . H nmr (400 mhz, acetone) 5.02 (s, 1h), 1.96 (s, 3h), 1.90 (m, 1h), 1.781.61 (m, 2h), 1.471.39 (m, 1h), 1.060.77 (m, 3h), 0.89 (d, j = 6.5 hz, 3h), 0.88 (s, 6h). C nmr (101 mhz, acetone) 169.34, 70.17, 47.81, 40.87, 38.08, 33.38, 30.26, 26.76, 23.22, 21.93, 20.49 . 2-hydroxyoctyl acetate h nmr (400 mhz, acetone) 4.013.88 (m, 2h), 3.43 (m, 1h), 2.00 (s, 3h), 1.521.18 (m, 10h), 0.88 (t, j = 7.16 hz 3h). C nmr (101 mhz, acetone) 170.12, 71.14, 69.12, 33.56, 31.68, 29.16, 25.08, 22.35, 19.88, 13.44 . H nmr (400 mhz, acetone) 4.013.88 (m, 2h), 3.43 (m, 1h), 2.00 (s, 3h), 1.521.18 (m, 10h), 0.88 (t, j = 7.16 hz 3h). C nmr (101 mhz, acetone) 170.12, 71.14, 69.12, 33.56, 31.68, 29.16, 25.08, 22.35, 19.88, 13.44 . 1-(hydroxymethyl)heptyl acetate h nmr (400 mhz, acetone) 4.85 (m, 1h), 3.55 (m, 2h), 1.99 (s, 3h), 1.651.20 (m, 10h), 0.88 (t, j = 7.16 hz 3h). C nmr (101 mhz, acetone) 169.90, 75.81, 68.34, 31.56, 30.47, 29.03, 25.63, 22.38, 20.20, 13.45 . H nmr (400 mhz, acetone) 4.85 (m, 1h), 3.55 (m, 2h), 1.99 (s, 3h), 1.651.20 (m, 10h), 0.88 (t, j = 7.16 hz 3h). C nmr (101 mhz, acetone) 169.90, 75.81, 68.34, 31.56, 30.47, 29.03, 25.63, 22.38, 20.20, 13.45 . 1-[(acetyloxy)methyl]heptyl acetate h nmr (400 mhz, acetone) 5.01(m, 1h), 4.21 (dd, j = 11.9, 3.4 hz, 1h), 4.5 - 3,93 (m, 1h), 1.99 (s, 3h), 1.98 (s, 3h), 1.651.20 (m, 10 h), 0.88 (t, j = 7.16 hz 3h). C nmr (101 mhz, acetone) 169.98, 169.79, 74.67, 68.66, 31.62, 30.40, 28.84, 24.90, 22.31, 20.03, 19.73, 13.41 . H nmr (400 mhz, acetone) 5.01(m, 1h), 4.21 (dd, j = 11.9, 3.4 hz, 1h), 4.5 - 3,93 (m, 1h), 1.99 (s, 3h), 1.98 (s, 3h), 1.651.20 (m, 10 h), 0.88 (t, j = 7.16 hz 3h). C nmr (101 mhz, acetone) 169.98, 169.79, 74.67, 68.66, 31.62, 30.40, 28.84, 24.90, 22.31, 20.03, 19.73, 13.41 . Cis-2-hydroxycyclohexyl acetate h nmr (400 mhz, acetone) 4.82 (dd, j = 7.1, 4.0 hz, 1h), 4.37 (s, oh), 4.04 (m, 1h), 1.99 (s, 3h), 1.82 (m, 1h), 1.771.61 (m, 4h), 1.31 (m, 2h), 1.411.21 (m, 1h). C nmr (101 mhz, acetone) 169.76, 73.31, 67.99, 29.54, 28.08, 21.90, 21.15, 20.62 . H nmr (400 mhz, acetone) 4.82 (dd, j = 7.1, 4.0 hz, 1h), 4.37 (s, oh), 4.04 (m, 1h), 1.99 (s, 3h), 1.82 (m, 1h), 1.771.61 (m, 4h), 1.31 (m, 2h), 1.411.21 (m, 1h). C nmr (101 mhz, acetone) 169.76, 73.31, 67.99, 29.54, 28.08, 21.90, 21.15, 20.62 . Cis-2-(acetyloxy)cyclohexyl acetate h nmr (400 mhz, acetone) 4.96 (d, j = 8.4 hz, 2h), 1.97 (s, 6h), 1.80 (m, 2h), 1.691.59 (m, 2h), 1.531.40 (m, 4h). C nmr (101 mhz, acetone) 169.49, 73.78, 29.54, 27.30, 20.09 . H nmr (400 mhz, acetone) 4.96 (d, j = 8.4 hz, 2h), 1.97 (s, 6h), 1.80 (m, 2h), 1.691.59 (m, 2h), 1.531.40 (m, 4h). C nmr (101 mhz, acetone) 169.49, 73.78, 29.54, 27.30, 20.09 . Trans-2-hydroxycyclohexyl acetate h nmr (400 mhz, acetone) 4.53 (d, j = 8.9 hz, 1h), 3.49 (m, 1h), 3.30 (s, oh), 1.97 (s, 3h), 1.91 (m, 2h), 1.761.59 (m, 2h), 1.391.16 (m, 4h). C nmr (101 mhz, acetone) 169.45, 77.15, 71.09, 32.88, 23.60, 3.04, 20.09, 19.64 . H nmr (400 mhz, acetone) 4.53 (d, j = 8.9 hz, 1h), 3.49 (m, 1h), 3.30 (s, oh), 1.97 (s, 3h), 1.91 (m, 2h), 1.761.59 (m, 2h), 1.391.16 (m, 4h). C nmr (101 mhz, acetone) 169.45, 77.15, 71.09, 32.88, 23.60, 3.04, 20.09, 19.64 . Trans-2-(acetyloxy)cyclohexyl acetate h nmr (400 mhz, acetone) 4.72 (m, 2h), 1.95 (s, 6h), 1.92 (m, 2h), 1.64 (m, 2h), 1.2431.23(m, 4h). C nmr (101 mhz, acetone) 169.97, 73.05, 29.66, 23.44, 20.10 . H nmr (400 mhz, acetone) 4.72 (m, 2h), 1.95 (s, 6h), 1.92 (m, 2h), 1.64 (m, 2h), 1.2431.23(m, 4h). C nmr (101 mhz, acetone) 169.97, 73.05, 29.66, 23.44, 20.10 . Cis-3-hydroxycyclohexyl acetate h nmr (400 mhz, acetone) 4.62 (m, 1h), 3.57 (m, 1h), 4.86 (s, oh), 1.95 (s, 3h), 1.931.77 (m, 1h), 1.771.61 (m, 1h), 1.611.46 (m, 2h), 1.451.31 (m, 3h), 1.311.06 (m, 1h). C nmr (101 mhz, acetone) 169.34, 70.89, 65.75, 38.70, 36.92, 30.27, 20.21, 18.86 . H nmr (400 mhz, acetone) 4.62 (m, 1h), 3.57 (m, 1h), 4.86 (s, oh), 1.95 (s, 3h), 1.931.77 (m, 1h), 1.771.61 (m, 1h), 1.611.46 (m, 2h), 1.451.31 (m, 3h), 1.311.06 (m, 1h). C nmr (101 mhz, acetone) 169.34, 70.89, 65.75, 38.70, 36.92, 30.27, 20.21, 18.86 . Trans-3-hydroxycyclohexyl acetate h nmr (400 mhz, acetone) 5.01 (m, 1h), 3.96 (m, 1h), 4.86 (s, oh), 1.98 (s, 3h), 1.931.77 (m, 1h), 1.771.61 (m, 1h), 1.611.46 (m, 2h), 1.451.31 (m, 3h), 1.311.06 (m, 1h). C nmr (101 mhz, acetone) 169.43 c, 69.93, 65.58, 41.29, 35.20, 29.82, 20.29, 19.00 . H nmr (400 mhz, acetone) 5.01 (m, 1h), 3.96 (m, 1h), 4.86 (s, oh), 1.98 (s, 3h), 1.931.77 (m, 1h), 1.771.61 (m, 1h), 1.611.46 (m, 2h), 1.451.31 (m, 3h), 1.311.06 (m, 1h). C nmr (101 mhz, acetone) 169.43 c, 69.93, 65.58, 41.29, 35.20, 29.82, 20.29, 19.00 . Cis-3-(acetyloxy)cyclohexyl acetate h nmr (400 mhz, acetone) 4.69 (m, 2h), 1.96 (s, 6h), 1.941.78 (m, 3h), 1.781.61 (m, 1h), 1.611.31 (m, 2h), 1.311.07 (m, 2h). C nmr (101 mhz, acetone) 171.09, 70.05, 34.50, 30.87, 20.38, 19.78 . H nmr (400 mhz, acetone) 4.69 (m, 2h), 1.96 (s, 6h), 1.941.78 (m, 3h), 1.781.61 (m, 1h), 1.611.31 (m, 2h), 1.311.07 (m, 2h). C nmr (101 mhz, acetone) 171.09, 70.05, 34.50, 30.87, 20.38, 19.78 . Trans-3-(acetyloxy)cyclohexyl acetate h nmr (400 mhz, acetone) 5.06 (m, 2h), 1.96 (s, 6h), 1.941.78 (m, 3h), 1.781.61 (m, 1h), 1.611.31 (m, 2h), 1.311.07 (m, 2h). C nmr (101 mhz, acetone) 171.09, 69.45, 34.57, 30.47, 20.33, 19.58 . H nmr (400 mhz, acetone) 5.06 (m, 2h), 1.96 (s, 6h), 1.941.78 (m, 3h), 1.781.61 (m, 1h), 1.611.31 (m, 2h), 1.311.07 (m, 2h). C nmr (101 mhz, acetone) 171.09, 69.45, 34.57, 30.47, 20.33, 19.58.
Cardiovascular disease (cvd) is a leading cause of morbidity and mortality in the united states . It kills one american every 38 seconds and accounts for 1 of every 2.9 deaths, more deaths than any other major cause of death . The 2006 overall death rate due to cvd was 262.5, but the rate increases substantially with age . It is estimated that more than 1 in 3 men and around 1 in 4 women aged 75 and over currently live with the condition . Although cvd is the leading cause of death, modifiable behavioral risk factors are major contributing or actual cause of this mortality . In both younger and older age groups the five key risk factors for cvd are hypertension, high serum cholesterol, diabetes, body mass index, and smoking . The majority of studies of alcohol intake have found j- or u - shaped risk curves with light to moderate drinkers having a lower risk of atherosclerotic cvd than nondrinkers or heavy drinkers . For physical activity, a dose - response relationship exists between duration and intensity of activity and cvd disease risk, with even relatively low levels of physical activity providing some benefit compared with inactivity . Although these lifestyle practices have substantial health benefits and reduce mortality, few studies have examined their impact in combination and on survival beyond age 75 . As part of a prospective cohort study of the effect of modifiable lifestyle practices on longevity and successful aging, we explored the association of smoking, alcohol consumption, caffeine intake, physical activity, and body mass index on cvd mortality in a large cohort (over 13,000) of elderly (median age 74 years) men and women followed for 26 years . The leisure world cohort study was established in the early 1980s when 13,978 (8877 female and 5101 male) residents of a california retirement community (leisure world laguna hills) completed a postal health survey . The population and the cohort are mostly caucasian, well educated, upper - middle class, and elderly . The baseline survey asked about demographic information (birth date, sex, marital status, number of children, height, weight); brief medical history (high blood pressure, angina, heart attack, stroke, diabetes, rheumatoid arthritis, fractures after age 40, cancer, gallbladder surgery, glaucoma, cataract surgery); medication use (hypertensive medication, digitalis, nonprescription pain medication); personal habits (cigarette smoking, exercise, alcohol consumption, vitamin supplement use); usual frequencies of consumption of 58 food (or food groups) that are common sources of dietary vitamin a and c; beverage intake (milk, regular coffee, decaffeinated coffee, black or green tea, and soft drinks). Based on their reported smoking history we classified participants as never, past, or current smokers . Consumption of alcoholic beverages was asked separately for wine (4 oz . ), beer (12 oz . ), and hard liquor (1 oz . ), each equivalent to about 1/2 oz . Of alcohol . Response choices for average weekday consumption were never drink, less than 1, 1, 2, 3, and 4 or more drinks . Total alcohol intake per day was calculated by summing the number of drinks consumed of each type . Individuals were then categorized into four groups: 0, <1, 2 - 3, and 4 + drinks / day . We estimated daily caffeine intake by summing the frequency of consumption of each beverage and chocolate multiplied by its average caffeine content (mg / standard unit) as 115, 3, 50, 50, and 6 for regular coffee, decaffeinated coffee, tea, cola soft drinks, and chocolate, respectively . Caffeine intake was categorized as <50, 5099, 100199, 200399, 400 + mg / day . Body mass index (weight (kg)/height (m)) was calculated based on self - reported height and weight at baseline and categorized according to federal guidelines: underweight (<18.5), normal weight (18.524.9), overweight (2529.9), and obese (30 +) [7, 8]. The amount of time spent on physical activities was ascertained by asking, on the average weekday, how much time do you spend in the following activities? Active outdoor activities (e.g., swimming, biking, jogging, tennis, vigorous walking), active indoor activities (e.g., exercising, dancing), other outdoor activities (e.g., sightseeing, boating, fishing, golf, gardening, attending sporting events), other indoor activities (e.g., reading, sewing, crafts, board games, pool, attending theater or concerts, performing household chores), watching tv . For each question, the response categories were 0 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 - 4 hours, 5 - 6 hours, 7 - 8 hours, 9 hours or more per day . The time spent per day in active exercise was calculated by summing the times spent in active outdoor activities and active indoor activities and in other activities by summing the times spent in other outdoor activities and other indoor activities . Followup of the cohort is maintained by periodic resurvey and determination of vital status by search of governmental and commercial death indexes and ascertainment of death certificates . To date 55 cohort members have been lost to follow up; search of death indices did not reveal that these individuals were deceased . Cause of death was determined from death certificates or by codes provided by the california department of vital statistics . We included as cvd deaths those coded 390459 in international classification of diseases 9 (years 19811998) and i00i99 in international classification of diseases 10 (years 19992007). Hazard ratios (hrs) and 95% confidence intervals (cis) were obtained using cox regression analysis . For the cox models, chronological age was used as the fundamental time scale with study entry being the age when the survey was completed and the event of interest being age at cvd death . Separate analyses were performed for four age groups (<70, 7074, 7579, and 80 + years) within the two sexes . Hrs were calculated for each lifestyle factor adjusted for age (continuous) and then additionally adjusted for the other lifestyle variables plus seven separate histories (no, yes) of hypertension, angina, heart attack, stroke, diabetes, rheumatoid arthritis, and cancer . No adjustment in the p values was made for multiple comparisons . To account for the possibility that recent disease development may have influenced lifestyle practices as well as be related to mortality previous reports present details of the methods and validity of exposure and outcome data [1015]. The institutional review boards of the university of southern california and the university of california, irvine approved the study . After excluding 682 subjects with missing information on the lifestyle factors, we analyzed data on 13,296 subjects (8444 women and 4852 men). At study entry, the participants ranged in age from 44 to 101 years (median: 74 years). By december 31, 2007, the subjects had contributed 180,122 person - years of followup (median: 13.5 years), and 11,929 (7367 women and 4562 men) had died . Age at death ranged from 59 to 108 years (median: 87 years). Over half of all deaths were due to cvd: 4575 women and 2656 men . Differences between males and females were highly statistically significant (p <.001) for all variables except caffeine (p <.01). Because of these differences as well as the different patterns of smoking (amount and duration), alcohol (type), activities (type), and body - build between men and women and the fact that women live longer on average than men and for comparison with other studies limited to a single sex, we performed separate analyses for men and women . Tables 2 and 3 show the age - adjusted and multivariable - adjusted hrs of cvd mortality for the various lifestyle variables for women and men, respectively . Adjustment for potential confounders increased the observed hrs for smoking but had limited effect on the others, generally attenuating the observed hrs . Although caffeine intake showed no consistent effect, the other modifiable factors were related to cvd death . Current smokers had significantly increased (about 40130%) risk compared with never smokers in all age - sex groups . In women, alcohol consumption (<3 drinks / day) was related to decreased (about 1530%) risk compared with abstainers in all but the oldest age group . In men, 4 + drinks / day was associated with reduced (about 1530%) risk in all but those aged 7074 years . Women and men aged 70 + years old who participated in active activities, even as little as 1/2 hour / day, had 2040% lower risk of cvd death compared to those who reported no active activities participation in other activities was also associated with reduced risk . However, more time in these activities was needed to show the same reduced risk as for active activities . Underweight and obese women in all age groups were at increased risk of cvd death (though not all groups showed statistically significant effects). Underweight men also appeared to be at increased risk, though the number of such men was small (n = 81). Risk was also increased in overweight men aged <75 years compared with their normal weight peers . Exclusion of the first five years of followup (including 1826 early deaths) changed the findings slightly . The multivariate - adjusted risk estimates changed by less than 10 percent except for current smokers aged 80 + years (women 1.46 to 1.28, men 2.20 to 2.50), underweight women aged 7074 years (1.29 to 1.13), obese women aged 7579 years (1.09 to 1.21), underweight men (aged <70 years, 1.75 to 1.49; aged 7074 years, 2.76 to 1.84; aged 7579 years, 1.48 to 1.72; and aged 80 + years, 1.12 to 0.84), obese men aged 80 + years (1.40 to 1.91). Hrs for active and other activities in men aged 75 + years were generally attenuated to 1.0, and all became nonsignificant . Our study extends the available literature on the cvd survival benefits of several lifestyle practices to the very old . We confirmed the beneficial effect of not smoking, participating in activities, drinking alcohol, and having a normal body mass index . Each of these was associated with reduced cvd death in our elderly men and women, even those aged 80 years and older . We previously reported the effects of several of these lifestyle practices on all - cause mortality in this cohort [5, 6, 8, 15]. Although not age stratified, results were similar to those found in the present analysis . Alcohol intake showed a small beneficial effect (15% reduction in risk) in both men and women, while a shallow u - shaped association of caffeine intake with mortality was observed in both sexes . The curves for the association of body mass index and all - cause mortality were almost identical for men and women with being underweight increasing risk about 50% and being obese increasing risk 2025% . The indices of physical activities, alcohol and caffeine intake, and smoking used in this study are crude and self - reported and their reliability and validity were not ascertained . Although our data on other variables are also self - reported, previous studies in our population and others support the reliability of medical history of major chronic disease [10, 13] and of self - reported height and weight . Another limitation is that changes over time in all potential risk factors may affect outcome . Additionally, the subjects in our study were mostly white, highly educated, and of middle social - economic class and therefore not representative of the general population . Although this may limit the generalizability of our results, it offers the advantage of reduced potential confounding by race, education, social - economic class, and presumed access to health care . Additionally, although we adjusted for other risk and potential confounding factors, unrecognized and uncontrolled confounders cannot be ruled out in this or any observational study . This cohort has the advantages of population - based prospective design, large sample size, inclusion of men and women, and data on several lifestyle factors and important confounders, including factors previously found to be related to mortality . The long and almost complete followup of the cohort resulted in a large number of outcome events . Previous studies have identified lifestyle factors that promote health and increase longevity, including absence of current smoking, drinking a moderate amount of alcohol, participating in moderate exercise, and being of normal body mass index . However, few studies have investigated the combined effect of these lifestyle factors and even fewer have included the very old or, if they did, did not show age - stratified results . In the hale project of european subjects aged 70 to 90 years, adherence to a mediterranean diet (hr = 0.71) and healthful lifestyle (moderate alcohol use (hr = 0.74), physical activity (hr = 0.65), and nonsmoking (hr = 0.68)) was associated with a lower rate of cardiovascular mortality . In the nurses' health study of middle - aged women, those who did not smoke cigarettes, were not overweight, maintained a healthful diet, exercised moderately or vigorously for half an hour a day, and consumed alcohol moderately had an incidence of coronary events that was more than 80 percent lower than that in the rest of the population . In the seneca (survey in europe on nutrition and the elderly: a concerted action) study of those aged 7075 years, a high - quality diet, nonsmoking, and physical activity were positively related to 10-year survival in both men and women . For men, the mortality risk for a low - quality diet was 1.25, for inactivity was 1.36, and for smoking was 2.06 . For women, the mortality risk for smoking was 1.76 and for inactivity 1.75, much higher than the risk associated with a low - quality diet 1.26 . In the nhanes i epidemiologic followup study, smoking predicted survival in middle - aged (4554 years old) and older (6574 years old) men and middle - aged women; nonrecreational physical activity predicted survival in older men and women; low body mass index was also associated with shorter survival in older men and middle - aged and older women; drinking was associated with shorter survival in older men . Experimental, clinical, and epidemiological studies suggest mechanisms that provide a biological basis for causal relations between these behavioral risk factors and lower rates of cvd and death . Alcohol increases high - density lipoprotein cholesterol concentrations, decreases platelet aggregation, and affects tissue plasminogen activator and other components of clotting and fibrinolysis . Likewise, physical activity reduces blood pressure, increases high - density lipoprotein cholesterol, decreases triglycerides, improves cardiorespiratory fitness, and produces beneficial changes in inflammatory / hemostatic factors . The reason for increased mortality among the underweight elderly is not clear . Previous all - cause and cvd mortality studies in the elderly have found persons in the lowest weight category at increased risk of death [20, 21]. Being lean, especially in the elderly, may represent a real risk because of nutrient deficiency and physical, functional, and psychological impairment . Evidence from epidemiologic studies indicates that the same factors that are associated with increased risk of cvd in middle - aged people are relevant in older adults . Although much effort has focused on the pharmacologic management of hypertension and blood lipid levels with proven success, lifestyle can also affect cvd mortality . Changing these risk factors in older adults can help reduce cvd risk as it does in middle - aged adults and without side effects, high cost, or medical intervention . Together avoidance of smoking, sensible drinking habits, regular physical activity, and maintenance of a healthy body weight may prevent much of the cvd in western populations . With increasing age, the elderly, however, may become limited by comorbid conditions, decreased functional ability, impaired cognition, and emotional instability and therefore need special programs providing increased physical and social activities and balanced and healthful nutrition . Of course, the greatest benefit will be achieved by adopting these habits early in life and maintaining them throughout the life course . Results in this large elderly cohort with long followup showing a decreased risk of cardiovascular mortality with several lifestyle practices suggest that maintenance of these is an important health promoter in aging populations.
Superior mesenteric artery (sma) syndrome is a rare disorder, recognized as weight loss, nausea, vomiting, and post - prandial pain due to compression and partial obstruction of the third portion of the duodenum by the sma . If conservative treatment fails, then laparotomy with duodenojejunostomy or lysis of the ligament of treitz is indicated . We report the first case of laparoscopic duodenojejunostomy as the definitive treatment of vascular compression of the duodenum . A very thin woman with a diagnosis of sma syndrome was prepared for surgery after having failed medical therapy . The patient was placed in a supine position, and four laparoscopic ports were required to perform a 5 cm duodenojejunostomy . It provides definitive treatment while preserving the benefits of minimally invasive surgical techniques in the debilitated patient . Vascular compression of the duodenum was first described by rokitansky in 1842, with the first successful operative treatment, a duodenojejunostomy, performed by stavely in 1908 . The site of obstruction typically occurs in the third portion of the duodenum as the organ is held between the superior mesenteric artery and lumbar spine . Symptoms are typically chronic and intermittent and include nausea, vomiting, distention, and post - prandial epigastric pain, with resultant weight loss . The compression may occur in the setting of a narrowed aortomesenteric angle, abdominal compression by a cast or girdle, or it may be categorized as idiopathic . Some authors have suggested a genetic predisposition patients are usually young, and women are affected more often than men . Other technical approaches include lysis of the ligament of treitz or gastro - jejunostomy which may be less effective; a duodenojejunostomy is required if these fail . Recently, advances in laparoscopic skills have enabled surgeons to forego the need for laparotomy when performing operations of increasing complexity . In this report, we describe the first known case of laparoscopic duodenojejunostomy for superior mesenteric artery (sma) syndrome . The patient is a thin 24-year - old female with past medical history of total abdominal colectomy and ileorectal anastomosis five years earlier . She had previously done well; however, she began to complain of nausea, bilious vomiting and a recent 20 pound weight loss . An upper gastrointestinal series with small bowel follow through demonstrated a partial obstruction of the third portion of the duodenum with marked dilatation proximally . With these clinical and radiologic findings, the diagnosis of sma syndrome was made . The patient did not improve with conservative management and subsequently surgical consultation and operation was requested . After thorough evaluation, the patient was taken to the operating room for a laparoscopic duodenojejunostomy . Due to the previous operation, an open hasson technique was performed in the right paramedian position, lateral to the umbilicus . As the intra - abdominal adhesions were cleared, three additional trocars were placed, one each in the left lateral abdomen, xiphoid, and at the umbilicus (figure 1). A kocher maneuver was performed revealing no masses in the duodenum or head of the pancreas . The ligament of treitz was identified, and a portion of the proximal jejunum, approximately 30 cm distal to the ligament of treitz, was found to easily reach the duodenum . A silk suture was placed between the duodenum and jejunum, holding these two portions of the bowel in apposition . A duodenotomy was made in the lateral aspect of the second portion of the duodenum avoiding the ampulla . After performance of an anti - mesenteric jejunotomy, a 35 mm gia (united states surgical corporation, norwalk, ct) was introduced into both lumens and a duodenojejunostomy was created (figure 2). A second load of the 35 mm gia was used to extend the anastomosis in excess of 5 cm . The anastomosis was reinforced with interrupted 3 - 0 silk lembert sutures and was noted to be airtight by insufflating the duodenum under a pool of saline . No drains or nasogastric tube were required, and the trocar sites were closed in the standard fashion . The right paramedian trocar was inserted first utilizing an open procedure, due to a previous midline incision . Creation of a laparoscopic duodenojejunostomy utilizing a 35 mm gia stapler (united states surgical corporation, norwalk, ct). A gastrograffin study obtained on postoperative day 2 demonstrated free flow of contrast through the duodenojejunostomy (figure 3). She was discharged home on postoperative day 4 without complications, tolerating a regular diet . Upper gastrointestinal series demonstrating a patent duodenojejunostomy with flow of contrast past the stapled anastomosis . Sma syndrome is a rare condition whose incidence ranges from 0.0024 to 0.34% for the general population, with a slightly higher incidence in chronic care facilities . Its actual incidence is largely unknown since its diagnosis is not frequently pursued in the chronically ill patients typically assume the knee - chest position after eating, which widens the aortomesenteric angle, relieves their partial duodenal obstruction, and allows the passage of gastric contents through this area of duodenal narrowing . The use of total parenteral nutrition or aggressive nutritional support may increase the bulk of the retroperitoneal fat pad and provide relief by widening the aortomesenteric angle . This syndrome can be caused by body casts or girdles and removing these implements can aid by decreasing the extraluminal compressive forces inflicted upon the duodenum . Open surgical approaches have included amputation of the ligament of treitz with repositioning of the duodenum, gastro - jejunostomy, and duodenojejunostomy . The most successful approach for treatment of the sma syndrome has been the performance of a duodenojejunostomy, and some authors have suggested that other operative interventions are ineffective . Our group opted to treat this syndrome laparoscopically by the same operation that we chose in open surgery, a duodenojejunostomy bypass . This is the first case report, to our knowledge, of performance of a laparoscopic duodenojejunostomy for treatment of sma syndrome . Postoperative radiologic studies confirmed patency of the duodenojejunostomy, and there have been no further obstructive episodes . In conclusion, sma syndrome can be added to the growing list of disorders that can be successfully treated laparoscopically . Laparoscopic treatment via duodenojejunostomy is safe and effective and may offer patients the benefit of decreased pain, hospital stay, and postoperative disability.
Overwhelming evidence proved that the formation and accumulation of advanced glycation end products (ages) progress in a normal aging process and at an accelerated rate under diabetes [1, 2]; an increase in the steady - state levels of highly reactive dicarbonylic compounds may lead to the formation of ages, while an increase in the generation of ages can be partly explained by the process of non - enzymatic glycosylation of proteins . These proteins appear to contribute to diverse cellular functions, such as the specific recognition and degradation of ages - modified proteins . So far, several age - binding proteins have been identified, including age - r1, age - r2, age - r3, rage, and macrophage scavenger receptors type i and type ii . In endothelial cells, ages exert adverse effects on mitochondrial function, with elevated production of reactive oxygen species (ros), and consequently increased oxidative stress leading to cellular dysfunction and even cell death . Ages also increase the formation of intracellular ros, no, and nitric oxide synthase (nos) and stimulate ceramides as well as the mapk cascade, which activates different targets including transcription factors through intermediate molecules such as nf-b [46]. Therefore preventing the endothelial cell from age - triggered injury may improve diabetes - associated vascular complications . The endogenous opioid peptides, endomorphin 1 (tyr1-pro2-trp3-phe4-nh2, em1) and endomorphin 2 (tyr1-pro2-phe3-phe4-nh2, em2), which were discovered in 1997 by champion et al ., have higher affinity and are more selective for the -opiate receptor than other opioid substances . Many studies indicated that the endogenous opioid system played roles in the regulation of the cardiovascular system in a variety of species [8, 9], such as rabbits, rats [11, 12], and mice furthermore, jaffe et al . Reported that vasodilator responses to endomorphin 1 were mediated by a nitric oxide - dependent mechanism and may act as an endothelium - dependent vasodilator agent in rat however, the precise molecular mechanisms by which ems inhibit age - induced injury in endothelial cells have not yet been thoroughly elucidated . The purpose of this study is to investigate the inhibitory effects and to involve mechanisms of ems on ages induced - oxidative stress and apoptosis in human umbilical vein endothelial cells . Endomorphins was synthesized by shanghai hanhong chemical co., ltd (shanghai, china). Fetal bovine serum (fbs) no and endothelial nitric oxide synthase (enos) assay kits were obtained from jian - cheng biological engineering institute (nanjing, china). Rabbit anti - human p38 (h174) antibody, fitc - conjugated goat anti - rabbit antibody were obtained from bioworld technology, inc . The primers, taq polymerase, dntp, and rnasin were provided by takara bio inc . Ages - bsa was produced by incubation of 10 mg / ml bsa with 100 mm glucose in 150 mm phosphate - buffered saline (pbs), ph 7.4 at 37c for 6 weeks . Ages - bsa was identified by fluorescence spectrophotometer . Before the study, we recruited mothers who assented and gave written consent to contributing 10 cm of umbilical cord postpartum, and were isolated according to a previous reported method with minor modifications . Cultured cells were identified as endothelial by their morphology and the presence of von willebrand factor . Briefly, the cells were grown in dmem supplemented with 10% fetal bovine serum, penicillin (100 units / ml), and streptomycin (100 mg / ml). Culture medium was refreshed every two days . For experiments, cells treated with endomorphins (10 m, 1 m, 0.1 m, or 10 nm) were exposed to these substances for 2 h before treatment with ages - bsa . Cells were incubated in 96-well plates at a density of 5 10 cells with 200 l culture medium per well . After cells were incubated according to the aforementioned group, 30 l medium containing 5 mg / ml mtt (sigma, usa) was added to each well . Following a 4 h incubation period, 100 l and then, after overnight incubation in darkness, the dissolved mtt crystals were quantified . Optical densities were obtained using a test at a wavelength of 570 nm . Levels of the nitric oxide (no) derivative nitrite were determined in the conditioned medium of huvec with the griess reaction . After cells were incubated according to the aforementioned grouping, 100 l culture solutions of each well was collected and put into the counterpart well of another plates, then no production in cells was measured by griess method and according to the indication on the no assay kit . After cells were incubated according to the aforementioned grouping, 200 l culture solutions of each well was collected and put into the counterpart well of another plates, then enos and inos expression in cells were measured according to the instructions given in the nos assay kit . Each experiment was performed in triplicate . A specific sandwich enzyme - linked immunosorbent (elisa) employing monoclonal antibody was used to determinate the level of et-1; the elisa was performed according to the instructions given in the et-1 elisa kit by ad litteram diagnostic laboratories (usa). After incubation, the cells were washed twice with pbs and the total mrna was extracted by trizol . Thereafter, it was reverse - transcripted under following conditions: 37c for 15 min, 85c for 5 sec, and the cdna product was stored at 80c . For the pcr, 3 l of the cdna products of each sample was amplified with taq dna polymerase, using a primer pair specific to human enos, et-1, and -actin in a 25 l reaction volume; the primer sequences and pcr condition were described in table 1 . Pcr cycle conditions were 95c for 30 sec, 95c for 5 sec, 60c for 30 sec for 50 cycles, with an initial denaturation at 94c for 5 min and a final extension of 5 min at 72c . The resulting data were analyzed by rotor - gene real - time analysis software 6.1 . Cells were fixed with 4% paraformaldehyde (ph 7.4) for 15 min at 4c and permeabilized with 0.2% triton x-100 for 5 min at room temperature . After being blocked with 5% normal bovine serum for 30 min, cells were incubated with p38 mapk antibody (1: 100 dilution) at 4c overnight followed by fitc - conjugated secondary antibody (1: 50 dilution, 1 h). Statistical evaluations were performed using one - way anova followed by tukey's test . Values of p <0.05 were considered statistically significant . Exposure of huvec to ages - bsa (100 mg / l) for 6 h, 24 h, and 48 h significantly decreased the cells viability significantly compared to that of bsa (100 mg / l, as osmotic control) (p <0.01, figure 1). The cell viability was decreased at 6 h and reached minimal level at 48 h after ages - bsa treatment . Whereas pretreatment with em1 and em2 (10 m, 1 m, 0.1 m, 10 nm) significantly increased the cells viability compared to ages - bsa group, the function was obvious at 24 h, 48 h compared to 6 h (p <0.005 versus p <0.05), and high concentration was more obvious than low concentration, which indicated that ems can attenuate the reduction of cell viability by ages - bsa in a time- and concentration - dependent manner (figure 2). As is shown in figure 3, the no production in huvec was 11.06 0.69 m after incubation for 24 h in the control group and was 20.15 2.05 m in the ages - bsa group, which was notably higher than that of control group (p <0.005), while the no production in huvec were 14.24 0.95 m, 14.70 1.72 m, 15.45 1.36 m, 16.06 1.60 m after incubation for 24 h in em1 pretreated group as the concentrations of 10 m, 1 m, 0.1 m, 10 nm, which were notably lower than that of ages - bsa group (p <0.005, 0.05). These results indicated that em1 inhibited the no production in a concentration - dependent manner in huvec stimulated by ages - bsa . The same results were observed in em2 group . In the control group (see figure 4), the secretion of inos was 0.29 0.03 u / ml after incubation for 24 h and was 0.55 0.05 u / ml in ages - bsa treated group, which was significantly increased to the control group (p <0.005). While the inos secretion in em1, em2 pretreated groups were 0.33 0.09 u / ml, 0.36 0.05 u / ml, 0.39 0.03 u / ml, 0.41 0.05 u / ml; 0.32 0.05 u / ml, 0.35 0.03 u / ml, 0.36 0.05 u / ml, 0.38 0.09 u / ml as the concentrations of 10 m, 1 m, 0.1 m, 10 nm, which were significantly decreased to the ages - bsa treated group (p <0.005, 0.05), these results indicated that ems efficiently and concentration - dependently inhibited the inos secretion in huvec . In the control group (see figure 5(a)), the secretion of enos was 2.39 0.09 u / ml after incubated for 24 h, and that of ages - bsa treated group was 0.65 0.17 u / ml in, which was significantly decreased compared to the control group (p <0.005). While the secretions of enos in em1, em2 pretreated groups were 2.30 0.09 u / ml, 2.10 0.09 u / ml, 2.03 0.22 u / ml, 1.91 0.14 u / ml; 2.32 0.43 u / ml, 2.23 0.39 u / ml, 2.18 0.12 u / ml, 2.06 0.16 u / ml as the concentrations of 10 m, 1 m, 0.1 m, 10 nm, which were significantly higher compared to the ages - bsa treated group (p <0.005, 0.05), these results indicate that ems pretreatment abrogated the decrease efficiently, and in a concentration - dependent manner . Similar results were observed for the mrna level of enos (figure 5(b)). These results indicate that ems efficiently inhibited the decrease of enos expression and secretion stimulated by ages in huvec . In the control group (figure 6(a)), the secretion of et-1 was 0.76 0.03 ng / ml after incubated for 24 h and was 0.99 0.08 ng / ml in ages - bsa treated group, which was significantly higher than that in the control group (p <0.005). While the et-1 secretions in em1, em2 pretreated groups were 0.85 0.03 ng / ml, 0.87 0.06 ng / ml, 0.88 0.01 ng / ml, 0.89 0.04 ng / ml; 0.76 0.03 ng / ml, 0.78 0.13 ng / ml, 0.81 0.06 ng / ml, 0.85 0.01 ng / ml as the concentrations of 10 m, 1 m, 0.1 m, 10 nm, which were significantly lower than the ages - bsa treated group (p <0.005, 0.05), these results indicated that ems pretreatment abrogated the increase efficiently in a concentration - dependent manner . Similar results were observed for the mrna level of et-1 (figure 6(b)). These results indicated that ems efficiently inhibited the et-1 mrna expression and et-1 secretion in huvec . In this study, our investigation tries to ascertain whether ems inhibit the ages - induced dysfunction in endothelial cells through p38 mapk activities . As noted in figures 7(b) and 8(a), the fluorescence intensity of p38 mapk in the nucleus was obviously elevated in ages - treated huvecs relative to that in bsa - treated group (figures 7(a) and 8(b)). However, in ems pretreated groups (figures 7(c)7(f)) and figures 8(c)8(f)), the fluorescence intensity of p38 mapk in the nucleus was similar to bsa group, obviously weaker compared to ages - bsa group . Therefore, these results implied that ems inhibited the expression of p38 mapk in the nucleus induced by ages . Vascular endothelial cells play an important role in modulating anti - thrombus and maintaining the natural function of vascular by secreting many active substances . Ages, high blood glucose, oxide - ldl, and inflammatory factor are the main factors that induce endothelial cells injury [19, 20]. Once endothelial cell were damaged, it would result in dysfunction and abnormal secretion of active substances (e.g. No, nos, et-1, and prostacyclin pgi2). No is a strong oxidant and one of the most important mediators in the regulation of endothelial cell functions, which is synthesized by three isoforms of no synthases (nos), that is, enos, inos, and nnos . Enos is constitutively expressed and there is particularly continuous no production during physiological conditions . Our results suggested that incubation with ages (100 mg / l) for 24 h led to an significantly increase in the no, inos production and a decrease in the secretion and the mrna expression of enos compared to control group in huvecs (figures 35); these effects were strikingly reversed by em1 and em2 pretreatment, these findings were in line with some previous reports [22, 23]. It is well recognized that no produced by enos is described as low output pathway whereas inos generates no in a high output manner which causes cell or organ dysfunction and apoptosis . Evidence indicated that nos isoform expression (particularly inos) is altered and no is oversupplied in some pathologic conditions [25, 26]. Based on our data, we inferred that ages can alter nos isoform expression by decreasing enos expression and stimulating inos oversupplied in huvecs, resulting in overproduction of no, which was due to enhanced inos expression . Ems can enhance nos activity by up - regulating enos expression and decreasing inos production, leading to a health production and bioavailability of no . It is indicated that ems can attenuate the dysfunction of nos induced by ages in huvecs . A large amount of studies reported that ems can regulate nos expression in mammalian cells, such as human bone marrow stromal cells, human macrophages, and mice peritoneal macrophages; however, to our knowledge, there was no report in huvecs . Et-1, a member of potent vasoconstrictor polypeptide family, has been characterized as one of the most potent endogenous vasoconstrictors; the balance between no and et-1 is critical for the regulation of vascular tone . Our study clearly indicated that em1 and em2 pretreatment down - regulated the mrna expression and the plasma concentration of et-1, which was up - regulated by ages - bsa (figure 6). We think that ems inhibited et-1 expression through increased no production which is synthesised by enos and decreased no production which is synthesised by inos, leading to a balance between et-1 and no, potentially contributing to endothelial function . It was shown earlier that p38 mapk directly phosphorylates c - jun [31, 32]; protein phosphatases and p38 mapk interact in various cell systems and have been implicated in the regulation of diverse cellular responses together . In huvecs, ages induce differentiation accompanied by activation of erk, jnk, and p38 mapk pathways . These datum are consistent with our observation that p38 mapk is activated by ages (100 mg / l); furthermore, our study showed that p38 mapk activation was weakened in ems pretreated groups relative to ages groups . The results indicated that the rescue effect of ems on the ages - induced injury may be mediated, at least in part, by the p38 mapk pathway . It is acknowledged that the research means and methods we used in the study on signal pathway seemed too monospecific, which needs to be demonstrated by various experimental methods and different angles ., endomorphins can attenuate the huvec dysfunction of synthesising and secreting no, enos, inos, et-1 induced by ages and may inhibited p38 mapk signal pathway in nucleus stimulated by ages . These findings have partly revealed the molecular mechanism of endomorphins on protecting huvecs from injuries induced by ages and thereby may provide the pharmacologic basis for the treatment of endothelial dysfunction in diabetes.
While developed countries have seen increasing incidence rates over the past several decades, developing countries have begun to experience the rising trend of cancer incidence and mortality . Breast and cervical cancers are the most common cancers in women and lung cancer is the most common cancer in men in developing countries . Developing countries with the highest rates of cancer are mostly in asia and south america, with incidence rates greater than 260.4 per 100,000 . Africa, a continent that is much slower in its development, only sees about 94.8127.5 cases per 100,000, with relatively higher rates in northern africa . Morocco, a country with development and epidemiological transitions growing faster than most other countries in africa, falls into the relatively higher incidence rates within africa . Are from developing countries and half of all cases of gastric cancer are in eastern asia . Globocan statistics of 2012 show gastric cancer rates as highest in asia and lowest in africa . Globocan estimated an age standardized rate of gastric cancer in morocco as 5.1 per 100,000 for males and 3.0 per 100,000 for females . As a reference, the world age standardized rate of gastric cancer is 17.4 per 100,000 in men and 7.5 per 100,000 in women for 2012 . In recent years, rates of gastric cancer have been declining in most countries in europe, asia, and north america; however, with limited data from africa it is difficult to make this generalization to african countries as well . Impressions from local oncologists in marrakech, morocco, suggest that gastric cancer may be seen more frequently in marrakech than other regions in morocco . Thus, this study was conducted to determine the age- and sex - specific and total crude incidence rates of gastric cancer in marrakech and compare them to the rates in casablanca, the largest city with a population - based cancer registry in morocco . This study was conducted at the center hospital university mohammad vi (chu) in marrakech, morocco . This hospital is the largest of the 4 hospitals in marrakech and the only public hospital for diagnosis and treatment of cancer in the city . The hospital serves patients from the city of marrakech (population of 1.063 million in 2012) and its surrounding region, marrakech - tensift - al haouz . A limited number of patients also come from the neighboring regions of souss - massa - dra and tadla - azilal . In 2012, the hospital diagnosed and/or treated 1,573 cancer patients who were covered by government health insurance . A majority of the patients seen at the hospital were from low- and middle - income socioeconomic levels of this community . The smaller portion of the patients who are from upper middle - income and upper socioeconomic levels seek care at the few private clinics and hospitals in marrakech . Due to possible long waiting times for histopathologic examination of biopsy and resection specimens in government hospitals in morocco, government health insurance allows patients to have the histopathologic examination done at private pathology laboratories . Cities of residence of patients found in the hospital medical records in this study included 47 cities, of which 32 were within either the region surrounding marrakech, the marrakech - tensift - al haouz region, or the nearby regions of souss - massa - dra or tadla - azilal . Of these 32 cities, 22 were reported as being from the region surrounding marrakech . From this information and the referral patterns of all cancer patients seen at the hospital, we believe that most patients who come to the hospital in marrakech were from one of these 3 regions; thus, these regions became our study area . We were unable to get a reported residence from the patients collected from private pathology labs, because it is not part of the standard pathology form, and therefore had to assume their referral patterns matched that of the hospitals and patient's residence fell within one of the three regions . The study identified 327 new gastric cancer patients diagnosed and/or treated in chu in the 5-year period (20082012). Logbooks and medical records of gastric cancer patients were retrieved and abstracted . A manual search of the oncology records information for age, sex, place of residence, clinical diagnosis, and histopathologic features of the tumor was abstracted . Clinical and pathological information including symptoms and signs at presentation, endoscopic and abdominal ct scanning results, histopathologic type of tumor, tumor differentiation, presence of intestinal metaplasia, and any results on h. pylori infection was collected . To supplement the pathology information of the patients identified from the study hospital and identify other patients who were treated at other healthcare facilities the review of the records of gastric cancer patients diagnosed in these laboratories during the period of 20082012 revealed 470 additional gastric cancer patients . Information obtained included name, pathology reference number, age, sex, histopathologic type, differentiation, and h. pylori infection (if noted). The population data used for calculating the incidence rates of marrakech was obtained from the 2004 census data . Population data for each region, province, and city in morocco was obtained . For each city, percent growth change and natural population increase rates were used to estimate the population in marrakech and the surrounding regions for the years in which data was abstracted from the medical records and pathology reports . The incidence rates of casablanca were obtained from the most recent editions of the population - based cancer registry of the region of grand casablanca for years of 2004, 2005, 2006, and 2007 . This registry information is collected and stored within the oncology center at the centre hospital ibn rochd, within a specific data processing department . The casablanca registry data covers cancer patients in all clinics, laboratories, and government hospitals in casablanca . Since patient data was gathered from medical records as well as pathology reports from private laboratories, having data twice for one patient was possible . Thus, to eliminate duplicates, the pathology reference number used in the laboratories and recorded in the medical records was used to identify and remove duplicated data for one patient . The name of the patient was also used to verify possible duplicate records . To prepare for data analysis, medical records and pathology reports were merged into a final database and a unique study i d was given after stripping the names of patients . After removal of duplicates, we were able to identify 774 patients of gastric cancer in 20082012 of which 447 were found in the reports of 4 large pathology laboratories and 327 from medical records of the hospital . After review of records, 49 patients were excluded because of reported residence outside of the three 3 regions defined as the at - risk population surrounding marrakech or because of histopathologic diagnosis of stomach lymphoma, which was not included in the incidence rates from the casablanca registry (figure 1). To obtain a total 4-year incidence rate for casablanca, the sum of the total number of cases reported for each year in the registry was divided by the sum of the population for each corresponding year . At the time of publication casablanca only had registries for a 4-year period and thus the incidence reported is a 4-year incidence rate . Descriptive statistics and incidence rate analyses were completed using sas (version 9.3, sas institute, cary, nc). Because the last available census data from morocco was 2004, it was necessary to estimate the population of the 3 regions surrounding marrakech for the study years (20082012). Natural population change since the time of the census was determined by applying the annual growth rate to the census data to estimate the population during the study years . Additionally, in order to compare rates from marrakech to rates from casablanca, age - adjusted incidence rates were calculated for 8 age categories . The 8 categories, determined by those given in the census information from morocco, were <19, 2024, 2534, 3544, 4554, 5564, 6574, and> 75 . Data from the cancer registry in casablanca had been standardized by using the who world population . Therefore, we used the who world (20002025) standard population, adjusted to match the 8 age categories, to calculate age - adjusted incidence rates in marrakech . Incidence rate ratios and their corresponding 95% confidence intervals were calculated to determine differences in rates from marrakech to rates from casablanca . For males, the median was 62 with a range of 1994 and, for females, median was 58 and range was 2388 . Most (79%) patients reported being from a city that was considered an urban city center by the moroccan census information . Patients were clinically diagnosed with gastric cancer by both endoscopy and ct scan (table 1). The vast majority (90%) of patients had histopathologic diagnosis of gastric cancer by biopsy; few (15%) were diagnosed by resection, including those that had both biopsy and resection . Adenocarcinoma represented 83% of the histological types of gastric cancer; carcinoma and gastric intestinal stromal tumors represented 13% and 3%, respectively (table 2). Age - specific incidence rates for all patients, males, and females for marrakech and casablanca are presented in tables 3, 4, and 5, respectively . In nearly all age ranges, rates of gastric cancer in marrakech were higher than the rates in casablanca . The exceptions were all patients, male and female patients under 19 years; all patients aged 2024 years; and all patients aged 4554 years . In males, in nearly all age ranges, the rate was significantly higher in marrakech . However, in females, only the age ranges 4554, 5564, and over 75 had rates that were significantly higher in marrakech . The incidence rates of marrakech for 20082012 and casablanca for the years available from their registry data, 20042007, are presented in table 6 . The rates of gastric cancer in marrakech for all patients, males, and females were 5.50, 7.19, and 3.87 per 100,000, respectively . First, age - specific incidence rates of gastric cancer were higher in marrakech in nearly all age groups for both males and females compared to respective rates in casablanca . Second, when comparing total incidence rates by sex, males in marrakech had a significantly higher rate than males in casablanca . Amongst females, while the rates between the two cities were statistically significant, the difference was not as prominent as that of the males . Finally, the majority of the residence of patients found in the medical records was concentrated in the 3 regions surrounding marrakech . With the exception of a few age groups, marrakech had higher age - specific incidence rates of gastric cancer than casablanca . Rates appeared higher in casablanca in the under 19 age group, because the casablanca cancer registry included pediatric cancer cases, while the patient records of cancer in marrakech did not . Gastric cancer is known to be a cancer of elderly populations, so this does significantly impact the results found . The variation of rates between sexes is not altogether surprising as gastric cancer is more common in males than females . Many patients who visit the hospital in marrakech travel many miles across rough geographic terrains and, due to travel costs or gender and cultural norms in morocco, women may simply seek care less often than men . In many developing countries, the presence of gender inequalities combined with factors affecting health behaviors can limit a woman's ability to make the decision to seek care . Compared to the nearby country of tunisia, women in morocco sought health care less often, due to geographic obstacles that make traveling difficult . Observing that the majority of gastric cancers were from the region of marrakech and the 2 surrounding regions is a reasonable finding because chu in marrakech is the only public cancer hospital serving marrakech and the surrounding regions . While all patients in this study were from 3 regions surrounding marrakech, there is a possibility that other patients from less populated regions might have been missed in this study because of not seeking medical care in marrakech . Symptoms of early onset gastric cancer are similar to other nonmalignant gastrointestinal conditions; thus, patients are not likely to travel far to seek care until symptoms become severe . Previous studies assessing patterns of gastric cancer reported low rates of the disease in africa compared to rates in other countries, despite widespread infection by h. pylori in africa [4, 15, 16]. However, these same studies also noted limited availability of cancer registries in africa, which limits the ability to generate true incidence and prevalence rates . This study is the first to assess incidence of gastric cancer in marrakech, allowing for comparison within the country to identify rate differences and future investigation of risk factors in relation to geographic locations . Previous research from marrakech identified gastric cancer as the most common digestive cancer in the city which helps to verify our results . Both studies identified an average age of diagnosis of 59 years; and 6470% of all cases were in males . The significant difference in gastric cancer incidence found between marrakech and casablanca is the first to be reported for these cities . A 25-time higher rate was found in a town in the andes mountains in colombia compared to the rate in a city that is 200 kilometers away on the coast . The difference in rates was attributed to a mismatch in the ancestry of the host and the microbe, which resulted in more carcinogenic gastric lesions in the high rate area . Similar differences were reported in chile and guatemala where higher gastric cancer rates were found among higher altitudes . Increased gastric cancer risks associated with environment and genotypic variations of the h. pylori strains have been well documented and these factors may explain the variations in gastric cancer rates in populations that have nearly identical infection rates [2022]. Inclusion of data from the major cancer hospital and the main private pathology laboratories in marrakech assured the comprehensiveness of data sources . Obtaining records from the largest private pathology laboratories andpublic hospital in the city allowed for a wider representation of socioeconomic backgrounds of patients and increased inclusion of the majority of gastric cancer patients in the region . The existence of census information for the population and age and sex strata allowed us to calculate incidence, age - specific, and sex - specific rates for marrakech . Availability of a quality population - based cancer registry in casablanca and the opportunity to compare its results to marrakech increased the efficiency of region comparison of rates in this study . Lack of information about the residence of the patients from the private pathology laboratories limited our ability to calculate region - specific rates . However, there is no reason to believe that patients from distant regions of morocco would seek histopathologic diagnosis in these laboratories in marrakech . Due to possible cultural norms of not seeking medical care or limited availability of health professionals in peripheral regions one of the main focal points of the study was to examine the most recent 5-year period of gastric cancer in marrakech rather than choose a previous matching period with the casablanca cancer registry . The reason was that the new cancer center in marrakech was opened in the 5 years preceding the study and the flow of patients was much larger and inclusive . Also, we are not aware of significant changes in the healthcare or exposure factors related to gastric cancer that occurred in marrakech between the 2 data intervals of 20042007 and 20082012 . However, this nonoverlapping period might be a limitation of the study . A unique mix of cultural and lifestyle factors and regional differences in morocco present an opportunity for future research into the investigation of risk factors that may contribute to the higher gastric cancer rate in marrakech . Previous research has shown that risk factors for gastric cancer could be categorized into (a) h. pylori infection, (b) nitrogen compounds and other chemical carcinogens, (c) high intake of salted, smoked, and cured foods [2, 26], and (d) other social and behavioral factors [25, 2729]. With scarce current data from morocco, these risk factors should be investigated in future studies in marrakech and other parts of morocco to elucidate the risk factors of gastric cancer in this population . In conclusion, a significantly higher rate of gastric cancer was found in marrakech when compared to the rates of casablanca . Notably, the difference in incidence in males between marrakech and casablanca was much more distinct than the difference in females . The incidence of the disease in marrakech could be higher than what is reported in this study because of the possible missed patients who did not seek medical care and die without diagnosis or documentation . Future studies should further evaluate the possible underestimation of gastric cancer in marrakech and explore the variable rates in other regions of morocco . Future studies should also explore the risk factors of the disease including infectious, dietary, and environmental factors and possible regional differences.
Obesity is a leading risk factor for many adverse health outcomes including type 2 diabetes, hypertension, dyslipidemia, coronary heart disease, and certain types of cancer . The prevalence of adult obesity in the us had doubled from 19761980 to 1999 - 2000 . In 2009 us ranked the highest in adult obesity prevalence among all countries in the organization for economic cooperation and development . The estimated annual medical cost of obesity in the us totaled 147 billion us dollars in 2008 . More recent data indicated a slowing down of the trend in adult obesity and even some leveling off in childhood obesity . Small but significant declines in the prevalence of obesity among low - income preschoolers aged 25 years were reported in 19 of 43 us states examined in the pediatric nutrition surveillance system from 2008 to 2011 . No significant change in the prevalence of adult obesity was found between 20032008 and 2009 - 2010 in the national health and nutrition examination survey (nhanes). The prevalence of morbid (i.e., grades 2 and 3) obesity was still increasing from 2005 to 2010, but its growth rate had slowed down as indicated in the behavioral risk factor surveillance system (brfss). Given the large disease burden of obesity and its high prevalence, it is crucial to continuously monitor the prevalence of obesity in the us . This study provides national estimates of obesity among us adults aged 20 years and older in 2011 - 2012 and tracks its trends from 1999 to 2012 . Study sample came from nhanes 1999 - 2000, 2001 - 2002, 2003 - 2004, 2005 - 2006, 2007 - 2008, 2009 - 2010, and 2011 - 2012 waves . Nhanes is a program of studies designed to assess the health and nutritional status of adults and children and represents a multistage probability sample of the us civilian, noninstitutionalized population . Participants' body weight and stature height were measured by digital scale and stadiometer in the nhanes mobile examination center . Body mass index (bmi) is defined by weight in kilograms divided by height in meters squared . Four prevalence measures were examined: overweight and obesity combined (bmi 25), obesity (bmi 30), grades 2 and 3 obesity combined (bmi 35), and grade 3 obesity (bmi 40). Age was adjusted by direct standardization to the year 2000 census population using the age groups 2039 years old, 4059 years old, and 60 years and older . Nhanes wave - specific sampling weight, sampling stratum, and primary sampling unit were taken into account in estimating prevalence in the population . Prevalence was estimated for both the overall population and subpopulations stratified by gender and race / ethnicity (i.e., non - hispanic white, non - hispanic african american, and hispanic). Piecewise logistic regressions were used to test the differential trends in adult obesity before and after 2010 . The model has the following setup: (1)logit(yi)=0+1xi+2(xi2010)di+i, di=1{xi2010}. In (1), yi is an indicator variable for overweight and obesity combined (bmi 25), obesity (bmi 30), grades 2 and 3 obesity combined (bmi 35), or grade 3 obesity (bmi 40); xi a continuous variable taking the values of 2000, 2002, 2004, 2006, 2008, 2010, and 2012 for the nhanes waves 1999 - 2000, 2001 - 2002, 2003 - 2004, 2005 - 2006, 2007 - 2008, 2009 - 2010, and 2011 - 2012, respectively; di an indicator variable for xi 2010; and i the error term . If the estimated coefficient 2 is significantly different from zero (equivalent to the estimated odds ratio e to be significantly different from one), piecewise logistic regressions were performed on the overall sample and on each gender and race / ethnicity group, controlling for age group (i.e., 2039 years old, 4059 years old, and 60 years and older) and accounting for survey design . In total, 5,560 adults aged 20 years and older participated in the nhanes 2011 - 2012 wave . Among them, 57 pregnant women and 322 individuals with missing values in body weight / height measures were excluded from the analyses . Nhanes oversamples minorities: 1,364 non - hispanic african americans and 1,037 hispanic were included besides non - hispanic white . Table 2 reports the estimated bmi and prevalence measures among us adults aged 20 years and older in 2011 - 2012 . The age - adjusted mean bmi was 28.5 (95% ci: 28.029.0) among men and 28.8 (28.329.3) among women . Non - hispanic african american women had the highest mean bmi of 32.3 (31.633.0) among all gender and race / ethnicity subgroups . The age - adjusted prevalence of overweight and obesity combined (bmi 25) was 71.1% (68.0%74.2%) among men and 65.5% (61.8%69.3%) among women, and the age - adjusted prevalence of obesity (bmi 30) was 33.3% (30.5%36.2%) among men and 35.8% (32.3%39.4%) among women . Among men, 11.8% (9.7%13.9%) and 4.3% (2.2%6.3%) were classified in grades 2 and 3 obesity combined (bmi 35) and grade 3 obesity (bmi 40), respectively, whereas among women, 16.7% (14.5%8.9%) and 8.0% (6.6%9.5%) were classified in grades 2 and 3 obesity combined and grade 3 obesity, respectively . Women had higher prevalence of obesity, grades 2 and 3 obesity combined, and grade 3 obesity than men (although the differences were not always statistically significant) among all race / ethnicity groups . Non - hispanic african american women had the highest prevalence of overweight and obesity combined (81.5%), obesity (56.4%), grades 2 and 3 obesity combined (28.7%), and grade 3 obesity (15.8%) among all gender and race / ethnicity groups, which were 29%, 73%, 92%, and 122% higher than among non - hispanic white women, respectively . Figure 1 shows the percentage change in prevalence measures among us adults of 20 years and older from 1999 - 2000 to 2011 - 2012 with 1999 - 2000 as the baseline . The age - adjusted prevalence of overweight and obesity combined (bmi 25), obesity (bmi 30), grades 2 and 3 obesity combined (bmi 35), and grade 3 obesity (bmi 40) in 2009 - 2010 were 7.2%, 17.8%, 17.6%, and 33.0% higher than in 1999 - 2000 . Compared to 2009 - 2010, the prevalence measures slightly decreased in 2011 - 2012, but the reductions were not statistically significant at p <0.05 . Figure 2 shows the gender- and race / ethnicity - specific trend in the age - adjusted prevalence of overweight and obesity combined (bmi 25), obesity (bmi 30), grades 2 and 3 obesity combined (bmi 35), and grade 3 obesity (bmi 40) among us adults aged 20 years and older from 1999 - 2000 to 2011 - 2012 . Compared to 2009 - 2010, most gender- and race / ethnicity - specific prevalence measures remained unchanged or slightly decreased in 2011 - 2012, except for the prevalence of overweight and obesity combined among non - hispanic white women, the prevalence of obesity among hispanic men, and all 4 prevalence measures among hispanic women which increased by 1.3 to 3.3 percentage points . None of the changes in gender- and race / ethnicity - specific prevalence measures (24 of them in total) between 2009 - 2010 and 2011 - 2012 were statistically significant at p <0.05 . Table 3 reports the statistical tests for trends in obesity over the 14 years of survey cycles from 1999 to 2012 using piecewise logistic regressions . The coefficients are expressed as annualized odds ratios (ors), denoting the estimated increase per year in the odds of a prevalence measure . A majority of the gender- and race / ethnicity - specific prevalence measures seemed to slightly increase over time (as indicated by the estimated e> 1). For example, the estimated or for the prevalence of obesity (bmi 30) among hispanic women is 1.03 (1.011.04), approximately equivalent to a yearly increase in obesity prevalence of 0.6 percentage points . Nearly all gender- and race / ethnicity - specific prevalence measures appeared to deviate downwards from the increasing trend (as indicated by the estimated e <1) during 20102012, but those changes in trends were not statistically significant at p <0.05 . The rate of increase appeared to slow down since the 2000s and most recent data on childhood obesity even indicated some leveling off . Using a nationally representative sample, this study estimates the obesity prevalence among us adults aged 20 years and older in 2011 - 2012 and tracks its trends from 1999 to 2012 . The main advantage of nhanes relative to other national health surveillance systems such as the brfss and the national health interview survey (nhis) is the objectively measured body weight and height, which eliminates self - report bias . However, the relatively small sample size of nhanes (about 5,000 in every two - year survey cycle, compared to about 0.4 million a year in brfss) limits the precision for population estimates . Unlike brfss or nhis, nhanes moreover, nhanes is a probability sample of the us civilian, noninstitutionalized population, excluding inmates of institutions (e.g., people in penal / mental facilities or homes for the aged, or on active duty in the armed forces). The prevalence measures are based on bmi, a function of weight and height, rather than on body fatness . Although bmi has been found to be closely associated with percentage body fat measured by dual x - ray absorptiometry in the nhanes, these two measures are fundamentally different and their levels of agreement could be a function of gender, age, and race / ethnicity . For instance, percentage body fat was found to be more correlated with bmi in women than men . The relation between percentage body fat and bmi in hispanic american women differed from that of african american and european american women . A thorough investigation on the differential relationship between bmi and body fatness across population groups and the long - term trend of obesity prevalence measured by percentage body fat is beyond the scope of this study but warranted in future research . The growth rate of the obesity epidemic among us adults appears to have slowed down in 2000s, but it is still too early to conclude that it has already reached the plateau and begun to level off . Both figures 1 and 2 showed some decline in the obesity prevalence measures in 2011 - 2012 compared to in 2009 - 2010, but none of the changes were statistically significant . This has also been indicated in the results of piecewise logistic regressions where the null hypotheses on the similarity in trends for prevalence measures before and after 2010 were not rejected . In conclusion, concurrent evidence on the leveling off of the obesity epidemic in the us is thin and the trend is unclear and inconclusive at this time . Given the high prevalence of obesity and its profound socioeconomic consequences, close monitoring of the trend is warranted.
It has been a decade since the spotlight on preventable medical errors first brought much needed attention to the culture of safety in health care organizations . A culture of safety has been defined as the shared values and patterns of behavior that determine the degree to which all organizational members direct their attention and action towards minimizing patient harm . Many healthcare institutions have adopted a culture of safety philosophy as an integral part of their delivery process or service . The perceptions and attitudes of personnel working in an organization about the safety culture are often termed safety climate, and can provide an important indication of the level of its safety culture . Patient safety climate is a multidimensional phenomenon, and important microclimates have been identified such as senior management engagement and leadership [5, 6]. Previously, researchers have found that there are differences in attitudes and perceptions of safety climate among employees in various work areas and members of different disciplines . For example, singer and colleagues reported that emergency department (ed) personnel, particularly ed nurses, perceived substantially lower levels of safety climate than workers in other areas of the hospital . This group also found that the higher up the person is in the organizational hierarchy, the more safe they perceive the climate to be and that these perceptual differences are damaging to improving patient safety . Healthcare - associated infections (hai) are an important patient safety issue . In the past 20 years, the overall incidence of hai has increased by 36%, and the substantial human suffering and financial burden of these infections is staggering . Annually, in the united states, approximately 2 million patients develop an hai, and nearly 90,000 of these patients are estimated to die; this ranks hai as the fifth leading cause of death in acute care hospitals . The centers for disease control and prevention because of the staggering costs and associated morbidity and mortality of this largely preventable problem, there has been a major focus on the reduction of hai internationally . The prevention and control of infections in a hospital is a quality - improvement activity that centers on improving the care of patients and protecting the health of staff [11, 12]; therefore, it would seem essential for there to be strong leadership with common goals in tackling these efforts . With a shift toward prevention and surveillance of hai occurrences, the roles and responsibilities of those working in the field of infection prevention and control are expanding, and infection control professionals are now referred to as infection preventionists (ips). Ips are responsible for directing interventions that protect patients from hai and working with clinicians, staff, and administrators to improve patient- and systems - level outcomes to reduce hai and other related adverse events . Ips vary in educational background, but most have a nursing background [15, 16]. Often, quality directors (qds) are also involved in the prevention of hai . The qd role is often more diverse, but the individual should be familiar with the activities of the ips as well as report to or be part of the senior leadership in the hospital . In terms of supporting the hospital infection program, the quality assurance department may be less responsible for continual monitoring and surveillance of hai and more involved in outbreak investigation and exploring root causes [11, 12]. The present study explored whether patient safety climate varied between two different but essential roles in the prevention of infection and across different hospitals: infection preventionists (ips) and quality directors (qds). The aims of this study were to (1) compare the perceptions of two aspects of patient safety climate between ips and qds in the same hospital, (2) identify setting and role characteristics associated with differences in perceptions of patient safety climates, and (3) identify setting characteristics that predict more positive perceptions of patient safety climates . Given the differences in responsibility and fit in the hierarchy of hospitals, we hypothesize that ips would perceive a lower climate of patient safety compared to qds . This study was an analysis of two cross - sectional surveys conducted simultaneously in the fall of 2008 . Both surveys were conducted to obtain preliminary baseline data on different aspects related to the prevention of hai with the ultimate goal of evaluating the california healthcare - associated infection prevention initiative (chaipi). This statewide initiative was designed to reduce hai using technology and educational sessions for ip personnel . Additionally, hospitals formed an educational collaboration and shared knowledge, successes, and barriers to reducing hai through webinars and meetings . One survey was conducted by columbia university in partnership with the association for professionals in infection control and epidemiology (apic) and targeted ips; the other survey was conducted by researchers at the university of california berkeley, center for health and public policy studies, who surveyed the qds . The ip and qd of all general acute care california hospitals were eligible to participate in their respective surveys . A list of all hospitals licensed to operate in california was obtained from the california office of statewide health planning and development . Specialty hospitals and hospitals in which patients had a mean length of stay of 30 days were excluded . For the ip survey, the eligible hospital list was cross - referenced with apic memberships to identify the ip at each of the hospitals . The ip survey was web based, and respondents were recruited using a modified dillman technique, which included e - mail and mail invitations and reminders, as well as announcements included in regularly scheduled apic communication materials (e.g., newsletters to members). For each qd, a structured, computer - assisted telephone interview was scheduled in advance and conducted with the qd of each hospital . When needed, multiple attempts were made to schedule the interview with each qd . Both surveys included the same two measures of patient safety climate, which were adapted from the patient safety climate in healthcare organizations (pscho). The first measure was the senior management engagement scale, which measured the understanding of current safety issues in their facility, taking supportive action when necessary, and appreciating that frontline care providers are often best qualified to solve patient safety issues (e.g., senior management supports a climate that promotes patient safety). The second measure was the leadership on patient safety scale, defined as the senior executives' ability to articulate values consistent with patient safety and reducing hai (e.g., the senior executives clearly articulate the hospital values relevant to patient safety and hai). Both the senior management engagement and leadership on patient safety scales included 5 items and used a 5-point likert scale (1-strongly disagree to 5-strongly agree). The composite scores for each scale were calculated by summing the responses for each item with higher scores indicating a more positive perception of the safety climate . Cronbach's alphas for each scale were: senior management engagement = .896 for the ips and = .902 for the qds; leadership on patient safety = .931 for the ips and = .863 for the qds . Other data obtained include hospital characteristics (i.e., medical school affiliation, number of beds, and location of hospital urban setting, suburban setting, rural setting), and infection prevention, and control department characteristics (i.e., independent budget of the department, presence of a physician hospital epidemiologist, use of an electronic surveillance system for infection detection, to whom the ip director reports to, ip respondent role, and number of ip fulltime equivalent (fte) staff per 100 beds). Descriptive statistics (i.e., frequencies, means, and standard deviations) were computed on all variables . Single missing items per case on the senior management engagement or the leadership on patient safety scales were imputed . For the first aim, we examined differences in ip and qd perceptions on both the items and composite patient safety microclimate scales using the wilcoxon signed - rank test . To meet the second aim,, we developed a multivariate ordinary least square regression to examine the association between setting characteristics and perceptions of both patient safety scales for both personnel types . The final models included the hospital and infection prevention and control department characteristics that were associated with the scores in univariate analyses with p 0.1 . There were 322 eligible hospitals; 149 hospitals (46.3%) responded to both surveys . Additionally, hospitals were removed from specific analyses if there were two or more missing responses and imputation was not possible . Therefore, the final sample size for the senior management engagement scale was 129 and 132 for the leadership on patient safety scale . Most hospitals were located in an urban setting (42%), followed by suburban (33%) or rural settings (34%). The average bed size of participating facilities was 241 (sd 161, range: 25952). In both the senior management engagement and leadership on patient safety scales, four of five items on each scale were significantly different (table 2). Ips perceived the senior management items more positively than the qds (difference in mean scores ranged from 0.2 to 0.3, all p values 0.05). Additionally, ips' perceptions were more positive than the qds on the senior management engagement composite score (21.4 versus 20.4, p <0.01). The qds' perceptions were more positive than the ips' on the leadership on patient safety items (difference in mean scores ranged 0.2 to 0.3, all p values 0.05); however, there was no difference on the composite score . None of the hospital and infection prevention and control department setting characteristics were significant predictors of the differences between the ips and qds perceptions of either of the safety microclimates . However, the ip respondents' that identified themselves as directors of the infection prevention and control department perceived more positive senior management engagement compared to ip nondirectors (mean 21.8, sd = 3.8 versus mean 20.5, sd = 4.3, p = 0.042). No role characteristics were associated with differences in perceptions on the leadership on patient safety scale . An independent budget for the infection prevention and control department was a significant predictor of more positive perceptions of patient safety in all 4 regressions . The presence of a hospital epidemiologist was also a significant predictor among qds of more positive perceptions on the leadership on patient safety scale . The number of hospital beds predicted more positive perceptions among qds on both scales . When entered into multivariate linear regression (table 4), having an independent budget remained the only statistically significant predictor of a high score for both ips and qds on both scales in each of the four regression models . This study examined the perceptions of two important patient safety microclimates from two different hospital personnel roles engaged in patient safety involving the prevention of infections . We found that ips and qds in the same hospital varied in their perceptions across the two patient safety climate scales . Our hypothesis that ips would perceive a lower climate of patient safety compared to qds was supported in only one of the microclimates . Generally, ips had more positive perceptions of senior management engagement and the qds had more positive perceptions of leadership on patient safety . We also found that having an independent budget for the infection prevention program was the only significant predictor of these microclimates . One reason for the differences in perceptions by personnel may be the measures of the microclimates themselves . For example, the items in the leadership on patient safety scale were more tailored to hais . While ips are generally involved with overall quality and patient safety, their primary role and interest is in prevention and control of infections . This could explain why the ips may have more negative perceptions about the way hospital executives handle improvements in infection prevention and control . This may also be due to the senior management scale being less tailored to infection prevention . Although there were no setting characteristics that were significant predictors of differences between ips and qds, ips who were directors of their departments perceived the senior management engagement more positively than ips who were not directors . In a study of personnel in 92 hospitals, singer and colleagues found differences in perceptions of safety climate by both role (i.e., senior management, supervisor, and front line worker) and by discipline (i.e., physician, nurse, other clinician and nonclinician). Similar to our findings, these researchers found that senior managers perceived fewer problems with senior management engagement than front line workers . However, another group of researchers found that leadership played a key role in infection prevention and that the most important leaders were not the senior executives traditionally associated with the term leader . They found several examples of hospital epidemiologists, nurses, quality managers, and infection preventionists who played vital roles in their hospital's patient safety activities . Finding ways to empower all ips to be leaders in patient safety is likely to be an important factor in reducing infections . Another key finding of our study is that budget was an important predictor of more positive perceptions of patient safety climates . Having an independent budget for the infection prevention and control department may allow for more autonomy and development of infrastructure to promote patient safety . According to a policy brief by pronovost, efforts are being made at johns hopkins hospital to improve the safety culture by investing resources to monitor the rate - based measures of quality and safety, nearly all of which are required by the centers for medicaid and medicare services (cms), the joint commission, or insurers . These authors noted that fulfilling a commitment to safe and high - quality care is not possible without significant investment in patient safety infrastructure . Results from their study confirmed that hospitals with greater financial and organizational resources are more capable of promoting the activities required for patient safety and infection control . As with any research, this study has both strengths and limitations . Using well - developed psychometrically tested measures of safety climate is a strength . In terms of internal validity, it is known that the survey mode can make a difference in responses, and in several studies researchers have found that telephone respondents answer questions more positively than do mail respondents [18, 23, 24]. Additionally, in a study by christian et al ., telephone respondents gave significantly more positive answers than did web respondents for various kinds of scale questions . However, the fact that the qds, who completed the survey via computer - assisted telephone, scored higher on one scale and not the other provides some evidence that it was unlikely that there was bias due to survey method . This was a cross sectional study, and only associations may be examined, not causation . Both surveys were conducted in the fall of 2008 . At the time the surveys were conducted, california hospitals were preparing for mandatory reporting of hai to the state's health department, and the cms policy on lack of reimbursement for hospital - acquired conditions (including many types of infections) was just being implemented . Therefore, these results may not be generalizable to other hospitals outside california . Our response rate is typical of multisite surveys of hospital personnel, which often have response rates in the range from 40 to 50 percent . Further analyses are needed to examine how these differences in climate impact the processes of care and patient outcomes . Although there have been many efforts to curb the increase in hai, it is clear that this preventable issue is slow to improve . This study represents an advance over previous studies on the relationship between safety climate and personnel perceptions by examining those leaders who are essential to the prevention of hais in acute health care settings . It also provides a solid basis for subsequent research on decreasing the gap in perceptions between these two personnel types . Given the finding that there are differences in perceptions among essential leaders, this discord could be an inhibition toward achieving the goal of decreased hais . It is essential for those personnel in leadership to work collaboratively in order to not only enhance health care environments but also make it safer for patients . This paper also highlights the importance of independently supporting the infection prevention and control department in order to optimize the safety climate.
Endoscopic techniques that allow visualization of the airways of patients with pulmonary maladies have become a mainstay of medical treatment . Since the invention of the rigid bronchoscope in 1897 by gustav killian, along with its refinement by chevalier jackson in the early 20 century, and shigeto ikeda's introduction of the flexible bronchoscope in 1967; these instruments have become important clinical assets in the armamentarium of surgeons, intensivists, and pulmonologists . Bronchoscopy, both fiberoptic and rigid, encompasses a number of diagnostic and therapeutic techniques to visualize the luminal surface of the trachea and proximal airways . Flexible or fiberoptic bronchoscopy, allows for excellent visualization of the airway lumen and luminal surface including segmental and subsegmental bronchi with a relatively less traumatic instrument; rigid bronchoscopy enables more therapeutic options but is limited to the trachea and main bronchi unless combined with a fiberoptic bronchoscope . Bronchoscopy has become an important tool not only for visualizing abnormalities, but also for biopsy / tissue sampling, removal of secretions, mucous plugs, clots, and foreign bodies . More recent advances include stent placement for relief of airway compression, laser applications (tumor resection), curtailing hemorrhage (using cryocoagulation / cryotherapy), assisting in the placement of percutaneous tracheostomies, and securing the airway through facilitation of endotracheal tube placement . Traditionally, complications of bronchoscopy were labeled minor, major / severe, or fatal . We discuss complications of both flexible and rigid bronchoscopy, categorizing them as mechanical or systemic for improved clarity . Since its introduction in the 1960s, published rates of complication from fiberoptic bronchoscopy have ranged from <0.1 to 11%, with mortality generally reported between 0 and 0.1% . Complications of fiberoptic bronchoscopy mechanical complications of fiberoptic bronchoscopy include oro- or nasopharyngeal, vocal cord, and airway trauma as well as bronchospasm, laryngospasm, pulmonary derecruitment / atelectasis, pneumothorax, airway hemorrhage, and introduction or exacerbation of infection . In general, the rates of mechanical complications have been, and continue to be, quite low . The most consistently reported mechanical complications are related to airway manipulation / trauma and bleeding . A number of questionnaire - based, cross - sectional studies in the 1970s examined the reported rates of complications . A survey sent to 1,041 physicians who performed bronchoscopy reported 12 deaths in 48,000 cases, none of which were related to direct mechanical airway trauma and only two of which were associated with pneumonia (both cases of pneumonia preceded the bronchoscopy). Other mechanical complications included four brushes breaking off in the bronchi, at least one of which required thoracotomy, and 52 episodes of life - threatening airway complications (most commonly bronchospasm). Lindholm et al ., examined airway pressures of patients undergoing fiberoptic bronchoscopy and found that while spontaneously breathing patients had little change in airway pressures (average of 5.2 cm h2o during inhalation and + 3.5 cm h2o during exhalation), intubated patients had a much wider range (as low as 35 cm h2o during inhalation and higher than + 35 cm h2o during exhalation). This is most likely a combination of the small cross - sectional area remaining in the endotracheal tube, while a fiberoptic bronchoscope is in place, combined with dyssynchronous breathing from the patient . The pattern of these pressure changes leads to a decrease in vital capacity (as tidal volume is restricted by high pressures and is lost via bronchoscopic suction), and a decrease in forced expiratory volume secondary to obstructed exhalation, which increases auto - positive end - expiratory pressure (peep) and functional residual capacity (frc). This increase in auto - peep and frc may actually protect against hypoxemia, particularly if the patient is breathing 100% oxygen, although following removal of the bronchoscope the peep and frc will decrease, at this point atelectasis, bronchospasm, and laryngospasm may all lead to post - procedural hypoxemia unless treated promptly . Prolonged suctioning during bronchoscopy can lead to further derecruitment and atelectasis, as well as worsening of post - procedural hypoxemia . Despite these physiologic derangements, mechanical rates of pulmonary complications remain low with rates of pneumothorax from 0.07 to 0.16%, and respiratory failure from 0.2 to 0.31% in more recent studies . Rates of more minor pulmonary mechanical complications including bronchospasm and laryngospasm range from 0.26 to 2% ., also called attention to the variability in cleaning practices of fiberoptic bronchoscopes ranging from water or saline only, to meat tenderizer, to alcohol, yet the rate of pneumonia (as reported) was remarkably low . This was confirmed by credle et al ., who reported only two instances of pneumonia in 24,521 procedures . Kovaleva et al ., demonstrated that pseudomonas aeruginosa is the most commonly transmitted organism by an improperly cleaned bronchoscope, most likely secondary to its ability to form biofilm in the bronchoscope channels . Infection can also be introduced from the oro- or nasopharynx into the lower respiratory tract (as well as from an infected to a non - infected area of the lung). Pharyngeal microbes are most common in this scenario: streptococcus, staphylococcus, moraxella, neisseria, and anaerobic bacteria . A prospective observational study of 13 hospitals confirmed a low reported rate of pneumonia as 0.6% (five of 908 procedures) in fiberoptic bronchoscopy . The expectation is that with modern, standard cleaning of bronchoscopes, and use of sterile technique where possible that these rates are even lower today . Traditionally, bronchoscopic hemorrhage was thought to be frequently fatal and associated with large tumors . Dedicated prospective data did not identify any cases of hemorrhage requiring transfusion, but did report bleeding in 0.7% (six of 908) cases . Those with preexisting bleeding disorders were not overrepresented among those patients with bleeding complications; this suggests bleeding was likely mechanical and not coagulopathic . Hemorrhagic complications were significantly higher in patients who had transbronchial biopsies, a trend that has persisted over decades . Rates of bleeding were higher (2%) in a prospective analysis of 205 cases in a teaching hospital, which could be attributed to the majority of operators being trainees, higher rates of interventional procedures (biopsies), the specific patient population of the teaching hospital, or the use of more detailed outcome measurements (i. e., underreporting in prior studies). For example, hemorrhage was specifically quantified as> 40 ml within 15 min or> 200 ml within 24 h of the procedure . Two decades later, a retrospective review demonstrated markedly lower rates of complications in a large academic medical center . Hemorrhage (> 50 ml) occurred in only five (0.12%) out of 4,273 cases of fiberoptic bronchoscopy, with only one requiring intubation, and an unrelated single case (0.02%) of epistaxis . These results were confirmed in a greek study in 2008 that demonstrated a rate of 0.17% of pulmonary hemorrhage (> 50 ml). Systemic complications are primarily related to the procedure itself, medication administration, or patient comorbidities . Systemic complications related to the procedure included vasovagal syncope, nausea / vomiting, aspiration, and hypoxemia . Complications related to medications can be anesthetic or sedation - related, as well as procedural - medication related (e. g., local anesthetics, glycopyrrolate). Finally, comorbidities including myocardial dysfunction, pulmonary insufficiency, or special cases such as increased icp can predispose to unique complications . Initial rates of systemic complications varied widely based on reporting . In 1978, pereira et al ., reported a 2.4% incidence of vasovasal reaction, and 0.2% nausea and vomiting . These rates were significantly decreased by 1995 where pue and pacht demonstrated a 0.05% incidence of vasovagal syncope and 0.1% incidence of vomiting . Rates of aspiration are inconsistently reported across all studies likely reflecting the difficulty in making the diagnosis unless frank aspiration is observed . This class of complication is also likely intimately tied to the type and amount of sedation received by the patient . A cross - sectional study by simpson et al ., demonstrated wide variability in sedation practices at that time . As early as the 1970s, cases of death related to both sedation and local anesthetics were reported surrounding fiberoptic bronchoscopy . Subsequently, no cases of sedation - related morbidity or local anesthetic toxicity were reported by pue and pacht in the 1995 study . They attributed their lower rate of complications to close monitoring (including pulse oximetry) and immediate availability of resuscitation equipment . It may be that standardization of sedation practices and the use of supplemental oxygenation also played a role in the decrease in sedation and anesthesia - related morbidity and mortality . During the initial decade of fiberoptic bronchoscopy myocardial infarction was associated with 33% of deaths, with another 17% related to preexisting pulmonary disease (pneumonia and emphysema) and another one of 12 patient deaths reported as being in extremis before the procedure . It has been reported that heart rate, blood pressure, and cardiac output all increase during fiberoptic bronchoscopy, and that increases in myocardial oxygen demand may induce arrhythmias or ischemia in at - risk patients . Rates of st changes during fiberoptic bronchoscopy have been reported as high as 17% (for patients over age 50), but severe arrhythmias are cited less than 0.1% of the time . More difficult to quantify is the effect of bronchoscopy on patients with preexisting pulmonary disease (often the indication for the procedure). Pulmonary - related deaths from fiberoptic bronchoscopy are almost always related to the intersection of underlying disease (large tumor and pneumonia) and the stress of the procedure itself . Increased airway pressures may be transmitted to the thoracic space and therefore raise intracranial pressure (icp) (raising both systolic blood pressure and impairing venous return). However, the data on high extrinsic peep does not reliably show an increase in icp . A series of 26 fiberoptic bronchoscopies performed in patients with icp monitors demonstrated an increase in icp in 81% of cases, however the mean arterial pressure also increased leading to a normal cerebral perfusion pressure in all cases, and no cases had neurologic sequelae . It is therefore common practice not to withhold fiberoptic bronchoscopy in patients with elevated icp when the procedure is indicated, but to use sedation and paralysis if necessary to attempt to mitigate the increase in icp in unstable patients . Complication rates from comorbid disease have fallen dramatically over time, which is likely attributable to improved monitoring and early intervention, as well as patient selection . Furthermore, the incidence of complications is similar for patients in the bronchoscopy suite and the intensive care unit, indicating that fiberoptic bronchoscopy can be performed safely even in the sickest patients regardless of location . However, it is important to note that the rate of minor complications such as hypoxemia and nonmalignant arrhythmia is significantly higher in the icu population, so vigilance is paramount . Nonetheless, flexible bronchoscopy has improved its capabilities by introducing enhancements that not only help in diagnosing malignancies, but also identifying areas of premalignancy [figure 1]. These improvements include endobronchial ultrasound, electromagnetic navigation, autofluorescence bronchoscopy, narrow - band imaging, and confocal fluorescence microscopy . It is a support adjunct to help guide the site of tracheal puncture entry of the tracheostomy, and to avoid damage to the posterior wall of the trachea . However, this function of fiberoptic bronchoscopy is being challenged by the use of ultrasound . Advances in equipment, monitoring techniques, and anesthetic medications continue to improve the margin of safety and make this procedure widely applicable . Schematic diagram of flexible bronchoscope design demonstrating multiple changes that lend to its efficiency and value to the operator (source: kovaleva et al .) The technique of rigid bronchoscopy was pioneered by gustav killian in 1876 when he used an esophagoscope to remove a pork bone from a patient's airway, thus preventing a tracheostomy . The rigid bronchoscope was improved upon by chevalier jackson in the early 20 century . Though the invention of the flexible fiberoptic bronchoscope by ikeda in 1967 changed the field of bronchoscopy, the use of the rigid bronchoscope remains an important technique in the management of upper airway disease . In adults, the primary indications for using the rigid scope are central airway obstruction secondary to neoplastic and nonneoplastic pathologies, massive hemoptysis, mucus plugging, and blood clot removal, as well as foreign bodies . There has been an expanding interest in the management of central airway obstruction by pulmonologists and this has led to a renewed interest in rigid bronchoscopy . More than just treating cancer - related central airway obstruction mechanically, rigid bronchoscopy also makes possible a number of therapies such as laser / photoresection, endobronchial stents, balloon dilation, electrocautery, use of the argon beam, and cryotherapy . The wide channel of the rigid bronchoscope lends itself to easier removal of foreign bodies from the airway and debulking of masses, easier control of hemorrhage during therapeutic interventions in the trachea and mainstem bronchi, as well as easier dilation of proximal airways, and easier deployment of stents and other airway implantables, all while allowing for relative ease of ventilation . Despite the multitude of indications and procedures: sex, age, and the aim of the procedure are not associated with complications . Unlike fiberoptic bronchoscopy, rigid bronchoscopy is performed in the operating room under general anesthesia . Performing rigid bronchoscopy under general anesthesia adds the potential complication of proceduralist and anesthesiologist sharing the airway but also adds a degree of safety by allowing the proceduralist to focus on airway intervention, while the anesthesiologist prevents and manages mechanical and systemic complications as they arise . Here the anesthesiologists, with the bronchoscope operator, need to navigate the multiple approaches to airway management, such as apneic oxygenation, spontaneous ventilation (assisted or otherwise), controlled mechanical ventilation, high frequency, and manual jet ventilation . Relative contraindications to rigid bronchoscopy include uncontrolled coagulopathy, oxygenation, and ventilator demands that are at the clinical extremes, especially in the hands of an inexperienced operator . The type and rate of complications of rigid bronchoscopy are similar to those of flexible fiberoptic bronchoscopy and can likewise be divided into mechanical and systemic complications . Complications of rigid bronchoscopy the most common mechanical complications of rigid bronchoscopy are trauma to the teeth, oropharynx, vocal cords or other glottic structures, laryngospasm, pneumothorax, and hemorrhage, and death . Systemic complications include vasovagal syncope, hypoxemia, hypercarbia, medication effects of general anesthesia, arrhythmia, post - procedural respiratory failure, and death . It should be noted that there are relatively few prospective studies providing quantifiable complication rates during and after rigid bronchoscopy, so the true rate of complications resulting from the procedure is difficult to pinpoint and will vary by operator experience and institution . However, advances in equipment, monitoring, and anesthetic drugs have increased the overall margin of safety for rigid bronchoscopy . One retrospective study reviewed 775 cases of rigid bronchoscopy in a university hospital between 1992 and 1999 and found that 86.7% of cases occurred without any of the above listed complications . In this study 103/775 (13.3%) of cases had complications, which included bleeding (6.6%), respiratory failure (5.3%), cough (0.6%), death (0.4%), and arrhythmia (0.3%). Furthermore, rigid bronchoscopy seems to be safe to use in neurosurgery patients with space - occupying lesions . Another notable retrospective study compared the complication rate of flexible fiberoptic bronchoscopy under topical anesthesia with the complication rate of rigid bronchoscopy under general anesthesia . Lukomsky et al ., reviewed 3,449 rigid bronchoscopy procedures and complications associated with rigid bronchoscopy occurred in 173 of 3,449 cases (5%); four rigid bronchoscope cases were complicated by pneumothorax [figure 2] and six cases were complicated by death (four due to hypoxia) resulting in a fatality rate of 0.17% . Post - bronchoscopy pneumothorax (r) (source: author file; tjp) one underreported complication during rigid bronchoscopy with laser is airway fire [figure 3]. With advances in technology, laser can now be used through flexible fiberoptic bronchoscopes, rigid bronchoscopes, during esophagoscopy, and during suspension microlaryngoscopy . Due to this variety of applications, most reports of the incidence of airway fire are not specific to rigid bronchoscopy . In order to ensure the highest margin of safety in preventing airway fire, good communication must exist between the anesthesiologist and proceduralist, and the concentration of inhaled oxygen when the laser is in use should be <40% . Standard precautions should be adhered to during laser airway procedures, especially when flammable objects (stents and endotracheal tubes) are also present in the airway . Sparking that may lead to airway fire (source: google images) as dutau et al ., have summarized; (i) rigid bronchoscopy is preferred clinical tool for the majority of therapeutic pulmonary interventions, (ii) this tool has a dual use in that it can be used for visualization of pathology / tumors and for interventions, (iii) extensive training is need before it can be deployed by a practitioner, (iv) it is mandatory for use in stenting of the airway and with the use of silicone stents (being reasonably minimally invasive), (v) can occasionally represent a bridge to definitive surgical management, and (vi) when surgery is not possible due to a patient's condition, rigid bronchoscopy can be used for palliative interventions . The rigid bronchoscope has had several new innovations that enhance patient safety and better facilitate its use for the practitioner . For example, the bryan - dumon ii rigid bronchoscope has an operator head with a universal instrumentation barrel . The operator head can be used on any dumon series color - coded tracheal and bronchial scope (on the proximal end of the scope). The texas rigid integrated (by wolff) bronchoscope enables the operator to access a larger working area without visual interruption with the availability of separate channels for instruments and optics . While oxygen saturation is fairly easy to maintain with larger bronchoscopes, monitoring fio2, minute ventilation, and airway pressures remain difficult to monitor, which can lead to hyperinflation and pneumothorax . The herner bronchoscope (by wolff) has a sampling / measuring port that allows monitoring of carbon dioxide, oxygen, and airway pressures . The expectation exists that technologic innovation will continue to improve the safety and efficacy of the rigid bronchoscope . The skilled and mature operator has fewer complications than novices, nonetheless, it is very safe even in the hands of trainees . However, the operator needs to be cognizant of methods to attenuate any bleeding complications . At the time of hemorrhage the nonbleeding lung must be protected . Whether the patient is intubated or not, the patient should be positioned with the bleeding lung in the decubitus, dependent position (if hemodynamics permit), and if necessary, a double lumen tube will have to be placed in the nonbleeding lung (this will require special skills). Other methods of bleeding control include the instillation of cooled saline into the bronchus and then clamping the bronchus with the fiberoptic scope tip . If this does not work then 5 ml of thrombin may be instilled (5,000 u dissolve in saline), or, alternately, 2 ml of 1:1,000 epinephrine mixed with normal saline in a 1:10 mixture in order to produce vasoconstriction, thereby reducing bleeding (no more than three 2-ml aliquots are recommended). There has also been use of tranexamic acid with significant airway bleeding, and even activated factor vii has been instilled into the lungs with successful resolution of bleeding (author tjp, case to be published). Sometimes there are large thrombi that can block the airways once the bleeding stops, and these may need to be removed with cryotherapy, which has been in use for over 30 years [figure 5]. It is also important during an episode of bleeding to have good visualization of the airways and the source of bleeding . Usually the scope's removal for manual cleaning to visualize the field is rarely needed, and only is necessary in the face of massive hemorrhage . In less than dire circumstances, the scope tip can be cleaned by gently rubbing it vertically against the mucosa of the cartilaginous part of the tracheal wall . If this maneuver does not clear the operator's vision, then place the scope as described above against the tracheal wall and flush the operating port vigorously . Bleeding airway after biopsy (source: google images) clot in bronchus that has been subjected to cryotherapy and removed (source: author file; tjp) since its introduction in the 1960s, published rates of complication from fiberoptic bronchoscopy have ranged from <0.1 to 11%, with mortality generally reported between 0 and 0.1% . Complications of fiberoptic bronchoscopy mechanical complications of fiberoptic bronchoscopy include oro- or nasopharyngeal, vocal cord, and airway trauma as well as bronchospasm, laryngospasm, pulmonary derecruitment / atelectasis, pneumothorax, airway hemorrhage, and introduction or exacerbation of infection . In general, the rates of mechanical complications have been, and continue to be, quite low . The most consistently reported mechanical complications are related to airway manipulation / trauma and bleeding . A number of questionnaire - based, cross - sectional studies in the 1970s examined the reported rates of complications . A survey sent to 1,041 physicians who performed bronchoscopy reported 12 deaths in 48,000 cases, none of which were related to direct mechanical airway trauma and only two of which were associated with pneumonia (both cases of pneumonia preceded the bronchoscopy). Other mechanical complications included four brushes breaking off in the bronchi, at least one of which required thoracotomy, and 52 episodes of life - threatening airway complications (most commonly bronchospasm). Lindholm et al ., examined airway pressures of patients undergoing fiberoptic bronchoscopy and found that while spontaneously breathing patients had little change in airway pressures (average of 5.2 cm h2o during inhalation and + 3.5 cm h2o during exhalation), intubated patients had a much wider range (as low as 35 cm h2o during inhalation and higher than + 35 cm h2o during exhalation). This is most likely a combination of the small cross - sectional area remaining in the endotracheal tube, while a fiberoptic bronchoscope is in place, combined with dyssynchronous breathing from the patient . The pattern of these pressure changes leads to a decrease in vital capacity (as tidal volume is restricted by high pressures and is lost via bronchoscopic suction), and a decrease in forced expiratory volume secondary to obstructed exhalation, which increases auto - positive end - expiratory pressure (peep) and functional residual capacity (frc). This increase in auto - peep and frc may actually protect against hypoxemia, particularly if the patient is breathing 100% oxygen, although following removal of the bronchoscope the peep and frc will decrease, at this point atelectasis, bronchospasm, and laryngospasm may all lead to post - procedural hypoxemia unless treated promptly . Prolonged suctioning during bronchoscopy can lead to further derecruitment and atelectasis, as well as worsening of post - procedural hypoxemia . Despite these physiologic derangements, mechanical rates of pulmonary complications remain low with rates of pneumothorax from 0.07 to 0.16%, and respiratory failure from 0.2 to 0.31% in more recent studies . Rates of more minor pulmonary mechanical complications including bronchospasm and laryngospasm range from 0.26 to 2% . The cross - sectional study from suratt et al ., also called attention to the variability in cleaning practices of fiberoptic bronchoscopes ranging from water or saline only, to meat tenderizer, to alcohol, yet the rate of pneumonia (as reported) was remarkably low . This was confirmed by credle et al ., who reported only two instances of pneumonia in 24,521 procedures . Kovaleva et al ., demonstrated that pseudomonas aeruginosa is the most commonly transmitted organism by an improperly cleaned bronchoscope, most likely secondary to its ability to form biofilm in the bronchoscope channels . Infection can also be introduced from the oro- or nasopharynx into the lower respiratory tract (as well as from an infected to a non - infected area of the lung). Pharyngeal microbes are most common in this scenario: streptococcus, staphylococcus, moraxella, neisseria, and anaerobic bacteria . A prospective observational study of 13 hospitals confirmed a low reported rate of pneumonia as 0.6% (five of 908 procedures) in fiberoptic bronchoscopy . The expectation is that with modern, standard cleaning of bronchoscopes, and use of sterile technique where possible that these rates are even lower today . Traditionally, bronchoscopic hemorrhage was thought to be frequently fatal and associated with large tumors . Dedicated prospective data did not identify any cases of hemorrhage requiring transfusion, but did report bleeding in 0.7% (six of 908) cases . Those with preexisting bleeding disorders were not overrepresented among those patients with bleeding complications hemorrhagic complications were significantly higher in patients who had transbronchial biopsies, a trend that has persisted over decades . Rates of bleeding were higher (2%) in a prospective analysis of 205 cases in a teaching hospital, which could be attributed to the majority of operators being trainees, higher rates of interventional procedures (biopsies), the specific patient population of the teaching hospital, or the use of more detailed outcome measurements (i. e., underreporting in prior studies). For example, hemorrhage was specifically quantified as> 40 ml within 15 min or> 200 ml within 24 h of the procedure . Two decades later, a retrospective review demonstrated markedly lower rates of complications in a large academic medical center . Hemorrhage (> 50 ml) occurred in only five (0.12%) out of 4,273 cases of fiberoptic bronchoscopy, with only one requiring intubation, and an unrelated single case (0.02%) of epistaxis . These results were confirmed in a greek study in 2008 that demonstrated a rate of 0.17% of pulmonary hemorrhage (> 50 ml). Systemic complications are primarily related to the procedure itself, medication administration, or patient comorbidities . Systemic complications related to the procedure included vasovagal syncope, nausea / vomiting, aspiration, and hypoxemia . Complications related to medications can be anesthetic or sedation - related, as well as procedural - medication related (e. g., local anesthetics, glycopyrrolate). Finally, comorbidities including myocardial dysfunction, pulmonary insufficiency, or special cases such as increased icp can predispose to unique complications . Initial rates of systemic complications varied widely based on reporting . In 1978, pereira et al . These rates were significantly decreased by 1995 where pue and pacht demonstrated a 0.05% incidence of vasovagal syncope and 0.1% incidence of vomiting . Rates of aspiration are inconsistently reported across all studies likely reflecting the difficulty in making the diagnosis unless frank aspiration is observed . This class of complication is also likely intimately tied to the type and amount of sedation received by the patient . A cross - sectional study by simpson et al ., demonstrated wide variability in sedation practices at that time . As early as the 1970s, cases of death related to both sedation and local anesthetics were reported surrounding fiberoptic bronchoscopy . Subsequently, no cases of sedation - related morbidity or local anesthetic toxicity were reported by pue and pacht in the 1995 study . They attributed their lower rate of complications to close monitoring (including pulse oximetry) and immediate availability of resuscitation equipment . It may be that standardization of sedation practices and the use of supplemental oxygenation also played a role in the decrease in sedation and anesthesia - related morbidity and mortality . During the initial decade of fiberoptic bronchoscopy myocardial infarction was associated with 33% of deaths, with another 17% related to preexisting pulmonary disease (pneumonia and emphysema) and another one of 12 patient deaths reported as being in extremis before the procedure . It has been reported that heart rate, blood pressure, and cardiac output all increase during fiberoptic bronchoscopy, and that increases in myocardial oxygen demand may induce arrhythmias or ischemia in at - risk patients . Rates of st changes during fiberoptic bronchoscopy have been reported as high as 17% (for patients over age 50), but severe arrhythmias are cited less than 0.1% of the time . More difficult to quantify is the effect of bronchoscopy on patients with preexisting pulmonary disease (often the indication for the procedure). Pulmonary - related deaths from fiberoptic bronchoscopy are almost always related to the intersection of underlying disease (large tumor and pneumonia) and the stress of the procedure itself . . Increased airway pressures may be transmitted to the thoracic space and therefore raise intracranial pressure (icp) (raising both systolic blood pressure and impairing venous return). However, the data on high extrinsic peep does not reliably show an increase in icp . A series of 26 fiberoptic bronchoscopies performed in patients with icp monitors demonstrated an increase in icp in 81% of cases, however the mean arterial pressure also increased leading to a normal cerebral perfusion pressure in all cases, and no cases had neurologic sequelae . It is therefore common practice not to withhold fiberoptic bronchoscopy in patients with elevated icp when the procedure is indicated, but to use sedation and paralysis if necessary to attempt to mitigate the increase in icp in unstable patients . Complication rates from comorbid disease have fallen dramatically over time, which is likely attributable to improved monitoring and early intervention, as well as patient selection . Furthermore, the incidence of complications is similar for patients in the bronchoscopy suite and the intensive care unit, indicating that fiberoptic bronchoscopy can be performed safely even in the sickest patients regardless of location . However, it is important to note that the rate of minor complications such as hypoxemia and nonmalignant arrhythmia is significantly higher in the icu population, so vigilance is paramount . Nonetheless, flexible bronchoscopy has improved its capabilities by introducing enhancements that not only help in diagnosing malignancies, but also identifying areas of premalignancy [figure 1]. These improvements include endobronchial ultrasound, electromagnetic navigation, autofluorescence bronchoscopy, narrow - band imaging, and confocal fluorescence microscopy . It is a support adjunct to help guide the site of tracheal puncture entry of the tracheostomy, and to avoid damage to the posterior wall of the trachea . However, this function of fiberoptic bronchoscopy is being challenged by the use of ultrasound . Advances in equipment, monitoring techniques, and anesthetic medications continue to improve the margin of safety and make this procedure widely applicable . Schematic diagram of flexible bronchoscope design demonstrating multiple changes that lend to its efficiency and value to the operator (source: kovaleva et al .) The technique of rigid bronchoscopy was pioneered by gustav killian in 1876 when he used an esophagoscope to remove a pork bone from a patient's airway, thus preventing a tracheostomy . The rigid bronchoscope was improved upon by chevalier jackson in the early 20 century . Though the invention of the flexible fiberoptic bronchoscope by ikeda in 1967 changed the field of bronchoscopy, the use of the rigid bronchoscope remains an important technique in the management of upper airway disease . In adults, the primary indications for using the rigid scope are central airway obstruction secondary to neoplastic and nonneoplastic pathologies, massive hemoptysis, mucus plugging, and blood clot removal, as well as foreign bodies . There has been an expanding interest in the management of central airway obstruction by pulmonologists and this has led to a renewed interest in rigid bronchoscopy . More than just treating cancer - related central airway obstruction mechanically, rigid bronchoscopy also makes possible a number of therapies such as laser / photoresection, endobronchial stents, balloon dilation, electrocautery, use of the argon beam, and cryotherapy . The wide channel of the rigid bronchoscope lends itself to easier removal of foreign bodies from the airway and debulking of masses, easier control of hemorrhage during therapeutic interventions in the trachea and mainstem bronchi, as well as easier dilation of proximal airways, and easier deployment of stents and other airway implantables, all while allowing for relative ease of ventilation . Despite the multitude of indications and procedures: sex, age, and the aim of the procedure are not associated with complications . Unlike fiberoptic bronchoscopy, rigid bronchoscopy is performed in the operating room under general anesthesia . Performing rigid bronchoscopy under general anesthesia adds the potential complication of proceduralist and anesthesiologist sharing the airway but also adds a degree of safety by allowing the proceduralist to focus on airway intervention, while the anesthesiologist prevents and manages mechanical and systemic complications as they arise . Here the anesthesiologists, with the bronchoscope operator, need to navigate the multiple approaches to airway management, such as apneic oxygenation, spontaneous ventilation (assisted or otherwise), controlled mechanical ventilation, high frequency, and manual jet ventilation . Relative contraindications to rigid bronchoscopy include uncontrolled coagulopathy, oxygenation, and ventilator demands that are at the clinical extremes, especially in the hands of an inexperienced operator . The type and rate of complications of rigid bronchoscopy are similar to those of flexible fiberoptic bronchoscopy and can likewise be divided into mechanical and systemic complications . . Complications of rigid bronchoscopy the most common mechanical complications of rigid bronchoscopy are trauma to the teeth, oropharynx, vocal cords or other glottic structures, laryngospasm, pneumothorax, and hemorrhage, and death . Systemic complications include vasovagal syncope, hypoxemia, hypercarbia, medication effects of general anesthesia, arrhythmia, post - procedural respiratory failure, and death . It should be noted that there are relatively few prospective studies providing quantifiable complication rates during and after rigid bronchoscopy, so the true rate of complications resulting from the procedure is difficult to pinpoint and will vary by operator experience and institution . However, advances in equipment, monitoring, and anesthetic drugs have increased the overall margin of safety for rigid bronchoscopy . One retrospective study reviewed 775 cases of rigid bronchoscopy in a university hospital between 1992 and 1999 and found that 86.7% of cases occurred without any of the above listed complications . In this study 103/775 (13.3%) of cases had complications, which included bleeding (6.6%), respiratory failure (5.3%), cough (0.6%), death (0.4%), and arrhythmia (0.3%). Furthermore, rigid bronchoscopy seems to be safe to use in neurosurgery patients with space - occupying lesions . Another notable retrospective study compared the complication rate of flexible fiberoptic bronchoscopy under topical anesthesia with the complication rate of rigid bronchoscopy under general anesthesia . Lukomsky et al ., reviewed 3,449 rigid bronchoscopy procedures and complications associated with rigid bronchoscopy occurred in 173 of 3,449 cases (5%); four rigid bronchoscope cases were complicated by pneumothorax [figure 2] and six cases were complicated by death (four due to hypoxia) resulting in a fatality rate of 0.17% . One underreported complication during rigid bronchoscopy with laser is airway fire [figure 3]. With advances in technology, laser can now be used through flexible fiberoptic bronchoscopes, rigid bronchoscopes, during esophagoscopy, and during suspension microlaryngoscopy . Due to this variety of applications, most reports of the incidence of airway fire are not specific to rigid bronchoscopy . In order to ensure the highest margin of safety in preventing airway fire, good communication must exist between the anesthesiologist and proceduralist, and the concentration of inhaled oxygen when the laser is in use should be <40% . Standard precautions should be adhered to during laser airway procedures, especially when flammable objects (stents and endotracheal tubes) are also present in the airway . Sparking that may lead to airway fire (source: google images) as dutau et al ., have summarized; (i) rigid bronchoscopy is preferred clinical tool for the majority of therapeutic pulmonary interventions, (ii) this tool has a dual use in that it can be used for visualization of pathology / tumors and for interventions, (iii) extensive training is need before it can be deployed by a practitioner, (iv) it is mandatory for use in stenting of the airway and with the use of silicone stents (being reasonably minimally invasive), (v) can occasionally represent a bridge to definitive surgical management, and (vi) when surgery is not possible due to a patient's condition, rigid bronchoscopy can be used for palliative interventions . The rigid bronchoscope has had several new innovations that enhance patient safety and better facilitate its use for the practitioner . For example, the bryan - dumon ii rigid bronchoscope has an operator head with a universal instrumentation barrel . The operator head can be used on any dumon series color - coded tracheal and bronchial scope (on the proximal end of the scope). The texas rigid integrated (by wolff) bronchoscope enables the operator to access a larger working area without visual interruption with the availability of separate channels for instruments and optics . While oxygen saturation is fairly easy to maintain with larger bronchoscopes, monitoring fio2, minute ventilation, and airway pressures remain difficult to monitor, which can lead to hyperinflation and pneumothorax . The herner bronchoscope (by wolff) has a sampling / measuring port that allows monitoring of carbon dioxide, oxygen, and airway pressures . The expectation exists that technologic innovation will continue to improve the safety and efficacy of the rigid bronchoscope . The skilled and mature operator has fewer complications than novices, nonetheless, it is very safe even in the hands of trainees . However, the operator needs to be cognizant of methods to attenuate any bleeding complications . At the time of hemorrhage the nonbleeding lung must be protected . Whether the patient is intubated or not, the patient should be positioned with the bleeding lung in the decubitus, dependent position (if hemodynamics permit), and if necessary, a double lumen tube will have to be placed in the nonbleeding lung (this will require special skills). Other methods of bleeding control include the instillation of cooled saline into the bronchus and then clamping the bronchus with the fiberoptic scope tip . If this does not work then 5 ml of thrombin may be instilled (5,000 u dissolve in saline), or, alternately, 2 ml of 1:1,000 epinephrine mixed with normal saline in a 1:10 mixture in order to produce vasoconstriction, thereby reducing bleeding (no more than three 2-ml aliquots are recommended). There has also been use of tranexamic acid with significant airway bleeding, and even activated factor vii has been instilled into the lungs with successful resolution of bleeding (author tjp, case to be published). Sometimes there are large thrombi that can block the airways once the bleeding stops, and these may need to be removed with cryotherapy, which has been in use for over 30 years [figure 5]. It is also important during an episode of bleeding to have good visualization of the airways and the source of bleeding . Usually the scope's removal for manual cleaning to visualize the field is rarely needed, and only is necessary in the face of massive hemorrhage . In less than dire circumstances, the scope tip can be cleaned by gently rubbing it vertically against the mucosa of the cartilaginous part of the tracheal wall . If this maneuver does not clear the operator's vision, then place the scope as described above against the tracheal wall and flush the operating port vigorously . Bleeding airway after biopsy (source: google images) clot in bronchus that has been subjected to cryotherapy and removed (source: author file; tjp) the majority of complications, as expected, occur in patients with high levels of comorbid disease undergoing more extensive therapeutic interventions . Bronchoscopy requires skilled operators and continues to evolve technologically to the advantage of both the physician and the patient . Overall, both rigid and flexible bronchoscopy, are safe and effective procedures for diagnosis and treatment of airway and pulmonary pathology.
Iron deficiency is the leading single nutrient deficiency in the world . Fifty percent of pregnant women in developing countries are anemic mostly due to iron deficiency . It is the only micronutrient deficiency which is also significantly prevalent in high income countries.1 maternal iron deficiency during pregnancy in animal experiments results in the development of obesity and hypertension in offspring despite the offspring having normal iron levels throughout postnatal life.25 iron deficiency - induced changes in maternal metabolism may have downstream effects on placental structure, endocrine and transport placental functions, nutrient interactions, and fetal organ development such as reduced kidney nephron number.6 however, association studies of specific nutrient effects in humans are difficult because of the likelihood of important confounding by other nutrients or dietary characteristics, as well as other lifestyle factors such as smoking and alcohol consumption.7 the use of the random assortment of genes from parents to offspring provides one method for assessing the causal nature of some environmental exposures . This approach, known as mendelian randomization (mr), uses genetic variants as instrumental variables (iv) for the environmental exposures of interest.8 genetic variants are not influenced by the many lifestyle and environmental characteristics that risk factors, such as iron deficiency, are associated with,9 and since they are allocated at conception cannot be influenced by the later occurrence of disease processes or treatment either . Therefore, associations derived from mr analysis are less likely to be affected by confounding and reverse causality that can bias established multivariable approaches to epidemiological association studies.10 women who carry a c282y mutation in the hfe gene are more likely, in the homozygous state, to suffer from hemochromatosis, resulting in iron overload in the liver.11,12 about 12%20% of northern europeans are heterozygotes for this mutation.11 hfe gene mutation carriers are usually asymptomatic, however there is evidence that c282y heterozygotes have higher total iron stores reflected by higher transferrin saturation levels,1316 and higher total body iron stores reflected by lower transferrin receptor: serum ferritin ratios.13 c282y homozygotes have significantly higher ferritin, transferrin saturation and serum iron levels compared to wild type individuals.14 in this study, we have used serum ferritin as the environmental measure of the exposure of interest; maternal iron status, as it is considered the most useful laboratory measure of iron status in the absence of inflammation.17 iv analysis uses the proportion of the variation in maternal iron status that is explained by c282y to provide an unconfounded estimate of the relationship with offspring outcomes . We hypothesize that women who carry the c282y mutation are at lower risk of iron deficiency during pregnancy, and therefore their offspring will have on average lower blood pressure and adiposity (as indicated by body mass index [bmi] and waist circumference [wc]). The aim of this study was to examine the relationship between maternal iron status and offspring bp and adiposity measures in adulthood, using both ordinary multivariable regression and iv regression methods . The uk women s cohort study (ukwcs), which includes 35,372 women, aged 3569 years at recruitment across england, wales, and scotland, was established in 1994 . The cohort is described in detail elsewhere.18 approximately 15,000 women from ukwcs were contacted between 1999 and 2002 and asked to provide cheek cell samples for dna extraction (phase ii data collection). All subjects who were found to be homozygous or heterozygous for the c282y gene mutation were also asked to provide a blood sample, to confirm the result from the cheek cell dna and to measure markers of iron status including serum ferritin . The method of analysis to detect the mutation is described in detail elsewhere.14 in addition, 3000 women were randomly selected to act as a control group.14 we have re - contacted 1416 mothers (identified as reporting having at least one live child in the first ukwcs questionnaire) between 2008 and 2010, of whom 716 were c282y allele carriers (aa or ag), and 700 were wild type hfe genotype (gg). The non - exposed in this sample were randomly selected from the pool of women with one or more children who were tested and found to have a wild type genotype . The total number of offspring for women contacted in this study was 3376, of whom 1686 were children to c282y carrier mothers and 1690 to wild type mothers . The mothers were asked to pass on the study information sheet and consent forms to their offspring . The offspring who consented to take part in the study were asked to self - measure their wc following specific instructions using a tape measure supplied in the study pack . Two measurements for each (in inches or centimeters) were provided and their mean used in all analyses . A standard operating procedure for the measurement of height, weight, and bp sheet was attached to the gp / practice nurse s letter and practice staff were asked to follow it when taking the measurements . If the first and second measurement differed by more than 5 mmhg for either the systolic blood pressure (sbp) or diastolic blood pressure (dbp), a third measurement was requested at least 1 minute after the second measurement . All analyses were performed using stata (v 11.0; stata corporation, college station, tx). The relationship of interest was examined using both ordinary least squares (ols) regression and instrumental variable (iv) regression modeling using the we adjusted for clustering of siblings (where there was more than one sibling per mother included in the study) using the robust cluster command in stata which computes a cluster - robust standard error of the difference in both the ols and the iv analyses . We used two - stage least square (2sls) as a method of estimation for iv regression, with maternal c282y genotype (aa, ag or gg) as the instrument, under an additive model, and maternal ferritin as the modifiable risk factor of interest . We included sbp, dbp, wc, and bmi, as outcomes . In the first stage of the 2sls model, the regression of maternal ferritin on c282y (instrument) is fitted . In the second stage, the outcome is regressed on the predicted values of maternal fn, the coefficient of which is the estimate of the causal effect . The standard errors of the second stage parameters are appropriately corrected to account for the uncertainty in the predicted values of the exposure from the first stage . The first stage f - statistic is reported to provide an indicator of the instrument strength . Values of 10 and over are taken to be sufficient to exclude weak identification using the specified instrument (maternal c282y).19 the weak identification f - statistic we used for the iv regression in the case of specification of robust cluster in the model is based on the kleibergen paap rk statistic, the null hypothesis being that the estimator is weakly identified by the instrument.20 rejecting the null hypothesis indicates that the instrument has sufficient strength.20 child age, maternal age (at phase ii of the ukwcs), and child gender were considered confounders and adjusted for in the multivariable ols models . In addition, maternal bmi (at phase ii) and maternal social class (as classified according to the three category national statistics socio - economic classification) were considered confounders and adjusted for in the multivariable ols models with offspring bmi and wc as outcomes . Other potential confounding factors such as mother s vegetarian status was tested for association with the exposure and offspring s blood pressure and adiposity, and were included in the multivariable ols model if they showed a statistically significant relationship with both . The two modeling methods used (ols and iv regression) are examining the same association of maternal iron status and offspring adiposity and blood pressure outcomes, using the difference in sbp, dbp, wc, and bmi per 10 g / l greater maternal serum ferritin . None of the models are testing the direct link between the maternal c282y genotype and offspring outcomes . We used 10,000 bootstrapped replications to estimate the standard errors of the differences between the iv and the multivariable ols estimates and then calculated p - values from these standard errors based on normal approximation for the sampling distribution of the mean differences . This study was conducted according to the guidelines laid down in the declaration of helsinki and all procedures involving human subjects were approved by the nhs north west research ethical committee (rec reference number 07/h1010/68). Written informed consent was obtained from all subjects . All analyses were performed using stata (v 11.0; stata corporation, college station, tx). The relationship of interest was examined using both ordinary least squares (ols) regression and instrumental variable (iv) regression modeling using the we adjusted for clustering of siblings (where there was more than one sibling per mother included in the study) using the robust cluster command in stata which computes a cluster - robust standard error of the difference in both the ols and the iv analyses . We used two - stage least square (2sls) as a method of estimation for iv regression, with maternal c282y genotype (aa, ag or gg) as the instrument, under an additive model, and maternal ferritin as the modifiable risk factor of interest . We included sbp, dbp, wc, and bmi, as outcomes . In the first stage of the 2sls model, the regression of maternal ferritin on c282y (instrument) is fitted . In the second stage, the outcome is regressed on the predicted values of maternal fn, the coefficient of which is the estimate of the causal effect . The standard errors of the second stage parameters are appropriately corrected to account for the uncertainty in the predicted values of the exposure from the first stage . The first stage f - statistic is reported to provide an indicator of the instrument strength . Values of 10 and over are taken to be sufficient to exclude weak identification using the specified instrument (maternal c282y).19 the weak identification f - statistic we used for the iv regression in the case of specification of robust cluster in the model is based on the kleibergen paap rk statistic, the null hypothesis being that the estimator is weakly identified by the instrument.20 rejecting the null hypothesis indicates that the instrument has sufficient strength.20 child age, maternal age (at phase ii of the ukwcs), and child gender were considered confounders and adjusted for in the multivariable ols models . In addition, maternal bmi (at phase ii) and maternal social class (as classified according to the three category national statistics socio - economic classification) were considered confounders and adjusted for in the multivariable ols models with offspring bmi and wc as outcomes . Other potential confounding factors such as mother s vegetarian status was tested for association with the exposure and offspring s blood pressure and adiposity, and were included in the multivariable ols model if they showed a statistically significant relationship with both . The two modeling methods used (ols and iv regression) are examining the same association of maternal iron status and offspring adiposity and blood pressure outcomes, using the difference in sbp, dbp, wc, and bmi per 10 g / l greater maternal serum ferritin . None of the models are testing the direct link between the maternal c282y genotype and offspring outcomes . We used 10,000 bootstrapped replications to estimate the standard errors of the differences between the iv and the multivariable ols estimates and then calculated p - values from these standard errors based on normal approximation for the sampling distribution of the mean differences . This study was conducted according to the guidelines laid down in the declaration of helsinki and all procedures involving human subjects were approved by the nhs north west research ethical committee (rec reference number 07/h1010/68). Written informed consent was obtained from all subjects . The characteristics and measurements of the study participants are described in tables 1 and 2 . Five hundred and seventeen of the original 3376 offspring consented to take part (17%), and 348 offspring of 277 mothers completed the study (10% of the invited sample, 61% of those who consented). One hundred and seventy (49%) were children of c282y mutation genotype mothers, of whom 12 were children of 11 homozygotes mothers (aa), and 158 were children of heterozygous mothers (ag). Two hundred and forty - seven (71%) were females and 101 (29%) were males . The mean age was 41 years for women (95% confidence intervals [ci]: 4041) and 40 years (95% ci: all participants who reported ethnicity information (n = 335) described their ethnic group as white . Two hundred and twelve offspring had no other siblings, 117 had one sibling included in the study, 15 had two siblings, and four had three siblings included . Four percent (n = 13) had systolic, and 2% (n = 7) had diastolic hypertension, according to the who cutoff points of 140/90 mmhg.21 figure 1 shows the average offspring bp, wc, and bmi for each maternal genotype . Maternal serum ferritin was associated with maternal age, offspring age, maternal and offspring vegetarian status, but there was no statistical evidence that maternal c282y genotype was associated with any of these factors (table 3). Maternal c282y was strongly associated with maternal fn: mean difference per each additional allele = 84 g / l (95% ci: 31137, p = 0.002). In univariable analysis, maternal ferritin was linked to offspring s dbp (0.1 mmhg for every 10 g / l increase in maternal ferritin, 95% ci: 0.030.3, p = 0.02), offspring wc (0.2 cm for every 10 g / l increase in maternal ferritin, 95% ci: 0.060.3, p = 0.006), and offspring s bmi (0.05 kg / m for every 10 g / l increase in maternal ferritin, 95% ci: 0.0020.1, p = 0.04). There were no differences in mean offspring bp, wc, and bmi between c282y carriers (aa, ag) and wild type mothers (gg) (results not shown). Maternal vegetarian status was significantly linked to both maternal ferritin and offspring dbp, and therefore was additionally entered in the multivariable ols model with dbp as the outcome . Table 4 shows the results of associations of maternal fn with each offspring outcome from both the confounder - adjusted multivariable analyses and the iv analyses using maternal c282y as the instrument . The first stage f - statistic for the strength of the instrument in the iv analysis was 10, and the kleibergen paap rk lm p - value was 0.009 for all outcomes considered . There was no relationship between maternal serum ferritin and offspring bp, wc, or bmi using both methods . There was also no significant difference between the ols and the iv analyses regression coefficients for any of the outcomes considered . We have examined the association of maternal iron status with adult offspring s bp, bmi, and wc . We have compared two methods; confounder - adjusted multivariable analyses, and analyses where we used a genetic mutation (c282y) in the hfe gene as an instrumental variable for maternal iron status . We have found that maternal iron status was not associated with the three offspring outcomes considered in this study using either method . There was also no statistical evidence that the associations differed between these two statistical approaches . In our sample, this supports our hypothesis that hfe c282y could be used as an instrumental variable for iron status . There are two published studies examining the relationship of maternal iron intake and hemoglobin levels in pregnancy with children s blood pressure at 3 and 7 years of age.22,23 however, to our knowledge, there are no previous studies examining the relationship of maternal iron status with adult offspring blood pressure and adiposity using either approach (ols or mr). Belfort et al reported a positive, rather than an inverse, association between maternal iron intake in pregnancy and child sbp at 3 years,23 while brion et al found no association.22 however, iron intake in pregnancy is not considered a good indicator of iron status, as this largely depends on women s iron reserves before pregnancy . Fortified foods may have the potential to reduce micronutrient deficiencies including iron during pregnancy.25 however, a study in denmark found that 40% of women of child - bearing age had low iron status despite having a national iron fortification program of flour.26 a key strength of this study is that it is the first to examine the association of maternal iron status with offspring blood pressure and adiposity in a human population . We have used serum ferritin as a measure of iron status, as there is evidence that ferritin alone provides a good approximation of total body iron reserves, as validated by transferrin receptor - to - ferritin ratios in people with unelevated c - reactive protein.22 there is however, a possibility that this approximation may vary in pregnant women . We have also tried to examine the association using two statistical approaches with different underlying assumptions for assessing causality that complement each other . The multivariable approach assumes that potential confounding factors are accounted for, correctly measured and modeled, and that there is no possibility of reverse causality . In this case, reverse causality is unlikely (ie, we cannot see how offspring outcomes could influence the mothers iron status). We have also used maternal ferritin concentration assessed many years after they were pregnant with the offspring, and are therefore assuming in these analyses that this is a reasonable proxy for maternal iron status during pregnancy . Any measurement error is likely to be non - differential with respect to the offspring outcomes that we have assessed here, and therefore the expectation would be that results would be biased towards the null . For the instrumental variable analyses, using maternal iron concentrations outside of pregnancy is not a major limitation as the genetic variant will have resulted in subtle differences in iron status throughout the woman s lifecourse including during pregnancy . However, the instrumental variable analysis assumes that the instrument is associated with the risk factor of interest, which we know is the case from previous studies and which we have demonstrated here, though the first stage f - statistic of 10 suggests that the instrument s strength to identify the estimator (maternal ferritin) is borderline.19 this would bias the instrumental variable analysis towards the null results seen in the multivariable analysis . Using another measure of iron stores during pregnancy, such as transferrin receptor - to - ferritin ratio, which is not affected by inflammation, could strengthen the genetic instrument . It is further assumed that the instrumental variable (for this study, the c282y mutation in the hfe gene) is not associated with any measured or unmeasured confounding, ie, it is naturally randomized in the population . This is confirmed by testing the association between maternal c282y and selected measured factors in our data as shown in table 3 . However, one of the conditions of iv analysis is that the instrument should not be related to the outcome except through the exposure of interest (z related to y only through x). The fact that maternal genotype is linked to offspring genotype may constitute a violation to this assumption . This would be the case in all transgenerational studies that attempt to use a mr design . The ideal way to tackle one of the main limitations in this study is that offspring genotype was not measured . There is some evidence linking c282y heterozygotes with an increased risk of cardiovascular (cv) disease.27,28 however, other studies show no association.29,30 if there is a true positive relationship between offspring genotype and their bp, this may counteract an inverse relationship between maternal genotype (used as a proxy for maternal iron status here) and offspring s bp, potentially leading to a spurious non - association in the relationship of interest . However, it could be argued that it is the iron status at the time of gestation that is the contributing factor to cv risk, and not the phenotype of the fetus . The study s response rate of 10% meant that the study had a smaller sample size than initially planned . Mr studies require sample sizes larger than classical epidemiological studies due to reduced precision of the estimates as genotype usually only explains a proportion of the variation in the environmental exposure of interest . The relatively poor response rate may be due to the indirect recruitment methods used (through mothers), as well as the necessity of visiting the gp . A key strength of this study is that it is the first to examine the association of maternal iron status with offspring blood pressure and adiposity in a human population . We have used serum ferritin as a measure of iron status, as there is evidence that ferritin alone provides a good approximation of total body iron reserves, as validated by transferrin receptor - to - ferritin ratios in people with unelevated c - reactive protein.22 there is however, a possibility that this approximation may vary in pregnant women . We have also tried to examine the association using two statistical approaches with different underlying assumptions for assessing causality that complement each other . The multivariable approach assumes that potential confounding factors are accounted for, correctly measured and modeled, and that there is no possibility of reverse causality . In this case, reverse causality is unlikely (ie, we cannot see how offspring outcomes could influence the mothers iron status). However, residual confounding is still possible with this approach . We have also used maternal ferritin concentration assessed many years after they were pregnant with the offspring, and are therefore assuming in these analyses that this is a reasonable proxy for maternal iron status during pregnancy . Any measurement error is likely to be non - differential with respect to the offspring outcomes that we have assessed here, and therefore the expectation would be that results would be biased towards the null . For the instrumental variable analyses, using maternal iron concentrations outside of pregnancy is not a major limitation as the genetic variant will have resulted in subtle differences in iron status throughout the woman s lifecourse including during pregnancy . However, the instrumental variable analysis assumes that the instrument is associated with the risk factor of interest, which we know is the case from previous studies and which we have demonstrated here, though the first stage f - statistic of 10 suggests that the instrument s strength to identify the estimator (maternal ferritin) is borderline.19 this would bias the instrumental variable analysis towards the null results seen in the multivariable analysis . Using another measure of iron stores during pregnancy, such as transferrin receptor - to - ferritin ratio, which is not affected by inflammation, could strengthen the genetic instrument . It is further assumed that the instrumental variable (for this study, the c282y mutation in the hfe gene) is not associated with any measured or unmeasured confounding, ie, it is naturally randomized in the population . This is confirmed by testing the association between maternal c282y and selected measured factors in our data as shown in table 3 . However, one of the conditions of iv analysis is that the instrument should not be related to the outcome except through the exposure of interest (z related to y only through x). The fact that maternal genotype is linked to offspring genotype may constitute a violation to this assumption . This would be the case in all transgenerational studies that attempt to use a mr design . The ideal way to tackle one of the main limitations in this study is that offspring genotype was not measured . There is some evidence linking c282y heterozygotes with an increased risk of cardiovascular (cv) disease.27,28 however, other studies show no association.29,30 if there is a true positive relationship between offspring genotype and their bp, this may counteract an inverse relationship between maternal genotype (used as a proxy for maternal iron status here) and offspring s bp, potentially leading to a spurious non - association in the relationship of interest . However, it could be argued that it is the iron status at the time of gestation that is the contributing factor to cv risk, and not the phenotype of the fetus . The study s response rate of 10% meant that the study had a smaller sample size than initially planned . Mr studies require sample sizes larger than classical epidemiological studies due to reduced precision of the estimates as genotype usually only explains a proportion of the variation in the environmental exposure of interest . The relatively poor response rate may be due to the indirect recruitment methods used (through mothers), as well as the necessity of visiting the gp . We found no association between maternal iron status and offspring s blood pressure and adiposity using both multivariable ordinary least squares regression and instrumental variable modeling with maternal c282y mutation in the hfe gene as the instrument . However, the relatively small study sample for a mr design and the lack of measurement of the offspring c282y genotype in order to adjust for any possible effect on the relationship of interest are likely to push the study results towards accepting the null hypothesis . Therefore, replication of findings in studies that avoid these limitations should be considered.
They may present with bilateral aml at an early age in patients who have tuberous sclerosis, vonhippel - lindau syndrome and neurofibromatosis type 1 (phakomatosis). With this in mind, we present a case which was initially diagnosed as a wilms tumor but was finally found to be a renal aml in a child without underlying phakomatosis . A 12-year - girl was referred from another hospital with chief complaints of a lump in the left side of abdomen for the last 5 months . The mass had progressively increased in size over a period of 5 months to involve most of her abdomen and produced significant abdominal distension . An initial evaluation with ultrasonography and contrast - enhanced computed tomography (cect) of abdomen and chest at the referring center showed that it was a left renal mass . Subsequently, she was started on chemotherapy for wilms tumor with 3 drugs (vincristine, doxorubicin and actinomycin d). After receiving week 6 of chemotherapy, she presented to us . At the time of presentation to us, she had a huge abdominal lump that was occupying the entire abdomen . The size of the mass had decreased subjectively as per the patient herself by 25% after initiation of chemotherapy . It was found to be having a variegated appearance arising from the lower pole of the left kidney and occupying almost the whole of abdomen . We repeated the cect abdomen and chest which revealed a 21 cm 17 cm 12 cm solid mass with necrosis within it and this was arising from the left kidney [figure 1]. (a and b) contrast - enhanced computed tomography scan images in the axial plane showing a large heterogeneous mass lesion arising from the left side of retroperitoneum replacing the entire left kidney . The mass was displacing the bowel loops, aorta (outlined arrow), and inferior vena cava (arrow) to the opposite side . The right kidney (*) was normal and located in the right renal fossa there was no intravascular extension or lung metastasis . Fine - needle aspiration cytology (fnac) was performed, but the aspirate contained only blood . Considering the rapid increase in size of the mass and the partial response to chemotherapy and the related necrosis, a repeat fnac was not ordered, and a working diagnosis of wilms tumor was kept . The operative findings confirmed that the mass was arising from the lower pole of the left kidney, and it was occupying the entire abdomen and pushing the peritoneal contents to the right paracolic gutter [figure 2a]. The specimen measured 27 cm 22 cm 18 cm and weighed 5.5 kg [figure 2b]. (a) intra - operative image showing the lump occupying almost the entire abdominal cavity with colon stretched over it and pushed to the right of the patient (b) the excised specimen showing that it arose predominantly from the middle and lower pole of the left kidney postoperative recovery was uneventful . Immunohistochemical analysis on the specimen showed negative pattern for wt-1, mic-2, desmin, nse, synaptophysin, s-100 andchromogranin . There was a positive reaction towards hmb45 [figure 3] and trace positivity towards vimentin . She was evaluated and found not to be having any such features, and hence, she has been put on annual follow - up . Photomicrograph of the tumor shows features of anangiomyolipoma with a variable mixture of smooth muscle bundles (thin arrow), blood vessels (bold arrow), and adipose tissue (star) (a and b: h and e, 40 and c: h and e, 200). Focal immunopositivity for hydroxy beta - methyl butyric acid-45 was also noted (parentheses) (d: hmb 45, 200) the histologic picture resembles a hamartoma, but currently, they are considered as benign neoplasms . There is a 4:1 female predominance and the mean age at presentation is around 40 years . Eighty percent of children with tuberous sclerosis develop these lesions by the age of 10 years . In children, the imaging characteristics of renal aml can vary considerably based on the amount and type of histologic elements present . Although fat is occasionally found even in wilms tumor, the diagnosis of renal aml is generally straight forward when correlated with other clinical features . Had described three cases of pediatric renal aml (age range 1115 years) that posed a diagnostic challenge . In all 3 cases, the misdiagnosis was attributed to the large size of the tumor with poor fat content, in an age group where renal aml is usually not common . Renal aml is the only benign renal tumor that can be categorically diagnosed by radiological studies alone . Despite this, the imaging in our case did not indicate towards aml because of low - fat content . Lipopenic aml comprises only about 5% of all amls, and in this situation, the diagnosis can be difficult to clinch with radiology alone . Although 75%80% of the patients present before 5 years of age, the age range is quite wide, and cases have been reported even in adolescence and adults . In fact, in the society of pediatric oncology (siop) 93 - 01 study, thirty patients out of 962 patients enrolled with wilms tumor were older than 16 years . In the siop study, wilms tumor in children between 6 months to 16 years were diagnosed by means of radiological studies alone . With this background, the diagnosis of wilms tumor was initially considered in our patient . Because the size of the mass had decreased on chemotherapy further made us to believe that this mass was in fact a wilms tumor . Typical cytological features described in conventional aml are admixture of adipocytes, smooth muscle cells, endothelial cells, foam cells, and giant histiocytes with a backdrop of inflammatory cells . A fnac or needle biopsy before initiating chemotherapy probably would have been helpful in diagnosing it early . Tuberous sclerosis complex has been characterized by vogt's triad, comprising mental retardation, adenoma sebaceum, and seizures . Renal amls in the setting of tuberous sclerosis may reach giant proportions although there is no consensus on when to term an aml as giant . The largest reported case of bilateral renal aml measured 30 cm 21 cm 13 cm and 30 cm 18 cm 10 cm with a total tumor burden of 7843 g that resulted in respiratory failure . Our patient was later evaluated for any markers for phakomatosis but none were found . After reviewing the literature, it is our belief that our case has by far the largest pediatric sporadic aml reported in literature . The largest sporadic renal aml reported till date weighed 7500 g in a 49-year - old lady . Management is conservative if the size of the lesion is <4 cm but larger lesions need to be surgically removed . Nephron - sparing surgeries are advocated, especially in tuberous sclerosis patients in whom bilateral affliction may occur . In our case, the absence of a pre - operative diagnosis precluded a nephron - sparing approach although in the hindsight, renal preservation would have been a difficult technical proposition considering the size and extent of involvement of the kidney . To conclude, a rare case of giant sporadic pediatric renal aml has been reported that was mistaken for a wilms tumor . This case highlights the importance of obtaining a tissue diagnosis before initiating chemotherapy, especially when the age of the patient is not in the standard age bracket for wilms tumor.
Syncope is a very common symptom and it represents an important public health problem because it leads to traumatic lesions, worsens quality of life; it is one of the most common causes of inability and it is associated with elevated health care costs (1, 17). Syncope is defined as a sudden and transitory loss of consciousness and orthostatic position associated with a fast, spontaneous and complete regain of consciousness . Lypotimia is defined as a sudden weakness, incapacity to maintain the orthostatic position, visus block out and near loss of consciousness . Vasovagal syncope is the most common cause of syncope and it represents about 1040% of all the causes (19). Vasovagal syncope physiopathology: when we step over from the clinostatic to orthostatic position about 800 ml of blood goes into the subdiaphragmatic part of the body with a reduction in preload into the right ventricle . In patients with vasovagal syncope the mechanoceptors located in the heart and in the carotid bulb send an exaggerated signal to the cerebral trunk with an alterated sympathovagal response and vasodepression (3). The head - up tilt test (hutt) is the most efficacious test in studying the vasovagal reaction . In addition, ecg monitoring is very important in discovering the cause of syncope both with traditional ecg 24-hr and the r - test, and with ecg monitoring over a period of 7 days . The aim of our study was to verify the diagnostic value of the hutt in patients suspected of vasovagal syndrome and of the r - test in patients with unexplained syncope . In our syncope unit, from 20022005, there were 211 patients symptomatic for syncope and/or lypotimia suspicious for vasovagal syndrome . Mean age was 41.5 yrs (range 1865 yrs); 88 patients were male and 123 were female . Fifty - eight patients had one or more lypotimic episodes in anamnesis and 153 patients had one or more syncopal episodes . Some patients had already undergone other diagnostic tests for syncope such as holter ecg monitoring, echocardiogram, electrophysiological study, electroencephalogram, encephalic ct, and upper aortic trunk doppler . After a detailed description of the test modality, the patients had to give their informed consent . Patients should fast for at least 2 hr before the test . In order to monitor arterial blood pressure (bp), we adopted the f500 system, a versatile non - invasive beat - to - beat monitoring system . It captures the continuous bp waveform, and automatically computes up to 15 important beat - to - beat hemodynamic parameters including cardiac output (co), stroke volume (sv), total peripheral resistance (tpr), pulse rate variability (prv) and baroreflex sensitivity (brs). Ecg monitoring at 25 mm / sec in 12 derivations is obtained in the basal position after the supine position phase, every 3 min and every time it was necessary . We used a tilt table with a foot board support to achieve the upright position smoothly and rapidly, and to reset the supine position quickly (<10 sec) when the test is completed to avoid the consequences of a prolonged loss of consciousness . This protocol provides a supine pre - tilt phase of at least 5 min when no venous cannulation is performed and at least 20 min when cannulation is undertaken; tilt angle is 6070. passive phase is a minimum of 20 min and a maximum of 45 min . If the passive phase has been negative 400 g of nitroglicerin spray is used sublingually; the drug challenge phase is about 1520 min . The end - point of the test is defined as the induction of syncope or a progressive and symptomatic fall in bp for at least 3 min or until a value of 60 mmhg in systolic bp is achieved or the completion of the planned duration of tilt including drug stimulation (15, 16, 18). Type 1 mixed response: heart rate falls at the time of syncope but the ventricular rate does not fall to <40 beats / min or falls to <40 beats / min for <10 sec with or without asystole of <3 sec . Type 2a cardio inhibition without a systole: heart rate falls to a ventricular rate <40 beats / min for> 10 sec, but asystole of> 3 sec does not occur . Type 2b cardio inhibition with a systole: a systole occurs for> 3 sec . Type 3 vasodepressor: heart rate does not fall> 10% from its peak at the time of syncope . Forty - five patients with syncope and a negative response to hutt, after a negative 24-hr holter ecg, underwent an ecg ambulatory registration with the r - test that registers ecg over a period of 7 days, and to give an analysis with dedicated software for specific event monitoring . The r - test (evolution novacor - cardioline) is a compact and lightweight ergonomic recorder (45 g batteries included, 60 48 28 mm) suspended around the neck like a medallion; it is maintained by an auto - adjustable cable, a particularly ergonomic configuration which drastically limits movement artefacts; its advanced miniaturized electronics are capable of real time qrs acquisition and processing . It stores only significant events; therefore, avoiding the generation of huge data files usually associated with long - term ecg monitoring . The number and type of events recorded, as well as the pre- and post - event time are entirely programmable, allowing either specific screening for the confirmation of a suspected pathology or a wider search field in the absence of strong clinical evidence . Voluntary registration is possible during the specific symptom; in addition, this recorder includes a pre- and a post - registration of specific events . The r - test evolution is equipped with a new acquisition system favoring the cm5 lead, for excellent results in arrhythmia detection and st shift measurement in case the user interface on pcs (rtsoft) is a model of user friendliness . Patient i d is directly sent to and stored in the recorder before it starts, for enhanced data treatment safety . Transfer of the recorded data, display of all the events as well as the heart rate curve and event histograms are immediate, allowing a global overview . Each strip can also be zoomed in on separately for a detailed analysis . In our syncope unit, from 20022005, there were 211 patients symptomatic for syncope and/or lypotimia suspicious for vasovagal syndrome . Mean age was 41.5 yrs (range 1865 yrs); 88 patients were male and 123 were female . Fifty - eight patients had one or more lypotimic episodes in anamnesis and 153 patients had one or more syncopal episodes . Some patients had already undergone other diagnostic tests for syncope such as holter ecg monitoring, echocardiogram, electrophysiological study, electroencephalogram, encephalic ct, and upper aortic trunk doppler . After a detailed description of the test modality, the patients had to give their informed consent . Patients should fast for at least 2 hr before the test . In order to monitor arterial blood pressure (bp), we adopted the f500 system, a versatile non - invasive beat - to - beat monitoring system . It captures the continuous bp waveform, and automatically computes up to 15 important beat - to - beat hemodynamic parameters including cardiac output (co), stroke volume (sv), total peripheral resistance (tpr), pulse rate variability (prv) and baroreflex sensitivity (brs). Ecg monitoring at 25 mm / sec in 12 derivations is obtained in the basal position after the supine position phase, every 3 min and every time it was necessary . We used a tilt table with a foot board support to achieve the upright position smoothly and rapidly, and to reset the supine position quickly (<10 sec) when the test is completed to avoid the consequences of a prolonged loss of consciousness . This protocol provides a supine pre - tilt phase of at least 5 min when no venous cannulation is performed and at least 20 min when cannulation is undertaken; tilt angle is 6070. passive phase is a minimum of 20 min and a maximum of 45 min . If the passive phase has been negative 400 g of nitroglicerin spray is used sublingually; the drug challenge phase is about 1520 min . The end - point of the test is defined as the induction of syncope or a progressive and symptomatic fall in bp for at least 3 min or until a value of 60 mmhg in systolic bp is achieved or the completion of the planned duration of tilt including drug stimulation (15, 16, 18). Type 1 mixed response: heart rate falls at the time of syncope but the ventricular rate does not fall to <40 beats / min or falls to <40 beats / min for <10 sec with or without asystole of <3 sec . Type 2a cardio inhibition without a systole: heart rate falls to a ventricular rate <40 beats / min for> 10 sec, but asystole of> 3 sec does not occur . Type 2b cardio inhibition with a systole: a systole occurs for> 3 sec . Type 3 vasodepressor: heart rate does not fall> 10% from its peak at the time of syncope . Forty - five patients with syncope and a negative response to hutt, after a negative 24-hr holter ecg, underwent an ecg ambulatory registration with the r - test that registers ecg over a period of 7 days, and to give an analysis with dedicated software for specific event monitoring . The r - test (evolution novacor - cardioline) is a compact and lightweight ergonomic recorder (45 g batteries included, 60 48 28 mm) suspended around the neck like a medallion; it is maintained by an auto - adjustable cable, a particularly ergonomic configuration which drastically limits movement artefacts; its advanced miniaturized electronics are capable of real time qrs acquisition and processing . It stores only significant events; therefore, avoiding the generation of huge data files usually associated with long - term ecg monitoring . The number and type of events recorded, as well as the pre- and post - event time are entirely programmable, allowing either specific screening for the confirmation of a suspected pathology or a wider search field in the absence of strong clinical evidence . Voluntary registration is possible during the specific symptom; in addition, this recorder includes a pre- and a post - registration of specific events . The r - test evolution is equipped with a new acquisition system favoring the cm5 lead, for excellent results in arrhythmia detection and st shift measurement in case the user interface on pcs (rtsoft) is a model of user friendliness . Patient i d is directly sent to and stored in the recorder before it starts, for enhanced data treatment safety . Transfer of the recorded data, display of all the events as well as the heart rate curve and event histograms are immediate, allowing a global overview . Among the patients, 113 were positive to the hutt and 98 were negative . In the positive group, 87 were females and 26 were males (median age 32 10 yrs), while in the negative group 36 were female and 62 were male (median age 61 10 yrs). Of the 45 patients who underwent the r - test, five patients were symptomatic for syncope: in three cases there was a registration of complete atrial ventricular block with idio - ventricular rhythm and in two cases there was evidence of major pauses> 3 sec (fig . R - test: results for hypokinetic arrhythmias . Among the patients submitted to the r - test, 19 patients presented with hyper kinetic arrhythmias (seven patients with ventricular ectopic beats (fig . 2), five patients with supra - ventricular ectopic beats, four patients with short traits of parossistic supra - ventricular tachycardia and three patients with short traits of atrial fibrillation) (figs . Syncope is a syndrome consisting of a relatively short period of temporary and self - limited loss of consciousness caused by a transient reduction in blood flow to the brain (most often the result of systemic hypotension). Syncope comprises part of a subset of clinical conditions in which loss of consciousness is transient; other conditions in this group, which are not syncope and should be clearly distinguished from syncope, include, for example, seizure disorders, post - traumatic loss of consciousness and cataplexy (4). Syncope accounts for up to 3% of emergency room visits and 6% of hospital admissions . The framingham study reported that approximately 3% of individuals have a syncopal episode during their lives, although lifetime incidence in the elderly can be as high as 23% . Mortality is generally low, but can be up to 33% at 1 yr in patients with a cardiac aetiology (5). Diagnosis can be made difficult by the intermittent nature of the symptoms, the large number of potential aetiologies, and the lack of a gold standard for clinical investigation . The cost of the investigation of recurrent unexplained syncope can be high, particularly if a relatively benign cause of syncope is overlooked in the process of excluding life - threatening disorders . Recurrences are common after the index event, occurring in up to one - third of patients . The search for an underlying cause in patients with syncope often poses a clinical dilemma and even after extensive evaluation, the specific cause can remain unknown in up to 50% of patients . In selected patients, the diagnostic yield can be improved with the use of specialized studies such as head - up tilt testing . Head - up tilt testing is a widely accepted tool in the investigation of syncope, particularly where there is no evidence of structural heart disease (6). Initial evaluation with anamnesis, clinical examination, ecg and bp in clinostatic and orthostatic positions screens the patients suspected of vasovagal syncope and cardiogenic syncope . With an initial evaluation a neurogenic reflex can be suspected with indicative data and when other syncope causes have been excluded, independent from tilt - table test results . Patients with positive tilt - table test results and those with a negative response (indefinite syncope) have similar characteristics and prognosis, so it seems they belong in the same population . The key remains in selecting the appropriate patients for each investigation, such as by the presence of a prodrome of autonomic symptoms in those with suspected vasovagal syncope (7). The absence of a gold standard diagnostic test for vasovagal syncope makes the calculation of the exact specificity and sensitivity of the tilt test difficult, particularly in view of the variable methodology used in the different groups reporting results . The ability of the test to differentiate patients from healthy controls is nonetheless established with specificity generally up to 90% and sensitivity ranging between 32% and 85% with the median closer to the upper number (8). The diagnostic value of the hutt in our group of patients is lower than that in the literature data, possibly due to the low pre - test probability . More rigorous application of the guidelines is necessary to optimize the usefulness of the hutt . Recent studies have seen how a correct and specific anamnesis is able to discover with a high diagnostic value patients affected by vasovagal syndrome (11, 13). However, the tilt test has a higher sensibility in young female patients (10). Sheldon et al (11) tested the sensitivity and specificity of a preliminary questionnaire about the characteristics of the syncopal episodes and every question was assigned a positive or negative score . The point score correctly classified 90% of patients, diagnosing vasovagal syncope with 89% sensitivity and 91% specificity; so it is true that a targeted anamnesis could make a diagnosis without the tilt test (14). The availability of implantable cardiac loop recorders is a significant advance in helping to clarify the situation in patients with unexplained syncope (9). Not unsurprisingly, many patients have been found to have a diagnosis different from that presumed from their history and other investigations as evidenced in the issue-2 study . The issue-2 study with the early application of a loop recorder in patients with unexplained syncope demonstrated that in a minority of patients during syncope recurrences there are tachy or bradyarrhythmias, supraventricular or ventricular that are responsible for syncopal episodes . In our study, the r - test was able to detect an arrhythmic cause of syncope in some patients with negative hutt and negative traditional holter ecg monitoring . In our opinion, r - test ecg monitoring for a period of 7 days, with the possibility of repeating the test, could be a preliminary test to determine the use of the implantable loop recorder in patients with unexplained syncope . It is a very simple method that also reduces the management costs of the unexplained syncope population (12).
All families were identified through the gliogene consortium, and the exclusions were based on reported information obtained from the questionnaire in which we asked about the clinical criteria used for these hereditary conditions . We excluded all families with a reported or confirmed diagnosis of neurofibromatosis i, neurofibromatosis ii, turcot's syndrome, or tuberous sclerosis . We identified 146 (34%) families meeting the criteria of having both familial glioma and associated cancers out of 428 probands recruited from 14 569 screened cases of incident glioma cases . The cases were initially screened for family history of glioma and had been diagnosed between 2007 and 2011 at one of our 14 recruitment centers . Biospecimen and clinicopathological information from probands and the above description of selected family members were collected after obtaining informed consent according to protocols approved by each center's institutional review board in accordance with the declaration of helsinki . The genomic areas covering tp53, cdkn2a, mlh1, and msh2 were selected because these genes have previously been reported to be associated with cancer pedigrees known to include glioma . Distributions of demographic characteristics of the probands, pathological characteristics of the glial tumors, and clinical variables of glioma in the families were described based on information derived from personal questionnaires (table 1). Glioma families were included from sweden (n = 14), denmark (n = 36), israel (n = 10), and the united states (n = 86) (table 2). The first category was families with at least 2 glioma cases verified and a third reported or verified in the same family (n = 67: sweden n = 7, denmark n = 12, israel n = 5, united states n = 43). (international classification of diseases codes for oncology: low grade glioma [who grades i and ii]: juvenile pilocytic astrocytoma [9421/3], fibrillary astrocytoma [9420/3], protoplasmic astrocytoma [9410/3], gemistocytic astrocytoma [9411/3], diffuse astrocytoma [9400/3], oligodendroglioma [9450/3], oligoastrocytoma [9382/3], ependymoma [9391/3]; high - grade glioma [who grades iii and iv]: anaplastic astrocytoma [9401/3], anaplastic oligodendroglioma [9451/3], anaplastic oligoastrocytoma [9382/3], anaplastic ependymoma [9392/3], gliosarcoma [9442/3], gliomatosis cerebri [9381/3], and glioblastoma [9440/3]). The second category was families with 2 glioma cases plus a report of at least one family member affected with colon cancer, breast cancer, or malignant melanoma (n = 128: sweden n = 12, denmark n = 38, israel n = 8, and united states n = 70). Some families belonged to both categories, having 3 cases of glioma, and another cancer in the family (n = 37: sweden n = 5, denmark n = 9, israel n = 3, and united states n = 20) (table 2). Table 1.demographic characteristics of the probands and pathological characteristics of the glial tumors from sweden, denmark, israel, and united states ascertained for multiplex ligation - dependent probe amplification analyses of tp53, cdkn2a / b, mlh1 and msh2glial tumor (pathological characteristics)number of affected individualsmedian age at diagnosis (y)sexracemale / femalewhite / black / hispanic / arabicastrocytic tumors astrocytoma, unclassified343.02/12/0/1/0 astrocytoma, fibrillary143.00/11/0/0/0 astrocytoma, gemistocytic131.00/11/0/0/0 astrocytoma, juvenile pilocytic12.00/11/0/0/0 astrocytoma, diffuse929.03/68/0/1/0 astrocytoma, anaplastic1847.011/718/0/0/0 ganglioglioma229.00/22/0/0/0 glioma, unclassified539.02/35/0/0/0 glioblastoma6456.035/2961/2/0/1oligodendroglial tumors oligodendroglioma1742.09/816/0/1/0 oligodendroglioma, anaplastic1051.52/810/0/0/0 oligoastrocytoma334.01/23/0/0/0 oligoastrocytoma, anaplastic345.01/23/0/0/0eppendymal tumors ependymoma, myxopapillary224.50/22/0/0/0 ependymoma328.00/33/0/0/0 ependymoma, anaplastic160.00/11/0/0/0neuronal and mixed neuronal - glial tumors dysembryoplastic neuroepithelial tumor128.00/11/0/0/0 paraganglioma of spinal cord151.00/11/0/0/0median age at diagnosis of probands . Table 2.descriptive characteristics of glioma families from sweden, denmark, israel, and united states ascertained for multiplex ligation - dependent probe amplification analyses of tp53, cdkn2a / b, mlh1 and msh2categoriesnumber of affected individualsmedian age at diagnosisnon - gbmgbmn (%) n (%) pedigrees available for mlpa analysis united states8545.049 (57.0)36 (43.0) sweden1457.08 (57.1)6 (42.9) denmark3651.018 (50.0)18 (50.0) israel1049.55 (50.0)5 (50.0)pedigrees with 3 glioma united states4348.020 (46.5)23 (53.5) sweden760.06 (85.7)1 (14.3) denmark1156.05 (45.5)6 (54.5) israel556.01 (20.0)4 (80.0)pedigrees with 2 glioma + colon cancer united states5345.019 (35.2)34 (64.8) sweden1052.04 (40.0)6 (60.0) denmark2550.010 (40.0)15 (60.0) israel135.01 (100.0)napedigrees with 2 glioma + breast cancer us3548.015 (42.9)20 (57.1) sweden560.03 (60.0)2 (40.0) denmark2445.012 (50.0)12 (50.0) israel841.05 (62.5)3 (37.5)pedigrees with 2 glioma + malignant melanoma united states1651.510 (62.5)6 (37.5) sweden0nanana denmark961.05 (55.6)4 (44.4) israel241.02 (100.0)namedian age at diagnosis of probands.overlap because some of the probands were included in several categories.abbreviations: mlpa, multiplex ligation - dependent probe amplification; n, number of affected individuals; na, not applicable . Demographic characteristics of the probands and pathological characteristics of the glial tumors from sweden, denmark, israel, and united states ascertained for multiplex ligation - dependent probe amplification analyses of tp53, cdkn2a / b, mlh1 and msh2 median age at diagnosis of probands . Descriptive characteristics of glioma families from sweden, denmark, israel, and united states ascertained for multiplex ligation - dependent probe amplification analyses of tp53, cdkn2a / b, mlh1 and msh2 median age at diagnosis of probands . Abbreviations: mlpa, multiplex ligation - dependent probe amplification; n, number of affected individuals; na, not applicable . The samples were screened for large deletions / duplications by multiplex ligation - dependent probe amplification (mlpa). Small (5070 nt) sequences are targeted, enabling mlpa to identify single exon aberrations . The samples were ligated and amplified using the salsa mlpa p003 mlh1/msh2 probe mix version b2 according to the protocol manufacturer's recommendation (mrc - holland). The p003 mlh1/msh2 probe mix version 2 contains probes for each of the 19 exons of the mlh1 gene and for each of the 16 exons of the msh2 gene . Also, 2 probes are included for the most 3 exon of epcam, a gene located just upstream of the msh2 gene . Deletions of the most 3 exon of the epcam gene can result in silencing of the msh2 gene . In addition, the p003 mlh1/msh2 probe mix also covers 7 genes in the cdkn2a-9p21 region + pax5 (9p13) dock8 (9p24.3), and gldc (9p21.1). The samples were analyzed on a ceqtm 8000 geneticanalysis system (beckman coulter inc . ). Data normalization and analysis were performed with genemarker software version 1.75 (softgenetics) using standard parameters . Standard mlpa analysis was performed following the manufacturer's instructions (mrc - holland), version 31; 17 - 06 - 211 . One hundred nanograms of genomic dna were denatured and then hybridized with salsa mlpa probe mixes that covers 6 genes in the tp53 - 17p13.1 region + nf2 and chek2 (included chek2 * 1100delc). Following ligation, pcr was performed in a bio - rad 1000series thermal cycler (bio - rad laboratories). Fragment separation was carried out as suggested by mrc - holland on an abi 3100 sequencer using pop7 polymer and genescan-500 rox sizing standard (applied biosystems). 8.75 l of hi - di formamide and 0.25 l of genescan-500 rox sizing standard were mixed with 1 l of the mlpa pcr product per sample for a total volume of 10 l . Since some of the variants found in this study were not standardized and clinically validated mutations, we used massively parallel sequencing of hybrid - captured dna to further evaluate preliminary findings from mlpa screening of genes in the 9p21 region . Agilent sureselect probes were designed to capture the genomic regions of cdkn2a and cdkn2b, including introns and 20 kb adjacent 5 and 3 regions, which covered the regions implicated by mlpa . Paired - end sequencing 2 100 bp was performed on the illumina hiseq2000 instrument to an average depth of> 100 reads, followed by alignment to the reference genome . Coverage over the suspected deleted / duplicated regions was not found to be different from coverage in control samples . All families were identified through the gliogene consortium, and the exclusions were based on reported information obtained from the questionnaire in which we asked about the clinical criteria used for these hereditary conditions . We excluded all families with a reported or confirmed diagnosis of neurofibromatosis i, neurofibromatosis ii, turcot's syndrome, or tuberous sclerosis . We identified 146 (34%) families meeting the criteria of having both familial glioma and associated cancers out of 428 probands recruited from 14 569 screened cases of incident glioma cases . The cases were initially screened for family history of glioma and had been diagnosed between 2007 and 2011 at one of our 14 recruitment centers . Biospecimen and clinicopathological information from probands and the above description of selected family members were collected after obtaining informed consent according to protocols approved by each center's institutional review board in accordance with the declaration of helsinki . The genomic areas covering tp53, cdkn2a, mlh1, and msh2 were selected because these genes have previously been reported to be associated with cancer pedigrees known to include glioma . Distributions of demographic characteristics of the probands, pathological characteristics of the glial tumors, and clinical variables of glioma in the families were described based on information derived from personal questionnaires (table 1). Glioma families were included from sweden (n = 14), denmark (n = 36), israel (n = 10), and the united states (n = 86) (table 2). The first category was families with at least 2 glioma cases verified and a third reported or verified in the same family (n = 67: sweden n = 7, denmark n = 12, israel n = 5, united states n = 43). (international classification of diseases codes for oncology: low grade glioma [who grades i and ii]: juvenile pilocytic astrocytoma [9421/3], fibrillary astrocytoma [9420/3], protoplasmic astrocytoma [9410/3], gemistocytic astrocytoma [9411/3], diffuse astrocytoma [9400/3], oligodendroglioma [9450/3], oligoastrocytoma [9382/3], ependymoma [9391/3]; high - grade glioma [who grades iii and iv]: anaplastic astrocytoma [9401/3], anaplastic oligodendroglioma [9451/3], anaplastic oligoastrocytoma [9382/3], anaplastic ependymoma [9392/3], gliosarcoma [9442/3], gliomatosis cerebri [9381/3], and glioblastoma [9440/3]). The second category was families with 2 glioma cases plus a report of at least one family member affected with colon cancer, breast cancer, or malignant melanoma (n = 128: sweden n = 12, denmark n = 38, israel n = 8, and united states n = 70). Some families belonged to both categories, having 3 cases of glioma, and another cancer in the family (n = 37: sweden n = 5, denmark n = 9, israel n = 3, and united states n = 20) (table 2). Table 1.demographic characteristics of the probands and pathological characteristics of the glial tumors from sweden, denmark, israel, and united states ascertained for multiplex ligation - dependent probe amplification analyses of tp53, cdkn2a / b, mlh1 and msh2glial tumor (pathological characteristics)number of affected individualsmedian age at diagnosis (y)sexracemale / femalewhite / black / hispanic / arabicastrocytic tumors astrocytoma, unclassified343.02/12/0/1/0 astrocytoma, fibrillary143.00/11/0/0/0 astrocytoma, gemistocytic131.00/11/0/0/0 astrocytoma, juvenile pilocytic12.00/11/0/0/0 astrocytoma, diffuse929.03/68/0/1/0 astrocytoma, anaplastic1847.011/718/0/0/0 ganglioglioma229.00/22/0/0/0 glioma, unclassified539.02/35/0/0/0 glioblastoma6456.035/2961/2/0/1oligodendroglial tumors oligodendroglioma1742.09/816/0/1/0 oligodendroglioma, anaplastic1051.52/810/0/0/0 oligoastrocytoma334.01/23/0/0/0 oligoastrocytoma, anaplastic345.01/23/0/0/0eppendymal tumors ependymoma, myxopapillary224.50/22/0/0/0 ependymoma328.00/33/0/0/0 ependymoma, anaplastic160.00/11/0/0/0neuronal and mixed neuronal - glial tumors dysembryoplastic neuroepithelial tumor128.00/11/0/0/0 paraganglioma of spinal cord151.00/11/0/0/0median age at diagnosis of probands . Table 2.descriptive characteristics of glioma families from sweden, denmark, israel, and united states ascertained for multiplex ligation - dependent probe amplification analyses of tp53, cdkn2a / b, mlh1 and msh2categoriesnumber of affected individualsmedian age at diagnosisnon - gbmgbmn (%) n (%) pedigrees available for mlpa analysis united states8545.049 (57.0)36 (43.0) sweden1457.08 (57.1)6 (42.9) denmark3651.018 (50.0)18 (50.0) israel1049.55 (50.0)5 (50.0)pedigrees with 3 glioma united states4348.020 (46.5)23 (53.5) sweden760.06 (85.7)1 (14.3) denmark1156.05 (45.5)6 (54.5) israel556.01 (20.0)4 (80.0)pedigrees with 2 glioma + colon cancer united states5345.019 (35.2)34 (64.8) sweden1052.04 (40.0)6 (60.0) denmark2550.010 (40.0)15 (60.0) israel135.01 (100.0)napedigrees with 2 glioma + breast cancer us3548.015 (42.9)20 (57.1) sweden560.03 (60.0)2 (40.0) denmark2445.012 (50.0)12 (50.0) israel841.05 (62.5)3 (37.5)pedigrees with 2 glioma + malignant melanoma united states1651.510 (62.5)6 (37.5) sweden0nanana denmark961.05 (55.6)4 (44.4) israel241.02 (100.0)namedian age at diagnosis of probands.overlap because some of the probands were included in several categories.abbreviations: mlpa, multiplex ligation - dependent probe amplification; n, number of affected individuals; na, not applicable . Demographic characteristics of the probands and pathological characteristics of the glial tumors from sweden, denmark, israel, and united states ascertained for multiplex ligation - dependent probe amplification analyses of tp53, cdkn2a / b, mlh1 and msh2 median age at diagnosis of probands . Descriptive characteristics of glioma families from sweden, denmark, israel, and united states ascertained for multiplex ligation - dependent probe amplification analyses of tp53, cdkn2a / b, mlh1 and msh2 median age at diagnosis of probands . Abbreviations: mlpa, multiplex ligation - dependent probe amplification; n, number of affected individuals; na, not applicable . The samples were screened for large deletions / duplications by multiplex ligation - dependent probe amplification (mlpa). Small (5070 nt) sequences are targeted, enabling mlpa to identify single exon aberrations . The samples were ligated and amplified using the salsa mlpa p003 mlh1/msh2 probe mix version b2 according to the protocol manufacturer's recommendation (mrc - holland). The p003 mlh1/msh2 probe mix version 2 contains probes for each of the 19 exons of the mlh1 gene and for each of the 16 exons of the msh2 gene . Also, 2 probes are included for the most 3 exon of epcam, a gene located just upstream of the msh2 gene . Deletions of the most 3 exon of the epcam gene can result in silencing of the msh2 gene . In addition, the p003 mlh1/msh2 probe mix also covers 7 genes in the cdkn2a-9p21 region + pax5 (9p13) dock8 (9p24.3), and gldc (9p21.1). The samples were analyzed on a ceqtm 8000 geneticanalysis system (beckman coulter inc . ). Data normalization and analysis were performed with genemarker software version 1.75 (softgenetics) using standard parameters . Standard mlpa analysis was performed following the manufacturer's instructions (mrc - holland), version 31; 17 - 06 - 211 . One hundred nanograms of genomic dna were denatured and then hybridized with salsa mlpa probe mixes that covers 6 genes in the tp53 - 17p13.1 region + nf2 and chek2 (included chek2 * 1100delc). Probe mixes used were p056-a2 for tp53 and me024-b1 9p21 for cdkn2a/2b . Following ligation, pcr was performed in a bio - rad 1000series thermal cycler (bio - rad laboratories). Fragment separation was carried out as suggested by mrc - holland on an abi 3100 sequencer using pop7 polymer and genescan-500 rox sizing standard (applied biosystems). 8.75 l of hi - di formamide and 0.25 l of genescan-500 rox sizing standard were mixed with 1 l of the mlpa pcr product per sample for a total volume of 10 l . The samples were screened for large deletions / duplications by multiplex ligation - dependent probe amplification (mlpa). Small (5070 nt) sequences are targeted, enabling mlpa to identify single exon aberrations . The samples were ligated and amplified using the salsa mlpa p003 mlh1/msh2 probe mix version b2 according to the protocol manufacturer's recommendation (mrc - holland). The p003 mlh1/msh2 probe mix version 2 contains probes for each of the 19 exons of the mlh1 gene and for each of the 16 exons of the msh2 gene . Also, 2 probes are included for the most 3 exon of epcam, a gene located just upstream of the msh2 gene . Deletions of the most 3 exon of the epcam gene can result in silencing of the msh2 gene . In addition, the p003 mlh1/msh2 probe mix also covers 7 genes in the cdkn2a-9p21 region + pax5 (9p13) dock8 (9p24.3), and gldc (9p21.1). The samples were analyzed on a ceqtm 8000 geneticanalysis system (beckman coulter inc . ). Data normalization and analysis were performed with genemarker software version 1.75 (softgenetics) using standard parameters . Standard mlpa analysis was performed following the manufacturer's instructions (mrc - holland), version 31; 17 - 06 - 211 . One hundred nanograms of genomic dna were denatured and then hybridized with salsa mlpa probe mixes that covers 6 genes in the tp53 - 17p13.1 region + nf2 and chek2 (included chek2 * 1100delc). Following ligation, pcr was performed in a bio - rad 1000series thermal cycler (bio - rad laboratories). Fragment separation was carried out as suggested by mrc - holland on an abi 3100 sequencer using pop7 polymer and genescan-500 rox sizing standard (applied biosystems). 8.75 l of hi - di formamide and 0.25 l of genescan-500 rox sizing standard were mixed with 1 l of the mlpa pcr product per sample for a total volume of 10 l . Since some of the variants found in this study were not standardized and clinically validated mutations, we used massively parallel sequencing of hybrid - captured dna to further evaluate preliminary findings from mlpa screening of genes in the 9p21 region . Agilent sureselect probes were designed to capture the genomic regions of cdkn2a and cdkn2b, including introns and 20 kb adjacent 5 and 3 regions, which covered the regions implicated by mlpa . Paired - end sequencing 2 100 bp was performed on the illumina hiseq2000 instrument to an average depth of> 100 reads, followed by alignment to the reference genome . Coverage over the suspected deleted / duplicated regions was not found to be different from coverage in control samples . We were able to successfully analyze 127 out of 146 glioma cases for tp53 and cdkn2a / b . One hundred thirty - seven out of 146 glioma cases were also successfully analyzed for mlh1 and msh2 . One mutation found was a deletion of exon 1 - 6 in msh2; this mutation was present in the proband of a single family . The family included 3 glioma cases and 1 relative with colon cancer (table 3). The other affected relatives in this family were a maternal first cousin diagnosed with anaplastic astrocytoma at age 32 years, a maternal first cousin's child diagnosed with oligodendroglioma at age 51 years, and a maternal aunt diagnosed with colon cancer at age 84 years (table 3). Another aberration found was the variant chek2 1100delc, and this aberration was present in one family that included 3 cases with glioma and one relative with breast cancer (table 3). The other affected relatives were the proband's mother, who was diagnosed with a glioblastoma at age 72 years, the child of the mother's firstcousin diagnosed with a glioblastoma at age 41 years, and a maternal aunt diagnosed with breast cancer at age 38 years . Table 3.description of aberrations detected in glioma families from sweden, denmark, israel, and united states by multiplex ligation - dependent probe amplificationfamily idmaternal / paternalgliomascolon cancerbreast cancermelanomagenemlpa status1bilineal31msh2del exon 1 - 62maternal31chek21100 delc3paternal411cdkn2aprom dupl1022 before exon 14paternal211cdkn2aprom dupl1022 before exon 15paternal312cdkn2aprom dupl1022 before exon 16maternal31efnb3del exon 27paternal212efnb3del exon 28bilineal31gldcdupl 9p24.1the maternal (mother s side)/paternal (father s side) refer only to the glioma in the family.unconfirmed glioma on the maternal side.abbreviation: mlpa, multiplex ligation - dependent probe amplification . Description of aberrations detected in glioma families from sweden, denmark, israel, and united states by multiplex ligation - dependent probe amplification the maternal (mother s side)/paternal (father s side) refer only to the glioma in the family . In addition, we found, a duplication at the promoter of cdkn2aprom dupl1022before ex1 (in 3 of the families), a deletion at exon 2 of efnb3 delex2 (in 2 of the families) and a duplication of gldc dupl9p24.1 (in one family) but these aberrations could not be verified by next - generation sequencing (table 2). In this large family study of gliomas, we found one large deletion in exons 1 - 6 of msh2 in one of the swedish families with a family history of colon cancer . The sequence of the breakpoints of the exon 1 - 6 deletions and the haplotypes surrounding the mutation were identical in all 9 kindred, suggesting a common origin of the mutation . A similar mutation was reported as an american founder mutation in families with lynch syndrome, an autosomal - dominant cancer syndrome traced back to a single couple who migrated from germany, and settled in pennsylvania in the early 1700s . Lynch syndrome is known to be associated with hereditary colorectal cancer and several extracolonic cancers including endometrial, gastric, small - bowel, renal, ovarian, and brain . Despite a low incidence, brain tumors were the third highest cancer - related cause of death in a large dutch cohort of patients with lynch syndrome . Germline mutations in msh2 have also been described in families with a syndrome diagnosis such as turcot's syndrome, which is clinically characterized by occurrence of primary brain tumors and colorectal cancer . Mutations in msh2 result in production of a faulty, truncated, or absent protein, which impairs the ability of the mmr system to recognize and repair dna mismatches . We also identified rearrangements in the promoter of chek2, the variant chek2 1100delc, in one american family having a family history of breast cancer . Chek2 acts as a checkpoint gene, activated in response to dna damage, and encodes a serine / threonine - protein kinase that phosphorylates p53 . The germline 1100delc variant of chek2 is a frameshift mutation, resulting in a truncated and nonfunctional protein . Nevertheless, chek2 is a well - known median penetrant gene that is quite common in the population to our knowledge, this specific aberration in the promoter has not been previously described in the literature . The aberration in cdkn2a was present in 3 families, all of which have a family history of both breast and colon cancer . Unfortunately, we were unable to confirm this aberration by additional deep - sequencing methods . Because of the unusual structure of cdkn2a, mutations in this locus may affect both p16 and p14 depending on the localization and type of sequence alteration . The p16 has been found to be inactivated in the vast majority of melanomas through mutation, deletion, or promoter hypermethylation of cdkn2a . The cdkn2a has, as a low penetrant risk loci, been associated with risk of glioma and melanoma in genome - wide association studies . The aberration discovered in cdkn2a supports the finding that germline mutations in cdkn2a / cdkn2b could cause the co - occurrence of the melanoma - astrocytoma syndrome reported previously . However, we did not observe the cdkn2a aberration in our families with a family history of melanoma, so it might be possible that other low - penetrance genes contributed to the melanoma - astrocytoma syndrome in this study . In conclusion, candidate genes in known syndromes do not explain these glioma - prone families . Large rearrangements are uncommon events explaining cancer - prone glioma families, and novel strategies of exome and whole genome sequencing of glioma families with similar phenotypes are one likely strategy for the future . This work was supported by grants from the nih, bethesda, maryland (5r01 ca119215, 5r01 ca070917, r01ca52689, p50097257, r01ca126831, 5p30ca16672). Additional support was provided by the american brain tumor association, the national brain tumor society, and the tug mcgraw foundation . For more information about the gliogene consortium, the analyses was supported by the swedish cancer foundation, swedish research council, the acta oncologica foundation through the royal swedish academy of science (bm salary support), support from ka wallenberg, the northern sweden cancer foundation, and ume university young research awards, the ume university hospital cutting edge research funds . The costs of publication of this article were defrayed in part by the payment of page charges . The members of the gliogene consortium: department of pediatrics, section of hematology and oncology, dan l. duncan cancer center, baylor college of medicine, houston, texas (melissa l. bondy, ching c. lau, michael e. scheurer, georgina n. armstrong, yanhong liu); department of biostatistics, the university of texas md anderson cancer center, houston, texas (sanjay shete, robert k. yu); department of pathology, the university of texas md anderson cancer center, houston, texas (kenneth d. aldape); department of neuro - oncology, the university of texas md anderson cancer center, houston, texas (mark r. gilbert); department of neurosurgery, the university of texas md anderson cancer center, houston, texas (jeffrey weinberg); section of cancer genetics, institute of cancer research, sutton, surrey, united kingdom (richard s. houlston, fay j. hosking, lindsay robertson, elli papaemmanuil); department of epidemiology and public health, yale university school of medicine, new haven, connecticut (elizabeth b. claus); department of neurosurgery, brigham and women's hospital, boston, massachusetts (elizabeth b. claus); case comprehensive cancer center, case western reserve university school of medicine, cleveland, ohio (jill barnholtz - sloan, andrew e. sloan, gene barnett, karen devine, yingli wolinsky); departments of neurology, neurosurgery, and preventive medicine, university of southern california, keck school of medicine, los angeles, california (rose lai, roberta mckean - cowdin); cancer control and prevention program, department of community and family medicine, duke university medical center, durham, north carolina (dora il'yasova, joellen schildkraut); cancer and radiation epidemiology unit, gertner institute, chaim sheba medical center, tel hashomer, israel (siegal sadetzki, galit hirsh yechezkel, revital bar - sade bruchim, lili aslanov); sackler school of medicine, tel - aviv university, tel - aviv, israel (siegal sadetzki); cancer late effects research, oncology, finsencenteret, rigshospitalet, university of copenhagen and head, survivorship, danish cancer society research center, copenhagen, denmark (christoffer johansen,); neurosurgery department, rigshospitalet, university copenhagen (michael kosteljanetz), neuropathology department, rigshospitalet, university of copenhagen, copenhagen, denmark (helle broholm); department of epidemiology and biostatistics, memorial sloan - kettering cancer center, new york, new york (jonine l. bernstein, sara h. olson, erica schubert), department of neurology, memorial sloan - kettering cancer center, new york, new york (lisa deangelis); mayo clinic comprehensive cancer center, mayo clinic, rochester, minnesota (robert b. jenkins, ping yang, amanda rynearson); department of radiation sciences oncology, ume university, ume, sweden (ulrika andersson, carl wibom, roger henriksson, beatrice s. melin); computational life science cluster (clic), ume university, ume, sweden (carl wibom); department of medical biosciences, pathology, ume university, ume, sweden (kristina cederquist); department of oncology, clinical science, lund university, lund, sweden (steina aradottir, ke borg); evanston kellogg cancer care center, north shore university health system, evanston, illinois (ryan merrell, patricia lada); departments of neurological surgery and epidemiology and biostatistics, university of california, san francisco, california (margaret wrensch, john wiencke, joe wiemels, lucie mccoy); division of epidemiology and biostatistics, university of illinois at chicago, chicago, illinois (bridget j. mccarthy, faith g. davis).
Modification of the efficacy of synaptic transmission, or synaptic plasticity, is widely considered as the basis of activity - dependent neuronal development and learning (feldman and brecht, 2005). A well - characterized form of synaptic plasticity is the potentiation and depression of synaptic transmission occurring at many neuronal structures including primary sensory cortices (see, e.g., frgnac and shulz, 1999; foeller and feldman, 2004). Experimental approaches to unveil changes in the strength of connections between two neurons have extensively developed since the 1970ies, based on the theoretical ground proposed by hebb (1949). In chapter 4 (the first stages of perception: growth of the assembly) of his book the organization of behavior, hebb proposes that repeated stimulation of specific receptors will lead slowly to the formation of an assembly of association area cells which can act briefly as a closed system after stimulation has ceased . The formation of a neuronal assembly was proposed to be implemented by a decrease of synaptic resistances induced by the persistence of reverberating activity that is sustained ongoing activity after transient inputs . Locally, at the level of a synapse, a period of maintained temporal correlation between pre- and postsynaptic activity would lead to an increase in the efficacy of excitatory synaptic transmission . Although hebb's rule became a widely used algorithm in computational models of brain functioning, its straightforward application leads to instability of the system induced by the continuous growth of synaptic efficacies which in turn leads to a saturation of all the plastic elements of the network . This divergence of synaptic weights was solved by theoreticians by using various rules of normalization which require, in addition to hebb's rule, depression of the gain of other competing synapses (stent, 1973; von der malsburg, 1973; sejnowski, 1977a, b). For instance, a model of self - organization was proposed by von der malsburg (1973) to account for the development of orientation selectivity in the visual cortex . Based on the hebbian principle, the model introduces a normalization rule where the sum of the synaptic weights of afferent contacts on one neuron remains constant with time . This implies that local increase in synaptic weight is obtained in detriment of all other contacts that were inactive at the same time . This rule bears similarities with the rule proposed by stent (1973) who assumed a selective decrease in the efficacy of synaptic transmission of afferent fibers which were inactive at the time when the postsynaptic neuron was discharging under the influence of other inputs . The algorithms of synaptic plasticity introduced by sejnowski (1977a, b) to model plasticity in the cerebellum, and later by bienenstock et al . (1982) for the primary visual cortex, overcome the problem of the synaptic saturation without introducing an ad hoc normalization rule . They are based on an input / output covariance algorithm where the change in synaptic efficacy is proportional to the covariation of pre- and postsynaptic activities . This covariation corresponds to the product of the differences of the instantaneous pre- and postsynaptic activities from their respective mean values (averaged over a certain period of preceding time). Covariance - based algorithms predict that the same synapse can both increase and decrease its synaptic efficacy, thereby allowing the connectivity state of the network to evolve into non - trivial states, i.e., non - diverging stable points that attract the dynamics of the system . Correlation - based algorithms of synaptic modification have been extensively studied experimentally in vivo in the developing visual cortex (frgnac et al ., 1988, 1992; reiter and stryker, 1988; frgnac and shulz, 1989; bear et al ., 1990; debanne et al ., 1998; mclean and palmer, 1998), the adult visual cortex (shulz and frgnac, 1992) and the adult auditory cortex (ahissar et al ., 1992, 1998; cruikshank and weinberger, 1996). Thus, most algorithms used to model synaptic plasticity in the developing or adult cortex include synaptic potentiation and depression rules . They can be mathematically described by a general equation where the modification of synaptic weight as a function of time is proportional to the product of a presynaptic and a postsynaptic term (review in frgnac and shulz, 1994, 1999). In these plasticity algorithms a precise temporal order between pre- and postsynaptic activation onsets is not required . Nonetheless, a temporal contiguity between the two events, that is a proximity in time of not more than several tens of milliseconds was required for synaptic potentiation in cortex both in vivo (baranyi and feher, 1981; wigstrm and gustafsson, 1985) and in vitro (frgnac et al ., 1994). More recently, a new form of hebbian plasticity has been described in which tight temporal contiguity and order between presynaptic and postsynaptic activities determine the amplitude and the sign of the synaptic change respectively . On theoretical grounds, this plasticity rule called spike - timing - dependent plasticity (stdp) has been proposed to be a major, computationally powerful, mechanism for induction of synaptic plasticity in vivo (gerstner et al ., 1996; abbott and nelson, 2000; song et al ., 2000; van rossum et al ., 2000) and a biologically plausible information storage mechanism in the brain . As we will see later, experimental evidence in vivo for this is still scarce . The induction of synaptic potentiation and depression depends, at least in the quiescent in vitro network, on the relative millisecond - scale timing of presynaptic and postsynaptic action potentials (debanne et al ., 1994, 1997; bell et al ., 1997; markram et al ., 1997; bi and poo, 1998; nishiyama et al ., 2000; kobayashi and poo, 2004; wang et al ., 2005; fino et al ., 2009). In pyramidal cells of layers 23 and 5 of sensory cortices, when an excitatory postsynaptic potential (epsp) generated by the presynaptic action potential precedes by up to a few tens of milliseconds the postsynaptic action potential, potentiation of the synapse is induced . Conversely, depression of the synapse is observed when the epsp follows the postsynaptic action potential by short (020 ms) or long (0100 ms) intervals, depending on the synapse being studied (feldman, 2000; sjstrm et al ., 2001; froemke and dan, 2002; sjstrm and nelson, 2002). This in vitro demonstrated stdp has been specifically proposed to be important for experience - dependent plasticity at layer 4 to layer 2/3 synapses in vivo (feldman and brecht, 2005). An anti - hebbian form of stdp with similar temporal requirements but inverse order has been described in cerebellum - like structures with comparable cell types (bell et al ., 1997; tzounopoulos et al ., 2004 in the electrosensory lobe of the electric fish, this anti - hebbian stdp has been proposed to suppress the afferent sensory consequences of an associated motor act, facilitating the detection of unexpected stimuli (review in bell, 1989; bell et al ., 1999). Despite intensive studies in brain slices and cultured neurons showing that stdp is a robust phenomenon at many cortical synapses, much scarcer evidence is available about how stdp is induced by neuronal activity in the mammalian cortices in vivo (review in dan and poo, 2006; caporale and dan, 2008). Since the statistical properties of neuronal activity patterns differ between in vitro and in vivo recording conditions, it is crucial to determine if stdp exhibits similar induction requirements . An increasing number of studies are addressing this question, although only a few have directly observed stdp at the level of synaptic responses (see, e.g., bell et al ., 1997; meliza and dan, 2006; cassenaer and laurent, 2007; jacob et al ., 2007). One of the main difficulties in assessing stdp in vivo is that the induction protocols are not as uniform as in vitro, rendering the comparison between them hazardous . The pioneering work of levy and steward (1983) defined for the first time the coactivity requirements for synaptic potentiation in the hippocampus of anesthetized rats . The associative induction of long - term potentiation did not require perfect synchronicity of convergent presynaptic elements but unexpectedly, levy and steward observed that the order of the potentiation trains of stimulation was crucial in defining the polarity, potentiation or depression, of the synaptic change . A retrograde interaction between a process initiated within the main dendritic shaft and individual spines was necessary and proposed a retrograde electrical invasion of the spine structure as an appealing possibility (see stuart et al . Stdp has been further shown in vivo at the single - cell level in the developing tectum of xenopus tadpoles (zhang et al ., 1998). Evoked synaptic currents were recorded through whole - cell perforated patch electrodes while the contralateral retina was stimulated electrically at minimal stimulation intensity . By varying the time between the postsynaptic tectal action potential and the retinal input, zhang and collaborators showed synaptic potentiation for inputs that repetitively arrived within 20 ms before the tectal spike and depression for inputs repetitively arriving within 20 ms after the tectal action potential . In the same preparation, visual inputs, instead of electrical stimulation, with particular time relationships with the postsynaptic action potential can induce long - term potentiation and depression compatible with stdp (mu and poo, 2006; see also engert et al ., 2002). The functional consequences of such changes in retinotectal connections have been studied by reverse correlation mapping at the level of the visual receptive field (vislay - meltzer et al ., 2006). Positive or negative stdp protocols combining visual activation in ectopic areas of the visual field (i.e., outside the classical receptive field) and the postsynaptic current activation through the recording patch pipette were applied . These protocols were shown to sculpt receptive fields by enhancing or removing responses arising from the stimulation of conditioned sub - regions of the receptive field . 2003) have shown similar changes in the receptive field structure of primary visual cortex in cat, induced by a combined visual and intracellular stimulation protocol . Interestingly, the changes in receptive field structure could be dynamically reversed, although not completely, by 10 min of spiking activity induced by white noise visual stimulation (vislay - meltzer et al ., 2006). (2003) showing the reversibility of activity - dependent synaptic changes by a short period of spontaneous activity (mainly bursting activity) and points to the strong lability of plastic changes in vivo compared to the in vitro conditions (see below). The quiescent state of the network in vitro allows the maintenance of an induced synaptic change since no spurious pairings occur . However, if randomized pairings at time intervals encompassing both ltp and ltd windows are imposed in vitro, robust ltd is observed (feldman, 2000). This results since the temporal window (i.e., the integral of the learning curve) of ltd is longer than that of ltp (feldman, 2000; froemke and dan, 2002). Consequently, the lability of the changes observed in vivo could result from higher levels of ongoing activity associated to an asymmetric stdp rule . The asymmetry of the learning rule in vivo depends however on the studied system (compare meliza and dan, 2006 and cassenaer and laurent, 2007). In the somatosensory cortex in vivo however, one cannot exclude that a smaller asymmetry of the plasticity rule combined to a high level of ongoing activity could have the same overall reversal effect . Since the stdp window looks narrower in vivo compared to in vitro (compare feldman, 2000 with jacob et al ., 2007), an alternative scenario would be that the temporal windows for ltd and ltp were dynamically adjusted by the ongoing activity . Because the level of activity is higher in vivo than in vitro, the system would compensate for the spurious pre - post pairings by decreasing and rendering more symmetric the temporal windows for ltd and ltp ., the occurrence of stdp has been indirectly studied by pairing sensory and/or electrical stimulations at time intervals compatible with the stdp rule (schuett et al ., 2001; yao and dan, 2001; fu et al ., 2002; yao et al ., 2004). The sensory stimulations increase the firing probability of neurons within a defined window of time, and thus the pairing of two stimuli favors the imposed spike - timing interactions . In most studies using sensory sensory associations (see also dahmen et al ., 2008 for a similar study in a1), the modifications of the neuronal response properties are rather small, particularly at the single - cell level, but the temporal specificity and the sign of the resulting response modifications are in agreement with the direction of response modifications expected from an stdp scenario and support the idea that stdp could mediate experience - dependent modulation of receptive fields in the visual cortex in vivo . (2001) included more than 25,000 pairings between a visual stimulus presented at 7 hz during 3 h and an associated intracortical electrical stimulation . Although the changes in the intensity of the voltage sensitive dye signal and the expansion of the cortical area representing the paired visual orientation last for up to 18 h after pairing, that is, much more than shown in any other study, the number of pairings is a hundred times larger than the average number of pairings of other studies and thus precludes a reasonable comparison . Stdp has been directly observed in vivo at the level of synaptic responses in the visual cortex (meliza and dan, 2006). Whole - cell recordings in the rat primary visual cortex were used to pair visually induced depolarization with spiking of the recorded neuron induced by current injection . Depending on the order of the visual input and the postsynaptic action potential, potentiation or depression was observed . Here, but also as a general observation of synaptic modification in vivo (see, e.g., jacob et al ., 2007), the amplitude of the modifications is smaller and more variable than those observed in cortical slices (froemke and dan, 2002). In the intact brain neurons are submitted to a strong bombardment of input activity that affects the temporal control of presynaptic activity during pairing and in turn, affects stdp induction . Thus, the question of stdp incidence in intact sensory cortices in mammals has still to be substantiated . In the in vivo somatosensory cortex of the rat, whisker deprivation results in cortical map modifications, which are concomitant with changes in the relative timing of thalamic and cortical action potentials within the stdp range (allen et al ., 2003; celikel et al ., this indicates that stdp could be involved in response modifications at the cellular level during experience - driven network reorganizations . Indirect evidence for this comes from a combined electrical stimulation of somatosensory afferents and transcranial magnetic stimulation (tms) of the somatosensory cortex in humans (wolters et al ., 2005, see also wolters et al ., 2003 for a similar study on the motor cortex). Evoked potentials induced by the tms were either enhanced or depressed as a function of the order of the paired associative stimulation . In the primary somatosensory cortex of anesthetized adult rats, backward pairings of spontaneous postsynaptic action potentials with subthreshold afferent excitation elicited by whisker deflections lead to depression of responses to the paired whisker with no significant changes to the unpaired whisker (jacob et al ., 2007). The experimental protocol was based on mechanical deflections of the whiskers only, and no electrical stimulation of the afferent pathway was used during the pairing (see figure 1a1). Since the action potentials of the recorded neuron were not artificially triggered but spontaneously fired by the recorded neuron, it was impossible to program a whisker stimulation that systematically preceded the action potential . Consequently, only the depression side of the stdp curve was studied . Although still in agreement with the stdp rule, the effect was observed only for time intervals shorter than 17 ms(see an example in figure 1a2), indicating that the range of synaptic delays that drive synaptic depression is narrower in vivo (see also yao and dan, 2001; fu et al ., 2002; cassenaer and laurent, 2007; dahmen et al ., 2008 for a similar observation) the shortening of the stdp window seems to depend on the developmental stage of the animal, since short windows (<20 ms) were observed in the adult (yao and dan, 2001; fu et al ., 2002; dahmen et al ., 2008 and the extracellular backward pairings in jacob et al ., 2007, see figure 1a3) whereas longer stdp windows (3550 ms) were observed in younger (intracellular pairings in jacob et al ., 2007, see figure 1b3) or developing (meliza and dan, 2006) animals . In the backward pairing (jacob et al ., 2007), the trains of whisker deflections were temporally irregular because the pairing was based on the spontaneously emitted action potentials of the recorded neuron . To assess the impact of such irregularities during pairing, several established models of integration of stdp (song and abbott, 2001; froemke and dan, 2002) were used to fit the experimental data . However, no satisfactory fitting was obtained (jacob et al ., 2007). To explore the potentiation side of the stdp curve in vivo, whole - cell patch recordings were needed (see figure 1b1). Using this technique, a timing - dependent depression of responses specific for the paired whisker was observed but spike - timing - dependent potentiation was more sporadically induced (figures 1b2,b3). Thus, spike - timing - dependent depression can be effectively induced in vivo and is therefore a plausible plasticity mechanism in the somatosensory cortex although a refinement of specific plasticity models is still necessary to fully account for the observed response and synaptic changes . (a1) experimental protocol for backward pairing . During control and test (not shown) whisker deflection of the principal and one adjacent whiskers were presented in a pseudorandom sequence at 0.5 hz . The input waveform for each deflection was a 10 ms rostrocaudal movement followed by a 10 ms plateau and a ramp back to the rest position . During pairing, a spontaneously emitted action potential triggered a subthreshold deflection of one whisker with a fixed delay (0, 10, 20, or 30 ms). (a2) significant depression (p <0.05) of response of a single neuron in the barrel cortex after a backward pairing (red histogram, after pairing) compared to control (green histogram, before pairing). (a3) specific depression for short delays of pairing . The mean response modification for the paired whisker (r = after before / after + before) is plotted against the delay of the pairing . The delay has been corrected to take into account the latency of the cortical response . The depression is significant (t - test, * p <0.05) only for pairings at a short - delay window (<17 ms). (b1) experimental protocol for whole - cell induction of stdp in vivo . During control and test (not shown) whisker deflection of the principal and one adjacent whiskers were presented in alternation at 0.5 hz . During pairing, whisker deflection was paired with current injection to elicit postsynaptic spikes at different delays (from 30 to + 30 ms). (b2) induction of spike - timing - dependent synaptic depression (left) or potentiation (right) in two representative neurons . Whisker deflection induced psp (wpsp) were averaged over 50 trials during baseline (green line) and after pairing (red line). (b3) learning rule for spike - timing - dependent synaptic depression in l2/3 in vivo . Mean pairing - induced changes in amplitude of the wpsp (psp = after before / before) as a function of delay between postsynaptic spikes and wpsp onset . As already mentioned, the different experimental protocols applied in vivo to induce stdp are rather heterogeneous in terms of the temporal frequency of the pairing and of the number of associations . In addition, while some studies combined peripheral sensory stimulation with juxtacellular or intracellular current injection to control the postsynaptic spiking discharge, others used combined sensory - sensory stimulation at inter - stimulus intervals compatible with the stdp rule . A comparative analysis is presented in table 1 that shows a list of in vivo experiments with the corresponding characteristics of the pairings as well as the amplitude and duration of the induced effect . A peculiar correlation appears from such comparative study, which is the inverse link between the number of pairings (the table is sorted from the highest to the lowest number of pairings) and the amplitude of the resulting modification in sensory responses [see column change (ltp or ltd), expressed as percentage of baseline, in table 1]. The inverse relation holds for response potentiations and depressions separately as well as for the cumulated effect (not shown in table 1). The interpretation of this relationship is hazardous since there are noticeable experimental differences between the studies, including the age, the cortical area, the recording methods, the temporal frequency of pairings and more importantly, the induction protocols themselves (sensory versus electrical afferent activation). Many of the studies showing larger effects induced by a relatively small number of pairings include an intracellular control of the postsynaptic spiking activity whereas on the other hand many of the studies with a high number of pairings and relatively small plastic changes include sensory - sensory stimulation as a way of controlling the temporal correlation of pre and postsynaptic activities . Nonetheless, one plausible interpretation is that in vivo spontaneous activity generates spurious coincidences of both signs that dilute the effect of the pairing, and this effect accumulates with the number of pairings . Alternatively, homeostatic mechanisms with longer time scales than the stdp rule and saturation of synaptic modifications with several tens of associations (see froemke et al ., 2006) can regulate the expression of synaptic plasticity . Stdp experiments conducted in intact nervous systems (sorted by the number of pairings). A, auditory stimulus; ap, action potentials; bf, best frequency; csc, compound synaptic current; ep, evoked potentials; epsc, excitatory postsynaptic currents; epsp, excitatory postsynaptic potentials; es, electrical afferent stimulation; ic, intracellular current; lfp, local field potential; moving v, moving oriented light bar; ns, not studied; o, olfactory stimulus; rf, receptive field; sap, spontaneous action potential; scd, spontaneous corollary discharge; t, tactile stimulus; tc, tuning curve; tms, transcranial magnetic stimulation; v, visual stimulus . Cumulated effect = ltp ltd . * no significant modifications of response amplitudes were observed . * the percentage change compared to baseline is not provided for the shift of the tc, * * * the percentage change compared to baseline is not provided . * * * * trains of 8 pulses at 400 hz repeated eight times at 0.1 hz . Developmental synaptic plasticity based on covariance rules in sensory cortices depends on the firing rate of presynaptic neurons . At high firing rates, the synapse is potentiated whereas at low firing rates, the synapse is depressed (see review in bear, 2003; malenka and bear, 2004). Conversely, within the framework of the stdp rule, potentiation or depression can be obtained by changing the relative timing between pre- and postsynaptic action potentials with no need for changes in the firing rates . The pairing protocol applied in the somatosensory cortex (jacob et al ., 2007) controls the temporal correlation between pre and postsynaptic spikes without inducing significant modifications of the firing rate of the neuron . Consequently, the induction of the observed functional plasticity is rate - independent although the level of plasticity itself can be modulated by the temporal frequency of the ongoing activity during pairing (see below). (1992, 1998) where an increase of the functional connectivity between two neurons was induced by increasing the temporal correlation of their activity using a backward pairing similar to the one applied in our study . The temporal frequency of the pairing was shown to influence stdp (sjstrm et al ., 2001): at low frequencies, depression dominates, whereas potentiation is induced at high frequencies . In the somatosensory cortex experiments (jacob et al ., 2007), the depression induced by short - delay pairings depended on the firing frequency during pairing . It should be noted that the pairing frequency in this protocol was dictated by the spontaneous activity of the recorded neuron and was not arbitrarily chosen by the experimenter . The vulnerable nature of the activity - dependent synaptic modifications in vivo could result from the effect of the ongoing activity irrespective of the sensory driven activity . Under this scenario, there should be a dependence of the level of synaptic plasticity on the ongoing activity . Indeed, the induced depression of response was maximal for intermediate spontaneous firing rates, with an optimal firing rate at 2.5 hz (see figure 2). Below one action potential per second, this decrease of the level of depression for very low frequency pairings has not been observed in vitro, and may result from the fact that at very low frequency of discharge the overall time of the pairing period (400 pairings in jacob et al ., 2007) is too long compared to the duration of the effect produced by each individual pair of action potentials . This result suggests that there is an optimal level of ongoing activity for the induction of stdp . Then, it can be proposed that in vivo, cortical structures with intermediate (a few action potentials per second) or sparser activities are more prone to show stdp . (a) experiments were performed in the barrel cortex of adult anesthetized rats (see jacob et al . During pairing, a spontaneously emitted action potential triggers a subthreshold deflection of a whisker with a fixed delay (0, 10, 20, or 30 ms). One pairing period contains 400 associations between an action potential and a stimulation of the whisker . (b) the differential change in response (rdiff) defined as the difference between modifications of responses in the paired and the unpaired pathways, is plotted against the mean temporal frequency of the spontaneous action potential discharge during pairing, at short delays (upper plot, 17 <delay <7 ms) and longer delays (middle plot, delay <17 ms). A band - pass curve fitted to rdiff for the short - delay pairings (not shown) gives a preferred frequency for the induction of response depression of 2.57 hz . In the lower two scatter plots, relative changes in response (rdiff) are plotted against the delay of the pairing computed as the imposed delay plus the latency between the stimulation and the arrival of the afferent volley to the cortex . The separation of the pairing population was based on the frequency during the pairing with frequencies between 1.5 and 4.5 hz (left plot) leading to depression . Stdp may be particularly useful in brain regions in which spike rates are low and information is conveyed in spike - timing information . The range of ongoing and evoked firing rate in awake animals differs in the different cortical areas . Extracellular recordings revealed firing rates between 10 and 25 hz in the visual cortex (kasamatsu and adey, 1974; livingstone and hubel, 1981), less than 5 hz in the auditory cortex (edeline et al ., 2001) and less than 1 hz in the barrel subfield of the somatosensory cortex (crochet and petersen, 2006). Ongoing activity in the network affects postsynaptic membrane properties and can modulate the induction of plasticity and compromise the stability of the synaptic modifications . There are striking differences as well between sensory cortices in the ratio between phasic or tonic patterns of evoked firing . Does stdp efficiency correlate with the sparseness of natural activity? In the retinotectal synapses of developing xenopus, where stdp has been extensively demonstrated, the activity is sparser than in the cortex of mammals (the spontaneous firing rate is below 1 hz, the evoked firing rate is between 1 and 2 hz). In the locust olfactory system, stdp has been induced in the synapses formed between the kenyon cells of the mushroom body and cells located in the -lobe (cassenaer and laurent, 2007). Here too, the activity of the kenyon cells is extremely sparse: the average spontaneous firing rate is below 0.01 spikes per second and the activity evoked by odor presentation is still below 2 spikes per second (perez - orive et al ., 2002; jortner et al ., 2007). Remarkably, long - term potentiation and depression can be induced in this system after only a few pairs of action potentials . In other terms, is stdp plausible in a natural in vivo condition? In the hippocampus, a prominent activity pattern is that of theta oscillations between 4 and 12 hz (buzski and draguhn, 2004). The phase and frequency of the theta rhythm is under the fine control of at least two independent generators acting together (kocsis et al ., 1999). Recent intracellular recordings in hippocampus of freely moving rats confirmed that theta rhythms are present at the synaptic level (lee et al ., 2006, 2009). Single - cell activity includes a few action potentials per cycle constrained to a particular phase . However, the phase of action potentials in the cycle changes as a function of the position and the direction of the animal (o'keefe and recce, 1993). This observation suggests that the timing of the spikes conveys information and constitutes a potential basis for physiological stdp to occur . Similarly to the observation in the somatosensory cortex, stdp - like pairings in the ca1 field of the in vivo hippocampus by stimulation of the schaffer pathway and of the contralateral commissural pathway, induced potentiation at 5 hz but not at 1 or 10 hz (dong et al ., 2008). It is likely that the occurrence and amplitude of plasticity is tuned by the frequency of the theta rhythm and the phase of the spikes in the theta cycle leads to a selection of the synapses being potentiated or depressed . Different rhythms are present at the microscopic and macroscopic level also in the cortex (steriade, 2001; crochet and petersen, 2006; poulet and petersen, 2008) and they might affect the induction of plasticity . Non - alert states have been associated with large oscillations at low frequency (15 hz), which reveal a synchronized activity and are reminiscent of the up and down states observed in anesthetized animals . Changes in the amplitude of the sensory responses, size of receptive fields, and rate of spontaneous firing are observed in the alert animal compared to the non - alert animal in the visual (wrgtter et al ., 1998; eyding et al ., 2003; stoelzel et al ., 2009), the auditory (edeline et al ., 2001) and the somatosensory (chapin and lin, 1984; de kock and sakmann, 2009) cortices . Interestingly, the spontaneous firing rate of thalamocortical neurons is lower and at the same time the rate of burst discharges is higher during synchronized non - alert states compared to alert desynchronized states (stoelzel et al ., 2009). These patterns of activity characteristic of the non - alert brain should have an impact in stdp induction since for example, cortical stdp induced in vitro at low frequency (sjstrm et al ., 2001; sjstrm and nelson, 2002; froemke et al ., 2006) and/or by bursts of action potentials (birtoli and ulrich, 2004; froemke et al ., 2006) favors synaptic depression, even if one has to keep in mind that these observations were made in layers 23 and 5, that is, in non - thalamo - recipient cortical layers . Attention related modulatory signals can change the sparseness of activity in the cortex (vinje and gallant, 2002), increasing the temporal precision of the network activity regime (frgnac et al ., 2006), and rendering the system more prone to stdp induction . Cortical release of noradrenaline for example, produces a reduction of spontaneous and evoked activity in the visual cortex (ego - stengel et al ., 2002). Through this powerful inhibitory action, the noradrenergic system might provide a reset signal (dayan and yu, 2006), broadcasted to the whole cortical mantle, leading to an optimized level of activity for the induction of stdp . Other neuromodulators can dynamically regulate timing - based plasticity rules by modifying the biophysical properties of dendrites and the efficacy of spike back propagation (tsubokawa and ross, 1997; sandler and ross, 1999). Action potentials back propagating into the dendritic tree critically determine the induction of stdp (engelmann et al . 2008), and its amplitude can be modulated by the network state (waters and helmchen, 2004) and dendritic depolarization (sjstrm and husser, 2006), both known to be modulated in turn by ascending neuromodulatory signals . A recent comparative study of corticostriatal plasticity in anesthetized and awake animals (stoetzner et al ., 2010) showed that the stdp plasticity rule depends critically on the behavioral state . Further in vivo experiments combining stdp induction protocols concomitant with the activation of neuromodulatory ascending systems (for slice and cell culture studies see lin et al ., 2007; pawlak and kerr, 2008; zhang et al ., 2009) are needed to explore how local rules of synaptic plasticity in general (shulz et al . Stdp in particular are regulated by global factors acting on several spatial (dendrites, neurons, network) and temporal (milliseconds to minutes) scales . In conclusion, in vivo experimental evidence for stdp, although not yet compelling, has been recently provided in various species and neural structures . Significant variations of the rule (e.g., the temporal length of the stdp window) have been observed and some properties of the induced plasticity, like the duration of the effect, differ from those observed in in vitro preparations . Endogenous patterns of ongoing in vivo activity like oscillatory rhythms, burstiness and sparse neural activity might help to counteract the effect of spurious spike coincidences and reduce the vulnerability of plasticity in vivo . In addition, attention related neuromodulatory signals, through the regulation of activity patterns and/or the adaptation of the plasticity rule itself (i.e., metaplasticity, abraham, 2008) might optimize the induction and expression of stdp in the intact brain . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Microleakage is one of the most important reasons for the secondary decay, inflammation, and necrosis of the pulp . In resin composite restorations, microleakage occurs between cavity wall and restorative materials usually due to the polymerization shrinkage . Composition of the bonding agents is one of the most important prerequisites to ensure a good seal and stable adhesion to the tooth tissue . The purpose of adding a solvent to the dental bonding agent is to dilute it to create a thin layer on the surface of etched tooth, and displacement of water from the collagenous network and penetration of resin monomers into these spaces . Although the presence of the solvent in bonding agent is necessary, the entire solvent must be completely eliminated from bonding before curing the bonding agent because its presence can have adverse effects on polymerization of the resin monomers . When the solvent's concentration is too high, reduced photoinitiator concentration and occupation of spaces between the monomer molecules will cause a reduction in the conversion of monomers to polymers and reduces the mechanical properties and strength of the bonding . Therefore, after bonding resin applications, the solvent is removed from the resin using air - stream . Acrylate in dental adhesives makes an important contribution in polymerization and creating an appropriate bonding . On the other hand, polyhedral oligomeric silsesquioxanes (poss) poss as cross - linking agents in bioadhesive acrylate affect the contractile behavior and improve their physical and mechanical properties . Observing the hybrid layer with scanning electron microscope, reported that among the different concentrations of ethanol as solvent (10%, 30%, and 50%), the concentration of 30 wt% was the optimum percentage of the solvent and concentrations of less than 10 wt% and over 50 wt% resulted in poor quality hybrid layer . Holmes et al . Reported that in a resin matrix which prepared with six different concentrations of acetone and ethanol, the highest conversions of monomer to polymer were observed in acetone and ethanol with concentrations of 5 mol and 2.5 mol, respectively . However, in higher concentrations of the solvents, the polymer conversion rate was reduced quickly so that at 13 mol approached zero . As the solvent concentration plays an important role in the efficiency of dentin binding agents, the present study was designed to evaluate the effect of ethanol concentration as a solvent in experimental acrylate - based dental adhesives containing poss, on the microleakage of dental composite restoration . In this experimental study, 42 extracted sound noncarious human premolars without restorations, abrasion, and cracks were selected and stored for 2 months in 0.2% thymol solution before performing the study . Standard class v cavities (h w d = 3 4 2) were prepared with 0.8 mm cylindrical diamond burs using a high - speed handpiece and water coolant in the buccal and lingual sides with the occlusal margin in enamel and the cervical margin in dentin . The teeth were randomly divided into 6 experimental groups of 7 . In all groups, teeth were acid etched by 35% phosphoric acid gel (ultradent, usa) for 15 s, rinsed for 15 s and blot - dried for 2 s. in group 1, as the control group, adper single bond, 3 m, usa was used the adhesives of all the test groups contained di and trimethacrylate monomers, poss, and photoinitiator system but the concentration of ethanol, as the solvent, in groups 2 through 6 varied and was 0%, 20%, 31%, 39%, and 46% by weight, respectively . The adhesives were prepared in iran polymer and petrochemical institute, tehran, iran . The adhesives were applied and light cured for 20 s at an intensity of 600 mw / cm (litex 695c, taiwan). Cavities in all control an test groups were restored with filtek z350 nanocomposite (3 m espe, usa) in 3 increments . Each increment of composite resin was cured for 40 s. finishing and polishing were done with flamed shaped polishing bur and disks (soflex, 3 m espe, usa). All samples were thermocycled between 5c and 55c for 1000 cycles . Then, wax was used to seal apics of all specimens . All the surfaces of teeth up to 1 mm around the restorations were covered with two layers of nail varnish . Then, specimens were immersed in 2% basic fuchsine (merck, germany) solution at room temperature for 24 h. the teeth were then rinsed thoroughly with distilled water . Cnc cutting section machine (fanavaran pars, iran) was used to section the specimens in halves through the middle of the restoration . Dye penetration in each section was scored under stereomicroscope (mbc-10, hp, usa) with 32 magnification . The following dye penetration standard scoring was used: 1 = penetration up to one - third of the cavity depth 2 = penetration up to two - third of the cavity depth 3 = penetration up to more than two - third of the cavity depth 4 = penetration up to axial wall or toward the pulp . Whitney u - test, and wilcoxon tests while significance was predetermined at p <0.05 . Table 1 shows the number and percentage of microleakage scores at enamel and dentinal margins . Number and percentage of scores at enamel and dentinal margins illustrates the representative microscopic images showing the scores of microleakage, taken under a stereomicroscope (at a 32 magnification). According to kruskal wallis test, there were significant differences in microleakage in enamel margins (p = 0.036) and in dentinal margins (p = 0.008) between all the tested groups . According to wilcoxon test, microleakage in dentinal margins was higher than enamel margins (p <0.001). In groups with 46 wt% solvent (p = 0.103), 0 wt% (p = 0.122), and control group (p = 0.096), microleakage results in the enamel and dentinal margins for the study groups are shown in table 2 . In the present study, an acrylate - based experimental bonding agent with varied solvent concentrations was used . The experimental bonding agent also contained poss nanostructures to improve the mechanical properties of the adhesive . The rate of resin composite microleakage was checked out in dentinal and enamel margins . In the study, ethanol solvent in experimental groups was the same as the solvent applied in the control group . The reason for using ethanol is the benefits of this solvent . Because of the higher boiling point of ethanol than acetone and establishment of hydrogen bonds with water remaining in dentin, its volatility is less, but still has more evaporation power than water . Have shown that the bonding agents containing acetone will lose the solvent rapidly, but bonding agents containing water are almost stable . Due to the rapid evaporation of acetone and lack of ability to penetrate the dry collagen network of dentin, the dentin should have sufficient moisture before using the bonding agents containing acetone . While ethanol is less sensitive to moisture and this will make it easier to use . Furthermore, bonding agents containing water, due to a low evaporation rate of water leads to a nonuniform hybrid layer and the remaining water prevents resin monomer polymerization, so the bond strength will be decreased . Therefore, bonding agents with ethanol compared to acetone needs more time to dry and there is a possibility of phase separation . Microleakage was significantly higher, in both enamel and dentinal margins, in group containing 0 wt% solvent, compared to the control group . It is attributed to the high resin viscosity in the 0% group and its lack of penetration into enamel porosities and intertubular dentin spaces . By increasing the solvent concentration, the microleakage decreased so that the leakage in enamel margins of the group containing 31 wt% solvent reduced significantly compared to the group with 0 wt% solvent and the lowest leakage was observed in this group (even less than the control group). In dentinal margins by increasing solvent, microleakage decreased and the bonding with 31 wt% solvent assigned the lowest microleakage between the experimental bonding groups . In enamel and dentinal margins, further increase in the solvent up to 46 wt%, the microleakage increased again . At the higher solvent concentrations, the solvent occupies the space between the monomers and will reduce the degree of conversion, mechanical properties of the polymer, and resin - dentin bond strength . The results of this study are in agreement with findings in the other studies stating that the solvent facilitates the penetration of resin in collagenous matrix by reducing the bonding agent viscosity . Wang et al . Studied the effect of different concentrations of ethanol on the quality of the hybrid layer and concluded that among the 10%, 30%, and 50% concentrations of solvent, the concentration of 30% was the best . In bonding agents with 10% ethanol, the bonding agent monomers are not able to penetrate into dentin because of higher viscosity of the adhesive . When the solvent concentration is 30%, more resin penetration occurred, whereas at the higher solvent contents 50%, penetration of the monomers decreases again greatly due to the high dilution bonding agent or severe dehydration which causes collapse of nanochannels between collagen fibrils . The concentration of 50% was not perfect due to the intense evaporation of the solvent and leaving a porous hybrid layer . If the concentration of the solvent becomes more than adequate, it will prevent polymerization of adhesive monomers, and mechanical properties of adhesives are reduced . Holmes et al . Studied a mixture of acetone and ethanol with six different concentrations . By adding solvents, the rate of monomer conversion to polymer increased compared to solvent - free resin, and the highest rate of polymerization was in 5 mol concentration of acetone and in ethanol, the maximum monomer conversion was observed in 2.5 mol concentrations . Increasing the concentration of solvent (for ethanol more than 2.5 and for acetone more than 5 m) led to a decrease of degree of conversion so that in concentration of 13, it reached the zero . By increasing the thickness of the bonding agent, the solvent trapped and prevented complete polymerization of adhesive and reduced the bond strength . Therefore, in clinical work using air - stream is necessary to prevent the accumulation of the solvent of the bonding agents . In a study by aw et al ., however, three different bonding agents, containing ethanol and water as solvent and one without solvent, were applied on teeth by the integration of other variables, and after following the study for 1 year, they found that the restorations were the same in terms of retention, marginal integrity, marginal discoloration, and post - treatment sensitivity . They believed that the solvent - free adhesive by creating thicker layer makes better thermal protection and reduces shear stresses, but if the thickness of layers becomes too high, may lead to the weakening of the bond strength . Believe that solvent concentrations greater than 20 wt% reduce the degree of conversion by increasing the physical space between reactive species during polymerization . It has been shown by cadenaro et al . That increasing the ethanol concentration up to 10 wt% and 20 wt% led to increased dc, but by adding 30 wt% during 1 s of light exposure lowered dc and then increased dc after 40 s exposure . The residual solvent results in higher degree of conversion through the decrease in the viscosity of the monomer blend which allows the macroradicals to propagate before the polymerization reaction being diffusion controlled . In the present study poss particles contain reactive methacrylate functional groups which take part in the copolymerization with the resin monomers increasing the cross - link density and consequently the mechanical properties of the adhesive layer . The nanostructures can also enhance the physical, chemical, and thermal properties of bonding agent and therefore impact on the leakage . Mousavinasab et al ., by comparing the amount of leakage between experimental adhesives containing nanoclay fillers, after 24 h and 6 months in class v restorations, concluded that these adhesives reduced enamel leakage in short term than control group (adper single bond). However, no success was observed in dentinal microleakage in the short - term (24 h) and long - term (6 months). The cause of more microleakage in these adhesives was attributed to its high concentration of 2-hydroxyethyl methacrylate . Sadat - shojai et al ., by adding nano - hydroxyapatite fillers to experimental dental acrylic - base bonding and 40 wt% ethanol, concluded that the incorporation of 0.2%0.5% by weight of the nano - hydroxyapatite fillers, enhanced physical properties compared to the group without filler . Showed the effect of poss nanoparticles on improving physical and mechanical properties and hydrolytic stability of cyanoacrylate adhesives . A reduction in the rate of solubility and water absorption was observed using poss nanostructures in the cyanoacrylate adhesives . According to the results, it can be concluded that in the bonding agents, an optimum percentage of solvent is required to have a minimum microleakage . The optimum solvent concentration was shown to be 31 wt% in the studied experimental bonding agent which led to the reduction in marginal microleakage . Furthermore, the presence of poss fillers may also result in a reduction in microleakage due to the lower hydrophilicity of the nanostructures and the higher cross - link density of the adhesive in the presence of the multi - acrylate poss . The authors of this manuscript declare that they have no conflicts of interest, real or perceived, financial or non - financial in this article . The authors of this manuscript declare that they have no conflicts of interest, real or perceived, financial or non - financial in this article.
Multiple anatomical defects are believed to contribute to involutional entropion, and numerous surgical techniques have been described to correct them . The three anatomic factors most consistently described in the literature as requiring attention are lower lid retractor disinsertion, horizontal lid laxity, and orbicularis oculi muscle override [111]. Horizontal lid laxity, diminished orbicularis tone, and lower lid retractor disinsertion the anatomic and histologic features of lower eyelid malposition have been described by numerous authors . Lower lid anatomy, including the lower lid retractors, was investigated by jones who theorized that laxity of the retractors would allow the inferior border of tarsus to rotate outward . Jones also postulated that lower lid retractor laxity was analogous to a levator aponeurosis dehiscence . Collin and rathbun histologically studied patients with entropion versus normal eyelids evaluating the lower lid retractors . In the entropion specimens, they found that the lower lid retractors and orbital septum only came to within 3.5 mm of the inferior border of the tarsus versus 1.5 to 2.5 mm in normal lids . Additionally, a larger amount of orbital fat was present in the entropion specimens compared to the normal lids indicating a retractor dehiscence . The tarsal plate has been shown to invert in entropion where the lower border rotates superiorly and anteriorly 16 degrees and the upper border rotates inward 63 degrees . In some patients, the junction of the inferior border of the tarsus with the lower lid retractors has an acute angulation as compared to a normal eyelid . With inferior distraction of the eyelid, an abnormal cul - de - sac develops below the inferior tarsal border forming a v shaped appearance (figures 1 and 2). Additionally, the presence of a white line representing the retracted edge of the disinserted lower lid retractors under the palpebral conjunctiva may be visible and is referred to as a complete retractor disinsertion . Putterman and wesley described patients where lateral tightening was insufficient to correct an ectropion . Additionally, when describing ectropion, hawes and dortzbach commented that the lower lid retractor muscle was further from the inferior tarsal border and that there was an increased amount of adipose tissue near the tarsus and capsulopalpebral fascia junction in ectropion patients . Horizontal lid laxity is also thought to be important in the development of entropion [20, 21]. As surgical treatments evolved, surgeons found that recurrence of the entropion was more likely if horizontal laxity was not corrected [2224]. Danks and rose found addressing horizontal laxity at the time of surgery in addition to advancing the lower lid retractors and eliminating orbicularis oculi muscle override increased the success rate of surgery . They recommended that horizontal lid shortening should be performed in all cases of involutional entropion . Lateral canthal tendon lengthening and an abnormal lid traction test (lid distraction test) were found to be statistically significant when comparing ectropion to control lids . The medial canthal tendon was also found to be longer in patients with ectropion compared to the control group, but the difference was not statistically significant . The orbicularis oculi muscle is thought to play a role in involutional entropion by the preseptal orbicularis migrating superiorly over the tarsus, perhaps because of increased connective tissue laxity . In a histologic study, sisler et al . Found septal and tarsal atrophy in patients with entropion . In ectropion, they found orbicularis and riolan's muscle ischemia, atrophy, and collagen fragmentation . Orbicularis oculi atrophy was also found with light and electron micrography in specimens of lids with ectropion [15, 28]. Historically, many studies have reported features associated with entropion as subjective clinical observations . Surgical interventions were aimed at addressing each of these features [111, 16, 22, 23, 25]. Other studies identified clinical features and compared them to the opposite unaffected lid or against lids with ectropion [2932]. Very few studies have been done in a comparative manner in patients with entropion versus age - matched controls . Compared patients with entropion versus age - matched controls with hertel exophthalmometry measurements and found that no statistically significant difference existed . Benger and musch limited their study to patients over the age of 65 and found that only patients with entropion of greater than 6-week duration had increased horizontal lid laxity compared to the age - matched controls . They found a statistically significant difference in the vertical distraction test of patients with entropion compared to their control group, but the vertical excursion from up to down gaze was not significant . More recently, beigi et al . Did a study measuring lower lid excursion, horizontal lower lid laxity, and orbital fat prolapse . However, they used the opposite unaffected eye as a control in patients with unilateral entropion . This study did not find a difference in horizontal laxity or lower lid vertical excursion between the lid with entropion and the nonentropic eyelid . However, orbital fat prolapse was found to be associated with involutional entropion, likely related to lower lid retractor thinning and dehiscence . This study represents an attempt to synthesize the information gleaned by previous studies and develop a comprehensive protocol to assess all the potential mechanisms and related clinical findings of involutional entropion and ectropion . The study was designed to evaluate and compare the clinical eyelid parameters proposed to contribute to entropion and ectropion formation . The findings will be compared with an age - matched control group to best remove any experimental bias . This prospective age - matched, case - control study was conducted from 2009 to 2010 with the institutional review board (irb) approval . The eyes were assigned to the entropion group, ectropion group, opposite lid entropion control group (entropion control), opposite lid ectropion control group (ectropion control), or the age - matched control group . Patients were evaluated for the presence or absence of involutional entropion or ectropion . The patient was observed and if the eyelid margin was rolled in toward the eye constantly or intermittently, then involutional entropion was diagnosed . If an eyelid was rolled outward either medially or along its entire length without evidence of anterior lamellar contracture or facial paralysis, involutional ectropion was diagnosed . The patients in each of the five groups were then evaluated for nine clinical parameters as follows . (1) margin to reflex distance 2 (mrd2) measured to the nearest half millimeter with a ruler as the distance between the central corneal light reflex and the lower lid margin; (2) lower lid crease measured to the nearest half millimeter using a ruler from the lower lid margin; (3) presence of a retractor dehiscence; this was deemed present when the junction of the lower lid retractors to the tarsus had a v shape when the lower lid was distracted inferiorly (figure 1); (4) presence of a retractor disinsertion with the finding of a subconjunctival white line in the fornix (figure 1); (5) presence or absence of orbital fat prolapse; this was deemed present if the inferior orbital fat protruded into the fornix and anterior level of the everted tarsus when the lower eyelid was distracted inferiorly (figure 1); (6) lower lid vertical excursion as measured to the nearest half millimeter by the movement of the central lower eyelid margin from up gaze to down gaze; (7) lateral canthal excursion as measured to the nearest half millimeter by the movement of the lateral canthal angle from up gaze to down gaze; (8) lower lid laxity and orbicularis oculi muscle tone with use of the snapback test; this was assessed by observing the time taken for the lower lid margin to return to its resting position after being pulled inferiorly; results were reported on a four - point likert scale defined as follows: (i) normal quick return; (ii) slow return; (iii) return requires one blink; (iv) return requires more than one blink; (9) horizontal lid laxity using inferior distraction of the lid; this was recorded to the nearest half millimeter by measuring the distance between the lid margin and the globe in primary gaze while pulling the lid inferiorly . Data was analyzed utilizing parametric and nonparametric tests within spss, version 16.0 (spss, chicago, il). The descriptive statistics of mean, median, range, and standard deviation were calculated for each group . The z test statistic reported for the mann - whitney u test indicates if the two samples being compared come from the same underlying distribution at the p = 0.05 significance level . A z score of less than 1.96 indicates that the two samples come from the same underlying distribution . Nominal data was analyzed with fisher's exact test as dictated by the expected 2 2 table values . The control group consisted of 26 patients (52 eyes) with a mean age of 75 (range 5689). There were 13 males (mean age 71, range 5989) and 13 females (mean age 79, range 5687) in the control group . The entropion group consisted of twenty - six consecutive patients (30 eyes), 13 male and 13 female, with unilateral (22 patients) or bilateral (4 patients) entropion . The females had a mean age of 79 (range 7085) and the males 72 (range 5384). The ectropion group consisted of 19 patients (30 eyes) with a mean age of 81 (range 5792). The ectropion group consisted of 12 males (21 eyes) (mean age 79, range 5789) and 7 females (9 eyes) (mean age 84, range 7592). A secondary control group was created using the normal eyelid of patients with unilateral disease . These groups were the designated entropion opposite lid control group (entropion control) and ectropion opposite lid control group (ectropion control). One patient with unilateral ectropion had scarring of the opposite lid and was not used in the ectropion control group . Table 1 contains a summary of the descriptive statistics for the control, entropion, ectropion, and opposite lid control groups . The statistical results of all the analyzed groups are summarized in table 3, and a summary of the statistically significant results for all groups is shown in table 4 . Shaped insertion and the parameter of a slowed return on the snapback test were both found to be statistically significant when comparing the entropion and ectropion groups to the control group . Additionally, a statistically significant difference was found between the entropion and ectropion groups for both of these measurements . A retractor dehiscence occurred more frequently in entropion and the snapback test was slower in ectropion . The presence of a white line and orbital fat prolapse in the inferior cul - de - sac were statistically significantly different and were more common in the entropion and ectropion groups compared to the control group . Lower lid excursion was decreased in the entropion and ectropion groups versus the control group . Lower lid distraction was greater and statistically significant in the ectropion and entropion groups compared to the control eyes . However, no statistically significant difference between the entropion and the ectropion groups was found in these four clinical parameters . The lid crease height was found to be statistically significantly greater in the entropion lid group than in the control group . Those eyes which did not have a measurable lid crease were excluded from the calculation . No statistical difference was found between the ectropion lid group and the control group or between the entropion and ectropion groups . Lateral canthal excursion was diminished and was statistically significant in the entropion group as compared to both the control and the ectropion groups . The difference was not found to be statistically significant between the ectropion group and the control group . In unilaterally affected entropion and ectropion patients, the risk for developing a malposition in the unaffected lid is demonstrated by significant abnormalities when compared to the age - matched control group . While many studies have used the contralateral lid as a control, the contralateral lid in unilaterally affected patients is not a valid normal control because of these abnormalities . This is supported by the fact that mrd2 was the only variable that showed no statistical difference between entropic or ectropic lids and the control lids . Retractor dehiscence, presence of a white line, orbital fat prolapse, decreased lower lid excursion, increased lower lid laxity, and increased lower lid distraction are findings associated with both entropion and ectropion . The presence of these features may promote the development of either entropion or ectropion in lids currently not exhibiting clinical changes . Eyelids with ectropion have decreased lid elasticity compared to the entropion and control groups as demonstrated with the snapback test . An increased lid distraction test is also found in the ectropion group when compared to the age - matched control group . Alterations in the tarsus or ligamentous attachments could be the underlying cause . Decreased or misdirected orbicularis oculi muscle function may also play a role in the lid rolling outward . Entropic lids have more significant retractor abnormalities than the ectropic lids . In order to develop entropion, a very lax or completely disinserted retractor is necessary, which may explain why entropion is more likely to be unilateral in its presentation . Lids with either entropion or ectropion have numerous significant abnormalities and differences compared to age - matched controls . This supports the clinical observation that surgical repair is most successful when multiple anatomical abnormalities are addressed . The more pronounced lower lid retractor dehiscence or disinsertion found in entropion and the poor snapback characteristics in ectropion may explain why involutional entropion and ectropion are rarely seen in opposite eyes of a single patient.
. They account for 2% to 5% of all primary intracranial neoplasms and 5.6% to 13% of intracranial tumors in children17). They are classified as intracranial tumors of benign or unspecified behavior by pediatric cancer registries8). Current treatment strategies for craniopharyngiomas include cystic drainage, intratumoral chemotherapy, limited resection, or a combination of gross total resection (gtr) and radiation therapy (rt). Surgery remains the treatment of choice because it allows rapid decompression, minimizes recurrence and provides a histological diagnosis . However, surgery can produce high treatment - related morbidity such as panhypopituitarism, diabetes insipidus, hypothalamic obesity, cognitive deficits4,10), or even death due to the close proximity of crucial neurovascular structures . Furthermore, secondary surgery to treat recurrent craniopharyngioma is associated with a higher risk of complications and a lower cure rate6). Subtotal resection (str) combined with rt and radiosurgery (gkrs) is being used increasingly as either a primary or secondary treatment for patients with craniopharyngioma2,12). The clinical records of pediatric patients treated for craniopharyngiomas between december 1995 and february 2011 were reviewed . Thirty - five pediatric patients diagnosed with a craniopharyngioma were treated, and their medical records and imaging data were analyzed retrospectively . Inclusion criteria were as follows: 1) age less than 19 years, and 2) surgical resection with a histopathological diagnosis of craniopharyngioma . The initial tumor diameter was calculated as the average of the longest diameter and the two other diameters vertical to the longest one . The extent of resection was determined by analyzing postoperative computed tomography scans and magnetic resonance imaging scans . A clinical and radiologic follow - up was performed three months after the diagnosis or initial treatment and then at intervals of one to two years thereafter . Progression of craniopharyngioma was defined as tumor growth on sequential imaging with or without associated symptoms . The overall survival and progression - free survival rates were estimated using the kaplan - meier method . Statistical analyses were performed using the statistical package for the social sciences (spss, version 18.0, spss inc ., chicago, il, usa). The mean follow - up duration was 76 months (range, 10 - 195). The female - to - male ratio was 16: 19, and the mean age was 8.6 years (range, 1 - 17). The initial mean tumor diameter was 30.4 mm (range, 14 - 55 mm). Preoperative tumors were divided into three types: cystic (15 patients), solid (13 patients) and mixed (7 patients). The preoperative tumor location was classified according to sami's classification16). Eight patients were classified as grade 1 (intrasellar or infradiaphragmatic) and grade 2 (occupying the cistern); 8 patients were classified as grade 3 (lower half of the third ventricle); 13 patients met grade 4 criteria (upper half of the third ventricle); and 6 patients were grade 5 (reaching the septum pellucidum or lateral ventricle). The symptoms at initial presentation included visual symptoms (13 patients), such as a visual field defect and decreasing visual acuity, nausea / vomiting (8 patients), endocrine abnormalities (7 patients), headaches (3 patients; 42.9%), dizziness (3 patients), and seizure (1 patient). Baseline characteristics of the 35 patients stratified by initial treatment are summarized in table 1 . Initially, gtr was performed in 30 patients and str followed by rt was administered in 5 patients . The rt dosage of patients who underwent str was 5400 cgy with a median fraction size of 180 cgy . Twenty - eight patients had endocrine abnormalities that required endocrine hormonal replacement post - treatment . The frequency of diabetes insipidus in patients undergoing gtr was 56.7% compared with 100% in patients who underwent str combined with postoperative rt . The difference in endocrine requirements and complications among the groups was not statistically significant because of the small number of cases (table 2). Progression - free was 51.2 months (range, 3 - 182): 49.7 months in the patients who underwent gtr and 60.2 months in those who received str followed by rt (table 3). Overall survival and local control rates at 10 years were 94.75.1% and 37.111.9%, respectively (fig . The mean time from the initial diagnosis until recurrence after surgery was 32.4 months (range, 5 - 108). Differences in tumor type and calcification were not significant in patients who had a recurrence . Of 14 cases with a recurrence after gtr, 5 patients were treated with second surgery (gtr), 1 patient with rt, 4 patients with gkrs, and 4 with str followed by rt . No recurrence had developed during the time from rt until the last follow - up . The remaining four patients underwent str followed by rt; their mean dosage was 3810 cgy (range, 1040 - 5400 cgy). Leksell gamma knife types b or c (elekta instruments, atlanta, ga, usa) were used for radiosurgery . The mean marginal dosage was 11.2 gy (range, 9 - 14 gy), and the mean target volume was 1719 mm (range, 424 - 6874). The local control rate of the lesions treated with gkrs was 100% (decreased in two patients and stable in two patients) at the final follow - up (mean, 75 months). The local tumor control rates for patients who received rt or gkrs was 100% at relapse (p=0.00) (fig . Two cases with recurrence after str followed by rt as an initial treatment were treated with gtr via a transnasal approach . No recurrence had developed during the time from repeat gtr until the last follow - up . Current treatment strategies for craniopharyngiomas include cystic drainage, intratumral chemotherapy, limited resection or gtr, and rt . Radical resection at presentation offers the best chance of disease control and potential cure with acceptable morbidity3) because craniopharyngiomas are histologically benign . However, surgery rarely obliterates the tumor completely . The ability to achieve gtr varies between 43 - 76% in published pediatric series4,10). Furthermore, local recurrence rates have been reported to range from 20 - 30% after gtr6,9) and from 70 - 100% after str without adjuvant treatment10,20,21). To prevent recurrence, aggressive resection is required, which may result in severe permanent neurologic injury and related complications, such as post - treatment endocrinopathy5,7), hypothalamic and frontal lobe damage and hypothalamic obesity4,10). In our series the local recurrence rate (14 patients, 46.7%) was slightly high compared with previous reports . The cause of our high local recurrence rate may be a minimal capsule or calcification around the tumor, which was closely adjacent to critical structures . The fine balance between decreasing neurological deficits and controlling local tumors has led to the use of radiation . Radiation therapies, including fractionated radiation and stereotactic radiosurgery, are often applied postoperatively in the event of str or tumor recurrence2,7,11,12,18,19). Fractionated rt improves craniopharyngioma control and survival18) and is the standard treatment for residual or recurrent tumors . Most patient series have demonstrated that when combined with str, adjuvant radiotherapy allows for greater tumor control and survival than surgery alone19). Dosages of 5000 - 6000 cgy are most commonly used19). In our study, five patients underwent fractionated rt combined with str as an initial treatment . The mean dosage was 5400 cgy with a median fraction size of 180 cgy, and the mean tumor size was 37.7 mm (range, 25 - 45 mm). The mean time to recurrence (16.0 months; range, 3 - 29) was shorter compared with that of gtr . Of 14 cases with a recurrence after first surgery (gtr), 9 patients were treated with second surgery . However gtr could be achieved only in 5 patients due to adhesion to surrounding critical structures . Five patients who experienced recurrence of their tumor after gtr as an initial treatment underwent rt as a secondary treatment no recurrence developed from the time of rt treatment through the last follow - up . Stereotactic radiosurgery is a relatively recent therapeutic option for craniopharyngioma that has significantly improved the effectiveness of and morbidity associated with rt . Kobayashi11) published the largest treatment and outcomes series, which involved 98 cases . At a mean marginal dosage of 11.5 gy and a mean tumor size of 3.5 cm, the tumor control rate was 79.6% with a complete response in 19.4% and a partial response in 67.4% of the cases . The actual five- and ten - year survival rates were 94.1% and 91%, respectively, with respective pfs rates of 60.8% and 53.8% . Young age was reported to be a predictor of unfavorable outcome after radiosurgery for craniopharyngioma . In our study, four patients received gkrs . The mean marginal dosage was 11.2 gy (range, 9 - 14 gy), and the mean target volume was 1719 mm (range, 424 - 6874). The local control rate of the lesions treated with gkrs was 100% (decreased in two patients and stable in two patients) at the final follow - up (mean, 75 months), although all patients were young . Nevertheless, the use of rt in malignant lesions in children has always posed a therapeutic dilemma; the risk of long - term toxicity must be balanced with the risk of recurrence . This issue is particularly challenging in the management of a benign neoplasm, such as craniopharyngioma, for which overall survival rates are 90 - 95% at five years and for which side effects from therapy or local progression of the disease can have devastating consequences5). Treatment - related side effects of rt have been well described in the literature and include endocrine, visual and cognitive sequelae as well as vasculopathy and secondary malignancies1,9,13). Side effects may occur acutely, but they are generally considered to be insidious9). In our study, no newly developed side effects or complications associated with rt or gkrs, such as visual disturbances, endocrine disorders or decreased cognitive function, were observed . This may be because all patients underwent surgery as an initial treatment, and pre - radiation neurologic symptoms were therefore already present . Limitations of our study include the fact that it was a retrospective, non - randomized analysis with a relatively short follow - up duration and a small number of cases . A single surgeon with considerable experience with craniopharyngioma performed all surgical procedures . While a randomized controlled study is not practical at this time, a population - based prospective study may provide more reasonable evidence - based treatment guidelines in the future . Our results suggest that if safe resection is possible, surgery should be the treatment of choice to prevent tumor recurrence . However, if the tumor is located near critical structures or if it recurs, subtotal resection combined with rt or gkrs may be effective both as an initial treatment for patients with a recurrent tumor and as a salvage treatment for recurrent lesions.
Autoimmune hepatitis (aih) is a chronic inflammatory disease characterized by progressive destruction of the hepatic parenchyma . The disease displays female predominance and is considered rare in childhood, although it may occur in very young children . The hallmark of the disease is the presence of circulating autoantibodies, defining two major subtypes: type 1 (aih-1) [3, 4] and type 2 (aih-2). Equally striking is the strong genetic susceptibility identified by specific mhc class ii molecules, especially hla - drb1, which discriminates between the two types of aih . Brazilian aih-1 patients carry hla - drb113 and/or hla - drb103 whereas aih-2 patients present mainly carry hla - drb107 . Hypergammaglobulinemia is a diagnostic feature of aih but other immunoglobulins may be altered as well . Low iga levels are particularly common in aih-2 and we have observed high ige levels in children with aih-1 . Elevated serum ige levels have been previously described in acute and chronic liver diseases usually linked to alcohol abuse or viral infection . This phenomenon is traditionally linked to allergy, asthma, and atopy, but elevated ige serum levels in specific autoimmune diseases have been increasingly acknowledged . To date, elevated ige serum levels have been identified in churg strauss vasculitis, sclerosing cholangitis, bullous pemphigus, autoimmune pancreatitis, and grave's disease . Ige seems also to play a role in the pathogenesis of rheumatoid arthritis contributing to the immune response against citrullinated proteins . Atta et al . Also observed specific ige antinuclear antibodies in systemic lupus erythematosus suggesting there is an important contribution to the pathogenesis of the disease . B lymphocyte switching to ige is induced by il4 and its neighbor gene il13, which form, together with il5, a well - studied cytokine gene cluster (5q31.1) controlling th2 type immune responses . Il4 is a pleiotropic cytokine essential for ige synthesis by b cells and for t cell differentiation into a th2 phenotype and upregulation of mhc class ii expression . The functions of il13 in immune surveillance and in th2 type immune responses partially overlap with those of il4 . In addition to the classic th2 pathway shared with il4, il13 has other important functions . Il13, together with il5, is a potent mediator of tissue fibrosis and tissue remodeling, as shown in experimental models of schistosomiasis . A steadily increasing literature indicates that there is an important role for il13 in the development of hepatic fibrosis, signaling through the il13 receptor to induce collagen production by local fibroblasts aih-1 pediatric patients typically exhibit liver fibrosis, including most patients in our study . About 25% of aih patients, despite treatment with corticosteroids, present progressive fibrosis, highlighting the importance of any gene which might be involved in this process . In addition, both il4 and il13 genes harbor functionally relevant polymorphisms [22, 23]. T cell - mediated cytotoxicity is believed to be the central mechanism responsible for hepatic damage, but other cells are involved . Typically, cd4 helper t and b cells gather around portal tracts, whereas cd8 cytotoxic t cells have a periportal distribution . In addition to the abundant infiltrating mononuclear cells, plasma cells and eosinophils may also be present . Interestingly, a previous study has highlighted the increased production of il4 messenger rna in aih-1 liver biopsies in parallel with the expected increase in inflammatory interferon gamma and other proinflammatory cytokines . These findings led us to try to identify additional factors involved in the autoimmune processes present in this liver disease, which might act either as prognostic disease markers or as novel targets for a therapeutic approach . To this end, we analyzed the major clinical manifestations and biopsies from brazilian children grouped according to the aih type and serum ige levels . We also investigated, in the predominant aih-1 group of patients, functional polymorphisms of the il4, il13, il5, and il4ra (il4 receptor alpha chain) genes involved in ige switching and eosinophil differentiation and maturation that we believe might contribute to overall genetic susceptibility to aih . A total of 141 patients diagnosed as aih, according to the international autoimmune hepatitis group report, were studied . Patients were followed at the pediatric hepatology unit of the children's institute, general hospital, faculty of medicine, university of so paulo in so paulo, brazil . Clinical, biochemical, and histological features of 74 aih patients (61 with aih-1 and 24 with aih-2) aged 1 to 14 years were evaluated . To increase statistical power for analysis of gene polymorphisms, we included a further 43 children with aih-1 (a total of 117). Non - hla matched siblings of bone marrow recipients from the same hospital and with similar social and ethnic background, without any autoimmune and/or other severe disease, were enrolled as healthy controls (hc, n = 227). Written informed consents were obtained from all participants and/or legal guardians, and the internal review board of the university of so paulo approved the study . Laboratory liver tests, including alanine aminotransferase (alt), aspartate aminotransferase (ast), alkaline phosphatase, gamma glutamyl transpeptidase (gt), albumin, -globulins, prothrombin, and total bilirubin, and autoantibody profiles were performed in all patients . Radioallergosorbent test (rast) for specific allergen against house dust, animal fur, food, and fungi was assayed by radioimmunoassay using unicap100e (pharmacia & upjohn company llc, mi, usa) system . I. immunoglobulins m, g, a, and e were assayed by nephelometry using a dade behring system nephelometer bn 100 (dade behring diagnostics inc ., somerville, nj). Serological tests for hepatitis a, b, and c were negative in all patients . Clinicians involved in this study ruled out other hepatic diseases such as alpha-1 antitrypsin deficiency and wilson's disease . Histological features of liver biopsies were graded semiquantitatively using the brazilian consensus for histopathology of chronic hepatitis . Specific monoclonal antibodies for ige, cd3, cd4, cd8, cd20, and cd16 (bd biosciences, san jose, ca, usa) were used for immunohistochemistry . Genomic dna was extracted using a dodecyl / hexadecyltrimethylammonium bromide (dtab / ctab) method . Rs2243250, rs2070874, il5 rs2069812, and il13 rs20541 polymorphisms were typed by restriction fragment length polymorphism (rflp). Il4 rs2070874 and il13 rs20541 typing by rflp is described elsewhere [30, 31]. The primers and restriction enzymes for il4 rs2243250 and il5 rs2069812 were 5cctaaacttgggagaacatggt, 3tcctcctggggaaagataga (avaii) and 5ttcctgctgctcatgaacagaatacgt, 3cattttgatggcttcagtgactcttcc (rsai), respectively . Il4 rs2227284 and il4ra rs1805011 polymorphisms were typed by aspcr (allele - specific polymerase chain reaction). Primers for il4ra rs1805011 have been described and primers used for il4 rs2227284 were 5ttgggtggacaagtagttggagcg, 5ttgggtggacaagtagttggagct and 3atgtcccatcctgcccaggatag . All statistical analyses were carried out using graphpad prism 5 or spss, v.13 software . The clinical and laboratory parameters were analyzed using student's t - test or fisher's exact test, as well as the mann - whitney test where necessary . The power was estimated for all studied snps and values ranged from 76 to 82%, indicating adequate sample size . In addition, all snps were in hwe and, as expected, haploview analysis confirmed that the three studied il4 snps were in linkage disequilibrium . For the possible genetic associations, or exact fisher's test were applied . Unpaired t - test was used to evaluate associations between ige and the genotypes of all studied snps . For regression analysis, variables presenting p value <0.100 in the univariate analysis were included . To identify possible gene - gene interactions, the majority of the aih patients were classified as type 1 (85% versus 15% type 2). The median age of diagnosis was 8.2 and 4.8 years, respectively, for aih-1 and aih-2 . In addition, 54% (13/24) of aih-2 patients developed the disease before the age of 5 years, whereas this occurred only in 8/117 (7%) of aih-1 patients (p <0.001). Twenty - three (20%) aih-1 and 11 (46%) aih-2 patients (p = 0.006) had relatives presenting autoimmune diseases . In addition, median serum alanine aminotransferase values were higher in the aih-2 group (28 versus 18 upper normal limit; see table 1). Serum igg, iga, and ige levels were significantly higher in aih-1 in comparison to the aih-2 group of patients (figure 1). High ige levels were observed in 50/91 (55%) of patients with aih-1, but only in 2/17 (12%) of those with aih-2 (p = 0.003) (table 1). Histopathology showed presence of cirrhosis in the majority of aih-1 patients (57 out of 60) analyzed, usually accompanied by necroinflammatory activity corresponding to a score 3 and a score 4 panacinar necrosis . Liver cell rosettes were also present in almost 90% of livers, accompanied by infiltrating eosinophils and/or plasma cells, independently of patients ige serum levels (table 2). Importantly, in contrast to increased ige serum levels present in about half of the patients, liver ige was absent in only 4 of the 46 aih-1 patients . Finally, most patients exhibited cd8 cytotoxic t cell and nk infiltrating cells, in some cases without detectable cd4 helper t cells (table 3). However, irrespective of serum ige levels, in most patients, moderate to high infiltration levels of cd4 helper t cells usually accompanied by moderately elevated liver nk cells were in fact present . In conclusion and in spite of having analyzed only a subgroup (46/60) of patients, our results clearly show that the well - known infiltrating proinflammatory cell profile coexists side by side with ige, eosinophils, and the plasma cells possibly involved in ige production . The reason for this mixed cell profile is currently unknown . Among the studied snps in aih-1, two functionally relevant snps present, respectively, in the il13 gene and in its receptor il4ra disclosed statistically significant increases . The first snp is il13 rs20541 (31 versus 23% of hc; p = 0.024, or = 1.55) and, moreover, homozygosis for the a allele at il13 rs20541, known to impact upon receptor ligand affinity, was also significantly increased compared to healthy controls (p <0.001, or = 4.62). Increased frequencies were also found for a allele at il4ra rs1805011 (68% versus 49%; p <0.0001, or = 2.15) and homozygosis for a (47% versus 19%; p <0.001, or = 3.75) (table 4). The remaining polymorphisms did not show any relevant difference when aih-1 and hc groups were compared (supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2015/679813). Finally, we carried out analysis using a logistic regression model, which included allele carriage of the different snps as well as clinical and laboratory parameters . Three modes of analysis were tested . In the first mode (mode 1), the results confirmed the findings for both il13 rs20541 (or = 9.45 (95% 2.2839.18) p = 0.002) and il4ra rs1805011 (or = 3.72 (95% 1.787.77) p <0.001). To investigate a possible association of snps with pathogenesis of the disease, a second mode (mode 2) of analysis considered each snp as the dependent variable . The t allele at il5 rs2069812 showed association with treatment suspension (remission by clinical and laboratory standards) (p = 0.004) but was a very rare outcome, present only in 7 patients (7/117, 6%) where 5 achieved regression of fibrosis after treatment (grades iv to ii). Il5 is directly involved in eosinophil activation and is a key molecule in allergy and eosinophilic inflammation, expressed by cd4 helper t and b cells, mast cells, and eosinophils . Finally, ige was considered as the dependent variable in another analysis (mode 3). The presence of the t allele at il4 rs2227284 showed association with high ige levels (or = 7.42 (95% ci 1.33 to 41.34), p = 0.02) (table 5), an expected result . The genes individually associated with susceptibility to the disease were examined for potential gene - gene interactions . Gene - gene interactions considered grouped genotypes for il4ra rs1805011, il4 rs2243250, il4 rs2070874, rs2227284, il13 rs20541, and il5 rs2069812 and the presence of 03 and/or 13 alleles at the hla - drb1 locus . Individuals presenting homozygosis for the a allele at il4ra rs1805011 and hla - drb103 and/or 13 allele were at six times greater risk to develop the disease (or = 14.00, p <0.001) compared to the risks conferred by the same alleles individually (hla - drb103 and/or 13, or = 8.28; il4ra rs1805011, or = 3.72). Individuals homozygous for the a allele at il13 rs20541, combined with hla - drb113 and/or 03 allele also showed a slightly greater risk to develop the disease (or = 8.88, p = 0.04). The recurrent presence of plasmocytes and eosinophils in liver biopsies along with the unusual finding of increased circulating ige antibodies in brazilian pediatric patients with aih was the basis for this retrospective study . To further understand if those cells might be disease markers for aih-1, we investigated gene polymorphisms of cytokines involved in plasmocyte and eosinophil maturation and ige production . Our hypothesis was that these snps might play an additional role in the development of aih, a disease primarily caused by autoreactive t cells, acting as disease modifiers in synergy with the strongly associated mhc class ii hla - drb113 and 03 alleles in the brazilian admixed population . Our cross - sectional analysis of laboratory and clinical parameters aimed to distinguish if the increased levels of circulating ige are markers for the presence of an autoimmune process and therefore present in all patients irrespective of other markers or an indicator of a pathogenic role varying according to disease severity . It is also possible that ige levels are simply an epiphenomenon caused by widespread inflammatory and immune activity . The degree of portal inflammation and, especially, parenchymal lesions and interface necroinflammatory activity were remarkable in aih-1 patients and occurred irrespective of ige serum levels . A major feature in the present series of analysis was the finding of panacinar necrosis in about half of all patients, again regardless of ige serum levels, eosinophil count, or other histology characteristics . In spite of liver - infiltrating eosinophils in about 60% of these patients, eosinophil count in peripheral blood of all patients was in the normal range (data not shown). This observation is in accordance with the observed lack of rast reactivity in the patients . We concluded that despite the high ige serum levels, the laboratory and clinical findings are not indicative of a concomitant allergy or atopy occurring in these children . In addition, eosinophils have a circulating half - life of only a few hours, with rapid removal of tissues by leukocyte extravasation . In tissues, eosinophils are not usually present in livers from healthy or cmv - infected patients, in contrast to liver transplanted patients, where eosinophil count correlates with degree of rejection . In our patients, and arguably due to the widespread inflammation, not only were eosinophils present but also ige was identified in most biopsies analyzed . In addition, plasma cells, t and b lymphocytes, and nk cells were also found in the liver of most patients, confirming the generalized inflammatory process . In aih, t cell - mediated cytotoxicity is believed to be the central mechanism responsible for hepatic damage . In fact, the intriguingly mixed immune profile included also the clearly defined cd8 cytotoxic t cell periportal infiltration responsible for the piecemeal necrosis that is a hallmark of the disease whereas cd4 helper t cell and b cells gathered around portal tracts . Of note, in our group of patients, we observed a more modest score in the case of cd4 helper t cell infiltrating cells than described elsewhere . Our data are similar to a recent study in adult aih and drug - induced liver injury patients . Infiltrating liver cells were profiled and the presence of eosinophils was detected after standard staining in varying percentages in both groups of patients, but tissue ige was not measured . Added to the unambiguous detection of eosinophils in the biopsies of our group of pediatric patients, we show that liver ige is present in the vast majority of patients . Taken together, beyond the characteristic portal and periportal inflammatory cell profile, the ubiquitous presence of ige deposits, plasma cells, and eosinophils suggests a yet unidentified additional role in the pathogenesis of aih . In rheumatoid arthritis, the involvement of eosinophils has been linked to il-5 and tgf-1, profibrogenic cytokines that contribute to collagen accumulation in tissues . It is possible that, likewise, the excess liver - infiltrating eosinophils take part in the development of the severe fibrosis typical of the disease in young children . On the other hand, il4 and il13 are major cytokines involved in ige synthesis by b cells and exhibit overlapping functions due to the interaction with the type ii receptor composed of the il4r and il13r1 expressed in nonhematopoietic cells and shared by both cytokines . Il13 additionally impacts upon tissue eosinophilia, tissue remodeling, and fibrosis, especially in the liver . We observed an association between presence of the il13 codon 110 a allele (coding for glutamine) and susceptibility to aih-1 . This variant has been associated with increased ige levels in both atopic and healthy children . Association with the functional polymorphism coding for valine in the alpha chain of the il4 receptor was also identified (see multivariate analysis, model 1). Chen et al . (2004) have previously shown that the il13 glutamine carrying variant displays increased activity compared to the wild type arginine variant . Furthermore, they showed that signal transduction by the variant was further enhanced when the il4 receptor alpha chain carried valine in position 50 . The results suggest that the joint presence of these two polymorphisms in aih pediatric patients may indeed impact aih pathology and contribute to disease severity . It is possible that the presence of higher circulating and liver ige reflects an overall stimulus of the immune system that results in enhanced immunoglobulin levels, which could include target - driven autoantibodies . It remains to be seen if any specific autoantigen is recognized by these ige antibodies, but without a defined target this analysis remains difficult to be achieved . The il4 rs2243250, rs2070874, and rs2227284 snps included in this study have been shown to impact il4 transcriptional activity and il4 rs2227284 (g> t), which resides in a putative transcription factor binding site, may act independently to regulate il4 transcription and ige production . Furthermore, presence of the t allele at il4 rs2227284 has been associated with higher ige levels in white, african - american, and hispanic asthma patients . In the multivariate analysis (see model 3), the same t allele was significantly associated with serum ige levels strengthening our hypothesis of an additional role for the il4, il13 cytokine pathway in the pathogenesis of aih . In conclusion, in agreement with the recurrent observation of high serum ige levels and presence of eosinophils, plasmocytes, and ige in the liver of aih-1 pediatric patients, we have identified novel associations with polymorphic variants of the il13 gene and the functionally related il4 receptor alpha chain which suggest ige - linked immune responses may be involved in the overall susceptibility to aih-1.
Both asthma and copd are airway diseases characterized by impaired airflow in the respiratory tract, chronic airway inflammation, as well as symptoms such as coughing, dyspnea, and wheezing . Intensive studies focused on the pathogenesis of these conditions implicate, among others, the group of phospholipases a2, which possess enzymatic and nonenzymatic properties . This paper presents general information about phospholipases and details the current knowledge about particular phospholipases a2 involved in asthma and copd in human and animal models . The data regarding interactions between members of this superfamily is summarized, as well as the role of these enzymes in exacerbations of inflammatory diseases . . The main substrates for these enzymes are glycerophospholipids which contain glycerol with a saturated fatty acid in the sn-1 position and an unsaturated fatty acid in the sn-2 position . The phospholipases responsible for hydrolysis of glycerophospholipids are divided into two groups: acylhydrolases and phosphodiesterases . The first group comprises phospholipase a1 (pla1) and a2 (pla2), which hydrolyze the ester bond at the sn-1 and sn-2 positions, respectively . The second group comprises phospholipase c (plc) which cleaves the glycerol - phosphate bond, and phospholipase d (pld), which liberates phosphatidic acid and alcohol (figure 1). The structure, function, and catalytic mechanism of the enzyme determine its place within the phospholipase a2 superfamily, be it secretory pla2 (spla2), cytosolic pla2 (cpla2), ca - independent phospholipase a2 (ipla2), paf acetylhydrolases (paf - ah), or lysosomal pla2 (lpla2). The latest classification, based on genetic structure, divides these enzymes into groups from i to xvi (in each one, the enzyme is represented by a capital letter). Table 2 includes information about the mechanism of action and function of particular subgroups of pla2s concerning physiology and pathophysiology . Currently about 300 million people worldwide suffer from asthma, and in 2025, this number is expected to grow by another 100 million . Asthma is defined according to the gina (global initiative for asthma) as a chronic airway inflammatory disease in which many cells and cellular elements are involved . Chronic inflammation is a cause of bronchial hyperresponsiveness, leading to recurrent episodes of wheezing, dyspnea, chest tightness, and coughing, occurring particularly at night or dawn . This is usually accompanied by episodes of diffuse bronchial obstruction of varying severity, which often subside spontaneously or with treatment . According to gold (the global initiative for chronic obstructive lung diseases), copd is characterized by a progressive and poorly reversible airflow limitation caused by both small airway diseases (airway inflammation and destruction) and parenchymal destruction (loss of alveolar attachment and decrease of elastic recall). Also, other extrapulmonary effects, such as weight loss, nutritional abnormalities, skeletal muscle dysfunction influence the severity of the disease . Apart from the genetic background (hereditary alpha-1 antitrypsin deficiency) cigarette smoke is a crucial environmental factor in copd development; it is responsible for airway inflammation and further oxidant / antioxidant imbalance (oxidative stress) causing amplification of lung inflammation . An analysis of studies concerning the profile of pla2s expression in many experimental systems has revealed ambiguous results . Many different inductors used for cells stimulation cause expression of various types of enzymes in the same cells . Also, the presence of heterogeneous cells in experimental systems influences the expression of pla2s . Mast cells, th2 lymphocytes, and eosinophils are the most important cellular components of asthma . It has been established that primary human lung mast cells constitutively express mrna for the ib, iia, iid, iie, iif, iii, v, x, xiia, and xiib spla2 groups and stimulation with anti - ige antibodies can induce their secretion . Hence spla2 proteins are believed to belong to preformed mediators which are stored in mast cells granules . Cells stimulation by anti - ige antibodies causes degranulation of mast cells, and spla2 appears in the early phase of allergic reaction . However exogenous hpla2v can activate eosinophils, inducing the liberation of arachidonic acid (aa) and ltc4 production . Increased cpla2 phosphorylation and cpla2 activity was observed in eosinophils of asthmatics after allergen challenge . Alveolar macrophages and neutrophils play a crucial role in the pathophysiology of copd [13, 14]. Human macrophages express cpla2iva, ipla2via, and several spla2s (iia, iid, iie, iif, v, x, and xiia, but not group ib and iii enzymes). Neutrophils stimulated in vitro by the tripeptide formyl - met - leu - phe (fmlp) demonstrate mrna and protein expression of spla2v and spla2x, where the spla2v protein is found in azurophilic and specific granules, and spla2x is found only in azurophilic granules . Gib, giia, giid, giie, giif, giii, and gxii spla2s are undetectable . Cell activation by fmlp or zymosan results in the release of gv but not gx spla2 . The balf of patients with copd demonstrates a three- to fivefold higher activity of pla2s in comparison to a control balf but the protein level shows no difference . However, significantly greater levels of this enzyme are found in the balf of smokers compared with nonsmokers . Among spla2s, a change of gly80ser in the spla2iid protein may be associated with body weight loss in patients suffering from copd . Spla2iid can be also involved in control of inflammation by inhibition of cd4 +, cd8 + t cells proliferation and induction of regulatory t cell differentiation . Cigarette smoke extract (cse) can induce the production of cytosolic phospholipase a2 in human pulmonary microvascular endothelial cells cpla2 also participates in phosphodiesterase 4 signaling, whose inhibition attenuates neutrophilic inflammation in copd . The increased values of pla2vii in patients with long - standing pulmonary hypertension (severe complication in copd) are related to severe endothelial dysfunction . The spla2v - induced activation of neutrophils in contrast to eosinophils requires the presence and activation of cpla2 . The inhibition of cpla2 may be more effective in diseases where neutrophils play a crucial role because they indirectly inhibit also the function of spla2 . The proposed mechanism of action of phospholipases a2 (pla2s) in inflammatory diseases includes the liberation of arachidonic acid, generation of lysophospholipids, interaction between enzymes belonging to the a2 superfamily, surfactant degradation, release of cytokines, and the impact on immunological and inflammatory cells (dendritic cells, t - cells, and leukocytes). The enzymatic properties of pla2s refer to their phospholipase, lysophospholipase, transacylase, adiponutrin - like, triglyceride lipase, peroxiredoxin 6, and acyl - ceramide synthase activities . Phospholipases a2 play a pivotal role in eicosanoid production because they hydrolyze the ester bond at the sn-2 position of the glycerophospholipid membrane, releasing arachidonic acid (aa) and lysophospholipids . It can act as a signaling molecule that regulates the activity of protein kinase c (pkc) and phospholipase c, influences ca concentration, and acts as an endogenous ligand for ppar receptors [28, 29]. Aa is also a precursor of lipid inflammatory mediators (eicosanoids). In cyclooxygenase (cox) pathways, it is transformed to prostaglandins and thromboxane while in lipoxygenase (alox) pathways, it is converted to leukotrienes . These molecules are responsible for bronchial constriction, increased vessel permeability, and inflammatory cell recruitment . Aa is also a substrate for resolvins and lipoxins (lxs) which have anti - inflammatory properties . Lipoxins can block granulocyte chemotaxis, migration, degranulation, oxidative burst, cytokine - mediated signaling in eosinophils, and secretion of cytokines from bronchial epithelial cells . Several independent studies have reported that significantly lower levels of lxs are observed in severe asthmatics compared to patients with nonsevere asthma [32, 33]. Resolvins demonstrate endogenous anti - inflammatory, proresolving, antifibrotic, antiangiogenic, anti - infective, and antihyperalgesic activity . Among cytosolic phospholipases a2, it has been well documented that cpla2iva (cpla2) plays an important role in eicosanoid production . In patients with inherited cpla2 deficiency (loss - of - function mutations in both cpla2 alleles), a widespread decrease in eicosanoid concentrations has been observed . S111p, r485h, and k651r mutations in pla2g4a gene are thought to play a crucial role in this condition . The functional consequences of localized mutations concerning cpla2 catalytic activity, ca recruitment, and affinity for the phospholipid membrane have been confirmed in vitro and in cell culture . In patients with severe asthma, the microsatellite fragments (t)n and (ca)n in the promoter region of cpla2 gene (pla2g4a) are shorter in comparison to healthy subjects . In addition, asthmatic patients with shorter microsatellite sequences demonstrate greater expression of cpla2 mrna, cpla2 protein, pge2 and 15-hete, but not ltc4 . Cpla2 participates in intracellular signaling, leading to allergen - induced production of inflammatory cytokines in the pbmc of asthmatics . Identified increased expression of three cpla2s, including cpla2, cpla2, and cpla2 in induced sputum cells from subjects with asthma and exercise - induced bronchoconstriction . Both cpla2 and cpla2 enzymes also participate in eicosanoids biosynthesis [40, 41]. Increased cpla2 expression and subsequent pge2 production are present in the asthma phenotype . The therapeutic decision to inhibit cpla2 in asthmatics may be unclear when considering the role of pge2 in airway inflammation . There is some evidence that pge2 can act as bronchodilator, as well as an inhibitor of both allergen - induced bronchoconstriction and inflammatory mediators production . It should be noticed that pge2 acts through four different types of receptors (ep1, ep2, ep3, and ep4). Changes in expression and combination of receptor subtypes actions may affect the action of pge2 giving it proinflammatory or bronchoprotective outcomes [4345]. The pleiotropic properties of pge2 make it difficult to establish the direct impact of pge2 deficiency which appears as a consequence of cpla2 inhibition . Moreover, although cpla2 is a major enzyme, it is not the only one providing substrates for eicosanoids synthesis; hence it cannot be excluded that other existing pathways can also perform this function . Spla2s and arachidonic acid accumulate in the balf of asthmatics after allergen challenge [47, 48]. Despite being specific to the sn-2 bond, spla2s play more of a supporting role in aa liberation . Only spla2v and spla2x can efficiently interact and hydrolyze phospholipids from the outer surface of the cell membrane . In acute and chronic animal asthma models, a deficit of spla2x diminishes the features of asthma (eosinophilia, airway hyperresponsiveness to methacholine, airway remodeling, eicosanoids, and th2 cytokine production). . Showed that the expression of spla2x predominates in the airway epithelium, and both spla2x and spla2iia are the main phospholipases produced by balf cells . Only spla2x, not spla2iia, is correlated with asthma features such as lung function, recruitment of neutrophils in asthmatics . Spla2x is responsible for production of cysteinyl leukotrienes (cyslts) which are proinflammatory in asthma and can be responsible for observable features of asthma . Moreover, the level of prostaglandin e2 (pge2) is also connected with spla2x, which can be explained by the fact that spla2x increases activity of cpla2iv which in turn leads to production of pge2 . These results are consistent with earlier studies by the same authors in which gene expression of spla2x and spla2 xii was demonstrated to be elevated in induced sputum cells of patients with asthma . The level of spla2x in induced sputum cells supernatant increased after exercise challenge among asthmatics with exercise - induced bronchoconstriction (eib). They demonstrated that recombinant spla2x caused aa release and rapid onset of cyslt synthesis in human eosinophils . It is possible that in a proinflammatory environment, that the spla2x propeptide is more rapidly converted to an active form that might influence the th1/th2 balance . Other spla2s (iia, iid, iie) contain a heparin - binding domain which allows these enzymes to be taken into the cells and further directed to compartments enriched in aa and enzymes responsible for eicosanoid production . In spite of the fact that several studies have confirmed the participation of ipla2 and ipla2 in aa release and eicosanoid production, there is no data indicating that these enzymes play a direct role in asthma . By the induction of ca influx they can influence the translocation and activity of ca - dependent pla2s isoforms . Group vii and viii paf - ah hydrolyze the short sn-2 residue of paf (platelet activating factor). As they lack activity against membrane phospholipids with long - chain sn-2 residues, they are unable to release arachidonic acid from membrane phospholipids . They exhibit pro- and anti - inflammatory properties . On the one hand, they inactivate paf the proinflammatory mediator by hydrolyzing it to inactive acetate and lysolipid but on the other hand, they assist in the generation of lysophospholipids and fatty acid hydroperoxides . Have established that asthmatics have a decreased level of paf - ah, and that asthma incidence and severity correlate to paf - ah deficiency in the japanese population . Also some paf - ah gene polymorphisms (ile198thr and ala379val variants) are known to be a risk factors for developing atopy and asthma . Despite positive effects in animal models, administration of human recombinant paf - ah (rpaf - ah) does not reduce both early and late phase of asthmatic response in mild asthmatics challenged with allergens . They are a precursor of platelet activating factor (paf) and lysophosphatidic acid (lpa). Lpa is involved in cell adhesion, motility, and survival . In animal models, lysophospholipid receptors are required for proper development and function of the cardiovascular, immune, respiratory, and reproductive systems . Lysophosphocholine and polyunsaturated fatty acids, including aa, can activate cpla2 and 5-lipoxygenase by increasing ca and inducing cpla2 phosphorylation, which then leads to ltb4 biosynthesis . Lysophospholipid has nonspecific cytotoxic effect that depends on its concentration (critical micelle concentration). At concentration below their unspecific cytotoxic effect lysophospholipids secretory phospholipases degrade phosphatidylcholine (pc), the main component of the surfactant responsible for maintenance of small airway patency . The generation of lysophospholipids and free fatty acids by spla2-mediated pc hydrolysis has been implicated in small airway closure in asthm . Spla2 action is enhanced by eosinophilic lysophospholipases that use lysophospholipids as a substrate [6568]. The presence of ipla2 proteins in alveolar macrophages suggests that they might play a role in surfactant degradation . It should be mentioned that some pla2s are involved in antibacterial defense thanks to their ability to hydrolyze the lipids of the bacterial membrane . Spla2s iia, v, x, and ib demonstrate bactericidal activity against gram - positive pathogens but the most effective is spla2iia . Apart from their enzymatic activity, they can act as extracellular mediators involved in chemotaxis, cytokine production, and induction of cellular signaling pathways . Mammalian n - type receptors have been identified for spla2ib and iia, x and m - type receptors for spla2ib, iia, iie, iif, v, and x . N - type like receptors are present in lungs whereas m - type receptors have been identified in lung and myeloid cells . Spla2s are stored in intrinsic mast cell granulates and are released after cell activation by ige and non - ige stimuli . After exocytosis, they can act in both autocrine and paracrine manners . By interacting with heparan sulphate proteoglycans and m - type receptors, they can induce pgd2 and ltc4 production and stimulate the subsequent degranulation of mast cells . Granata et al . Delivered an evidence that spla2s can act as proinflammatory connections between mast cells and macrophages in the airway . They suggest that the activation of macrophages by spla2s leads to production of proinflammatory cytokines which sustain the inflammatory and immune response, chemokines responsible for recruitment of monocytes and neutrophils, as well as destructive lysosomal enzymes, no, pge2, and metalloproteinases connected with airway remodeling . They influence the migration and adhesion of neutrophils as well as the release of elastase [76, 77]. In eosinophils, spla2 ia and iia stimulate -glucuronidase release and cytokine production (il-6, il-8) by aa and lysophospholipid generation, by interaction with membrane peptidoglycans via their heparin - binding site, and through binding with specific m - type or n - type receptors . The functions of spla2s receptors require further studies because there are still some missing or unequivocal information . Spla2 and cpla2 interaction is quite well documented [79, 80]. The effect of group iia and v pla2s on h2o2-induced aa release is dependent upon the presence of cpla2 and the activation of pkc and erk1/2 in murine mesangial cells . Spla2 activation induces production of bronchoconstrictor cysteinyl leukotrienes and suppresses cpla2 expression and the subsequent production of bronchodilator pge2 . Recently it has been established that in human eosinophils, spla2 initiates ser(505) phosphorylation of cpla2 and stimulates leukotriene synthesis through involvement of p38 and jnk mapk, cpla2, and 5-lipoxygenase activation, which may be an important process also in airways of asthmatics . Also in bone - marrow - derived mast cells, spla2 mediates the selective release of aa by binding m - type receptors and then inducing mapk signaling pathways that lead to cpla2 activation . Another aspect of phospholipases and the asthma / copd relationship is the participation of these enzymes in the pathogenetic mechanisms of disease exacerbation caused by bacterial factors . This role relates to increased expression of selective pla2s, modulation of their activity and involvement in cellular signaling . Elevated cpla2 expression was found in primary human lung macrophages after lps treatment [15, 83]. Lps stimulates expression of cpla2 and cox-2 in macrophages, leading to increased production of aa and pge2 . Lps treatment was also followed by rapid changes in cpla2 phosphorylation [84, 85]. The lps - phosphorylated form of cpla2 is present in induction of inos and tnf- expression [87, 88] and metalloproteinase production . Selective spla2 contributes to lps - intracellular signaling in liver macrophages [84, 90, 91]. In mice with lps - induced lung inflammation, the expression of spla2x remains the same before and after treatment . In this study, increased expression of spla2iid and spla2v has been observed, as well as decreased spla2iie and spla2iif levels in the lungs . In rats, spla2iia was seen to have the highest expression after lps administration . In mspla2x mice with knock - in of human spla2x (hspla2x), allergen - induced inflammatory cell recruitment into airways (eosinophils) the application of specific hspla2x inhibitor (ro 061606) significantly attenuates airway inflammation symptoms, mucous secretion, and hyperresponsiveness . In spla2v knock - out mice, spla2v has been proven to play a role in the development of lung injury and neutrophilic inflammation after bacterial stimulus (lps). In addition, spla2v was seen to be connected with regulation of cell migration and generation of airway hyperresponsiveness after ovalbumin challenge . In a murine allergen - challenged asthma model, administration of rpaf - ah is effective in blocking late - phase pulmonary inflammation . Taking into consideration the severe asthma phenotype, the difficulties related to obtain asthma control utilizing currently available treatments and the progressive character of inflammation in patients with copd that increases the morbidity, it seems reasonable to study the differences in pathogenesis of the diseases conditions, especially in relation to possible new therapies and drugs . The superfamily of these enzymes contains approximately 30 members that have similar and isoform - specific properties . The inhibitors of particular pla2s show the positive effect in treatment of inflammatory diseases and they inhibit allergic reaction in vitro . The cpla2 that evolved together with receptors for eicosanoids, present only in vertebrate, seems to play crucial role in course of inflammation . Its inhibitors such as efipladib and ecopladib successfully inhibit inflammation in rheumatoid arthritis and osteoporosis . The inhaled form of cpla2 inhibitor, the pla-950, is considered as potential new treatment in asthmatic patients as well as other pla2s can influence the function of cpla2 or have similar effects . The studies and analysis of protein involved in regulation of particular spla2 involved in inflammatory diseases could result in finding new target for drugs . Since 1980, it has been known that glucocorticoids (gcs) can inhibit the activity of pla2 . The underlying mechanism concerns induction of mrna and protein expression of lipocortin 1 (annexin 1) and the pla2 inhibitory protein [101104]. The structure, function, and mechanism behind the anti - inflammatory action of annexin 1 have been well described elsewhere . Glucocorticoids can also suppress the production of spla2iia by blocking mrna synthesis and posttranslational expression in rats . It is questionable whether therapeutic doses of glucocorticoids have sufficient power to satisfactorily inhibit the activity of pla2 . . Demonstrated that topical gcs at therapeutically relevant concentration (10 m) inhibit the spontaneous activity of cpla2 in the range of 8.617.3% depending on the type of gc . They suggest also that this effect may appear as a consequence of a decreased ability to binding the receptors by gcs present in airway in subtherapeutical doses . Although it has been established that treatment with gcs can indirectly inhibit cpla2 and aa - derivates production resistance to gcs in patients with asthma and copd could also be problematic . Moreover the gcs have systemic effects and long - term application can cause the side effects . The approach to attack the inflammation process more precisely and downstream (inhibition the eicosanoids production) seems to be rationale . Another aspect regarding annexin 1 and pla2s is their cell - specific manner of interactions . . Demonstrated that cleavage of annexin 1 causes phosphorylation of cpla2 during mast - cell activation . Hence it is not clear whether gcs - induced expression of annexin always leads to inhibition of cpla2 activity . As previous studies indicate that gcs can stimulate expression of cpla2 in amnion fibroblast it cannot be excluded that in some specific circumstances gcs may directly induce cpla2 [109, 110]. Previous studies confirm the involvement of phospholipases a2 in asthma and copd although there are some gaps relating to the roles of specific enzymes . The diagnostic problems concerning the overlap syndrome that shares the features of asthma and copd demand further studies on the pathogenesis of these diseases . The phospholipases a2 through their involvement in the course of inflammation seem to be important aspects of this investigation . As they demonstrate pro- and anti - inflammatory properties, a detailed analysis of their role should act as a focus for further studies intended to bring new insights into the pathogenesis of the diseases and identify targets for new drugs . Data from studies focused on role of pla2s in inflammatory diseases facilitate the understanding of molecular aspects of inflammation . It can be observed that cpla2 plays a main role in eicosanoid production and other pla2s may influence their activity thanks to enzymatic properties or act as regulators of inflammation through their nonenzymatic activity . The pleiotropic properties of single phospholipase and their differential expression in many cells confirm that this is well - organized network of interaction, and further studies focused on this aspect may provide more useful knowledge . A comparison of how this network works in different inflammatory diseases, as well as in healthy subjects may indicate a key molecule, whose activity or presence will be a diagnostic parameter or whose activation or inhibition will have therapeutic value . Asthma and copd are heterogeneous diseases and current treatment gives only the possibility to obtain the phenotype of well - controlled diseases . Analysis of data regarding the involvement of pla2s in course of diseases arises the concept to use combined therapy rather than the treatment based on inhibition of one of them . The results from preclinical studies of cpla2 inhibitors are promising but clinical trials will give concrete knowledge about the effectiveness and possible side effects.
Signal transducing adaptor proteins are a group of intracellular and transmembrane molecules which are crucial supplementary factors of signaling pathways . They mediate interactions between different molecules and contribute to the formation of signaling complexes . Adaptor proteins lack enzymatic activity and interaction domains enable them to connect with other molecules (e.g., proteins, lipids). Src - like adaptor protein 1 (slap-1) was cloned in a yeast two - hybrid screen with the cytoplasmic domain of the receptor tyrosine kinase ephrin type - a receptor 2 as decoy [1, 2]. Slap proteins are not identical in size; slap-1 (or often quoted as slap) contains 276 amino acids while slap-2 consists of 261 amino acids (figure 1). Src protein tyrosine kinases (ptks) are protooncogenes that play a role in cell proliferation, survival, and morphology . Unlike src ptks, in addition to the myristoylated amino - terminal and sh domains, slap family members contain unique carboxy - terminal sequences as well . Slap-1 has a longer carboxy - tail than slap-2, but the n - terminal is longer in slap-2 . Myristoylated part of the slap promotes the association with membranes, while isoforms without the myristoylated n - terminal are located in the nucleus (figure 1). Human slap is coded by a 64 kb intron of the thyroglobulin gene, on chromosome 8q24.23 in the candidate territory for a recessive demyelinating neuropathy . Sequence analysis could not find any mutations suggesting that this gene is not responsible for the disease . Sh domains are the most similar parts of the two slap molecules, in which the sequence homology is 59%, while the n - terminals are the most different parts; they have only 19% identity . This isoform contains only 210 amino acids due to the deletion of 50 bp from exon 6, which results an alternative reading frame . Although expression of slap-1 and slap-2 mrnas has been most extensively studied in lymphocytes, they are also expressed by numerous human and murine tissues and cell lines [1, 2, 712] (table 1). Several proteins have been reported to interact with slap-1 and slap-2 [5, 8, 9, 1315] (figure 2). Slaps are involved in a broad range of cellular processes, for example, lymphocyte development, neuronal excitotoxicity and platelet activation . Slap molecules may participate in several pathological conditions of the immune system as well . In the present review, we will discuss the role of both slap proteins in different cell types and overview our current understanding regarding their relevance in pathological conditions . Tcr consists of a ligand binding heterodimer and the cd3 complex that includes the and heterodimers and the homodimer . The expression of the -chains is about the 10% of the other subunits of the tcr complex . Slap-1 may interact with many molecules involved in the tcr signal transduction (zap-70, syk, lat, cd3 -chain, vav, and lck) through the sh2 domain [9, 16]. Slap-1 reduces the production of il-2 and the transcription of nfatc1 and ap-1, thereafter functions as a negative regulator of the tcr signaling; both sh2 and sh3 domains are necessary for this effect . However, upon ionomycin or pma activation of lymphocytes, these inhibitory effects are absent suggesting that slap-1 regulates the proximal part of the tcr pathway . Slap may associate with the n - terminal of the e3 ubiquitin ligase c - cbl in a tyrosine phosphorylation independent way . The simultaneous expression of slap-1 and c - cbl promotes the ubiquitination and degradation of the -chain, consequently enhancing the recycling and preventing the accumulation of the receptor complexes . By contrast, similarly to slap / lymphocytes, c - cbl / lymphocytes overexpress the -chain due to its abolished degradation . For successful operation, slap-1 requires the phosphorylation of the cytoplasmic domains of the tcr -chains and the activation of lck, but not of zap70 . It has been shown that the phosphorylated proportion of the -chains is slightly traceable in lck / lymphocytes [20, 21]. Slap colocalizes with early endosomes according to confocal microscopy images (figure 3). It is noteworthy that downregulation of -chain of t - cells has been observed in many pathological conditions including rheumatoid arthritis (ra), systemic lupus erythematosus (sle), human immunodeficiency virus (hiv) infection, and various cancers [2228]. The fate of the early lymphocytes depends on the tcr - mediated signals: both too strong and too week signals through the tcr lead to cell death (during positive and negative selections, resp . ). It is expressed at low levels in cd4 cd8 cells and at high levels in cd4 + cd8 + thymocytes . Slap as a regulator of the tcr expression plays a pivotal role in the downregulation of tcr complexes of the developing lymphocytes . Moreover, the apoptosis of zap70 / cells was inhibited in the absence of slap . It has been reported that the proline rich - sequence (prs) of cd3 act together with slap in the regulation of tcr expression in cd4 + cd8 + thymocytes . Cd3 prs deficient cells were unable to degrade the -chain . In double positive thymocytes, the chains of the tcr complex are constitutively ubiquitinated, but the ubiquitination is absent in mature cells . It has been shown that cd3 prs, lck, c - cbl, and slap are required for the ubiquitination and degradation of the -chains . In the absence of ubiquitination, both the lysosomal sequestration and degradation are failed, and tcr chains are upregulated in cd4 + cd8 + lymphocytes . In addition, modified tcr complex ubiquitination influences the formation of the immunological synapse and alters the selection of the immature cells . The lack of slap increases the avidity of the tcr which leads to the negative selection of antigen specific cd8 + cells . All these data suggest that slap plays a major role in the tcr repertoire configuration . Slap is associated with c - cbl in b lymphocytes, leading to bcr recycling (figure 4). Slap deficiency increases the bcr levels of immature b cells in hel - specific md4- transgenic mice, which is a frequently used model to study nave b lymphocytes . In this model the upregulated receptor complex levels lead to increased signal transduction . Slap deficient mice have an increased number of splenic b cells, but the surface expression of bcr and igm of mature lymphocytes is decreased . Furthermore, the activation induced calcium flux is diminished in slap ko b cells . In virtue of the previous data slap regulates the level of bcr s which is essential for the adequate development and function of b cells . Slap-2 has a negative regulatory role on the antigen receptor signaling of t and b lymphocytes . The overexpression of slap-1 and slap-2 inhibits the upregulation of cd69 after antigen receptor cross - linking . Slap-2 suppresses the antigen binding induced calcium influx in t (jurkat) and b (bjab) cell lines . Slap-2 reduces the cd69 expression in jurkat cells (61%) more significantly than in bjab cells (28%). Slap-2 is associated with ubiquitin ligase c - cbl similarly to slap-1, deletion of the carboxy - terminal of slap-2 was reported to inhibit this connection . In activated jurkat cells slap-2 binds to c - cbl, zap-70, and cd3 in a phosphorylation independent manner . The coexpression of slap-2 and zap-70 or syk in t - cell lines lead to the degradation of both kinases . Thus, slap-2 induces the c - cbl dependent degradation of tyrosine kinases and downregulates cd3 expression . Slap-2 is expressed in human monocytes and bone marrow cells [1, 35], but not in csf1 independent monocyte cell lines such as raw264.7 . It was shown that slap-2 may bind to both c - fms and c - cbl, and several domains of slap-2 are involved in this interaction (figure 5). The overexpression of slap-2 in murine bone marrow reduced the m - csf - induced tyrosine phosphorylation . Slap-2 downregulates the c - fms signaling through a c - cbl dependent internalization and degradation of the csf-1r, providing a negative feedback of the m - csf pathway . In addition, c - fms stimulation induces the phosphorylation of the serine rich n - terminal domain of the slap-2 by a jnk dependent pathway . The activation - induced gm - csfr downregulation is attenuated in slap-1 and slap-2 deficient bone marrow dendritic cells (bm - dc), which is associated with enhanced map / erk and akt pathways upon gm - csf stimulation . The inhibited activation through gm - csfr impairs the bone marrow derived dendritic cell maturation . Slap-1 and slap-2 deficient bm - dc cells produce less il-12 and tnf- upon lipopolysaccharide (lps) stimulation and induce significantly less ifn- secretion of t - lymphocytes than the wild type cells . These data suggest that slap proteins are necessary for monocyte and dendritic cell maturation and activation . Slap has a prominent role in the regulation of intracellular signal transduction in mast cells . Slap - specific small interfering rnas inhibit the effect of dexamethasone on the phosphorylation of plc, lat, syk, and erk . Actinomycin d inhibits the transcription of slap following dexamethason treatment, suggesting that the upregulation for slap-1 upon glucocorticoid treatment occurs at the transcriptional level . Slap-1 plays a role in the negative regulation of antigen - stimulated mast cells as well . Upon antigen stimulation of the rbl-2h3 mast cell line, elevated transcription of the sla gene and upregulation of the slap-1 (but not slap-2) protein were reported . An increased amount of slap-1 was detected after 60 minutes stimulation and it reached the maximum after 2 - 3 hours . By contrast, after silencing of slap, increased il-3 and mcp-1 production was detected . Inhibiting the development and activation of osteoclasts is currently the gold standard therapeutic strategy in this disease . Although today several antiosteoporotic drugs are widely used in the clinical practice, the effect of these medications on increasing bone density and strength is moderate . There is an inverse correlation between both slap-1 and slap-2 and the tartrate - resistant acid phosphatase (osteoclastogenesis marker) mrna expression . The level of osteoclast - specific protein mrnas (e.g., catepsin k and mmp-9) are elevated in the slap-1 / preosteoclasts . Slap-1 has an inhibitory effect on the map kinase pathway which is initiated with the binding of m - csf to its receptor c - fms . This receptor is a tyrosine kinase transmembrane protein which accumulates in lipid rafts where it associates with slap-1 . The lack of slap enhances osteoclastogenesis without changing the resorptive function of the individual cells . In addition, slap-1 deficiency increases the apoptosis of the mature polykariotic osteoclasts without altering the viability of the precursors . According to our current understanding, slap-1 has a regulatory effect on osteoclastogenesis and mature cell survival through the m - csf pathway . Slap-2 is expressed in human platelets and may associate with syk, c - cbl, and lat . After its activation, slap-2 promotes syk and c - cbl to approach their substrates . Slap-2 inhibits glycoprotein vi (gpvi) initiated signal transduction of platelets through the connection with c - cbl . This inhibitory effect on thrombocyte activation is similar to those described previously in lymphocytes [1, 5]. Slap may also associate with platelet derived growth factor receptor (pdgfr) in nih3t3 mouse embryonic fibroblast cell line . Overexpression of slap in nih3t3 cells inhibits pdgf - induced mitogenesis suggesting that slap is a negative regulator of growth factor initiated signaling . Although in embryonic rat telencephalon sections slap-1 mrna is absent in migrating neurons, it is highly and selectively expressed in neurons which have reached their final location . Pyramid cells are typically located in the deeper layers of the cortex, and they have connection with the subcortical areas . It is not yet clear whether slap-1 plays a role in the axon guidance during development but apparently has a remarkable expression . Western blot analysis and immunolabeling of rat brain extract showed that slap-1 is located in the postsynaptic membrane . Slap-1 has an association with ephas and nmdars have a connection with ephbs [44, 45]. Ephb may excite the enlistment of ephas and promote the recruitment of slap-1 and nmdars . Despite the analogous localization, slap-1 does not affect the baseline activity of nmdars through a src - dependent stimulation of the receptors . Slap-1 may have a role in the negative feedback which regulates the number of the nmdars and prevent excitotoxicity . This effect of slap-1 is based on the proteasomal degradation of redundant nmdars in neurons . The described role of slap in neurons seems to be essential for the adequate neuronal functions . Rheumatoid arthritis (ra) is a common autoimmune disease that is associated with progressive disability and systemic complications . Symmetric synovial inflammation of multiple joints, especially the small joints of the hands and the feet, is characteristic for the disease . The ongoing inflammation leads to cartilage destruction, bone erosions, and subsequent joint deformities . Although the current treatment strategy, especially the use of biologicals, improved largely the outcome of the disease, still only a small portion of the patients are in sustained remission and systemic complications (including cardiovascular risk) still represent a significant challenge . Tnf- plays an essential role in the pathogenesis of ra through promotion of angiogenesis, suppression of regulatory t - cell activation, and cytokine and chemokine expression . According to the recently published data of our research group, tnf- treatment downregulates the expression of -chain of cd4 t - lymphocytes reversibly and selectively in a dose dependent way . Tnf- induces the expression of slap which promotes the proteasomal but not the lysosomal degradation of the -chain . Tnf- treatment does not alter the slap mrna level, suggesting that tnf- controls slap activity through mirna mediated posttranscriptional silencing . Cd4 + t - lymphocytes isolated from ra patients expressed more than 2-fold higher slap levels than the t - cells of healthy donors . Tnf- treatment enhances the expression of slap in the cd4 + t - lymphocytes of healthy donors and dmard treated ra patients but does not alter the expression of cd4 + t - cells isolated from biological dmard (etanercept, certolizumab pegol) treated patients . A spontaneous mutation in zap70 protein uncoupled proximal tcr signal transduction and led to severe symmetrical arthritis in skg mice upon exposure to zymosan . According to recently published data, slap deficiency dramatically reduced both the incidence and severity of zymosan - induced chronic autoimmune arthritis in skg mice . The protective role of slap deficiency was associated with the increased number of regulatory t - cells and decreased amount of th17 cells . Slap expression is increased in several cancers including chronic myeloid leukemia (cml), chronic lymphocytic leukemia (cll), and prostate cancer . By contrast, its expression is decreased in acute myeloid leukemia (aml), myeloma, and colon cancer . Furthermore, slap is associated with several oncogenic signaling pathways . It was recently reported that the transmembrane protooncogene c - kit is degraded through a slap dependent pathway . Slap binds to the wt c - kit and initiates its ubiquitylation and degradation in the proteasome . By contrast, slap does not have a similar regulatory effect on the oncogenic c - kit variant (c - kit d816v). Oncogenic c - kit associates with slap and phosphorylates it on three different tyrosines (y120, y258, and y273); the phosphorylated forms of slap do not alter the downstream signaling of the mutant c - kit . These data suggest that slap regulates wt c - kit signaling, but the oncogenic variant escapes from this negative feedback regulation . The fms like tyrosine kinase (flt3) is a receptor tyrosine kinase, which is predominantly expressed in hematopoietic progenitor cells . After ligand stimulation, slap colocalizes with the flt3-itd and targets it for c - cbl dependent ubiquitylation and proteasomal degradation . About 30% of patients with aml have mutation in the flt3 gene and gain of function mutations contribute to the initiation of aml . The expression of slap is increased in patients with acute promyelocytic leukemia (apl) carrying flt3-itd mutation as compared to the flt3-wt . Fli-1 is a transcription factor, a member of the e26 transformation - specific (ets) protein family . Furthermore, the fli-1 locus is an integration site for the friend murine leukemia virus, which induces erythroleukaemia in responsive mice . Slap protein and mrna levels are overexpressed in fli-1 transformed erythroblasts . Slap binds to both the phosphorylated and unphosphorylated forms of the erythropoietin receptor (epor). Slap expression prevents the epo - induced differentiation, whose effect is associated with the inhibition of stat5 activation and bcl - x upregulation ., slap is expressed in colon epithelium, but it is significantly downregulated in colorectal tumors . Interestingly, silencing of slap promotes tumor progression, while overexpression inhibits tumor growth and invasiveness . Slap promotes the destabilization of the src substrate ephrin type - a receptor 2 (epha2) in the intestinal cells . Epha2 plays a critical role in the regulation of several intracellular signal pathways which mediate cell migration, invasion, and angiogenesis . The inhibitory effect of slap appears to be independent from c - cbl but has an association with the ubiquitination factor ube4a and with the ptyr594-epha2 . Slap proteins are expressed in a variety of cell types which indicates a conserved function of these proteins . Both slap-1 and slap-2 have a prominent role in the negative regulation of several membrane bound receptors and receptor tyrosine kinases, thereafter slaps play a central role in the regulation of intracellular signal transduction and cell reactivity . The proper function of slaps is necessary for immunoreceptor repertoire configuration and helps to avoid uncontrolled cell activation, proliferation, and migration . Slap molecules are involved in the ubiquitination of proteins, which may lead to proteasomal degradation . Selective regulation of slap molecules in different cell types may allow the fine control of cell activation and differentiation . Exploring the precise role of slap proteins will contribute to the understanding of many yet unknown physiological regulatory processes . In addition, tissue specific targeting of slap may provide valuable therapeutic approaches in diverse diseases including ra, osteoporosis, immunodeficiency, and different cancers.
Linear psoriasis is a rare form of psoriasis, characterized by a linear distribution of the psoriatic lesions along blaschko's lines . The pathogenesis of linear psoriasis is not clear, but it could be explained by the well - established concept of genetic mosaicism . A 56-year - old previously healthy woman presented with a 3-month history of multiple confluent erythematous papules and plaques covered by scales . The papules and plaques had well - defined and sharply demarcated boundaries, ranged from 3 to 10 mm in diameter, were limited to the right side of her body and were arranged along blaschko's lines with a marked mid - line cutoff . The lesions were first noticed in the right scapular region and progressively extended within a few weeks to the lateral aspect of the right superior limb, the right side of the trunk, the abdomen and the anterior aspect of the inferior limb, especially pronounced in the proximal third of the thigh and the knee (fig . The patient denied any episodes of infection preceding the dermatosis . No psoriasis - form nail or scalp lesions were observed, and there was no personal or family history of psoriasis . The histopathologic analysis of a skin biopsy revealed orthokeratosis, parakeratosis and spongiosis - form munro's microabscesses, in association with a regular elongation of rete ridges, suprapapillary thinning, and an absence of granular cell layers (fig . A slight improvement was noticed after 1 month of combined treatment with betamethasone valerate and calcipotriol ointment . After complete laboratory exams including blood cell count, renal, hepatic and lipid panels, hbv and hcv serologies, and a chest radiograph, the patient was started on methotrexate 10 mg weekly with excellent response . In the 26th week of treatment, as only residual lesions persisted, the methotrexate dose was reduced to 7.5 mg weekly and maintained until the present time (cumulative dose of 465 mg) with no clinical relapse . There are few cases reported in the literature [1, 2, 3], and therefore there is no estimated prevalence . Also because of its clinical and histological similarity to ilven, the main differential diagnosis is ilven, and the distinction between the two entities has been discussed in the literature [4, 5, 6]. A late onset of asymptomatic to slightly itchy lesions with a possible involvement of scalp and nails and a favorable response to antipsoriatic treatment favors the diagnosis of linear psoriasis [8, 9]. In contrast, ilven lesions usually occur in the first months of life, are slowly progressive, very pruritic and highly refractory to antipsoriatic therapy . As for the histological features, ilven classically demonstrates hypergranulosis and parakeratosis alternating with hypogranulosis and orthokeratosis . On the other hand, the classic features of psoriasis are hyperkeratosis, parakeratosis, the absence of granular cell layers, an elongation of rete ridges, suprapapillary thinning and munro's microabscesses, which can also be seen in ilven . Immunohistopathologic studies may be helpful in distinguishing the two conditions, as done by vissers et al . : in ilven patients, the number of ki-67-positive nuclei tended to be reduced, whereas the number of keratin-10-positive cells was increased compared with psoriasis patients . Involucrin expression, another marker, is absent in ilven patients but detectable in psoriasis . The pathogenesis of linear psoriasis is not clear, but it could be explained by the well - established concept of genetic mosaicism.
A 50-year - old female occupational therapist with a history of laparoscopic anterior resection 4 years previously for a t1 n0 m0 recto - sigmoid adenocarcinoma was found to have an elevated serum carcinoembryonic antigen (cea) of 415.0 g / l on surveillance blood testing . A computed tomography (ct) scan demonstrated a large mass in the left lobe of the liver involving the left and middle hepatic veins . Core biopsies demonstrated moderately differentiated adenocarcinoma, positive for ck20, cea, and cdx2 and negative for ck7, ttf-1, and wt-1, consistent with metastatic colorectal cancer . Since the liver lesion was potentially operable, a f - fluorodeoxyglucose - positron emission tomography (pet)/ct scan was arranged to check for occult extra - hepatic metastases . The pet / ct demonstrated a left iliac bone metastasis, retroperitoneal lymphadenopathy and a f - fluorodeoxyglucose (fdg)-avid thyroid nodule, reported as suspicious of malignancy (figure 1). Given the presence of extra - hepatic metastases, the patient was treated with 6 months of palliative oxaliplatin and modified de gramont chemotherapy . Although the possibility of a primary thyroid cancer was considered, in the context of inoperable metastatic colorectal cancer, further investigation of the thyroid abnormality was not considered appropriate at that time . Ct performed upon completion of treatment demonstrated partial response to chemotherapy: reduction of the liver metastasis, resolution of the retroperitoneal lymphadenopathy, and sclerosis of the right iliac bone metastasis . After 3 months, she underwent left hepatectomy and cholecystectomy, followed by radiotherapy to the left ilium 2 months later . After 2 years of follow - up, a ct scan demonstrated progression of the thyroid nodule and serum cea had risen to 2.2 ultrasound - guided fine needle aspiration of the thyroid nodule was graded thy5 with glandular malignant cells, which were negative for ttf1 and positive for cdx2 by immunocytochemistry . This was consistent with metastatic colorectal adenocarcinoma, and, given that other disease sites had not changed over 2 years, the patient was offered a right hemi - thyroidectomy . The patient is under ct and cea surveillance and remains in remission 10 months later with undetectable serum cea levels . Although benign and malignant incidentalomas are rare in routine clinical practice,1 some clinicians have claimed that widespread use of whole - body imaging examinations has led to increased detection of thyroid incidentalomas2 two systematic reviews (55,160 and 125,754 subjects), analyzing studies using fdg / pet for various indications and patient populations, identified an incidence of focal fdg - avid thyroid lesions of 1%1.6%.3,4 malignancy was detected in 33%34.8% of those with follow - up data available, of whom 81.3%83% had papillary thyroid cancer (ptc), in keeping with the overall proportion of thyroid cancers that are ptcs . Of two studies reporting focal fdg - avid thyroid incidentalomas in patients with known or suspected nonthyroid malignancy, an incidence of 2.0%3.9% was reported, with 34.7%41.7% of these malignant lesions.5,6 in kim et al s study,6 all incidentalomas operated upon were identified as ptcs . There has been a debate over the need to treat all ptcs . Despite the threefold increase in the reported incidence of ptc over the last 3 decades,7 the death rate has remained stable.8 this is supported by the studies of active surveillance, which has not been associated with increased morbidity,9 and evidence of a significant burden of clinically occult ptc at autopsy.10 follicular, medullary, and anaplastic thyroid cancers carry worse prognoses and are considered to require intervention unless the patient has a very poor prognosis from the known nonthyroid malignancy . A retrospective study of 47,813 thyroidectomies performed for various indications, identified thyroid metastases in 0.13% of samples.11 similar large data sets are not available for thyroidectomies performed only in patients with a known nonthyroid malignancy . Moreover, patients with thyroid metastases will typically have advanced malignancy and not proceed to thyroidectomy, so such data would underestimate the true incidence . In an autopsy series, the incidence was 1.9%24% in patients with known malignancy.12 cohort studies have suggested an association with renal cancer,13 although autopsy series indicate they are most commonly derived from lung, breast, and melanoma.12 this case emphasizes the importance of considering carefully whether or not to intervene when an incidental fdg - avid thyroid nodule is detected in a patient with metastatic cancer . Appropriate investigation and management depend on the disease stage, patient s performance status, prognosis, and treatment plan for the known nonthyroid cancer, and whether or not the thyroid abnormality is symptomatic . If there are symptoms, ultrasound and fine needle aspiration for tissue diagnosis is warranted, and multidisciplinary team discussion involving an endocrine surgeon prior to considering further investigation and treatment . For asymptomatic patients, further investigation of fdg - avid thyroid lesions is only appropriate where demonstrating either metastatic disease to the thyroid or a more aggressive thyroid cancer will alter management strategy for that individual patient . The patient in our report had inoperable metastatic disease, so the incidentaloma was not considered likely to affect clinical outcome . However, after the patient underwent potentially curative liver surgery and high - dose radiotherapy, and completed follow - up for 2 years, it became appropriate to further assess the thyroid lesion . One study recruited 43 patients with metastases to the thyroid gland and reported a longer survival (34 vs 25 months) for those undergoing surgery than in subjects treated nonsurgically.14 this was not replicated in another nonrandomized study of 36 patients with metastasis to the thyroid in which 21 patients received surgery versus 15 that did not.11 there was no statistical difference in overall survival despite the worse clinical situation of the nonsurgical cohort . Therefore with such weak evidence available, in patients suitable for intervention for their incidentaloma, surgery is generally the treatment of choice for solitary thyroid metastasis and for known thyroid metastasis in patients where other extrathyroid metastases are resectable.13 patients must be counseled regarding the 1%6% risk of surgical complications associated with thyroidectomy, including vocal cord paralysis, hypothyroidism, and hypoparathyroidism.2 in summary, fdg - avid thyroid nodules occur relatively frequently . On finding thyroid incidentalomas in patients with a history of cancer, metastasis should be considered, even though the majority of these lesions will be benign or ptc . Incidentalomas must be seen in the context of the prognosis and treatment plan for the known malignancy.
Malignant tumors which originated from mesenchymal tissue, has occurred very rarely in the breast . The metaplastic carcinomas which have characterized by a combination of mesenchymal and epithelial components would be uncommon malignancies of the breast . The chondrosarcoma has been a typical example of these rarest tumors of the mesenchymal tissue . A 65 years old man has presented in our department with a complaint of a right sided breast mass which has rapidly grown for 5 months . Breast palpation has revealed a painless, less mobile, and firm to hard mass of 1010 cm with regular margins in area of right breast . Contrast enhanced mri (figures 1a and b) of breasts has revealed huge mixed signal intensity multi lobulated cystic - solid extra - pulmonary mass lesion involving the right anterior chest wall extending from infra clavicular region to the level of xiphisternum measuring 10.4 cm (si) 10.3 cm (ap) 9.9 cm (trans) appearing predominantly hyper intense on t2w and hypo intense on t1w . Heterogeneous predominantly peripheral solid tumoral enhancement has observed with multiple large loculated central areas of necrosis and intensely enhancing septae . Histopathology has revealed the overall appearances of low - grade chondrosarcoma with a tumor composed of lobules of cartilage of varying size separated by fibrous tissue . Immunohistochemical studies have performed by standard revealed that chondrosarcomatous elements were positive for s-100 and vimentin, but negative for cytokeratin and also for estrogen and progesterone receptors . This paper has discussed one of the rarest mesenchymal malignancies of the breast, primary chondrosarcoma . As a primary breast tumor, chondrosarcoma might occur in three different forms: as a pure neoplasm (pure chondrosarcoma), as the stromal component of a histologically malignant phyllodes tumor, or as chondrosarcomatous differentiation in a metaplastic carcinoma . In this report prognosis of chondrosarcomatous breast tumors has not fully known, because many of the reported cases were difficult to analyze (owing to lack of detailed clinical or morphologic information). These tumors were usually large - sized that have occurred in more than 40 year old woman . Axillary lymph nodes have found in 14 - 29% of the cases, most of which were reactive hyperplasia . The present case substantiates the clinical findings of previously reported cases . To diagnose a primary chondrosarcoma of the breast, other types of pure sarcoma, such as spindle cell sarcoma, neuroectodermal tumor, angiosarcoma etc, have also been reported [6, 7]. The history of the patient had an important feature as the mass had grown rapidly without systemic and deleterious effect on the patient s health status . These tumors have tended to grow rapidly and present themselves as a mass for a short duration [2, 3, 7]. A large multilobular mass with regular margins and without a sign of regional invasion has detected by palpation . Previous reports have also pointed out that these large tumors have not generally invaded skin and regional lymph nodes despite their locally advanced nature [2 - 4, 7]. A relatively circumscribed, well demarcated mass, as in our patient, was an imaging characteristic of a pure mesenchymal or a metaplastic carcinoma with sarcomatoid differentiation . It has been redported that imaging studies seldom led to the diagnosis of sarcoma in a suspected benign lesion . The mass was complex echoic on ultrasound and has shown round hyperdense opacity on mammography [4, 7, 8]. The very limited number of such cases has not permitted us to establish an appropriate therapeutic approach . Chondrosarcoma in common locations has generally known as refractory to all types of conventional chemotherapy and radiotherapy . Pure chondrosarcoma and metaplastic cancer of the breast has rarely invaded axillary lymph nodes and would be generally hormone receptor - negative [1, 2, 4, 11]. This extremely rare tumor has tended to grow rapidly, and it was usually large at first physical examination . A large, hyper dense and complex echoic mass with regular margins has given the impression of a benign tumor on mammography and ultrasound . Despite its large size, it has not invaded local and regional structures . Regarding systemic management, there was no standard treatment protocol, and a large variety of chemotherapy protocols have been employed in treating this disease . Systemic therapy principles have been derived from small retrospective case reviews of primary breast chondrosarcomas and extrapolated from studies of non - breast chondrosarcomas, since the clinical behavior and histology were similar . This fact has been supported the theory that adjuvant therapy with estrogen antagonists and other hormone manipulations had no role in treatment of mammary sarcomas . The adjuvant treatment could decrease the rates of local and systematic recurrences, but the results were not significant because of the rarity of this pathological entity and the small numbers of cases have reported, which made the evaluation of the role of the chemotherapy and the radiotherapy in the primary breast chondrosarcoma more difficult . It has seemed to be very important to identify the mammary primary sarcomas as entity separated from the carcinomas of the breast . The primitive chondrosarcoma has remained a rare pathology, among which the therapeutic modalities and the forecast were credibly identical to those of the sarcomas of the same type arising in the other localizations . It has seemed to be very important to identify the mammary primary sarcomas as entity separated from the carcinomas of the breast . The primitive chondrosarcoma has remained a rare pathology, among which the therapeutic modalities and the forecast were credibly identical to those of the sarcomas of the same type arising in the other localizations.
Myoepithelioma is a benign tumor that can originate from any secretory system throughout the body . In the salivary gland, myoepithelioma is rare, accounting for 1% of all salivary gland tumors . Although myoepithelioma of the salivary gland originates most frequently in the parotid gland, myoepithelioma of the accessory parotid gland (apg) is extremely rare, and to date, only 5 cases have been reported in the english literature [2, 3, 4, 5]. Because the clinicopathological and mri findings of myoepithelioma of the apg have not yet been fully described, and given the rarity of this condition, we hereby describe the clinicopathological and mri findings of an epithelioid myoepithelioma of the apg that was treated in our hospital . A 31-year - old woman presented with a 5-year history of a slowly enlarging left mid - cheek mass in the pre - parotid region . Upon examination, a mobile non - tender and smooth - surfaced mass measuring 20 mm in the greatest dimension was noted in the left pre - parotid region . An unenhanced ct of the neck confirmed a well - circumscribed and homogenous mass measuring 18 10 mm and located anterior to the left main parotid gland and on the surface of the masseter muscle . This lobulated mass demonstrated isointensity and hyperintensity relative to the muscle on t1- and t2-weighted mri images (wis), respectively, and homogeneous enhancement on contrast - enhanced t1-wis (fig . C). A time - signal intensity curve (tic) generated from a dynamic mri study revealed a gradual enhancement pattern (fig . 1d). On t2-wis, the mass periphery was surrounded by hypointensity that was suggestive of a fibrous capsule . The tumor was most likely considered a pleomorphic adenoma (pa), given the clinical presentation and mri findings . The mass and the surrounding salivary tissue were completely separated from the main parotid gland and connected to the parotid duct via a ductule . All facial nerve branches and the parotid duct were successfully preserved, and postoperative complications such as facial paralysis and salivary fistula were not observed . Grossly, the tumor was well encapsulated, solid, and lobular (fig . Microscopically, the tumor primarily comprised cells with round nuclei and a few cells with oval and slightly spindle - shaped nuclei . The neoplastic cells were arranged in an epithelial and mostly lattice - like structure with hyalinous and mucinous stroma . 2c), cam5.2 (cytokeratin stain), s-100 protein, smooth muscle actin (sma), cytokeratin14, and ae1/ae3 (pan - keratin stain), as well as negativity for carcinoembryonic antigen . Based on these results, the final histopathological diagnosis of the tumor was epithelioid myoepithelioma . Pa is reportedly the most common subtype of benign apg tumors; in contrast, myoepithelioma represents an extremely rare apg tumor pathology . Only 5 cases of myoepithelioma of the apg have been reported in the english literature . Kawashima et al . Reported a case in a 34-year - old woman, isogai et al . Reported a case of plasmacytoid myoepithelioma of the apg in a 47-year - old woman, and sun et al . Reported a case in a 41-year - old man and one in a 22-year - old woman; recently, xie et al . Described the fifth case in a 65-year - old man who was treated via an endoscopic approach . There have been only a few reports on the imaging findings of myoepithelioma of the parotid gland . According to wang et al ., myoepithelioma of the parotid gland is characterized by a well - defined and smooth or lobulated mass with homogeneous or inhomogeneous enhancement on the ct . Although mri is a widely used modality for evaluating parotid gland tumors because it provides a greater amount of morphological information than ct does, the mri features of myoepithelioma of the apg have not been previously described . The typical mri findings of pa, in contrast, have been well described to include a lobulated or oval - shaped well - defined encapsulated mass, a mass with a hypointensity on t1-wis and hyperintensity surrounded by a hypointense capsule on t2-wis as well as a gradual tic enhancement pattern in dynamic mri studies . In the present case, the myoepithelioma of the apg was isointense relative to the muscle on t1-wis, hyperintense relative to the muscle on t2-wis, and well enhanced on contrast - enhanced t1-wis . Additionally, a tic generated from a gadolinium - enhanced dynamic mri study displayed a gradual enhancement pattern . We preoperatively suspected the mass to be pa because the mri findings were completely consistent with those of pa . As the name indicates, myoepithelioma comprises neoplastic cells exhibiting myoepithelial differentiation; these cells display various morphologic patterns such as spindle, plasmacytoid, epithelioid, and clear types . Because of this morphologic diversity, it is usually difficult to definitively diagnose myoepithelioma by fnac before surgery, although das et al . Reported a case of a successful preoperative parotid myoepithelioma diagnosis via a cytological examination and immunohistochemistry . The main differential diagnoses of myoepithelioma include pa, adenoid cystic carcinoma, other salivary tumors without obvious ductal differentiation, and mesenchymal tumors . In particular, we should always consider various low - grade malignant tumors when interpreting the fnac results from salivary tumors . A histopathological examination of the resected specimen can yield a definitive diagnosis of myoepithelioma, and immunohistochemical staining plays an important role in the detection of neoplastic myoepithelial cells . Such cells are typically positive for cytokeratin, vimentin, s-100 protein, calponin, sma, and glial fibrillary acidic protein, but negative for carcinoembryonic antigen . In our case, the histopathological findings of an epithelial and lattice - like arrangement of neoplastic cells with hyalinous and mucinous stroma were also characteristic components of pa . However, neither cartilaginous myxoid stroma nor a glandular structure was found in our case, and the tumor was entirely encapsulated by connective tissue . Additionally, positive immunohistochemical staining of the neoplastic cells for cam5.2, cytokeratin14, ae1/ae3, sma, and calponin indicated that these neoplastic cells possessed both epithelial and myoepithelial characters . Complete resection along with the surrounding salivary tissue is recommended for myoepithelioma management in order to avoid tumor recurrence . In conclusion, a mid - cheek mass could easily be suspected as an apg tumor according to the clinical presentation and imaging findings . However, because myoepithelioma is an extremely rare apg tumor subtype and the imaging findings of myoepithelioma resemble those of pa, which is the most common benign apg tumor subtype, we believe that it is nearly impossible to preoperatively distinguish myoepithelioma of the apg from pa of the apg or low - grade malignant tumors, even by using fnac, given that kawashima et al . Also misdiagnosed a myoepithelioma of the apg as a suspected adenoid cystic carcinoma (after fnac).
A total of 2,634 fecal and intestinal samples were collected from pigs exhibiting diarrhea from 569 swine farms in all 9 provinces of south korea, during january 1december 31, 2008; age groups of the pigs are defined in the table . All samples were processed as 10% (vol / vol) suspensions with phosphate - buffered saline (pbs; 0.1 m, ph 7.2), and viral rna was extracted from them . Subsequently, reverse transcription pcr (rt - pcr) was performed by using 3 primer pairs as described previously (4). To determine complete spike (s) gene sequence, we purified, cloned, and sequenced pcr products on an automated dna sequencer by using t7, sp6 primers, and newly designed s gene specific primers (primer sequences available on request). Sequences were analyzed by clustalx version 1.83 program (http://www.clustal.org) and megalign software (dnastar inc ., madison, wi, usa), and compared with those of reference strains in genbank . The complete s gene sequence of the pedv variant with a large genomic deletion (strain mf3809/2008/south korea) described here has been deposited in genbank under accession no . The pedv variant with a large deletion in the s gene was found in 3 samples (2 fecal and 1 intestinal) of the suckling pigs with diarrhea at 1 farm in chungnam province . Other pigs on the same farm were infected with pedv with the full - length s gene; however, in no instance were both the pedv variant and pedv with the full - length s gene observed in 1 pig . Pedv, porcine epidemic diarrhea virus; s gene, spike gene . Of the 2,634 samples, 205 (7.8%; 49/569 [8.6%] farms) were positive for pedv: 116 (16.8%) of 692, 12 (2.4%) of 504, 29 (3.6%) of 808, 34 (24.1%) of 141, 1 (16.7%) of 6, and 13 (2.7%) of 483 samples from the 6 age groups tested (table); however, when sf2/sr2 primers were subjected to pcr, a strong and single band of unexpected size (1,000 bp) was found in each pcr product from 3 diarrhea samples of the suckling pigs on 1 farm . Exact length of the band was 981 nt, and the band was much shorter than that of intact fragment because of 612-nt deletion at positions 2277723388 (1,593 vs 981 nt for pedv reference strains and pedv variant, respectively; technical appendix figure 1). Sequence similarity of the 981-nt fragment of mf3809 was found to be in pedv s gene region in genbank by blast analysis (http://blast.ncbi.nlm.nih.gov/blast.cgi). The complete s gene (3549-nt segment, corresponding to 1182 aa) of mf3809 had high (93.3%98.5% nt, 92.0%98.0% aa) sequence identity to all known pedv strains for which full - length s gene sequences were available in genbank, except that mf3809 has the large deletion in its s gene . Phylogenetic analysis confirmed that mf3809 belonged to a cluster containing a pedv reference strain, not a cluster that included any other coronaviruses, and showed the closest genetic relationship with pedv strains from south korea in 2009 (figure). A) relationships between the pedv variant (mf3809/2008/south korea) and other coronaviruses based on the full - length spike gene . Pedv, porcene epidemic diarrhea virus; tgev, transmissible gastroenteritis virus; prcv, porcine respiratory coronavirus; ccov, canine coronavirus; fcov, feline coronavirus; hcov, human coronavirus; mi - batcov, miniopterus bat coronavirus; sc - batcov, scotophilus bat coronavirus; hecov, human enteric coronavirus; bcov, bovine coronavirus; phev, porcine hemagglutinating encephalomyelitis virus; eqcov, equine coronavirus; crcov, canine respiratory coronavirus; mucov, murine coronavirus; pi - batcov, pipistrellus bat coronavirus; ro - batcov, rousettus bat coronavirus; sarsr - cov, severe acute respiratory syndrome - related coronavirus; ty - batcov, tylonycteris bat coronavirus; ibv, infectious bronchitis virus; tucov, turkey coronavirus; bwcov, beluga whale coronavirus; bucov, bulbul coronavirus; thcov, thrush coronavirus; muncov, munia coronavirus . B) phylogenetic tree of the entire spike genes of the pedv variant and all known pedv strains available in genbank . The phylogenetic tree was constructed using the neighbor - joining clustering method in mega version 5.22 with a pairwise distance (5). Bootstrap values (based on 1,000 replicates) for each node are given if> 60% . Pedv strains isolated from various countries are marked with colors as follows: europe (black), china (red), japan (olive green), usa (bright magenta) and south korea (blue). Besides a large (204-aa) deletion at positions 713916, a 2-aa (d / ni) deletion was identified at positions 163164 . We also discovered 2 separate insertions: a 4-aa (qgvn) insertion at positions 5962 and a 1-aa (n) insertion at position 140 . A total of 15 separate substitutions were identified, and the number(s) of replaced amino acids ranged from 1 through 5 . These sequence variations were similar to those in highly virulent isolates recently reported in china (6) and the united states (3), as well as in south korea . To further characterize the virus, we conducted rt - pcr with respect to the membrane (m) gene using the protocol described previously (7). The complete m gene sequence was determined and then submitted, together with the complete s gene sequence, to genbank under accession no . The entire m gene of mf3809 had 96.6%100% nt (96.0%100% aa) sequence identity to all known pedv strains available in genbank, and phylogenetic analysis showed that mf3809 belonged to a cluster containing pedv reference strain and showed the closest genetic relationship with 2007 korean pedv strains (data not shown). Cells and supernatants in every passage were collected separately for rna extraction and used to detect the virus and determine the amount of the viral rna in the medium with real - time rt - pcr (8). The cells and supernatants of the 3 passages were positive for the virus, and the control inoculated with pbs was negative; however, the amount of viral rna in the medium decreased with each passage . Whether the positive result was attributed to residual viruses of the initial inoculation or to the decreased propagation of the virus in the cells further studies, such as continuous serial passages and neutralization assays, are needed to determine the final activity of the virus in vero cells . Our large - scale study of the incidence of pedv in pigs with diarrhea in south korea found that 7.8% of animals were infected with the virus . Moreover, our investigation identified and characterized a new pedv variant with a 612-nt deletion in s gene, corresponding to a 204-aa deletion . The coronavirus s protein plays a pivotal role in regulating interactions with specific host cell receptor glycoproteins to mediate viral entry and stimulate induction of neutralizing antibodies in the natural host (1,2,9). Mutations or deletions in the coronavirus s gene affect its pathogenicity and tissue tropism (1012). Porcine respiratory coronavirus (prcv), a naturally occurring deletion mutant of transmissible gastroenteritis virus (tgev), is an example of pathogenic change and tropism switching, apparently associated with s gene change . Prcv has a 224-aa deletion at positions 21244 in the n terminal region, which is needed for the enteric tropism of tgev and comprises antigenic sites c and b (1315), of s1 compared with tgev . In other words, tgev, a highly enteropathogenic porcine coronavirus, is turned into prcv, a respiratory pathogen with reduced pathogenicity, as a consequence of a large deletion in the s gene . Unlike prcv, the pedv variant has a 204-aa deletion at positions 713916 in the c - terminus of s1 and n terminus of s2, destroying 4 n - linked glycosylation sites at positions 728, 745, 783, and 875, as well as 2 neutralizing epitopes, ss2 (753760) and ss6 (769776) (technical appendix figure 2). These amino acid mutations might cause the conformational change of s protein and result in antigenicity / immunogenicity alteration of the pedv variant . Further studies should be conducted to analyze extensive genomic sequences and determine biological properties, such as pathogenicity, tissue tropism, and transmissibility of the new pedv variant . Summary of amino acid mutations in spike (s) protein of porcine epidemic diarrhea virus (pedv) variant; schematic diagram of the s genes of classical pedv, recent prevalent pedv and the pedv variant; and alignment of amino acid sequences of the entire s proteins of the pedv variant and reference strains.
In clinical practice, one may encounter female patients with infertility which may be attributed to primary or secondary causes . In the group of primary infertility, congenital anomalies form relatively small but significant group . Mayer - rokitansky - kuster - hauser syndrome (mrkh) is characterized by congenital absence of the uterus and vagina . There is a failure of development of the mullerian derivative of the vagina and the portions of the mullerian ducts that form the uterus . The american fertility society classification, based on uterine anomalies is most commonly used to classify mullerian duct anomalies . Mrkh syndrome is a class 1 mullerian duct anomaly, and it has been subdivided into typical or type a and atypical or type b. patients with type a syndrome have symmetric muscular buds, normal fallopian tubes . Patients with type b have asymmetric muscular buds, abnormal fallopian tubes, and may be associated with other congenital anomalies such as renal, skeletal, hearing, cardiac, and ocular anomalies . Out of few genes which are identified in causation, one candidate is a mutation of the wnt4 gene, a developmental gene which regulates growth and differentiation during embryogenesis . Women with this syndrome are characterized by the presence of 46 xx karyotype, normal female secondary sex characters, normal ovarian functions, and underdeveloped vagina . The presence of leiomyoma in mrkh syndrome is very rare, and only a few cases have been reported in the literature . Here, we report a case of mrkh syndrome (type a) with multiple leiomyomas originating from the rudimentary uterus . Twenty - five years married female presented to the gynecology outpatient department with primary amenorrhea . Secondary sexual characters revealed the presence of pubic hair and axillary hair (tanner stage 5) [figure 1a]. Ultrasonography examination showed agenesis of the uterus with right adnexal mass measuring 5 cm 4 cm 4 cm . Differential diagnosis of leiomyoma of the rudimentary uterus in mrkh syndrome includes ovarian fibroma, a gastrointestinal stromal tumor of the intestine and extravesical leiomyoma of the urinary bladder . Values were: serum follicle stimulating hormone 7.17 miu / ml; serum leutenizing hormone 15.6 miu / ml; serum prolactin 10.64 ng / ml; and cancer antigen 125 4.5 iu / ml . With a provisional diagnosis of mrkh syndrome associated with right adnexal mass, she was taken for laparotomy . A rudimentary bicornuate uterus measuring 1.5 cm 1.5 cm with a small cervix measuring 1 cm 1 a total abdominal hysterectomy was performed in view of the presence of multiple nodules in a nonfunctional uterus . Multiple myomertial nodules [figure 1b] were seen arising from the rudimentary right and the left horns of the uterus [figure 1c]. On cut section of the specimen, uterine horns were found noncommunicating, and they had a rudimentary endometrial cavity . All the nodules were well circumscribed, grayish white and had a characteristic whorled appearance . Histological examination revealed features of leiomyoma [figure 1d] with rudimentary mullerian lining [figure 1e]. Failure of fusion and development of mullerian ducts results in muscular thickening at the proximal end of each tube that are joined in the midline by a visible and palpable cord resembling hypoplastic bicornuate uterus without an endometrial lining . Rarely, an active endometrium can exist with uterine analog, which becomes active in the presence of well - estrogenized state . In literature, it is mentioned that fibroids and adenomyosis rarely develop in the rudimentary nonfunctioning uterus . Cytogenetic abnormalities in the form of spontaneous chromosomal rearrangements are known to occur in uterine leiomyomas . These chromosomal arrangements may be responsible for the initiation and progressive growth of the leiomyomas . The leiomyomas are found to have higher concentration of estrogen receptors as compared to normal myometrium . These might explain the propensity to develop leiomyoma in the presence of exogenous and endogenous estrogen . As the proximal ends of mullerian ducts have smooth muscles, the presence of leiomyoma in a case of mullerian agenesis is a theoretical possibility . However, the occurrence of multiple leiomyomas in a rudimentary uterine bulb has been rarely reported earlier . The possible reason for this uncommon occurrence could be a decreased concentration or sensitivity of the estrogen receptors or a lesser genetic predisposition for the clonal chromosomal abnormalities that are observed in women with normal uterus with leiomyomas . In our patient, we could not perform cytogenetic and receptor studies to point out the exact etiopathogenesis of this unique occurrence of multiple leiomyomas in the rudimentary uterine bulbs . Hysterectomy was performed in our case in view of nonfunctioning uterus and risk of recurrence after myomectomy . Treatment for patients of mrkh syndrome with leiomyoma is myomectomy or hysterectomy and vaginal reconstruction (vaginoplasty). Frank's dilatation method, williams vaginoplasty, vecchietti procedure, abbe - mcindoe vaginoplasty and davydov technique . With advances in minimal access surgery the ovarian function is normal in these patients so that ovum can be retrieved and with the help of a surrogate mother, it is possible to have fertility potential.
Eye movement assessment potentially provides a valuable window into the human central nervous system function and may help to obtain insights into the structure of complex forms of human behavior including attentional control [1, 2]. Furthermore, the study of oculomotor control in pathological conditions offers insight into the underlying neural mechanisms . Neurodegenerative movement disorders are frequently accompanied by a broad spectrum of oculomotor abnormalities since large parts of the human central nervous system contribute to the function of vision comprising visual areas, oculomotor areas, and associated visual memory structures including eye movement control . A large part of knowledge about these higher oculomotor functions results from electrophysiological investigations in the monkey brain and functional imaging in humans by use of advanced test paradigms which have shown eye movement - related activity in several cortical and subcortical areas [46]. In addition, computer - based neuroimaging such as fiber tracking by means of diffusion tensor imaging has depicted major pathways that are linked to oculomotor control and its changes in neurodegenerative movement disorders such as huntington disease (hd) [7, 8]. Oculomotor abnormalities in parkinson's disease (pd) have recently been reported to be associated with higher functional networks revealed by task - free intrinsic functional connectivity neuroimaging techniques . The nature of the contribution of intrinsically interacting large - scale cortical functional networks to eye movements and their key to pathological dysfunction is currently being addressed in neuroimaging research . Evidence for the need of intrinsically organized brain activity associated with visual input depends on the almost infinite visual information received by the human eye from the external environment . Before guiding the eyes adequately in the orbit, a target of special interest in the visual scene needs to be determined, followed by target selection and by programming the oculomotor system in a coordinated manner to rotate the eye ball until the object is foveated . The entropy, a measure of information, of the visual stream arriving at the human eye is about 10 bits / s whereas only approximately 3,000,000 bits / s are leaving the retina due to the limited number of available axons of the optic nerve and finally less than 10,000 bits / s are believed to be under attentive scrutiny . Thus, the investigation of eye movements has been applied as an experimental tool over the past four decades and provides a unique opportunity to understand the functional integrity of brain structures both in the healthy brain and in pathological state . The latter include the broad variety of parkinsonian syndromes and other neurodegenerative conditions such as amyotrophic lateral sclerosis, fronto - temporal lobar degeneration, and alzheimer's disease . Pathological conditions are of special interest to ophthalmologists, neurologists, and scientists in order to get insights into potential alterations of the complex oculomotor networks, including fundamental issues of human behavior comprising conflict resolution and free will . Retinal structure is divided into the fovea centralis with ultimate vision in its center and the larger periphery (with markedly less visual acuity) so that humans have developed the ability to foveate or refoveate an object of interest in the visual field . Rotating the eye ball offers a somewhat more economical strategy to shift or to maintain an object of interest on the fovea than turning the whole head . In general, eye movements are required to compensate small head movements to sustain stability of gaze, to accurately track moving objects in the visual surrounding smoothly, or to rapidly redirect the eye onto a new target rather than scanning the environment . Eye movements can be subdivided into two main classes: one class of movements comprises vestibuloocular reflexes, optokinetic nystagmus, fixation, and smooth pursuit eye movements (spem). Saquer, meaning jerk) in order to perform conjugated, fast eye movements shifting the eye ball discontinuously in a stepwise manner onto a new target . This review summarizes the fundamental mechanisms of eye movement control, considering healthy and pathological states of the brain . More specifically, we discuss the main features of the oculomotor phenotypes that are specific for different movement disorders and that can serve as model conditions to study how distinct brain areas contribute to eye movement control . In addition, we focus on fixational eye movements as presenting a continuous range from microsaccades to (pathological) square wave jerks (swj). Due to the particular role of eye movement alterations for the clinical and neuroscientific work - up of parkinsonian syndromes, we will focus on movement disorders in this synopsis to emphasize the significance in assessing eye movement control to understand the respective pathophysiology . Together, our aim is to condense both the oculomotor dysfunctions in patients with neurodegenerative movement disorders and the underlying pathological mechanisms that result in the observed dysfunctional oculomotor behavior . Beyond the fact that oculomotor dysfunctions can be important for the purposes of clinical diagnosis, we discuss the potential functions and mechanisms of higher cortical contributions to eye movement control, in particular by reviewing broad pathological spectrum of cognitive control in functional system - related neurodegenerative conditions . During the absence of any (e.g., vestibuloocular) stimulus, healthy subjects are expected to withhold any unwanted considerable gaze shift maintaining the eyeball in its primary position . However, by performing attempted visual fixation of an unmoving target, conjugated small (<1), jerk - like, involuntary saccades (microsaccades) and slow conjugated drifts are near - instantly observed . For clear vision in the sense of the highest spatial resolution, the perception of an object should be optimized by small saccadic eye movements rather than by holding the image completely steady upon the retina . Perfectly fixed images upon the retina cause sensor adaption (fading) due to the property of being designed for the highest motion responsiveness like other sensory systems . Thus, in case of attempted fixation of stationary targets, microsaccades play an important role in counteracting visual fading by shifting the image on the retina back and forth in small portions of approximately 0.5 degrees . In addition, larger voluntary saccades or blinks are considered to also effectively overcome visual fading . The generation of microsaccades depends on the target size whereas luminance appears to be of no effect in modulating microsaccades . The dynamics vary during scanning the visual scene, and the frequency of microsaccade production tends to increase with more challenging visual tasks which require increased visual discrimination abilities . The relationship between microsaccade amplitudes with respect to their peak velocities follows the main sequence in an approximately linear manner . Microsaccades can be suppressed by precision demanding tasks (e.g., threading a needle) but cannot be voluntarily evoked . With respect to their amplitude swj are thought to have the same neural substrate as microsaccades and present as conjugated, rapid eye movements (preferentially in horizontal direction) that intrude accurate fixation . More specifically, both microsaccades and swj continuously shift the eyes away from the target and back onto it in an involuntary manner . In pathological conditions, they mostly present abnormally large and frequent . However, preschool children may present with larger swj (> 1) and less stable gaze holding that rarely also occur in healthy adults but manifest more frequently in the elderly . One diagnostic challenge rises from the large overlap of swj presentation between patients with movement disorders and healthy subjects . Patients with neurodegenerative movement disorders frequently develop abnormal swj which frequently interrupt fixation, within the broad spectrum of oculomotor deficits [3, 27]. Since swj are believed to present as a continuous spectrum ranging from microsaccades to larger saccadic intrusions, the mechanisms generating swj appear to be similar to those of microsaccades and share a common oculomotor network with the saccadic system . In addition, it is relevant for the characteristics of swj in movement disorders that swj generation appears to be similar in the healthy brain and in pathological state . Larger swj probably reflect internal neural noise in the saccadic control loops and in the superior colliculus that forms a major component for the release of saccades by triggering the saccadic pulse generator in the midbrain . The neural noise is hypothesized to initiate a saccade away from the target, resulting in a position error that is counteracted by shifting the gaze back onto the target . The higher this neural noise is (e.g., in movement disorders due to an impaired triggering of the superior colliculus from the basal ganglia), the more prominent swj seem to occur . The cerebellum may contribute to abnormal swj in addition if it is involved in the pathological process in cerebellar diseases and neurodegenerative parkinsonian syndromes other than pd . During impaired stationary fixation such as sustained abnormal eye oscillations (e.g., large swj, pathological nystagmus), patients may report that vision is becoming subjectively blurred . In general, two clinical approaches to abnormal fixation need to be distinguished, on the one hand, the examination of the patient's eye while the eye remains in primary position and on the other hand during the fixation in eccentric gaze holding . In summary, abnormal oscillations of the eyes including pathological nystagmus and markedly large or frequent swj (beyond the aforementioned physiological fixation eye movements) account for a red flag symptom that should prompt further investigations with respect to differential diagnostic procedures . The vast majority of these visual fixation signs are linked to dysfunctions of the central nervous system, in the absence of inaccurate vision, ophthalmologic diseases, or eye muscle affections . Abnormalities during fixation can be investigated with frenzel goggles or the ophthalmoscope by asking the patients either to hold their gaze steadily at the primary position or to shift their gaze towards eccentric positions . Frenzel goggles inspection of the patient's fixation ability accounts for a sensitive instrument to address fixational dysfunction or nystagmus . Unlike the ophthalmoscope, frenzel goggles are equipped with small lights illuminating the patient's eyes and provide high - powered positive magnifying glasses (> + 15 diopter) that disable the subject to adequately fixate any target in the visual field . Hence, the examiner can detect abnormal swj and particularly pathological nystagmus since the absence of target fixation facilitates the manifestation of nystagmus forms that were attributed to peripheral vestibular impairment . First, stimuli cannot be presented under specific conditions such as defined target positions . Second, the observations cannot be quantitatively characterized that is, metrics of saccadic accuracies, latencies with respect to stimulus onset, or determining peak eye velocities are not possible . The latter parameter is of special interest since peak eye velocity obtained during saccade performance characterizes the main sequence that provides robust metrics to assess pathology in peak eye velocity . To overcome these limitations, computer - based recording techniques are applied to quantify subtle alterations in eye movement control, that is, electrooculography, scleral search coil systems, and videooculography (vog). The past decades have emerged easy manageable computer - based eye trackers with integrated software environment for both stimulus design and automated data analysis for laboratory and portable usage . Scleral search coil systems and vog emerge as the most widely used techniques to quantify eye movements, although electrooculography is yet the only device allowing recordings with closed eyes . The vog measurement offers the best compromise between easily tolerable, noninvasive measurement and spatial and temporal resolution but requires advanced calibration techniques to be able to accurately quantify oculomotor performance . In contrast, scleral search coil systems provide optimum spatial and temporal resolution and warrant no calibration approach due to the absolute calibration by default but are invasive since they are based on tightly fixated another reason for vog having become popular is the improved electronic hardware with additional software packages including both stimulus design and eye movement recording analysis features . Moreover, modern vog systems provide easier usage and high portability with the possibility to assess human gaze behavior outside a dedicated room and even under dynamic conditions by utilizing an additional head - mounted camera (e.g.,). Video - based eye trackers comprising one or two head mounted and adjustable infrared miniature cameras allow online measurements so that the recorded data can be visually inspected in real - time . Commonly, the systems operate at about 250 hz temporal sampling frequency which is constrained by spatial resolution of the field of view . Basal oculomotor network function (at brainstem / basal ganglia / cerebellar level) is usually tested by visually guided reactive saccades [17, 34, 35]. In this paradigm, subjects are asked to track a randomly jumping target as quickly and as accurately as possible . Smooth pursuit eye movements are elicited by requiring the subjects either to track a continuously moving target or to track a sinusoidally oscillating target . In order to assess attentional eye movement control as a correlate of the cognitive (cortical) top - down oculomotor pathway, delayed both conditions aim at investigating the subject's ability to suppress the reflexive urge to shift their gaze towards a new suddenly upcoming target in the visual scene . Parkinson's disease (pd) is the second most common neurodegenerative disorder with cardinal motor symptoms comprising hypokinesia, tremor, rigidity, and postural impairment, while a multitude of nonmotor conditions including cognitive decline as part of the disease process has become evident [39, 40]. Autopsy - controlled studies by braak and coworkers [4144] indicated that the pathological process of pd can be characterized as a six - stage ascending spreading scheme beginning in the lower brainstem (stages 1 - 2) towards mesencephalic structures including the basal ganglia (stages 3 - 4) and finally reaching the cortex (stages 5 - 6). These findings suggest that pd has a preclinical stage and a symptomatic stage as soon as patients display the aforementioned cardinal motor symptoms defining clinical onset not before stage 3 . Only a few studies have systematically investigated oculomotor dysfunctions in asymptomatic subjects with gene mutations . Whereas saccadic hypometria and the problems in withholding unwanted gaze shifts (hyperreflexivity) are a hallmark of both early pd and symptomatic parkin mutation carriers, presymptomatic parkin mutation carriers revealed undistinguishable oculomotor performance compared to age - matched healthy controls . Pd patients presented with a lack of attentional control resulting in the disability to withhold unwanted gaze shifts which appears to manifest even in nondemented pd patients . This can be tested by utilizing tasks such as delayed saccades [9, 37, 46] or antisaccades . Pd onset typically incorporates motor symptoms caused by dopaminergic nigrostriatal cell degradation in the basal ganglia which are critical in locomotion including eye movements . The substantia nigra pars reticulata tonically inhibits the superior colliculus (sc) via gaba - ergic projections, whereas pausing the inhibitory sc input provides a prerequisite for saccadic release . The sc is an important visuomotor structure and plays a major role in triggering both voluntary and reflexive saccades . The cerebellum contributes to saccadic control in optimizing saccade trajectory by increasing eye acceleration during saccade onset and controls the movement procedure in order to keep the eye on track . Cerebellar pathology in oculomotor function, however, typically cannot be observed in pd with very few exceptions (see below). Unlike the basal ganglia, the sc remains intact until later stages in the pathological process, and both the sc and the striatum receive cortical input from the frontal eye fields (fef), the supplementary eye fields, and the parietal eye fields . Areas in the parietal cortex associated with oculomotor control beyond the parietal eye fields encompass superior and inferior parietal lobe and are a critical interface for attention and multiple sensory integration from visual and somatosensory modalities . The supplementary eye fields contribute to target selection and visual search, and the fef are critical in target selection of competing stimuli mediating their information to the sc and directly to the saccadic generator in the brainstem . The striatum serving as the main input gate of the basal ganglia evaluates incoming and competing information for appropriate execution; however, with the putamen being the most affected area in pd, it remains to be discovered to what extent the pd pathology targets this mechanism . The striatum gains also incoming streams from the dorsolateral prefrontal cortex which contributes to voluntary eye movements in the sense of inhibition control to prevent unwanted reflexive saccades . As a part of the limbic system, the so - called cingulate eye field, located in the anterior cingulate cortex (which is involved in motivation, behavior, and executive control), contributes to saccade generation . Guiding voluntary saccades requires several neural mechanisms within the framework of preemptive perception that manifests in activation in the cingulate eye field prior to the release of a saccade . Deterioration of dopaminergically mediated pathways in the basal ganglia in pd leads to overactive sc inhibition preventing the sc to trigger the brainstem saccadic generator . This may contribute to saccadic hypometria, as depicted in figure 2, and slowed initiation of voluntary saccades such as reduced number of rapid alternating self - paced saccades where subjects are asked to shift their gaze as fast and as accurately as possible between to stationary targets . In pd, deep brain stimulation of the subthalamic nucleus has undoubtedly positive effects in treatment of motor symptoms, but the improvement of oculomotor performance is still debated . Compensatory effects on the functional level of the sc mediated by the substantia nigra pars reticulata have been reported yielding improved saccade initiation and inhibitory control but did not significantly prevent prosaccades during antisaccade condition . One possible explanation of these discrepancies could result from the included patients' degree of motor impairment . Since motor performance worsens in the course of pd, it could be hypothesized that those patients investigated by yugeta et al . Presenting with a unified parkinson's disease rating scale iii score in the ranges of 644 (stimulation off state) and 124 (stimulation on state) were less severely affected than those reported by pinkhardt et al . With an updrs iii score in the ranges of 1664 (off) and 562 (on). This may lead to the assumption that the less advanced patient group exhibited more benefits from deep brain stimulation on saccadic performance than those presenting with higher updrs iii scores which is probably associated with cortical involvement . This hypothesis is in line with the findings of macaskill and coworkers who attributed oculomotor dysfunctions in early and noncognitively impaired pd to pure basal ganglia disorder whereas the more widespread cortical involvement later in the course of pd may result in malfunctioning cortical areas involved in saccadic control . Proposed a possible task - related modulation within the basal ganglia resulting in oscillatory spike activity that may contribute to both moreover, functional connectivity neuroimaging revealed that connectivity loss in the putamen versus the caudate nucleus follows the same gradient as dopamine depletion, indicating a decoupling of the putamen prior to the caudate nucleus . Other imaging studies on functional integration in pd patients [63, 64] indicated widespread functional remapping that likely alters connectivity associated with oculomotor function . The nature of the cortical contribution of large - scale higher function networks to oculomotor control remains a promising issue in future studies . Spem provide an optimum strategy of maintained movement adaptation in a highly predictive manner and involve large parts of the brain cortex, comprising primary visual areas like the striate and extrastriate cortex as well as the fef and supplementary eye fields . Likewise, the cerebellum is involved in performing pursuit and functions as a major hub after receiving the cortical efferents that are to be integrated in innervating the relays of the ocular motor neurons through the medial vestibular nucleus . The easiest way to elicit spem is to ask a subject to track some continuously moving object in front of one's eyes . In the vog, a quantitative measure of spem performance is the gain value describing the ratio of eye to target velocity . In patients with pd, spem are frequently interrupted or nearly abolished by anticipatory saccades resulting in a reduced pursuit gain, as depicted in figure 3 . Notably, even in advanced cases, the patients are fairly able to track the target smoothly whereas the episodes of performing spem exclusively shorten with more frequent saccadic intrusions . Thus, the genuine spem system appears to be intact which raises the question of whether an executive dysfunction contributes to the characteristic anticipatory saccades during pursuit . For this fundamental issue, pinkhardt et al . Suggested that accompanying extradopaminergic processes might cause spem impairment . Thus, a lack of inhibitory control which is closely linked to the higher functions located in the dorsolateral prefrontal cortex as well as the striatal projections might explain these observations of dysfunctional spem . The mechanism of swj generation appears to be similar in pd patients and healthy controls, as indicated by otero - millan and coworkers . Moreover, it was proposed that the characteristics of swj (such as frequency and amplitude) are linked to the internal neuronal noise level within the sc and the brainstem saccade generator . In pathological states such as pd,, the sc might be triggered by an increase in fef activity that compensates pathological increased inhibition of the sc from the substantia nigra pars reticulata . In summary, pd patients present with a broad spectrum of disturbed oculomotor function comprising saccadic intrusions during spem, impaired inhibition control, and hypometric saccadic gains, while eye velocities used to be normal . Notably, these deficits manifest early in the disease course; however, they can be observed in the symptomatic rather than in presymptomatic stages of familial pd cases . In general, as the disease progresses, the oculomotor disturbances develop their full spectrum . The combination of both, the observed oculomotor phenotype and autopsy - controlled findings in pd, may increase our understanding of eye movement control as (i) the oculomotor nuclei in the brainstem appear to be spared by the pd - associated pathological process and (ii) the oculomotor deficits may primarily reflect a lack of attentional control . In the clinical context, the quantitative objective measure of eye movements by means of vog has the potential as a possible technical surrogate marker in pd [6, 67]. Msa is a neurodegenerative disease characterized by autonomic and pyramidal dysfunction in addition to a broad spectrum of parkinsonism presentations and cerebellar ataxia . On neuropathological grounds, deterioration of nigrostriatal as well as olivopontocerebellar pathways contributes to the clinical phenotype of msa with the predominant parkinsonian symptoms (msa - p subtype) on the one hand and the predominant cerebellar dysfunction (msa - c subtype) on the other hand . Nota bene, altered eye movements in msa underlie both pathomechanisms . In msa - c, patients frequently present with typical cerebellar - type oculomotor signs comprising disturbed spem as well as downbeat, rebound, and gaze - evoked nystagmus . Pathological nystagmus in the presence of parkinsonism characterizes a unique identity for differentiating msa from other parkinsonian syndromes . In contrast, it is more difficult to distinguish msa - p from pd because possible cerebellar symptoms mostly remain subtle; however, if present, they provide a red flag for msa since cerebellar signs have not been reported in pd . Saccadic hypometria in msa can be observed, with mildly or moderately inaccurate saccade amplitudes . Msa patients are principally able to generate normal saccade amplitudes, and peak eye velocities are unaffected in msa compared to controls . Reduced vertical eye velocities suggest in almost all cases a diagnosis different than msa or pd . Disruptions of spem as consecutive, fine - stepped catch - up saccades emerge predominantly in msa - c, while patients with msa - p can present with a mixed picture of both catch - up saccades and anticipatory saccades . In addition, msa patients present with the disability to withhold unwanted gaze shifts suggesting an impaired executive control although msa patients show cognitive deficits only in the late stages of the disease . This aspect is worth mentioning since msa patients may manifest, like pd patients, an attention deficit that can be discovered by cognitively demanding tasks in vog (e.g., antisaccades, see figure 1). These observations call for further investigations in order to study higher function networks that may contribute to the pathological process in msa resulting in disturbed eye movement control . Progressive supranuclear palsy (psp) is characterized by parkinsonism associated with signs like supranuclear gaze palsy, early falls, dysphagia, dysarthria, axially pronounced rigidity, and behavioral / cognitive impairment . Psp can be subdivided into different subtypes that are characterized by their clinical course, most probably related to different patterns of pathological tau distribution in the brain . Apart from the classical psp (richardson syndrome, psp - rs), recent classifications subdivide clinical phenotypes including psp - parkinsonism (psp - p), pure akinesia, progressive nonfluent aphasia, and corticobasal syndrome (cbs) [72, 73]. The eponymous supranuclear gaze palsy is a central element of all subtypes but is not present in all stages of all subtypes . The subtypes psp - rs and psp - p with the oculomotor hallmark of abnormally reduced vertical peak eye velocity are subsequently discussed . Oculomotor features might be diagnostically important as an early feature for psp since definitive biomarkers remain to be defined yet, and subtle early clinical states of psp may be indistinguishable from pd . Slowing of saccades, particularly vertically, is caused by midbrain atrophy targeting burst neurons in the rostral interstitial nucleus of the medial longitudinal fasciculus that drives the extraocular eye muscles for vertical saccade generation . Moreover, the omnipause neurons are required to suppress their firing while the burst neurons innervate the extraocular eye muscles to drive the saccade . A second inhibitory pathomechanism of the omnipause neurons is suggested to contribute to reduced peak eye velocity due to its interference with the burst neurons . The dopaminergic nigrostriatal pathways and the superior cerebellar peduncle are reported to be involved in the pathological process resulting in prolonged latencies and (mostly subtle) cerebellar oculomotor signs, respectively . Study of oculomotor dysfunctions both in psp - rs and in psp - p revealed a similar presentation comprising slowed vertical saccades, saccadic hypometria, prolonged latencies, and impaired pursuit eye movement . In advanced stages, psp patients are fairly disabled to generate large saccade amplitudes, preferentially vertical, as exemplified in figure 4 . When vertical saccades become slowed, horizontal saccade velocity remains intact until the pathological process also involves horizontal burst neurons resulting in reduced horizontal peak eye velocities [3, 76]. Psp patients also present with disrupted visual fixation when they attempt to fix their eyes upon stationary targets . Additionally, they present with more frequent, larger swj (with amplitudes up to 5), slower saccades, and more horizontal swj compared to controls . The phenomenon of considerably higher prevalence of horizontal swj in combination with larger amplitudes may give a clue for psp although microsaccades are observed preferentially in horizontal direction with increasing target size . Two further explanations for the presence of abnormally large and frequent swj in psp have been proposed: (i) since horizontal swj rate often increases during the release of vertical saccades, a swj coupling mechanism was suggested to enhance vertical saccade burst and (ii) the decreased peak eye velocity and the resulting prolonged saccade duration may increase the probability that vision fades so that larger and more frequent swj could overcome visual fading in psp [21, 28]. Remarkably, spem remain intact even in severely impaired psp patients as long as a target is continuously moving in a predictive manner with low peak velocity and acceleration . This could be demonstrated when patients were asked to track a sinusoidal oscillating spot with low frequency . With increasing stimulus frequency, the ability to perform spem considerably declines due to the disability to perform catch - up saccades to refoveate the target . Psp is frequently accompanied by cognitive decline and frontal brain dysfunctions including executive deficits that can be demonstrated in cognitively demanding tasks such as the antisaccade condition in which the psp patients often present with a limited ability to inhibit the visual grasp reflex in a sense of shifting the gaze towards the opposite target direction . In addition, vergence eye movements are reported to be affected early in the psp course and may also be associated with horizontal diplopia in some cases . In summary, pathologically slowed vertical saccades' peak velocities are the eponymous hallmark of psp . The psp - associated damage involves midbrain structures including the saccadic burst generator in the brainstem that is responsible for the impaired (vertical) eye muscles innervation . Moreover, a hallmark of psp is the early appearance of cognitive and behavioral deficits that also manifest in oculomotor function by means of a considerable lack of inhibitory control of saccades (e.g., tested by antisaccades). Autosomal dominant huntington's disease (hd) is a progressive neurodegenerative disease, clinically presenting with a hyperkinetic movement disorder (chorea), cognitive decline, and behavioral symptoms . The age of disease onset is predictable by the number of pathologically increased cag repeats . Oculomotor deficits in patients with hd and presymptomatic gene carriers are reported to be one of the earliest signs . They present as dysfunction of fixation ability, impaired initiation and inhibition of saccadic eye movements, impaired spem [2, 84], and decreased inhibition control in the sense of erroneously responding to novel stimuli [8587]. Moreover, slowed saccades become prominent in both vertical and horizontal directions, latencies have been reported to be increased, and saccadic hypometria can be observed in hd like in other movement disorders . Slowing of saccades is likely caused by midbrain atrophy, in particular in the pontine nuclei critical for the saccadic burst; however, the pathophysiology in oculomotor - related midbrain areas is ill - defined, so far . Presymptomatic gene carriers show subtle cognitive and motor impairment due to striatal and cortical neuropathological changes that cause increased error rates during inhibition tests such as antisaccades and likely reflect first clinical symptoms . Reflexive saccades remain unaffected for a long time whereas both reflexive and voluntary - guided saccade performance decline with disease progression, since the structural connectivity between the frontal cortex and the caudate body seems to be particularly related to the control of voluntary - guided saccades [7, 86]. Difficulties in voluntarily initiating saccades in the presence of excessive saccadic intrusions during attempted fixation and a lack of inhibition control in the sense of withholding gaze shifts to new stimuli are apparently contradicting findings; a comprehensive explanation for this phenomenon in hd remains to be identified . The extraocular eye muscles and the attention system . The latter one is apparently involved already in presymptomatic hd . Cerebellar signs manifest in many neurodegenerative movement disorders such as msa and in the heterogeneous group of hereditary spinocerebellar ataxia . One prominent feature is cerebellar ataxia with impaired body posture; in addition, patients present with dysarthria, dysmetria, and dysdiadochokinesia . Cerebellar dysfunctions in eye movement control frequently manifest in a variety of symptoms including the spectrum of pathological nystagmus, dysmetric saccades, abnormally large swj, postsaccadic drift as a consequence of pulse - step - mismatch, mildly slowed saccades, and a disturbed pursuit in the sense of corrective saccades interrupting spem [3, 16, 28, 37, 50, 88]. These deficits become pronounced in advanced cases, while many patients present with less dominant oculomotor abnormalities in early stages . In order to detect these symptoms, vog is helpful beyond pure visual inspection . Oculomotor dysfunctions have been characterized by the genetically defined spinocerebellar ataxia subtypes; for a comprehensive review, see . Only a few studies investigated presymptomatic spinocerebellar ataxia gene carriers in contrast to hd . For spinocerebellar ataxia type 2 presymptomatic patients, a relation between cag repeats, estimated time to disease onset, and decreased peak eye velocity has been reported . Together, these vog findings in cerebellar dysfunction mirror the cerebellar contribution to the oculomotor system, that is, refinement of saccade guidance, the adaptive strategy to perform perfect smooth pursuit, and the ability to hold the eye in a steady position . To our knowledge, the role of the cerebellum in attentional oculomotor control remains incompletely defined yet and might be a promising issue for future investigations . In the absence of definitive biomarkers, vog holds promise for a complementary noninvasive tool to characterize the oculomotor phenotype of distinct disease entities within the spectrum of neurodegenerative diseases . In the course of neurodegenerative disorders, hence, the resulting clinical condition might be considered as an investigational model for the contribution of functional components to eye movement control . In vivo examination of the oculomotor system offers a valuable window into altered brain function in the pathological state of movement disorders . Thus, we can learn about the contribution of different functional systems that may interfere with the way we direct our attention in the visual scene . In addition, oculomotor control covers large portions of the whole brain that appear to be decomposable into two major subdivisions: (i) the oculomotor nuclei responsible for the innervation of the six extraocular eye muscles and (ii) the much more complex network of higher cognitive control that is strongly associated with visual attention . The investigation of eye movements may become important to clinicians in the context of differential diagnostics of movement disorders such as in distinguishing between parkinsonian syndromes or to uncover a possible cerebellar contribution to pathological processes . Vog provides a sensitive noninvasive in vivo method to detect alterations in oculomotion function in patients with neurodegenerative movement disorders . Malfunctioning oculomotor control appears to have some characteristic feature that can give clues to be attributed uniquely to the subtype of the movement disorder . More specifically, other neurodegenerative types of parkinsonian syndromes can be differentiated from pd early in the course . One should keep in mind that some of the parkinsonian - associated hallmarks such as slowed eye velocities could also manifest in other neurodegenerative (nonmovement) disorders, resulting in the necessity for careful interpretation of vog results in the light of the clinical presentation . Particular aspects such as swj or larger intruding eye movements may provide motivation for future investigations (possibly together with functional brain imaging studies [9, 92]) to increase our understanding of the functional pathoanatomy of these neurodegenerative conditions . Notably, attentional dysfunction in oculomotor control mostly presents early in the course of neurodegenerative movement disorders even while no obvious cognitive deficits exist . This finding prompts the notion that even a subtle pathology of cortical networks may cause a broad variety of oculomotor alterations . To further investigate the complex nature of visual attention and the way we direct or withhold our gaze, it might be safe to assume that we can learn much from pathological conditions related to specific functional systems . This approach offers the possibility to refine our existing models of human oculomotor networks whose functional interaction may be considered an essential framework for higher functions such as visual attention.
Juxtafacet cysts (jfcs) are uncommon intraspinal, extradural lesions that arise from the facet joints . Jfcs can be further distinguished as either synovial cysts, if histology confirms the presence of a synovial lining membrane, or alternatively as a ganglion cyst, if no such membrane is present . However, few differences exist between the two in terms of diagnosis and management.1 2 3 4 5 6 7 their pathogenesis remains unclear, with most authors citing excessive joint mobility leading to synovial fluid herniation through joint capsule defects.2 4 7 calcification in the cyst walls is a common finding on imaging for jfcs, appearing as peripheral areas of high attenuation on computed tomography (ct) and peripheral hypointensity on t1- and t2-weighted magnetic resonance imaging (mri).8 9 10 but although calcification of the cyst walls are commonly reported findings,9 10 11 complete calcification of the cyst is exceedingly rare.11 12 13 we present here an unusual case of a jfc presenting as a giant, multilobular, completely calcified mass with significant extraforaminal extension . The patient was a 57-year - old woman who presented with a 2-year history of gradually worsening lower back and left leg pain . She also reported numbness in her left heel and foot and subjective weakness in the left foot . Her past medical history was significant for hypothyroidism, hypertension, mild levoscoliosis, rheumatoid arthritis, and scleroderma managed on weekly methotrexate injection . Her past surgical history was negative for any previous lumbar surgeries, but the patient had received multiple cervical surgeries resulting in c3c7 fusion . On neurologic exam, the patient was found to have decreased strength in plantarflexion and dorsiflexion of the left lower extremity but was otherwise nonfocal . The patient's imaging was most notable for a large, multilobular mass, measuring 54 31 30 mm, arising from the left l5s1 facet joint that had caused destruction of the joint itself and that showed severe encroachment of the adjoining foramen, with coexisting grade i anterolisthesis of l5 on s1 . The lesion was hyperdense on plain radiograph (fig . 1) and on ct imaging (fig . 2a, 2b, and 2c) and appeared hypointense on t1- and t2-weighted mri sequences (fig . Preoperative plain film of the lumbar spine showing a large, completely calcified lesion extending out from the l5s1 intervertebral space . (a) axial computed tomography (ct) image taken preoperatively, showing the origin of the lesion from the left l5s1 facet joint . (b) a preoperative midsagittal ct image demonstrating grade 1 anterolisthesis of l5 on s1 . (c) a preoperative sagittal ct image demonstrating foraminal stenosis at l5s1 caused by the lesion . (a) t1-weighted magnetic resonance image (mri) of the same lesion, which appears uniformly hypointense . (b) the patient underwent an l5 laminectomy for excision of the mass along with an l5 to s1 fixation and fusion . Intraoperatively, the lesion was noted to consist of a pastelike material that was compressing the thecal sac and that extended ventrally out of the foramen . Histologic analysis identified the lesion as a mineralized simple pseudocyst, containing mineralized proteinaceous material that did not refract plane polarized light after ethanol fixation (fig . 4a and 4b). (a) hematoxylin and eosin stained sections of the resection reveal dense membranous fibrous connective tissue separating spaces associated with dense calcifications as well as smaller loculated spaces filled with calcium (20 magnification). (b) higher magnification (40) reveals the wall of the spaces to be associated with granular calcifications and no obvious cellular lining . The patient experienced no intraoperative or postoperative complications, and her postoperative hospital course was unremarkable . By postoperative day 2, the patient had recovered full strength in her extremities but still had some residual numbness, and she was discharged to home in stable condition on postoperative day 3 . At 2-year follow - up, the patient continued to be free of her lower extremity pain and weakness and had not experienced any subsequent postsurgical complications (fig . 5a and 5b). (a) postoperative plain film (anterior - posterior) showing removal of the mass and placement of fixation hardware . Mineralized, extradural lesions of the lumbar spine arising from the facet joint are uncommon causes of spinal pathology . The differential diagnosis consists of several uncommon disorders, including synovial osteochondromatosis,14 tumoral calcinosis,15 tumoral calcium pyrophosphate dehydrate crystal deposition disease (pseudogout),16 and lumbar presentation of ossification of the ligamentum flavum.17 the case we present here represents another potential consideration in that differential diagnosis . Completely calcified jfcs are rare, with only a handful of instances existing in the literature . Almefty et al presented four patients with multiple - level, bilateral, consistently calcified thoracic spinal cysts.12 these lesions were atypical due to their number, location, and mineralization . Kasliwal and deutsch presented on the case of a unilateral lumbar jfc at the l4l5 level.13 similar to our case, the patient presented with radicular symptoms in the setting of a lumbar lesion that appeared hypointense on t1- and t2-weighted mri . It should be noted that calcification of jfcs can result from treatment as well, as mtellus et al noted a case of a cyst undergoing complete calcification after intracystic steroid injection therapy.11 the case presented here was remarkable not just for its mineralization but also for its size . Jfcs have typically been recorded to be between 10 and 20 mm in diameter at their widest dimension on imaging.10 18 the case we report here, however, measured 54 mm at its widest dimension, showing significant extension into nearby structures . Moreover, although jfcs frequently extend into the spinal canal and cause compression of the thecal sac,2 the majority of the lesion in our case existed outside the spinal canal . This may explain how the cyst grew to be so large before the patient presented for evaluation . It should also be noted that our patient's medical history included rheumatoid arthritis and scleroderma, and systemic inflammatory diseases have been associated with jfcs in the past.1 19 moreover, inflammatory arthritides are known to contribute to the pathogenesis of synovial cysts outside of the spine.20 however, no studies to date have established systemic inflammation as a risk factor for jfc development, and the role of inflammatory joint disease in the pathogenesis jfcs remains unclear . Many methods of treating jfcs have been described, including simple laminotomy with cystectomy and the potential addition of a laminectomy, hemilaminectomy, mesial facetectomy, or foraminotomy.3 4 minimally invasive approaches with tubular retractors have also been described.19 21 in terms of treatment of this patient, it was presumed that the symptoms of back pain were secondary to facet dysfunction and that the left - sided plantar flexion weakness was due to foraminal stenosis . Due to the size and mineralization of the lesion, it was felt that a complete facetectomy was needed to adequately address the underlying pathology, necessitating a concurrent fusion . Our case highlights the significant variation that exists in the size, location, and content of jfcs . Although uncommon, jfcs should be considered in the differential diagnosis of lesions arising from the facet joint, even if they appear calcified and noncystic in nature.
Hypertrophy of the inferior olivary nucleus (ion) is an interesting phenomenon as it reflects a secondary response to an interruption of afferent connections resulting in increased and abnormally synchronized neuronal activity (best and regehr, 2009; shaikh et al ., 2010). Herein we report on a patient with hypertrophy of the ion secondary to ponto - mesencephalic hemorrhage and a change in the perception of earth - vertical over time . We address the role of the ion and of the dentate nucleus (dn) in the processing of vestibular input and specifically ask whether over - excitation of the dn secondary to disinhibition of the contralateral ion shifts perceived vertical into the opposite direction than previously observed for dn inhibition (e.g., due to cerebellar stroke; baier et al ., 2008). The dn is part of an extensive network among brainstem, cerebellar, thalamic, and cortical areas involved in the integration of graviceptive input (brandt, 2000; angelaki et al the cvp are important for posture since head position relative to gravity is signaled by one component of the vestibular system, the otolith organs . While upright, the internal representation of earth - vertical is accurate in healthy human subjects (howard, 1982). Following unilateral or asymmetric bilateral lesions along the cvp, however, this estimate becomes biased as reflected by a tilt in the subjective visual vertical (svv; brandt and dieterich, 1993). In addition to svv tilts, vestibular tone - imbalances may lead to partial or complete ocular tilt reaction (otr; consisting of ocular torsion, head roll, skew deviation) depending on the exact topography of the lesion (brandt, 2000). Vestibular input projects from the vestibular nuclei via bilateral ascending pathways through the medial longitudinal fascicle (mlf) to the interstitial nucleus of cajal (inc) and through the inferior cerebellar peduncle to the cerebellar cortex . The nodulus and the ventral uvula receive vestibulo - cerebellar mossy fibers and forward these signals to the deep cerebellar nuclei . Cerebellar efferents are relayed back to the vestibular nuclei and the ion (buttner - ennever, 1999) and fed into ascending pathways reaching the posterolateral thalamus and ending in the temporo - peri - sylvian vestibular cortex, where vestibular input converges with other sensory signals (kahane et al . Previous studies identified various cerebellar structures that contribute to internal estimates of direction of gravity . These include the nodulus (mossman and halmagyi, 1997), the biventer lobe, and the dn (baier et al ., 2008). Specifically, lesions of the dn are associated with contraversive otr and contralateral svv deviations (baier et al ., 2008). The dn, however, not only receives graviceptive input from the vestibular nuclei but is also interconnected with the ion by the rubro - dentato - olivary tract (guillain mollaret triangle, figure 1; pearce, 2008). However, more recent work suggest that the pathway from the deep cerebellar nuclei through the superior cerebellar peduncle may not synapse to red nucleus neurons (lapresle, 1979), but rather bypasses the red nucleus and directly projects via the central tegmental tract to the inferior olive, resulting in a dentato - olivary pathway (matsuo and ajax, 1979; deuschl et al ., 1990; shaikh et al ., 2010). Schematic illustration of the guillain mollaret triangle projected on a coronal mr - image of the patient, showing the t1-hyperintense subacute ponto - mesencephalic hemorrhage (*). It is also taken into consideration, that the red nucleus may rather be bypassed (lapresle, 1979), resulting in a direct dentato - olivary pathway (dashed line). As a consequence the right central tegmental tract (ctt) is damaged, interrupting the connection between the red nucleus (rn) and the ion . Lesions along the central tegmental tract may result in oculopalatal tremor (matsuo and ajax, 1979; deuschl et al ., 1990) and hypertrophy of the ipsilateral ion (ruigrok et al ., 1990) with its enlarged neurons developing abnormal soma - somatic gap junctions (koeppen et al ., 1980; de zeeuw et al ., 1998; goyal et al ., 2000). Ion hypertrophy is not just a histopathological finding but can also be visualized in vivo by mr - imaging (kitajima et al ., 1994; previous work suggests that the ion is involved in coordination and timing of movements and motor learning (de zeeuw et al ., 1998). Here we evaluate whether secondary hypertrophy of the ion leads to contralateral svv tilt indicating hyperactivity of the contralateral dn in line with the current understanding of the guillain mollaret triangle . Informed written consent was obtained after a full explanation of the experimental procedure to the patient . The protocol was approved by a local ethics committee and was in accordance with the ethical standards laid down in the 1964 declaration of helsinki for research involving human subjects . Svv measurements were obtained on a motor - driven turntable (acutronic, jona, switzerland) at day 16, month 4, and month 38 after symptom onset . To evaluate the svv, the patient was asked to align a luminous arrow (time limit per trial: 15 s; 24 trials per position) along perceived vertical in different whole - body - roll orientations (upright, 45, 90 ear - down) in a random order . The arrow projection started 10 s after the turntable came to a full stop . The arrow starting position deviated randomly between 28 and 72 clockwise (cw) or counter - clockwise (ccw) relative to true earth - vertical . For comparison, svv adjustments (taken at angles between upright and 90 every 15) from a group of healthy normal subjects (n = 7) using a similar paradigm were used (tarnutzer et al ., 2009). A 65-year - old male patient complaining of acute - onset gait unsteadiness presented with horizontal gaze palsy, impaired upgaze, left trigeminal hypesthesia, and left - sided sensorimotor impairment . Brain mri obtained 14 days after symptom onset showed a predominantly right - sided ponto - mesencephalic dorsal hemorrhage, including the medial vestibular nuclei bilaterally, the right superior and lateral vestibular nucleus, the right (and probably also the left) mlf, and the central tegmental tract bilaterally (figures 2a, b). No cerebellar or thalamic structures were damaged . T2-weighted mr - images shows a ponto - mesencephalic high signal hemorrhage (arrow) within the pontine and mesencephalic tegmentum anterior to the forth ventricle the axial (a) and sagittal plane (b) 14 days after symptom onset . Follow - up mr after 4 months reveals hypertrophy and prominence of the right ion as illustrated in the axial (c), coronal (d), and sagittal (e) plane images . Subjective visual vertical measurements when upright obtained 16 days after symptom onset deviated ipsilaterally (relative to the right ion that later showed hypertrophy) by 3.0 3.0 (mean 1 sd) for clockwise (cw) arrow rotations and by 4.3 3.9 for counter - clockwise (ccw) arrow rotations, whereas in all roll - tilted positions roll under - compensation (svv deviations toward the direction of body - roll) being increased compared to deviations in healthy controls was noted (figure 3). A diagnostic work - up revealed no cause for the hemorrhage and the patient was discharged home . Mean (1 sd) svv adjustment errors (trials with cw and ccw arrow rotations analyzed separately) plotted against whole - body - roll in the patient at day 16, month 4, and month 38 . For comparison the grand mean (black dots) 2 sd of svv adjustments from seven healthy normal control subjects (data taken from tarnutzer et al . This range covers about 95% of all values and is illustrated by the gray area . At follow - up (month 4) the patient complained of progressive difficulty walking and fixing with the eyes mri showed increased signal and hypertrophy of the right ion (figures 2c e). Svv measurements revealed large contralateral (relative to the right ion) deviations when upright being clearly distinct for cw (20.3 10.5) and ccw (10.2 4.5) arrow rotations . For left - ear - down positions, adjustment errors remained in the same range as in the acute stage, while errors were shifted to roll over - compensation (svv deviations away from the direction of body - roll) for right - ear - down roll . The patient returned for regular follow - up visits and 38 months after symptom onset the svv was re - measured . On clinical examination svv in upright position revealed large a large trial - to - trial variability of adjustment errors for both cw (3.8 24.6) and ccw (14.1 14.0) arrow rotations . Again svv errors depended on the direction of arrow rotation (figure 3), but now arrow roll adjustments showed under - compensation for both directions . While roll under - compensation for left - ear - down positions were unchanged compared to previous recordings, adjustment errors for right - ear - down positions shifted back from roll over - compensation to roll under - compensation . In this case report we describe for the first time a significant shift in the internal estimate of direction of gravity associated with hypertrophy of the ion . A roll tilt bias in estimated direction of gravity is generally explained by an asymmetric lesion along the ascending bilateral cvp (brandt, 2000). In the acute stage, the svv in this patient deviated rightward, i.e., toward the side of the predominant hemorrhage . Thus we assume that the loss of the right vestibular nuclei (known to result in ipsilesional svv deviations; dieterich and brandt, 1993; brandt, 2000) is the main contributor to the svv adjustment errors measured at day 16 . However, interruption of the left mlf may also contribute to the svv tilt because mlf - lesions lead to contralateral svv deviations (dieterich and brandt, 1993; brandt, 2000). The shift in svv from an ipsilateral (i.e., rightward) to a contralateral (i.e., leftward) svv deviation observed at month 4 is most likely associated with hypertrophy of the right ion at that stage since the dn is under control of the contralateral ion (pearce, 2008). In the case presented here the predominantly right - sided ponto - mesencephalic hemorrhage interrupted the right central tegmental tract, which most likely explains the hypertrophy of the right - sided ion at follow - up . In the following we provide a hypothetical explanation for the switch from acute ipsilateral (with regards to the side of ion hypertrophy at follow - up) to chronic contralateral svv deviations as a result of the hypertrophy of the ion . We conjecture that the switch in svv tilt is a consequence of removing gaba - mediated inhibitory modulation of the ion neurons provided through the central tegmental tract (best and regehr, 2009). As a consequence synchronized oscillations of large groups of neurons in the ion are then sent to the cerebellar cortex and the deep cerebellar nuclei through climbing fibers (shaikh et al ., 2010) and result in a loss of the inhibitory control provided through this pathway (leigh and zee, 2006). This mechanism may lead to an over - excitation of the dn contralateral to the hypertrophic ion and consequently to a tilt toward the side of the over - active dn . Over - excitation of the dn leading to a shift in svv toward the side of the stimulated dn is analogous to the reported contralesional svv shifts in case of an inhibition (e.g., by stroke or bleeding) of the dn (baier et al ., 2008). The relative improvement of svv errors at month 38 despite the fact that the clinical findings (gait ataxia, vertical torsional pendular nystagmus) persisted and mr - imaging continued to show an increased signal on t2-weighted sequences and hypertrophy of the right ion may indicate distinct mechanisms of adaptation of the involved networks . While the pendular nystagmus is governed by brainstem circuits, estimating direction of gravity is a cognitive task based on multisensory cortical integration, possibly situated within the temporo - peri - sylvian vestibular cortex (kahane et al ., 2003). Based on the improvement of svv accuracy and the ongoing nystagmus we hypothesize that long - term adaptation has led to a re - weighting of the different sensory input signals used for generating the internal estimate of direction of gravity . Thereby the otolith signal might be weighted less and consecutively the internal estimate of direction of gravity is less biased . However, svv measurements at month 38 have to be interpreted with caution, as they varied considerably more from trial - to - trial compared to day 16 and month 4 . In summary, this case report further supports the crucial role of the dn in processing vestibular information and how it is modulated by the ion . It suggests that over - excitation of the dn by disinhibition of the ion can result in functional impairment of estimating the direction of gravity . In short, inhibition of the dn (e.g., by an ischemic cerebellar lesion including the dn) leads to svv tilt away from the affected dn (baier et al ., 2008) and over - excitation of the dn as reported here leads to svv tilt toward the affected dn . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Carbapenem resistant gram - negative bacteria (gnb) such as enterobacteriaceae (cre) (including escherichia coli [crec] and klebsiella pneumoniae [crkp]), pseudomonas aeruginosa (crpa) and acinetobacter baumanni (crab) are important emerging causes of nosocomial blood stream infections and carry significant mortality . Urgent threat by the us centers for disease control and prevention (cdc), while the antimicrobial availability task force formed by the infectious diseases society of america had identified crpa and crab of particular importance, because of growing antimicrobial resistance among these isolates and shrinking therapeutic options . Indian single center studies overall report a prevalence of carbapenem resistance in up to 12 - 15% of enterobacteriaceae and 40 - 60% in a. baumanii and p. aeruginosa . However, there is little data from india about the clinical profile and treatment outcome of infections caused by these organisms . This was a retrospective study performed at a 600 bed tertiary care facility in chennai, india between may 2011 and may 2012 . We identified all blood culture results that had yielded a growth of carbapenem - resistant gnb during the study period . Blood cultures were performed using bact / alert (biomerieux) culture system, and species' identification was carried out with vitek - gni card (biomerieux). Antibiotic susceptibility was performed using disc diffusion interpretive criteria as per revised clinical and laboratory standards institute performance standards . Gram - negative bacteremia was defined as the isolation of gram - negative bacilli in blood culture specimen in at least two bottles of two different culture sets with clinical features compatible with systemic inflammatory response syndrome . Clinical parameters analyzed included severity of illness as calculated by acute physiology and chronic health evaluation (apache) ii score on the day of bacteremia onset, presumed source of infection and presence of arterial and venous central catheters or hemodialysis catheters . The source of bacteremia was defined on the basis clinical and microbiologic evaluation using infections criteria proposed by cdc . Presence of risk factors such diabetes, recent surgery, organ transplant and immunosuppression were recorded . Prior antibiotic usage, dose of colistin and requirement for renal replacement therapy (rrt) after treatment with colistin commenced were also noted . The records of 50 patients with bacteremia caused by crec, crkp, crab, crpa were identified and analyzed . The mean age of patients was 52.3 years and 32 (64%) were male . The most common co - morbid condition was diabetes mellitus (30%), followed by chronic kidney disease (22%). The total mean duration of hospitalization was 24.68 days with a mean of 11.76 days of intensive care unit (icu) care . The mean time to onset of bacteremia was 6.4 days after admission . Of the 50 patients, 96% had already received antibiotics, including beta - lactam / beta - lactamase inhibitors (32%) and carbapenems (40%) [table 1]. The mean (standard deviation [sd]) apache ii score at the onset of bacteremia was 19.64 3.8 . Thirty - eight percent (n = 19) patients had septic shock complicating bacteremia . Fourteen episodes (28%) of bacteremia were attributed to ventilator - associated pneumonia (vap), 12 episodes (24%) to the central line related bloodstream infections (clabsi), 10 episodes (20%) were due to intra - abdominal infections (iai) and 9 episodes (18%) to urinary tract infections . The most common causative organism in our study was crkp (44%) followed by crec (26%), while crab and crpa were isolated in 20% and 10% patients respectively [table 2]. Observed outcome of patients all patients received a loading dose of colistin with a mean of 5.14 million units intravenously followed by a mean 5.18 million units total daily dose . Mean creatinine clearance (calculated estimated glomerular filtration rate [egfr]) at the initiation of colistin was 52.48 ml / min . Six patients (12%) required rrt after initiation of colistin for worsening renal functions; all recovered to normal renal function . The overall survival at 30 days was 40% in our study with lowest survival rates for clabsi (33.3%), with survival rates for vap, iai and urosepsis patients of 35.7%, 40% and 44.4% respectively . Overall 30 days survival for crab and crkp bacteraemia were lowest (30% and 31.8% respectively), while survival rates for crpa and crec bacteraemia were 40% and 61.5% respectively . We also found that patients treated with combination therapy had lower mortality (44.8%) compared with colistin monotherapy (66.6%) although this was statistically not significant (p = 0.35) [table 3]. Carbapenem resistance in gram - negative organisms is increasingly encountered in healthcare - associated infections in india . Bacteremic episodes due to these organisms carry a high mortality as shown by previous studies from other countries . In our study, the most common carbapenem resistant gram - negative isolate was crkp (44%) followed by crec (26%) with more than half of all episodes due to pneumonia or clabsi, similar to two previous indian studies presented as abstracts in scientific meetings . Our patients had a high apache ii score (19.64 3.8 sd) and had a mean icu stay of 11.76 days, with a mean time of onset of bacteremia after admission of 6.4 days . These results are in concordance with previous studies implicating these organisms as causes of healthcare - associated infections . Seriously ill - patients in icus for prolonged periods often require central lines, dialysis catheters, broad spectrum antibiotics, and mechanical ventilation, which make them susceptible to resistant hospital - acquired infections . Notably only 40% of our patients had received carbapenems, but virtually all had antibiotic exposure, suggesting that healthcare exposure and overall prior antibiotic exposure may be more important risk factors for developing carbapenem resistant infections rather than prior receipt of carbapenems . Colistin has emerged as the cornerstone of therapy for carbapenem - resistant gnb, but the correct dose and frequency of dosing is a subject of on - going study . The mean colistin loading dose in our study was only 5.14 million units followed by mean total daily dose of 5.18 million units intravenously, even with a mean egfr of 52.48 ml / min at colistin initiation . Use of low colistin doses may be because of a perceived concern about nephrotoxicity; our study period was also prior to evolution of new colistin dosing recommendations . In our study, six patients (12%) required new onset rrt due to worsening renal functions after colistin initiation but this was fully reversible with dosing adjustments, which was reassuring and similar to other studies . The overall 30 days survival rate in our cohort was only 40%, but it was difficult to assess whether this was due to sepsis itself or due to underlying severe illness and multiple co - morbidities . Mortality in our patients was highest when clabsi or vap was the source of bacteremia and when crab and crkp were the causative organisms . Better survival rates from the west have been reported, but similar results to ours have been observed in two previous indian abstract presentations . Higher colistin doses are associated with higher microbiologic clearance and reduced mortality at 7 days although 28 days mortality did not differ . It is also possible that relatively low dose our patients received may have contributed to mortality . We also observed that patients treated with two drug combinations had a trend towards a higher survival rate than those treated with colistin monotherapy, as observed in other studies also . Small study numbers in the two groups and the fact that more severely ill patients may receive combination treatment, may have resulted in the absence of a statistically significant difference . We acknowledge significant limitations in our study: its retrospective nature, relatively small sample size and absence of a control group for comparison . We have shown that carbapenem - resistant gram - negative bacteremia is a serious healthcare - associated infection in critically ill - patients in indian icus with co - morbidities and prior antibiotic exposure; k. pneumoniae is the most common organism at our center . Thirty days survival rate is only 40% and even lower for clabsi or vap or when due to a. baumanii or k. pneumoniae . Colistin is the cornerstone of therapy and may need to be studied at higher doses to optimize the outcome; nephrotoxicity requiring rrt was seen in 12% of patients only and was reversible in all . Combinations of other antibiotics with colistin may result in a lower mortality compared with monothrapy, however this needs needs to be explored through a randomized controlled study
Mass amounts of high - throughput sequenced dna are being produced as a result of metagenomics projects, and new tools are needed to identify the taxonomic content of these environmental samples . Currently, biologists have two main goals: (1) classify as many organisms as possible, and (2) assess the genes and functions within the sample . This is especially difficult when the sample contains many uncultivated organisms that have no known reference genome . In addition, the reads obtained from these samples can have short lengths from next - generation technologies, complicating the identification process . Such technologies are pivotal in order to sequence as much dna as possible within such a sample in a timely fashion but have a size typically, researchers classify metagenomic reads, or sequenced dna reads, by scoring their alignment to previously sequenced organisms using blast [24]. Unfortunately, this underrepresentation has severely restricted the development of an automated system that recognizes sequences from taxa without completely sequenced genomes [5, 6]. In fact, several researchers believe that sequencing error skews our estimates of the abundance of taxa since errors can cause artificial divergence in reads, enough to falsely predict new operational taxonomic units (otus) [5, 7]. Recent papers call for ways to infer which species are truly known or unknown from metagenomics samples due to this unwanted variation [5, 7]. Huson et al . Show that anywhere between 10% and 90% of all reads may fail to produce any hits to known genomes when analyzed with blast, and they develop a last common ancestor (lca) algorithm to assign reads to the most confident taxon (class). In, brady and salzberg also state that they investigate confidence scores for predicting the correctness of the classifier, but they are unable to solve this problem . Therefore, a detector is clearly needed for composition - based methods to accept / reject reads based on their known / unknown status . In this paper, we address this detection problem and show that we can use the likelihood scores as confidence scores and can interpolate the scores between different read lengths to obtain a consistent detector of known reads . In this paper, we develop a detector for unknown novel genome reads for use with composition - based methods that can accept / reject reads from novel taxa anywhere in the taxonomic hierarchy . For example, a species - level confidence detector may reject a read but the genus - level detector may accept it . This would indicate that this is a new species within a known genus . To detect these novel genomes, we show that composition - based methods perform better than homology - based methods on the finer resolution of taxonomic levels . The nave bayes classifier (nbc) and phymmbl offer fast and attractive solutions, because they are based on the dna's compositional word - frequency occurrence and are able to give a log - likelihood score or similar that can be used to develop such a detector [8, 9]. Nbc and phymm's ease of use, speed of training and testing, combined with its log - likelihood output (or in the case of phymmbl, hybrid scores) make them attractive, simple, yet elegant designs for large - scale metagenomic classification and comparison . In order to design a detector, we partition the available data into three datasets as shown in figure 1 . The first is the known dataset, composed of 635 known completed microbial genomes in genbank that were available as of february 2008 . Then, we use a second dataset consisting of 102 novel genomes, those strains added to genbank from february 2008 to august 2008 . This second dataset is used to train the detector to determine whether a read belongs to a known or unknown species / genus . Finally, we have a third test unknowns dataset composed of 275 genomes, added to genbank from august 2008 to november 2009 . We specifically define the term unknown as a read's taxonomic class does not exist in the training database for the particular taxonomic level / rank being classified . For example, some reads may originate from unknown species / genera but still be known at the phyla level . Concept for each dataset in figure 1, and describe their composition in detail in the next section . Ultimately, we show that such a detector, in conjunction with composition - based likelihood scores, is able to determine if a read originates from unknown species / genera . In order to accomplish this goal, we start by evaluating the accuracy of nbc, blast, and phymmbl on 102 novel genomes for the species and genus levels (after being trained on the 635 genome training dataset). Based on this evaluation, we then design a detector: first by using blast scores followed by using the nbc likelihood scores . We also design a detector for phymmbl using the combination of its phymm - likelihood and blast scores . Finally, we compare the performance of the classifier+detectors for the nbc and phymmbl approaches on the test dataset of 275 novel genomes to the blast - based methods: megan, sort - items, and carma . Because homology - based methods have never been benchmarked for known / novel detection, we will benchmark these for the first time while also developing and benchmarking composition - based detectors . Finally, we demonstrate nbc's, phymmbl's, and sort - item's performance on an experimentally acquired acid mine drainage dataset . The 635 microbes of the known dataset, from, belong to 470 distinct species and 260 distinct genera . 404 strains are the sole member of their species - class while 171 strains are the sole member of their genus in the dataset . This shows that some knowledge will be lacking when it comes to species- and genus - class diversity . While 66 species contain more than one strain, 89 genera contain more than one strain . The microbial strains genome lengths range from 160 k(bp) for candidatus carsonella to 13 mil(bp) for sorangium cellulosum . In order to design the detector, another 102 strains were acquired from genbank and labeled novel and not represented in the known training database . 54 of these 102 novel strains belong to 36 known species while the remaining 48 comprise 46 novel species (with respect to the known database). At the next taxonomic level, 81 of the strains belong to 55 known genera while the remaining 21 comprise 21 novel genera . This is a good known / unknown representation for different levels of the detector because all strains are novel (with respect to the training dataset), approximately 1/2 of the strains' species classification is unknown, and approximately 1/5 of the strains' genera classification is unknown . 275 strains were acquired in november 2009 from ncbi, which were all new, completely sequenced microbial genomes, since august 2008 . The 275 genomes comprise 156 unique genera, of which 64 are in the known database and 92 are not, and 216 unique species, of which 48 are known and 168 are not . 172 (63%) of the genomes belong to the 64 known genera, and 96 (34%) of the them belong to the 48 known species . Strains belong to a diverse set of genera and species; the 275 172 = 103 (37%) unknown strains belong to 92 novel genera, and 175 96 = 179 (66%) of the strains belong to 168 novel species . 5 strains from the test set's genera overlap with the unknown genera in 102 genomes used to train the detector . This means that the detector trained on unknown genera that is also represented in 2% of the test set . There is a concern that this overlap may have artificially raised accuracy, but the overlap affects only 2% of the sequences, so we conclude that the artificial increase in performance, if any, is negligible . Also, all classifiers have the same training advantage, so it is still a fair comparison . Therefore, we do not overtrain our detector on many examples of unknowns that also occur in the test set . It is possible that when designing a detector with a different dataset, some of the unknowns may exist in the novel training data, so this is a realistic dataset . Also, there is a good distribution of novel to known strains based on which we would expect 37% of the genomes to be rejected (i.e., declared by the detector to be unknown) at the genus level while 66% to be rejected at the species level . To develop a detector, we compose a roc (receiver operating characteristic) curve using the likelihood scores of the composition - based methods on the training dataset . Each score is associated with the binary decision of whether the genome exists in the database or not . The best operating point on the training dataset is determined as the threshold that obtains the best combined sensitivity and specificity, defined by the the maximum point of the summed sensitivity and specificity metrics . Draw 100 l - length reads from each of the 737 full genomes (coding and noncoding), where l = 500, 100, 25 bp . Score the l - length reads (using nbc, phymmbl), where the scores can be interpreted as posterior probabilities of the genomes predicted by the classifiers . Construct an roc curve using the algorithm's scores and known / unknown labels . Select score threshold corresponding to best operating point for the training data (to be subsequently used on test data). We define the following measures which will be used to compare the methods . Detector sensitivity = tp/(tp + fn), where tp is the number of true positives (reads from known taxa correctly identified) and fn is the number of false negatives (reads from known detector specificity = tn/(tn + fp), where tn is the number of true negatives (unknown reads correctly identified as unknown), and fp is the number of false positives (unknown reads labeled as known) number . Detector accuracy = total correct decision / total number of reads = (tp + tn)/(tp + fn + fp + tn). Classifier accuracy = total correctly classified / totalnumber of reads, where correctly classified means classified correctly into its taxonomic rank . Overall classification accuracy = (total detected as known that are also correctly classified)+tn / total number of reads, where the first term can be approximated by (tp + fp)(classifier accuracy). The methods, in addition to nbc, can be accessed via the web . Nbc is available for download and online at http://nbc.ece.drexel.edu/. Phymmbl is available for download from http://www.cbcb.umd.edu / software / phymm/. Sort - items is available for download from http://metagenomics.atc.tcs.com / binning / sort - items/. Megan is available for download from http://www-ab.informatik.uni-tuebingen.de/software/megan . To compare several methods for the task of detecting novel genomes, we simulate several scenarios . In the first section, we develop a detector (blast, nbc, and phymmbl) that accepts / rejects reads of unknown species and genera based on each method's score; species / genus levels are informative levels where we would expect to see larger differences between the various methods . Also, we narrow our performance comparisons to these levels since many taxa do not have all levels defined (e.g., some taxa have species-, genus-, family- and phyla - level labels but are missing family-, and class - level labels in the genbank taxonomy database). We only develop the detector for phymmbl and nbc, since there are other blast - based detectors, such as megan, carma, and sort - items that perform such a detection task . As a measure of comparison between roc curves in all sections, we assess the area - under - the - curve (auc) metric, a standard measure for detector performance . We then compare the performance of the nbc and phymmbl detectors on a test set and show that they can improve the detector accuracy of the raw method and outperform blast - based methods . We also show the overall classification performance (binning each read into their associated bins) in addition to the unknown class . The poor classifier accuracies on novel genomes leads us to ask how well can classifiers predict unknown taxa . In other words, can blast's bit score or nbc's / phymmbl's score be used to indicate whether a fragment is truly from a new species, genus, and so forth? Here, we show the utility of blast's bitscore when accepting / rejecting known / unknown reads . In creating the receiver operating characteristic (roc) curve for blast's bitscore, reads are marked as correct if they are correctly classified . In figure 2, we show blast's ability to accept / reject reads from known / unknown strains for strain, species, and genus levels . We see that each of the optimal operating points is near 100% sensitivity for the three taxonomic levels while the specificities are around 20%, 35%, and 60% for strains, species, and genera, respectively . Blast's ability to predict taxonomically known and unknown reads using the bit score / e - value while blast is clearly a good classifier for known organisms within its database, it lacks the ability to reject (declare unknown) novel genomes with both high sensitivity and specificity . We now investigate the feasibility of phymmbl / nbc's score to develop a better detector for known and unknown taxa from using very short - read reads . To develop a detector using the nbc likelihood scores, we vary a threshold and mark reads correct if they are in the database (a looser constraint than being correctly classified). The auc for the 500 bp reads are marginally better than the 25 bp reads, and, interestingly, the genus and species levels perform the same . The roc curves are also constructed for phymmbl for species- and genus - level performance and 500 bp and 25 bp reads . As seen in figure 4, the roc shapes are similar to those of blast's, but with better specificity . The 25 bp species - level specificity for phymmbl is 46% compared to blast's 35%, and the genus - level specificity is 65% compared to blast's 60% . The sensitivity that is sacrificed is only a 1 - 2% decrease from blast's 99% . While the 500 bp and 25 bp genus - level operating points are the same, the 500 bp read's auc is better than the 25 bp read's auc . For the species level, the 500 bp operating point and auc are better than the 25 bp operating point . One of the obstacles to using the best derived roc operating point is that the threshold changes according to the fragment length . This is an important aspect to address since in any given dataset from next - generation sequencing technology, the read lengths are variable (usually with an average length). To overcome this obstacle and adjust the threshold for each read length, we interpolate between different operating thresholds for the three read lengths previously, the best operating threshold point was chosen for the 500 bp, 100 bp, and 25 bp reads for each of the strains, species, and genus classifications . The best operating point is determined as the point that obtained the combined best sensitivity and specificity, which sum closest to 200% (100% for specificity / sensitivity, resp . ). For nbc thresholds for example, using this method on the species level, the nbc log - likelihood best operating thresholds were determined to be 8079, 1445, and 185 for 500 bp, 100 bp, and 25 bp, respectively . A linear interpolation between these points yields a good fit (where the r fit value is 1 3e6 or 1 when rounded). On average for the strain, species, and genus classification, the linear log - likelihood fit is y = 16.6x + 210, where x is the length of the read and y is the likelihood detector threshold . For phymmbl, we found that the best thresholds for species level were 270.6, 27.4, and 18.5 for 500 bp, 100 bp, and 25 bp reads . Even though the phymmbl scores are not truly likelihood scores (since they combines phymm's likelihood score and blast's e - value), the thresholds follow a trend, and we can develop a heuristic interpolation for them . For example, the species - level fit is modeled by y = 0.001x 0.0074x 17.75 (where the r fit is again nearly 1). The detectors, developed using the 635 known genomes and the 102 unknown genomes, are used to accept or reject 100 reads from each of the 275 new genomes as known or unknown, respectively . The new 275 genomes are all unknown on the strain level but some have known status on higher levels (as described in the materials and methods section). In addition to evaluating the detectors, we also assess the ability of megan and sort - items to accept / reject taxa via their capability to classify a read at the species / genus level . The sensitivity, specificity, and detector accuracy are calculated for all methods and can be seen in table 1 . The detectors' ability to accept / reject reads from novel species was better than accepting / rejecting reads from novel genera, unlike homology - based lca algorithms that perform better at higher - level taxa . This can be due to the fact that there are more unknown species in the set, and, therefore, if the detector's specificity is high, it will do better on classes with more unknowns . To compare the implementations of nbc+detector and phymmbl+detector against current methods, we downloaded megan version 3.7.2 . Also, we downloaded the sort - items that was last updated january 7th, 2010 and used tblastx since it requires a protein - blast search . We also benchmarked against webcarma 1.0, run on march 8, 2010 . For webcarma, we infered whether a taxon was in the database or not by checking if that taxon showed up in the results file . Webcarma only annotated approximately 10,000 of the 27,500 reads resulting in poor genera / species detection and detection accuracy . The results in table 1, which summarize the sensitivity, specificity, and detection - accuracy of nbc and phymmbl detectors, indicate that the performance of the phymmbl detector is better than the nbc detector for 500 bp and 100 bp reads whereas nbc detector is better for the 25 bp reads . We conjecture that nbc is overfitting the operating - point thresholds due to the linear - interpolation heuristic, which interpolates the operating threshold between different - sized read lengths, and a more intelligent interpolation may be needed . On the test data, phymmbl's sensitivities were better than nbc's, but the specificity rates were not as good as nbc's . Nonetheless, phymmbl+detector worked better for most of the reads and species / genus levels . It can achieve around 80% sensitivity and 90% specificity for the species level and 50+% sensitivity and 90+% specificity for the genus level . We hypothesize that nbc, because of its dependence on fixed nmer size overfits the data compared to phymmbl, and therefore the thresholds derived on the training dataset do not extend to the test set as well . Megan uses an lca algorithm to determine if a read should be assigned to a particular taxonomic level, and sort - items uses additional alignment information . We used the default parameters for the megan and sort - items . In order to do a fair comparison, we used the same blast reports that were generated for the 500 bp phymmbl analysis for megan, and we obtained a tblastx report for sort - items . For the 27,500 reads, 4 reads did not get scored by blast and, therefore, were not even assessed by the methods . If the method assigned a read at the genus / species level, we determined that this read passed its built in detector, regardless of the accuracy of the assignment . In other words, if a read is assigned to the family level, it is considered unknown at the species / genus levels . If a read is assigned to the species level (and, therefore, consequently has most upper - level assignments as well) but is the wrong species and genus, we declare that megan / sort - items detector labels it as known (passed it) at the species - level and genus - level but misclassified it . If method did not assign a read or assigned it above the species / genus levels (e.g., as its family - label), we mark it as rejected for the species / genus level detection . We observe from table 1 that megan has worse specificity for both species and genus levels, than either nbc, or phymmbl - based detectors . For the genus level, megan has the best sensitivity out of all the methods, although its specificity remains low . In order to be able to take the classifier accuracy into consideration in addition to the detector, we define an overall classification accuracy measure as (number of reads correctly classified) + (number of reads correctly rejected)/(total number of reads). The (number of reads correctly classified) can be calculated as (#of reads that pass the detector that are correctly classified). For the species level, megan's detection accuracy, shown in table 2 is worse than the other detection methods . Consequently, its accuracy as a detector is about the same or lower than phymmbl's detector . Sort - items does not classify below the genus level . As a detector, it has low sensitivity and high specificity, but the sensitivity drastically decreases as the reads get shorter . On the other hand, sort - items has a high positive predictive value for the reads it does pass, and, therefore, it has a high detection accuracy for 500 bp on the genus level, which decreases for shorter reads . Unknown genomes were used in the development of the detector as opposed to the 635 known genomes . For nbc+detector and phymmbl+detector, we hypothesize that their performance lowers for genus - level classification compared to the species level because fewer unknown we conjecture that as the database grows and more unknown examples are available, a detector will be more accurate . Finally, in table 2, we show how the methods' classification accuracy (without an unknown class) can be improved with the detector . In this experiment, the classifier method first scores the reads; then, the reads are accepted or rejected using the detector . Nbc, blast, and phymmbl all perform 2035% accuracy for the species and genus level, when used in their native form without a detector (we do not benchmark blast+detector, since phymmbl uses blast and performs better than blast). However, when the detector is added, the classifiers' overall accuracy, defined as the number of reads correctly rejected plus the number of reads identified as known that were correctly classified divided by the total number of reads, significantly improves for both species level and genus - level classification . To calculate megan and sort - items overall classification accuracy, we scored both algorithms' output as a true positive if it correctly identified the correct genus or species, and we score the output as a true negative if the method only assigned unknown reads to higher than the genus level (in other words, it could not resolve the correct species / genus). For the species level, megan performed worse than classifiers with detectors, as seen in table 2 . For the genus level, both methods are better than nbc+detector but is still worse than phymmbl+detector . We conclude that the purely blast - based or composition based algorithms are not as good as the hybrid phymmbl + detector for determining novel species / genera . A question arises; how does the structure of the genomes relate to the novel / known detection . Since noncoding regions are much more variable than coding regions, are they more susceptible to errors in the detector methods? We analyzed the 275-genome test set for the composition - based approaches to get an idea of how these different regions perform . We first ran the 27,500 500 bp reads through metagenemark to annotate the coding regions . We have shown that metagenemark has almost 90% accuracy for predicting coding regions for 500 bp fragments . Metagenemark did not annotate 766 of the reads, resulting in 2.8% of the 500 bp reads as noncoding . Since this is a significant stretch of noncoding dna, we expect to have a small proportion . We then examined the accuracy rates of the detector on the coding / noncoding regions in table 3 . We can see that phymmbl has higher accuracy for coding regions than noncoding regions, and nbc is opposite . We hypothesize that since phymmbl partially uses blast, that it is more likely to predict homologous gene regions correctly than noncoding regions . In fact, 32% of noncoding regions failed in the genus - level detection in phymmbl . Nbc, on the other hand, which is fully composition based, is more likely to recognize the unique signatures of the noncoding regions and its noncoding genus - level detection accuracy is almost as high as phymmbl's, but its discrimination between known and novel gene regions is not sufficient . While it is important to benchmark methods rigorously on a test set, we can only get a true insight into their usage by examining a real dataset . We, therefore, analyze the soudan acid mine red drainage dataset, which is a sample taken near a borehole of the mine . This is a challenging metagenomics sample because there are 317 k reads, where the average read length in this sample is 100 bp, which some researchers claim are very short reads . In the red soudan mine set, the number of organisms found without the detector was 628/631, using nbc / phymmbl, respectively, out of the 635 . This is most likely false, since acid mine drainage is known to be of low complexity . We also found the median number of reads per organism is 214/340 while the mean is 506/503 with standard deviation of + / 954/545 . So, while there is high variance for high - abundance organisms, there is an even spread of hits across the genome training set, highlighting a higher than expected diversity . While the soudan sludge's diversity may be higher than that studied by tyson et al ., it is doubtful that it is this high, and this issue highlights the difficulty of analysis on soil and water samples complicated by short reads . Therefore, the results in this section should be examined in a critical light, as all of these classifiers performed better for longer reads . The idea is to highlight the advantage of using methods that will filter out unknown taxa accurately, so that we can gain an accurate assessment of known taxa at particular levels . The raw nbc scores found the four most abundant genomes to be (1) flavobacterium johnsoniae with 12,816 reads, (2) trichodesmium erythraeum ims101 with 9641 reads, (3) sorangium cellulosum (so ce56) with 8747 reads, and (4) clostridium beijerinckii with 7300 reads, johnsoniae et al . Are not usually found in marine environments while trichodesmium erythraeum ims101 is . While these organisms could come from the soil part of the sludge, it is unlikely that they would survive in such a salty environment . For phymmbl (shown in table 4), the most abundant four genomes are (1) gramella forsetii with 4102 reads, (2) marinobacter aquaeolei with 3885 reads, (3) flavobacterium johnsoniae with 3480 reads, and (4) dinoroseobacter shibae with 3402 reads . Phymmbl has identified marine microbes in 1, 2, and 4 that are indeed more likely to be present in the marine sludge . Next, the species / genus detectors are evaluated on the dataset . For nbc, only 141 reads out of 317 k passed the species - level detector, and 179 reads passed the genus - level detector . For phymmbl, 794 reads out of the 317 k reads passed the species - level detector while 1053 reads passed the genus - level detector . The detectors may seem too selective because sensitivities of the detectors are suboptimal, as shown in the results section . Although as expected, the sensitivity is much higher for the phymmbl detector because it passes more reads . Tables 4 and 5 illustrate the distribution of reads that passed the nbc and phymmbl detectors . For nbc, the top hit is marinobacter hydrocarbonoclasticus, which can degrade hydrocarbons and is found in pollution therefore, likely to be present in the sample . The second hit, ruegeria is known to metabolize sulfur and could play an important part in the acid drainage of the mine, therefore, it is also quite likely to be present in the sample . Dinoroseobacter shibae is known for its ability to perform aerobic anoxygenic photosynthesis, and since the red sample of the acid mine drainage is near the surface, it is also likely to be present . In, authors found a wide range of metabolisms in the sample, and nbc passed organisms that had a diversity of metabolisms . Therefore, we show the power of the detector to discriminate reads that are most likely to be in our database, as opposed to not applying the detector, in which case unknown strains are simply misclassified . Phymmbl finds similar organisms but in a different order and since it has higher sensitivity, it is able to find more species / genus reads that pass the detector . The abundant species that are in the top 10 raw reads but did not pass the detector are gramella forsetii, flavobacterium johnsoniae, polaromonas naphthalenivorans, aeromonas salmonicida, and rhizobium leguminosarum . Gramella forsetii may be truly present as it is reasonable to find in the sample since it degrades polymeric organic matter, but it is usually found in marine environments, so it is difficult to conclude . Flavobacterium johnsoniae and aeromonas salmonicida are fish - born pathogens and could actually be present [25, 26], but this again is hard to conclude . Polaromonas naphthalenivorans is likely since it grows on hydrocarbons found in contaminated sediment, so that is a misrejection of the classifier . On the other hand, one hypothesis is that reads that correspond to these bacteria may actually be from closely related but unknown species . Another hypothesis is that these reads are from horizontally transferred elements which are responsible for particular metabolisms but actually belong to an unknown species . We also compared against sort - items, since this homology - based method had the best 500 bp classification accuracy for the genus level and was comparable to megan for 100 bp reads . Compared to nbc / phymm+detector, the main differences are that it accepts gramella and flavobacterium as a likely genera, although the other detectors reject these . It also finds a likely presence of alkalilimnicola, which is an arsenite oxidizing bacterium and is found commonly in contaminated waters . This intuitively seems likely in the acid mine setting and seems to have an advantage over the other methods . Sort - items passes ruegeria, which is known to be in marine - only settings but could be present due to the saline nature . We can see that the phymmbl / nbc+detector methods are more selective in confidently passing reads through the detector than sort - items, and we hypothesize that the composition - based methods, such as nbc and phymmbl, better reject some organisms that are unknown at the genus level . However, it may also be true that the sensitivity of these methods may not be as accurate on a real dataset, as seen with the sort - items discovery of the abundance of alkalilimnicola . All the methods agree that under 1% of the data originates from previously sequenced genera! This agrees with the hypothesis that 90+% of species cannot be cultured and, therefore, have not been previously sequenced . This is an amazing result and shows us the difficult problems that metagenomics samples pose . We only examine species / genus classifications in this paper, but we hypothesize that more than 1% can be successfully classified into higher taxonomic levels . We emphasize that this discussion is an exercise in analyzing an extremely challenging dataset that has a diversity of organisms and short 100 bp reads . In this paper, we introduce a novel / known organism detector, an automated approach to determine whether a given organism is previously known or novel . We also rigorously benchmarked all relevant algorithms to assess their performances and to distinguish novel from known reads . Being able to discriminate between next - generation sequencing reads that originate from known novel organisms will allow biologists to make new organism discoveries, have higher confidence in those reads that come from previously sequenced species, and discern other domain - level contaminants (such as viral or eukaryotic dna) in the sample . Previously developed homology - based methods can be used for such detection, but, as we have shown, those methods are suboptimal, especially at the species level . Overall, the phymmbl detector is the best and obtains 85+% accuracy for accepting / rejecting species reads (in novel detection) and 70+% for genus reads . In phymmbl, misclassification of reads that pass the detector causes a 10%/3% drop in overall accuracy for 500 bp reads . For example, for the species - level, the detector accuracy is 86.8%, but it is overall classification accuracy (correctly classifying the known reads plus labeling the unknowns) is 78.6% . This detection classification drop is about 4 - 5% for megan, but megan has worse detector / classification accuracy to begin with . An impressive factor in sort - items, is that it only drops 0.2% when classifying reads that pass the detector, meaning this method is very confident in correctly classifying any read that passes its detector . This makes sort - items overall accuracy one of the best for the genus level at 500 bp . The next step will be to implement such a detector for upper levels on the tree of life . The end product will then be to supply a probabilistic threshold to users, so that reads that have a likelihood score above this threshold can be confidently labeled as known whereas those whose score falls under this threshold can be confidently labeled as novel . Such a detector can give a first pass of all the reads that may belong to the database, and would be useful in determining new species . On the other hand, we can also use this system to determine whether a given taxon is novel at deep branching within the tree of life . Once reads are identified to come from novel species, they can then be placed in the phylogenetic tree to determine their position in the tree of life . For example, a read that is on the threshold of detection may just be another allele of a gene within the same species . Those with very low scores are more likely to be novel, and then they will have to be aligned and placed in a tree with other sequences to determine lineages . But with the vast amount of information coming from metagenomics datasets (with millions of reads), obtaining a first - pass set of sequences that is a fraction of the original number can significantly reduce computational time of subsequent phylogenetic analysis . This work develops a detector and demonstrates its application to identify known and unknown genomes for composition - based classification methods, and we demonstrate that our detector with a hybrid method outperforms current homology - based methods . Effectively, the detector introduces an unknown class and enables classification methods to filter out reads that will not be classified correctly, resulting in improved classification accuracy . In addition to detecting novel genomes, we also propose that the detector can be used to filter out noisy reads that have lowconfidence when scored . We use the previously implemented nave bayes classifier and phymmbl (interpolated markov model plus blast), which assigns a read to the closest match in the database, to design a detector that can detect reads from previously sequenced organisms . We show that nbc and phymmbl scores can be used to determine if a read is from a novel organism in respect to the training database . The overall classification accuracies of composition - based methods are greatly improved when detectors are added to filter out unknown organisms . Also, there is only a mild decrease in performance when classifying ultrashort reads as opposed to roche 454 length . We determine that the phymmbl + detector classification performs similarly or better than all the methods . Overall, the phymmbl detector obtains 85+% accuracy for accepting / rejecting species reads and 70+% for genus reads and only slightly lower in the overall classification accuracy.
Although traditionally malignant melanoma has been considered a tumor of the caucasians, recently, an increasing incidence is being noted in india . We present here a case of malignant melanoma, resembling a vascular tumor; the first of its kind from the indian subcontinent . A 40-year - old gentleman presented to us with multiple asymptomatic, pigmented, nodular lesions, resembling cluster of grapes, distributed over the medial aspect of right lower limb . Initially, there was a single nodular lesion, which rapidly increased in size over the next 3 months; gradually new nodules arose in the vicinity which coalesced with each other to form a plaque . He also complained of heaviness due to a mass in his right groin . His past medical and surgical history including drug history were unremarkable . Fever or other constitutional symptoms were absent except for the presence of significant weight loss and occasional episodes of bleeding from the lesions when subjected to trivial trauma; he also complained of occasional breathlessness and two episodes of bloody expectoration following cough . On dermatological examination, multiple dome - shaped nodular lesions were found on the distal part of right lower limb; ranging from 2 - 3 mm in diameter to plaque of 5 cm 7 cm with bosselated surface; formed by the coalescence of individual nodules [figure 1]. The color varied from light to dark mottled brown with some lesions showing atrophy and superficial ulceration . On palpation, they were firm, nontender nodules with the smooth, glossy surface, with woody hard induration of the underlying skin . General survey was normal except for the presence of pallor and a palpable mass in the right inguinal region sized about 7 cm 3 cm which was hard and immobile [figure 2]. Routine hematologic and biochemical investigations were within normal limits except for the presence of anemia (hb - 8.4g / dl) and an elevated erythrocyte sedimentation rate (55 mm / h). The patient was referred to the department of general medicine to evaluate his respiratory complaint and rule out any other evidence of systemic metastasis . (a and b) multiple brownish dome - shaped nodular lesions with a bosselated surface, right lower limb right inguinal lymphadenopathy on histopathological examination (hpe), sections showed a proliferative growth centered in the upper dermis with marked thinning of the epidermis [figure 3]. Tumor cells were arranged in nests with focal infiltration of adnexa [figure 4]. The cells were polygonal with hyperchromatic nuclei, perinuclear halo, and prominent nucleoli; also inclusion bodies were found with conspicuous mitotic activity [figure 5]. Proliferative growth in the upper dermis with marked thinning of epidermis (h and e, 40) lobulated mass showing closely packed pigmented cells (h and e, 100) the mass showing clustered polygonal cells with hyperchromatic nuclei and perinuclear halo (h and e, 400) clark et al . Divided malignant melanoma into three main subsets, by using a combination of clinical and pathological features; the superficial spreading melanoma, the nodular melanoma, and the lentigo maligna melanoma . The national institutes of health consensus conference on the diagnosis of melanoma has suggested the use of the asymmetry, border irregularity, color variegation, diameter> 6 mm checklist for the detection of melanocytic lesions . Risk factors for the development of melanoma may be divided into three categories: phenotypic manifestations of gene / environment interactions, environmental factor, and genetic factors . The histological diagnosis of melanoma is based on the assessment of a constellation of findings, including both architectural and cytological features . Cytological atypia, nuclear enlargement, nuclear pleomorphism, hyperchromasia of nuclei, nucleolar variability, and the presence of mitoses especially deep in the dermis, is considered necessary for a diagnosis of melanoma . There is a lack of maturation of nests of melanocytes with a descent into the dermis . Pagetoid spread of large solitary epidermal melanocytes is usually considered diagnostic of melanoma . In our case, kaposi sarcoma is multifocal, endothelial proliferation predominantly involving the skin and other organs and associated with the formation of vascular channels and proliferation of the spindle - shaped cell . Clinically, skin lesions vary from small violaceous papules to large plaques to ulcerated nodules . Initially, the upper body is involved, often along skin lines in a pityriasis rosea - like pattern and at sites of local trauma . Lesions develop on the face, in particular, the nose, and on oral mucosal surfaces, including the gums and hard palate . During tumor progression the color changes to brownish and the skin overlying the tumor becomes hyperkeratotic and, in particular on the lower extremities, may ulcerate . On hpe, tumor lobules are composed of bland, spindle - shaped cells with poorly defined, pink cytoplasm along with extensive vascular proliferation at all levels of the dermis . Retiform hemangioendothelioma presents mainly in young adults, with no sex predilection, as a slowly growing, asymptomatic, dermal, and subcutaneous plaque or nodule . Histology reveals arborizing, thin - walled, narrow, vascular channels with a striking resemblance to the rete testis . Dusky blue or red nodules develop and grow rapidly, and fresh, discrete nodules appear nearby . In some cases, hemorrhagic blisters are a prominent feature . As the tumors grow, the edema may increase, and older lesions may ulcerate . On histology vascular channels infiltrate the normal structures in a disorganized fashion along with the characteristic dissection of collagen . In our case, none of the histological features of hemangioendothelioma or angiosarcoma was present . There have been reports of rare disseminated malignant melanoma presenting as multiple asymptomatic, nodular lesions on the trunk, extremities, and the face and a rare sporotrichoid pattern of malignant melanoma . However, our case is unique as it is malignant melanoma mimicking closely mimicking a vascular tumor; where the final diagnosis could only be reached on hpe . Very few reports have depicted an unilateral distribution of malignant melanoma; in our case also the lesions are unilateral; distributed only over the right lower limb; this has further added to the uniqueness of our case . Malignant melanoma is itself a rare disease in our set - up, further the unilateral distribution and clinical resemblance to vascular tumors has made our case even more unique; all these features prompted the current case report . There are no conflicts of interest . A rare report of malignant melanoma from the indian subcontinent region, which clinically resembled a vascular tumor; histopathological examination clinched the final diagnosis there are no conflicts of interest . A rare report of malignant melanoma from the indian subcontinent region, which clinically resembled a vascular tumor; histopathological examination clinched the final diagnosis
Langerhans cell histiocytosis (lch) is a rare disease affecting predominantly children and young adults but can be found in any age group . The disorder is characterized by abnormal, clonal proliferation and accumulation of antigen - presenting dendritic cells, the langerhans cells (lcs), associated with immunosurveillance and immune regulation . The peculiar cytomorphological, immunohistochemical, immunophenotypic, ultrastructural, and functional properties of these cells allow them to be identified amid various cells of the monocyte - macrophage lineage . The spectrum ranges from unifocal disease with excellent survival to multifocal disease with single system or multisystem involvement associated with poor prognosis . The skin, bone, lymph node, lungs, liver, spleen, thymus, and central nervous system may be involved . The varied disease manifestations mandate different treatment modalities, which range from minimal therapy to aggressive multidrug chemotherapeutic regimens . The present study was undertaken to study the cytomorphological features of lch, along with the differential diagnoses so that a rapid and accurate diagnosis on fine - needle aspirates can be made . Seven cases of lch diagnosed on fine - needle aspiration (fna) over a period of 10 years (2004 - 2013) were retrieved from the archives . The clinical data from the cytology forms and case files of the patients were collected . The clinical parameters including the age, sex, and signs and symptoms with emphasis on the type of lesions were evaluated . Fna was performed by the cytopathologist using 23-gauge needle fitted to a 10 ml disposable syringe mounted on syringe holder . The smears were air - dried for may - grnwald - giemsa (mgg) and wet - fixed in 95% alcohol for hematoxylin and eosin (h and e) and papanicolaou staining . The age of the patients ranged from 25 days to 11 years and the male - to - female ratio was 1:1.3 . All the seven cases were confined to the head and neck region, which included three cases of lymphadenopathy, three cases of scalp swelling, and one case of orbital swelling as shown in table 1 . Clinically, the diagnoses suggested were tuberculosis, abscess, and malignancy in cases with enlarged lymph nodes . The scalp swelling was thought to be tuberculosis in one case and this patient also had cervical lymphadenopathy . The clinical possibility of a retrobulbar inflammatory lesion was kept in the case with orbital swelling . Clinical and cytomorphological findings in langerhans cell histiocytosis (n = 7) the cytological findings are summarized in table 1 . The cytologic smears in all the cases were cellular showing isolated lcs with low nuclear: cytoplasmic ratio, many having large, pale, bland ovoid vesicular coffee - bean nuclei with grooves and indentations, along with ample eosinophilic granular cytoplasm [figure 1a c]. Areas of necrosis were seen in one case and staining for acid - fast bacilli done in this case was negative (case 2). On cytology, the diagnosis rendered was lch in all the cases . Langerhans cell histiocytosis (a) cytological smear showing langerhans cells (lcs) with a few binucleate and multinucleate forms in a polymorphic infiltrate with a preponderance of eosinophils (mgg, 100) (b) aspirate smear showing lcs with grooved folded nuclei (arrows) (h and e, 400) (c) an occasional lc showing mitosis (arrow) (h and e, 200) (d) histological section showing diffuse infiltration by sheets of lcs (h and e, 400). Inset shows nuclear and cytoplasmic positivity for s-100 immunostain in lcs (immunoperoxidase, 400) histopathologic confirmation was performed in all the cases . Paraffin sections showed sheets and islands of dense mixed infiltrate composed of lcs, eosinophils, and lymphocytes [figure 1d]. In all the cases, immunohistochemistry for s-100 antibody showed nuclear and cytoplasmic staining in lcs [figure 1d]. The cytologic smears in all the cases were cellular showing isolated lcs with low nuclear: cytoplasmic ratio, many having large, pale, bland ovoid vesicular coffee - bean nuclei with grooves and indentations, along with ample eosinophilic granular cytoplasm [figure 1a c]. Areas of necrosis were seen in one case and staining for acid - fast bacilli done in this case was negative (case 2). On cytology, the diagnosis rendered was lch in all the cases . Langerhans cell histiocytosis (a) cytological smear showing langerhans cells (lcs) with a few binucleate and multinucleate forms in a polymorphic infiltrate with a preponderance of eosinophils (mgg, 100) (b) aspirate smear showing lcs with grooved folded nuclei (arrows) (h and e, 400) (c) an occasional lc showing mitosis (arrow) (h and e, 200) (d) histological section showing diffuse infiltration by sheets of lcs (h and e, 400). Inset shows nuclear and cytoplasmic positivity for s-100 immunostain in lcs (immunoperoxidase, 400) paraffin sections showed sheets and islands of dense mixed infiltrate composed of lcs, eosinophils, and lymphocytes [figure 1d]. In all the cases, immunohistochemistry for s-100 antibody showed nuclear and cytoplasmic staining in lcs [figure 1d]. The disparate group of diseases with variable nomenclatures histiocytosis x, eosinophilic granuloma, letterer - siwe disease, hand - schuller - christian syndrome, hashimoto - pritzker syndrome, self - healing histiocytosis, pure cutaneous histiocytosis, langerhans cell granulomatosis, type ii histiocytosis, and nonlipid reticuloendotheliosis are now collectively referred to as lch . The clonal proliferation of the antigen presenting dendritic cells, the langerhans cells, supports neoplastic nature of lch . For a long time it may be a viral infection induced or a defect in t cell macrophage interaction and/or a cytokine - mediated process, involving interplay of tumor necrosis factor, interleukin 11, and leukemia inhibitory factor . The multifocal unisystem disease almost always occurs in the bone usually involving the skull, spine, pelvis, ribs, and mandible in more than half of the cases . The multifocal multisystem disease involves multiple organs the bone, liver, spleen, hematopoietic system, skin, and lymph node . Lytic lesions in the skull bones having a punched out appearance was seen in one case . The differential diagnoses of skull lesions clinically include ewing's sarcoma, non - hodgkin lymphoma, and osteomyelitis . Ewing's sarcoma and non - hodgkin lymphoma are characterized by a monotonous population of malignant small round cells . In acute osteomyelitis, there is a neutrophilic predominance while chronic osteomyelitis shows numerous plasma cells and lymphocytes . The cytological smears in lch are almost always cellular, composed of sheets and scattered lcs with interspersed polymorphous population of eosinophils, neutrophils, lymphocytes, plasma cells, and multinucleated giant cells . In fna, the cellularity of the smears and proportion of various cells correlate with the stages of lesions in lch . Further, with increasing duration fibrosis sets in; the lcs and eosinophils become an occasional finding . The cytologic differential diagnoses of lch include dermatopathic lymphadenitis, parasitic infection, kimura's disease, cat - scratch disease, sinus histiocytosis with massive lymphadenopathy, and hyperplastic lymph nodes . The cytomorphological features in the presence of relevant clinical and radiological findings are sufficient for reaching a correct diagnosis and ancillary studies are not mandatory in all the cases . In diagnostic difficulties, ancillary techniques such as immunostaining and electron microscopy are of help . The birbeck granules pentalaminar structures with prominent central cross striations seen on electron microscopy is the ultrastructural hallmark, which is present in 2 - 69% of the cases . To conclude, fna procedure, which is rapid, quick, and easy may be helpful in the early identification of lch patients so that appropriate therapeutic measures are instituted . A high index of suspicion, awareness of cytological features of lch, and the diagnostic pitfalls hold the key to an accurate diagnosis.
The femoral approach is still the most commonly used route for diagnostic cardiac catheterizations and percutaneous coronary interventions . At the end of the procedure the femoral artery is usually compressed manually to control bleeding until hemostasis is achieved . Local vascular complications such as bleeding and hematoma are not uncommon, ranging from less than 1% to 12% . Many devices have been developed to aid in the closure of the femoral arteriotomy, including the vasoseal (datascope inc ., jude medical devices, minneapolis, mn, usa), the starclose clip closure system (abbott vascular, redwood city, ca, usa), and the perclose (perclose, redwood city, ca, usa) suture - mediated closure system . In two recent meta - analyses these devices have proven their efficacy in significantly reducing time to hemostasis while simultaneously improving patient comfort . Vascular closure devices should be avoided or used with caution with non - common femoral artery sheath location, small femoral artery size, bleeding diathesis, morbid obesity, inflammatory disease, uncontrolled hypertension and in the presence of significant peripheral vascular disease, especially with calcification . In an attempt to reduce local complications, inflatable compression devices such as the femostop (radi medical system ab, uppsala, sweden) and the safeguard (datascope corp ., fairfield, nj, usa) (figure 1) have thus been developed for compression of the femoral artery and are now in use in some centers because they are well accepted by the nursing staff . Figure 1 the safeguard 24 cm pressure assisted dressing . The safeguard 24 cm pressure assisted dressing . We hereby report a clinical experience describing a significant complication occurring after safeguard use for femoral hemostasis . In this case, an extensive pressure ulcer developed in the groin of a very elderly patient in whom a safeguard had been applied overnight because of persistent oozing after diagnostic coronary angiography . A 95-year old diabetic female was referred to our catheterization laboratory for workup of percutaneous aortic valve replacement because of a severe calcified aortic stenosis and pronounced dyspnea on effort . The patient was anesthetized locally with 2% lidocaine and the femoral artery cannulation and placement of a 6 fr introducer sheath (cordis, miami, fl, usa) were performed by the usual technique without complications . Angiography disclosed a significant stenosis of the mid tract of the right coronary artery which was treated with a 3.518 mm bare metal stent dilated at up to 20 atm, achieving a good final angiographic and clinical result . Three hours after the procedure, when a check of the activating clotting time showed a value of 150 sec, the sheath was removed and manual compression was performed . After achieving hemostasis, a 24 cm safeguard pressure assisted device was positioned in the point of maximum femoral pulse and inflated with 40 ml of air, as recommended in the device package insert . No bleeding or oozing was found after manual compression or shortly after positioning the safeguard. Two hours later the safeguard bulb was deflated but a persistent oozing was observed . Similarly, 4 h after positioning the safeguard another deflation attempt was performed, but oozing was still present and the device was again inflated with 20 ml of air, and kept overnight . Since the volume of inflated air was significantly lower than recommended, the nurse did not deflate the bulb every 2 h as suggested by the safeguard instructions . In the early morning of the following day nonetheless, a circular area of non - blanchable erythema was observed which developed into a pressure ulceration two days after (figure 2), with partial - thickness loss of dermis . The lesion was treated with frequent irrigations of saline solution, gentle manual debridement and hydrocolloid - based dressings (3 m tegasorb, minneapolis, mn, usa) and resolved without any need for systemic antibiotics in a week, leaving, however, a minor scar . Figure 2right groin's extensive (129 cm) pressure ulcer with loss of epidermis and dermis . Right groin's extensive (129 cm) pressure ulcer with loss of epidermis and dermis . The 24 cm safeguard pressure - assisted device is a disposable device with a clear polyurethane bladder and a pressure sensitive self - adhesive peel backing . A luer valve enables a syringe to be connected to the device in order to inflate the central bladder with air to provide pressure to the puncture site . Adverse effects reported by the manufacturer that may result from the use of this device include hematoma, local bleeding, pseudoa naurysm and arterio - venous fistula; all complications associated with bleeding . To date, only a single prospective, non - randomized, multicenter study has been conducted in 101 low - risk patients to evaluate the safety and effectiveness of the safeguard space . The device proved to be effective in reducing active compression time without increasing risk in patients undergoing diagnostic and interventional procedures . The case report described here highlights how such a device, despite its inherently favorable features including user friendliness for staff, may seriously harm a patient if the instructions for use are not meticulously followed . Given its inherent mechanical pressure properties, it is absolutely mandatory to deflate the bulb of the device every 2 hours to allow for capillary refill in accordance with the device instructions . Even if long - term harm to the patient could be avoided, thus leading to an acceptable final cosmetic result, greater harm could have been caused, possibly with potentially dire medico - legal implications (e.g. In the case of groin skin damage in a younger woman). Vascular access complications are amongst the most common adverse events associated with coronary angiography and intervention . A number of devices are available to aid in achieving post - procedure homeostasis . Information on vascular complications from access of the femoral artery, the methods of arterial closure, and post - procedural care instructions (including avoidance of lenghty mechanical pressure with pneumatic devices) can help physicians and nurses to provide safe and effective care to patients after cardiac catheterization.
An 18-year - old male presented with a complaint of chest discomfort, exertional dyspnea, and an intractable dry cough . Chest radiography revealed a mass like lesion in left upper mediastinum and trachea deviated to the right - side . Multi detector computed tomography (mdct) revealed a 12 9 15 cm sized heterogenously enhancing mass in anterior mediastinum extending ventrally into the left pectoralis major muscle, and dorsally into the aortic arch, pulmonary artery trunk, and descending aorta, and encroaching the left lung field (fig . 1 and 2) however, the diameters of involved vessels were preserved (not shown), and the trachea and both main bronchi were patent (fig . 2 and 3). Transthoracic echocardiography demonstrated minimal pericardial effusion with moderate mitral regurgitation and a left ventricular ejection fraction of 52% . Pulmonary function test (pft) findings were within normal limits, and including a peak expiratory flow rate (pefr) of 50% the predicted value . Although the patient underwent a fluoroscopy - guided percutaneous needle lung biopsy twice, the type of tumor was not confirmed, and thus, a thoracotomic incisional biopsy was decided upon under general anesthesia . After intravenously injecting 1% propofol and succinylcholine in the supine position, a univent tube was successfully intubated by direct laryngoscopy . Anesthetic maintenance was then carried out by the target - controlled infusion of propofol and remifentanil with o2, air, and intermittent intravenous rocuronium . During the first 45 minutes after induction in the supine position, end - tidal carbon dioxide partial pressure (petco2), heart rate (hr) and systolic / diastolic blood pressures were 37 - 39 mmhg, 109 - 120 bpm, and 121 - 181/85 - 103 mmhg, respectively . Even after closing the left main bronchus using a bronchial blocker, pulse oximetry o2 saturation (spo2) was maintained at 97 - 99%, and central venous pressure (cvp) was maintained at 14 - 15 mmhg under controlled positive pressure ventilation . He was then placed in the right lateral decubitus for the left thoracotomy approach, and for the first 30 minutes after this positional change, his vital signs remained unchanged . However, spo2 then began to decline, and fiberoptic bronchoscopy demonstrated the left main bronchus was almost totally obstructed, and that the ballooned bronchial blocker had been dislodged into the carina . Accordingly, we immediately turned patient supine to relieve the mass effect on the main bronchi . However, hypoxemia was further aggravated up to 65% even after two lung ventilation and increasing the inspiratory oxygen fraction (fio2) to 1.0 . Nevertheless, blood pressure (112 - 123/72 - 77 mmhg) and petco2 (32 - 36 mmhg) remained in their normal ranges . Eventually, the patient was placed in the left lateral decubitus position to detach the mass from the site of obstruction by gravity, and thereafter, spo2 improved from 79% to 93 and then to 97 - 99%, and cvp simultaneously decreased from 65 to 18 - 20 mmhg . Surgery was then undertaken under a partial (femoro - femoral) cardiopulmonary bypass (cpb) in the right lateral decubitus position . The total bypass time was 150 minutes, and blood pressures and heart rates perioperatively were 89 - 120/44 - 50 mmhg and 95 - 115 bpm, respectively . During bypass, core temperature was maintained at normothermia (36) and petco2 was 36 - 43 mmhg . A frozen biopsy later confirmed hodgkin's lymphoma . After weaning the patient off cpb, his spo2 was 100%, petco2 42 - 46 mmhg, and cvp 12 - 16 mmhg under controlled positive pressure ventilation supplying fio2 1.0 . Muscle relaxation was reversed using glycopyrrolate and pyridostigmine . After observing full recovery of spontaneous respiration and of extremity muscle power, we extubated the univent tube and transferred the patient to an intensive care unit (icu) with o2 5 l / min administered through a venturi mask . In the icu, no signs of hypoxemia were evident (spo2 98%), and no cardiorespiratory or neurologic abnormalities were found . On postoperative day 2, the patient was moved to a general hospital ward . Loss of muscle tone, especially that induced by muscle relaxants, makes airways susceptible to collapse due to external compression by mediastinal masses, and furthermore, the supine position leads to cephalic displacement of the diaphragm and reduces thoracic anteroposterior diameter . In addition, controlled positive pressure ventilation reduces negative intrathroacic pressure, which tend to move the mediastinal mass away from the airway and cardiovascular system . Furthermore, in combination, these influences can provoke severe airway obstruction in the supine position under general anesthesia, and thus, the use of muscle relaxants is not recommended under general anesthesia, and accordingly, surgery is best performed under local anesthesia . However, when surgery must be performed under general anesthesia, especially with muscle relaxants, resuscitating methods should be provided to manage cardiorespiratory complications . In addition, a number of resuscitating methods have been introduced, such as, positional changes, tracheobronchial stenting, and rigid bronchoscopy to relieve airway obstructions and cardiopulmonary bypass [6 - 10]. Changing posture is more feasible than any other method, and we recommend before induction that the position which frees the patients from tumor - related cardiorespiratory complications be determined . If this comfortable position is not determined preoperatively, the sitting position is preferable for resuscitation in the presence of an airway obstruction . This position moves the diaphragm caudally and alleviates the pressure of the mediastinal mass on surrounding organs . However, as in our case, the sitting position does not always effectively relieve cardiorespiratory complications during general anesthesia, and as has been previously reported, the lateral decubitus or prone position should then be adopted to enable the nature of the complication to be determined . Nevertheless, it is unclear which position is best for clearing an airway obstruction due to a mediastinal mass during general anesthesia . The right lateral decubitus position could either prevent compression of the cardiorespiratory system during induction or relieve hypoxemia and hypotension during general anesthesia, irrespective of whether a tumor in the anterior mediastinum primarily expands toward the left or right side of the chest . However, in another report, the right lateral decubitus position did not solve the hypoxemia or hypotension caused by an anterior mediastinal mass, which was misdiagnosed as a pericardial effusion by preoperative echocardiography . In addition to changing posture, emergency percutaneous cardiopulmonary bypass support or extracorporeal membrane oxygenation (ecmo) support can be applied to an unexpected airway collapse during general anesthesia caused by a mediastinal mass . Furthermore, when a patient with a mediastinal mass complains of cardiorespiratory symptoms before induction, it may be advisable to have a prepared cardiopulmonary support system available in the operating room . Our case showed a rise in cvp after being positioned in the right lateral decubitus that was sustained even in the sitting position . The right heart and pulmonary artery, which are at lower pressures than the left heart and aorta, are more vulnerable to compression by a mediastinal mass . Although the pulmonary trunk was not compressed by preoperative mdct in our case, the positional change might have caused a mass effect on the right heart or pulmonary artery and the observed increase in cvp . However, the maintenance of normal blood pressures suggested a partial obstruction of the pulmonary circulation . Furthermore, the airway below the right main bronchus was probably only partially collapsed because petco2 remained in the normal range . When the cross - sectional area of the trachea is compressed by more than 50% of predicted, or pericardial or pleural effusions are visualized by preoperative ct, the patient may be more vulnerable to perioperative complications . Furthermore, a peak expiratory flow rate (pefr) by the pulmonary function test (pft) of less than 50% of the predicted value should raise concerns about complications due to a mediastinal mass . In our patient, the preoperative tracheal cross - sectional area was patent, but pefr by pft was 50% of predicted and minimal pericardial effusion was observed by echocardiography . Our patient also complained of exertional dyspnea, and thus, we should have expected hypoxemia or hypotension during general anesthesia . In conclusion, positional changes can be used to relieve an unexpected airway obstruction caused by an anterior mediastinal mass . However, before applying this method, it should be considered whether the intended posture is likely to be hazardous or effective . We recommend that when a patient is positioned that the center of the mass should be located in the dependent site of the body.
Endometriosis is one of the most common gynecological diseases and is defined as a benign and proliferative chronic disorder characterized by the ectopic presence and growth of functional endometrial tissue, glands and stroma, outside the uterine cavity.14 endometriosis affects ~10% of women in reproductive age and up to 50% of infertile women.48 according to the classification of the american society for reproductive medicine, there are four different stages of endometriosis; stages i and ii represent initial stages, while stages iii and iv are advanced stages.9 the stage of endometriosis is based on the location, amount, depth and size of the endometriotic foci . Specific criteria are the extent of the spread of the tissue, the involvement of pelvic structures, the extent of pelvic adhesions and the obstruction of the fallopian tubes.9,10 the stage of endometriosis does not necessarily correspond to the severity of symptoms, and hence a woman in stage i may experience very intense symptoms, while a woman in stages ii iii may have less intense symptoms and signs.9 the pathogenesis of the disease is not fully known, and several theories have been proposed to explain it . The most accepted theory suggests that immune dysfunction and abnormal differentiation of endometriotic tissue may be involved in the development of the disease.3 other possible explanatory hypotheses include genetic, epigenetic or environmental factors.2,3,11,12 moreover, the embryogenetic theory and the potential role of endocrine disruptors are other hypotheses considered to be plausible regarding the pathogenesis of endometriosis.1315 the diagnosis of endometriosis is traditionally based on laparoscopic inspection of the pelvis and should ideally be confirmed by histological examination of the excised lesions.7,16 the most common clinical signs of endometriosis are menstrual irregularities, chronic pelvic pain (cpp), dysmenorrhea, dyspareunia and infertility.4 a significant proportion of women with endometriosis are asymptomatic, and the disease is often diagnosed during laparoscopic investigation due to other pelvic conditions.17,18 three different clinical presentations of endometriosis have been described, peritoneal endometriosis, endometriotic ovarian cysts and deeply infiltrating endometriosis (die).4 die is the most aggressive presentation of endometriosis; it is characterized by an infiltration of> 5 mm of endometrial tissue into the retroperitoneal space and accounts for ~20% of the cases.4,19,20 symptoms of endometriosis can often affect psychological and social functioning of patients.21,22 for this reason, endometriosis is considered as a disabling condition that may significantly compromise social relationships, sexuality and mental health.2224 although the impact of endometriosis on mental health and psychological well - being has been investigated in several studies, data published so far are not robust enough to draw firm conclusion . Therefore, the aim of this narrative review is to elucidate the impact of anxiety and depression in the management of women with endometriosis . As detailed below, several studies have reported the association between endometriosis and psychological diseases . Pope et al25 underlined that endometriosis is related to a wide range of psychiatric symptoms, especially depression, anxiety, psychosocial stress and a poor quality of life . According to recent literature,21,23,2531 depression and anxiety are the most common disorders associated with endometriosis . In this context, a total of 81 women with pelvic pain were studied, of whom 40 had endometriosis and 41 had other gynecological problems . Each patient completed six standardized psychometric tests (eysenck personality questionnaire [epq], beck depression inventory [bdi], general health questionnaire, state - trait anxiety inventory [stai], the golombok rust inventory of marital state and the short - form mcgill pain questionnaire) to assess personality, psychopathology, marital state and pain . According to the results of their study, endometriosis patients showed higher psychoticism, introversion and anxiety scores than those of women with other gynecological conditions . In addition, a study by lagan et al30 investigated quality of life, negative emotions, such as anger, anxiety and depression, and possible psychopathological comorbidity in a sample of 166 women with endometriosis . Patients completed the following self - report instruments: symptom checklist-90-r, state - trait anger expression inventory-2, self - rating anxiety scale, self - rating depression scale and quality of life index . The results showed that somatization, depression, sensitivity and phobic anxiety are higher in these patients than in women without endometriosis.30 moreover, the same authors found that women with endometriosis are characterized by high levels of anxiety and a significant decline in quality of life . Chen et al28 used the taiwan national health insurance research database (nhird) with a longitudinal study design to identify women with endometriosis who were diagnosed with depression or anxiety disorders by board - certified psychiatrists . They found that endometriosis is associated with an elevated risk of developing depression and anxiety disorders.28,29 in full agreement with these data, sepulcri rde and do amaral33 evaluated depressive symptoms, anxiety and quality of life in 104 women with a diagnosis of pelvic endometriosis . The bdi and the hamilton rating scale for depression (ham - d) were used to evaluate depressive symptoms; the spielberger stai and the hamilton rating scale for anxiety (ham - a) to evaluate anxiety symptoms, and the short (26-item) version of the world health organization quality of life assessment - bref (whoqol - bref) to evaluate quality of life . They found that 86.5% presented depressive symptoms and 87.5% presented anxiety and, most important, that psychiatric symptoms were not associated with endometriosis stage.33 in this study, age correlated positively with depressive symptoms, while there was no association between age and anxiety symptoms.25,33 nevertheless, other authors found that only 29% of endometriotic women showed moderate to severe anxiety symptoms, while depression was present in 14.5%.21 these apparently contradictory results may be due at least in part to different methodologies used to identify psychiatric symptoms or to selection biases (in particular, the inclusion of other comorbidities that can severely influence mental health). In addition, endometriotic patients show high levels of alexithymia,31 which further makes it difficult to identify other psychiatric disturbances, due to a severe difficulty in identifying and describing emotions . Briefly, the literature confirms a significant incidence of anxiety, depression and psychopathological symptoms among women with endometriosis . These comorbidities could influence the severity of symptoms and the health - related quality of life of affected women.2123,33 the presence of cpp is an important variable to be taken into account when assessing the association between endometriosis and psychological diseases . Cpp is defined as a nonmalignant pain perceived in pelvic areas that is constant or recurs over a period of 6 months.34 endometriosis is one of the most common causes of cpp;35,36 indeed, women with endometriosis may suffer from a wide range of pelvic pain such as dysmenorrhea, dyspareunia, nonmenstrual (chronic) pelvic pain, pain at ovulation, dyschezia and dysuria.18,31,35 it is important to underline that pain seems to be independent of the stage of endometriosis, so women with mild endometriosis may have intense pelvic pain while women with more severe endometriosis may suffer less from acute / chronic pain.31,3739 this finding suggests that psychological factors may be involved, which influence pain experience in women with endometriosis.31,37,39 it has been demonstrated that pelvic pain has significant negative effects on women s mental health and quality of life; in particular, women who suffer from pelvic pain report high levels of anxiety and depression, loss of working ability, limitations in social activities and a poor quality of life.3946 several studies have tried to investigate the relationship between endometriosis, pelvic pain and depression or anxiety disorders . Lorenatto et al42 compared the prevalence of depression between a group of women with a diagnosis of endometriosis and cpp and a group of women with endometriosis but no cpp . The results of this study show that depression was present in 86% of the women with cpp and in 38% of the women without pain . Moreover, the symptoms associated with depression (somatic concerns, work inhibition, dissatisfaction and sadness) were significantly higher in women with pain . According to these data, depression may be the result of the experience of pelvic pain rather than of endometriosis itself . This hypothesis seems to be confirmed by the study performed by souza et al,44 in which 57 patients aged between 25 and 48 years who underwent laparoscopy because of cpp were evaluated for quality of life and depressive symptoms . The whoqol - bref was used to evaluate quality of life while the ham - a and the bdi were used to investigate the presence of anxiety and depressive symptoms . According to their data analysis however, endometriosis in addition to cpp did not have an additional impact upon the quality of life.44 in this regard, roth et al47 compared women suffering from cpp associated with endometriosis with women experiencing cpp due to other medical conditions . Participants completed a battery of validated questionnaires assessing demographic status, pain experience and other pain - related symptoms, pain disability, frequency of depressive symptoms, level of affective distress, satisfaction with pain treatment and satisfaction with their marital relationship . Interestingly, they did not find significant differences between the two groups for frequency of depressive symptoms and level of affective distress . Nevertheless, large cohort analyses37 found that women with endometriosis associated with pelvic pain reported higher levels of anxiety and depression and lower quality of life than women without pain symptoms, and healthy women . Although current data do not allow to draw firm conclusions, accumulating evidence suggests that psychopathological diseases might amplify pain symptoms in endometriotic patients31 and, in this way, contribute to create a vicious circle (psychopathological diseases increased cpp worsening of psychopathological diseases; figure 1). Summarizing the results of the abovementioned studies (table 1), the experience of cpp should be considered as an important component of having endometriosis and may significantly affect women s quality of life and psychological well - being . More specifically, psychiatric comorbidities associated with endometriosis seem to be an effect of the experience of pelvic pain rather than of endometriosis itself.25,47 the relationship between emotional diseases and perception of pain in women with endometriosis is still unclear . Studies on this topic have obtained controversial results; it has not yet been elucidated if depression, anxiety and emotional distress determine an increased perception of pain or if pain causes psychological distress and psychopathological symptoms.31,33,42 however, anxiety and depression could increase pain perception both emotionally and cognitively, determining less tolerance to pain and greater sensitivity to physical sensations in general.33 consequently, further studies are needed to investigate these aspects . Treatment of endometriosis can be complex and it is important to take into account several factors such as side effects, the anatomic type of endometriosis, role of previous surgery, infertility and future fertility desires.7,48 the main purpose of treatments should be pain control, improvement of the quality of life, prevention of disease recurrence, fertility preservation and reduction of anatomical damage.48,49 hormonal treatment aims at downregulation of the ovaries, reducing the estrogen stimulation of endometriotic growth.7,4850 the choice of the most appropriate hormonal therapy depends on several factors such as therapeutic effectiveness, tolerability, drug cost, physician s experience and expected patient compliance.48 combined oral contraceptives (cocs), danazol, gestrinone, medroxyprogesterone acetate and gonadotropin - releasing hormone (gnrh) agonists are the most frequently used drugs in the hormonal treatment of endometriosis.49,50 during the last few years, gnrh agonists, which downregulate the pituitary and thereby indirectly the ovaries, have been commonly used as alternatives to gestagens and danazol in order to avoid a high rate of side effects such as weight gain, acne and headache.4952 although the gnrh agonists are effective in reducing endometriosis symptoms, they are often associated with anxiety and depression during treatment.25,49,52,53 for this reason, psychiatric drugs may be considered as adjunctive treatment during endometriosis therapy, even if they can produce side effects and some patients are reluctant to take additional drugs.25,49 there are few studies in the literature about the effects of hormonal treatment for endometriosis on quality of life and psychological functioning of affected women: bergqvist and theorell50 evaluated quality of life and psychiatric comorbidities in a sample of 48 women with endometriosis before, during, and after treatment with nafarelin or medroxyprogesterone acetate, using questionnaires that were both of a general and a more specific nature . They found that there was a significant reduction of symptoms during the study and important factors for quality of life such as sleep disturbances, anxiety and depression symptoms improved significantly after hormonal treatment.50 in partial agreement with the previous study, zhao et al49 investigated the impact of progressive muscle relaxation (pmr) training on anxiety, depression and quality of life of patients with endometriosis undergoing gnrh agonist therapy . The patients were evaluated with stai, hospital anxiety and depression scale depression subtest (hads - d) and sf-36 before and after the pmr intervention . According to the results of this study, pmr training is effective in reducing anxiety and depressive symptoms, which could be associated with gnrh agonist therapy . However, it is important to evaluate previous psychiatric comorbidities that could increase the risk for psychiatric disturbance related to hormonal therapy for endometriosis.25 surgery is the primary treatment for more severe forms of endometriosis, such as die.4,54,55 currently, several gynecological surgeons are attempting to modulate how much their surgery is radical according to fertility desires and future quality of life of the patient . To date, there are few data available in the literature on quality of life and anxiety and depression levels after surgery for endometriosis . A review by deguara et al54 underlined that laparoscopic surgery is associated with improved quality of life and emotional well - being compared to medical therapies . A prospective cohort study by van den broeck et al55 evaluated depression levels, relationship satisfaction and sexual functioning of 203 women who underwent laparoscopic surgery for moderate or severe endometriosis . Participating patients completed the bdi, dyadic adjustment scale (das) and the short sexual functioning scale (ssfs) 1 month prior to and 6, 12, 18 and 24 months after the intervention . Results showed that radical surgery for endometriosis improved the levels of depression and sexual functioning of the patients.55 these data suggest the importance of psychological factors not only for the severity of symptoms but also in the management of the disease and in the selection of the most appropriate therapy . Considering this scenario, we take the opportunity to solicit further studies to clarify the relationship between endometriosis therapies and psychological outcomes, taking into account other endometriosis - associated comorbidities such as infertility.56,57 in particular, it would be interesting to investigate whether a correlation occurs between psychological outcomes and levels of pro - inflammatory cytokines in peritoneal fluid,5860 which are known to play a detrimental role in pain exacerbation61 and may contribute to endometriosis - related infertility.62 endometriosis is a very complex condition and psychological factors have an important role in determining the severity of symptoms and the effectiveness of the treatments . According to recent data, women with endometriosis are at risk for anxiety, depressive symptoms and other psychiatric disorders . Since it is still unclear if these comorbidities are a result of endometriosis itself or other factors such as cpp, we solicit further studies about this topic in order to better understand the relationship between endometriosis and psychological diseases . In addition, we take the opportunity to stress the importance of a multidisciplinary approach in the management of women with endometriosis . In this regard, psychological assessment is recommended in order to identify women at risk of developing symptoms of anxiety and depression and provide them an adequate psychological support . The aim should be to reduce as much as possible the impact of endometriosis on quality of life and psychological well - being of these patients.
In 1978 when the nobel prize in physiology and medicine was awarded jointly to a german, werner arber, and the two americans, daniel nathans and hamilton o. smith, " for the discovery of restriction enzymes and their application to problems of molecular genetics, " public health laboratories in europe were essentially still structured in the same way as when they were originally founded . In the late 1890s robert koch had initiated routine testing of stool specimens to detect human carriers of salmonella typhi . Screening for corynebacterium diphtheriae, for streptococcus pyogenes (the causative agent of scarlet fever, then a feared infection) and mycobacterium tuberculosis were other major tasks for public health laboratories, at a time when eradicating pathogens by detecting and isolating human carriers was considered feasible . In the following decades, subtyping, the characterization of microorganisms beyond the species level was restricted to exceptional situations, with results often coming in months after the actual problem had occurred . However, infectious disease challenges are manifold and not of static nature . Identifying human carriers the changes in infectious diseases are the result of ongoing changes in human demographics and behaviours, of changes in technology and industry, changes in economic development and land use, increasing and rapid international travel and commerce, ongoing microbial adaptation, and also the consequence of public health measures . Addressing infectious diseases unabatedly requires a strong public health infrastructure to detect and rapidly respond to these emerging threats to health . Identifying clones of pathogens quickly and reliably is now of crucial importance if public health authorities are to respond effectively to the threat posed by a specific infectious source . One of the most notable benefits resulting from the discovery of restriction enzymes is the ability of the new armoury of molecular methods to characterise and quickly identify bacterial clones . In the last three decades, dna fingerprinting thchniques have become an indispensable tool in the everyday work of public health laboratories; restriction enzymes were the key to this innovation . For the public health laboratory system in austria (total population 8.3 million), the implementation of these new methods has effectuated a complete restructuring, with a switch from geographic allocation of tasks (six laboratories each serving a certain geographic area) to allocating special tasks to the only two remaining laboratories, each offering specialized service to all of the country . In this special article, the author discusses the variegated applications of molecular typing in today's public health laboratories by presenting three case studies to help illustrate preventive management strategies relying on subtyping . These examples originate from the daily routine work of the austrian agency for health and food safety (ages). Ages is an independent statutory agency established by the austrian health and food safety act in 2002 . The austrian examples presented here are from the years 2010/2011 and are supposed to give an overview of the diverse fields of applications of various dna subtyping methods routinely employed in everyday work . Restriction fragment length polymorphism (rflp) analysis is a direct result of the work of w. arber, d. nathans and h.o . Dna macrorestriction analysis by pulsed field gel electrophoresis (pfge), which revolutionized precise separation of dna fragments greater than 40 kb, has even become the gold standard for subtyping of food borne pathogens like listeria, salmonella, campylobacter and bacillus cereus . Cantor developed this variation of agarose gel electrophoresis in which the orientation of the electric field across the gel is changed periodically (" pulsed ") rather than kept constant as it was in conventional agarose gel electrophoresis . This technology separates large fragments of unsheared microbial chromosomal dna obtained by embedding intact bacteria in agarose gel plugs, enzymatically lysing the cell wall and digesting the cellular proteins . Subsequent restriction fragment length polymorphism analysis allows differentiation of clonal isolates from unrelated ones . In april 2010, the austrian reference centre for salmonella noticed a sudden increase in the number of salmonelloses due to a usually rare serotype: while only five human salmonella enterica subsp . Enterica serovar mbandaka - infections were documented in the year 2009, 19 such cases were noticed during the two weeks from march 10 to march 31 . Isolates were subjected to molecular analysis using pfge and isolates from the year 2010 were found to be indistinguishable from each other but clearly different from those received in previous years . Epidemiological investigation revealed consumption of raw or insufficiently heated eggs or egg dishes as the highly likely source of infection . Because the epidemiologically incriminated eggs were traced to 56 different austrian producers but no increase was noticed in neighbouring countries, like germany or italy, 226 laying hen flocks serving the 56 producers were environmentally sampled . Although three months had passed between the beginning of the outbreak and sampling of the farms, faecal dust samples from two laying hen flocks still tested positive for the outbreak strain, as did a specimen from a commercial feed product taken at one of these two farms . From the farm with the positive feed sample, 290 consecutive eggs were tested using pools of five eggs each (testing separated for surface and egg content): salmonella mbandaka was cultured from one of 58 tested pools on egg surface only . The investigation proved that consumable eggs were the vehicle of this outbreak, and that salmonella mbandaka was introduced into the laying hen flocks involved - from 8 of the 9 austrian provinces - via commercial feed . Further investigations, with microbiological testing of 226 additional laying hen flocks and tracing their feed supply, finally identified one austrian feed mill as the sole source of the incriminated feed . Figure 1 presents the pfge patterns of the outbreak clone using the restriction enzyme xbai in comparison with isolates of sporadic cases gained in previous years; salmonella braenderup h9812, which gives rise to a broad spectrum of precisely defined bands, was used as internal standard . The comparison of pfge patterns from human isolates, food isolates, animal isolates and feed isolates allowed us to identify and confirm the sources of disease . Once an epidemiological investigation has identified a potential source, pfge can help confirm that the outbreak strain is found in some stage of food production . This leads to a better understanding of the means of contamination and spread and therefore to better control interventions . However, the time required to complete the procedure (> 1 day), the need for relatively specialized equipment for electrophoresis and the fact that pfge generates band patterns that are difficult to share between laboratories are major disadvantages inherent in this method . The analysis of banding patterns can be time - consuming, and the interpretation of banding patterns is somewhat subjective . As a result, improved methods are being sought, but as yet no single method has been able to replace pfge . Ten years ago, gel based rflp analysis using the repetitive insertion sequence is6110 as a probe was still considered the gold standard for typing of mycobacterial strains . However, the technical steps of is6110 rflp were both labor - intensive and lengthy . Moreover, sophisticated computer image analysis software was required for fingerprinting in large - scale analysis . Therefore, typing of mycobacteria has nearly completely switched from rflp analysis to a polymerase chain reaction - based typing method that relies on the analysis of tandem repeats present in the mycobacterium tuberculosis complex - genome in up to 41 genetic elements . These genetic elements, called mycobacterial interspersed repetitive units (mirus), are scattered throughout the genome, with a variable number of copies of the repeat unit in each locus . Miru - variable - number tandem repeats (vntr) analysis generates numerical values that can easily be shared between laboratories .the availability of whole - genome sequences has facilitated the discovery of these vntrs, loci that contain short strings of nucleotides that are repeated a few to many times . This has led to the birth of this new subtyping method, also called multilocus vntr analysis (mlva). Results are depicted by numerical codes, giving the number of miru alleles at each locus tested . The following example shows the potential of this molecular subtyping method to disprove an epidemiological connection . The simultaneous occurrence of tuberculosis in cattle and deer in western austria and cases of human tuberculosis in eastern austria were noted in early 2011 and prompted an investigation to elucidate a possible connection . Mycobacterium caprae, a recently defined member of the mycobacterium tuberculosis complex, causes tuberculosis among animals and, to a limited extent, in humans in several european countries . While in the ten year period until 2009, there was only one human tuberculosis case with mycobacterium caprae documented in austria (in 2008), in 2010 three such cases were registered for this mandatorily reportable disease . Already in fall 2008, the western provinces tyrol and vorarlberg had begun to test all cattle for tuberculosis, after documenting occurrence of mycobacterium caprae in some herds of one of nine tyrolean districts . Cattle were supposed to have become infected after grazing on alpine pastures contaminated by diseased deer . In the affected district, the county of reutte, neighbouring the province of vorarlberg, more than 10% of the red deer (cervus elaphus) population was found to be infected with mycobacterium caprae . Overstocking and winter feeding (with " unnatural " crowding of deer at few feeding places) the sudden emergence of three human mycobacterium caprae infections in 2010 raised the question as to whether there was an epidemiological link between animal and human illness . Figure 2 depicts the geographic origin of the mycobacterium caprae infections in cattle, deer (unpublished ages data) and humans documented in 2010 [16 - 18]. Miru patterns from deer and cattle isolates were indistinguishable from each other, but clearly different from the three patterns of the human isolates . The molecular genetic analysis did not reflect patterns indicative of spread of mycobacterium caprae from the veterinary outbreak in western austria to the human cases in eastern austria . Miru - vntr results were substantiated by epidemiological findings: patient a, a 13 year old girl of turkish ancestry living in vienna probably became infected when visiting her grandparents in rural turkey during summer breaks . Patient b, a 85-year - old lady from lower austria, probably got infected by her late husband, who had the cattle of his farm culled due to bovine tuberculosis in the early 1960s . Patient c, a 70-year - old patient from upper austria probably got infected around 1965, when the cattle of his farm had to be culled by public order because of tuberculosis . Molecular typing was not only able to exclude a connection between the recent re - emergence of tuberculosis in cattle and deer with the occurrence of human mycobacterium caprae cases but even to disprove the existence of a human outbreak . Ten years ago, a single - endonuclease, amplified fragment length polymorphism analysis method by which the patterns are resolved by standard agarose electrophoresis, was adopted as an international standard by the european working group for legionella infections (ewgli), especially for cases of travel - associated legionellosis . However, while this method allowed relatively reliable screening of isolates within a single laboratory, inter - laboratory comparison of the results still posed a significant hurdle . Therefore, ewgli developed a sequence - based typing (sbt) scheme for clinical and environmental isolates of legionella pneumophila, which is presently widely used in europe in the investigation of outbreaks of legionellosis caused by legionella pneumophila . The advantages of using a multilocus sequence typing approach with nonselective housekeeping genes has been well documented for various microorganisms . Using the so - called sbt protocol, the sbt database (provided by ewgli in conjunction with the london based health protection agency and the european centre for disease prevention and control in stockholm under http://www.hpa-bioinformatics.org.uk/legionella/legionella_sbt/php/sbt_homepage.php) allows assignment of the seven ordered alleles, flaa, pile, asd, mip, momps, proa, and neua as described by gaia et al . And ratzow et al ., and representation as one of presently 1032 sequence types (st). St 81 for instance has the allelic profile, i.e. The ordered string of allele numbers separated by commas, 2,10,3,28,9,4,9 . The following example on legionella pneumophila underlines the considerable potential of this molecular typing method to elucidate connections between an environmental source, in this case a hospital drinking water system, and a case of human illness . At the end of july 2010, the austrian reference centre for legionella learned about a case of legionella pneumonia in a 70 year old female patient, who had died on july 26 . Onset of symptoms had occurred on july 22, admission to hospital c on july 24 . A urinary antigen test performed on day 2 of hospitalization was positive for legionella pneumophila . The patient, who also suffered from neoplasm bronchi with brain metastases, had previously been hospitalized in hospital a for chemotherapy from july 6 to 16, and after spending four days at her private home (from july 16 to 20) - in hospital b for -knife intervention (july 20 to 21). In order to identify the environmental source of infection, efforts were made to obtain a patient isolate for comparison with possible future environmental isolates . A blood culture drawn on july 25 (with a negative result reported by the laboratory of hospital c) two blood culture bottles were sent to the national reference laboratory and volumes of 0.1 and 0.5 ml were directly plated onto buffered charcoal yeast extract agar with and without glycine, vancomycin, polymycin b and cycloheximide supplementation (oxoid, cambridge, uk). After incubating for five days, approximately ten colony forming units (cfu) per ml blood culture medium were gained: legionella pneumophila serogroup (sg) 1 (st 81) and legionella pneumophila sg 3 (st 93). Double infection is a rare, but not unusual phenomenon, be it in salmonellosis, in tuberculosis or in legionellosis . For the health administrators in charge, an available isolate usually initiates an attempt to identify the source of the patient's infection in order to prevent further fatalities . Legionella is often found in warm and cold water systems of buildings; without proof of clonal identity, the mere demonstration of legionella pneumophila in a water system cannot be regarded as proof of causal relation with illness . Within the incubation period of 2 to 10 days the testing of water samples, drawn from the patient's room in hospitals a and b and at her home, demonstrated legionella contamination in all three facilities . Water samples (cold and hot water, mixed) obtained on july 29 from the room occupied by the patient during her stay in hospital a yielded 1 cfu legionella pneumophila sg 1 (st 81)/100 ml from the sample " hand washbasin tap " and 7 cfu legionella pneumophila sg 3 (st 93)/100 ml from the sample " shower " . Water samples (again cold and hot water, mixed) obtained on july 29 from the room occupied by the patient during her stay in hospital b yielded 1 cfu legionella pneumophila sg 1 (st 442)/100 ml from the sample " shower " . Water samples obtained on august 4 from the patient's home yielded 1 - 220 cfu legionella pneumophila sg 10/100 ml . Sequence based typing revealed that hospital a was the causative reservoir . The financial resources necessary to sanitize this contaminated drinking water system would not have been allocated without microbiological proof of a causal connection with human illness . Molecular typing of pathogens causing diseases complements the traditional epidemiological surveillance by providing appropriate discriminatory analyses to foster rapid and early detection of dispersed clusters or outbreaks, and for detection and investigation of transmission chains . It also supports studies to trace - back the source of an outbreak and to identify new risk factors as the strains can be linked more accurately to epidemiological and clinical data . All of this information can be applied towards improving and better targeting existing infectious disease prevention and control measures and thus presents a clear and immense benefit for the public health and public health policies . Molecular typing has evolved to become a routine tool in the daily work of public health laboratories . As this holds true not only for austria, but also for many other european member states, extensive work is presently being done to prepare for a molecular infectious diseases surveillance system in the european union . Starting with food and waterborne diseases and with tuberculosis, the ecdc in stockholm, sweden, focuses on establishing centralised databases for typing results from pfge and from mlva . In the case of food and waterborne diseases, this will enable the linkage of national sporadic cases or outbreaks across the european member states' borders and beyond . The system will start with nontyphoidal salmonella, enterohaemorrhagic escherichia coli and listeria monocytogenes and it will be compatible with the global surveillance of food and waterborne diseases - system led by the centers for disease control and prevention in atlanta, georgia (pulsenet international) and the world health organization in geneva, switzerland (global food - borne infections network). To enhance capacity building in the european member states, an mlva implementation project has already been initiated with the aim to support establishment of the methodology in mycobacterium tuberculosis reference laboratories . To enhance the capacity for pfge methodology, a first hands - on workshop took place in june 2011 in order to support listeria monocytogenes molecular typing implementation as a prerequisite for effective surveillance systems so the challenge is now no longer to simply type microorganisms, but to type them in a unified way that allows for data exchange between public health laboratories all over the world . To accomplish that, a significant investment in bioinformatics will be required in order to translate large amounts of metagenomics (gene - based) data into a form that provides useful epidemiologic information . New dna sequencers can determine more than 100 megabases of dna sequences per run, and new sequencing technologies eliminate the bacterial cloning step used in traditional sanger sequencing . Instead, they multiply single isolated dna molecules and analyze them with computers capable of massive parallel processing . The emphasis of future dna subtyping developments should be on the use of sequence based metagenomics rather than on the gel based methods still used in many public health laboratories . The end - point of typing techniques will be sequencing a whole genome of a pathogen which has the highest discriminatory power . However, - as illustrated by the examples of molecular typing presented in this manuscript - for epidemiologic purposes for many diseases methods with lower discriminatory power are presently the gold - standard for public health purposes . Addressing emerging infectious diseases requires international and interdisciplinary partnerships to assemble an appropriate infrastructure to detect and respond to these threats to health . Sequence - based typing methods are offering new perspectives of enhanced resolution and comparability of typing systems for public health applications . As gene sequencing technology develops further and methods of sequence analysis become even more user - friendly, new typing methods will evolve and promote acceptance of routine molecular typing in public health laboratories even more.
The vast majority of mitochondrial genomes contain seven genes that form the membrane domain of complex i, which are labeled nd1 to nd6 plus nd4l (table 1). All these genes encode very hydrophobic subunits that are co - translationally inserted into the mitochondrial membrane with multiple transmembrane stretches (tms, table 1). In some green algae, however, nd3 and nd4l are not present in the mitochondrial genome but are instead encoded by nuclear dna, suggesting that these subunits may be imported into the mitochondria due to the reduced number of their tms compared with the other nd subunits (table 1). Plants also have an additional mitochondria - encoded subunit, nd7 . Except nd7, the nd proteins have homologous counterparts in bacterial complex i, but their nomenclature differs considerably in the bacteria for which structural information is now available . In table 1 we present the correspondence between the bacterial proteins and the mitochondrial nd subunits, with the human ones as reference for all organisms . Function insights in mitochondrial complex i have been previously obtained from the analysis of mutations in the nd genes that are associated with human diseases . Disruptive mutations in nd subunits, mostly affecting the assembly of complex i, are commonly found as somatic mutations in oncocytic tumors, but not as germline maternally inherited mutations associated with human diseases, because of their lethality . Instead, many missense mutations affecting conserved residues in nd subunits are causative of human diseases, ranging from mono - symptomatic pathologies, such as leber's hereditary optic neuropathy (lhon), to more severe and multi - systemic clinical phenotypes, such as mitochondrial encephalomyopathy, lactic acidosis and stroke - like syndrome (melas) and leigh syndrome . Thus, different clinical entities are most probably determined by variable degrees of complex i dysfunction . The best - studied pathogenic mutations are those associated with lhon, which map in the nd1, nd4 and nd6 subunits (table 1, see also bridges et al . ). They have been modeled to lie in conserved hydrophilic loops protruding at the matrix side of the mitochondrial membrane, in the nd1 and nd4 subunits, and in a highly conserved tms in the nd6 subunit . Because the equivalent loops of the bacterial homologs of nd proteins are not yet resolved in the crystal structures, it is hard to precisely locate these and other pathological mutations in the reported structure of bacterial complex i. however, the combination of modeling studies with current structural information suggests the presence of hotspots in complex i structure that may contain most of these pathogenic mutations . A major hotspot in the nd1 subunit would lie at the interface between the hydrophilic domain and the membrane domain of complex i, encompassing part of the large q binding pocket and the structural elements that can transmit redox - driven conformational changes to the proton - pumping subunits . Moreover, the great majority of the pathogenic mutations that affect the nd6 subunit lie within the second tms of the protein, suggesting a critical role of this region in complex i function . Primary and provisionally pathogenic mutations in the overlapping spectrum of lhon / melas / leigh syndrome have been found also in the nd5 and nd3 subunits . Conversely, the nd2 and nd4l subunits harbor only reported, not confirmed mutations (for the complete list of mtdna mutations, see the mitomap repository). Table 1 shows the number of confirmed and reported mutations for each nd subunit, as well as the pathogenic potential of the amino acid substitutions associated with reported mutations as assessed by the on - line tool polyphen-2, which predicts the possible impact of amino acid substitutions on the structure and function of human proteins . Nd1, nd4, nd5 and nd6 are most affected by pathogenic mutations (table 1), suggesting that these subunits form the functional core in the bioenergetic machinery mitochondrial complex i (figure 1). Nd3 and nd2 may also have a role in this machinery, because nd3 harbors confirmed pathogenic mutations and nd2 some potentially pathogenic mutations (table 1). However, we note that nd2 has the most divergent structure from its bacterial counterparts among all mitochondrial nd proteins . Consequently, nd2 is less conserved than the nd4 and nd5 proteins, despite sharing a similar helical core related to sodium / proton antiporters . Moreover, the nd2 subunit has been associated with extra - mitochondrial proteins as well . Considering this evidence, we propose an ancillary role for the nd2 subunit, even if current information cannot exclude its possible involvement in proton pumping . Pathogenic lhon mutations have been shown to alter the reaction with either the q substrate or the quinol product of complex i and decrease its binding to q - antagonist inhibitors, for example, rotenone . These functional effects have been reproduced by site - directed mutagenesis in the equivalent subunits of the bacterial complex . Consistent with these findings, the nd1, nd4 and nd5 subunits have been shown to bind analogs of various potent inhibitors, from rotenone to plant acetogenins and synthetic pesticides . Some subunits belonging to the hydrophilic domain of complex i also contribute to the binding of q and its antagonist inhibitors, in particular the psst and 49kd proteins (beef complex i nomenclature). Indeed, the available x - ray structures indicate that complex i contains a large cavity formed by the bacterial equivalents of mitochondrial 49kd and psst subunits, together with nd1 and the nd6-containing bundle in the hydrophobic domain of the complex . This structural evidence appears to be inconsistent with previous data, suggesting that the nd4 and nd5 subunits of mitochondrial complex i may bind q or its antagonist inhibitors such as fenpyroximate . Clearly, the contribution of at least four distinct subunits to the large q - binding pocket would be sufficient to account for the likely presence of reaction sites for the quinone substrate, its semiquinone intermediate and/or the quinol product . However, also the nd2 subunit has been reported to bind a q - antagonist, the acetogenin asimicin . Q binding and reduction at the interface between nd1 and the hydrophilic domain of the complex may thus produce large conformational changes that are mechanically transmitted along the plane of the membrane, progressively involving nd2, nd4 and nd5 . Fenperoxymate, asimicin, piericidin, rolliniastatins and related potent inhibitors may not only displace q, but also prevent the mechanical transmission of these redox - linked conformational changes, presumably due to their large energy of binding to the complex . Indeed, they have binding constants in the nanomolar range . Partial reduction and binding of potent inhibitors change the conformation of complex i and the mutual relationships of its subunits . However, in complex i the structural alterations induced by the above inhibitors may produce a profound structural disruption of the connection between q reduction and proton pumping . Hence, potent q - antagonist inhibitors functionally overlapping piericidin previously called type a - inhibitors, now including also fenperoxymate may physically act as spanners that block the mechanical transmission of redox - linked conformational changes to the proton - pumping subunits . The most potent inhibitors of mitochondrial complex i, such as the acetogenin rolliniastatin-1 and the antibiotic piericidin, inhibit more potently the proton - pumping activity than the redox activity of mitochondrial nadh - q reductase (table 2). Conversely, weak inhibitors like myxothiazol may not elicit equivalent structural changes, because they inhibit with comparable potency the redox and bioenergetic function of nadh: q reductase (table 2). Among the experimental facts that recent models for complex i can hardly explain is the variability in the bioenergetic efficiency of nadh: q reductase catalysis . Although the general consensus assigns a stoichiometry of four protons per nadh oxidized or ubiquinol produced (without counting the two scalar protons required for quinol formation), the stoichiometry, which can be experimentally measured varies considerably depending on the q substrate used . Although hydrophobic quinones like decyl - q elicit bioenergetic reactions equivalent to those of endogenous q-10, hydrophilic q analogs such as q-0 induce little proton pumping in their rotenone - sensitive reaction with complex i. in the q tail there appears to be a very narrow chemical threshold for inducing the shift from the half - efficient to the fully - efficient capacity of proton pumping . These differences cannot be due to mere partition effects in the membrane or interaction with redox groups in the hydrophilic domain of the complex, because the measured reactions remained sensitive to q - antagonist inhibitors . Direct coupling mechanisms (e.g., ohnishi et al . ; treberg and brand), as well as the two - stroke' mechanism proposed by brandt while this work was in progress, can hardly explain the narrow chemical threshold found in the proton - pumping efficiency of complex i. the recent structure of thermus complex i shows a cavity that can easily accommodate at least one isoprenoid unit in the hydrophobic tail of q, even if a q molecule was not visible in the x - ray images . This q - reacting cavity is embedded in a region that is exposed beyond the limit of the lipid membrane, protruding at its matrix (negative) side . There, bound q would be at a sufficient distance from the closest redox group of the hydrophilic arm, iron sulfur cluster n2, to allow rapid electron transfer yielding the semiquinone and quinol products . A recently proposed mechanism considers the known ph - dependence of n2 oxido reduction as a vehicle for proton uptake at the matrix side of the membrane, in a way that leads to full translocation of the same (and at least another) proton to the opposite side of the membrane . This uptake of a proton at the n2-q junction might compensate for the partial counter - charge separation due to electron transfer between n2 and bound q, leaving a net charge separation of approximately one - half negative inside, that is, equivalent to that observed experimentally . However, at the moment it appears totally conjectural how a proton taken up by n2 in the matrix then ends up at the opposite side of the membrane, from which bound q would be separated by no less than 4 nm . The same structural evidence does not support the presence of a semiquinone - gated proton pump associated with q reduction by complex i. hence, we find our similar proposal of semiquinone - gated pumps to be clearly untenable . Here, we provide a new way to envisage how complex i works, which leaves aside any similarity with other q - reacting enzymes . Our proposed model flips upside down the structure of complex i, as recently shown in treberg and brand, to make it resemble a gun (figure 1). The shape similarity, although accidental, has suggested us a functional analogy with the mechanism of shotguns . The mechanism of semi - automatic shotguns relies on two essential devices (figure 1, top right): a long spring that drives the recoil action of the barrel and a short spring that is located in the back of the firing chamber and transfers its inertial momentum to the bolt via a lever system connected to the long spring . Spring - loaded conformational changes have been previously proposed for viral agglutinins with membrane fusion capacity, which extend the length of amphipatic helices in response to a lower ph . The structure of bacterial complex i shows a very long helix, helix hl, that runs parallel to the membrane plane spanning most of the hydrophobic domain, with a central interruption . A similar long helix is present in the mitochondrial complex i and apparently also in its plastidial homolog . The long helix hl has been proposed to act as a piston or rod driving the proton - pumping action of the antiporter - like subunits of complex i. we consider instead that this hl helix may store energy in a spring - loaded fashion as viral agglutinins and is therefore analogous to the long spring exploiting the recoil of semi - automatic shotguns . Expanding the analogy further, one or more of the tilted helixes observed at the rear of the q cavity in the bacterial complex may function as the short spring transferring inertia to a shotgun bolt . These helices belong to the bacterial subunit corresponding to nd1, the protein most consistently associated with the binding of q and its inhibitors in the mitochondrial complex i. of note, the elastic capacity of tilted helices has been already described . In mammalian mitochondria, it is entirely possible that additional subunits of both the hydrophobic and the hydrophilic domain may contribute to this proposed spring - loaded mechanism and its fine regulation . In a final step of the analogy with shotguns, we propose that the formation of the ubiquinol product acts as a sort of trigger for firing' protons outside mitochondria, first directly and then automatically . The free energy associated with the second electron transferred from the iron sulfur clusters of the hydrophilic domain to bound q would explosively drive the forward movement of the bolt', thus firing' the proton - pumping activity of the distal membrane subunits . It will also be partially converted into mechanical energy, via conformational changes that compress the long hl helix along the membrane plane . In the subsequent recoil of the hl helix, protons could be taken up from the matrix side by the de - protonated pumps, while an additional q substrate could be inserted in the reaction pocket, aided by the sliding movement of membrane elements associated with hl helix recoil . Notably, the energy released by the mechanical relaxation of the same hl helix would then arm' again the spring and bolt device via conformational changes transmitted by inter - connected parts of the nd6 and nd1 subunits (figure 1b, step 3). The process would link the sliding movement of the long helical spring (c - terminal part of helix hl) to an elastic compression of the short spring, whose relaxation will then push forward the bolt' again, leading to an automatic firing of the protons previously inserted in the pumps . Hence, two functional proton pumps would be sufficient to produce the maximal stoichiometry of proton translocation by complex i, because they would automatically fire twice with a single release of the product ubiquinol . Although nd4 and nd5 are postulated to form the proton pumps in complex i (figure 1 and supplementary movie 1), it is possible that the nd2 subunit provides backup reinforcement for the automatic firing of protons . The basic feature of the new shotgun model for complex i (figure 1 and supplementary movie 1) is that it eliminates the requirement of semiquinone - linked pumps or other devices of direct coupling, which do not seem to be compatible with the structural information available for bacterial complex i. our model implies that most of the bioenergetic function of complex i resides in the proton - pumping subunits nd4 and nd5 . These proteins can fire protons outside in two automatic rounds per every quinol produced, via a mechanism provided by spring - loaded helical structures intimately inter - locked within the hydrophobic domain of the complex, dynamically connecting proximal q reduction to distal proton pumping (figure 1). Additionally, the present model provides a new explanation for the following pieces of evidence: the involvement of the distal subunits nd5, nd4 and also the nd2 homolog of bacteria in the binding of potent q antagonist inhibitors such as plant acetogenins, even if these subunits are far away from the q - reacting pocket in the complex . The potent inhibitors may physically disrupt the long distance connections between distal proton pumping and proximal q reduction at different points of the hydrophobic domain of the complex.the increased potency of potent type a inhibitors for the proton - pumping activity of nadh: q reductase (table 2), similarly to the action of amiloride - like inhibitors of the antiporter activity of the complex . By disrupting key conformational changes, these inhibitors also block the re - loading of the q substrate into its reaction pocket, thereby jamming the spring - loaded action of proton pumping.the charge separation that occur upstream of the rotenone site . Besides the redox - linked protonation of the n2 cluster, it may derive from the spring - loading of nd4 and nd5 with matrix - derived protons during recoiling.the q - dependent variability in the bioenergetic efficiency of complex i. hydrophilic q analogs would be unable to enter the membrane sliding process driven by the hl helix that re - loads the empty q reacting chamber therefore, they can elicit only a single firing of protons by the complex.that most of the energy of q reduction seems to be released with the second electron forming the quinol product . Indeed, quinol formation would act as the trigger for firing protons outside the membrane.the concentration of pathological mutations in hotspots is contributed by multiple nd subunits . A central hotspot is proposed to lie in the intricate part of the complex that connects q reduction with distal proton pumping (figure 1). Multiple points of attrition are likely to be present in such a delicate part of the functional mechanism and pathogenic mutations in the nd proteins may stress these points, then affecting the whole bioenergetic capacity of the complex . The involvement of the distal subunits nd5, nd4 and also the nd2 homolog of bacteria in the binding of potent q antagonist inhibitors such as plant acetogenins, even if these subunits are far away from the q - reacting pocket in the complex . The potent inhibitors may physically disrupt the long distance connections between distal proton pumping and proximal q reduction at different points of the hydrophobic domain of the complex . The increased potency of potent type a inhibitors for the proton - pumping activity of nadh: q reductase (table 2), similarly to the action of amiloride - like inhibitors of the antiporter activity of the complex . By disrupting key conformational changes, these inhibitors also block the re - loading of the q substrate into its reaction pocket, thereby jamming the spring - loaded action of proton pumping . The charge separation that occur upstream of the rotenone site . Besides the redox - linked protonation of the n2 cluster, it may derive from the spring - loading of nd4 and nd5 with matrix - derived protons during recoiling . The q - dependent variability in the bioenergetic efficiency of complex i. hydrophilic q analogs would be unable to enter the membrane sliding process driven by the hl helix that re - loads the empty q reacting chamber therefore, they can elicit only a single firing of protons by the complex . That most of the energy of q reduction seems to be released with the second electron forming the quinol product . Indeed, quinol formation would act as the trigger for firing protons outside the membrane . A central hotspot is proposed to lie in the intricate part of the complex that connects q reduction with distal proton pumping (figure 1). Multiple points of attrition are likely to be present in such a delicate part of the functional mechanism and pathogenic mutations in the nd proteins may stress these points, then affecting the whole bioenergetic capacity of the complex . Other models proposed to date do not seem to account for all the above pieces of evidence . However, this hypothesis is just a new view of assembling together recent structural information for bacterial complex i with previous evidence accumulated for mitochondrial complex i and render it attractive to the cell death field . Clearly, the model and its postulates (figure 1) are open to intellectual and experimental challenges, in the perspective of improving even further the understanding of one of the most complex enzymes in nature and its frequent involvement in disease.
Cryptorchidism (undescended testis) is the most common congenital malformation in newborn boys, occurring in approximately 3% of full - term infants . In most cases, the undescended testes seen after birth descend normally within a few months, and only 1% of patients with a persisting cryptorchid condition require medical or surgical treatment . It is well known that undescended testes, if untreated, lead to an increased risk of testicular malignancy, usually seminomas that arise from mutant germ cells . Urry et al . Reported that azoospermia was evident in 13% of patients with unilateral cryptorchidism; this rate increases to 89% in untreated bilateral cryptorchid patients . Intratubular germ cell neoplasia (itgcn) is the most common precursor of testicular malignancy . Dieckmann and skakkebaek reported that approximately 50% of patients with itgcn will develop an invasive testicular germ cell tumor within five years, and pourkeramati et al . Found that 23.08% of infertile men with intra - abdominal testis had itgcn based on examinations of orchiectomy specimens furthermore, the incidence of itgcn has markedly increased over the past decade, and hence, it is essential that it is promptly and accurately diagnosed in patients with cryptorchidism . In the present retrospective study, we aimed to determine the incidence of itcgn in postpubertal cryptorchidism, and the usefulness of immunohistochemical staining in its diagnosis . In addition, we analyzed the degree of spermatogenesis to evaluate the fertility of these patients . Between january 2002 and august 2012, we performed orchiectomy in 31 postpubertal patients (aged 12 years or over) with unilateral cryptorchidism after counseling them about the risk of malignancy, androgenic dysfunction, and male infertility . Cryptorchidism was defined as a condition where testis that was not descended into the scrotum . This study was approved by the institutional review board of yonsei university wonju college of medicine (ywmr-12 - 0 - 027). One pathologist (m.e .) Reviewed all the slides to confirm the pathologic diagnosis . The specimens were evaluated for itgcn using immunohistochemical staining with antibodies against placental - like alkaline phosphatase (plap) and oct 3/4, as it is difficult to recognize itgcn based on hematoxylin - eosin (h&e) staining alone . Malignancy was defined cytologically as the presence of atypical germ cells that showed a significant increase in size, were clearly pleomorphic, had hyperchromatic nuclei, and were arranged in layers attached to the basal tubular membrane . None of the cases involved infiltration of the interstitium or showed signs of inflammatory lymphocytic infiltration . To confirm the diagnosis of itgcn, sections from the testis were stained with oct 3/4 and plap antibodies . In order to assess fertility, this involved assessing 100 tubules and recording their heterogeneity by grading them between one and ten using the most advanced germ cell contained in the tubule . A key assumption is that the progressive degeneration of the tubule invariably features the loss of constituent cells in a defined order beginning with the most mature (spermatozoa), followed by the spermatogonia, and then the sertoli cells . All tubules were classed from ten (normal) to one (no germ or sertoli cells), with the midpoint on the scale represented by tubules that contained spermatocytes as the most advanced cell type . The mean patient age at the time of surgery was 34 years (range, 17 - 74 years). The majority of the patients (21 of 31) presented with an empty scrotum, and the undescended testis was found on subsequent examination . Abdominal cryptorchidism was present in four patients, while inguinal retention was found in 27 patients . One patient (3.2%), a 20-year - old man with abdominal cryptorchidism, was confirmed to have itgcn based on immunohistochemical nuclear staining for plap and oct3/4 in the surgical specimen (fig . Histological assessment of spermatogenesis revealed that the mean johnsen score was 3.42 (range, 1 - 9). The most frequent (12 of 31 patients) johnsen score was 2 (no germ cells present). The majority of patients (27 of 31) presented with impaired spermatogenesis with a johnsen score of <5 (no spermatozoa or spermatids, but many spermatocytes present). There were two patients each with a johnsen score of 6 (only a few spermatids present) and 9 (many spermatozoa present but the spermatogenesis is disorganized). Several putative risk factors for testicular malignancy have been identified, although there is generally only limited evidence to support their prognostic value . Concluded that cryptorchidism is the most widely accepted risk factor for testicular cancer, and is associated with a relative risk of between 3.7 and 7.5 times that among the general population . Granados loarca and esau ortega reported that one of the 25 (4%) postpubertal undescended testis patients they assessed had seminoma, and similarly, ben jeddou et al . Found that two of 81 patients aged> 14 years with undescended testis had malignant disease . In the present study, one of the 34 men with untreated postpubertal undescended testis was diagnosed as having itgcn . Interestingly, the overall incidence of itgcn in intersex states was found to be higher than in the normal group (6%, six of 102 cases), and was significantly higher in the pubertal age group . It is important to elucidate the frequency with which itgcn occurs to appropriately monitor the at - risk groups . Periodic testicular self - examination, close follow - up by the physician, and periodic testicular ultrasound are mandatory . Subtle changes in internal testicular architecture, even in the absence of suspicious palpable findings, may warrant a biopsy . (we attempted to contact the patient who was confirmed to have itgcn to perform physical exam and check paternity but failed .) Several immunohistochemical markers have been used to identify malignant germ cells in adult cases of itgcn, the most common of which include plap and oct 3/4 . On the basis of multiple findings, it has been hypothesized that itgcn originates early during fetal development . This is illustrated by the presence of a number of markers common to itgcn and immature germ cells, including plap and oct 3/4 . Plap shows membranous positivity in 90%-100% of seminomas, and oct 4 shows uniform nuclear staining in all seminomas . Given the risk of itgcn or malignancy in postpubertal undescended testis, immunohistochemical staining for plap and oct 3/4 was recommended as part of the diagnostic process, and preventive orchiectomy might be needed after informing patients of the consequences of testicular preservation and the likelihood of their removal in the therapeutic process . In other studies, immunohistochemical study underwent in cases with germ cells did not show itgcn on routine h&e staining . However, in our study, every specimens were evaluated for itgcn using immunohistochemical staining for plap and oct 3/4, along with routine h&e staining . Ford et al . Reported that spermatogenesis is severely impaired in persistently undescended testis . Pryor et al . Found itgcn in testicular biopsies with low johnson's criteria scores and atrophic germinal epitheliums, and other studies have also shown that itgcn and invasive testicular tumors occur at a high incidence in patients with undescended testis, which are characterized by atrophic germinal epitheliums . In our study, the specimen that was positive for the germ cell tumor markers also showed a low johnsen score, which is consistent with these other studies . Oct 3/4 and plap have a high sensitivity and specificity for diagnosing itgcn in adults . However, these proteins are present in a very high proportion of germ cells in the testis of normal neonates and young infants with cryptorchidism . The presence of these markers is generally related to the early stages of fetal germ cell maturation that normally proceeds in the neonate, but requires a longer period in cryptorchid testes due to delayed maturation . Therefore, in contrast to the situation in adolescents and adults, these markers can be unreliable for the detection of itgcn in very young children, and thus, care is needed when interpreting the results of oct 3/4 and plap immunohistochemical staining in these patients . First, it was retrospective in nature and was based on a review of medical records . Second, there may have been a selection bias, because only patients in a single center were enrolled . Third, paternity was not investigated, and therefore, we could only use the johnsen score to assess fertility . We suggest that preventive orchiectomy should be performed in cases of postpubertal cryptorchidism because of its malignant potential and subsequent risk of infertility in some patients . Before performing preventive orchiectomy, we should discuss the possibility of androgenic dysfunction and male infertility with the patient . After surgery, the pathologist should perform immunohistochemical staining for plap and oct 3/4, which are frequently expressed in testicular malignancy, because itgcn may be overlooked when using h&e staining alone.
Completion of a pregnancy invokes two potentially opposing effects on the mother s subsequent risk of breast cancer, hence the dual effect of pregnancy . Most familiar in breast cancer risk tables is the association of parity with a lifetime reduction in breast cancer risk . However, studies of breast cancer incidence in young women demonstrate a clinically under - recognized transient increase in breast cancer risk in the years immediately following pregnancy where all parous women, regardless of age, have higher incidence of breast cancer compared with nulliparous women [14]. This increase in risk has been shown to persist for at least ten [2, 3] and up to 15 years after birth in women under age 25 at delivery . Unfortunately, delayed childbearing further increases this transient risk for subsequent breast cancer, with maternal age greater than 30 at first birth resulting in both an elevation of the peak incidence in the initial years post - partum and a longer tail effect of increased risk persisting for 3050 years post - partum [15]. Evolving epidemiologic research demonstrates differences in incidence risk during this post - partum transient peak, dependent upon which additional variables are analyzed . In addition to maternal age, total number of pregnancies and family history are important contributors to the risk effect of pregnancy on breast cancer incidence . In one study of uni - parous women, the transient increase in risk peaked at 5 years after first delivery and leveled off 15 years after delivery . Women who were bi - parous, regardless of age at second birth, had a lower magnitude of transient increase in risk that also peaked earlier, at 3 years post - partum . This alteration in risk profile is possibly due to an overlap, or stacking, of effects conferred by their first pregnancy . The transient increase in breast cancer incidence following childbirth is worsened by a concomitant family history of breast cancer . Moreover women 30 years of age or older at first birth with a family history have a three - fold increased risk over those with no family history, and this risk persists longer, for 2030 years post - partum [5, 6]. Furthermore, women with germline mutations in the breast cancer susceptibility genes brca1 or brca2 experience a similar transient increase in breast cancer incidence compared to their high risk, nulliparous controls [7, 8]. Though the initial effect of any completed pregnancy on breast cancer incidence is an increased risk, a cross - over to a long - term protection occurs for women of younger maternal age at first birth, which has been referred to as the cross - over effect . Uni - parous women who complete their first pregnancy before age 25 still experience a transient increase in risk, however they are subsequently rewarded with a lifetime risk reduction of 36% for developing breast cancer . Likewise, increasing parity also confers long term risk reduction, decreasing a women s lifetime risk of developing breast cancer by 7.0% for each additional birth . Age and parity appear to act synergistically with high parity [5] and young age [20] at first birth associated with the greatest ultimate reduction in lifetime breast cancer risk . This protective effect is weakened among multiparous women if their age at first birth is greater than 30 . A family history of breast cancer lowers but does not negate the overall lifetime protective effect with increasing parity . Reduction in lifetime risk for breast cancer with any degree of parity has been variably reported for brca1 and brca2 mutation carriers [1214]. (table 1) table 1lifetime breast cancer risk associated with age at first pregnancy.risk separated by age (median)agegeneral population [1, 2, 18, 20]family history brca1 mut carriers brca2 mut carriers nullip12.71.962.85<201.060.5311202412.11.081.7425301.112.11.081.48>301.192.1940.834.77risk was set to 1 as reference and varies between studies, family member diagnosed before age 50, represented as a range since some studies reported> 30 and others> 35 . Risk was set to 1 as reference and varies between studies, family member diagnosed before age 50, represented as a range since some studies reported> 30 and others> 35 . Conversely, advanced maternal age at first birth nearly abrogates the lifetime breast cancer protection as first pregnancy above age 35 results in loss or significant delay in the cross over effect [15, 16]. These studies note a tail effect of increased risk for up to 50 years post - partum [4, 17], well into the decades of life when breast cancer is commonly diagnosed . Thus, for these women, the delayed protective effect of pregnancy against breast cancer will not occur in an average lifetime . Research such as the shanghai breast cancer study demonstrates how cultural shifts in countries with low incidence of breast cancer and historically young onset of childbearing to more advanced maternal age are also noting an increase in breast cancer incidence . Overall each year of increased maternal age at first birth results in an estimated 3.5%5.3% increase in lifetime relative risk for breast cancer [19, 20]. In terms of lifetime breast cancer risk, the age of 35 years acts as a critical point; prior to this age full - term pregnancy offers women some degree of protection, but after this age full - term pregnancy is associated with a permanent increase in breast cancer risk . At present, several conclusions can be drawn from the available epidemiologic data on the impact of pregnancy with breast cancer incidence . All women who complete a pregnancy are in a transient period of moderate increased breast cancer risk compared to their nulliparous peers . The degree of increased risk is akin to other routine breast cancer risk factors, such as early menarche and number of first degree relatives affected before age 50 . However, the risks related to pregnancy history are not currently incorporated into clinical tools for assessing a woman s risk for the development of breast cancer . Greater understanding of this transient increase is needed for subsequent adaptation into clinical breast cancer risk assessment . Moreover, attention to this breast cancer risk factor is warranted in the assessment of young women presenting with breast complaints in the post - partum years and consideration of such risk along with the clinical guidelines for evaluation of such complaints is required to avoid false reassurance or delayed diagnosis . There are several possible and likely intertwined hypotheses as to underlying mechanisms driving the dual effect . The transient increase in breast cancer risk experienced by all parous women appears to be due to an event or events associated with pregnancy . Candidate contributors to the increased incidence include: pregnancy - related hormones such as estrogen, progesterone, and growth hormone that promote previously initiated cells, immune suppressive effects of pregnancy, and the post - partum involution process [17, 21, 22]. Research on the role of pregnancy related hormones has shown that increased exposure to estrogen, progesterone, and insulin like growth factor 1 (igf-1), that is increased in pregnancy in response to growth hormone, are associated with promotion of breast cancer cell proliferation . Therefore, it is possible that the transient increased risk for breast cancer observed with a recent pregnancy is due to the significant increase in concentrations of these hormones during pregnancy, resulting in high - level exposures and subsequent tumor initiation and/or promotion . Alternatively, we and others have reported on an event inherently related to pregnancy that may contribute to growth and development of breast cancer cells . Involution mimics aspects of wound healing and immunosuppression, which are both known to be pro - tumorigenic . We hypothesize that the tissue microenvironment of involution, with its associated immune cell influx, activated fibroblasts, extracellular matrix (ecm) deposition, elevated matrix metalloproteinase levels and bioactive matrix fragments resembles a pro - tumorigenic wounding environment, and may be responsible for the increased incidence and/or poor prognosis of breast cancer with recent pregnancy [17, 23]. There are several hypotheses put forth to explain the biological processes responsible for why young women experience the benefit of the cross - over effect significantly more than older first time mothers . First, full term pregnancy induces terminal differentiation of the mammary gland, which is thought to render the gland less susceptible to tumorigenesis [2426]. Young mothers receive benefit due to the shorter exposure time between puberty and full term pregnancy, the window of peak susceptibility [26, 27]. Conversely, the persistent risk for advanced maternal age is believed to be due to increased exposure time of breast tissue to potential mutagens before the terminal differentiation of the gland by pregnancy . This belief is backed up by evidence that any interval of> 16 years between menarche and first birth, regardless of the specific ages when those events occurred, results in an increased risk for breast cancer . Thus, in older first time mothers, there is theoretically a greater chance for pre - malignant breast lesions to develop before a completed pregnancy occurs, which would be subsequently promoted either by the pregnancy or an event associated with that pregnancy, such as post - partum gland involution . Second, increasing parity overall reduces lifetime menstrual cycling which may impact lifelong breast cancer risk via reducing exposure to the cycling of hormones associated with both the luteal (progesterone and to a lesser extent estrogen) and follicular / ovulatory (estradiol) phases of menstruation [21, 22]. Finally, there is recent evidence in rodents suggesting that a decrease in mammary stem cells occurs with early parity . If one accepts the mammary tumor stem cell hypothesis, which proposes that stem cells in the mammary gland are the targets for transformation [2933], then a global reduction in the number of mammary gland stem cells would be anticipated to reduce a woman s lifetime risk . Further research is needed to delineate the mechanisms underpinning the dual effect and cross over effect of pregnancy on breast cancer . Objectives would be to define chemotherapeutics aimed at abrogation of the transient risk and enhancement of the protective effects of pregnancy . Hopeful results of this research would result in a reduction in diagnosis of pabc and young women s breast cancer overall . In contrast to the relatively robust body of data outlining the effects of pregnancy on breast cancer incidence, the distinct role that lactation contributes has been harder to isolate . Overall, lactation is attributed with a wide range of relative risk reductions, ranging from 4.364% in 89 reported studies to date [10, 34, 35]. Meta - analyses on these studies revealed multiple benefits, including that a protective effect was conferred by lactation with reductions in relative risk for pre - menopausal breast cancer as high as 64% . These studies demonstrate that a woman s relative risk can be decreased by 4.3% for every 12 months of lactation, and that any degree of lactation but particularly extended lactation can be protective . However, some of the studies examined in these meta - analyses revealed no correlation between lactation and reduction of a woman s risk for breast cancer [34, 35]. These epidemiologic studies on lactation are complicated, and potentially inconclusive, when viewed en masse due to issues that include inherently varying definitions of lactation, inability to control for potentially important cofounders such as body mass index (bmi), exclusivity of lactation, lifetime level versus per pregnancy exposure, and concomitant medications or medical conditions, to name a few . In addressing the overlapping epidemiologic effects of pregnancy and lactation, it can be postulated that for women at increased risk for breast cancer due to recent childbirth, post - partum lactation would mitigate this increase . One study of the effect of lactation on the transient increased risk of breast cancer in the 5 year interval from most recent child - birth showed that any duration of lactation conferred reduction against the peak increase in pabc risk . Specifically, within 5 years of parturition, absence of lactation conferred an overall risk of 1.64, while presence of lactation reduced this risk to 1.24 . The trend continued but the effect was reduced by 510 years post - partum . After 10 years post - partum the effect was lost, indicating that the protective effect of lactation is most noted on the transient post - partum period of increased risk for developing breast cancer and limited to nil on lifetime risk of breast cancer . Women with germline mutations in brca1 and brca2 do not as clearly benefit from lactation [12, 37]. One potential confounder of this data is the grouping of brca1 and brca2 mutation carriers as one, given that independent assessment of brca1 mutation carriers demonstrated a 4450% reduction in risk for breast cancer observed with lactation duration> 1 year, a greater risk reduction than observed in some studies of the general population [38, 39]. Several hypotheses could explain the protective effect of lactation on transient and overall breast cancer risk . First, similar to pregnancy, lactation promotes terminal differentiation of mammary epithelial cells, potentially rendering them less susceptible to carcinogenic stimuli . This hypothesis is supported by data indicating that very early age at first breastfeeding, <20 years is protective beyond that afforded by maternal age at first pregnancy alone [4042]. Second, length of lactation further decreases a woman s lifetime exposure to cycling hormones over pregnancy alone by further suppression of ovulation . An intriguing aspect to this hypothesis comes from the data on women with brca1 mutations, where lengthy lactation conferred large benefit . Given the overwhelming propensity for brca1 carriers to have hormone receptor negative tumors, the data suggests that another ovarian axis - driven mechanism besides stimulation of tumor cells accounts for the protection afforded by lactation . The known protection from breast cancer observed in brca1 carriers through prophylactic oophorectomy, which results in a 5660% decrease for development of breast cancer, supports this possibility [39, 43, 44]. Third, in a recently developed mouse model with a precocious lactogenic phenotype, knock - out of caveolin 3 renders the mice resistant to mammary tumor formation induced by orthotopic tumor cell implantation into the mammary gland [45, 46]. One may also postulate that the prolongation of time between two tumor promoting events, pregnancy and involution, by increased length of lactation lessens the chances of these two events acting synergistically to promote progression of previously initiated cells . Lastly, in the case of longer lactation that may naturally dwindle with maturity of the child, could a gradual decrease in lactational pull invoke a less robust involution program than that induced with abrupt cessation? In summary, lactation may provide a reduction in a woman s transient risk and lifetime chance for developing pre - menopausal breast cancer, with varying degrees of evidence currently available . Interestingly, it has been reported that the united states has a low proportion, only 50%, of parous women who have ever breast fed . From these data, it is possible to hypothesize that any measure instituted to promote breastfeeding practices could also be considered a potential breast cancer prevention strategy . Breast cancer is the leading cause of cancer death in us women age 1529 . In 2005, the us alone was estimated to have 11,110 breast cancer cases identified in women under 40 with a concomitant 1,110 deaths . Statistics from similar countries world - wide show near identical rates of incidence and death in young women due to breast cancer moreover, despite the recent reduction in total incidence of breast cancer, mostly attributable to women over age 50, the annual incidence in the under 40 age range is not decreasing and the absolute number of affected women herein is increasing [49, 50]. Regardless of how one chooses to draw the upper limit of age for young women s breast cancer, this population reflects the dominant child - bearing portion of humanity . In 2005, the us reported nearly 5,000 cases of breast cancer diagnosed during pregnancy, making it the second most common co - diagnosed cancer emerging epidemiologic and prospective research is providing enhanced insight into this subset of young women s breast cancer, allowing it to progress as an important focus for goals of prevention, therapeutics, and survivorship interventions in the future . When breast cancer is diagnosed concomitantly with pregnancy and is treated with definitive intent to both satisfactorily offer disease control and maintain the pregnancy, long terms outcomes appear equivalent based on age - matched, stage - matched non - pregnant controls [52, 53]. Guidelines on the acceptable management of breast cancer during pregnancy have been published and long - term outcomes in both the treated mothers and their co - treated offspring are favorable . These observations support the ongoing effort to offer pregnancy preservation in the setting of breast cancer therapy when stage of disease at presentation and desires of the patient and involved parties for the child are compatible . Identified issues that complicate breast cancer diagnosis during pregnancy include delay in diagnosis and subsequent trend toward later stage, including higher incidence of nodal involvement [55, 56]. Differences as high as an average delay of 57 months and 2.5 fold risk of advanced disease have been reported [5558]. Likewise, enrichment for negative biologic features that worsen prognosis, including higher grade, lower percentage of hormone - receptor positivity, increased her 2 neu over - expression, and higher ki-67 nuclear antigen indices are present [5961]. However, if pregnancy alone is an isolated variable with cases matched by stage, age, and year of diagnosis then the diagnosis of breast cancer during pregnancy is not associated with poorer maternal outcome than non - pabc cases [17, 55, 56, 58, 6265]. Importantly, while some published studies that included women diagnosed during pregnancy have indicated worse maternal outcomes for pabc, these studies either did not match specifically on the known biologic drivers of metastasis and/or included women who were post - partum but lactating or within 1 year of parturition as cases in the same group as women diagnosed when pregnant [6668]. A recent prospective french study of 40 pabc cases, where pabc was defined as breast cancer occurring during pregnancy or 1 year after delivery, noted overall survival rates of 72% for pabc versus 97% for age - matched controls this study provides an excellent detailed review of pabc cases, both those diagnosed during pregnancy versus post - partum compared with age matched controls . Overall, the difference in outcomes between groups (combined as both during pregnancy and post - partum) could be correlated with the pregnant pabc cases being enriched for high grade tumors and both pabc subsets enriched for hormone - receptor poor tumors . Likewise, though the mean gestation age at diagnosis was 22 weeks, only three cases received chemotherapy during pregnancy versus 31 post - partum cases, suggesting that a delay of chemotherapy initiation due to pregnancy may be present, and may confound interpretations . The authors also acknowledge that differences in anti - endocrine therapy were present, and both issues may occlude disease - specific outcomes against the combined pabc cases [69, 70]. These biologic and therapeutic differences do not permit pregnancy to sort out as an independent poor - prognostic factor . Categorizing breast cancer according to current identifiable biologic subgroups based on er, pr, her 2 status, and tumor grade remains important for delineation of specific pregnancy effects on cancer outcomes and will hopefully provide rational clinical guidance to the co - management of the breast cancer and pregnancy . A caveat to this approach when taken in isolation, those cases pregnant at diagnosis in the french study and other larger retrospective reviews faired similarly to reports defining cases as solely pregnant at diagnosis and it appears the post - partum cases drove the worsened outcomes for the overall group [6668]. Hence, we emphasize the distinction of two pabc subgroups with pabc diagnosed during pregnancy more similar to non - pabc when overall outcomes are considered . The unfortunate delay of diagnosis and poorer prognostic disease excellently documented in these reviews of concomitant breast cancer with pregnancy [53, 59], highlights the need for attention to clinical breast exams and thorough evaluation of breast concerns in pregnancy . Converse to the above data, if one focuses on the reported cases of women who are diagnosed with breast cancer subsequently, but within temporal proximity of a completed pregnancy, increased metastasis and death due to breast cancer can be consistently identified, including across large global cohorts [6668, 7174]. This worsened prognosis remains independent when age, tumor stage, tumor biologic features, and even patient - related confounders of alcohol use, bmi, education, socioeconomic status, and race are included . The largest of these series from norway reports outcomes from 516 pregnant cases and 531 within 6 months post - partum at time of diagnosis from a cohort of 42,511 cancers . The highest percentages of death from cancer observed in this study was among cases within 6 months post - partum at 67% versus 44% in pregnant cases, and 31% in controls . The effect of worsened prognosis in the post - partum period appears to be time dependent and diminishes as increased time occurs between parturition and breast cancer diagnosis . In two large studies, the time frame of diagnosis <2 years after giving birth significantly increased hazard ratios for breast cancer death when compared with parturition 5 years prior to diagnosis or nulliparous women [72, 75]. In one of these studies, diagnosis within 12 months of parturition had the worst survival rate at 38%, whereas cases diagnosed 1348 months and> 48 months post - partum had survival rates of 51% and 60% compared with age - matched nulliparous women at 65% . Other factors controlled for included age at first birth, parity, and breastfeeding duration, indicting that a recent birth alone may be an adverse prognostic factor among young women diagnosed with breast cancer . Exactly when the effect of a recent birth recedes sufficiently to no longer impact risk of metastasis and death remains undefined . A 2008 study of 4,560 british women with breast cancer whose last pregnancy was more than 30 years ago had a 35% reduced risk of dying when compared with women who had a full - term pregnancy in the 15 years prior to diagnosis, indicating that the number of deaths complicated by pabc could extend as far as even 15 years after pregnancy . (table 2) table 2survival statistics for women diagnosed during pregnancy or post - partum.% survivalstudy: non - pabcpregnantpost - partummathelin et al 97%72%63%dodds et al 80%na6.513.6%stensheim et al 69%56%33%beadle et al 64.8%62.6%64.9%rodriguez et al 66.6%na61%daling et al 75.676.7%na51.8% (2 years)whiteman et al 65%na38% (<1 year)some cases may have been within 5 years post - partum, thus some cases are actually pabc, the authors define lactation period as the period from date of delivery to 6 months post - partum, therefore these cases are considered post - partum, this is a mix of reproductive states: 22% pregnant, 1% diagnosed at delivery, and 76% postpartum . Some cases may have been within 5 years post - partum, thus some cases are actually pabc, the authors define lactation period as the period from date of delivery to 6 months post - partum, therefore these cases are considered post - partum, this is a mix of reproductive states: 22% pregnant, 1% diagnosed at delivery, and 76% postpartum . Clarity of definition among the subsets of pabc is important if we are to discern metastatic potential of breast cancers diagnosed during pregnancy, lactation, or post - partum . A recent retrospective review of an impressive 668 cases of pabc (pregnant or within 1 year of pregnancy) in women age 35 or younger concluded that no significant differences in distant metastasis or overall survival were found compared with non - pabc . Two reasons for this disparate conclusion may reflect the author s choice of dichotomization between pregnant cases, post - partum cases, and controls; an issue that may also confound other studies [66, 71, 77]. Controls in this study were those cases which did not meet their definition of pabc, however, these controls would meet the definition defined by the majority of epidemiologic studies . We have reported that in women under age 40 at breast cancer diagnosis, 18% will meet the criteria of being within 2 years and 45% within 6 years of parturition . If the above cited references on the time frame of post - partum pabc are taken into consideration, many of the control cases from this recent report would potentially be better categorized as pabc and their inclusion may worsen the risk profile of this control group . A strength of this study is the authors excellent delineation of their study groups, including that 25/51 cases of breast cancer diagnosed during pregnancy had treatment delayed until post - partum . The tumors in these cases were persistent into the post - partum period and may be therefore more similar to cancers diagnosed within months of parturition, which have the worst prognosis of all sub - groups of pabc . Potentially transferring cases diagnosed during pregnancy, but untreated until post - partum to the post - partum grouping may alter the risk profile of the post - partum cases . However, and most importantly, these authors definitively report on the success that can be achieved by rationale and aggressive management of these high risk tumors in young mothers . Overall, the data on pabc support a varying alteration in risk of death from breast cancer for mothers dependent upon time of diagnosis relative to the pregnancy . We believe this supports the presence of distinct subsets of pabc based on biologic aggressiveness: those diagnosed and treated during pregnancy and those diagnosed or treatment delayed until the post - partum period . Conservatively, control or non - pabc groups may be best defined using nulliparous cases or cases greater than 10 years post - partum to mitigate against the uncertainty of when the effects of pabc become negligible to ensuing breast cancer prognosis . Likewise, the data demonstrates that pabc is not a rare event or niche of breast cancer, but a significant and deadly subset of the disease that may, in fact, be increasing due to cultural shifts regarding child - bearing choices . The canadian 2008 study predicted that an extra 1 in 13 women with less than 2 years between delivery and diagnosis will die from their disease compared to women with five or more years between delivery and diagnosis . If we apply these statistics to us birthrates from 2006, when 4.3 million women experienced live births, 25,000 of these women will be diagnosed with invasive breast cancer and 2,000 may die from their disease within 2 years of giving birth . If one accepts the data that breast cancer diagnosed during pregnancy, when stage and biology at diagnosis are taken into account, does not have a pregnancy - specific poorer prognosis, and that cases diagnosed within 5 years of parturition do have a pregnancy - related increased risk, then it can be proposed that an event associated with pregnancy, but not pregnancy itself, may facilitate breast cancer metastasis . We propose that this event is mammary gland involution . Retrospective evidence that supports this hypothesis is found in the association of increased metastatic potential with post - partum breast cancer cases . Involution is a developmentally - regulated process by which the fully differentiated milk - producing breast regresses to a pre - pregnant - like state . Involution occurs at weaning if lactation occurs or post - partum if lactation does not ensue . The scale and rapidity of involution is unique to the mammary gland, involving apoptotic cell death of 50%80% of the mammary epithelium, and entails a remodeling program that returns the gland to a quiescent state [81, 82]. Accumulating evidence indicates that mammary gland involution utilizes some of the same tissue - remodeling programs that are activated during wound healing and inflammation [83, 84]. These similarities include macrophage cell influx, elevated levels of the immunomodulators tgf beta 1 and 3, and matrix metalloproteinase (mmp)-2, -3, and -9, deposition of fibrillar collagen and the onco - fetal protein tenascin, and presence of bioactive proteolytic fragments of the extracellular matrix proteins fibronectin and laminin . These stromal attributes of wound healing / inflammation have been causally associated with tumor progression [17, 23, 85, 86] and may result in dissemination of tumor cells and metastasis . 1 integrins are required for re - epithelialization of a wound, and 1 integrin loss in human breast cancers results in tumor suppression . Tgf beta also promotes tumor growth indirectly through activation of the stroma, and its upregulation stimulates matrix deposition and proliferation of fibroblasts in the healing wound . Additionally, increased abundance of inflammatory cells is a hallmark of human cancers [90, 91] and pre - clinical models of breast cancer demonstrate that macrophages are required for tumor cell migration, invasion and metastasis . Angiogenesis and lymphangiogenesis, processes that require both mmp activity and deposition of collagen for formation of new vessels, are important steps in both wound healing and tumor progression [93, 94]. Finally, fibronectin is an important component of the early wound healing stroma and has been shown to be a component of the matrices of metastatic tumors as well . These examples highlight only some of the similarities that have been observed between wound healing and tumor progression . Thus, given that a wound healing microenvironment is tumor promotional, and the involution microenvironment is similar to that of wound healing, it can be predicted that involution would promote cancer . Rodent models of involution confirm increased metastasis of human breast cancer cells that have been exposed to the involution micro - environment . Moreover, wound healing and mastitis have been shown to increase breast cancer risk [97, 98] and other types of epithelial cancers are known to result from repetitive wounding and regeneration, further implicating the involution microenvironment in tumor promotion . Evidence that involution utilizes tissue remodeling programs reminiscent of wound healing has been obtained from rodent models, with relevance to women unknown . As evident in fig . 1 elevated proliferation and differentiation during pregnancy and lactation transform the rudimentary branching structure of the nulliparous gland into a florid milk - secreting organ (fig ., this abundance of proliferative and differentiated growth then transforms to a marked desmoplastic regressing environment, as the gland remodels to a rudimentary structure (fig . 1d, and data not shown). It is likely that this involution process will utilize a predictable wound healing / inflammatory cascade, such as that described in rodent models . In human tissue, we have found that it is common to observe fully lactational lobules adjacent to involuting lobules . The presence of both lactating and actively involuting lobules in the same tissue specimen permits the investigation of microenvironment changes that are specific to involution, and provides insight into the potential tumor promoting attributes of this period . As evident in fig . 2, immune cells appear to be specifically recruited to the involuting lobules, as they are much less abundant in the adjacent lactational lobules . This observation indicates that the microenvironment surrounding an involuting lobule is distinct from that of a lactational lobule, and provides compelling evidence that human breast involution utilizes wound healing programs to remodel after pregnancy . If a present malignancy is superimposed on such an inflammatory milieu, then the tumor could be promoted, resulting in increased metastases compared to a tumor that has not been exposed to the involution microenvironment . Human breast tissue sections collected from age - matched nulliparous (nullip) (a), pregnant (preg) (b), lactating (lac) (c), involuting (inv) (d), or fully regressed (regr) (e) (> 10 years post - partum) women and stained by h&e to reveal the complex and distinct morphology inherent to each developmental stage, 200. each image depicts the size of a single lobule representative of that developmental stage . Human tissue was acquired through a protocol approved by the colorado multi - institutional review board.fig . Immune cells as detected by ihc for common leukocyte antigen cd45 are stained brown in a breast biopsy from a woman who was actively involuting at the time of the biopsy, which revealed no malignancy (i.e. Normal tissue). Both lactating (lac) and involuting (inv) lobules are present and highlighted with dashed lines . Human breast tissue sections collected from age - matched nulliparous (nullip) (a), pregnant (preg) (b), lactating (lac) (c), involuting (inv) (d), or fully regressed (regr) (e) (> 10 years post - partum) women and stained by h&e to reveal the complex and distinct morphology inherent to each developmental stage, 200. each image depicts the size of a single lobule representative of that developmental stage . Human tissue was acquired through a protocol approved by the colorado multi - institutional review board . Immune cells as detected by ihc for common leukocyte antigen cd45 are stained brown in a breast biopsy from a woman who was actively involuting at the time of the biopsy, which revealed no malignancy (i.e. Normal tissue). Both lactating (lac) and in conclusion, while parity may reward women who give birth when they are younger than thirty - five with varying degrees of lifetime protection from breast cancer, it is also true that parous women will experience a transient increased period of risk for breast cancer immediately following any childbirth . This transient risk is further increased by older age at first birth, positive family history of breast cancer, and in women with germline mutations in breast cancer susceptibility genes . Of uncertain significance is the protective effect observed with lactation . When tumors are matched for known clinical features, women who are diagnosed with pabc during pregnancy experience outcomes similar to women diagnosed with non - pabc, indicating that pregnancy per se is not an independent risk factor for breast cancer . Conversely, women who are diagnosed with pabc in the post - partum period have a poorer prognosis that is independent of known prognostic factors . We believe a major difference between these groups is exposure of the tumor cells to the involution microenvironment, which has attributes of a wound . Women who are diagnosed during pregnancy and treated during pregnancy effectively eliminate the lesion that we propose will be promoted by the involution microenvironment if left in situ . Mechanisms underlying the distinct biology of pregnancy - associated tumors that are promoted by involution are currently being identified in human and rodent mammary tissues in our labs . Our ultimate goal is to target the involution period with intervention strategies that may help eliminate the increased metastatic potential of pabc.
The gingiva is often the site of localized growths that are considered to be reactive rather than neoplastic in nature . Many of these lesions are difficult to be identified clinically and can be identified as specific entity only on the basis of typical and consistent histomorphology . Pyogenic granuloma (pg) or granuloma pyogenicum is a well - known oral lesion . The name pyogenic granuloma (pg) is a misnomer since the condition is not associated with pus and does not represent a granuloma histologically . The majority remains small and lesions more than 1 cm in diameter are rare on the cheeks, tongue, and floor of the mouth possibly because masticatory trauma restricts their size through necrosis and ulceration . Pg is a benign lesion; therefore, surgical excision is the treatment of choice . To avoid the possibility of recurrence the lesion must be excised down to the underlying periosteum and predisposing irritant must be removed . A 30-year - old systemically healthy male patient presented with a chief complaint of growth in the mouth involving lower - left back teeth region of the jaw . The patient had noticed a small painless growth about few years back . There was a very gradual increase in size, which led to discomfort while eating as the extent of growth had reached the occlusal plane [figure 1] since 3 months . There was no history of intake of any hormonal supplements, but the patient was given antibiotics by some dentist for the same . Intraoral examination revealed a solitary diffused growth, pale bluish red in color, measuring around 21.5 cm seen in the interdental region in relation to the left first molar and second molar region that did not extend lingually [figure 1]. The superior surface of lesion showed indentation of the upper teeth as a result of surface ulceration . There was no mobility or pathological migration of any of the molars was not present . Abscess drainage with help of a periodontal probe the intraoral periapical radiograph of teeth 46 and 47 region revealed widening of the periodontal ligament space, marked interdental bone loss with change in the trabecular pattern of bone . Roots of the involved teeth did not show any signs of resorption [figure 3]. Intraoral periapical radiograph showing interdental bone loss and change in the trabecular pattern in between first and second molars blood examination revealed normal values . The treatment comprised of oral prophylaxis and surgical excision of the growth by gingivectomy procedure under local anesthesia . Although many treatment techniques have been described for pg, when it is large or occurs in a surgically difficult surgically area, choosing an appropriate treatment modality can be difficult . Excisional biopsy is indicated for the treatment of pg . Except when the procedure would produce marked deformity: in such a case, incisional biopsy is mandatory . Conservative surgical excision and removal of causative irritants (plaque, calculus, foreign materials, and source of trauma) are the usual treatments for gingival lesions . Here, local anesthesia 1: 80,000 given to the patient and abscess was drained with the help of the periodontal probe . In this case, pg was associated with periodontal abscess and bone loss, so interval bevel gingivectomy was performed . Periosteum reflected and exposed the underlying bone [figure 4]. Exposing the underlying bone after excision of growth after complete degranulation and scaling, root planning angular defect was filled with g - bone bone alloplast (defect filled with g - bone bone alloplast ten days later, periodontal pack and suture were removed and satisfactory healing of the gingiva was seen . Complete healing of the operated area was observed at 3 month follow - up visit [figure 6]. Complete healing after 3 months of operation radiograph also shows sign of bone fill after 3 months histopathological findings in the photomicrograph shows hematoxilin eosin - stained section showing the overlying epithelium had hyperplastic parakeratinized stratified squamous epithelium exhibiting areas of pseudoepitheliomatous hyperplasia [figure 8]. Highly vascular connective tissue exhibiting numerous small and large endothelium - lined channels engorged with red blood cells . Thickened wall of blood vessels, proliferating endothelial cells and few lymphatic vessels were evident . Mixed inflammatory cell infiltrate consisting predominantly of neutrophils and lymphocytes were also seen [figure 9]. Photomicrograph shows hyperplastic parakeratinized stratified squamous epithelium exhibiting areas of pseudoepitheliomatous hyperplasia photomicrograph showing endothelium lined channels, mixed inflammatory cell infiltrate consisting predominantly of neutrophils and lymphocytes although many treatment techniques have been described for pg, when it is large or occurs in a surgically difficult surgically area, choosing an appropriate treatment modality can be difficult . Excisional biopsy is indicated for the treatment of pg . Except when the procedure would produce marked deformity: in such a case, incisional biopsy is mandatory . Conservative surgical excision and removal of causative irritants (plaque, calculus, foreign materials, and source of trauma) are the usual treatments for gingival lesions . Here, local anesthesia 1: 80,000 given to the patient and abscess was drained with the help of the periodontal probe . In this case, pg was associated with periodontal abscess and bone loss, so interval bevel gingivectomy was performed . Periosteum reflected and exposed the underlying bone [figure 4]. Exposing the underlying bone after excision of growth after complete degranulation and scaling, root planning angular defect was filled with g - bone bone alloplast defect filled with g - bone bone alloplast ten days later, periodontal pack and suture were removed and satisfactory healing of the gingiva was seen . Complete healing of the operated area was observed at 3 month follow - up visit [figure 6]. Complete healing after 3 months of operation radiograph also shows sign of bone fill after 3 months histopathological findings in the photomicrograph shows hematoxilin eosin - stained section showing the overlying epithelium had hyperplastic parakeratinized stratified squamous epithelium exhibiting areas of pseudoepitheliomatous hyperplasia [figure 8]. Highly vascular connective tissue exhibiting numerous small and large endothelium - lined channels engorged with red blood cells . Thickened wall of blood vessels, proliferating endothelial cells and few lymphatic vessels were evident . Mixed inflammatory cell infiltrate consisting predominantly of neutrophils and lymphocytes were also seen [figure 9]. Photomicrograph shows hyperplastic parakeratinized stratified squamous epithelium exhibiting areas of pseudoepitheliomatous hyperplasia photomicrograph showing endothelium lined channels, mixed inflammatory cell infiltrate consisting predominantly of neutrophils and lymphocytes the incidence of pg has been describe between 28.8% to 32% of all reactive lesions . As reported by buchner et al . In study of 302 consecutive localized gingival outgrowths it was found pg occurred in all ages but mainly in youngsters . More in the third decade pg was thought to be a mitotic infection contracted from horses . It was claimed by inagi k (1991) without any scientific evidence that pg results from purulent change within benign oral tumors . Recently, angiogenesis - associated factors tie2, angiopoietin-1, angiopoietin-2, ephrin b2, and eph b4 have been detected in pg in immunohistochemistry . It is now generally accepted that the lesion is exaggerated localized connective tissue reaction to minor trauma or irritation . Other oral sites are the lower lip, tongue, buccal mucosa, upper lip, and palate . Gingival pg is more common in the maxilla than in the mandible and in the anterior region than in the posterior regions of both jaws . Gingival irritation as a result of calculus, overhanging edges or rough restorations might be the predisposing factor for the development of gingival pg . It is possible that microulceration from these irritants in an already inflamed gingiva allows the ingress into the gingival connective tissue of low virulent oral microflora . This evokes an exaggerated vascular hyperplastic response in the connective tissue resulting in the formation of pg . Pg is a common reactive lesion that generally develops rapidly, bleeds easily, and ulcerates causing the erroneous clinical impression of the malignant tumor . It is however a well - circumscribed benign soft tissue tumor of innammatory rather than the neoplastic nature arising from the connective tissue of the skin or mucous membrane . Clinically, pg is a smooth or lobulated exophytic lesion manifesting as small, red erythematous papules on a pedunculated or sometimes sessile base, which is usually hemorrhagic and compressible . Rarely pg exceeds 2.5 cm in size and it usually reaches its full size within weeks or months, remaining indefinitely thereafter . Clinical development of the lesion is slow, asymptomatic, and painless, but it may also grow rapidly . The surface is characteristically ulcerated and friable which may be covered by a yellow, fibrinous membrane and its color ranges from pink to red to purple, depending on the age of the lesion . Young pgs are highly vascular in appearance because they are composed predominantly of hyperplastic granulation tissue in which capillaries are prominent . Thus, minor trauma to the lesion may cause considerable bleeding, due to its pronounced vascularity, whereas older lesions tend to become more collagenized and pink . Differential diagnosis of pg includes parulis, peripheral giant cell granuloma, peripheral ossifying fibroma, hemangioma, peripheral fibroma, leiomyoma, hemangioendothelioma, hemangiopericytoma, bacillary angiomatosis, kaposis sarcoma, metastatic tumor, pregnancy tumor and post extraction granuloma . Numerous small and larger endothelium- lined channels are formed that are engorged with red blood cells . These vessels sometimes are organized in lobular aggregates and some pathologists require this lobular arrangement for the diagnosis (lobular capillary hemangioma). A mixed inflammatory cell infiltrate of neutrophils, plasma cells, and lymphocytes is evident . Neutrophils are more prevalent near the ulcerated surface; chronic inflammatory cells are found deeper in the specimen . Pg is a benign lesion; therefore, surgical excision is the treatment of choice . Other conventional surgical modalities for the treatment of pg reported is cryosurgery in form of either liquid nitrogen spray or a cryoprobe, which has been used for eradication of the lesion . It is a safe, easy, and inexpensive technique suited for out patient's clinic setting . Nd: yag and co2, and flash lamp pulsed dye lasers have also been used for the pg . Lasers have shown to be a successful option for the excision of pg with advantages of minimal pain and invasiveness and the lack of need for suturing or packing.
Concerns have been raised that general deveopments may not necessarily reduce such inequalities and therefore regular data monitoring is required . A key challenge for equality evaluation and monitoring, mainly in developing countries, is assessing the socioeconomic status (ses). Measuring household economic status in developing countries data on two frequently used indicators of wealth, household income and expenditure levels, are often unavailable or unreliable . Moreover, in countries where a large part of the population works in self - subsistence agriculture of the informal sector, expressing income or expenditure levels in monetary values can be extremely time - consuming and suffers important reliability problems . In this setting, the assets that households have acquired are a good indicator of their long - run economic status . The world bank has developed a tool to measure the relative economic position of households using data on durable consumer goods, housing quality, water and sanitary facilities and other amenities . These assets are combined into an index of economic status using principal component analysis (pca). The pca method has been shown to provide a measure of economic status that has a higher predictive value, than other proxies such as an index based on the value of goods owned, or occupation . The limitation of existing asset indicators is that they often comprise many assets and therefore it is impractical to add them to the already lengthy health study questionnaires, or to administer them in facilities where patients may be in life - threatening conditions or when resources to administer ses measurements are limited . Therefore, we sought to develop and validate a tool with a limited number of indicators to allow easy and quick administration . We also aimed to develop a pragmatic tool that can be rapidly used to calculate a score in the field . The national statistical office (nso) of iran provides each year an estimate of the national demographic characteristics, annual income, annual consumption expenditure, ownership of assets and housing quality . The living standards measurement study (lsms) data is obtained using each year a survey of about 27,000 nationally representative households (14,000 rural and 13,000: urban) from 28 provinces, sampled proportional to the size of the province population . We used the dataset of year 2006 for our analyses . In the dataset of nso we found 33 variables which could be informative of ses [table 1]. We used the world bank technique of developing wealth index by principal component analysis (pca) and setting the first extracted principal component as the wealth index . In this technique weights of items in the composite wealth score areactually the factor scores . A factor score is a measure of the strength of the association of an item with the first principal component . We did not use the sampling of the survey during the pca procedure, but we considered them when constructing population wealth quintiles . List of indicators ordered based on their priority in entrance to the linear regression model all analyses were performed using stata / se . Using pca method on all 33 asset ownership and housing quality indicators a proxy wealth index was constructed . For selecting the best indicators for constructing the simple asset index, wealth index was regressed onto the 33 asset indices using forward selection method . Variables were selected for pca using their order of entrance into the linear regression model by forward method . The first index was constructed by the first 5 assets then increased up to 9 assets [table 2]. Again pca was used for weight calculations . The first five indices constructed by the first 5 to 9 indicators in comparison with the base ranking three measures computed for checking the validity of the constructed simple index, pearson's correlation coefficient between the new index and the 33-item wealth index, spearman's correlation coefficient of quintiles produces by new index and main wealth index and percent agreement in the two wealth quintile assignments and its weighted kappa statistic . The national statistical office (nso) of iran provides each year an estimate of the national demographic characteristics, annual income, annual consumption expenditure, ownership of assets and housing quality . The living standards measurement study (lsms) data is obtained using each year a survey of about 27,000 nationally representative households (14,000 rural and 13,000: urban) from 28 provinces, sampled proportional to the size of the province population . In the dataset of nso we found 33 variables which could be informative of ses [table 1]. We used the world bank technique of developing wealth index by principal component analysis (pca) and setting the first extracted principal component as the wealth index . In this technique weights of items in the composite wealth score areactually the factor scores . A factor score is a measure of the strength of the association of an item with the first principal component . We did not use the sampling of the survey during the pca procedure, but we considered them when constructing population wealth quintiles . List of indicators ordered based on their priority in entrance to the linear regression model all analyses were performed using stata / se . Using pca method on all 33 asset ownership and housing quality indicators a proxy wealth index was constructed . For selecting the best indicators for constructing the simple asset index, wealth index was regressed onto the 33 asset indices using forward selection method . Variables were selected for pca using their order of entrance into the linear regression model by forward method . The first index was constructed by the first 5 assets then increased up to 9 assets [table 2]. The first five indices constructed by the first 5 to 9 indicators in comparison with the base ranking three measures computed for checking the validity of the constructed simple index, pearson's correlation coefficient between the new index and the 33-item wealth index, spearman's correlation coefficient of quintiles produces by new index and main wealth index and percent agreement in the two wealth quintile assignments and its weighted kappa statistic . The constructed wealth index on 33 asset indicators present in the data set had showed a principal component's eigenvalue equal to 6.76, which could explain about 20.5% of the variance in the data . The distribution of the constructed index was rather normal without truncation or clumping, which is illustrated in figure 1 . The histogram of the constructed wealth index regressing the asset indicators onto the constructed 33-item proxy wealth index using forward regression method produced an ordered list of indicators, which is presented in table 1 . The first indicators list is: washing machine, bath room, kitchen, freezer, vacuum cleaner and personal computer (pc). This 6-item indicator was selected as the index with minimum number of indicators which had reasonable agreement . The distribution of asset items ownership in each quintile of the community because of the similarity of the weights of indicators in the pca model which are all around.4, we replaced these weights with 1 to compute the index as: kitchen + bathroom + washing machine + vacuum cleaner + freezer + pc . Comparing this very simplified index with the 33-item wealth index about 65% of households were in the same quintiles, with a weighted kappa statistics of 0.76 . For households in different quintiles, movement was generally limited to one quintile, with just 2% of households moving two or more quintiles . The relationship between this score and the quintile the household belongs to is summarized in table 4 . Comparison of the agreement between the quintiles produced based on the 33-item proxy wealth index and the very simplified (vs) 6-item proxy wealth index the relationship between the simplified score and the quintile the household belongs to its measurement is important not only in studies related to social determinants of health or measuring health socioeconomic - inequalities, but also in almost all studies due to its confounding role . Socio - economic class points to social groups resulting from interconnected economic, social and legal relationships in the population, while socioeconomic status is an accumulative concept referring to assets, income from assets and expenditures resulting from these incomes . Ses is a combined indicator for social factors affecting health, which may include different factors including income, education, job, etc, and usually a combination of them is used for measuring effect of ses . Thus, it cannot be said that an variable alone can represent this indicator . For example, in various studies, effect of job on various aspects of health has been assessed as one of the best variables due to its relevance to other factors shaping ses . Other than known variables such as education and job, what is common is measuring this indicator using monetary indices such as income or expenditure . In most developed countries, ses indicator is household income or expenditures, while measuring these variables in developing countries is not as easy as in the developed countries and requires other methods, since much part of community in these countries do not have fixed income and use different resources and do not have recorded expenditures . Considering these limitations, world bank recommended using characteristics of residence place, facilities and living means as good indicators for long - term economic status of households and based on which relative indices of households economic status can be made . The problem with these indices is that these questions assess only part of wide range of ses and do not provide a perfect index . In addition, the number of these variables is large and adding them to health questionnaires or national reporting forms is usually impossible . This study could identify 6 items as predictors of ses index, which have appropriate validity compared to 33 items and their combination method is simple so that respective community can be classified into 5 ses categories . In most studies in other developing countries addressing development of socioeconomic indices, national data such as lsms were used, which is annually collected with the aid of world bank . Malawi and ivory coast studied validity of quick assessment indices of household income and wealth in african rural areas . First was creating asset - based index, which was obtained by multiplying household access to each asset by reverse percentage of community having that asset and summing them . When both variables were changed logarithmically, their correlation was obtained as 0.74 and 0.83 in mali and malawi, respectively . The other method used by these authors was selection of some questions for assessing total household expenditures . In this method, it was assumed that households with higher expenditures have higher ses . In this study, authors used statistical algorithm proposed by mark et al, known as max - r in order to reach a shortened list of expenditure questions which could give good assessment of household expenditures . They could obtain a short list of 10 questions related to expenditures in ivory coast, results of which showed 0.79 correlation coefficient with total household expenditure . In the present study, appropriate agreement was observed among 6 selected items with total ses variables . In addition, un - weighted combination of these items showed that it is possible to classify community at national level into 5 ses classes . It should be noted that selected sample which included over 27,000 families, is a national sample, therefore the result is generalizable to national level data and not to any specified population . For example, having fridge freezer and pc in home for discriminating low ses classes do not have necessary power and having kitchen and bathroom are not discrimantory at high ses levels . Thus, if a study, say in the capital of the country is going to create discrimination at mid - high ses level, using assets such as having kitchen and bathroom would not be useful, while, in deprived rural communities such as bashagard district and or sistan - baluchestan province, considering pc and fridge freezer do not have discrimination power . Another limitation is speed of people adopting technology, which can make items combination and their discriminatiory power different over time . For example, by developing new generations of a product and lowering its cost, probably this combination changes and it is necessary to find new combinations of these variables in periodic studies such as lsms . One of advantages of this classification is its easy application for users and its understandability by all including policy makers . The other important point is that in some countries like uk, there have been classifications for allocating resources and considering people health as early as about 100 years ago . Certainly using this kind of classifications in these countries, which are used by other decision making systems, other than health however, on the other hand, if we accept that the aim of defining social variables in health arena is investigating their impact on health and classes needing various interventions, thus considering combination of indices in such a way that it can have the highest impact on health will be useful . In a study in bangladesh, the authors created an index for measuring women's ses so that they can assess and monitor socioeconomic inequality in health system in providing maternal service using this index . Their goal was obtaining an index with limited number of questions so that they can measure it in the location of health service delivery . Then, they measure correlation of each variable used for creating pca index with developed index . To this end, they classified samples in to five quintiles using index and investigated frequency of each variable in each quintile . Variables showing highest relationship with socioeconomic quintiles were selected and some scores were assigned to them, which were proportionate with importance level of variable in socioeconomic status . In a study by patel et al ., for developing a simple index, which can be used for diving families with children suffering from diarrhea into 4 income classes, in a sample including 300 individuals referring to hospital, income and wealth level of 25 variables including living facilities were investigated and 8 questions were selected and the index was designed according to it, and based on which suggested income groups had 43% consistency with real income groups . Since the choice of assets and their weights are context specific, the proposed simple index is specific to current iran's society and cannot be recommended for other time periods or other countries; however, there are now few countries in the world where such a survey (or censuses with asset items included in their questionnaires) has not been conducted repeatedly over the past decade . We think that presenting this idea may promote executives of other countries to adopt this method for constructing standardized pragmatic and quick means of assessing the poverty status in their country, which can be easily applied even in sub - district levels of data collection and equity monitoring . To move forward quickly toward integrating equity into health information systems, a feasible, cost - effective and short - term recommendation is to construct standardized simplified ses indices and incorporate them into all sources . We propose that this simplification is able to improve potential for equity analysis and pro - equity policies, especially in developing countries.
In the search for new agents to protect the lung from injury, kuklin and colleagues report that tezosentan, a non - selective endothelin-1 receptor antagonist, reduces pulmonary edema in endotoxemic sheep, in parallel with a prevention of protein kinase c- activation . Acute lung injury (ali) and its more severe form, acute respiratory distress syndrome (ards), are syndromes of acute respiratory failure secondary to permeability, non - cardiogenic, pulmonary edema . Ali / ards is a major cause of morbidity, death and cost in intensive care units . Alveolar edema accumulates in ali / ards mainly because the permeability of the capillary (endothelium)alveolar (epithelium) barrier is increased . This mechanism allows edema formation at normal capillary pressures and greatly increases the rate of edema formation at elevated capillary pressures . In addition, pressure elevation in the pulmonary circulation and mechanical stresses applied to the lung (during mechanical ventilation, for example) may cause " stress failure " in lung capillaries and alveoli, as evident in the formation of breaks and discontinuities in the endothelial and epithelial membranes of the blood gas barrier . The american european consensus conference on ards defined ali / ards as a " syndrome of inflammation and increased permeability " . Hence, it is now widely accepted that the pathophysiology of ali / ards is driven by an aggressive inflammatory reaction that damages the alveolocapillary unit . After rapid recruitment of leukocytes to the inflamed site, there is activation of mediator cascades including the production of cytokines, chemokines, acute phase proteins, free radicals, complement, coagulation pathway components and focal upregulation of adhesion molecule expression units . Several cytokines, such as tumor necrosis factor alpha (tnf-), interleukin (il)-1, il-6 and il-8, have been found in bronchoalveolar lavage fluid and plasma of patients with ards . Inflammatory mediators amplify endothelial injury directly or by recruiting inflammatory cells into the vascular, interstitial and alveolar spaces . In addition, some mediators may also alter endothelial permeability by disturbing intracellular signaling pathways . Tnf- and -thrombin have been shown to activate protein kinase c - mediated mechanisms that participate in the pulmonary endothelial response to agents involved in lung injury . Protein kinase c is a ubiquitously expressed family of kinases that have a key role in regulating multiple cellular activities . Activation of specific protein kinase c isoforms, most probably protein kinase c-, may cause lung endothelial dysfunction through several mechanisms . Endothelins are a family of 21-amino - acid isopeptides . Initially described as strong vasoconstrictors, for example, transgenic mice overexpressing endothelin-1 release increased amounts of tnf-, interferon-, il-1 and il-6 . The endothelin system is activated in clinical lung injury and in various types of experimental lung injury, and several endothelin receptor antagonists have been reported to exert protective effects in some models of ali / ards . Endothelins may thus play a pathophysiologic role in ali / ards and promote pulmonary edema by increasing the filtration pressure (as postcapillary vasoconstrictors), and also by increasing capillary permeability (as inflammatory mediators). The results of kuklin and colleagues are in accordance with this hypothesis and provide further insight into an intracellular effect of endothelin receptor antagonists (i.e. Prevention of protein kinase c- activation). Endothelin receptor antagonists have been made available recently for clinical use in the treatment of pulmonary arterial hypertension . These drugs may therefore offer new and attractive opportunities for the management of patients with ali / ards, especially because, to date, no pharmacologic agent has been convincingly shown to improve the prognosis of these patients . The data of kuklin and colleagues suggest that endothelin receptor antagonists might benefit patients with ali / ards . As expected from the use of a receptor antagonist, the level of the ligand increased; that is, the plasma concentration of endothelin-1 was elevated after tezosentan treatment . As also expected from the proinflammatory properties of endothelin-1, plasma levels of tnf- and il-8 increased after tezosentan treatment . The clinical relevance of these observations is unknown, but production of these cytokines might counteract the benefits expected from endothelin blockade . In other experimental models of ali / ards, endothelin receptor antagonists did not decrease intrapulmonary shunt, lung lymph flow or the histologically evaluated degree of parenchymal injury, despite a reduction in pulmonary vascular resistance . The work of kuklin and colleagues provides important information on the complex effects of endothelin blockers on inflammatory processes . From a clinical point of view, given the prolific nature of the inflammatory cascade causing ali / ards and the angel / devil effects of endothelin receptor antagonists on inflammatory mechanisms, it is unlikely that these single agents could reverse or terminate such a complex process . Ali = acute lung injury; ards = acute respiratory distress syndrome; il = interleukin; tnf- = tumor necrosis factor alpha.
The number of patients undergoing chemotherapy grows year by year . Despite their efficacy in controlling the cancer, chemotherapy drugs are not inert, and they cause damage to the human body regarding nail involvement, diverse clinical features can be observed, according to the structure affected and the severity of the damage caused . The most common chemotherapeutic agents implicated in nail changes are cyclophosphamide, doxorubicin and hydroxyurea [2, 3]. In the majority of cases, the effects are fully reversible after a few months once the causative agent has been withdrawn [2, 4]. A 25-year - old male patient was admitted to the hospital's hematology ward with the diagnosis of acute lymphocytic leukemia . The hyper - cvad regimen delivers a combination of drugs in 2 cycles (cyclophosphamide, vincristine, doxorubicin and dexamethasone in cycle a, methotrexate and cytarabine in cycle b), split into smaller doses and administered at more frequent intervals in order to minimize side effects . During hospitalization, a dermatology assessment was requested . The dermatological examination showed nail injury characterized by transverse, brown - gray hyperpigmentation affecting the proximal half of the nail plate, with a brown band delimiting the healthy nail plate on all fingers (fig . 1, fig chromonychia induced by chemotherapeutic agents has different forms, the most common being melanonychia [2, 4, 5]. The dark pigmentation in nails can be diffuse, transverse or longitudinal and can coexist with skin and mucosal pigmentation [2, 4, 6]. It has been suggested that chemotherapy drug regimens influence the incidence of changes that may result from toxicity in the nail matrix, nail bed, periungual tissue and digits vessels [2, 6]. Although several chemotherapeutic agents can cause these changes, those most associated with these side effects are cyclophosphamide, doxorubicin and hydroxyurea [2, 3]. Cyclophosphamide is an alkylating agent whose main target is the cell cycle; thus, tissues with high proliferation rates are more susceptible . Alkylating agents form cross - links with dna filaments and prevent dna replication, therefore entailing cytotoxicity . Cyclophosphamide can cause nail changes such as diffuse, black pigmentation, longitudinal striae ranging in color from slate gray to black, and diffuse, dark gray pigmentation located proximally, with overlying transverse, black bands [2, 4]. This drug - induced nail pigmentation starts from the proximal edge of the nail and proceeds towards the distal edge . Upon withdrawal of the drug it takes approximately 46 months [2, 3]. In 60% of patients, cyclophosphamide is also associated with pigmentation of the oral mucosa and tongue, which also regresses upon withdrawal of the drug [2, 4]. Its side effects include skin and nail hyperpigmentation, alopecia, skin rash, pruritus, photosensitivity, urticaria, acral erythema and palmoplantar erythrodysesthesia . Nail changes such as transverse, dark brown bands alternating with white stripes [2, 7] and dark brown diffuse pigmentation bands 45 mm wide, which affect two - thirds of the distal portion of the nail, also occur [2, 5]. Additionally, doxorubicin can cause subungual keratosis, onycholysis and thickening of the nail plate . Hydroxyurea causes an immediate inhibition of dna synthesis by acting as an inhibitor of ribonucleotide reductase, without interfering in the synthesis of ribonucleic acid or protein . This pigmentation has a diffuse, dark brown color which may appear as single or double transverse bands [2, 4]. Ungual hyperpigmentation induced by chemotherapy is not uncommon, although its occurrence is underestimated and seldom reported, especially in patients with dark skin phototypes, such as our patient, in this case, the drugs most probably implicated are doxorubicin and cyclophosphamide because they produce ungual alterations very similar to the ones seen in our patient; his chemotherapeutic scheme included both of them.
Granuloma annulare (ga) was first described in 1895 by colcott - fox who reported an 11-year - old girl with a ring eruption of the fingers . The condition is a benign, usually self - limited granulomatous disease of the dermis and subcutaneous tissue . Clinically, the condition is characterized by asymptomatic, flesh - colored or erythematous - brown papules, frequently arranged in a ring or annular pattern on the distal extremities . It may be skin - colored erythematous or violaceous measuring 1 - 5 cm in diameter . Several clinical variants of ga have been reported, namely localized, generalized or disseminated, targetoid, giant, subcutaneous and perforating ga . We report an 18-month - old male child with multiple, progressive ga over the lower extremities . An 18-month - old male child presented with multiple annular lesions over lower extremities and buttocks . Initially it started as a small papule over the left thigh, substantially attaining the present size . There was no history of fever, pain, drug intake or recent vaccination . On examination, on cutaneous examination, closely set, skin - colored, firm, smooth papules 2 - 3 mm in size arranged in a ring - like fashion to form annular plaques measuring approximately 3 3 cm (eight lesions) were present over dorsal aspect of foot [figures 1 and 2], both legs and buttocks . Granuloma annulare over the left foot granuloma annulare over the right ankle routine hematological, biochemical and urine examinations were normal . Venereal disease research laboratory test, human immunodeficiency virus 1 and 2, hepatitis surface antigen test were negative and a biopsy showed features consistent with ga . Ga is a benign, relatively common cutaneous disease that classically presents as closely set, skin - colored, firm, smooth papules 2 - 3 mm in size arranged in a ring - like fashion to form annular lesions . Most cases occur before the age of 30 years and it is approximately twice more common in females . It often favors sacral sites such as the dorsa of the hands, elbows and feet but involvement of the palms appears to be rare . Occasional familial cases are described with the occurrence in twins, siblings, and members of successive generations . Attempts to identify an associated hla sub - type have yielded disparate results in different population groups . Linear ga, a follicular pustular form and popular umbilicated lesions in children have also been described . The condition manifests as numerous (at least 10, often hundreds to thousands) small, asymptomatic, erythematous, violaceous, brown- or skin - colored papules . Rarely, ga may be complicated by nerve involvement as a result of granulomatous inflammation surrounding cutaneous nerves and perineural infiltrates of histiocytes in the dermis . The differential diagnoses of localized ga include tineacorporis, pityriasis rosea, pityriasis rotunda, erythema annulare centrifugum, nummular eczema, discoid lupus erythematosus, psoriasis, necrobiosis lipoidica, morphea, hypertrophic lichen planus and erythema chronicum migrans . Treatment options include topical or intralesional corticosteroids, imiquimod cream, topical calcineurin inhibitors (tacrolimus, pimecrolimus), cryotherapy, and pulsed dye laser.
Copd is a heterogeneous condition, with pathophysiological abnormalities that vary in severity between patients.1 small airway inflammation is a common feature of copd,2 causing a reduction of the cross - sectional area of the small airway lumen . Small airway narrowing and collapse can cause gas trapping on expiration and hyperinflation.3 the presence of hyperinflation is associated with greater dyspnea and reduced exercise tolerance.4 impulse oscillometry (ios) measures respiratory resistance and reactance during tidal breathing using sound waves of different frequencies.5 resistance is the loss of energy arising from friction or turbulence, while reactance is the capacity for energy storage, which is dependent on the elastic properties of the lungs . Copd patients typically have increased total airway resistance and a greater negative reactance compared to healthy subjects.6 small airway narrowing and closure during expiration can prevent low - frequency oscillometric signals from traveling to the distal lung.6 these regional choke points within the airway tree are present during expiration but not during inspiration, and cause expiratory flow limitation (efl). Dellac et al7 used within - breath analysis to show that the difference between inspiratory and expiratory reactance at 5 hz (known as x5) identifies efl during tidal breathing in copd patients; x5 of 0.28 kpa / l / s has a high specificity and sensitivity for detecting efl . Copd patients with higher x5 values have greater dyspnea.6 the aim of this study was to quantify the proportion of copd patients with efl, and to further characterize the clinical characteristics of patients with efl . We also studied whether the presence of efl is stable after 2 years of follow - up . A total of 147 copd patients were recruited (75 from the copdmap cohort) with 45 patients attending for follow - up at 2 years . Patients were aged> 40 years, with post - bronchodilator forced expiratory volume in 1 second (fev1)/forced vital capacity (fvc) ratio of <0.7, 10 pack - year smoking history, and had no history of asthma . The study was approved by the greater manchester ethics committees (ref: 10/h1003/108) and all patients provided written informed consent . Copd patients performed the following procedures at baseline and 2-year visit: st george s respiratory questionnaire (sgrq), copd assessment test (cat), dyspnea visual analog scale (vas), spirometry with reversibility, ios (masterscreen; erich jaeger, hoechberg, germany), plethysmography, diffusing capacity of the lungs for carbon monoxide (dlco), and the 6-minute walk test, as previously described.8 plethysmography, dlco, and spirometry (vmax, carefusion, hoechberg, germany) were performed according to the ats / ers guidelines.911 x5 was calculated as mean inspiratory reactance at 5 hz (x5 in) minus the mean expiratory reactance at 5 hz (x5ex). Statistical analysis was performed using unpaired t - tests or mann whitney u tests for comparison between groups at baseline; paired t - test or wilcoxon matched pair tests for within patient comparisons at 2 years; and chi - square tests for categorical data . Analysis was performed using prism 5 (graphpad, la jolla, ca, usa); p<0.05 was considered statistically significant . In all, 55 (37.4%) of the 147 copd patients had efl; see table 1 for clinical characteristics . Patients with efl were more likely to be current smokers (p=0.01), have worse airflow obstruction (mean 42 versus 59 fev1% predicted; p<0.0001); and have more gas trapping with a higher rv (median 166 versus 121% predicted; p<0.0001) and frc (mean 144 versus 122% predicted; p<0.0003). The efl group had worse sgrq activity and symptom component scores and lower 6-minute walk distance . There were significant differences between groups for all ios measurements; notably, r5r20 was greater in the efl group . X5 was significantly associated with r5r20 (r=0.87, p<0.0001), fev1% predicted (r=0.49, p<0.0001), fev1/fvc (r=0.27, p=0.001), hyperinflation (rv% predicted: r=0.37, p<0.0001; frc% predicted: r=0.33, p=0.0003), cat score (r=0.21, p=0.011), and sgrq total score (r=0.22, p=0.009) including all the sgrq domains (symptoms, impact, and activity). There was no association between x5 and the vas dyspnea scale (r=0.11, p=0.22). A total of 45 patients returned at 2 years . In all, 20 patients had efl at baseline, of which 14 (70%) had efl at 2 years . For the remaining 6 patients without efl at 2 years, the median x5 changed from 0.44 kpa / l / s at baseline to 0.24 kpa / l / s after 2 years (p=0.031). A total of 25 patients did not have efl at baseline; 21 (82%) remained without efl at 2 years . Overall, there were no significant changes in x5 values between baseline and 2 years for both the efl and non - efl groups . Fev1 decreased in both the groups (mean changes: efl: 66.5 ml / year, p=0.003; non - efl: 71 ml / year, p=0.0005). Efl was a common finding in copd patients, being present in over a third of the cohort . Efl patients had a lower fev1% predicted and more hyperinflation and gas trapping, with reduced exercise performance . R5r20 is recognized as a measurement of small airway resistance5; efl was associated with greater small airway impairment . This association is compatible with the cause of efl, namely small airway narrowing and collapse . Dellac et al7 proposed the x5 threshold value of 0.28 kpa / l / s for efl using results from forced oscillometry data during individual breathing cycles . We used mean data from multiple breathing cycles during ios, which may categorize some patients with efl despite not all cycles reaching the efl threshold . Nevertheless, using this method to define efl we identified a subgroup of patients with marked small airway disease, gas trapping, and hyperinflation . Furthermore, the identification of efl was reproducible in the majority of cases at the 2-year follow - up . Aarli et al6 used ios to measure efl in copd patients, and also found that efl was associated with lower fev1 values and greater hyperinflation . In common with our findings, a significant association with worse health status and symptom scores was also reported . While there were some differences in the patient - reported outcome tools used, the overall interpretation of these two studies is that the presence of efl is associated with a greater symptom burden in copd patients . Aarli et al6 reported that copd patients with x5 0.1 kpa / l / s experienced greater dyspnea . The x5 0.1 kpa / l / s threshold value is obviously lower than that used in the current study, and is likely to identify patients with less severe efl . The higher x5 threshold value used in this study identified a group with greater efl that was associated with more severe disease manifestations . It has been reported that x5 is associated with the level of symptoms and duration of hospitalization during copd exacerbations.12 treatment with an inhaled corticosteroid / long - acting beta - agonist combination for 3 months improved x5.13 the identification of small airway disease and efl in copd patients using oscillometry methods may allow individualized targeting of drugs to treat these pathophysiological abnormalities . For example, inhalers with a greater proportion of extra - fine particles14 could be targeted to copd patients with efl . There was limited follow - up at 2 years, and larger cohort studies are needed to build on the observations here about the long - term clinical implications of efl . We show that ios can identify patients with efl, and that efl is associated with more severe airflow obstruction, hyperinflation, and symptoms . We suggest that efl is a treatable trait,15 and may provide an opportunity for therapeutic intervention.
Immunopathology is associated with the most common life - threatening disorders, including atherosclerosis and related cardiovascular diseases, cancer, and chronic inflammation . A number of diseases, such as lupus erythematosus, rheumatoid arthritis, or hiv infections, are characterized by pronounced immunopathologies; others, such as atherosclerosis and cancer, by less obvious latent pathological changes in the immune system . Such changes may represent early events in the disease initiation and development and might therefore be especially interesting for timely diagnostics and for development of preventive treatment . Altered macrophage plasticity and polarization can contribute both to the malignancy development and to the tumor vascularization . In that regard, comprehensive analysis of the macrophage population diversity would be necessary for developing adequate therapeutic approaches and monitoring the therapy efficiency . Recent studies have revealed many aspects of the complex and important role of macrophages in the pathogenesis of atherosclerosis . Formation of the atherosclerotic plaque begins with monocyte activation and transformation into macrophages that reside in the subendothelial area of the blood vessel wall and accumulate lipids in their cytoplasm becoming foam cells . This lipid trapping is performed by means of uncontrolled phagocytosis . At the same time, certain types of macrophages are implicated in tissue repair, and these cells have been found in regressing plaques in mouse models [4, 5]. Therefore, different types of macrophages are responsible for the plaque initiation, growth, and, eventually, regression [68]. Correspondingly, anti - inflammatory agents are considered as an important component of antiatherosclerotic therapy . Here again, the analysis of macrophage phenotypic diversity could improve the understanding of the pathological process and assessment of the therapy efficiency . According to current epidemiological data, atherosclerosis - related diseases and cancer are the two greatest contributors to the overall mortality in the developed countries [10, 11]. Given that these diseases are tightly associated with immunopathology, development of comprehensive diagnostic methods and therapeutic approaches to modulate the immune system appears to be of the greatest importance . Likewise, no drugs are available to date that allow targeted immune correction in atherosclerosis . It is clear that changes in cytokine expression and phenotypic features of macrophages may reflect the disease progression state . In many pathological conditions, the analysis of different types of cells circulating in the bloodstream can provide valuable information about the disease progression . During the recent years, a number of cell types have been isolated and studied for possible application in diagnostics and drug development . Circulating tumor cells (ctcs) can be extracted from patient's blood and used to analyze the expression of relevant genes and surface markers . For instance, successful isolation and molecular characterization have been described for metastatic breast cancer, metastatic colorectal cancer, and lung cancer . This strategy is especially useful in cases of advanced metastatic cancer, where the patients could benefit from a personalized treatment . The analysis of ctcs has a great diagnostic potential but can also help in revealing the possible drug resistance of the tumor and designing the optimal therapy . Many current studies are focused on the improvement of ctc - based analyses and their clinical implementation . Peripheral blood mononuclear cells (pbmcs) are relatively easily obtainable cells that can be used for monitoring a wide spectrum of conditions and pathologies . The analysis of mrna profiles of isolated pbmcs could be used for evaluation of metabolic changes . Pbmcs can also be kept in short - term culture and used for studying cytokine production induced by stimulation . For instance, changes in proinflammatory cytokine production by isolated pbmcs have been described in such conditions as allergies, alterations of immune response, and immunization [1719]. Studies on pbmcs have demonstrated that vascular endothelial growth factor (vegf) production was decreased in women with preeclampsia . Isolated pbmcs can serve as a relevant system for testing various drugs, especially related to inflammation . Recently, the potential of macrophage - based test system for diagnostics and treatment of atherosclerosis has been explored . Atherosclerosis progression is usually slow, and the disease often remains asymptomatic until the ischemia of organs and tissues becomes evident . This may happen due to the obstruction of a blood vessel with growing atherosclerotic plaque or the embolism caused by a thrombus formed on a destabilized plaque . Therefore, the first manifestations of the disease are often lethal [23, 24]. However, it is hindered by the absence of clinical symptoms and complaints and by the fact that the spectrum of risk factors is very wide, including genetic predisposition, lifestyle and diet patterns, chronic inflammation, and metabolic factors . Immunopathology is likely to be one of the mechanisms underlying atherosclerosis development starting from the early stages, and its assessment can therefore have an important diagnostic value . . These cells can eliminate pathogens by phagocytosis, release of reactive oxygen species, production of proinflammatory cytokines, and modulation of the t - cell immune response . Macrophages are present in all organs and tissues and represent the first line of immune defence, responsible for removal of foreign agents and pathogens . The pool of macrophages remains constant in every tissue, and the cells are renewed from the population of circulating monocytes, although the results of recent studies suggest that these cells are also capable of self - renewal . It has been known for a long time that changes in the phagocytic activity of macrophages might be dependent on changes in the peripheral blood monocyte population, and alterations of the monocyte pool lead to various pathological conditions . Proliferation of promonocytes, which can be stimulated by systemic inflammatory stimuli, leads to the increase of the number of circulating monocytes [29, 30]. Monocytes and macrophages, together with their precursors and dendritic cells, form the mononuclear phagocyte system (mps), although the identity of the dendritic cells remains disputed [32, 33]. The development, maintenance, differentiation, and function of mps are regulated mostly by colony - stimulating factor 1 (csf-1) in homeostatic conditions and by granulocyte - macrophage colony - stimulating factor (gm - csf) during inflammation . Inflammatory signals and various pathological conditions, including atherosclerosis development, stimulate the inactive circulating monocytes to become activated macrophages that can be distinguished by their phenotypic properties . Macrophages can acquire different functional phenotypes influenced by the surrounding microenvironment in a process known as macrophage polarization . Reaching consensus on macrophage classification was challenging due to the high variety of activation types, dependence of the results on the particular experimental setup, and differences of macrophage activation profiles between humans and animal models . Recently, a group of leading immunologists have summarized the current knowledge on the issue and drawn recommendations for conducting and reporting the experiments involving macrophage polarization . Initially, two main classes of macrophages, m1 and m2, have been defined which could be obtained by activation of macrophages by proinflammatory interferon (ifn-) and lipopolysaccharide (lps) or by interleukin-4 (il-4), respectively [3739]. M1 macrophages are characterized by the production of proinflammatory cytokines tumor necrosis factor- (tnf), il-1, il-6, il-12, and proteolytic enzymes, as well as by the expression of fc- receptors on the cell surface [40, 41]. Polarization towards the proinflammatory phenotype can be induced in vitro by toll - like receptor (tlr) ligands, including tnf, lipopolysaccharide (lps), and interferon (ifn-) that might also play a role in the pathogenesis of atherosclerosis . It has been demonstrated that m1 macrophages are present in the atherosclerotic plaques where they maintain the local inflammatory process and promote the extracellular matrix degradation contributing to the formation of unstable plaques that can induce thrombus formation and are therefore especially dangerous [4345]. The subpopulation of m2 macrophages was further divided into several subtypes depending on the activation stimuli (figure 1): m2a (activated by il-4), m2b (activated by immune complexes), and m2c (activated by il-10). Each of these subtypes is characterized by a distinct pattern of cytokine and surface marker expression which can also vary between the species . It has been proposed therefore to refer to different subtypes of macrophages indicating the activation type (e.g., m(il-4) instead of m2a). M2a macrophages have strong anti - inflammatory properties and can be regarded as tissue - repairing cells . They have poor phagocytic capacity and participate in the formation of extracellular matrix by stimulating production of collagen . They express il-1 receptor antagonist (il-1ra) and secrete ccl18, transforming growth factor (tgf-), and remodelling enzymes . M2b and m2c macrophages express different chemokine receptors, produce il-10, and can modulate inflammation but do not synthesize the extracellular matrix and can therefore be regarded as regulatory macrophages . Anti - inflammatory macrophages were also shown to express mannose receptor (cd206), stabilin-1, and decoy receptor il-1rii on the surface [4951]. However, the heterogeneity of this population requires further studies and standardization of the nomenclature . For the sake of simplicity, later in this work, we will refer to the il-4-activated m2a macrophages as m2 phenotype . The production and release of the proinflammatory cytokines, such as il-1 and il-18, are dependent on the macrophage inflammasome status [53, 54]. Inflammasome is a caspase - activating complex formed by several proteins, including caspase-1, which is responsible for cytokine maturation . Active caspase-1 can also be released from the activated cells and may contribute to the damage of neighbouring cells . In can be induced by danger- and pathogen - associated molecular patterns (damps and pamps) [5659]. Importantly, inflammasome is activated in atherosclerosis in response to cholesterol accumulation in the blood vessel wall and formation of cholesterol crystals in foam cells . On the other hand, atherogenesis can be associated with ongoing infections with various pathogens, such as chlamydia pneumonia and helicobacter pylori, which can induce the inflammasome activation [6163]. There might exist other factors that contribute to the inflammasome activation and atherosclerosis progression, including the formation of uric acid crystals and impaired autophagy . Therefore, the inflammasome activation and release of proinflammatory cytokines and caspase-1 are relevant for atherosclerosis progression and can be regarded as important markers of the pathological process . Development of a reliable monocyte / macrophage - based functional test remains challenging due to several technical problems . The traditional method implies cell adhesion, which leads to monocytes activation and is therefore widely criticized . Another method is fluorescence - activated cell sorting (facs), which is fast and accurate but requires labelling of cells with specific antibodies, which can also lead to activation . A pure fraction of monocytes / macrophages can be isolated using magnetic separation . In this method, unspecific activation can also occur due to possible phagocytosis of paramagnetic particles . So far, the only method that can extract nonactivated monocytes is elutriation [66, 67]. It requires, however, special equipment and is impossible to introduce into routine clinical practice . Because of these technical problems, recent studies focused on the identification of molecular markers that could substitute for functional tests in diagnostics of immunopathologies . Studies of monocyte function include the assessment of their motility, adhesion, phagocytic activity, and low - density protein (ldl) uptake [68, 69]. Macrophages can take part in pathological processes via stimulation with circulating soluble activation factors, adhesion to the endothelium, and migration into the tissue where they meet local activation factors . The monocytes' response to these stimuli depends on their priming in circulation and therefore can have a diagnostic potential . The analysis of macrophage pro- and anti - inflammatory phenotypic classes can provide important information on the disease progression, as has been demonstrated for atherosclerosis . A monocyte / macrophage - based assay has recently been designed to evaluate changes in monocyte response to pro- and anti - inflammatory stimuli and to reveal possible bias of the macrophage polarization towards m1 or m2 phenotype . In this method, a pure population of blood monocytes was isolated using magnetic separation [49, 70] (figure 2). The analysis of macrophage activity was performed by stimulating the cells with lps, proinflammatory stimulus ifn-, and anti - inflammatory stimulus il-4 . Proinflammatory activity of macrophages was assessed by the levels of secreted tnf and il-1 and anti - inflammatory activity by the levels of ccl18 production and il-1ra expression . Inflammasome activation can also be assessed in this experimental system by measuring the il-1 expression at mrna level and comparing the results with the amount of mature il-1 detected by elisa . Another evidence of inflammasome activation that can be used as readout is the release of active caspase-1 . Expression and release of the inflammasome - dependent cytokines tnf and il-8 should also be measured to provide the control of inflammasome activity . Further characterization of macrophages can be performed by analyzing such markers as mmr, cd163, tgf - rii, csfr1, tnfri, cd16, cd32, cd64, and stabilin-1, as well as the expression of tlr1, tlr2, and tlr4 at mrna level and on the cell surface . The described experimental system can provide important information on monocyte activation state and possible skew of the monocyte predisposition towards pro- or anti - inflammatory response . Apart from altered polarization towards one or the other phenotype, pathological conditions can be associated with other phenotypical alterations of monocytes / macrophage, including phagocytosis, migration, and proliferation . Alterations of macrophage phenotype and plasticity associated with atherosclerosis have recently been discussed in a comprehensive review . The described method has been used to analyze activation of monocytes isolated from blood of healthy subjects (n = 19), atherosclerosis patients (n = 22), and breast cancer patients (n = 18). The obtained results demonstrated that production of proinflammatory tnf was significantly lower in atherosclerosis patients and significantly higher in cancer patients in comparison to healthy subjects . On the other hand, production of anti - inflammatory ccl18 was decreased both in atherosclerosis and in cancer patients . To evaluate the diagnostic potential of macrophages' activation test in asymptomatic atherosclerosis, a study was performed on individuals with predisposition to atherosclerosis (n = 21, mean age 63 9 years) and subclinical atherosclerosis (n = 21, mean age 62 7 years) in comparison to healthy subjects (n = 21, mean age 60 9 years). Predisposition to atherosclerosis and subclinical atherosclerosis were detected by measuring the age - adjusted carotid intima media thickness (cimt). The analysis of tnf and ccl18 production by stimulated macrophages revealed dramatic individual differences between the analyzed subjects that may reflect the individuals' predisposition to immunopathology . Macrophages from subjects with subclinical atherosclerosis were characterized by especially low degree of activation in response to stimuli (figure 3). Therefore, the ability of macrophages to polarize towards pro- and anti - inflammatory phenotypes was decreased at early stages of atherosclerosis development, although the causative significance of this observation remains unclear . Changes of the immune system occur early in many pathological processes, opening the intriguing possibility that patients may benefit from a preventive treatment targeting the underlying immunopathology . Enhanced monocyte activation may lead to macrophage polarization towards pro- or anti - inflammatory phenotype leading to chronic inflammation and atherosclerosis or to oncopathologies, respectively . For instance, it has been demonstrated that depolarization of macrophages from the m2 phenotype was associated with tumor regression . To explore the potential of the macrophage activation test for drug development, the macrophage depolarization effects of herbal extracts were studied on cells obtained from healthy subjects . Plant extracts with immune - modulating properties are widely used in traditional medicine, but their therapeutic potential for modern clinical practice remains to be investigated . The extracts of the following plants with known anti - inflammatory activity were included into the study: flowers of hawthorn (crataegus sp . ), elderberry (sambucus nigra), and calendula (calendula officinalis) and herbs of st . Cultured macrophages were exposed to pro- and anti - inflammatory stimuli (ifn- and il-4, resp . ), and tnf and ccl18 production was measured after 6 days . Tnf secretion by ifn--stimulated macrophages treated with elderberry, calendula, and violet extracts was 1013-fold higher than that of untreated stimulated macrophages . On the other hand, hawthorn and st . John's wort also suppressed the secretion of ccl18 by il-4-stimulated macrophages (figure 4). Therefore, st . John's wort and hawthorn extracts appear to be natural agents with immune - modulatory properties that could be used for macrophage depolarization . Importantly, natural agents are characterized by relatively good tolerance and minimal side effects and are therefore especially suitable for long - term therapy, which is necessary for successful immune correction . One of the therapeutic strategies for treatment of atherosclerosis is the inhibition of intracellular cholesterol accumulation . It is well established that hypercholesterolemia is a potent risk factor for atherosclerosis development [7476]. However, the accumulating evidence demonstrates that atherogenic potential depends not so much on the total level of cholesterol as on the nature of cholesterol - containing lipoprotein particles that serve as a source of cholesterol storage in the arterial wall . Low - density lipoprotein (ldl) and especially its modifications, such as small dense, oxidized, desialylated, or electronegative ldl, play the key role in atherogenesis, and their levels positively correlate with the disease progression [7779]. Moreover, modified ldl particles can provoke formation of autoantibodies that initiate the inflammatory response and form highly atherogenic immune complexes with ldl particles . In that regard the ability of blood serum to induce cholesterol accumulation is referred to as serum atherogenicity . It has been previously demonstrated that serum obtained from atherosclerosis patients caused cholesterol accumulation in cultured cells and therefore was highly atherogenic . Primary culture of human aorta cells can be a useful system for testing various antiatherosclerotic substances . Using this system, atherogenic properties of patient's blood serum can be analyzed before and after drug administration to assess its therapeutic potential [8284]. Serum from study participants was added to cultured subendothelial intimal cells derived from uninvolved human aorta at concentration of 10%, and cholesterol accumulation was measured after 24 h using a previously established method . It was demonstrated that blood serum atherogenicity decreased in study subjects treated with a single dose of hawthorn extract . The observed decrease was 73% and 83% after 2 and 4 hours, respectively, in comparison to the baseline (figure 5). These results indicate that hawthorn extract may be regarded as a potent antiatherosclerotic agent . On the other hand, john's wort extract was a potent macrophage depolarizing agent, and hawthorn was demonstrated to reduce the serum atherogenicity . Further studies employing macrophage - based cellular test systems will allow identification of novel agents with therapeutic potential . Monocyte / macrophage - based test system is a versatile tool to detect immunopathology, including increased monocyte activation and altered polarization of macrophages towards pro- or anti - inflammatory phenotypes . Alterations in monocyte activation and imbalance in macrophage polarization can be associated with a variety of pathological conditions, including different types of cancer and atherosclerosis . Therefore, the development of immunomodulating therapy might contribute significantly to the improvement of the existing treatment strategies . However, the complexity of the immunopathology requires flexible and reliable methods for diagnostics and monitoring of treatment efficiency . It was proven to be suitable for the analysis of immunopathology in subclinical atherosclerosis and breast cancer . This method can also be applied for studying numerous other pathologies, where monocyte / macrophage activation is implicated, including other types of cancer, chronic inflammation, and autoimmune disorders . Given the broad spectrum of cytokines that may be analyzed, the described method can be improved to perform a more detailed study of macrophage activation . The application of monocyte / macrophage activation test for drug research was illustrated by screening a series of medicinal plant extracts for antiatherosclerotic activity . Together, these results demonstrate the possibilities of macrophage - based cellular tests for diagnostics and drug research in conditions associated with immunopathology.
Despite many potential health benefits of cycling14 as an active transportation mode, safety concerns deter people from cycling in north america.5 injury data from the usa suggest these concerns are valid: beck et al6 found that cyclists there were at greater risk of both fatal and non - fatal injuries than motor vehicle occupants . However, cycling injury risk could be much lower, as shown by continental differences in cycling safety . Canadian and american cyclists are two to six times more likely to be killed while cycling than danish or dutch cyclists7 8 and american cyclists are eight to 30 times more likely to be seriously injured than cyclists in germany, denmark and the netherlands.9 road infrastructure that separates motor vehicles from bicycles is prevalent in the cycling countries of northern europe but not in north america, which could explain some of the observed difference in cycling safety.4 5 we reviewed the evidence on route infrastructure and injury risk,6 and found evidence that bicycle - specific infrastructure (eg, bike routes, painted bike lanes and off - road bike paths) was associated with the lowest injury risks, that sidewalks and multi - use trails were associated with higher risks, and that major roads had higher risks than minor or local roads . At intersections, roundabouts, higher vehicle volumes and multiple vehicle and turning lanes, the evidence on infrastructure and injuries remains sparse and faces challenges that have rendered conclusions difficult and often controversial . Many studies have unclear route definitions, broad route groupings and insufficient adjustment for exposure to risk and confounders . We conducted a case crossover study in the canadian cities of vancouver and toronto10 to examine the influence of infrastructure on injury risk, while ensuring strict control for denominators (ie, exposure to risk, cyclist traffic volume) and for personal and trip characteristics (eg, propensity for risk - taking, time of day). The first set, reported elsewhere,11 compared injury sites to randomly selected control sites of any type, and showed that bicycle - specific route infrastructure was associated with decreased injury risk, providing more detailed support to previous findings.12 13 this paper presents the second set of analyses . It examines intersections and non - intersections separately to assess the distinct features of each, and to determine if the impact of infrastructure differed at these two location types.14 to do this, we used control sites matched to injury sites based on intersection status . The study was conducted in the cities of toronto and vancouver, canada, where the proportions of trips to work by bicycle were 1.7% and 3.7% in 2006, respectively, according the 2006 canadian census . Toronto has a population of approximately 2.5 million, an area of 630 km, snowy winter weather and warm summer weather, and vancouver has a population of approximately 0.6 million, an area of 115 km, rainy winter weather and mild summer weather . At the time of the study, both cities had the cycling infrastructure most common in north american cities, mainly local street bikeways, off - street paths and painted bike lanes (400500 km in each city). The following were differences in cycling - related circumstances between the cities: toronto had streetcar tracks on many major streets and vancouver was subject to a helmet law for adults, had traffic circles at some local street intersections, and had cycle tracks alongside a few major or minor streets (see route infrastructure definitions, table 1). Definitions of route types and bicycling infrastructure, and selected characteristics as observed at the randomly selected study control sites * median vehicle speeds and traffic counts as measured at the randomly selected control sites . Crossover study,10 15 a design that uses injured participants as their own controls, well suited to studies of the effects of transient exposures (eg, varying infrastructure along a cycling trip) on acute events (eg, injury). Comparisons within individuals and trips are fully controlled for personal factors (eg, age, sex, cycling experience) and trip characteristics (eg, weather, bike type, safety equipment use).10 15 our overall design is described in detail elsewhere.10 11 the study population included injured cyclists aged 19 years and over who were treated at emergency departments at study hospitals in vancouver (st paul's, vancouver general) or toronto (st michael's, toronto general, toronto western) between 18 may 2008 and 30 november 2009 . Canadian hospitals are publicly funded so those injured and seeking emergency treatment in the catchment areas (the cities urban cores) are likely to present to one of the study hospitals . All study hospitals were university affiliated, and one regional tertiary trauma centre was included in each city . Hospital research staff reviewed intake records at least weekly, then relayed contact information to the study coordinators in their respective city . Introductory letters were sent to all potential participants, followed by a phone call from the study coordinator to invite participation and screen for eligibility . Up to 10 contact attempts per injured bicyclist were made over 3 months following the injuries . We excluded cyclists who were: injured outside of toronto or vancouver or did not reside in the study cities (the geographical areas were the postal definition of the cities themselves, and did not include the surrounding metropolitan municipalities).unable to participate in an interview (fatally injured, injured too seriously to communicate, could not speak english, or unable to remember the trip).injured while trick riding, racing, mountain biking, participating in a critical mass ride, or while on private property.injured while riding a motorised bike (eg, electric scooter or pedal - assisted e - bike), unicycle or tandem bike.already enrolled in the study due to a previous injury . Injured outside of toronto or vancouver or did not reside in the study cities (the geographical areas were the postal definition of the cities themselves, and did not include the surrounding metropolitan municipalities). Unable to participate in an interview (fatally injured, injured too seriously to communicate, could not speak english, or unable to remember the trip). Injured while trick riding, racing, mountain biking, participating in a critical mass ride, or while on private property . Injured while riding a motorised bike (eg, electric scooter or pedal - assisted e - bike), unicycle or tandem bike . The study design and recruitment protocol were evaluated and approved by research ethics boards at the universities of british columbia and toronto and each participating hospital . Eligible participants were interviewed in person as soon after the injury as possible to maximise recall . The interviewers collected data on characteristics of the trip (eg, weather conditions, time of day, clothing worn, helmet use, etc) and of the cyclist (age, sex, education, income, cycling experience), although these were not required as adjustment factors in the analysis due to the crossover design . Characteristics of the injury and control sites, described below, were also documented (eg, presence of construction, where the cyclist was riding at the time eg, on the sidewalk or the street, which lane or side of street). Participants traced their trip route on a city map (scale 1: 31 250) and indicated the injury site . The interviewer used a map wheel (calculated industries scalemaster 6020 classic, carson city, nevada, usa) to determine the trip distance . Control sites on the same route were identified by multiplying a randomly generated proportion (ms excel, microsoft, redmond, washington, usa) by the trip distance, then tracing the resulting distance along the route using the map wheel . One control site was deliberately matched to the intersection status of the injury site, by adjusting it forward or back (even or odd random number, respectively) along the route until it matched . The other control site was selected in the same way, except without matching on intersection status . These unmatched sites were used in the first set of study analyses, reported earlier,11 but as some of them did match the injury site on intersection status by chance alone, we were able to include them as additional controls in this analysis to augment statistical power . Trained observers completed a site observation form17 developed for the study in consultation with transportation engineering personnel . The form was pretested for feasibility, detail and clarity at 16 sites, revised, then tested for intra - observer reliability at 25 sites, reported elsewhere.11 the observers were blinded to the injury or control status of the sites . Observations were timed to match the time of day of the injury trip (weekday vs weekend; morning rush, mid - day, afternoon rush, evening, night). The observation form recorded information at the location of the cyclist at each site and considered the cyclist's direction of travel . Observations included the characteristics of the routes and intersecting streets, the presence of cycling infrastructure (eg, bike lanes, cycle tracks, signage), presence and type of intersection (eg, two - way stop, four - way stop, stoplight, traffic circle), streetcar tracks and street lighting . Measurements included surface grade (measured using a suunto pm-5 clinometer, vantaa, finland), distance visible along the direction of travel (measured using a rolatape measure master mm-12 trundle wheel, watseka, illinois, usa), counts of motor vehicle, cyclist and/or pedestrian traffic volume in 5 min in both directions and average motor vehicle traffic speed (five vehicles measured at normal traffic speeds, ie, not as they were accelerating from or decelerating to a stop, using a bushnell velocity speed gun, overland park, kansas, usa). Separate analyses were performed to evaluate the effects of infrastructure (table 1) in crashes occurring at intersections and non - intersections . Conditional logistic regression with one or two control sites per injury site was used to estimate associations between injury and infrastructural characteristics . The dependent variable was binary (1=injury site or 0=control site), and or were calculated using the following model:1 where ij is the probability of injury for the ith subject and jth site, given the covariates xij1, xij2, n is the number of subjects; ni=2 if there was one injury site and one control site and ni=3 if there was one injury site and two control sites; and p is the number of covariates . Independent variables including route types and bicycling infrastructure were defined (table 1) with the help of city transportation engineering personnel . Most infrastructure variables offered in the models were the same for intersection and non - intersection analyses . For intersections, two additional design variables were offered: the route types meeting at the intersections and the type of intersection control . Two final multiple logistic regression models (one for intersections and one for non - intersections) were constructed using backwards selection, starting by offering all variables of interest . The variable with the highest p value (wald test) was removed and the model refit with the remaining variables until all variables were statistically significant (p<0.05). Of 2335 injured cyclists who were treated at a study emergency department during the study period, 927 were ineligible, 741 were eligible and 690 agreed to participate (414 from vancouver and 276 from toronto). There were 667 with unknown eligibility, including 124 refusals and 543 not contacted (because of incorrect phone numbers or addresses, or no response with repeated phone calls within 3 months). Participants represented 93.1% of those confirmed to be eligible and 66.5% of those estimated to be eligible (based on the proportion eligible among those contacted).11 common reasons for ineligibility were not being a resident of the study city or being injured outside the city . A complete accounting of participation is included as a supplemental figure in an earlier paper.11 of the 690 participants, 211 were injured at intersections and 479 at non - intersection sites . No matched control site was selected for one person injured at an intersection and one injured at a non - intersection, so these cases were excluded from the analyses . The 210 intersection injury sites were matched to 272 control sites (210 matched deliberately and 62 matched by chance). The 478 non - intersection injury sites were matched to 801 control sites (478 deliberately and 323 by chance). Process by which injury and control sites were matched based on whether injuries occurred at intersections or not in a case crossover study conducted in vancouver and toronto (canada). The unadjusted and adjusted associations of all variables that were included in the final model of intersection characteristics and bicycling injury are shown in figure 2 . Compared to intersections of two major streets, intersections of two local streets were associated with significantly lower odds of injury (adjusted or 0.19, 95% ci 0.05 to 0.66). Intersection type was associated with injury, with the highest risk noted for traffic circles, a relationship that was strengthened and became significant after adjustment for other variables (adjusted or 7.98, 95% ci 1.79 to 35.6). Compared to motor vehicle speeds of 3150 km / h, speeds below 30 km / h were associated with lower cycling injury risk (adjusted or 0.52, 95% ci 0.29 to 0.92). Cycling in the direction opposite to motor vehicle travel was associated with increased injury risk (adjusted or 7.8, 95% ci2.02 to 30.3), as were downhill grade (adjusted or 2.22, 95% ci 1.21 to 4.08) and high cycling traffic (more than 75 cyclists / h, adjusted or 3.04, 95% ci 1.17 to 7.93). The variable bike or pedestrian infrastructure (table 1) was not associated with an increased or decreased injury risk at intersections and was therefore not included in this model . The unadjusted and adjusted effects of all variables considered in intersection risk modelling are available in supplementary table s1 (available online only). Intersections: results of conditional logistic regression analyses of associations between infrastructural characteristics and bicycling injury in a case crossover study conducted in vancouver and toronto (canada). Shown are the effects for single variables (left) and for all these variables together in the final multiple regression model (right), with final variables selected via a backward selection (comparison of n=210 injury sites and n=272 control sites, all at intersections). The unadjusted and adjusted associations of all variables that were retained in the final model of non - intersection characteristics and bicycling injury are shown in figure 3 . Bicycle - specific infrastructure was associated with reduced injury risk in non - intersection locations . Cycle tracks (physically separated lanes alongside major streets) (adjusted or 0.05, 95% ci 0.01 to 0.59) and local streets with diverters at the nearest intersection to reduce motor vehicle traffic (adjusted or 0.04, 95% ci 0.003 to 0.60) were especially protective . The presence of streetcar or train tracks within a 5 m diameter of the site was associated with increased injury risk (adjusted or 4.15, 95% ci 2.31 to 7.45) as was downhill grade (adjusted or 2.05, 95% ci 1.48 to 2.85) and the presence of construction at the site during the injury trip (adjusted or 2.67, 95% ci 1.70 to 4.19). Although it was not statistically significant, we also found a suggestion of increased risk with shared lanes or sharrows (adjusted or 1.99, 95% ci 0.76 to 5.20). Results for all variables considered are available in supplementary table s2 (available online only). Non - intersections: results of conditional logistic regression analyses of associations between infrastructural characteristics and bicycling injury in a case crossover study conducted in vancouver and toronto (canada). Shown are the effects for single variables (left) and for all these variables together in the final multiple regression model (right), with final variables selected via a backward selection (comparison of n=478 injury sites and n=801 control sites, all at non - intersection locations). Of 2335 injured cyclists who were treated at a study emergency department during the study period, 927 were ineligible, 741 were eligible and 690 agreed to participate (414 from vancouver and 276 from toronto). There were 667 with unknown eligibility, including 124 refusals and 543 not contacted (because of incorrect phone numbers or addresses, or no response with repeated phone calls within 3 months). Participants represented 93.1% of those confirmed to be eligible and 66.5% of those estimated to be eligible (based on the proportion eligible among those contacted).11 common reasons for ineligibility were not being a resident of the study city or being injured outside the city . A complete accounting of participation is included as a supplemental figure in an earlier paper.11 of the 690 participants, 211 were injured at intersections and 479 at non - intersection sites . No matched control site was selected for one person injured at an intersection and one injured at a non - intersection, so these cases were excluded from the analyses . The 210 intersection injury sites were matched to 272 control sites (210 matched deliberately and 62 matched by chance). The 478 non - intersection injury sites were matched to 801 control sites (478 deliberately and 323 by chance). Process by which injury and control sites were matched based on whether injuries occurred at intersections or not in a case crossover study conducted in vancouver and toronto (canada). The unadjusted and adjusted associations of all variables that were included in the final model of intersection characteristics and bicycling injury are shown in figure 2 . Compared to intersections of two major streets, intersections of two local streets were associated with significantly lower odds of injury (adjusted or 0.19, 95% ci 0.05 to 0.66). Intersection type was associated with injury, with the highest risk noted for traffic circles, a relationship that was strengthened and became significant after adjustment for other variables (adjusted or 7.98, 95% ci 1.79 to 35.6). Compared to motor vehicle speeds of 3150 km / h, speeds below 30 km / h were associated with lower cycling injury risk (adjusted or 0.52, 95% ci 0.29 to 0.92). Cycling in the direction opposite to motor vehicle travel was associated with increased injury risk (adjusted or 7.8, 95% ci2.02 to 30.3), as were downhill grade (adjusted or 2.22, 95% ci 1.21 to 4.08) and high cycling traffic (more than 75 cyclists / h, adjusted or 3.04, 95% ci 1.17 to 7.93). The variable bike or pedestrian infrastructure (table 1) was not associated with an increased or decreased injury risk at intersections and was therefore not included in this model . The unadjusted and adjusted effects of all variables considered in intersection risk modelling are available in supplementary table s1 (available online only). Intersections: results of conditional logistic regression analyses of associations between infrastructural characteristics and bicycling injury in a case crossover study conducted in vancouver and toronto (canada). Shown are the effects for single variables (left) and for all these variables together in the final multiple regression model (right), with final variables selected via a backward selection (comparison of n=210 injury sites and n=272 control sites, all at intersections). The unadjusted and adjusted associations of all variables that were retained in the final model of non - intersection characteristics and bicycling injury are shown in figure 3 . Bicycle - specific infrastructure was associated with reduced injury risk in non - intersection locations . Cycle tracks (physically separated lanes alongside major streets) (adjusted or 0.05, 95% ci 0.01 to 0.59) and local streets with diverters at the nearest intersection to reduce motor vehicle traffic (adjusted or 0.04, 95% ci 0.003 to 0.60) were especially protective . The presence of streetcar or train tracks within a 5 m diameter of the site was associated with increased injury risk (adjusted or 4.15, 95% ci 2.31 to 7.45) as was downhill grade (adjusted or 2.05, 95% ci 1.48 to 2.85) and the presence of construction at the site during the injury trip (adjusted or 2.67, 95% ci 1.70 to 4.19). Although it was not statistically significant, we also found a suggestion of increased risk with shared lanes or sharrows (adjusted or 1.99, 95% ci 0.76 to 5.20). Results for all variables considered are available in supplementary table s2 (available online only). Non - intersections: results of conditional logistic regression analyses of associations between infrastructural characteristics and bicycling injury in a case crossover study conducted in vancouver and toronto (canada). Shown are the effects for single variables (left) and for all these variables together in the final multiple regression model (right), with final variables selected via a backward selection (comparison of n=478 injury sites and n=801 control sites, all at non - intersection locations). In this study, the types of routes meeting, the intersection configuration, the speed of vehicles, the amount of cycling traffic and the direction of cyclist travel were all related to injury risk at intersections . Intersections involving local streets or separated routes tended to have the lowest risks, with local local street intersections having about one - fifth the risk of major major street intersections . Average observed speeds less than 30 km / h had about one - half the risk of higher speeds at intersections . Speed limits of 30 km / h are mandated on residential streets in northern european countries where cycling is safer.9 traffic circles were more hazardous than all other intersection types (traffic lights, two - way stops, four - way stops and uncontrolled intersections). All traffic circles were in vancouver, at intersections of two local streets (intersections that were otherwise found to be very safe). In vancouver, local street traffic circles are small (approximately 68 m in diameter; figure 4) unlike major street roundabouts common in europe . Comparisons are difficult because of the size difference, but other studies have shown that large roundabouts (30 m in diameter) reduce injury risk for motor vehicle occupants and this has fostered interest in this intersection design.18 19 despite the reduced risk for motor vehicles at roundabouts, studies of cyclists have found increased risks.2022 brde and larsson23 showed that roundabouts with radii greater than 10 m were safer than smaller circles . Daniels et al21 and schoon and van minnen19 showed reductions in roundabout risks for cyclists when there were lanes physically separated from motor vehicles . The increased risk to cyclists associated with traffic circles and roundabouts could relate to the large number of associated conflict points.24 in our study, the two main types of crashes at traffic circles were with motor vehicles (n=8), because the cyclist was not seen, or were single cyclist crashes (n=9), resulting from interactions with the infrastructure (eg, hitting the curb, sliding on the sharp turn). A typical traffic circle found in residential areas of vancouver, designed to calm motor vehicle traffic, but found to increase risk at intersections of local streets in this study . (b) design dimensions of traffic circle (derived from measurements taken throughout the city). The dashed arrow shows the route a cyclist is required to take when turning left . We included a variable indicating whether the cyclist was travelling in the opposite direction to motor vehicles and found it to increase risk at intersections significantly . While not an infrastructural variable, it can be related to infrastructure (eg, sidewalk riding) or forced by infrastructure (two - way cycle lanes at one side of the street). At the time of the study, none of the route infrastructure in vancouver or toronto mandated cycling in the direction opposite to traffic . The wrong - way crashes in this study were among cyclists entering the intersection from sidewalks (n=10) or local streets (n=8; traffic lanes are not demarcated and cyclists rode on the left instead of the right side of the street). One other study found an increased risk of a crash for cyclists riding on sidewalks when entering an intersection in the direction opposite to traffic flow.25 intersections with high cycling traffic counts (more than 75/h) were associated with increased injury risk . Most of these crashes were with motor vehicles (n=51), not with other cyclists (n=1). Many studies have found increased safety with increased trips by bicycle.26 27 most data about safety in numbers is at the macro level (ie, city or country level), whereas our analysis examined the micro level (intersections). Two other recent studies examined the impact of increased cyclist volume at intersections: one in finland showed lower crash risk with increased cyclist volume at a newly installed raised bicycle crossing;28 and one in montral found injury risk increased at a lower rate than cyclist volumes at signalised intersections.29 our results may thus not be generalisable . At intersection locations, we found that any bike or pedestrian infrastructure that the cyclist was riding on before entering the intersection (eg, cycle tracks, bike lanes, sidewalks) was not significantly associated with injury risk . This is probably because, in vancouver and toronto at the time of the study, this type of infrastructure was implemented along streets between intersections, not through intersections themselves . Although many northern european countries implement special features for cyclists at intersections, these were almost never observed in our study cities . We could only measure the effects of infrastructure implemented at the time of the study . Our consistent finding11 that cycle tracks decrease risk are similar to findings by lusk et al12 in montral . Other studies have also found decreased risks for bicycle lanes3034 or cycle tracks.19 because previous research has shown increased risks for separated facilities such as off - street paths and sidewalks,3133 35 36 some north american transportation safety advocates argue against cycle tracks and other bicycle - specific infrastructure.37 however, our results support separation from motor vehicles for injury prevention . Conversely, infrastructure that pairs cyclists with either motor vehicles (shared lanes and sharrows) or pedestrians (multi - use paths, sidewalks) offered no such protection . Shared lanes and sidewalks our findings highlight the importance of distinguishing bicycle - specific from mixed - use infrastructure in analyses of risk . Similar to cycle tracks, local streets with diverters to reduce motor vehicle traffic were found to have very low risk, probably because they reduce motor vehicle volumes . Traffic slowing devices (eg, traffic circles, curb extensions and speed bumps or humps) are also considered traffic calming measures and were implemented to slow traffic on local streets, but were not found to have a significant benefit . One study found that motor vehicles may speed up immediately after a traffic - slowing device.38 we found that streetcar tracks and construction were associated with increased risk of cycling injury, consistent with our previous analysis.11 the construction finding suggests the need for demarcated route detours to allow cyclists to avoid construction zones . Our finding that streetcar tracks are associated with injury appears to be new to the empirical literature, although these have long been thought hazardous by toronto cyclists.36 downhill grade was associated with increased risk at both intersections and non - intersections, similar to findings elsewhere,11 39 40 probably affecting risk due to speed of travel and resulting force of impact . While the overall topography of a city is not modifiable, routes targeted for bicycle - specific infrastructure can be selected to minimise elevation changes to improve safety and simultaneously reduce exertion from uphill travel . Level surfaces and gentle slopes have been shown to be preferred by potential riders.5 the importance of grade to both cycling safety and attractiveness highlights the opportunity to foster cycling in naturally flat cities . The current study used a case crossover design10 that addresses many of the challenges of observational studies of bicycle safety,13 including effective control for both exposure to risk and personal factors that may affect both risk and environmental exposure such as experience and risk aversion . The blinded observations and lack of reliance on self - report of site characteristics offer advantages over previously used methods.11 13 cycling conditions were observed after the injury event, so we cannot be sure they were exactly as occurred on the injury trip . This should not affect stable infrastructure such as route type, but may affect more transient conditions, such as traffic counts . Because observations were made in the identical way for injury and control sites, misclassification is likely to be non - differential and to bias risk estimates to the null . The most significant limitation of the current analysis was that we could only examine the effects of infrastructure that was present in the study cities, and not the full range of infrastructure that could be used to mitigate cyclist risk . This calls for replication of our study in other cities with different types of infrastructure, and for further studies as new infrastructure is built . A severity analysis is planned for the study data, but the main focus of the study was the initial risk of being involved in an injury crash, rather than the injury consequences . The study was restricted to cyclists whose injuries were serious enough to result in a visit to a hospital emergency department . By using hospital records, injuries caused by all kinds of crashes were included (eg, with a motor vehicle or not). We could not include individuals who were so severely injured that that they could not recall their trip route; however, few were excluded by this eligibility criterion (two fatally injured and 26 who could not remember their route). The results of this study therefore may not apply to those with minor injuries not requiring emergency treatment or with the most serious injuries . We offered multiple variables to the models and some were likely to be significant by chance alone . We have attempted to be cautious in our interpretations, by looking for consistency with other studies, and recommending verification in future studies in which a result is novel . In addition, we have presented complete tables showing all variables in the unadjusted and adjusted models in supplementary tables (available online only) for examination by interested readers . Different infrastructure characteristics influenced risk at intersections and non - intersections . At intersections, significant variables were route types meeting at the intersection, intersection type, cyclist travel direction, motor vehicle speed, cyclist traffic count and route grade . At non - intersection locations, significant variables were bike or pedestrian infrastructure, streetcar or train tracks, construction and route grade . Only route grade was significant in both analyses . Despite the differing variables important in the two analyses, there are consistent patterns: features that separate cyclists from motor vehicles and pedestrians (cycle tracks, local streets, traffic diverters) and lower speeds (motor vehicle speeds less than 30 km / h, level grades) were associated with significantly lower injury risk to cyclists . These features are incorporated into transportation design in northern european countries with high cycling modal shares and low injury risk, and have been shown to encourage cycling in north america.5 79 important additional evidence from this study includes the importance of obstacles in reducing safety (traffic circles, streetcar or train tracks, construction). Transportation planners and engineers in many north american cities are interested in promoting cycling and will benefit from the accumulating evidence about the value of building environments sensitive to cyclists . What is already known on the subjectthe risk of injury associated with bicycling is higher in north america than in northern european countries where cycling infrastructure is common.evidence is accumulating that routes with low motor vehicle traffic and bicycle - specific infrastructure improve cycling safety.this evidence has been considered inconclusive because previous studies have had unclear route definitions, grouped routes with potentially different injury risks, and had poor control for traffic volume and personal characteristics . What this study addsthis study examined the injury risk associated with multiple carefully defined and measured route infrastructure characteristics . It analysed intersection and non - intersection locations separately, to examine the special characteristics of each . Crossover design effectively controlled for personal, trip and exposure factors, allowing the focus to be on route infrastructure.intersections of two local streets had much lower risks than intersections of two major streets, but traffic circles increased the risk of these otherwise safe intersections . Entering intersections in the direction opposite to traffic increased injury risk, and motor vehicle speeds below 30 km / h reduced risk.at non - intersection locations, cycle tracks alongside major streets but physically separated from traffic and local streets with diverters that reduced motor vehicle traffic had much lower injury risk than routes with no bike infrastructure . Exxonmobil added stress to faulty pipelineexxonmobil realised in 2006 that its 1940s - era pegasus pipeline had many manufacturing defects . These included faulty welds that resulted in a major spill in arkansas . Rather than timely repairs, exxon allegedly added new stresses by starting to carry a heavier type of oil, reversing the direction of the flow and increasing the amount of crude surging through it . The oil spill cleanups highlight the risks of transporting heavy canadian crude, as proposed by the keystone xl pipeline . Insideclimate news, the new york timeshttp://www.fairwarning.org/2013/08/67215/?utm_source = master+list&utm_campaign=561d4145da - rss_email_campaign&utm_medium = email&utm_term=0_b07bcba8fa-561d4145da-76566645#sthash.mdavhzrh.dpuf the risk of injury associated with bicycling is higher in north america than in northern european countries where cycling infrastructure is common . Evidence is accumulating that routes with low motor vehicle traffic and bicycle - specific infrastructure improve cycling safety . This evidence has been considered inconclusive because previous studies have had unclear route definitions, grouped routes with potentially different injury risks, and had poor control for traffic volume and personal characteristics . This study examined the injury risk associated with multiple carefully defined and measured route infrastructure characteristics . It analysed intersection and non - intersection locations separately, to examine the special characteristics of each . Crossover design effectively controlled for personal, trip and exposure factors, allowing the focus to be on route infrastructure . Intersections of two local streets had much lower risks than intersections of two major streets, but traffic circles increased the risk of these otherwise safe intersections . Entering intersections in the direction opposite to traffic increased injury risk, and motor vehicle speeds below 30 km / h reduced risk . At non - intersection locations, cycle tracks alongside major streets but physically separated from traffic and local streets with diverters that reduced motor vehicle traffic had much lower injury risk than routes with no bike infrastructure . Exxonmobil realised in 2006 that its 1940s - era pegasus pipeline had many manufacturing defects . These included faulty welds that resulted in a major spill in arkansas . Rather than timely repairs, exxon allegedly added new stresses by starting to carry a heavier type of oil, reversing the direction of the flow and increasing the amount of crude surging through it . The oil spill cleanups highlight the risks of transporting heavy canadian crude, as proposed by the keystone xl pipeline.
Cf patients at the um cf center are routinely seen at quarterly intervals, and their clinical and laboratory data are recorded in the cf database . Annual ogtt screening starts at 6 years of age for pancreatic - insufficient patients not already on insulin treatment for diabetes . Clinical data were retrieved from patients who had an ogtt performed between january 1, 1996, and december 31, 2005, to identify individuals who had ifg as defined by fasting glucose 100125 mg / dl (5.66.9 mmol / l). All patients and their parents gave informed consent, permitting their records to be reviewed for research purposes . Subjects who had at least one ogtt performed during the study period were identified as having normal glucose tolerance (ngt), igt, cystic fibrosis related diabetes without fasting hyperglycemia (cfrd fh) or cfrd with fasting hyperglycemia (cfrd fh+) by standard definitions (table 1). Additionally, the presence of ifg was noted within each of the first three categories . As cf patients may have fluctuations in the ogtt category from year to year, baseline for subjects with ifg was considered the ogtt within the study period when they first demonstrated fasting glucose elevation . For all other subjects, classification of glucose tolerance abnormalities in cf because ogtt results can vary from year to year, patients are categorized based on the first ogtt with ifg during the test period, or for those who never developed ifg, the first ogtt during the test period . Following the initial population assessment of ifg prevalence, subjects with ifg were matched by age, sex, and ogtt category to cf patients with normal fasting glucose (nfg) levels . Patients were evaluated for subsequent progression to cfrd fh+, changes in lung function and nutritional status, and death during the study period . Lung function was determined by change in forced expiratory volume in 1 s (fev1) and forced vital capacity (fvc). Subjects were determined to be pancreatic insufficient based on their need for enzyme replacement therapy . Only patients with diabetes with fasting hyperglycemia, and thus none of the patients included in the current analysis, were treated with insulin . Ogtts occurred during yearly screening visits when patients were determined to be in a state of stable baseline health . Blood was sampled through an indwelling catheter for glucose and insulin levels at time 0 and every 30 min for 2 h. plasma insulin levels were measured in the um fairview laboratory by radioimmunoassay using a double - antibody method . Fasting weight was measured on the same calibrated clinic scale at each visit, and height was measured in triplicate on a wall - mounted stadiometer . Bmi results for children and adolescents 18 years of age were reported as bmi percentile . Because a portion of the children were> 18 years of age by the end of the study, overall group values were reported for those> 18 years of age only; therefore, data includes 96 individuals at baseline and 122 individuals at follow - up . Fev1 and fvc were measured by standardized american thoracic society methods . For patients who died during the study period, final pulmonary function tests and weights included in the analyses were obtained at least 60 days before the time of death to exclude acute changes . The effect of ifg within each glucose tolerance category was estimated in the paired case - control study using a mixed - effect linear model with a random effect for each pair to account for the correlation between patients in a pair . Odds ratio (or) for death and progression to cfrd fh+ were estimated from conditional logistic regression stratified by pairs . All analyses were performed in sas, version 9.2 (sas institute, cary nc). In the analysis of the clinical outcomes, similar patterns were found with and without inclusion of the patients who died, except that the paradoxical improvement in fev1 in cfrd fh became no change when deceased patients were excluded from baseline and follow - up (data not shown); therefore, the entire matched sample was used for statistical analyses . Subjects who had at least one ogtt performed during the study period were identified as having normal glucose tolerance (ngt), igt, cystic fibrosis related diabetes without fasting hyperglycemia (cfrd fh) or cfrd with fasting hyperglycemia (cfrd fh+) by standard definitions (table 1). Additionally, the presence of ifg was noted within each of the first three categories . As cf patients may have fluctuations in the ogtt category from year to year, baseline for subjects with ifg was considered the ogtt within the study period when they first demonstrated fasting glucose elevation . For all other subjects, classification of glucose tolerance abnormalities in cf because ogtt results can vary from year to year, patients are categorized based on the first ogtt with ifg during the test period, or for those who never developed ifg, the first ogtt during the test period . Following the initial population assessment of ifg prevalence, a case - control cohort study was performed . Subjects with ifg were matched by age, sex, and ogtt category to cf patients with normal fasting glucose (nfg) levels . Patients were evaluated for subsequent progression to cfrd fh+, changes in lung function and nutritional status, and death during the study period . Lung function was determined by change in forced expiratory volume in 1 s (fev1) and forced vital capacity (fvc). Subjects were determined to be pancreatic insufficient based on their need for enzyme replacement therapy . Only patients with diabetes with fasting hyperglycemia, and thus none of the patients included in the current analysis, were treated with insulin . Ogtts occurred during yearly screening visits when patients were determined to be in a state of stable baseline health . Blood was sampled through an indwelling catheter for glucose and insulin levels at time 0 and every 30 min for 2 h. plasma insulin levels were measured in the um fairview laboratory by radioimmunoassay using a double - antibody method . Fasting weight was measured on the same calibrated clinic scale at each visit, and height was measured in triplicate on a wall - mounted stadiometer . Bmi results for children and adolescents 18 years of age were reported as bmi percentile . Because a portion of the children were> 18 years of age by the end of the study, overall group values were reported for those> 18 years of age only; therefore, data includes 96 individuals at baseline and 122 individuals at follow - up . Fev1 and fvc were measured by standardized american thoracic society methods . For patients who died during the study period, final pulmonary function tests and weights included in the analyses were obtained at least 60 days before the time of death to exclude acute changes . The effect of ifg within each glucose tolerance category was estimated in the paired case - control study using a mixed - effect linear model with a random effect for each pair to account for the correlation between patients in a pair . Odds ratio (or) for death and progression to cfrd fh+ were estimated from conditional logistic regression stratified by pairs . All analyses were performed in sas, version 9.2 (sas institute, cary nc). In the analysis of the clinical outcomes, similar patterns were found with and without inclusion of the patients who died, except that the paradoxical improvement in fev1 in cfrd fh became no change when deceased patients were excluded from baseline and follow - up (data not shown); therefore, the entire matched sample was used for statistical analyses . Of the 310 subjects in the total study population, ifg was found in 22% (table 1). The prevalence of ifg increased with the severity of the ogtt glucose category, from 14% of those with ngt, 31% of igt, and 53% of cfrd fh (p <0.0001). When only patients with fasting glucose levels 110125 mg / dl (6.16.9 mmol / l) were considered ifg (who criteria), the overall prevalence of ifg was 19% and by ogtt class was ngt 12.5%, igt 25%, and cfrd fh 46% . For the cohort study, subjects with ifg and their matched nfg control subjects showed no difference in sex, race, or baseline age (table 2). Pancreatic insufficiency status was not significantly different (93% control subjects vs. 99% ifg case subjects, p = 0.73). Cf mutations were similar between case subjects and control subjects with half of patients homozygous and 40% heterozygous for f508 . The year of study entry was earlier for ifg case subjects than for control subjects but when looked at by ogtt group, this was only significant for cfrd fh (ngt = 9 months, p = 0.25; igt = 15 months, p = 0.10; cfrd fh = 24 months, p = 0.02). The frequency of ogtt evaluation was similar between groups (3.6 vs. 3.7 per patient, p = 0.75). Case - control cohort study: demographic summary for pairs matched on age and sex values are mean sd or n (%). Table 3 shows the clinical characteristics of subjects and control subjects by glucose tolerance category for the total cohort and broken down by pediatric and adult age - groups . Ifg subjects were matched for sex in all three categories and were matched as closely as possible for age to control subjects; however, adult ifg subjects in the igt group were on average 2.4 years older than the control subjects (p = 0.03) (table 3). The proportion of children 18 years of age was higher in ngt (38%) than in igt (33%) and cfrd fh (28%), but these differences were not significant . Case - control cohort study: clinical characteristics of all patients with ifg and their matched nfg cf control subjects values are n (%) or mean se . Follow - up% predicted fev1 and fvc measured> 60 days before death . At baseline, ifg case subjects within the igt category had significantly better measures of lung function compared with their control subjects with an 20% higher fev1 and a 10% higher fvc (p = 0.005 and 0.033, respectively). This was primarily related to better lung function in pediatric patients with igt who had 30% higher fev1 at baseline (p = 0.008). While adults with ifg had a 28% higher fev1 at baseline than their nfg control subjects, it did not achieve statistical significance (p = 0.081). Lung function for both children and adults did not significantly differ between subjects with ifg and their nfg control subjects in the ngt or cfrd fh categories . Overall there was a slightly longer duration of follow - up for the ifg subjects (7.6 vs. 6.2 years). Within glucose tolerance categories, this difference was significant only in the cfrd fh group (p = 0.003) where it was related to the death rate of five deaths in subjects with nfg versus one death in an ifg subject . Across all three glucose tolerance categories, the number of subjects who died among the ifg case subjects was less than or equal to the number of deaths in the control subjects for that group . Only two subjects with ifg died during the follow - up period, compared with nine in the nfg control group . The overall odds of death was eight times higher for control subjects than ifg case subjects (95% ci 1.00164, p = 0.0499, based on nine informative pairs where paired participants had different outcomes). At follow - up, analysis of lung function showed that within the igt category, fev1 continued to be about 20% higher and fvc about 15% higher in ifg than in control subjects with igt and nfg (p = 0.008 and 0.023, respectively). When children and adults with igt were evaluated separately, the difference in pulmonary function was only significant for children . Mean follow - up fev1 and fvc in the ifg groups were lower in both the ngt and cfrd fh categories . Thus, ifg was not associated with different pulmonary outcomes in the ngt and cfrd fh categories, and it was associated with improved pulmonary status in the igt category, especially in children . In the ifg group, 57% of subjects progressed to cfrd fh+ compared with 50% of the control case subjects . Overall, the odds of progressing to cfrd fh+ was not significantly higher in ifg (or 1.6 [95% ci 0.73.6], p = 0.301, based on 23 informative pairs where paired participants had different progression outcomes). Of the 310 subjects in the total study population, ifg was found in 22% (table 1). The prevalence of ifg increased with the severity of the ogtt glucose category, from 14% of those with ngt, 31% of igt, and 53% of cfrd fh (p <0.0001). When only patients with fasting glucose levels 110125 mg / dl (6.16.9 mmol / l) were considered ifg (who criteria), the overall prevalence of ifg was 19% and by ogtt class was ngt 12.5%, igt 25%, and cfrd fh 46% . For the cohort study, subjects with ifg and their matched nfg control subjects showed no difference in sex, race, or baseline age (table 2). Pancreatic insufficiency status was not significantly different (93% control subjects vs. 99% ifg case subjects, p = 0.73). Cf mutations were similar between case subjects and control subjects with half of patients homozygous and 40% heterozygous for f508 . The year of study entry was earlier for ifg case subjects than for control subjects but when looked at by ogtt group, this was only significant for cfrd fh (ngt = 9 months, p = 0.25; igt = 15 months, p = 0.10; cfrd fh = 24 months, p = 0.02). The frequency of ogtt evaluation was similar between groups (3.6 vs. 3.7 per patient, p = 0.75). Case - control cohort study: demographic summary for pairs matched on age and sex values are mean sd or n (%). Table 3 shows the clinical characteristics of subjects and control subjects by glucose tolerance category for the total cohort and broken down by pediatric and adult age - groups . Ifg subjects were matched for sex in all three categories and were matched as closely as possible for age to control subjects; however, adult ifg subjects in the igt group were on average 2.4 years older than the control subjects (p = 0.03) (table 3). The proportion of children 18 years of age was higher in ngt (38%) than in igt (33%) and cfrd fh (28%), but these differences were not significant . Case - control cohort study: clinical characteristics of all patients with ifg and their matched nfg cf control subjects values are n (%) or mean se . Follow - up% predicted fev1 and fvc measured> 60 days before death . At baseline, ifg case subjects within the igt category had significantly better measures of lung function compared with their control subjects with an 20% higher fev1 and a 10% higher fvc (p = 0.005 and 0.033, respectively). This was primarily related to better lung function in pediatric patients with igt who had 30% higher fev1 at baseline (p = 0.008). While adults with ifg had a 28% higher fev1 at baseline than their nfg control subjects, it did not achieve statistical significance (p = 0.081). Lung function for both children and adults did not significantly differ between subjects with ifg and their nfg control subjects in the ngt or cfrd fh categories . Overall there was a slightly longer duration of follow - up for the ifg subjects (7.6 vs. 6.2 years). Within glucose tolerance categories, this difference was significant only in the cfrd fh group (p = 0.003) where it was related to the death rate of five deaths in subjects with nfg versus one death in an ifg subject . Across all three glucose tolerance categories, the number of subjects who died among the ifg case subjects was less than or equal to the number of deaths in the control subjects for that group . Only two subjects with ifg died during the follow - up period, compared with nine in the nfg control group . The overall odds of death was eight times higher for control subjects than ifg case subjects (95% ci 1.00164, p = 0.0499, based on nine informative pairs where paired participants had different outcomes). At follow - up, analysis of lung function showed that within the igt category, fev1 continued to be about 20% higher and fvc about 15% higher in ifg than in control subjects with igt and nfg (p = 0.008 and 0.023, respectively). When children and adults with igt were evaluated separately, the difference in pulmonary function was only significant for children . Mean follow - up fev1 and fvc in the ifg groups were lower in both the ngt and cfrd fh categories . Thus, ifg was not associated with different pulmonary outcomes in the ngt and cfrd fh categories, and it was associated with improved pulmonary status in the igt category, especially in children . In the ifg group, 57% of subjects progressed to cfrd fh+ compared with 50% of the control case subjects . Overall, the odds of progressing to cfrd fh+ was not significantly higher in ifg (or 1.6 [95% ci 0.73.6], p = 0.301, based on 23 informative pairs where paired participants had different progression outcomes). A german review of 1,128 ogtts performed on cf patients 1064 years of age found 32% with ifg, but the data were not separated by ogtt category, and many subjects had diabetes (4). In an u.s . Report of 73 children and adolescents with cf, 18% with ngt and 33% with igt had ifg (5). In the present study of 310 children and adults, ifg was found in 14% of those with ngt, 31% of those with igt, and 53% of those with cfrd fh, with an overall prevalence of 22% . Nutritional status and pulmonary function begin to decline several years before the diagnosis of cfrd, in the pre - diabetic period (8,9), where clinical deterioration correlates with the degree of insulin insufficiency (10). Insulin insufficiency allows a catabolic state, negatively impacting nutrition and lung function (9,11). We hypothesized that ifg, as part of the spectrum of glucose tolerance abnormalities in cf, would be associated with worse outcomes . Mortality was significantly reduced in patients with ifg, and lung function was better in pediatric patients with ifg in the igt group and not significantly worse in adults with ifg and igt or in children and adults with ifg in the ngt and cfrd fh groups . An explanation for the unexpected association of ifg with improved or no worse clinical outcomes may lie in the etiology of ifg . In the general population, epidemiologic studies suggest that ifg and igt are two distinct categories with only partial overlap (1215). Both ifg and igt identify individuals at risk for future diabetes, involve impairment of early (first - phase) insulin secretion, and are associated with insulin resistance (16)., it occurs primarily in the liver, which results in excessive hepatic glucose production (hgp) and fasting hyperglycemia despite normal fasting insulin levels . Fasting hyperglycemia may also be related to impaired glucose mediated glucose uptake (glucose uptake not related to insulin, which predominates in the fasting state) (14). Because peripheral muscle insulin sensitivity and late (second - phase) insulin secretion are normal in patients with ifg, glucose levels normalize after a glucose load . In contrast, insulin resistance in igt occurs primarily in skeletal muscle; this, combined with defective second phase insulin secretion, results in postload hyperglycemia (12,15). In cf, euglycemic clamp studies demonstrate normal peripheral insulin sensitivity in nondiabetic cf patients and only mild peripheral insulin resistance in those with diabetes (17). For reasons that are unclear, in contrast to peripheral skeletal muscle, hepatic insulin resistance with increased hgp is found even in nondiabetic cf patients with completely nfg levels (1720). Glucose - mediated glucose uptake is normal (17). Because elevated hgp correlates with resting energy expenditure (18), we and others (17,18) have hypothesized that nfg levels are seen in the face of increased hgp because of an adaptive physiologic balance between high glucose utilization and elevated glucose production . The current study supports this hypothesis since healthier, better nourished cf patients would be expected to have lower resting energy needs in the fasting state, thus less ability to metabolize extra glucose produced by the liver and leading to ifg (fig . A: in the normal population, fasting hgp is balanced by total body glucose utilization (gu). B: inflammation, undernutrition, and perhaps the cf gene defect increase gu in cf patients . Hgp is elevated for reasons that are not understood very well, but fasting glucose levels are normal when hgp and gu are in balance . C: in healthier cf patients, hgp is similarly elevated but gu is reduced, leading to ifg . The relation between ifg and better pulmonary status was only seen in the patients with igt . This relation was not seen in the ngt patients, who were healthier as a group . In the cfrd fh group, the relation between ifg and clinical status may have been obscured by the greater degree of inflammation and peripheral insulin resistance that characterizes cf patients with diabetes . Nonetheless, the greatest impact on survival was seen in the cfrd fh group (the study group at the highest risk for imminent death). Within the igt group, children with ifg and their control subjects were the same age, while adults with ifg were 2.4 years older than their control subjects . Although the difference in lung function compared with control subjects was only significant in children, the observation that adults with igt and ifg were no worse than their younger control subjects may be clinically important since lung function declines with age in cf . Unlike the general population where ifg is a pre - diabetic state, the current study demonstrates that ifg does not appear to be an independent risk factor for the progression to diabetes in cf, although there is a nonstatistically significant suggestion that it may confer increased risk in those with ngt . The extraordinarily high rate of progressive glucose tolerance abnormalities leading to diabetes in cf may overwhelm any relation between ifg and the future risk of diabetes . While igt is well known to be a risk factor for cardiovascular disease in the general population, it was initially reported that no such association existed for ifg (21). In the framingham heart study, however, ifg was found to be associated with increased risk of coronary heart disease in women but not men (22). This is interesting given that a sex difference in mortality has also been reported in cfrd . The added diagnosis of diabetes has been associated with reduced survival in women but not men with cf, albeit from inflammatory lung rather than inflammatory cardiovascular disease (23,24). Recently gender differences in mortality have disappeared at um, perhaps because of more aggressive diabetes screening and treatment (25). No sex differences were apparent in the current study, but the sample size may have been too small for meaningful conclusions . Greater variability in lung function was seen in adults with ngt, and it cannot be ruled out that the sample was too small to detect clinically significant differences . Longitudinal assessment of this cohort will be important to determine whether current findings persist . Ifg subjects and control subjects were matched by age at ogtt rather than year of entry so that the ifg case subjects were enrolled on average 16 months earlier than the nfg control subjects (significant only in the cfrd fh group). At um and elsewhere, the cf population has shown a trend toward improvement in outcomes over the years, implying later enrollment would confer improved clinical outcome . Thus, the earlier enrollment would be expected to result in a bias toward worse clinical outcomes, rather than the better results that were found in the ifg group . In summary, ifg is relatively common in the cf population . It does not signify increased risk of progression to diabetes . In our study, it is associated with improved survival, and it appears to be associated with improved pulmonary status in pediatric patients with igt.
Surgical outcomes from 430 dsek cases performed by a single surgeon in a tertiary eye hospital were compiled and analyzed retrospectively to assess the rate and types of complications with their management . Skb) had undertaken wet - lab and skill transfer courses from accomplished dsek surgeons abroad before starting the procedure . The informed written consent was obtained from all patients after institutional review board approval and the study was in accordance with the declaration of helsinki . Four hundred and thirty eyes of 366 patients underwent dsek from july 2006 through june 2011 . The median age of these patients was 59.5 years (range: 4 - 92 years). Most eyes had pseudophakic corneal edema and/or bullous keratopathy (259 eyes) of which 225 (52.3%) eyes had posterior chamber intraocular lens (pciol) and 34 (7.9%) eyes had anterior chamber intraocular lens (aciol). Fuchs dystrophy with different grades of cataract was present in 98 (22.8%) eyes and post - pkp failed graft in 32 (7.4%) eyes . Preoperative diagnosis (no . Of eyes=430) all the dsek procedures were performed using the similar technique . The preoperative donor endothelial cell density (ecd) was 2200 cell / mm (range 2214 - 3305 cell / mm; median: 2441 cells / mm). The donor dissection was performed manually after mounting the donor tissue on barron's artificial anterior chamber (katena, usa) and 60:40 taco forceps technique was used for donor insertion . The unfolding of the donor tissue was performed by injection of balanced salt solution (bss) and air from the sideports . In 98 cases, where the patients presented with moderate to severe fuchs dystrophy with some degree of cataract, the dsek procedure was combined with phacoemulsification (pe) or manual small incision cataract surgery (msics) with pciol implantation . The detailed description of the surgical technique used by the author was published earlier . The intraocular lens (iol) exchange and secondary pciol implantation were performed in seven eyes . Early postoperative complications were defined as those complications that happened within 2 months of surgery and late complications were those, which occurred after 2 months . The corneal graft that had not cleared even after 2 months of surgery was classified as pgf . The periodic ecd was analyzed postoperatively for each patient until the last follow - up visit . The follow - up period was between 3 and 60 months (mean 18.7 months). Any complication either intraoperative or postoperative, which happened, was managed either medically, or by appropriate surgical means . An excel (microsoft, redmond, wa, usa) spreadsheet was used to compile the complications and calculate the results . Table 2 shows the operative complications in relation to the donor dissection . In three (0.7%) cases, the donor button was changed with a new one because of poor donor preparation . In 10 (2.3%) cases, additional donor tissue preparation complications such as button - holes or thin donor posterior lenticule (0.5%) cases, donor button was replaced with a new one because of reverse donor unfolding; and one donor button came out during forcible injection of air while giving air tamponed . So, during operation the overall donor button damage was in six (1.4%) cases, and in all cases the button was replaced with a new button immediately . Intraoperative complications during donor dissection (n=13) operative complications during recipient procedure (n=20) table 4 enumerates the important early postoperative complications . The two most common complications in early postoperative period were air - induced pupillary block glaucoma in 12 (2.8%) eyes [fig . 2a and b], one case had interface fungal infection [fig . 3a and b], and one case had postoperative bacterial endophthalmitis . Early postoperative complications (n=50) (a) air - induced pupillary block; (b) air - induced pupillary block in slit section (a) primary graft failure; (b) primary graft failure in slit section (a) interface infection 7 day postoperative; (b) interface infection in slit section air - induced pupillary block glaucoma cases were initially treated with intravenous injection of mannitol and pupillary dilatation . In eight (66.7%) eyes, pupil dilated and air bubble moved anteriorly with releif of pupillary block . But in four (33.3%) cases, under topical or peribulbar anesthesia, air bubble was brought anteriorly by tapping the iris with a sinskey's hook from the sideports . It is more with aphakic bullous keratopathy cases, aciol cases, and post - pkp - failed graft cases . It is also interesting to note that the incidence is highest in the initial 100 cases and reduced with time . In 18 (85.7%) eyes, donor dislocation occurred within 24 h of surgery, but in three cases, it happened after 7 days after the first follow - up visit . Once the donor dislocation was detected, it was immediately treated by repositioning of the donor tissue and rebubbling . In all dislocation cases, repositioning and rebubbling table 6 shows the details of donor dislocation management, its success and failures, and repeat procedures . In three eyes, finally they were converted into pkp . In partial non - attachment cases, (a) donor dislocation on 2 day; (b) donor dislocation on 2 day in slit section; (c) donor dislocation on 2 day anterior segment oct picture; (d) donor reattachment after repositioning and rebubbling donor dislocation: overview (n=21) donor dislocation management: success and failures and repeat procedures (n=21) excluding the pupillary block glaucoma, seven eyes had glaucoma in early postoperative period due to other factors such as previous toxic anterior segment syndrome (tass) in three cases, past history of glaucoma surgery in three cases, and iridocorneal endothelial syndrome in one case . They were initially treated with oral and topical antiglaucoma medications, but ultimately, in two cases, trabeculectomy with mitomycin - c and in one eye cyclocryopexy was required . The tass occurred in two eyes where dsek was combined with pe and foldable hydrophobic acrylic iol implantation [fig . They were treated with systemic and frequent topical steroids, cycloplegic, and intraocular pressure - lowering agents . (a) toxic anterior segment syndrome at 7 day; (b) toxic anterior segment syndrome note the anterior uveitis in pgf cases, re - dsek was performed with a fresh healthy donor tissue as early as possible . In case of interface infection, a therapeutic pkp with very good optical quality tissue the culture report was fusarium spp . And the patient was further treated with antifungal agents . The bacterial culture was positive for bacillus cereus . In spite of urgent therapeutic pkp and vitrectomy, the eye could not be saved and evetually it was eviscerated on the 5 day . Table 7 shows the overall causes of graft failure in 11 cases in early postoperative period, that is, within first 2 months after the surgery . Early graft failure (within first 2 months) and final management (n=11) table 8 shows the details of overall complications in the late postoperative period . In this period, the other important complications were late interface opacification in 13 (3.1%) eyes, endothelial graft rejection occurred in five (1.2%) eyes, epithelial ingrowth in two eyes, and late infectious keratitis in two eyes . Fourteen (3.3%) patients had late secondary graft failure between 6 and 54 months . Late postoperative complications (of 424 patients) the most common cause of secondary glaucoma in late postoperative period was steroid - induced glaucoma in 35 (8.3%) eyes . Initially, all the secondary glaucoma cases were treated with antiglaucoma medications, and topical steroids were reduced, changed, or withdrawn in selected cases . In one eye, the intervened surgical methods were trabeculectomy with mitomycin - c in five cases and ahmed glaucoma valve (agv) in two cases . One was with iridocorneo endothelial (ice) syndrome and the other case was with congenital hereditary endothelial dystrophy (ched). Among the five cases of late secondary angle closure glaucoma (acg), 360 adhesion was noticed between the iris and the donor lenticular edge [fig . Breaking of adhesion cured the secondary glaucoma; but in two eyes, as the graft health was not good, repeat dsek procedure was performed after breaking the adhesion . All of these cases are doing fine with clear graft until their last follow - up . Causes and number of patients developed late secondary glaucoma (n=48) (a) clear graft in dsek after 3 years total cupping; (c) normal optic nerve of the other eye (a) 360 peripheral anterior synechia; (b) 360 peripheral anterior synechia iris bombe five (1.2%) eyes had endothelial graft rejection that occurred between 11 and 36 months after the dsek procedure [fig . Three patients with graft rejection presented with sudden dimness of vision and photophobia; but in two cases, the rejection episodes were diagnosed during routine examination . All eyes had keratic precipitates and anterior chamber cells, with diffuse corneal edema in three cases . But none of the eyes developed endothelial rejection line . Graft rejection cases were treated immediately by intravenous methyl prednisolone injection and frequent topical prednisolone acetate eye drop . In three cases, the rejection episode was reversed with medication and the grafts were cleared [fig . But, in two eyes graft edema persisted even after maximum medication and re - dsek was eventually required . (a) endothelial graft rejection in dsek; (b) endothelial graft rejection in dsek note corneal edema with descemet's folds; (c) same eye after two doses of intravenous methyl prednisolone interface opacification was another complication noticed in 13 eyes (3.1%), and in all cases, it occurred 6 months after the surgery [fig . This was mostly [10 eyes (2.4%)] with the tass - related pbk cases . (a) late interface opacification in the pupillary area; (b) late interface opacification in slit section secondary graft failure occurred in 14 (3.3%) cases between 6 and 54 months after the dsek procedure [fig . 10a - c]. Of these, eight (2.4%) eyes were with pciol, four (11.7%) eyes had previous aciol, and two (13.3%) eyes were aphakic . In nine eyes, the dsek graft failed 3 years after the surgery . Among 14 cases, three cases (two with aphakia and one eye with aciol) were treated with pkp and one case was lost to follow - up . (a) clear graft 2.5 years after dsek; (b) late graft failure same eye after 3.5 years; (c) late graft failure in slit section same eye after 3.5 years; (d) re - dsek - same eye postoperative 3 months epithelial ingrowth was seen in two cases, and in both cases, venting incisions were given during surgery . Late infectious keratitis occurred in two cases one after 8 months and the other after 18 months of the surgery [figs . 11 and 12]. In both the cases, there was history of foreign body entry in the eye one case developed cataract (of 5 phakic cases where dsek was performed alone without lens extraction) after 18 months of surgery and treated with pe with pc iol implantation . Late infective keratitis with interface hypopyon percentage of periodic endothelial cell loss over last 5 years the overall median ecl after 3 months was 19.7% . It was 32.5%, 38.9%, 42.2%, 47.1%, and 54.2% after 1 year, 2 years, 3 years, 4 years, and 5 years, respectively [table 10]. However, the ecl had not been analyzed independently with different group of patients and with or without complications, such as donor dislocation and rebubbling, secondary glaucoma, rejection episode, etc . Periodic endothelial cell loss following manual dsek seven (1.6%) eyes developed cystoid macular edema, between 4 and 11 months after surgery and they were treated with sub - tenon's injection of triamcinolone acetonide, and nepafenac eye drop - q.i.d . For 3 months . In all cases, the total number of graft failure in this series was 31 (7.2%) cases that occurred between day 1 and 5 years after the surgery [table 11]. Eleven (2.6%) of them happened within 2 months of dsek procedures and in 20 eyes graft failed (4.7%) after that . Total graft failure following manual dsek procedure (n=31) summary of repeat surgery in failed - dsek cases (n=31) table 2 shows the operative complications in relation to the donor dissection . In three (0.7%) cases, the donor button was changed with a new one because of poor donor preparation . In 10 (2.3%) cases, additional donor tissue preparation complications such as button - holes or thin donor posterior lenticule (0.5%) cases, donor button was replaced with a new one because of reverse donor unfolding; and one donor button came out during forcible injection of air while giving air tamponed . So, during operation the overall donor button damage was in six (1.4%) cases, and in all cases the button was replaced with a new button immediately . Intraoperative complications during donor dissection (n=13) operative complications during recipient procedure (n=20) the two most common complications in early postoperative period were air - induced pupillary block glaucoma in 12 (2.8%) eyes [fig . 2a and b], one case had interface fungal infection [fig . 3a and b], and one case had postoperative bacterial endophthalmitis . Early postoperative complications (n=50) (a) air - induced pupillary block; (b) air - induced pupillary block in slit section (a) primary graft failure; (b) primary graft failure in slit section (a) interface infection 7 day postoperative; (b) interface infection in slit section air - induced pupillary block glaucoma cases were initially treated with intravenous injection of mannitol and pupillary dilatation . In eight (66.7%) eyes, pupil dilated and air bubble moved anteriorly with releif of pupillary block . But in four (33.3%) cases, under topical or peribulbar anesthesia, air bubble was brought anteriorly by tapping the iris with a sinskey's hook from the sideports . It is more with aphakic bullous keratopathy cases, aciol cases, and post - pkp - failed graft cases . It is also interesting to note that the incidence is highest in the initial 100 cases and reduced with time . In 18 (85.7%) eyes, donor dislocation occurred within 24 h of surgery, but in three cases, it happened after 7 days after the first follow - up visit . Once the donor dislocation was detected, it was immediately treated by repositioning of the donor tissue and rebubbling . In all dislocation cases, repositioning and rebubbling table 6 shows the details of donor dislocation management, its success and failures, and repeat procedures . In three eyes, finally they were converted into pkp . In partial non - attachment cases (a) donor dislocation on 2 day; (b) donor dislocation on 2 day in slit section; (c) donor dislocation on 2 day anterior segment oct picture; (d) donor reattachment after repositioning and rebubbling donor dislocation: overview (n=21) donor dislocation management: success and failures and repeat procedures (n=21) excluding the pupillary block glaucoma, seven eyes had glaucoma in early postoperative period due to other factors such as previous toxic anterior segment syndrome (tass) in three cases, past history of glaucoma surgery in three cases, and iridocorneal endothelial syndrome in one case . They were initially treated with oral and topical antiglaucoma medications, but ultimately, in two cases, trabeculectomy with mitomycin - c and in one eye cyclocryopexy was required . The tass occurred in two eyes where dsek was combined with pe and foldable hydrophobic acrylic iol implantation [fig . They were treated with systemic and frequent topical steroids, cycloplegic, and intraocular pressure - lowering agents . (a) toxic anterior segment syndrome at 7 day; (b) toxic anterior segment syndrome note the anterior uveitis in pgf cases, re - dsek was performed with a fresh healthy donor tissue as early as possible . In case of interface infection, a therapeutic pkp with very good optical quality tissue was immediately performed . The bacterial culture was positive for bacillus cereus . In spite of urgent therapeutic pkp and vitrectomy, the eye could not be saved and evetually it was eviscerated on the 5 day . Table 7 shows the overall causes of graft failure in 11 cases in early postoperative period, that is, within first 2 months after the surgery . Table 8 shows the details of overall complications in the late postoperative period . In this period, the other important complications were late interface opacification in 13 (3.1%) eyes, endothelial graft rejection occurred in five (1.2%) eyes, epithelial ingrowth in two eyes, and late infectious keratitis in two eyes . Fourteen (3.3%) patients had late secondary graft failure between 6 and 54 months . Late postoperative complications (of 424 patients) the most common cause of secondary glaucoma in late postoperative period was steroid - induced glaucoma in 35 (8.3%) eyes . Initially, all the secondary glaucoma cases were treated with antiglaucoma medications, and topical steroids were reduced, changed, or withdrawn in selected cases . In one eye, developed total glaucomatous optic atrophy inspite of crystal clear graft [fig . The intervened surgical methods were trabeculectomy with mitomycin - c in five cases and ahmed glaucoma valve (agv) in two cases . One was with iridocorneo endothelial (ice) syndrome and the other case was with congenital hereditary endothelial dystrophy (ched). Among the five cases of late secondary angle closure glaucoma (acg), 360 adhesion was noticed between the iris and the donor lenticular edge [fig . Breaking of adhesion cured the secondary glaucoma; but in two eyes, as the graft health was not good, repeat dsek procedure was performed after breaking the adhesion . All of these cases are doing fine with clear graft until their last follow - up . Causes and number of patients developed late secondary glaucoma (n=48) (a) clear graft in dsek after 3 years secondary glaucoma; (b) glaucomatous optic atrophy total cupping; (c) normal optic nerve of the other eye (a) 360 peripheral anterior synechia; (b) 360 peripheral anterior synechia iris bombe five (1.2%) eyes had endothelial graft rejection that occurred between 11 and 36 months after the dsek procedure [fig . Three patients with graft rejection presented with sudden dimness of vision and photophobia; but in two cases, the rejection episodes were diagnosed during routine examination . All eyes had keratic precipitates and anterior chamber cells, with diffuse corneal edema in three cases . But none of the eyes developed endothelial rejection line . Graft rejection cases were treated immediately by intravenous methyl prednisolone injection and frequent topical prednisolone acetate eye drop . In three cases, the rejection episode was reversed with medication and the grafts were cleared [fig . But, in two eyes graft edema persisted even after maximum medication and re - dsek was eventually required . (a) endothelial graft rejection in dsek; (b) endothelial graft rejection in dsek note corneal edema with descemet's folds; (c) same eye after two doses of intravenous methyl prednisolone interface opacification was another complication noticed in 13 eyes (3.1%), and in all cases, it occurred 6 months after the surgery [fig . This was mostly [10 eyes (2.4%)] with the tass - related pbk cases . (a) late interface opacification in the pupillary area; (b) late interface opacification in slit section secondary graft failure occurred in 14 (3.3%) cases between 6 and 54 months after the dsek procedure [fig . 10a - c]. Of these, eight (2.4%) eyes were with pciol, four (11.7%) eyes had previous aciol, and two (13.3%) eyes were aphakic . In nine eyes, three cases (two with aphakia and one eye with aciol) were treated with pkp and one case was lost to follow - up . (a) clear graft 2.5 years after dsek; (b) late graft failure same eye after 3.5 years; (c) late graft failure in slit section same eye after 3.5 years; (d) re - dsek - same eye postoperative 3 months epithelial ingrowth was seen in two cases, and in both cases, venting incisions were given during surgery . Late infectious keratitis occurred in two cases one after 8 months and the other after 18 months of the surgery [figs . 11 and 12]. In both the cases, there was history of foreign body entry in the eye one case developed cataract (of 5 phakic cases where dsek was performed alone without lens extraction) after 18 months of surgery and treated with pe with pc iol implantation . Late infective keratitis with interface hypopyon percentage of periodic endothelial cell loss over last 5 years the overall median ecl after 3 months was 19.7% . It was 32.5%, 38.9%, 42.2%, 47.1%, and 54.2% after 1 year, 2 years, 3 years, 4 years, and 5 years, respectively [table 10]. However, the ecl had not been analyzed independently with different group of patients and with or without complications, such as donor dislocation and rebubbling, secondary glaucoma, rejection episode, etc . Periodic endothelial cell loss following manual dsek seven (1.6%) eyes developed cystoid macular edema, between 4 and 11 months after surgery and they were treated with sub - tenon's injection of triamcinolone acetonide, and nepafenac eye drop - q.i.d . For 3 months . In all cases, macular edema resolved with improvement of vision . The total number of graft failure in this series was 31 (7.2%) cases that occurred between day 1 and 5 years after the surgery [table 11]. Eleven (2.6%) of them happened within 2 months of dsek procedures and in 20 eyes graft failed (4.7%) after that . Total graft failure following manual dsek procedure (n=31) summary of repeat surgery in failed - dsek cases (n=31) the most common cause of secondary glaucoma in late postoperative period was steroid - induced glaucoma in 35 (8.3%) eyes . Initially, all the secondary glaucoma cases were treated with antiglaucoma medications, and topical steroids were reduced, changed, or withdrawn in selected cases . In one eye, the intervened surgical methods were trabeculectomy with mitomycin - c in five cases and ahmed glaucoma valve (agv) in two cases . One was with iridocorneo endothelial (ice) syndrome and the other case was with congenital hereditary endothelial dystrophy (ched). Among the five cases of late secondary angle closure glaucoma (acg), 360 adhesion was noticed between the iris and the donor lenticular edge [fig . Breaking of adhesion cured the secondary glaucoma; but in two eyes, as the graft health was not good, repeat dsek procedure was performed after breaking the adhesion . All of these cases are doing fine with clear graft until their last follow - up . Causes and number of patients developed late secondary glaucoma (n=48) (a) clear graft in dsek after 3 years secondary glaucoma; (b) glaucomatous optic atrophy total cupping; (c) normal optic nerve of the other eye (a) 360 peripheral anterior synechia; (b) 360 peripheral anterior synechia iris bombe five (1.2%) eyes had endothelial graft rejection that occurred between 11 and 36 months after the dsek procedure [fig . Three patients with graft rejection presented with sudden dimness of vision and photophobia; but in two cases, the rejection episodes were diagnosed during routine examination . All eyes had keratic precipitates and anterior chamber cells, with diffuse corneal edema in three cases . But none of the eyes developed endothelial rejection line . Graft rejection cases were treated immediately by intravenous methyl prednisolone injection and frequent topical prednisolone acetate eye drop . In three cases, the rejection episode was reversed with medication and the grafts were cleared [fig . But, in two eyes graft edema persisted even after maximum medication and re - dsek was eventually required . (a) endothelial graft rejection in dsek; (b) endothelial graft rejection in dsek note corneal edema with descemet's folds; (c) same eye after two doses of intravenous methyl prednisolone interface opacification was another complication noticed in 13 eyes (3.1%), and in all cases, it occurred 6 months after the surgery [fig . This was mostly [10 eyes (2.4%)] with the tass - related pbk cases . (a) late interface opacification in the pupillary area; (b) late interface opacification in slit section secondary graft failure occurred in 14 (3.3%) cases between 6 and 54 months after the dsek procedure [fig . 10a - c]. Of these, eight (2.4%) eyes were with pciol, four (11.7%) eyes had previous aciol, and two (13.3%) eyes were aphakic . In nine eyes, three cases (two with aphakia and one eye with aciol) were treated with pkp and one case was lost to follow - up . (a) clear graft 2.5 years after dsek; (b) late graft failure same eye after 3.5 years; (c) late graft failure in slit section same eye after 3.5 years; (d) re - dsek - same eye postoperative 3 months epithelial ingrowth was seen in two cases, and in both cases, venting incisions were given during surgery . Late infectious keratitis occurred in two cases one after 8 months and the other after 18 months of the surgery [figs . 11 and 12]. In both the cases, there was history of foreign body entry in the eye one case developed cataract (of 5 phakic cases where dsek was performed alone without lens extraction) after 18 months of surgery and treated with pe with pc iol implantation . Late infective keratitis with interface hypopyon percentage of periodic endothelial cell loss over last 5 years it was 32.5%, 38.9%, 42.2%, 47.1%, and 54.2% after 1 year, 2 years, 3 years, 4 years, and 5 years, respectively [table 10]. However, the ecl had not been analyzed independently with different group of patients and with or without complications, such as donor dislocation and rebubbling, secondary glaucoma, rejection episode, etc . Periodic endothelial cell loss following manual dsek seven (1.6%) eyes developed cystoid macular edema, between 4 and 11 months after surgery and they were treated with sub - tenon's injection of triamcinolone acetonide, and nepafenac eye drop - q.i.d . For 3 months . In all cases, macular edema resolved with improvement of vision . The total number of graft failure in this series was 31 (7.2%) cases that occurred between day 1 and 5 years after the surgery [table 11]. Eleven (2.6%) of them happened within 2 months of dsek procedures and in 20 eyes graft failed (4.7%) after that . Total graft failure following manual dsek procedure (n=31) summary of repeat surgery in failed - dsek cases (n=31) the dsek offers an effective and efficient alternative to traditional pkp for the treatment of corneal endothelial dysfunctions . As a relatively new procedure, as previously reported, such complications include pupillary block by air, donor dislocation, graft failure secondary glaucoma, and graft rejection . The potential causes of donor dislocation include the presence of interface viscous fluid or air, patient squeezing, and eye rubbing . There are complications with the preparation, handling, and insertion of donor lamellar tissue into the anterior chamber of the recipient . But most of the reported complications are with automated dissection of the donor tissue, that is, with dsaek and most of the reports did not cover the management of each complication . One with microkeratome - related dissection where four tissues were discarded because of imperfect cut and one with manual dissection where the incidence of donor descemet's perforation was 4.4% . In this series, there were other problems that have not been reported earlier, such as excessive donor thickness for which the donor tissue was discarded . Two other important intraoperative complications happened where the donor tissue were discarded and replaced with a new one . One was reverse unfolding in two eyes during injecting air from the side port, and in another case, the donor tissue came out of the a / c during unfolding . As previously described, pupillary block by air is an important complication of dsek procedure . In fact, the reported incidence of pupillary block varies between 0.5% and 13% in different series . This is due to the displacement of an excessively large air bubble . In this series, but in last 130 cases, it happened only in one (0.8%) eye . The incidence could be prevented drastically by placing a freely mobile air bubble and put a drop of cycloplegic at the end of the surgery as recommended by terry et al . Donor dislocation is one of the most important complication and the rates varied from 0% to 82%, with an average dislocation rate of 14.5% . The graft dislocation may represent either fluid in the interface of an otherwise well - positioned graft or complete dislocation into the anterior chamber . In this series, it is interesting to note that the incidence of this unique complication is reduced with experience, and the same author had reported 8% dislocation rate in 2008 . Price and price reported a dislocation rate of 50% in the first 10 eyes undergoing dsaek, which was reduced to 13% in the next 126 cases after changing the procedure to include face - up positioning after surgery and smoothening of the corneal surface . Several other authors have shown the similar results that, with experience and time, the dislocation rate is reduced . The results of dislocation management are also satisfactory with a success rate of 72.3% that is comparable with other published series . In this study, the donor dislocation was highest in aphakic, aciol, and post - pkp cases compared with uncomplicated pbk and fuchs dystrophy cases . So case selection is an important criteria and special precautions are to be taken in this kind of complicated cases . Re - dislocation of donor lenticule, even after rebubbling, is also higher in these cases . The published studies showed rates of pgf from 0% to 29%, with an average pgf rate of 5% . Poor surgical technique has been linked to pgf in dsek, with surgeon inexperience and related excessive of iatrogenic intraoperative manipulation donor endothelial as the main factor . In fact, some studies refer to this entity as iatrogenic pgf . In this series, the pgf happened in only three (0.7%) eyes and one of them after donor dislocation and subsequent rebubbling . Published reports on secondary glaucoma after dsek was between 0% and 15%, with an average of 3% . In this series, the incidence of secondary glaucoma was 11.8% and the commonest cause of this late secondary glaucoma was topical corticosteroids - induced (8.3%). Most of the patients showed rise in iop after 3 months of surgery . Some of the patients had previous history of open - angle glaucoma and also it was more with abk and post - pkp - failed graft cases . As previously reported, patients with a preoperative diagnosis of fuchs endothelial dystrophy did not show a statistically significant increase in iop compared with other group . In this study, two the four eyes with ice syndrome initially remained good, but later failed due to progressive peripheral anterior synechia formation . So, ice syndrome may not be a good indication of dsek, because of continuous nature of the disease . The dsek in ched is often difficult and corneal edema takes long time to clear . In some cases, it is not possible to score and strip the dm, and to work under shallow ac and poor visualization due to thickened edematous cornea . There is also a case report on abandoning the procedure and converting to a pk on operation table due to these technical difficulties . Of the four eyes in this series, dm stripping was not possible in two eyes, in one eye it was partial, and only in one eye it was easy . In two eyes, corneal edema cleared after 6 months, and in one eye, there was residual diffuse stromal opacity . One eye developed secondary glaucoma and ultimately the graft failed . Among reviewed studies, the endothelial rejection rates varied from 0% to 45.5%, with an average rejection rate of 10% with the follow - up ranging from 3 to 24 months . In this series, the rejection happened with five (1.2%) cases that is low compared with most of the study, although some studies reported the incidence as 0% . Allan et al . Reported that 15 (7.5%) of 199 eyes had a graft rejection episode within the first 2 years after dsek or deep lamellar endothelial keratoplasty, a rate less frequent than in their series of patients who underwent pkp . In this series, the clinical presentations of endothelial rejection were similar with previous study; however, no rejection line was noticed in any of the five cases . Three cases were reversed with intravenous injection of methyl prednisolone and topical steroids, with two cases progressing to graft failure requiring redo procedure . Epithelial ingrowth, interface opacification, and interface hemorrhages are less common complications in this series and these are comparable with reported studies . Among these, interface opacity is one of the important reasons for repeat endothelial keratoplasty (rek) as reported by letko et al . Interface fibrosis was also described histo - pathologically in failed dsaek cases where pkp procedure was performed later on . The incomplete removal of dm as a cause of partial graft detachment in dsaek has been reported . In this series, partial donor detachment happened in three cases and with time they attached completely . In all three cases, the graft was initially attached in more than two - third area . Postoperative cystoid macular edema developed in seven (1.7%) eyes, which resolved with topical nonsteroidal anti - inflammatory agent and sub - tenon triamcinolone acetonide injections . Two cases of retinal detachment may not be directly related to the dsek procedure: in one case, it was aciol - related pbk, and in the other case, the patient was highly myopic . The corneal surgeon should consult a retinal specialist whenever the patient complains of suboptimal or sudden drop of vision in spite of a clear graft . In this series, the median ecl in manual dsek in different postoperative periods is almost similar to the automated procedure or dsaek of other series using similar donor insertion technique . The dsek grafts experienced more initial cell loss until 1 year, and then a slow and steady cell loss over next 4 years . This is consistent with an earlier finding that cell loss in dsek patients plateaus more quickly . Furthermore, the 5-year ecl after manual dsek compared favorably with that measured after pkp in the cornea donor study (54.7% versus 70%). Late secondary donor failure due to the reported late graft failure varies between 0 and 45% after 1 year with an average of 6% in the 1 year . In this series, late secondary donor failure occurred in 14 (3.3%) eyes, which is comparable with other series and it happened between 10 months and 5 years . Late graft failure was more in dsek in pseudophakic eyes with aciols than with pciols (11.7% versus 2.4%). Previous studies have also showed that ecl in dsaek in pseudophakic eyes with aciols is higher and the graft failure was 16% up to 30 months follow - up . Although dsek surgery in patients with an aciol remains controversial, considering the outcomes from different studies, this is a good surgical option in selected cases . As the published report of dsek beyond 5 years are few in number, so long - term graft clarity with dsek is yet to be determined . Showed that only four (7.8%) eyes had late donor failure among 51 cases in their longest follow - up of more than 5 years . The failed dsek cases, early or late can be managed by redo procedure in majority (54.8%) of the cases . The infection following dsek procedure, either in the form of interface keratitis and endophthalmitis in early postoperative period, or delayed keratitis after 3 months is always serious and has already been reported in literature . They were managed either medically or by pkp . In this series, in early period, one interface fungal keratitis with candida, and one fulminant endophthalmitis occurred with b. cereus for which evisceration was required on the 5 day . Of these cases, one responded to medical treatment with resolution of the infection and the second case required a therapeutic pkp . As a fairly new procedure, the relative inexperience of surgeons in earlier cases may account for more graft manipulation and ecl during surgery . In addition, the dsek in certain indications have more complications than clean case of pciol - related pbk or fuchs endothelial dystrophy . These eyes are aphakic eyes, aciol - related pbk, post - pkp - failed graft, ched, and ice syndrome . In aphakic cases, there are reports of posterior dislocation of the donor disc into the vitreous cavity with or without retinal detachment . Other difficult cases are vitreous in the anterior chamber, previous large peripheral iridectomy, large yag capsulotomy even in presence of pciol, and a large filtration bleb . An experienced surgeon can perform these difficult cases, but with extra precautions and care, and these cases may require additional procedures . All the surgeries were performed by single surgeon with a maximum follow - up period of 5 years . For late complications, so the long - term delayed complications may not be reflected properly in this series . However, to the best of my knowledge after medline search, this is a compilation of complications of the largest series of manual dissection of dsek performed by single surgeon with the same technique for a period of more than 5 years . In conclusion, the dsek / dsaek is an exciting and promising alternative procedure to the traditional pkp . Like other corneal transplantation surgeries, the learning curve is steep and the potential for complications is significant during first few cases . Both operative and postoperative complications do occur in dsek and increases with the longer postoperative follow - up, but all very much within acceptable limit . The re - dsek procedure can be easily performed in most of the failed cases with satisfactory results.
On february 13, 1996, a 7-year - old boy from doihue in administrative region vi was admitted to the hospital clnico fusat of rancagua in the region (figure 1) with a 2-day history of adynamia and dizziness . On admission,, progressive paralysis developed that evolved to respiratory failure; the boy was connected to a mechanical ventilator . Cat scan showed diffuse cerebral edema, and the electroencephalogram indicated no electric activity . Intracranial hypertension developed, and the patient map of south america showing the geographic position of chile and map of chile presenting the geographic distribution of the administrative regions of the country . A virus was considered the most probable cause, laboratory tests were conducted to determine the presence of the following viruses: herpes, measles, coxsackie, echo, and polio . Interviews with relatives and the boy s nanny revealed that bats had been observed in the family s house . The nanny also reported that she had seen a bat flying away from the child s toy box . Even though these interviews failed to reveal any direct contact with bats or any history of an animal bite, this epidemiologic information prompted the physicians to suspect rabies . On february 26, 1996, a serum sample and corneal smear were obtained from the patient and sent to the rabies laboratory of the instituto de salud pblica de santiago (isp). A rabies antibody titer of 1:625 was found in the serum specimen by using the indirect fluorescent - antibody (ifa) technique (14). The patient had no history of rabies vaccination to account for the presence of antibodies . The corneal smear was negative for rabies antigen by the direct fluorescent - antibody (dfa) assay (15). On march 4, a second serum sample, the second serum sample was tested simultaneously with the first one by ifa assay, and a titer of 1:15,625 was detected . The saliva sample was negative by dfa assay and suckling mouse inoculation (15,16). The patient died on march 5, 1996, when artificial respiratory support was disconnected . Postmortem tissue samples of cerebral cortex, hippocampus, cerebellum, and nuchal skin biopsy were sent to the isp rabies laboratory for diagnosis . Rabies postexposure prophylaxis with the suckling mouse brain fuenzalida - palacios vaccine was administered to the victim s mother and to 10 health - care providers who had possible contact with the patient s saliva . The rabies postexposure prophylaxis schedule used was 2 ml of vaccine, subcutaneously, on each of days 1, 2, 3, 4, 5, 6, 21, and 90 . Blood samples were taken from vaccinees on day 14 after the initial dose of vaccine; ifa assay showed that adequate immune responses had developed . The virus was isolated from the patient s brain tissue by intracerebral inoculation of suckling mice (16). To help identify the possible source of infection, the virus was antigenically and genetically characterized . Antigenic characterization of the virus was carried out by using a panel of eight monoclonal antibodies directed against the viral nucleoprotein, provided by the centers for disease control and prevention . These analyses identified a rabies antigenic variant associated with tadarida brasiliensis (free - tailed bat) in chile, which had been designated as antigenic variant 4 (agv4) (9,17). Genetic characterization was done by sequencing a 320-bp portion of the rabies virus nucleoprotein gene from nucleotide position 1,157 to 1,476, as compared with the sadb 19 strain (18,19). Briefly, genomic viral rna was extracted from infected tissue by using trizol (invitrogen, san diego, ca, formerly gibco - brl inc .) According to the manufacturer s instructions . Complementary dna was produced by a reverse transcription polymerase chain reaction with primers 10 g and 304 (19) and was sequenced by using the taq big dye termination cycle sequencing ready reaction kit (applied biosystems, foster city, ca), according to the manufacturer s protocol, on an applied biosystems 377 dna automated sequencer (applied biosystems). This human rabies virus isolate was compared with viruses obtained from domestic animals and insectivorous bats in urban centers in chile from 1977 to 1998 (18). Pileup and pretty programs of the wisconsin package, version 10 (genetic computer group, 2000, madison, wi), were used to produce sequence alignments and comparative nucleotide analyses . The programs dnadist (kimura - two parameter), neighbor (neighbor - joining method), and dnapars (parsimony method) from the phylip package, version 3.5 (20), were used in the phylogenetic studies . The bootstrap method, as implemented by the seqboot program from phylip, was followed by the use of dnadist and neighbor for the distance matrix analyses . Although five genetic variants of rabies virus are found in chile (18) (figure 2, groups a to e), a reservoir has been identified for only two: t. brasiliensis (figure 2, group d) and lasiurus sp . Phylogenetic analyses of the chilean human isolate demonstrated that it segregated in group d. this group represents the genetic variant of rabies virus most frequently isolated throughout the country, formed by viruses from the metropolitan region and regions iv, v, vi, vii, viii, ix, and x (figure 1). The high bootstrap value that supports the inclusion of this virus in group d and the very close genetic relationship it has with the other members of this group (average genetic distance 0.5%) clearly show that t. brasiliensis is the likely reservoir of the rabies virus isolated in this case . Neighbor - joining tree comparing the human rabies isolate with representatives of the rabies genetic variants obtained from insectivorous bats and domestic animals in chile (18). Bootstrap values obtained from 100 resamplings of the data by using distance matrix (top) and parsimony methods (bottom) are shown at nodes corresponding to the lineages representing the rabies virus variants (a, b, c, d, and e) currently circulating in chile . Only bootstrap values duvenhage virus, genbank accession number, european bat lyssavirus, myotis chiloensis, roman numerals indicate the administrative region where the sample was obtained, tadarida brasiliensis, metropolitan region, lasiurus borealis . The absence of a history of an animal bite, the clinical presentation of the disease without the classic signs of hydrophobia or aerophobia, and the absence of any human rabies cases for a period of 24 years in chile were the primary reasons that rabies was not first suspected and a definitive diagnosis was delayed in this case . Retrospective studies of human rabies epidemiology have demonstrated that it is not uncommon to observe rabies cases in which there is no history of a bite, mainly in situations involving insectivorous bat rabies variants . For example, of the 17 human rabies cases associated with insectivorous bats reported in the united states from 1980 to 1996, only one had clear documentation of a bite (22). Without proper education, patients may not be aware of the risks from a bat bite . Moreover, the wound may not be appreciated as a concern because of the limited injury inflicted by the bat's small teeth (23). Finally, there may not be an opportunity to obtain a history from a pediatric patient or to discern an exposure that occurs during sleep or other circumstances (24). In cases in which a patient shows clinical signs of central nervous system involvement of unknown or suspected viral origin, health - care providers should be aware of the importance of conducting a thorough medical history to appropriately assess the possibility of rabies . With the important changes in the epidemiologic patterns of rabies in latin america, this disease should be included in the differential diagnosis of neurologic diseases characterized by acute encephalitis and progressive paralysis, even when no previous history of an animal bite exists and even in regions where canine rabies has been eradicated.
Thyroid cancer, the most common type of endocrine malignancy, is becoming increasingly prevalent worldwide and accounts for more deaths than all other endocrine cancers combined.1 in the united states, the yearly incidence rate has nearly tripled from 4.9 per 100,000 in 1975 to 14.3 per 100,000 in 2009.2 similarly, from 1988 to 2009, the incidence rate in the people s republic of china has increased by 2.36 times with an average annual growth rate 5.92%.3 differentiated thyroid cancer (dtc), arising from thyroid follicular cells that include both papillary and follicular histological types, accounts for> 90% of all thyroid cancers.4 following the american thyroid association s guidelines for dtc management, standard care treatments include surgery, radioactive iodine-131 (rai) treatment, and thyroid hormone suppression therapy.5 among this standard regimen, the use of post - thyroidectomy adjuvant rai is associated with dramatic decreases in locoregional recurrences, distant metastasis, and disease - related mortality among patients with dtc.6 however, given the large radioactive iodine doses provided, patients receiving rai need special protection (ie, being housed within radiation isolation wards); as a result, many patients fear radiation exposure, as well as loneliness and pessimism during isolation, which negatively affect their treatment adherence . In modern medicine, health education has become an essential component of treatment . For instance, psychological nursing has been used to intervene in the lives of patients suffering from mental health issues, resulting in improvements to treatment adherence . Thus, we hypothesized that a specialist shared - care approach, including a psychological and behavioral intervention, would be a suitable alternative for improving treatment adherence among patients with dtc undergoing rai . The present study used the quality of life core questionnaire (qlq - c30), self - rating depression scale (sds), and self - rating anxiety score (sas) to compare the influence of psychological and behavioral intervention above and beyond a conventional nursing protocol on postoperative rai for patients suffering from dtc . This study conformed to the principles of the declaration of helsinki7 and was approved by the ethics committee of shandong provincial qianfoshan hospital . Written informed consent was obtained, and participant confidentiality was strictly guarded . From 2013 to 2015, patients with dtc undergoing rai treatment were recruited from the department of endocrinology, shandong provincial qianfoshan hospital . All patients with dtc were confirmed for their disease status through a pathological examination after a total thyroidectomy . Exclusion criteria were as follows: aged <18 years or> 70 years, pre - existing psychiatric diagnosis, or undifferentiated thyroid cancer diagnosis . A single oral dose of rai was administered to all enrolled patients . To compare the influence of psychological and behavioral intervention on patients with dtc undergoing rai, patients were randomly divided into two groups: routine nursing group, and the psychological and behavioral intervention group . The routine nursing group underwent admission education, a medication guide, isolation protection education, and discharge guidance, as is conventionally performed for these patients . As for patients in the psychological and behavioral intervention group, in addition to the routine guidance, we provided a psychological and behavioral intervention protocol, as shown in figure 1 . Briefly, before rai treatment, we conducted detailed interviews with each patient in a quiet ward, without any distraction, to better understand his or her inner feelings and nature of their psychological reaction to the treatment . We also administered a questionnaire survey to assess the degree of the patient s reactivity . Usually, uncertainties regarding the illness and prognosis may give rise to anxiety, depression, and other psychological problems among this patient population . Thus, we needed to establish appropriate communication channels with patients to develop a positive rapport and encourage cooperation . Meanwhile, we attempted to minimize any undesirable stimulation, remove harmful mental barriers, analyze the patients thinking processes and mood changes, encourage them to express their true feelings, and enable them to safely express negative emotions (such as fear, anxiety, or depression) so as to guide them to bravely face the reality of their disease state . After rai, the patients were engaged in one - to - one conversations over the internet, to address any further issues and provide emotional support while they were housed in the isolation ward . To further improve patients social identity and sense of belonging, we regularly organized patient group meetings to allow them to express their own anticancer experiences . Thus, the patient s role transformed from an intervention recipient to an intervention provider, which was beneficial for improving his or her mental health status and life quality . During the entire intervention, we also cooperated with doctors to provide information regarding details of efficacious cases of dtc management, which helps promote methods for encouraging patients to undergo standardized rai treatment regimen . To evaluate health - related quality of life, this internationally acknowledged questionnaire has been validated for assessing health - related quality of life among cancer patients participating in clinical trials, with an internal consistency of> 0.70.8 this questionnaire contains multi - item scales of functional capacities (ie, physical, role, cognitive, emotional, and social), symptom profiles (ie, fatigue, pain, and nausea / vomiting), and global quality of life . For each assessment, the scores range from 0 to 100, with a score of 100 representing perfect functional capacity and very strong symptom experiences.9 to evaluate mental health status, the sds and sas were also utilized at baseline and 1 year after rai . The sds is a self - reported, 20-item measure of depressive symptoms, which has been confirmed as a valid and reliable instrument across several studies.10 the sas is a self - reported measure of anxiety symptoms, which also contains 20 items.11 item responses for both questionnaires are placed on a scale from 1 to 4 (1, rarely; 2, some of the time; 3, very often / often; 4, almost always). The cutoff value for the sds was 53 points, while for sas it was 50 points, with higher scores reflecting more severe depressive or anxiety symptoms . Statistical analysis was performed with statistical package for social science (version 12.0; spss inc . This study conformed to the principles of the declaration of helsinki7 and was approved by the ethics committee of shandong provincial qianfoshan hospital . Written informed consent was obtained, and participant confidentiality was strictly guarded . From 2013 to 2015, patients with dtc undergoing rai treatment were recruited from the department of endocrinology, shandong provincial qianfoshan hospital . All patients with dtc were confirmed for their disease status through a pathological examination after a total thyroidectomy . Exclusion criteria were as follows: aged <18 years or> 70 years, pre - existing psychiatric diagnosis, or undifferentiated thyroid cancer diagnosis . To compare the influence of psychological and behavioral intervention on patients with dtc undergoing rai, patients were randomly divided into two groups: routine nursing group, and the psychological and behavioral intervention group . The routine nursing group underwent admission education, a medication guide, isolation protection education, and discharge guidance, as is conventionally performed for these patients . As for patients in the psychological and behavioral intervention group, in addition to the routine guidance, we provided a psychological and behavioral intervention protocol, as shown in figure 1 . Briefly, before rai treatment, we conducted detailed interviews with each patient in a quiet ward, without any distraction, to better understand his or her inner feelings and nature of their psychological reaction to the treatment . We also administered a questionnaire survey to assess the degree of the patient s reactivity . Usually, uncertainties regarding the illness and prognosis may give rise to anxiety, depression, and other psychological problems among this patient population . Thus, we needed to establish appropriate communication channels with patients to develop a positive rapport and encourage cooperation . Meanwhile, we attempted to minimize any undesirable stimulation, remove harmful mental barriers, analyze the patients thinking processes and mood changes, encourage them to express their true feelings, and enable them to safely express negative emotions (such as fear, anxiety, or depression) so as to guide them to bravely face the reality of their disease state . After the interviews after rai, the patients were engaged in one - to - one conversations over the internet, to address any further issues and provide emotional support while they were housed in the isolation ward . To further improve patients social identity and sense of belonging, we regularly organized patient group meetings to allow them to express their own anticancer experiences . Thus, the patient s role transformed from an intervention recipient to an intervention provider, which was beneficial for improving his or her mental health status and life quality . During the entire intervention, we also cooperated with doctors to provide information regarding details of efficacious cases of dtc management, which helps promote methods for encouraging patients to undergo standardized rai treatment regimen . To evaluate health - related quality of life, the qlq - c30 was used at baseline and 1 year after rai . This internationally acknowledged questionnaire has been validated for assessing health - related quality of life among cancer patients participating in clinical trials, with an internal consistency of> 0.70.8 this questionnaire contains multi - item scales of functional capacities (ie, physical, role, cognitive, emotional, and social), symptom profiles (ie, fatigue, pain, and nausea / vomiting), and global quality of life . For each assessment, the scores range from 0 to 100, with a score of 100 representing perfect functional capacity and very strong symptom experiences.9 to evaluate mental health status, the sds and sas were also utilized at baseline and 1 year after rai . The sds is a self - reported, 20-item measure of depressive symptoms, which has been confirmed as a valid and reliable instrument across several studies.10 the sas is a self - reported measure of anxiety symptoms, which also contains 20 items.11 item responses for both questionnaires are placed on a scale from 1 to 4 (1, rarely; 2, some of the time; 3, very often / often; 4, almost always). The cutoff value for the sds was 53 points, while for sas it was 50 points, with higher scores reflecting more severe depressive or anxiety symptoms . Statistical analysis was performed with statistical package for social science (version 12.0; spss inc ., as shown in figure 2, 60 patients met our inclusion criteria and completed the 1-year follow - up . Of the 30 participants in the routine nursing group (male: 7, female: 23), 27 had papillary carcinoma and three had follicular thyroid carcinoma; the average age was 51.6513.01 . For the remaining 30 participants in the psychological and behavioral intervention group (male: 8, female: 22), 26 had papillary carcinoma and four had follicular thyroid carcinoma; the average age was 50.9210.58 . There were no significant differences in the sex, age, or pathological type between the two groups . As shown in table 1, no qlq - c30 subscales showed a significant difference between the two groups at baseline . After rai, except for nausea / vomiting and pain, all other parameters (ie, physical functioning, role functioning, emotional functioning, cognitive functioning, fatigue, and global quality of life) improved for both groups from before to after rai (p<0.05). Interestingly, when comparing both groups after rai, there was a significant increase on all functional scales (physical, role, cognitive, emotional, and social) and global quality of life in the intervention group (p<0.05). As shown in table 2, patients in both groups displayed higher sds and sas values at baseline compared to those at follow - up . Although there were no significant differences between the two groups before rai, values were significantly higher than the standardized cutoffs (sds: 53, sas: 50, both p<0.05). Thus, all patients reported significant depression and anxiety symptoms prior to rai treatment . At the 1-year follow - up, both groups reported significantly lower sds and sas scores (both p<0.05). Furthermore, this decline was more significant in the intervention group (p<0.05). Therefore, above and beyond a conventional nursing care protocol, the inclusion of psychological and behavioral intervention was more effective in alleviating distress reactions . As shown in table 1, no qlq - c30 subscales showed a significant difference between the two groups at baseline . After rai, except for nausea / vomiting and pain, all other parameters (ie, physical functioning, role functioning, emotional functioning, cognitive functioning, fatigue, and global quality of life) improved for both groups from before to after rai (p<0.05). Interestingly, when comparing both groups after rai, there was a significant increase on all functional scales (physical, role, cognitive, emotional, and social) and global quality of life in the intervention group (p<0.05). As shown in table 2, patients in both groups displayed higher sds and sas values at baseline compared to those at follow - up . Although there were no significant differences between the two groups before rai, values were significantly higher than the standardized cutoffs (sds: 53, sas: 50, both p<0.05). Thus, all patients reported significant depression and anxiety symptoms prior to rai treatment . At the 1-year follow - up, both groups reported significantly lower sds and sas scores (both p<0.05). Furthermore, this decline was more significant in the intervention group (p<0.05). Therefore, above and beyond a conventional nursing care protocol, the inclusion of psychological and behavioral intervention was more effective in alleviating distress reactions . We investigated the impact of a 1-year psychological and behavioral intervention, combined with routine nursing care, on the health - related quality of life and mental health status among patients with dtc receiving post - thyroidectomy adjuvant rai treatment . As hypothesized, patients who were subjected to psychological and behavioral intervention reported significant improvement in their quality of life (as shown by their qlq - c30 scores), as well as reduced depression and anxiety symptoms (as reflected in their sds and sas scores). Patients with cancer often experience psychological problems due to heightened stress experience.12 several studies have suggested that life quality can more accurately reflect the therapeutic effects of any intervention when compared to survival or fatality rates among patients with cancer.12 therefore, psychological and behavioral intervention plays an important role in improving the life quality among patients with cancer . Studies have shown that if cancer patients can mobilize their bodily strength toward cancer resistance, this can help with recovery and remission.13 thus, nurses, especially those with extensive practice and research experience in psychological counseling, can play a vital role in developing patients positive attitudes toward treatment . In the present study, compared with patients receiving conventional nursing care, those provided with psychological and behavioral intervention reported higher qlq - c30 scores and reduced sds and sas scores at 1-year follow - up . Thus, our results confirm that psychological and behavioral interventions, based on routine nursing care, can effectively improve the life quality and reduce mental health issues among patients with dtc undergoing rai . Since patients with dtc receiving rai need special protection post radiation, they tend to display anxiety, loneliness, depression, and other negative mental states, especially during the isolation period . Nurses providing emotional support can help alleviate these psychological symptoms, which in turn may enhance the patients abilities to respond to and actively cooperate with treatment . Therefore, it is necessary to create a systemic and consummate nursing care model for patients housed in isolation wards . In the present study, maintaining one - to - one communication with patients helped encourage them to express their negative emotions, as well as transfer any positive energy and enhanced support . Our results indicate that the psychological and behavioral intervention was effective in alleviating depressive and anxiety symptoms . Additionally, we regularly gathered the patients to organize meetings to express their experiences and exchange support with each other . During these meetings, by bringing out their own anticancer experiences, patients were able to transform themselves from the role of support receiver to one of support provider . This helped foster a more positive social identity and sense of belonging, which likely aided patients improved mental health status and quality of life . Given knowledge regarding standard of living and long - term dtc survival, nurses must cooperate with doctors in order to educate patients to accept standardized treatment regimens, including rai . It is possible that nursing care models with a psychological and behavioral intervention component can accomplish this goal . For instance, as this was a single - center study, with a relatively small number of patients, we may have issues with participant selection bias . Meanwhile, although this study was approved by the ethics committee of the shandong provincial qianfoshan hospital, we did not register it in any trial registry, which also means an important limitation . Furthermore, the investigation was completed 1 year after rai . Before definitive conclusions can be drawn, these findings must be replicated with a larger sample and more research centers, and evaluations should be continued during longer term follow - ups . We investigated aspects of health - related quality of life and mental health status among patients with dtc undergoing rai . Specifically, we assessed whether a psychological and behavioral intervention strategy, in combination with a routine nursing care model, would help facilitate positive mental health and life quality outcomes . Given modern medical models (bio - social medicine) and improved living standards, improvements to patients overall life quality and addressing patients physiological and psychological requirements are necessary, above and beyond focusing on prolonged survival.14 our results suggest that after 1 year of a consistent psychological and behavioral intervention, patients with dtc demonstrated improved life quality and mental health outcomes . Developing a reasonable and effective psychological nursing plan may be key to alleviating maladaptive symptom profiles, restoring a positive mental health status, and ultimately overcoming the disease . During daily nursing work thus, it is important that a patient s mental health needs are included within a standard of nursing care, which should help better promote full patient recovery.
Hiv replication requires the successful orchestration of reverse transcription, nuclear entry, and integration while avoiding various antiviral factors and innate immune sensors during early steps of infection (malim and bieniasz, 2012). Recognition of hiv by innate immune sensors induces the production of type i interferons and consequently interferon - stimulated genes (isgs), some of which possess direct antiviral activity against hiv replication (schoggins et al ., 2011). Along with isgs, cells are also equipped with intrinsic antiviral factors, including restriction factors that constitutively protect the cell from infection (bieniasz, 2004). Cyclophilin a (cypa), a host peptidylprolyl isomerase, was the first host factor shown to bind the hiv-1 capsid protein and to be required for the early steps of infection (luban et al ., 1993). Since the capsid core efficiently protects the genome of pathogenic hiv-1, engages essential host - derived replication factors, and enables evasion of antiviral factors and innate immune sensors, its interaction with cypa is of particular interest (campbell and hope, 2015). To date, cypa has not been associated with specific cellular pathways in human cells, and the nature of cellular factor(s) required for the effects of cypa on hiv-1 infection has remained elusive (hilditch and towers, 2014). In primary cd4 target cells, hiv depends on cypa for maximal replication (de iaco and luban, 2014, franke et al ., 1994, saini and potash, 2006, schaller et al ., 2011, yoo et al ., 1997). Use of the cypa inhibitor cyclosporin a (csa) demonstrated that optimal reverse transcription of hiv-1 (braaten et al ., 1996) and viral nuclear import (de iaco and luban, 2014) requires cypa in many cell lines, consistent with the ability of lentiviruses to infect non - dividing cells and with the presence of a conserved cypa - binding loop in their capsid (goldstone et al ., 2010, lin and emerman, 2006, yamashita and emerman, 2004). Cypa also influences hiv-1 integration sites (schaller et al ., 2011) and the evasion of cytosolic innate sensors in monocyte - derived macrophages (rasaiyaah et al ., 2013). Unlike hiv-1, hiv-2 and simian immunodeficiency virus (siv)mac replication is modestly affected by inhibition of cypa in cell lines (billich et al . Accordingly, hiv-1 capsid binds cypa with an affinity in the micromolar range, while hiv-2 and the related sivmac capsids bind cypa with a much lower affinity (price et al ., 2009, schaller et al . In several cell lines such as hela, hiv-1 does not depend on cypa (sokolskaja et al . 1994), and heterokaryon experiments suggest instead that cypa controls a dominant restriction mechanism specific to hela cells and to capsid mutants a92e and g94d (song and aiken, 2007). Mutations conferring a restriction phenotype that would be both associated with cypa and conserved across cell types in single - cycle virus infection assays have remained elusive . Additional host factors that regulate the early steps of hiv-1 replication are also associated with capsid . For instance, cpsf6, ranbp2 (nup358), nup153, and rhesus trim5 all bind to the viral capsid (di nunzio et al ., 2012, ganser - pornillos et al ., 2011,, 2014, price et al ., 2012, schaller et al ., 2011, stremlau et al tnpo3 is also required for hiv-1 infection and this requirement maps genetically in part to the viral capsid (brass et al ., 2008, krishnan et al ., 2010). Interestingly, the resistance factor mx2 inhibits hiv-1 infection after reverse transcription, and this maps to the interaction between the viral capsid and cypa (goujon et al ., 2013, the understanding of the orchestration of the early steps of hiv-1 infection by these factors, particularly at the step of nuclear entry of the viral pre - integration complex, remains incomplete (gaudin et al ., 2013). Mutations in the viral capsid that alter cypa binding also modulate the effects of these factors on infection, leading to the notion that cypa binding to capsid influences interactions (genetic or biochemical) with these factors (sokolskaja and luban, 2006). However, no essential host factor is known to be required for the effects of cypa on hiv-1 infection . Cypa binds to a characteristic proline - containing loop that is present in lentiviruses but absent from other retroviruses (goldstone et al ., 2010, lin and emerman, 2006) and affects the isomerization of proline 90 in hiv-1 capsid (bosco et al ., 2002). We previously described chimeric mutants of hiv-1 and hiv-2, corresponding to naturally occurring amino acids, with an increased affinity for cypa: p86 ha in hiv-2 (short hivac-2; hiv cypa affinity - enhanced capsid) and v86i - iap91lpa - m96l in hiv-1 (short hivac-1) (lahaye et al ., 2013). In monocyte - derived dendritic cells (mddcs), a physiologically relevant cd4 target cell derived from primary blood monocytes, hivac-1 and hivac-2 promote innate sensing of the viral cdna by the cytosolic dna sensor cyclic gmp - amp synthase (cgas) before nuclear import (lahaye et al ., 2013). This response requires abrogation of samhd1 using vpx present in hiv-2/sivmac (hrecka et al ., 2011, in addition, these mutants show a striking defect in infection of mddcs, downstream of the samhd1 restriction (lahaye et al ., 2013). Neutralizing type i interferon (ifn) does not rescue infection by hivac-2, suggesting that the inhibition is not secondary to the induction of an antiviral innate immune state . Hivac-2 gives rise to normal levels of late reverse transcription (late rt) products, but reduced levels of 2-ltr circles and integrated viral dna, as compared to hiv-2, suggesting a restriction before nuclear import . We surmised that the increased affinity of hivac-2 for cypa rendered the virus intrinsically susceptible to antiviral restriction mediated by cypa at the level of nuclear import . Normally, wild - type (wt) hiv would avoid such cypa - mediated resistance, a typical characteristic of restriction factors (malim and bieniasz, 2012). This observation raised the possibility that the underlying restriction mechanism could shed light on the long - sought host factors implicated in the positive effects of cypa in hiv-1 infection . Mddcs were susceptible to infection by hiv-1 with vpx, but not to hivac-2 infection (figure s1a). We examined whether the resistance to hivac-2 infection was intrinsic to the virus . Upon combined infection with the two viruses, when hivac-2 was present and activated an innate immune response in mddcs as shown by cd86 induction, cells remained susceptible to hiv-1 with vpx (figure s1a). Thus, the resistance to hivac-2 infection is unlikely due to the induction of an antiviral state but appears to be intrinsically linked to the capsid . In order to examine the role of cypa in hiv resistance, we treated mddcs with csa at the time of infection . Csa modestly increased hiv-2 infectivity and decreased hiv-1 infectivity, consistent with previous reports (manel et al . Strikingly, in the case of infection of dcs with hivac-1 and hivac-2, the presence of csa restored infectivity (figures 1a, 1b, s1b, and s1c). Next, we reasoned that, if the restriction of hivac viruses was not a consequence of the induction of an antiviral state in immune cells, then it must be conserved . Hivac-1 and hivac-2 titers were decreased compared to their wt counterparts following infection of immune - related thp-1 cells and non - immune ghost cells (figures 1c, s1d, and s1e). Csa restored infection of hivac-1 and hivac-2 to levels comparable with those of the wt viruses . Csa, an immunosuppressive compound, also targets proteins other than cypa . To confirm the role of cypa knockdown of cypa expression in mddcs and thp-1 using short hairpin rna (shrna)-coding lentivectors also restored infectivity of hivac-2 (figures 1e1h). Expression of a non - targetable cypa protein together with the shrna reverted the inhibition of hivac-2 infection (figures 1i and s1f s1i). To genetically confirm the role of cypa, we used ppia jurkat cells that are genetically defective for cypa expression (braaten and luban, 2001). As was the case for mddcs and ghost cells, infection of wt jurkat cells by hivac-2 was inhibited, and addition of csa rescued infectivity (figures s1j and s1k). In contrast, infectivity of hivac-2 was similar to hiv-2 in ppia jurkat cells, and csa had no further effect on infectivity . Next, we examined whether the cypa restriction was limited to a specific hivac capsid sequence or whether it could be extended to a general family of lentiviral capsid mutants . The distinctive feature of hivac-2 is the rational exchange of proline 86 with a corresponding pair of naturally occurring amino acids histidine - alanine in hiv-1 nl4 - 3, in order to restore a cypa - binding loop that would presumably fit the catalytic site of cypa more closely (lahaye et al ., 2013). We examined an alignment of 4,132 sequences of hiv-1 capsid available at the time in the los alamos national laboratory database and extracted all the existing pairs of amino acids preceding glycine 89-proline 90 . We identified six additional amino acid pairs and introduced them into hiv-2 rod9 (figures 2a and 2b). In accordance with hivac-2, these six mutants encapsidated higher amounts of cypa protein in the viral particles (between 20- and 50-fold more, figure s2a), consistent with an increased affinity of these mutated capsids for cypa (lahaye et al ., 2013). On ghost cells and mddcs, infectivity was consistently low and rescued by csa, except for one mutant p86aa (figures 2c and s2b). Hiv-2 is closely related to sivmac, but their cypa - binding loops differ . To examine whether the cypa restriction was applicable to primate lentiviruses other than hiv, we generated a mutant of sivmac239 encoding for the cypa - binding loop of hivac-2, resulting in virus sivmac239 qpapqq85ihagplpa (figure 2d). We also generated macaque monocyte - derived dendritic cells (odoherty et al . Macaque mddcs were readily infected with vsv - g pseudotyped gfp - encoding sivmac239 (figures 2e and 2f). In contrast, infectivity of sivmac239 qpapqq85ihagplpa was inhibited in macaque mddcs, and csa treatment restored gfp expression . Thus, cypa restriction of lentiviral infection is conserved in macaque cells and affects a broad family of capsid mutants . To determine whether cypa was sufficient for restriction, we explored the phenotype of second - site mutations in the capsid mutants . The capsid mutant hiv-1 n74d, but not hiv-1 wt, has been previously shown to be sensitive to csa in hela cells (ambrose et al ., 2012, yang and aiken, 2007). This suggested that n74 might influence the restriction mediated by cypa on hivac-1 and hivac-2 . Strikingly, the infectivity of hivac-1 n74d and hivac-2 n73d was largely restored and was insensitive to csa in hela cells, ghost cells, and mddcs (figures 3a3d, s3a, and s3b). Importantly, the second - site mutation did not abrogate the increase in cypa recruitment to the hivac-2 n73d capsid (figures 3e and s3c). / n73d constitute second - site mutations in capsids that specifically escape the direct antiviral effect of cypa, suggesting that additional host factors are implicated in the restriction . Next, we examined whether host factors that bind the lentiviral capsid or whose activity genetically maps to the capsid would be necessary for the restriction . We focused on thp-1 cells, because ghost cells are already multi - resistant to antibiotic selection, and sufficient knockdown was difficult to achieve for several host factors in mddcs (data not shown). We knocked down mx2, tnpo3, cpsf6, nup153, ranbp2, and trim5 and tested whether this would rescue infection by hivac-1 or hivac-2 . Knockdowns were confirmed by western blot for mx2, cpsf6, and tnpo3 (figure s4a), and by qpcr for ranbp2, nup153, and trim5 (figure s4b). Depletion of tnpo3, cpsf6, nup153, ranbp2, and mx2 reduced hiv-1 and hiv-2 infections, with tnpo3 depletion having the strongest inhibitory effect (figures 4a and s4c). Depletion of trim5 did not affect hiv-1 or hiv-2 infection but rescued infection by a n - mlv retroviral vector (bock et al . These effects validated the functional impact of all knockdowns on hiv infection in thp-1 cells . However, there was no rescue of hivac-1 or hivac-2 infection in any of these cases . In mddcs, the levels of late reverse transcription products were similar between wt hiv and hivac viruses (figures 5a and s5a). Addition of csa during infection with hivac-2 restored the formation of 2ltr circles and integrated dna (figure 5a). Thus, hivac viruses progress normally through reverse transcription and are specifically restricted by cypa at the level of nuclear import . The cypa - mediated restriction at nuclear import suggested to us that a nuclear envelope protein could be involved . We were intrigued by finding that sun2 (unc84b), an inner nuclear membrane protein and member of the linker of nucleoskeleton and cytoskeleton (linc) complex, inhibits hiv infection when it is artificially overexpressed (schoggins et al ., 2011). While sun2 was suggested to be an ifn - stimulated gene (schoggins et al ., 2011), we found that it is expressed constitutively in thp-1 cells and mddcs and it is not induced by type i ifn, whereas mx1 and mx2 are (figure s5b). To test whether sun2 was required for the cypa restriction, we generated sun2 mouse bone - marrow - derived dcs (bmdcs) (figure s5c) (lei et al . The infectivity of hivac-1 lentivector was reduced compared to hiv-1 wt lentivector, and infectivity could be restored by csa treatment, validating that the cypa - mediated restriction of hivac is conserved in mouse cells (figures 5b, 5c, and s5d). Strikingly, in sun2 bmdcs, infectivity of hivac-1 lentivector was largely rescued (figures 5b, 5c, and s5d). Furthermore, we found that viral reverse transcription products of hivac-1 lentivector were similar between wt and sun2 cells, while 2ltr circles and integrated viral dna were reduced in wt cells and increased in sun2 cells, in a fashion similar to the one observed with csa treatment of wt cells (figure 5d). Thus, sun2 is an essential host factor for the cypa - mediated restriction of hivac capsids at nuclear import . Next, we sought to extend the role of sun2 to other activities of cypa in hiv infection . Sun2 inhibited the infection of hiv-1 and hiv-2, confirming its antiviral activity when overexpressed (figure 5e) (schoggins et al ., 2011). In hela cells, as expected, hiv-1 wt and hiv-1 p90a are independent of cypa, while hiv-1 n74d depends on cypa for infection (figure 5e). Overexpression of sun2 inhibited hiv-1 n74d infection, and csa treatment did not reduce infectivity further, indicating that sun2 overexpression functions in the same pathway as cypa in this model (figure 5e). In these cells, which were used for infections, we also observed that sun2 overexpression leads to nuclei that are ruffled and less circular, supporting the notion that an optimal nuclear envelope structure is required for hiv infection through sun2 (figures 5f5h). Finally, we examined the contribution of endogenous sun2 to hiv-1 wt and hiv-2 wt infection in primary cd4 targets and thp-1 cells . In mddcs, sun2 knockdown reduced infection by hiv-1 and hiv-2 (figures 6a and 6b). Although dendritic cells are physiologically relevant target cells for the immune response to the virus, the bulk of viremia in patients is produced by cd4 t lymphocytes . Depletion of sun2 in primary activated human cd4 t cells reduced hiv-1 and hiv-2 infectivity similarly to mddcs (figures 6c and 6d). Sun2-depleted cells showed similar viability as compared to control cells (figures s6a and s6b). Depletion of sun2 also reduced accumulation of hiv-1 over time using a replication - competent virus (figures 6e, 6f, s6c, and s6d). In contrast to knockout mouse bmdcs, transient depletion of sun2 in human mddcs, cd4 t cells, and thp-1 cells was not sufficient to rescue hivac-1 or hivac-2 infectivity (figures 6c and s6e s6 g). To determine the contribution of sun2 to the role of cypa during hiv-1 wt infection, we used the non - immunosuppressive cypa inhibitor, cbs1, in cd4 t cells (figure s6h). Sun2 depletion or inhibition of cypa both reduced hiv-1 and hiv-2 infectivity in cd4 t cells (figures 6c, 6 g, and 6h). Importantly, combining cypa inhibition with sun2 depletion did not lead to additive inhibition (figures 6 g and 6h). Similar results were obtained in thp-1 cells (figure s6i). While the cypa inhibitor reduced viral rt cdna levels in control cells, this effect of the cypa inhibitor interestingly, cypa inhibition or sun2 depletion did not reduce the level of integrated dna at a detectable level in cd4 t cells (figure s6j). Thus, in primary cd4 t cells, sun2 is an essential host factor for the positive effects of cypa on reverse transcription and infectivity . Here, we show that cypa mediates a conserved restriction against a family of capsid mutants in hiv-1, hiv-2, and sivmac, and we leverage this phenotype to identify sun2 as an essential host factor in mediating the activities of cypa on hiv-1 wt infection in primary cd4 t cells . The restriction applies to capsid mutants in hiv-1, hiv-2, and sivmac and has been consistently observed in primary cells and cell lines of human, macaque, and mouse origin . The capsid mutant family is exemplified by the hivac-2 mutant, which shows a strikingly enhanced affinity for cypa as compared to hiv-2 and is dependent on cypa for inhibition of infection . Hivac-1, an analogous mutant in the cypa - binding loop, is also restricted and dependent on cypa for inhibition, even though the enhanced affinity is less striking (lahaye et al ., 2013). Importantly, the mutant viruses display normal capsids at the structural level (lahaye et al ., 2013) and proceed normally through rt, unlike other cypa - binding mutants such as g89v and p90a (braaten et al ., 1996), indicating that inhibition of their infectivity does not result from gross structural defects . As expected, viral mutants with a strong susceptibility to cypa - mediated restriction are rapidly counter - selected in nature: hiv-1 wt escapes this antiviral mechanism and genetic alteration in the virus is required to reveal it, in accordance with the principle of restriction factors (malim and bieniasz, 2012). Interestingly, our results show that hiv-2 is slightly restricted by cypa, indicating that it has not acquired a complete resistance to this antiviral mechanism . We propose that the acquisition of the ability of lentiviruses to enter the nucleus of non - dividing cells (goldstone et al ., 2010, lin and emerman, 2006) offered an opportunity for co - evolution of a host defense mechanism that inhibits lentiviral nuclear import, which can be revealed by the family of capsid mutants described herein . The combined observations that hivac capsids are inhibited at nuclear import and that the nuclear envelope protein sun2 acts as an antiviral factor in hiv infection when overexpressed prompted us to examine whether sun2 could play a role in the restriction of hivac capsids . Even though mouse cells are not natural targets of lentiviruses, the restriction mediated by cypa was conserved and the rescue of hivac infectivity in sun2 knockout cells thus provides a compelling genetic demonstration . Prior to this work, hiv-1 capsid mutants a92e and g94d were selected in the presence of csa and became dependent on cypa inhibition for replication (aberham et al . This led to the hypothesis that a cell - type - specific restriction factor inhibits hiv-1 infection after reverse transcription but before nuclear import . However, unlike the hivac capsid mutants, a92e and g94d are generally not dependent on csa in other cell types (de iaco and luban, 2014, qi et al ., 2008, yin et al ., 1998), and evidence for the existence of a restriction factor is limited to a very narrow range of cell lines (de iaco and luban, 2014, song and aiken, 2007). Moreover, it is, so far, not apparent in primary cd4 target cells of the virus (qi et al ., 2008). Cypa was also suggested to modulate hiv-1 restriction specifically in owl monkey cells (towers et al ., 2003), but this was later found to stem from a trim5-cypa fusion protein in this species (nisole et al . In contrast, our results establish a conserved cypa - dependent restriction that is active in primary cd4 target cells, indicating a weakness point in the viral cycle . Unexpectedly though, sun2 knockdown in human cells did not rescue hivac capsids, as opposed to knockout murine bmdcs . We envision three possibilities: (1) transient knockdown of sun2 differentially impacts the cypa - dependent restriction in cells as compared to the constitutive knockout that may be developmentally compensated; (2) there are underlying species differences between human and mouse sun2; (3) there are underlying cell - type differences between murine bone - marrow - derived - dcs and human immune cells . We generated crispr / cas9 knockouts of sun2 in thp-1 cells, but observed an unexpected loss of cypa dependency on hiv-1 infection in this experiment, questioning the applicability of this approach (data not shown). It will be important to develop methods to further manipulate sun2 expression in hiv target cells . Looking at known capsid - associated factors, we show that depletion of mx2, tnpo3, cpsf6, nup153, ranbp2, or trim5 do not rescue hivac-1 or hivac-2 infectivity . While we cannot exclude that the host factor knockdowns were not sufficient, our inability to detect even a partial rescue, when control infections with wild - type virus or mlv were affected, strongly suggests that none of these factors contributed to the cypa - dependent restriction . Unexpectedly, mx2 was constitutively expressed in thp-1 cells in the absence of type i ifn, and its depletion reduced hiv-1 and hiv-2 infection in pma - treated cells, suggesting that mx2 may not be antiviral in differentiated myeloid immune cells in the absence of type i ifn . In contrast, the n74d and n73d mutations, which lie in the binding pocket of cpsf6 and nup153 (matreyek et al ., 2013, price et al ., 2012) did not lead to similar rescue, it is possible that another host factor binds the same capsid region, or that the mutation causes structural consequences further away from the cpsf6 and nup153 binding pocket . It will be interesting to evaluate whether depletion of these factors in the context of sun2 overexpression or depletion differentially impacts infection with hiv-1 wt and capsid mutants . The restriction of hivac capsids at nuclear import and their rescue in sun2 knockout cells is an artificial situation that we leveraged to more broadly understand the natural mechanisms of cypa activities during hiv infection . We provide evidence in two additional models of cypa activities that sun2 is a key host factor . First, we examined hela cells, in which cypa has no effect on hiv-1 wt infectivity but promotes hiv-1 n74d infectivity . Accordingly, sun2 overexpression in hela cells cancels the positive effect of cypa on hiv-1 n74d infectivity . Optimal sun2 levels are thus required for cypa activity on hiv infection in hela cells . This is unlikely to be a non - specific effect of overexpression, because it was selective for hiv-1 n74d, and sun2 overexpression was previously found to have no impact on several other viruses (schoggins et al ., 2011). Second, we examined the role of sun2 in mediating the positive effects of cypa on hiv infectivity in primary cd4 t cells and mddcs . Using two distinct shrnas targeting sun2, we showed that sun2 is an essential host factor of hiv-1 and hiv-2 infection . Furthermore, in cd4 t cells, sun2 depletion was not additive with cypa inhibition of hiv-1 infectivity, and it abrogated the cypa dependence of hiv-1 reverse transcription . Interestingly, sun2 depletion had a strong effect on hiv-1 infectivity but little effect on viral late rt products and integrated cdna levels at the time point examined . This suggests the possibility that sun2 may regulate the dynamics of the early steps of replication, integration sites, or viral transcription to impact hiv infectivity, and these possibilities warrant further study . Overall, our results show that, while sun2 and cypa can mediate a potent restriction of hivac capsids, hiv-1 wt has evolved to exploit sun2 and cypa instead of being susceptible to their restriction . Furthermore, sun2 is required for both hiv-1 and hiv-2 in cd4 cells, indicating that sun2 is an essential hiv - associated factor, including but not limited to cypa activities . The ability of artificial sun2 overexpression to inhibit hiv was previously reported in several transformed cell lines and in mddcs (donahue et al ., 2016, schoggins et al ., 2011). We now show that endogenous sun2 mediates cypa activities on infection and that endogenous sun2 is essential for infection in relevant primary cd4 t cells . This suggests a non - linear biphasic response (i.e., hormesis) with the endogenous level of sun2 being the optimal level for infection . Sun2 levels in various target cells or tissue environments may have been a driving force in selecting an optimal level of cypa affinity in lentiviral capsids . Future studies on sun2 in hiv infection will require experimental setups that allow a precise control overexpression levels . In hela cells, sun2 overexpression inhibits hiv-1 infection and simultaneously leads to deformation of nuclei that become ruffled and less circular, pointing to a tempting link between nuclear envelope architecture and hiv infectivity . Sun2 does not associate with nuclear pores but connects the nucleoskeleton with the cytoskeleton through nesprins (liu et al . 2006), and it will be important to examine the contribution of these other factors to the effects of cypa during hiv infection . Since sun2 is a protein of the inner nuclear membrane of the nuclear envelope, it could potentially interact directly with the nuclear fraction of the viral capsid (chin et al ., 2015). The interaction between the capsid and sun2 could alternatively be indirect, such as through nuclear lamins or nesprins . Sun2 could thus contribute to viral uncoating in the cytosol, to virus docking on the nuclear pore, to its transport through the nuclear pore, and to its targeting to specific regions of chromatin . All of these possibilities have been shown to depend on binding of the hiv-1 capsid to cypa (campbell and hope, 2015). Overall, our results establish that cypa has a conserved ability to restrict lentiviral infection and that sun2 is a key host factor in mediating both positive and negative activities of cypa on infection . This enables us to unravel the detailed molecular mechanisms of cypa and sun2 in the context of hiv infection and extends our understanding of the desirable antiviral defenses that are normally bypassed by hiv-1 . The hiv-1 wt construct was nl4 - 3 vifvprvpuenvnef encoding gfp or tagrfp in nef, and the hiv-2 wt construct was rod9 envnef encoding gfp in nef as previously described (manel et al ., 2010). Sivmac239 mutants hiv-1 n74d, hiv-1 v86i - iap91lpa - m96l (hivac-1), hivac-1 n73d, hiv-2 n73d, hiv-2 p86 ha (hivac-2), p86ra, p86qa, p86aa, p86am, p86hv, p86pi, hivac-2 n73d, sivmac239 qpapqq85ihagplpa, and pspax2 variant (hivac-1 mutation) were generated by overlapping pcr mutagenesis . In all final constructs, the entire dna fragments originating from the pcr and encompassing the restriction sites used for cloning were fully verified by sequencing . Plasmid dna was purified using with the low endotoxin hipure plasmid kit (invitrogen). Recombinant plasmid dna did not induce dendritic cell maturation, and viral - producing cells were washed after dna transfection . Ghost (ghost x4r5), 293 ft, and hela cells were cultured in dmem, 10% fetal bovine serum (fbs) (gibco), and penicillin - streptomycin (gibco). Thp-1 and jurkat cells were cultured in rpmi medium, 10% fbs (gibco), and penicillin - streptomycin (gibco), and thp-1 cells were differentiated with 30 ng / ml (50 nm) of pma for 16 hr . Dcs were generated from blood cd14 monocytes using granulocyte macrophage colony - stimulating factor (gm - csf) and interleukin-4 (il-4). Viral particles were produced by transfection of 293 ft cells in 6-well plates with 3 g dna and 8 l transit-293 (mirus bio) per well . One day after transfection, media was removed, cells were washed once, and fresh media was added . Viral supernatants were harvested 1 day later, filtered at 0.45 m, used fresh or aliquoted, and frozen at 80c . Viral titers were measured on ghost cells titration as previously described (manel et al ., 2010). Rt activity in viral supernatants was measured using the sg - pert assay (pizzato et al ., viral supernatants did not induce dendritic cell activation in the absence infection . At day 4 of mddc differentiation (or day 7 for bmdcs), cells were harvested, counted, and resuspended in fresh medium at a concentration of one million per ml with 5 g / ml polybrene, gm - csf, and il-4 (or in bmdcs dc medium); 100 l were aliquoted in round - bottomed 96-well plates, and virus dilutions and treatments were added . 48 hr after infection, cell - culture supernatants were harvested and uv - irradiated to inactivate free virus . For cd4 t cells infection, activated cells were harvested, counted, and resuspended in fresh medium at a concentration of 0.25 million per ml with 8 g / ml protamine . 100 l of cells was aliquoted in round - bottomed 96-well plates, and virus dilutions and treatments were added . Hela were infected similarly to ghost cells as previously described (manel et al ., 2010) with 8 g / ml protamine . The paired t test or paired repeated measures (rm) anova one - way test were used, unless indicated otherwise in figure legends . In figures, p <0.05, p <0.01, p <0.001, p <0.0001; ns, not significant . B ., j .- f.g ., and j .- m.p . Provided cbs1.
A 39-year - old man visited our clinic with a 2-week history of whitening of the eyelashes of his left lower lid . The patient reported that this started with 1 to 2 lashes on the central part of his eyelid and that adjacent eyelashes subsequently became involved over the next few days . Otherwise the patient was in excellent health with no significant medical history; he had no known drug allergies and was on no chronic medications . There was no associated family history of vitiligo, poliosis, or autoimmune disorders such as vkh or sarcoidosis . On examination, a pigmented skin nevus, approximately 4 mm in diameter, was noted above a patch of white eyelashes on the central aspect of the left lower eyelid (fig . 1). According to the patient, the nevus had existed and remains unchanged since childhood . No other abnormalities of the eyelid were noted and there was no vitiligo or signs of periocular inflammation . His visual acuity was 20/20 in both eyes and there were no significant findings in the anterior segment or fundus . Serological tests for autoimmunity (antinuclear, antimitochondrial, and antismooth muscle antibodies) were negative and human leukocyte antigen (hla) typing failed to demonstrate types hla - dr4 or dw53 excisional biopsy of the central eyelid, including the pigmented nevus and white eyelashes, was performed . On histopathologic examination, the nevus cells appeared unremarkable and showed no evidence of malignancy . Marked deficiency of melanocytes in the hair follicles was visible as compared with the normal overlying epidermis (fig . 2). Infiltration of inflammatory cells, including lymphocytes and macrophages, was observed in the dermis (fig . 3, the majorities of halo nevi are acquired compound melanocytic nevi and appear in childhood and early adolescence . The site of predilection is the trunk and the back, especially when there are multiple lesions . Patients with halo melanocytic nevi usually seek medical attention when their pigmented lesions develop a rim of depigmentation . Over time, i, the central nevus remains brown in color or its pigment can disappear leading to a pink - colored papule (stage ii). Then the central papule disappears, leading to a circular area of depigmentation (stage iii). Finally, the depigmented area may repigment (stage iv), leaving no trace of its existence . The underlying pathophysiology of the halo phenomenon is not well understood, but may possibly be the result of an immune response leading to nevus cell destruction . Some authors suggest an autoimmune response directed against antigenic changes of dysplastic nevi while others regard it as an autoimmune phenomenon against melanocytes, as occurs in vitiligo . However, cellular and antibody - mediated immune mechanisms seem to be heavily involved in both theories and it is now well accepted that the inflammatory response is predominantly lymphocytic in nature, often with the addition of a small number of melanophages . There are four histologic forms of halo nevi described: (a) inflammatory halo nevus, (b) noninflammatory nevus, (c) halo nevus without halo or halo nevus phenomenon, and (d) halo dermatitis around a melanocytic nevus (mayerson's nevus). A halo nevus without the halo phenomenon is very rare and can only be diagnosed by histology . . Described spontaneous regression of congenital nevi without the development of the halo phenomenon . Sotiriadis et al . Reported one case of a halo nevus without the halo phenomenon which developed on the trunk of a 5-year - old girl . They reported pathologic findings of a thin epidermis with marked orthokeratotic hyperkeratosis and dense lymphocytic infiltration intermingled with melanocytes; these findings were consistent with the diagnosis of a halo nevus . A t - cell - mediated autoimmune response leading to melanocyte destruction with resultant poliosis and associated halo nevi in vkh disease however, our case exhibited no evidence of autoimmune disease and no halo phenomenon or vitiligo . In our case only histopathologic findings, such as infiltration of lymphocytes and melanophages, suggested the regression phase of the melanocytic halo nevus . Total loss of melanocytes in eyelash follicles may be an isolated sign of the halo phenomenon without depigmentation of the skin . Despite an in - depth review of the literature . The only reports of halo nevi of the eyelids were accompanied by vitiligo, not poliosis . Also, a case of poliosis with a conjunctival melanoma has been described . One possible, though very unlikely, explanation for the presence of poliosis without skin depigmentation occurring in this case may be a predilection of melanin - rich hair follicles for immunologic reactivity . It is not possible for us to state with certainty why this may have occurred in the setting of a halo nevus undergoing regression, although it is very likely that the inflammation resulted from an exaggerated cell - mediated immune response . In conclusion, we herein present a case of a halo nevus with poliosis of the eyelashes as the only sign of the halo phenomenon . Further analysis is needed to elucidate the mechanism of spontaneous regression of a halo nevus without depigmentation.
Upon activation by donor alloantigens, recipient naive t cells can differentiate into a variety of graft - destructive, effector t cell or graft - protective, regulatory t cell (treg) phenotypes . These t - cell commitments are determined largely by the texture of the innate immune milieu in which t - cell activation occurs . A milieu in which transforming growth factor 1 (tgf1) is expressed in the absence of proinflammatory cytokines promotes the commitment of alloactivated t cells into a tissue - protective, forkhead box p3 (foxp3) treg phenotype . In contrast, a milieu in which proinflammatory cytokines are abundant prevents the generation of foxp3 tregs and instead directs t - cell commitment into the tissue - destructive t helper 1 (th1), th2, or th17 phenotypes [1 - 4]. Unfortunately, a robust expression of proinflammatory cytokines is typical for recently engrafted organ transplants . The inflamed state, highly detrimental to the treg induction and immunoregulatory function, is a consequence of innate immune activation in response to the ischemia and reperfusion injury . Although conventionally used agents such as corticosteroids are perhaps useful in restricting the early graft inflammation [7 - 9], their broad immunosuppressive action, including blocking the expression of tgf1, does not facilitate tolerance . Hence, we believe that reducing the adverse forms of inflammation but allowing activity of tgf1 and other inhibitory cytokines within a graft may prove to be a key approach for the induction and maintenance of allograft tolerance . We suspect that the creation of an intra- and peri - graft milieu devoid of proinflammatory cytokines will serve to guide the majority of donor - activated t cells into a tgf1-incited, treg tissue - protective phenotype . Indeed, our own results and the results of others support this concept [12 - 15]. Therapies that primarily block adverse inflammation, such as alpha1-antitrypsin, anti - interleukin (il)-6, or anti - tumor necrosis factor - alpha, have been successfully utilized by our group in tilting the balance of the allograft response toward tolerance, or in restoring tolerance in the non - obese diabetic (nod) model of type 1 diabetes, even in nod mice with frank diabetes . Given the availability of therapies (many of them approved by the us food and drug administration) that are suitable for blocking the adverse forms of inflammation, rapid translation into the clinic seems possible for the treatment of certain immune - inflammatory disorders . We are aware that a pure prevention or a blockade of inflammation may not be sufficient to achieve lasting transplant tolerance in humans . Additional lymphocyte - depleting measures are required first of all in order to prevent rejection in pre - sensitized recipients . Nonetheless, we believe that favorably tipping the balance of pro- and anti - inflammatory cytokines in the milieu in which non - depleted t cells re - populate will foster t - cell commitment into a tissue - protective mode and promote tolerance . Our current efforts at blocking tim4 (t - cell immunoglobulin and mucin domain - containing protein 4), a molecule upregulated by antigen - presenting cells exposed to proinflammatory cytokines and toll - like receptor agonists, have proven equally successful in promoting long - term engraftment in preclinical models of transplantation and autoimmunity, although this method is not yet ready for testing in humans . If confirmed that tim4 blockade leaves t - cell anti - viral responses largely intact, it may be an especially attractive strategy to promote tolerance in patients with chronic viral infections . Induction and maintenance of transplant tolerance require that graft - protective foxp3 tregs efficiently and durably restrain the pool of graft - destructive effector t cells after anti - rejection therapy is withdrawn (figure 1). For tolerance to be permanent, the foxp3-dependent treg immunoregulatory phenotype must be stabilized . A stable expression of foxp3, the treg lineage specification transcription factor, is required to maintain treg function and thereby maintain transplant tolerance . Loss of foxp3 gene expression, such as that occurring in the inflamed, il-6-rich environments, can destabilize treg molecular phenotype and immunoregulatory function, thereby undermining the maintenance of transplant tolerance . With the loss of immunoregulatory function among these destabilized tregs, rejection occurs as the immunoregulatory restraints upon donor - reactive effector t cells are released . A milieu dominated by anti - inflammatory cytokines or inflammation - dampening agents promotes the commitment of donor - activated t cells into a regulatory t - cell phenotype and thereby fosters transplant tolerance . A milieu dominated by proinflammatory cytokines promotes effector t cell generation and rejection of the allograft . Aat, alpha-1-antitrypsin; apc, antigen - presenting cell; il, interleukin; teff, effector t cell (t helper 1 [th1], th2, and th17); tgf1, transforming growth factor 1; tnf, tumor necrosis factor - alpha; treg, regulatory t cell . Foxp3 expression in tregs is regulated, in part, by epigenetic modifications of the foxp3 chromosomal locus . The methylation status of cpg - sensitive residues upstream of the transcriptional start site (exon1) is an important regulator of foxp3 expression . Methylation of these residues represses foxp3 gene expression while complete demethylation is required for optimal foxp3 gene expression . Other epigenetic mechanisms, such as histone methylation and acetylation, also modulate foxp3 stability . Of note, therapeutic agents that directly foster maintenance of demethylated foxp3 promote robust expression of foxp3-sensitive genes, immunoregulatory t - cell function, and tolerance . For this purpose, some inhibitors of dna methyltransferases, such as nucleoside analog 5-azacytidine, have been successfully used in experimental studies . Perhaps owing to the known toxicity of demethylating agents, formal clinical trials in transplantation that treg infusions have the potential to prolong allograft survival and induce transplant tolerance is widely acknowledged . However, the clinical use of tregs for the adoptive transfer into transplant recipients is hindered by the inherent instability of the foxp3-dependent treg phenotype upon exposure of tregs to inflamed environments . As noted, in the proinflammatory milieu, foxp3 expression is diminished, inhibitory function is compromised, and some tregs even convert to t effector - like phenotypes [22,30 - 32]. Such treg instability has been associated with the activation of dna methyltransferases and the consequent remethylation of cpg residues . It therefore seems intuitive that therapeutic strategies able to maintain foxp3 in a demethylated state may be essential for the effective application of treg therapy in the clinic . While inhibitors of dna methyltransferases and of histone deacetylase are not without toxicity, the addition of safe agents that synergize or supplant these drugs as a means to regulate epigenetic expression of foxp3 should prove extremely valuable in the long - standing quest to induce tolerance . Tregs and conventional effector t cells take important cues from their microenvironment, which influences their commitment into regulatory or effector phenotypes . Among extracellular stimuli, il-2-triggered expression of stat5 (signal transducer and activator of transcription 5) likely plays a major role in stabilizing tregs . Stat5, activated downstream of il-2 receptor complex signaling, binds to the promoter region of the foxp3 gene and thereby activates its transcription . By enhancing transcription of foxp3 we and others have utilized il-2, il-2 anti - il-2 complexes, or il-2.ig either alone or in conjunction with rapamycin and other agents to promote tolerance induction . Such therapies have successfully induced transplant tolerance or restored self - tolerance in the nod model of type 1 diabetes . In addition to activating the stat5 pathway and expression of foxp3, il-2 signal, if delivered by a long - lived il-2 anti - il-2 complex or il-2.ig, also causes apoptosis of repeatedly activated effector (but not regulatory) t cells . The fact that calcineurin inhibitors such as cyclosporin negatively impact treg function and activation - related effector t - cell apoptosis may indeed be a result of suppressed il-2 signals . We have previously shown that cyclosporin does prevent tolerance induced by co - stimulation blockade in a cardiac transplant model . Rapamycin, on the other hand, did not impede the induction of such achieved tolerance and, as we showed later, does promote the generation of induced tregs . The imbalance of tissue - protective tregs and tissue - destructive th17 cells was recently implicated in the pathogenesis of autoimmunity and certain types of rejection . Of note, the commitment of naive t cells to the th17 phenotype (a subset with aggressive cytodestructive properties) is inhibited by il-2, and the expression of stat5 negatively regulates th17 cells . It is therefore reasonable to posit that the activation of the il-2/stat5 pathway promotes tolerance by favorably tilting the balance between th17 cells and tregs toward treg dominance . These strategies have centered upon attempts to delete or at least deplete donor - reactive t cells or alter the early events of t - cell activation such as through co - stimulation blockade . The notion that graft inflammation is the major impediment to transplant tolerance prompts us to further investigate the means of its most efficient therapeutic targeting . It may not be possible to create transplant tolerance unless the inflammatory milieu in which donor - reactive t cells perceive donor antigen is modified . Adverse inflammation in the peri - transplant period can guide the majority of donor - activated naive t cells into the graft - protective treg mode . In addition, strategies that foster the expression of treg foxp3 by epigenetic modification may be utilized in conjunction with anti - inflammatory agents to further stabilize tregs and tolerance.
Faithful dna replication is crucial for genomic maintenance . When replication is perturbed, cells activate stress response networks that connect the detection of replication - blocking lesions with dna damage tolerance (ddt) and repair pathways, chromatin modifications, cell - cycle control, and various other changes in cell physiology, often collectively referred to as the dna damage response (ddr) (jackson and bartek, 2009). Failures in these processes are implicated in the etiology of many developmental and neurological disorders and are thought to drive genome instability characteristic of cancer (odriscoll and jeggo, 2008). Genome duplication is carried out by the replisome machinery, initially assembled at replication origins (gerbi and bielinsky, 2002). Notably, replication initiation critically depends on the loading and activity of the polymerase (pol)/primase complex . This is the fundamental initiator of dna replication in eukaryotic cells, as the replicative dna polymerases can only elongate an existing rna - dna primer produced by this complex . The primase produces short rna fragments (about 712 nt long), which are subsequently subjected to limited extension by pol. These rna - dna primers are then extended by the replicative polymerases pol and pol (aze et al ., 2013). Pol/primase - mediated processes are not only relevant for origin - dependent replication initiation, but also for origin - independent initiation events, as is the case of lagging strand dna synthesis, and possibly the restart of stalled forks downstream the blocking lesion under conditions of genotoxic stress (branzei and foiani, 2010; heller and marians, 2006). The latter aspect is potentially crucial for efficient ddt and replication, especially in conditions in which fast replication is a requirement, such as at the early stages of development (odriscoll and jeggo, 2008). Two distinct modes of ddt, error - prone and error - free ddt, operate in all eukaryotic organisms (sale, 2012). Error - prone ddt is mediated by translesion synthesis (tls) polymerases and largely accounts for mutagenesis . Error - free ddt uses a recombination - related mechanism known as template switching (ts), in which one newly synthesized strand serves as replication template for the other blocked nascent strand (branzei, 2011; giannattasio et al ., 2014). The choice between these ddt modes has profound consequences for genome stability, and to date, several factors have been implicated in ddt pathway choice: pcna post - translational modifications with mono - ubiquitylation, poly - ubiquitylation, and sumoylation (branzei et al ., 2008; 2005); genome architectural transitions coupled with early stages of replication (gonzalez - huici et al ., 2014); and cell - cycle - specific changes in the abundance or regulation of key ddt factors (karras et al ., 2013; waters and walker, 2006). Together with pol/primase, a number of structural proteins that tether the replicative minichromosome maintenance (mcm) helicase to the replicative polymerases are loaded at replication origins (aze et al ., 2013). Ctf4 (and-1 in mammalian cells) functions as such a replisome architectural factor, bridging the mcm helicase and two molecules of pol/primase (gambus et al ., 2009; simon et al ., it is of note, however, that while pol and primase are essential for cellular proliferation, ctf4 is not . This indicates that even if uncoupled from the replicative helicase, pol/primase supports dna synthesis . Besides its roles to maintain normal replisome architecture, ctf4/and-1 is also required for sister chromatid cohesion (hanna et al ., 2001; yoshizawa - sugata and masai, 2009). Increasing number of reports indicate replication stress at the basis of chromosomal instability, and as an important underlying factor of developmental anomalies (halazonetis et al ., 2008; however, the nature of the early chromosome lesions arising following such replication perturbations is largely unknown . Moreover, the connections between these replication dysfunctions and the observed chromatin structural alterations similarly triggered by mutations in cohesion factors remain elusive . Here we used budding yeast saccharomyces cerevisiae cellular models of specific replication stress and sister chromatid cohesion defects to investigate a possible crosstalk between recombination - mediated ddt and chromatin structure / cohesion . Our results indicate that both replicative helicase - coupled re - priming and sister chromatid cohesion are important to facilitate error - free ddt by ts, but they do so via different mechanisms . The results shed light on how highly conserved replication - associated pathways crosstalk to each other and contribute to normal replication fork and chromatin structure, providing mechanistic insights into the molecular basis of human disorders caused by replication dysfunctions . Error - free ddt by ts can be molecularly monitored by examining the formation of x - shaped structures composed of sister chromatid junctions (scjs) in the proximity of replication forks using 2d gel electrophoresis (branzei et al ., 2008). In this assay, yeast cells are released synchronously and allowed to replicate in media containing the alkylating reagent methyl methanesulfonate (mms). The pattern of replication intermediates at genomic locations of interest is analyzed at different time points during dna replication . Previous results showed that ts intermediates form during replication of damaged templates and accumulate when the sgs1-top3-rmi1 complex is defective because of compromised resolution (branzei et al ., 2008; liberi et al ., 2005; giannattasio et al ., replication of damage templates leads to a progressive accumulation of scjs in sgs1 mutant cells (liberi et al ., 2005), as well as in sgs1 hypomorphic mutants disrupted only in the helicase domain (onoda et al . Deletion of ctf4 causes a g2/m delay associated with slower proliferation (kouprina et al ., 1992), but it does not prominently impact on s phase progression when cells are replicating in the presence of mms (figure s1a). Notably, we found that the ctf4 mutation reduced the amount of x - shaped scjs in both sgs1 and wild - type (wt) background (figures 1a and s1b), suggesting a supportive role for ctf4 in ts . Cells defective in error - free ddt are characterized by a more prominent dependency on tls, showing higher levels of spontaneous mutagenesis and increased damage sensitivity following inactivation of error - prone ddt components (cejka et al ., 2001). We found that ctf4 cells have statistically significant increased spontaneous mutagenesis rates (figure 1b). This was largely dependent on rev3 (figure 1b)the catalytic subunit of the tls polymerase pol, accounting for most of the mutagenic events in budding yeast . Furthermore, ctf4 and rev3 showed strong additive effects for mms sensitivity (figure s1c), supporting the view that tls - mediated ddt acts as a compensatory mechanism in ctf4 cells . To further characterize the role of ctf4 in ddt, we examined its genetic interactions with classical error - free ddt pathways governed by rad6-rad18 post - replicative repair and rad51 recombinational repair branches . Ctf4 mutants showed additive damage sensitivity when combined with rad18 or rad51 (figure s1d). Since the rad6-rad18 pathway controls both ts- and tls - mediated ddt, we also examined the genetic interaction of ctf4 with the pcna polyubiquitylation pathway (mediated by rad5, mms2, and ubc13) that specifically affects ts (pfander et al ., 2005). However, also in this case, we found an additive effect on damage survival (figure s1e). Next, to address the possibility of an effect of ctf4 on ddt by influencing the post - translational modifications of pcna, we analyzed the pattern of sumo- and ubiquitin / polyubiquitin - conjugated pcna species in ctf4 cells . We detected no major changes in pcna modifications both in spontaneous and mms - treated conditions (figure 1c). We conclude that ctf4 facilitates error - free ddt in parallel with canonical post - replicative repair pathways regulated by pcna modifications with sumo and ubiquitin . Previous work assigned two main functions to ctf4: an architectural role in the context of the replisome achieved by bridging the pol/primase complex to the mcm replicative helicase (gambus et al ., 2009; simon et al ., 2014; tanaka et al ., 2009)and an additional role in sister chromatid cohesion (hanna et al ., a ctf4 deletion mutant shows a mild increase in premature sister chromatid separation in g2/m, accompanied by sporadic chromosome loss and aneuploidy without obvious defects in completing the bulk of dna replication (hanna et al ., 2001; it is therefore possible that the ts defect of ctf4 mutants (figure 1a) is an indirect consequence of defective sister chromatid cohesion or, alternatively, a direct result of mcm - uncoupled pol/primase compromised activity . The first hypothesis leads to the proposition that mutants defective in cohesion, but proficient for pol/primase function, would also be defective in formation of ts intermediates composed of scjs . To test this, we analyzed the consequences for ts of impairing sister chromatid cohesion using genetic conditions that result in loosening or opening of the cohesin ring . Scc1 is an essential subunit of the cohesin complex that is cleaved at anaphase (uhlmann et al ., 1999). Using the temperature - sensitive allele, scc1 - 73, we found that impairment of cohesin function during a single round of replication also caused a defect in ts (figures 2a). Similar results were obtained using a gal promoter - driven conditional scc1 allele, gal - scc1, the expression of which is induced by galactose and repressed by glucose (data not shown). Next, we asked if pol/primase mutants are different or similar to ctf4 and cohesin mutants with respect to ts . We investigated the contribution of two alleles, pri1-m4, affecting the pri1 subunit of primase (marini et al ., 1997), and pol1 - 1, affecting the catalytic subunit pol1 of pol (lucchini et al ., 1988). To mildly interfere with the function of pol/primase without affecting the ability of cells to traverse s phase, cells were grown at the permissive temperature and synchronously released in media containing mms at semi - permissive temperatures that allow completion of dna replication with normal kinetics (data not shown; see below). Both pri1-m4 and pol1 - 1 mutations caused a reduction in the x molecules accumulating in sgs1 (figures 2b and s2a). This phenotype is suggestive of a positive role of pol/primase in error - free ddt by ts, a conclusion also supported by the increased mutagenesis in pol and pri1 mutants previously reported (longhese et al ., 1993; considering the phenotypic similarity between ctf4 and both cohesin and pol/primase mutants with regard to ts, we asked if ctf4 contribution to cohesion might take place in the context of the pol/primase complex . To this purpose, we examined the percentage of premature sister chromatid separation, a widely used cohesion readout, in pri1-m4 cells . Compared to wt, pri1-m4 cells exhibited a significant increase in premature sister chromatid separation, at a level similar with the one caused by mutations in the non - essential cohesion factors ctf4, chl1, and ctf18 included in the analysis (figure 2c). Previously, based on genetic interactions, non - essential cohesion factors were divided in two genetic pathways, having as prominent members ctf4 and chl1 or ctf18 and ctf8, respectively (xu et al ., while combination of mutations in the same cohesion pathway generally does not exacerbate the observed cohesion defects associated with single mutations and does not lead to synthetic fitness defects, the opposite is true for combinations of mutations belonging to separate pathways . To further test if the cohesion defects observed with pri1-m4 (figure 2c) are manifested in the context of the pol/primase / ctf4 complex, we combined pri1-m4 with deletion mutations in genes affecting the two non - essential cohesion pathways . Supporting the above view that pri1-m4 cohesion defects reflect a role for pol/primase / ctf4 in cohesion, pri1-m4 manifested synthetic fitness defects with ctf18 and ctf8, but not with ctf4 or chl1 (figure s2b; data not shown). Altogether, these data demonstrate that interfering with the functionality of the pol/primase / ctf4 and cohesin complexes results in similar defects both in cohesion and error - free ddt by ts, leading to the question of whether cohesion and ts recombination are linked by a causal relationship . Sister chromatid cohesion defects reflect impairments in maintaining accurate physical proximity between the newly replicated chromatids . While it is reasonable to assume that by influencing the accessibility of the sister chromatid donor sequence cohesin facilitates sister chromatid recombination (covo et al ., 2010; tittel - elmer et al ., 2012), to what extent the physical proximity of chromatids impacts on scj formation during the non - canonical recombination mechanism of ts is unknown . To address this, we used a previously described system that artificially re - establishes cohesion in a locus - specific manner . The system relies on the ability of the lactose inhibitor (laci) to bind the lactose operator sequence (laco). In the wt form (tetramer; figure 3a, right), laci is able to form tetramers that bind two different laco sequences present on each chromatid, while a truncated version of the laci protein (dimer; figure 3a, left) is only able to form a dimer and to bind the laco sequences on a single chromatid . Therefore, after dna replication, only the tetramer version of laci, and not the dimer, can bind the identical laco sequences placed on both sister chromatids, restoring sister chromatid cohesion locally in cohesion - defective mutants (straight et al ., 1996). By using the above assay, we examined whether artificial tethering of the sister chromatids was able to locally rescue the ts defects associated with cohesin mutants . Sgs1 and sgs1 scc1 - 73 cells carrying either the dimer or the tetramer laco / laci system were synchronized at the permissive temperature, and after activation of laci expression, cells were released in media containing mms at the non - permissive temperature for scc1 - 73 to induce ts defects associated with decreased cohesin function (see figure 2a). Next, we examined by 2d gel the pattern of ts intermediates arising at locations proximal to the laco array (figure 2a). We found that, unlike the sgs1 scc1 - 73 mutant carrying the dimer version of laci, which showed reduced accumulation of ts intermediates (figure 3b, upper panel), the strain with the tetramer version of laci rescued x molecule formation (figure 3b, bottom panel). To verify the specificity of the tethering system, we digested and hybridized the same genomic dna to probe for replication intermediates forming in the proximity of the early origin of replication ars1, located on chromosome iv, which should not be affected by the laci variants binding to laco cassettes on chromosome iii . As expected, the ts defect associated with scc1 - 73 at ars1 was not alleviated (figure s3). Because artificial tethering of the chromatids is able to bypass the absence of a functional cohesin ring in regard to scj formation, these experiments demonstrate that the role exerted by the cohesin complex in ts is structural . To now assess whether, as in scc1 - 73, the ctf4 defect in ts is also due to increased physical distance between the sister chromatids, we used the same experimental approach, but in the sgs1 ctf4 background . Interestingly, artificial cohesion did not restore the formation of x molecules in the sgs1 ctf4 strain (figure 4a), although the laco / laci system efficiently reduced the local cohesion defects on chromosome iii associated with ctf4 (figure 4b). The function of ctf4 in ts revealed by this assay is thus different from the structural one of cohesin (figure 3b). Of note, the defect of ctf4 cells resembled the one caused by inactivation of the rad51 recombinase (figure s4a). These results indicate that ctf4 affects key aspects of the ts reaction that cannot be substituted by simply restoring the physical proximity of the sister chromatids . Taken together, the data suggest that the repair / ts defect of ctf4 mutants is primarily caused by faulty mcm - uncoupled pol/primase activity rather than by defective sister chromatid cohesion . Based on the above results, we conclude that, at least in regard to ddt, the roles of cohesin and pol/primase / ctf4 are manifested via two fundamentally distinct mechanisms . Supporting this view, deletion of ctf4 resulted in synthetic lethality when combined with scc1 - 73 even at permissive temperatures (figure s4b) (mclellan et al ., 2012). In addition, using a combination of temperature - sensitive alleles of pol/primase mutants and cohesin, we obtained viable pri1-m4 scc1 - 73 cells that displayed, however, increased mms sensitivity compared to the single mutants (figure s4c). This result highlights once again a differential contribution of cohesin and the pol/primase / ctf4 complex toward ddt . A diverse molecular purpose of pol/primase and cohesin during canonical recombination can also be deduced from their contribution to the donor choice: in cohesin mutants, the inter - sister recombination events decrease in favor of events involving the homologous chromosome (covo et al ., 2010; tittel - elmer et al ., 2012), whereas ctf4 causes a decrease in both sister- and inter - homologous recombination in conditions of dna damage (ogiwara et al ., these results reveal that, despite cohesin and ctf4 mutants showing similar phenotypes in cohesion and ddt, cohesin aids ts by maintaining the proximity of the recombination donor, while the pol/primase / ctf4 complex must affect some fundamental activity or step during recombination - mediated damage bypass . To identify the ts - sensitive step that is defective in pol/primase / ctf4 complex mutants, when re - priming is either affected or uncoupled from the mcm helicase, we combined ctf4 and pri1-m4 with a series of mutations affecting distinct hr - associated processes . We found that ctf4 shows synthetic sickness / lethality with rad52 (kouprina et al ., 1992), but not with rad51 (figure 5a) or other rad51 mediators, such as rad55, that assist rad51-mediated strand invasion (data not shown). We also observed a similar pattern of genetic interactions for pri1-m4 (figure s5a). Although rad51 and rad52 act together in most recombination events, a significant amount of hr events are detectable in rad51 mutants that are dependent on rad52 (krogh and symington, 2004). In saccharomyces cerevisiae, the major rad51-independent activity of rad52 is represented by strand annealing, which also involves rad59 and rpa (krogh and symington, 2004). Notably, ctf4 also showed synthetic fitness defects when combined with rad59 (figure 5b) and the s. cerevisiae rpa largest subunit rfa1 allele, rfa1-t11 (figures 5c; see below). However, no synthetic interactions were observed with rad1 (figure s5b), defective in the process of double - strand break (dsb) repair by single - strand annealing (krogh and symington, 2004). The single - stranded dna - binding complex rpa initially covers ssdna in order to prevent secondary structure formation and to mediate the subsequent binding of rad52 (krogh and symington, 2004). Binding of rad52 to stretches of rpa - covered ssdna may promote annealing of such sequences, potentially leading to rearrangements, such as deletions and duplications, especially in the presence of repeat sequences (branzei, 2011). Supporting this view, we found a strong increase, of a 1,000-fold magnitude, in spontaneous deletion rates of genomic elements flanked by repeat sequences, in both ctf4 and pri1-m4 mutants with respect to wt (figure 5d). These deletion events were not dependent on rad51; rather, the rad51 mutation itself caused an increase in such deletion events in both wt and ctf4/pri1-m4 backgrounds (figure 5d). To directly test the genetic evidence of an altered amount of ssdna in ctf4 and pri1-m4 mutants, we performed electron microscopy (em) analysis on the replication intermediates extracted from wt, ctf4, and pri1-m4 cells replicating under damaging conditions . Pri1-m4 showed a strong increase in the length of the ssdna stretches exposed at the replication fork (figure 6a). In addition to this, we found that although not different for the average length, both ctf4 and pri1-m4 mutants showed a 2-fold increase in the number of internal gaps detected behind replication forks (figure 6b). Holliday junction - like structures in which the two newly synthesized strands are paired, in both ctf4 and pri1-m4 (figure 6c). It is of note that such reversed fork structures were absent in wt cells, suggesting that reversed forks are not predominantly induced following genotoxic stress in saccharomyces cerevisiae . This is in line with previous reports on total replication intermediates formed during replication in the presence of uv- or mms - induced damage (lopes et al ., 2006), and with the structural analysis of x - shaped structures forming at a specific chromosome locus during replication of damaged templates in wt and sgs1 budding yeast cells (giannattasio et al ., 2014) altogether, the results demonstrate a profound alteration in the metabolism of ssdna in pol/primase / ctf4 complex mutants . This likely leads to the subsequent formation of unscheduled reversed forks and recombination structures, having negative effects on both chromatin structure and ddr . This process generates endogenous damage and replication stress, although the molecular nature of the latter remains poorly understood . While various studies outline that intimate links must exist between dna replication and ddt / ddr mechanisms (branzei and foiani, 2010; jackson and bartek, 2009), how relatively mild replication - challenging conditions interfere with other chromosome metabolism processes associated with dna replication remains largely elusive . Here we set out to examine how specific replication pathways may crosstalk to each other and affect ddt . Remarkably, we found that mild impairment in replication - associated molecular pathways related to re - priming, replisome architecture, and cohesion invariably negatively impinged on template switching (figures 1a and 2b). The defects in error - free ddt were coincident with an increase in mutagenic ddt and other types of genomic rearrangements (figures 1b and 5d), as well as with altered replication fork structures (figure 6). These results provide in vivo support for the primer - driven post - replicative ddt as the most prominent pathway of ddt, at least in budding yeast (becker et al ., 2014; branzei, 2011; heller and marians, 2006; lehmann and fuchs, 2006). Moreover, as deletion of ctf4 that does not directly impact on primase activity caused a similar phenotype to the one of primase mutants, the present work carries the implication that this re - priming function provides genome stability when carried out in the context of mcm - coupled pol/primase protein complex (figure 7). On the contrary, when re - priming is deregulated, problems are bound to occur . Limited re - priming can lead to fork uncoupling and long stretches of ssdna at the fork (figure 6a); these ssdna discontinuities can engage in error - prone annealing events (figure 5d) and cause altered replication fork architecture (figures 6c and 7). Deregulated re - priming events can lead to a larger number of internal gaps (figure 6b), some of which may be more easily filled - in via tls - mediated mechanisms (figure 1b) or also engaged by error - prone strand - annealing activities (figures 5d and 7). Notably, under conditions of limited or mcm - uncoupled re - priming, we observe an unusual high frequency of fork - reversal events associated with long ssdna stretches at the fork . The ssdna regions may be due to prolonged replication fork uncoupling or exonucleolytic processing of the reversed forks (figure 7). These observations indicate that at least in saccharomyces cerevisiae fork reversal is disfavored or extremely transient when re - priming is working efficiently . The fork reversal phenotype we reported here for ctf4 and pri1-m4 mutants is induced by dna damage . While in primase mutants about 12% of the forks are present in reversed conformation during replication in the presence of mms (figure 6c), following fork stalling induced by hu treatment, we found only 1% reversed forks in primase mutants and no reversed forks in wt and ctf4 mutants (data not shown). This is in contrast with the phenotype of rad53 replication checkpoint mutants in which about 10% of replication forks are in a reversed fork conformation after hu treatment (cotta - ramusino et al ., 2005; sogo et al ., 2002). Accumulation of reversed forks upon checkpoint defects likely reflects local accumulation of torsional stress (bermejo et al ., 2011) and not ddt attempts, as only about 1% reversed forks are observed in checkpoint defective cells upon mms treatment (lopes et al ., 2006). Thus, replication fork reversal is differentially modulated upon challenges to replisome stability or during replication - associated ddt . Under specific types of genotoxic stress (ray chaudhuri et al ., 2012), or upon impairment of kinetically favored ddt mechanisms (e.g., re - priming), transient fork reversal may become a crucial strategy to promote fork stabilization or to mediate alternate modes of damage - bypass in both s. cerevisiae and higher eukaryotic cells (neelsen and lopes, 2015). While fork reversal may initially function as a fork stabilization mechanism both at stalled and damaged replication forks (atkinson and mcglynn, 2009; neelsen and lopes, 2015), it is of note that unless promptly restarted reversed forks can be processed by multiple nucleases (cotta - ramusino et al ., 2005; doksani et al ., 2009; neelsen et al ., 2013; szakal and branzei, 2013), thus being a potential source of deleterious ssdna discontinuities and dsbs that may trigger, in the long run, genome instability (figure 7). Indeed, reduced amounts of pol in saccharomyces cerevisiae induce recombination - associated chromosome deletions and duplications (song et al ., 2014). We propose that altered fork structures may be engaged in break - induced replication (bir) type of mechanisms (figure 7), which may function as alternate and likely aberrant modes of ddt, prone to deletions as well as genomic duplications (costantino et al ., 2014). Notably, in support of the bir notion above, we found that ctf4 and pri1-m4 mutants display synthetic lethality with deletions of rad52 and rad59, generally required for bir, but not with rad51, which is often dispensable for bir (anand et al ., 2013). As many replication factors, including ctf4, also facilitate the dna synthesis step of bir (lydeard et al ., 2010), it is likely that the bir events induced under such replication stress conditions might be more prone to errors, leading to rearrangements . Indeed, inactivating mutations in error - free ddt factors as well as in pol/primase cause an increase in genomic duplications and deletions (figure 5d) (putnam et al ., 2010). Altogether, these results provide a molecular rationale for why cellular conditions characterized by replication stress are coincidently defective in error - free ddt processes and prone to deleterious bir or other annealing events (figures 1 and 5). These recombination pathways are bound to involve similarly defective replication steps, thus setting the stage for vicious circles in which more replication stress is being created . Mild replication dysfunctions of the type we uncovered here in ctf4 and pri1-m4 mutants are likely the culprits not only for genome instability, but also for chromosomal structural and cohesion alterations . Indeed, we found that differently from impairments in cohesin, the cohesion and ts defects of pol/primase / ctf4 are in a non - causal relationship . On one hand, improvement of sister chromatid proximity does not rescue the ts defects of ctf4 mutants (figure 4). On the other hand, inability to perform ts is unlikely at the basis of the observed cohesion defects, as mutations in canonical ts factors do not result in similar cohesion defects (warren et al ., 2004). We propose that the two phenotypes, defective ddt and cohesion impairment, arise coincidentally, but likely independently, from the same replication condition . In the case of pol/primase / ctf4 mutants, the underlying replication dysfunction relates to deregulated re - priming, and abnormal distribution of ssdna discontinuities . In addition, it is possible that increased replication pausing and altered fork structure in pol/primase / ctf4 complex mutants affects the topology of the replicating dna in manners that negatively impinge on cohesion (liu et al ., 2010). The coincident cohesion and ddt defects associated with mutations in the pol/primase / ctf4 complex suggest an intimate relationship between these two biological processes during replication . This hypothesis may also explain that hypomorphic mutations in other replication factors, affecting replication initiation or primer - processing, lead to cohesion defects and reduced tolerance to genotoxic stress (kerzendorfer et al . Remarkably, oncogene - induced replication stress, as well as ddr and cohesion dysfunctions associated with neurological and developmental defects, resemble in many respects the replication impairments studied here (halazonetis et al ., 2008; neelsen et al ., 2013; odriscoll and jeggo, 2008; van der lelij et al ., 2010). We propose that aberrant ddt associated with compromised error - free ts and fork rearrangements is a potential underlying common source of lesions in a number of replication disorders . The yeast strains used in this study were mostly derivatives of w303 and detailed genotypes are indicated in table s1 . Information about growing media, cell cycle arrest, release, and analysis are described in supplemental experimental procedures . Forward mutation and spontaneous intra - chromosomal deletion rates were calculated as described in the supplemental experimental procedures . Purification of dna intermediates and 2d gel analysis were carried out as previously described (vanoli et al ., 2010). Each experiment shown was performed independently at least twice with qualitatively identical results . Genome preparation and signal quantification methods
Dental caries is a multifactorial infectious disease, related to biofilm accumulation on dental surface16 and frequent consumption of fermentable carbohydrates2 . By the fermentation of dietary carbohydrates, the bacteria in the dental biofilm produce acids that decrease the ph and increase the biofilm potential in promoting dental demineralization3,4 . Additionally, the acid environment selects cariogenic bacteria, such as mutans streptococci16 . Among them, streptococcus mutans is known to be one of the most important cariogenic microorganisms15,16 because, in addition to being acidogenic and acid - tolerant, it uses sucrose to produce insoluble glucans in biofilm matrix3, which may play an important role in the development of caries3,5,17,22 . Different genotypes of s. mutans may present different expression levels of glucosyltransferases19 and higher production of insoluble polysaccharides has been reported by genotypes from caries - active individuals8,20 . Different genotypes of s. mutans have been found in saliva, and dental biofilm and ap - pcr technique has been widely used to discriminate this genotypic diversity1,6,7,9,11,12,18,23,26 . This technique has a discriminatory potential comparable to other techniques for genotypic identification of s. mutans 13,14,28 . The application of more than one arbitrary primer was suggested to increase the discriminatory power of ap - pcr genotyping13,29 . Saarela, et al.28 (1996) have reported that primers opa 05 and opa 13 were efficient to identify s. mutans genotypes . Truong, et al.29 (2000), investigating genotypic diversity among mutans streptococci, verified that primers opa 03 and opa 18 were capable to distinguish s. mutans from other oral microorganisms . Li and caufield13 (1998), after evaluating various arbitrary primers in the genotyping of reference strains of s. mutans, suggested that the primer opa 02 showed the best power of genotype discrimination, giving the highest number of amplicons when compared to other primers . Nevertheless, there is always the question whether other primers should be used to ascertain this diversity and, in addition, the evaluation of different primers was performed with only reference strains13 . Thus, the aim of the present study was to evaluate the degree of agreement of genotypic identification between ap- pcr reactions performed with distinct arbitrary primers (opa 02, opa 03, opa 05, opa 13 and opa 18) of streptococcus mutans isolated from saliva of adult volunteers . This research was approved by the research ethics committee of the dental school of piracicaba, state university of campinas (protocol #078/2007), the volunteers were fully informed about the procedures, and written consent was obtained prior to the beginning of the study . Stimulated saliva from 11 volunteers, who participated in a previous study evaluating the effect of sucrose on genotypic diversity1, was collected for isolation of mutans streptococci . Healthy volunteers (18 to 28 years old), who fulfilled inclusion criteria (counts of mutans streptococci in saliva from 10 to 10 colony - forming units (cfu) per ml) and exclusion criteria (antibiotic use for the last 2 months prior to the beginning of the study, use of any form of medication that modifies salivary secretion, periodontal disease, general / systemic diseases) took part in this study . Thereafter, pcr with specific primers (gtfb and gbpb) was conducted18,24 for identification of s. mutans, and then, these isolates were submitted to genotyping protocols by arbitrarily primed polymerase chain reaction (ap - pcr) with 5 different arbitrary primers: opa 02, opa 03, opa 05, opa 13 and opa 18 . Stimulated saliva samples were collected by parafilm chewing, in the morning, under fasting condition, and without previous toothbrushing . Saliva samples were diluted in sterile 0.9% nacl and plated on mitis salivarius - bacitracin agar (msb) (difco, sparks, md, usa). After incubation for 48 h at 37c in 10% co2, 8 representative morphological types of s. mutans colonies were collected from each sample, subcultured on mitis salivarius agar (msa) (difco, sparks, md, usa) and pure cultures stored at -70c in 10% skim milk medium10 . The purity and identity of the isolates were checked by gram's stain and colonial morphology on msa . Then, aliquots were collected from skim milk and plated on brain heart infusion (bhi) (difco, sparks, md, usa), which was incubated for 24 h at 37c in 10% co2 . The colonies from bhi agar were inoculated into todd hewitt broth (difco, sparks, md, usa) and incubated for 18 h at 37c and 10% co2 . Cultures were then centrifuged at 4c for 15 min, genomic dna was extracted and purified from cell pellet18, and stored at -20c . Integrities of the genomic dna samples were checked in samples electrophoretically resolved in 1% agarose gel and stained with ethidium bromide (5 g / ml). Isolates were confirmed for species identity in pcr reactions with primers specific for gtfb, enconding glucosyltransferase b (5, actacactttcgggtggcttgg-3 and 5, cagtataagcgccagtttcatc-3)24, and specific to gbpb, enconding glucan - binding protein b (5, caacagaagcacaaccatca-3 and 5- tgtccaccattaccccagt-3)18 . Although gtfb primers amplify s. mutans gtfb gene, a previous study revealed that gtfb primers yield some cross - amplification with several clinical isolates of s. sobrinus (defined as s. sobrinus species by sequencing of 16srrna)10 . To overcome this problem, the strains were also tested with gbpb primers because these primers yield amplicons of predicted size in all s. mutans genotypes tested in a previous study18, and do not amplify s. sobrinus sequences18 . Each reaction consisted of 1 l template dna, 10 m of each primer, 10 m of dntp, 2.5 l 1x pcr buffer, 50 mm mgcl2 and 5u/l taq dna polymerase in a total volume of 25 l . The amplification reaction was performed in a thermocycler (tc-412, techne, duxford, cambridge, uk) in 30 cycles as follows: denaturation 95c for 30 s, annealing at 59c for 30 s, and extension at 72c for 1 min, using s. mutans ua130 (kindly provided by dr . Page w. caufield, new york university, ny, usa) and s. sobrinus, and distilled / deionized water as positive and negative controls, respectively . The resulting amplicons were submitted to electrophoresis in 2% agarose gels and the images were captured by a digital imaging system (gel logic 100 imaging system, kodak, tokyo, japan). Ap - pcr assays were performed with the arbitrary primers: opa 02 (5-tgccgagctg-3)13, opa 03 (5- agtcagccac-3)29, opa 05 (5-aggggtcttg-3)28, opa 13 (5-cagcacccac-3)28 and opa 18 (5- aggtgaccgt-3)29 . The reactions were processed in 50 l mixtures containing 1x pcr buffer, 5 u / pl of taq dna polymerase, 10 mm dntp, 20 m primer, 50 mm mgcl2 and 2 l template dna . Reactions were performed with the following conditions: opa 02: one initial cycle of denaturation at 95c for 2 min, followed by 45 cycles of 94c for 30 s (denaturation), 36c for 30 s (annealing) and 72c for 1 min (extension) and a final extension at 72c for 5 min; opa 03 and 18: one initial cycle of denaturation at 95c for 2 min, followed by 30 cycles of 94c for 1 min (denaturation), 32c for 1 min (annealing) and 72c for 2 min (extension) and a final extension at 72c for 5 min; opa 05 and 13: one initial cycle of denaturation at 95c for 2 min, followed by 35 cycles of 95c for 1 min (denaturation), 36c for 2 min (annealing) and 72c for 2 min (extension) and a final extension at 72c for 5 min . Opa 02: one initial cycle of denaturation at 95c for 2 min, followed by 45 cycles of 94c for 30 s (denaturation), 36c for 30 s (annealing) and 72c for 1 min (extension) and a final extension at 72c for 5 min; opa 03 and 18: one initial cycle of denaturation at 95c for 2 min, followed by 30 cycles of 94c for 1 min (denaturation), 32c for 1 min (annealing) and 72c for 2 min (extension) and a final extension at 72c for 5 min; opa 05 and 13: one initial cycle of denaturation at 95c for 2 min, followed by 35 cycles of 95c for 1 min (denaturation), 36c for 2 min (annealing) and 72c for 2 min (extension) and a final extension at 72c for 5 min . The ap - pcr products were electrophoretically resolved in 1.5% agarose gels, using s. mutans ua130 and distilled and deionized water as positive and negative control, respectively . The gel was stained with a 5 g / ml of ethidium bromide solution for 10 min, and their images were captured by a digital imaging system (gel logic 100 imaging system, kodak, tokyo, japan). The amplicon profiles (amplitypes) of the same volunteer were always resolved side - by - side in the same gel for visual comparisons1,11,25 . Isolates were considered as having the same genotypic identity when presented identical ap - pcr product - size profiles . The genotypes found were analyzed descriptively and their proportion, in relation to the number of colonies isolated in each sample and condition, was calculated . Also, the number of bands from each genotype amplified by each of the arbitrary primers was counted and the mean value was calculated . This research was approved by the research ethics committee of the dental school of piracicaba, state university of campinas (protocol #078/2007), the volunteers were fully informed about the procedures, and written consent was obtained prior to the beginning of the study . Stimulated saliva from 11 volunteers, who participated in a previous study evaluating the effect of sucrose on genotypic diversity1, was collected for isolation of mutans streptococci . Healthy volunteers (18 to 28 years old), who fulfilled inclusion criteria (counts of mutans streptococci in saliva from 10 to 10 colony - forming units (cfu) per ml) and exclusion criteria (antibiotic use for the last 2 months prior to the beginning of the study, use of any form of medication that modifies salivary secretion, periodontal disease, general / systemic diseases) took part in this study . Thereafter, pcr with specific primers (gtfb and gbpb) was conducted18,24 for identification of s. mutans, and then, these isolates were submitted to genotyping protocols by arbitrarily primed polymerase chain reaction (ap - pcr) with 5 different arbitrary primers: opa 02, opa 03, opa 05, opa 13 and opa 18 . Stimulated saliva samples were collected by parafilm chewing, in the morning, under fasting condition, and without previous toothbrushing . Saliva samples were diluted in sterile 0.9% nacl and plated on mitis salivarius - bacitracin agar (msb) (difco, sparks, md, usa). After incubation for 48 h at 37c in 10% co2, 8 representative morphological types of s. mutans colonies were collected from each sample, subcultured on mitis salivarius agar (msa) (difco, sparks, md, usa) and pure cultures stored at -70c in 10% skim milk medium10 . The purity and identity of the isolates were checked by gram's stain and colonial morphology on msa . Then, aliquots were collected from skim milk and plated on brain heart infusion (bhi) (difco, sparks, md, usa), which was incubated for 24 h at 37c in 10% co2 . The colonies from bhi agar were inoculated into todd hewitt broth (difco, sparks, md, usa) and incubated for 18 h at 37c and 10% co2 . Cultures were then centrifuged at 4c for 15 min, genomic dna was extracted and purified from cell pellet18, and stored at -20c . Integrities of the genomic dna samples were checked in samples electrophoretically resolved in 1% agarose gel and stained with ethidium bromide (5 g / ml). Isolates were confirmed for species identity in pcr reactions with primers specific for gtfb, enconding glucosyltransferase b (5, actacactttcgggtggcttgg-3 and 5, cagtataagcgccagtttcatc-3)24, and specific to gbpb, enconding glucan - binding protein b (5, caacagaagcacaaccatca-3 and 5- tgtccaccattaccccagt-3)18 . Although gtfb primers amplify s. mutans gtfb gene, a previous study revealed that gtfb primers yield some cross - amplification with several clinical isolates of s. sobrinus (defined as s. sobrinus species by sequencing of 16srrna)10 . To overcome this problem, the strains were also tested with gbpb primers because these primers yield amplicons of predicted size in all s. mutans genotypes tested in a previous study18, and do not amplify s. sobrinus sequences18 . Each reaction consisted of 1 l template dna, 10 m of each primer, 10 m of dntp, 2.5 l 1x pcr buffer, 50 mm mgcl2 and 5u/l taq dna polymerase in a total volume of 25 l . The amplification reaction was performed in a thermocycler (tc-412, techne, duxford, cambridge, uk) in 30 cycles as follows: denaturation 95c for 30 s, annealing at 59c for 30 s, and extension at 72c for 1 min, using s. mutans ua130 (kindly provided by dr . Page w. caufield, new york university, ny, usa) and s. sobrinus, and distilled / deionized water as positive and negative controls, respectively . The resulting amplicons were submitted to electrophoresis in 2% agarose gels and the images were captured by a digital imaging system (gel logic 100 imaging system, kodak, tokyo, japan). Ap - pcr assays were performed with the arbitrary primers: opa 02 (5-tgccgagctg-3)13, opa 03 (5- agtcagccac-3)29, opa 05 (5-aggggtcttg-3)28, opa 13 (5-cagcacccac-3)28 and opa 18 (5- aggtgaccgt-3)29 . The reactions were processed in 50 l mixtures containing 1x pcr buffer, 5 u / pl of taq dna polymerase, 10 mm dntp, 20 m primer, 50 mm mgcl2 and 2 l template dna . Reactions were performed with the following conditions: opa 02: one initial cycle of denaturation at 95c for 2 min, followed by 45 cycles of 94c for 30 s (denaturation), 36c for 30 s (annealing) and 72c for 1 min (extension) and a final extension at 72c for 5 min; opa 03 and 18: one initial cycle of denaturation at 95c for 2 min, followed by 30 cycles of 94c for 1 min (denaturation), 32c for 1 min (annealing) and 72c for 2 min (extension) and a final extension at 72c for 5 min; opa 05 and 13: one initial cycle of denaturation at 95c for 2 min, followed by 35 cycles of 95c for 1 min (denaturation), 36c for 2 min (annealing) and 72c for 2 min (extension) and a final extension at 72c for 5 min . Opa 02: one initial cycle of denaturation at 95c for 2 min, followed by 45 cycles of 94c for 30 s (denaturation), 36c for 30 s (annealing) and 72c for 1 min (extension) and a final extension at 72c for 5 min; opa 03 and 18: one initial cycle of denaturation at 95c for 2 min, followed by 30 cycles of 94c for 1 min (denaturation), 32c for 1 min (annealing) and 72c for 2 min (extension) and a final extension at 72c for 5 min; opa 05 and 13: one initial cycle of denaturation at 95c for 2 min, followed by 35 cycles of 95c for 1 min (denaturation), 36c for 2 min (annealing) and 72c for 2 min (extension) and a final extension at 72c for 5 min . The ap - pcr products were electrophoretically resolved in 1.5% agarose gels, using s. mutans ua130 and distilled and deionized water as positive and negative control, respectively . The gel was stained with a 5 g / ml of ethidium bromide solution for 10 min, and their images were captured by a digital imaging system (gel logic 100 imaging system, kodak, tokyo, japan). The amplicon profiles (amplitypes) of the same volunteer were always resolved side - by - side in the same gel for visual comparisons1,11,25 . Isolates were considered as having the same genotypic identity when presented identical ap - pcr product - size profiles . The genotypes found were analyzed descriptively and their proportion, in relation to the number of colonies isolated in each sample and condition, was calculated . Also, the number of bands from each genotype amplified by each of the arbitrary primers was counted and the mean value was calculated . A total of 88 representative colonies of s. mutans were isolated from saliva, being 8 from each volunteer . All isolates were identified with all tested arbitrary primers were identified as s. mutans in the pcr reactions with specific primers . Most volunteers (9 out of 11) carried only one genotype (table 1). The exceptions were volunteer 8, who harbored 3 genotypes identified with all tested arbitrary primers (figure 1), and volunteer 11, who presented 2 genotypes when evaluated using the following primers: opa 02, 03, 05 and 13 . Using primer opa 18, considering the proportions of genotypes in relation to the total number of isolates, in volunteer 8, the predominant genotype was " h " (75%) and the others, " i " and " j ", represented 12.5% each one of the 8 isolates of this volunteer . For volunteer 11, the predominant genotype was " m " (87.5%) and the genotype " n " represented 12.5% . In addition, the genotypes were distinct among all volunteers . Table 1 also presents the number of bands produced after the ap - pcr reaction with each one of the arbitrary primers tested . The amplification with opa 02 primer resulted in a higher number of bands (mean of 11.9), in relation to the other primers . Opa 03 primer presented around 9.7 bands and the other primers between 8.6 and 8 bands . The proportion (%) of the genotypes in relation to the number of colonies isolated in each condition is represented within the parenthesis . The genotypes m and n were identified by all primers, except for opa 18 . It is well known that the oral cavity harbors distinct genotypes of s. mutans 9,12,18,20,27,28 . In the present study, only one genotype was found in the saliva of 9 out of 11 volunteers (table 1). This agrees with the findings of previous studies in saliva or dental biofilm samples of children9,12,18,20,27,28 and adult subjects1,21 . This low genotypic diversity could be related to the fact that other genotypes might be present in saliva in a proportion below to the detection limit of the microbiological method used26 . Also - certain genotypes present in the oral cavity could become permanently established, while other genotypes, due to their reduced ability of interacting with the host, form a transient population21 . Despite this low genotypic diversity found in the present study, saliva samples harbor those genotypes present at higher proportions in dental biofilms1,12 . In the present study, although distinct genotypes were identified by all primers tested, the opa 02 showed the best results, considering the number of bands produced by reaction (table 1). These data are in agreement with the study of li and caufield13 (1998). Despite the lower number of bands yielded in reactions with opa 03, when compared to primer opa 02, primer opa 03 allowed an efficient differentiation of genotypes . This result is in contrast with those of li and caufield13 (1998)m who found that opa 03 presented a lower discriminatory capacity than opa 02 . In addition, opa 05, 13 and 18 showed a smaller number of bands than opa 02 and opa 03 (table 1). The reduced number of bands might decrease the differentiation among genotypes, since just one genotype was identified by opa 18 in volunteer 11, compared to the other two genotypes identified with the other primers (table 1). In addition, although opa 05 produced fewer bands than opa 02 and 03, which might make difficult the differentiation of the genotypes, it seems that this characteristic did not impair the identification and differentiation of the genotypes in the samples analyzed . Because of this finding, considering the results of the present study, an association between opa 02 and opa 03 or opa 02 and opa 05 may be useful in the identification of genotypic diversity . Nevertheless, further studies should evaluate a larger number of volunteers and different samples, such as biofilm, which present a higher diversity, using different primers . In conclusion, the results of the present study suggest that primers opa 02, 03, 05 and 13 were suitable for genotypic identification of s. mutans isolates of saliva from adult volunteers.
Presented herein is a case in which an aberrant right hepatic artery (rha) passes anterior to the infundibulum and fundus of the gallbladder and courses to an unusually anterior hepatic entry . A 54-year - old female with a history of biliary colic was scheduled for laparoscopic cholecystectomy . Laparoscopic dissection revealed an aberrant right hepatic artery (rha) anterior to the infundibulum and fundus of the gallbladder . Further dissection revealed the cystic artery to branch laterally off this rha over the gallbladder fundus anteriorly . The cystic artery then wrapped postero - laterally on the gallbladder's surface to its neck . After the gallbladder was removed, the aberrant rha was readily visible traveling across the gallbladder bed and entering the liver at an unusually anterior location . The origins and paths of both the cystic and right hepatic arteries have several documented anomalies . We are unaware of any reports of an rha that transverses the entire neck and fundus of the gallbladder before such an anterior hepatic entry . This case serves as a striking reminder of the variations in extrahepatic biliary and vascular anatomy . Ligation of this uniquely located aberrant rha could have led to intraoperative hemorrhage or potential hepatic ischemia . The extrahepatic vascular and biliary anatomy of calot's triangle is well known to be inconsistent and highly variable . Careful dissection of the cystic duct and artery is required with a constant mind on the numerous anatomical possibilities to avoid both conversion requiring hemorrhage and postoperative biliary leak . Presented herein is a case in which an aberrant right hepatic artery (rha) passes anterior to the infundibulum and fundus of the gallbladder and courses to an unusually anterior hepatic entry . A 54-year - old female presented to her primary care physician with complaints of intermittent epigastric pain accompanied by nausea and vomiting . Her symptoms did not last longer than 15 minutes per episode and had been occurring 2 to 4 times per week for 2 months . The patient was given the diagnosis of biliary colic and scheduled for an elective laparoscopic cholecystectomy . At operation, the procedure was initiated with establishment of pneumoperitoneum and the standard two 12-mm and 10-mm trocars in the midline with two 5-mm ports laterally . These adhesions were seen as likely evidence of previous gallbladder inflammation despite no such ultrasound findings . Immediately visible upon retraction of the gallbladder was a thick tissue band covered in omental remnants extending from the area of the common bile duct towards the infundibulum . Initially thought to be the cystic duct, the size and path of this structure was not compatible . Dissection of adhesions revealed the structure to be an aberrant right hepatic artery adherent to the anterior surface of the gallbladder, enveloped in its peri - toneal covering . Further dissection revealed the cystic artery to branch laterally off this rha over the gallbladder fundus anteriorly (figure 1). The cystic artery was clipped and ligated and the rha was completely freed from the gallbladder . The gall - bladder was then able to be retracted superolaterally allowing dissection of the cystic duct . The duct was clipped proximally and left open for insertion of cholangio - catherization (figure 2). After the gallbladder was removed, the aberrant rha was readily visible traveling across the gallbladder bed and entering the liver at an unusually anterior location (figure 3). The remainder of the procedure was completed as an uncomplicated laparoscopic cholecystectomy . The aberrant right hepatic artery (above right angle dissector) adherent to the anterior surface of the gallbladder . The cystic artery branches off this rha and wraps laterally around the gallbladder towards the infundibulum . With the cystic artery ligated and the right hepatic artery dissected off the gallbladder, the gallbladder was then able to be retracted laterally, allowing for cystic duct identification and ligation for cholangiography . After the gallbladder has been removed, the right hepatic artery is elevated with a probe to illustrate its high site of hepatic entry . Superiorly, the artery has adherent remains of omental tissue residual from the preoperative inflammation and adhesions . The origins and paths of both the cystic and right hepatic arteries have several documented anomalies . A single cystic artery with a dominant course originating at the flexure of the right hepatic artery within calot's triangle passing posteromedially to the cystic duct toward the gallbladder neck is most common (70% to 80%). In approximately 5% of patients, the cystic artery courses outside of calot's triangle to the gallbladder . Frequently seen cystic artery variants include double artery (15% to 20%), cystic artery originating from an aberrant right hepatic artery (5% to10%), left hepatic artery origin (1% to 3%), and gastroduodenal artery origin (3% to 7%). Studies of hepatic arterial anatomy during liver harvesting for transplantation provide an excellent database documenting anomalies . A replaced rha is seen in 15% to 25% of patients, of which the vast majority reveal the rha branching off the superior mesenteric artery . Other aber - rant rha sources are the gastroduodenal artery, right gastric artery, and aorta . While the rha is seen anterior to the junction of the cystic and common bile ducts in a quarter of patients, these pass posteromedially to the gallbladder and cystic duct before entering the liver . While an rha adherent to the cystic duct and gallbladder neck is described amongst the most rare of anomalies, we are unaware of any reports of an rha that transverses the entire neck and fundus of the gallbladder before such an anterior hepatic entry . Inadvertent right hepatic artery ligation in cholecystectomy has been associated with liver ischemia, sometimes warranting hepatic lobectomy . An angiographic study would be needed to confirm the origin of this rha and whether it was an accessory rha or a true single aberrant rha this, however, was not clinically indicated . The size of the vessel (figures 1 and 2) alone is sufficient evidence of its significance . Based on historically observed patterns, this rha was most likely of superior mesenteric origin . This case serves as a striking reminder of the variations in extrahepatic biliary and vascular anatomy . Ligation of this aberrant rha could have led to intraoperative hemorrhage or potential hepatic ischemia.
Vitamin d deficiency, a pandemic health problem, is a major cause of rickets in infants and toddlers and of osteopenia in adolescents [16]. The production of vitamin d in the skin depends on sunshine exposure, latitude, skin - covering clothes, the use of sun block, and skin pigmentation . Although the mediterranean region generally has a sunny climate, higher rates of hypovitaminosis d are seen in european and mediterranean countries [710]. Vitamin d deficiency is especially common in the middle east because of the prevalence of wearing skin - covering clothes and because of staying out of the sun . Besides acting as a regulatory hormone in calcium metabolism, noncalciotropic effects of vitamin d such as cellular differentiation and replication in many organs vitamin d is also critical in glucose homeostasis and insulin secretion via its endocrine mechanisms [1214], besides its autocrine and paracrine role in adipocytes [15, 16]. Insulin resistance plays a major role in obesity, and as a population gets heavier at younger ages, the age of onset of non - insulin - dependent diabetes mellitus also decreases . Regrettably, obesity and adiposity is an emerging trend in the industrialized world it is a result of alimited exercise, a sedentary lifestyle, and replete diets with high - calorie, low - nutrient foods . The literature provides conflicting data as to whether vitamin d deficiency and insufficiency is a risk factor for the development of impaired glucose tolerance in childhood obesity . Low 25-hydroxyvitamin d level is found to be associated with insulin resistance in adults, but no relationship was found with parameters of glucose homeostasis and insulin sensitivity in healthy youth . This study was conducted to study the relationship of vitamin d deficiency and insufficiency with insulin resistance in obese children and adolescents and the prevalence of vitamin d deficiency among children living in the metropolitan area of istanbul, turkey . Enrolled in the study were 118 obese children (50% males, 50% females; mean age 12 2.2 years) and a control group of 68 healthy nonobese children (48.5% males, 51.5% females; mean age 12.6 1.7 years). They had been admitted to the bezmialem vakif university general pediatrics clinic in the marmara region between january 2011 and january 2012 . Each participant underwent a detailed physical examination (including evaluation for syndromes and endocrine diseases), as well as a laboratory evaluation . Standing height was measured to the nearest 0.1 cm with a harpenden fixed stadiometer . Body weight (kg) was measured on a seca balance scale to the nearest 0.1 kg, with each subject dressed in a light t - shirt and shorts . Body mass index (bmi) was calculated by dividing weight by height (kg / m). Obesity was defined as the bmi> 97th percentile, the definition of the international task force of obesity in childhood and population - specific data [21, 22]. Children whose obesity was the result of a syndromal problem (prader willi, laurence - moon biedl syndrome, etc .) Were excluded, as were those whose obesity had an endocrinal cause such as cushing's syndrome or hypothyroidism . None of the participants was using meneedication or had a history or evidence of current metabolic, cardiovascular, respiratory, or hepatic disease . All blood analyses were performed on fasting samples in both the study and control groups . Cholesterol, high - density lipoprotein (hdl), low - density lipoprotein (ldl), and triglycerides were measured by the homogeneus colorimetric enzyme technique (roche, cobas 8000). Serum 25-ohd levels were determined by the electrochemiluminescence enzyme immunoassay method (eclia) (advia centaur, usadpc co., usa). Glucose was measured by the glucose oxidase technique (siemens advia 1800) and insulin levels were analyzed with direct chemiluminescence technique (siemens centaur, usa). Insulin resistance was estimated from fasting plasma measurements using homa - ir (insulin (mu / l) glucose (mmol / l)/22.5). Insulin resistance criteria were homa - ir> 2.5 for prepubertal children and homa - ir> 4.0 for adolescents . Vitamin d status was classified as either deficient, insufficient, or sufficient (serum 25-ohd: <10 ng / ml, 1020 ng / ml, and> 20 ng / ml, resp . ). Statistical analysis was performed with pasw statistics, v.13.0 . A paired t - test was used to calculate the difference of two parameters in groups; one - way anova was used in the calculation of difference of two parameters in groups with more than two in the same group and between different groups . Categorical data were evaluated using the chi - square test; p <0.05 was accepted as statistically significant . The study was approved by the local ethical committee . Written informed consent was obtained from parents . Age and gender distribution were not statistically different between the two groups (p = 0.79 and 0.839, resp . ). Subjects of the obese group had significantly higher waist circumference sds (0.027), bmi (p <0.001), bmi sds (p> 0.001), and bmi percentage (p> 0.001) compared with the control group (table 1). Table 2 presents the biochemical characteristics of all subjects . Compared with the nonobese subjects, obese subjects had higher fasting insulin, homa - ir, serum alt, triglyceride, and total and ldl - cholesterol levels . The 25-ohd levels of obese children were significantly lower than those of the non - obese (p = 0.002). Hdl - cholesterol levels of the obese subjects were significantly lower than the non - obese ones . The obese group was classified according to 25-ohd levels as vitamin d deficient (10 ng / ml), insufficient (1020 ng / ml), and sufficient (25-ohd> 20 ng / dl). The correlation of vitamin d levels with insulin resistance in the obese group was evaluated with homa - ir . The homa - ir levels of the obese subjects who were vitamin d deficient and insufficient did not statistically differ from those with vitamin - d - sufficient ones (p = 0.72) (table 3). Table 4 presents the correlations among homa - ir with other biochemical parameters in the obese group . Homa - ir was not correlated significantly with age and serum 25-ohd levels but significantly correlated with triglyceride and ldl levels . Homa - ir correlated significantly with bmi (p <0.001), bmi sds (p <0.01), and bmi percentage (p <0.001). Obese children in turn have higher risk of hypovitaminosis d. turkey's vitamin d prophylaxis augmentation program (started in 2005) has resulted in a marked decrease in vitamin d deficiency in healthy children under 1 year of age; yet despite these improvements, most turkish adolescents are still vitamin d deficient . In our study, this finding revealed that obesity could be a risk factor of hypovitaminosis d in turkish children and adolescents . Recent studies from different countries have also demonstrated that vitamin d deficiency is common in obese children, possibly due to the low quality of diet . Here in turkey, rates of hypovitaminosis d in healthy adolescents were 59.4% and 65% in two different studies [26, 29]. Vitamin d plays an important role in glucose homeostasis in the mechanism of insulin release . Most of the studies suggested vitamin d deficiency as a risk factor of disturbed glucose homeostasis in adults [3033], but this hypothesis is still controversial in relation to children . It remains unclear if vitamin d deficiency and insufficiency are associated with insulin resistance in obese children and adolescents . Insulin resistance was estimated from fasting plasma measurements using homa - ir . In our study, insulin resistance values were higher in obese subjects compared with the healthy, vitamin - d - sufficient, age- and gender - matched children and adolescents . In order to determine the role of 25-hydroxyvitamin d levels in glucose intolerance and insulin resistance in obese children, we compare the homa - ir levels of vitamin - d - sufficient obese children and adolescents with the vitamin - d - deficient and -insufficient obese ones . There were no significant differences in homa - ir levels in obese children and adolescents due to 25-hydroxyvitamin d levels . In correlation analyses, we found that homa - ir depended on the degree of obesity and correlated with serum lipid profile . There was a significant trend towards higher insulin concentrations and insulin resistance in subjects with higher body mass index independent from 25-hydroxyvitamin d levels . Recent studies researching the relationship between vitamin d deficiency and insulin resistance in obese children revealed controversial results . In two studies, no relationship was found between low vitamin d status and insulin resistance [34, 35]. On the other hand, the literature mostly supported the hypothesis that low vitamin d status is associated with worse glucose tolerance . . Showed that vitamin d deficiency is associated with increased insulin resistance in children . The study by reis et al . Showed that low serum vitamin d in adolescents was strongly associated with increased risk for fasting hyperglycemia, hypertension, and metobolic syndrome . In the study conducted by garanty - bogacka et al ., fasting insulin levels and homa - ir were found correlated with low vitamin d levels . A limitation of this study is that vitamin d deficiency and insufficiency was defined only by 25-ohd levels . It is 1,25-dihydroxyvitamin d which is active on the vitamin d receptor in the insulin producing cells . It was also, not possible to evaluate other parameters modifying bone health such as subjects' dietary calcium intake or the responsiveness of the vitamin d receptor . In addition, with the lack of consensus regarding the definition of optimal vitamin d status in children, it is not possible to determine the level of vitamin d which disturbs glucose homeostasis and causes metabolic effects . In conclusion, in our study, insulin resistance correlated mostly with bmi but not with 25-hydroxyvitamin d levels in the obese children and adolescents . We found significant association between the degree of obesity and some biochemical parameters with insulin resistance, but different levels of 25 hydroxyvitamin d status among obese children were not an independent predictor of insulin resistance.
Neuroimaging research has consolidated its position as the major approach to investigate the human brain in vivo and has contributed to the improvement of knowledge about the biological basis of psychosis, especially schizophrenia . Schizophrenia is generally accepted as a neurodevelopmental disorder in which the most consistent morphological findings are enlarged lateral ventricles and reduced volume in the prefrontal and medial temporal lobes (1, 2). Although these abnormalities are evident in schizophrenia patients, the timing of their occurrence remains unclear . Advances in neuroimaging technologies and a ultra - high - risk (uhr) strategy that uses clinical - state - based criteria for identifying prodromal individuals, has resulted in renewed interest in brain development associated with the course of schizophrenia because the advances in research provide important insight into how brain changes occur (3). This strategy is a promising approach for the investigation of the neurobiological basis of risk for and conversion to illness that might provide potential prodromal markers of psychosis . Many neuroimaging studies in uhr individuals have reported alterations in several brain regions that correspond to structural abnormalities found in schizophrenia, particularly the frontal and medial temporal cortices, anterior cingulate cortex (acc), and superior temporal gyrus (stg) (4 - 6). Several hypotheses based on evidence about such brain abnormalities in uhr individuals have been proposed . Such deficits precede the onset of illness and certain events such as an intense or prolonged stressor or other environmental factors might exacerbate these deficits . Alternatively, such deficits could mark the onset of illness (5, 6). In this paper, we review the recent literature on brain magnetic resonance imaging (mri) changes in individuals at uhr for psychosis . We have recently reported cross - sectional cognitive and neuroimaging studies as well as conducted longitudinal observations to examine clinical and brain changes in uhr individuals . Throughout this review, we first discuss the most consistent findings in uhr individuals and then examine brain structural alterations as illness - onset markers, followed by suggestions for future directions of neuroimaging studies in uhr individuals . Accumulative studies of morphological changes in uhr individuals have used diverse methods to measure and identify the mri features of brain structures, such as manual and automated region of interest (rois), voxel - based morphometry (vbm), and surface - based cortical thickness methods . The manual roi method is considered the gold standard of 3d quantitative measurements due to its precision and is often used to detect subtle morphological changes . However, because it is time consuming and is specific to particular brain regions, most roi studies to date in uhr individuals have focused on the medial temporal cortex, including the hippocampus, which is one of the key regions in the neuropathology of schizophrenia (4, 6). Roi studies of hippocampal volume have frequently reported smaller volumes in uhr individuals than in healthy controls, particularly in the left hemisphere (7 - 9), although these findings have been inconsistent (10). Such abnormalities in the left hippocampus have also been reported in first - episode patients (feps) (10, 11). Findings from vbm studies in uhr individuals that have shown reduced gray matter in the hippocampus and adjacent parahippocampal cortex (12, 13) are compatible with those from roi approaches . Neurocognitive studies in uhr individuals have reported memory impairment, which is sensitive to hippocampal damage (14). The left hippocampus is known to subserve verbal memory and suggests that verbal episodic memory is a potential marker of risk for psychosis . This has been supported by several studies with relatively large samples of uhr individuals that have shown significantly poorer memory functions in uhr patients who later converted to psychosis (14 - 16). In this regard, one study examined whether interrelated structural - functional deficits of the hippocampus are present across early prodromal states (epss) and late prodromal states (lpss) of schizophrenia compared with healthy controls using a combined hippocampal volume and neuropsychological measures (rey auditory verbal learning test) (17). Both the eps and lps groups have reduced bilateral hippocampus volumes, but these reductions were correlated with a poorer cognitive test performance in only the lps group . These previous studies suggested a progressive and interrelated structural - functional pathology of the hippocampus as an index of increased risk for psychosis . Differences in hippocampal volume between uhr patients who later converted to psychosis (uhr - p) and those who did not (uhr - np) have been investigated by cross - sectional comparison, although the findings from these studies have shown contradictory results . Phillips et al . (18) reported reduced bilateral hippocampal volumes in uhr individuals and feps compared with healthy controls . In addition, uhr - p individuals were found to have a greater volume in the left hippocampus at the baseline compared with uhr - np individuals and feps . However, in contrast, a study by the same research group using a larger sample found no significant differences in the hippocampal volume between uhr - p and uhr - np individuals (10). (7) also reported no significant differences in the hippocampal volume between uhr - p and uhr - np individuals . However, they found a smaller left hippocampal volume in feps than in uhr individuals as well as healthy controls and a larger left hippocampal volume in uhr - p individuals compared with feps . Recently, witthaus et al . (19) divided the hippocampus into two regions, the head and corpus / tail, and compared the volumes of these two subregions in uhr individuals, feps, and healthy controls . Uhr individuals had a smaller volume in the bilateral hippocampus corpus and tail, but not the head, than the healthy controls . In addition, uhr - p individuals had a reduced volume in the right hippocampus corpus and tail compared with uhr - np individuals . (9) investigated the contributions of family history to hippocampal volume in uhr individuals . Those without a family history of psychosis were found to have a smaller hippocampal volume than those with a family history of psychosis . This suggests that morphological anomalies in the hippocampus are affected more by nonspecific environmental factors than by genetic factors . Magnetic resonance spectroscopy (mrs) studies have been conducted to investigate whether metabolic changes are found in the hippocampus of uhr individuals . Mrs studies have indicated normal levels of n - acetylaspartate (naa; a marker of neuronal / axonal integrity) in the hippocampus of uhr individuals (8, 20, 21). Recently, wood et al . (8) investigated hippocampal volume and mrs as well as hippocampal t2 relaxation time, which is highly sensitive to the presence of neuropathological changes . The uhr - p group had a significantly elevated t2 relaxation time for the left hippocampal head . These findings suggest that morphological anomalies in the hippocampus occur before the onset of psychosis, but are not related to transition, and the magnitude of reduced hippocampal volume matches the stage of illness (11, 13), although the study with the largest sample did not support this conclusion (10). The stg is also one of the key regions often investigated by the roi approach in schizophrenia (22, 23) and uhr individuals (24, 25). Several studies in schizophrenia and feps have reported a reduced volume in the stg, particularly in the left hemisphere, as with hippocampal deficits (1, 22, 26, 27). Volume reduction of the stg in psychosis patients is related to functional deficits, including auditory hallucinations and thought disorder (28, 29). In a longitudinal study of feps, progressive reduction in the left stg volume was highly correlated with progressive neurophysiological deficits, especially mismatch negativity (mmn) (30). Recently, we investigated mmn in the auditory cortex of uhr individuals to clarify whether mmn deficits appear before illness onset . The uhr group showed reductions in both the amplitude of mmn and the magnetic counterpart of mmn (mmnm) compared with healthy controls (31). We also found a negative correlation between the left mmnm dipole moment and clinical symptoms, in addition to a smaller right mmnm dipole moment than in healthy controls . We suggest that deficits in the early stage of auditory processing exist before illness onset . Several cross - sectional vbm studies have reported a smaller stg in uhr individuals than in healthy controls (12, 32, 33). Our recent findings in cortical thickness measurement using a surface - based method are consistent with previous vbm findings that have shown a decreased left stg cortical thickness in uhr individuals compared with healthy controls (34). In particular, the mean cortical thickness in the stg gradually decreases according to psychotic stages (i.e., in order, healthy controls, uhr individuals, and schizophrenia patients). Recently, takahashi et al . (24) conducted a longitudinal examination of the stg subregions (planum polare, heschl's gyrus, planum temporale, and rostral and caudal regions) in uhr individuals . In cross - sectional comparisons, they found no differences in the whole stg and its subregions at the baseline between uhr individuals and healthy controls as well as no differences between uhr - p and uhr - np individuals, whereas male uhr - p individuals had a smaller planum temporale at follow - up than did the healthy controls . In longitudinal comparisons, uhr - p individuals showed a significant reduction in the planum polare, planum temporal, and caudal regions of the stg compared with uhr - np individuals and healthy controls . A more recent study from the same center with a larger sample of antipsychotic - nave individuals at uhr reported smaller bilateral stg volumes at the baseline in uhr patients compared with healthy controls, but no differences between uhr - p and uhr - np individuals (25). Speculatively, abnormalities of the stg in schizophrenia might be associated with deficits in face perception often noted in schizophrenia patients because the stg and fusiform gyrus play central roles in processing faces (35). Our group recently reported specific problems in configural face processing in schizophrenia and suggested that inadequate facial recognition in schizophrenia results from deficits in processing configuration information (36). More recently, we also found deficits in the processing of facial configuration in uhr individuals suggesting that the deficits contribute to social dysfunction in schizophrenia (37). Deficits in social functioning in uhr individuals have been assessed using the social functioning scale (38). Taken together, findings from other centers and our own group suggest that uhr individuals have structural and functional abnormalities in the stg before illness onset, particularly in the left hemisphere . In addition, it is suggested that a progressive regional pathological process in the stg occurs before the first expression of frank psychosis, and such deficits might lead to deficits in social functioning . Structural abnormalities in several frontal regions have been reported in uhr individuals, particularly in the prefrontal cortex (pfc), including the dorsolateral pfc (dlpfc), medial pfc (mpfc), and the acc . Reduced pfc gray matter has been consistently reported by our group and others (34, 39). One study found a significant elevation of the naa / creatine and choline / creatine ratios in the left dlpfc in uhr individuals, which was interpreted as a decline in creatine indicative of hypometabolism (21), whereas another study showed a significant reduction in the naa / creatine and naa / choline ratios in the left frontal lobe (40). However, our recent mrs study found no differences in the left dlpfc between uhr subjects and healthy controls (41). The discrepancies in these findings might partly have arisen from differences in sample characteristics such as age and definition of volumes of interest . Deficits in the pfc in uhr individuals might be related to cognitive dysfunction, such as working memory and attention deficits (4, 15). In particular, spatial working memory ability has been suggested as a marker of risk for psychosis (42). In this context, we recently conducted a study in which uhr individuals performed a spatial working memory task during functional mri scanning . Our data showed decreased dlpfc activation in uhr individuals compared with healthy controls (choi et al . In preparation). Abnormalities in the midline cortical structures that include the mpfc and acc have been reported (34). We recently found impaired social cognition, such as theory of mind, in uhr individuals (43). This could be the result of reduced gray matter in the mpfc, which plays a role in social cognition . A recent review suggested that alterations in cortical midline structures during the prodrome might be related to phenomenological disturbances, particularly a disrupted sense of self, based on the involvement of the mpfc and acc regions in self - related processing (44). The recently discovered default mode network (dmn) is a set of brain regions that mainly consists of the mpfc and the posterior cingulate cortex that are involved in self - referential processing (45). Thus, it is valuable to examine whether abnormalities in the dmn exist in the uhr group . Therefore, we reconstructed and compared the intrinsic organized dmn of the resting brain in uhr subjects and healthy controls based on functional mri time series correlation . Our data showed that compared to healthy controls, uhr subjects showed hyperconnectivity within the default network regions (46). Abnormalities of the acc region have been implicated in the pathophysiology of psychotic disorders (47). This region is associated with impaired cognition, such as self - monitoring and disorganization in schizophrenia patients (48). The pattern of cortical folding in this region has been investigated in uhr individuals because of the evidence for early neurodevelopmental anomalies . Uhr individuals have a poorly developed left paracingulate sulcus and an interrupted left cingulate sulcus compared with healthy controls (49). (9) examined the contribution of a family history of schizophrenia to acc morphology and found that uhr individuals without a family history of schizophrenia had reduced paracingulate folding and more frequent cingulate sulcus interruptions in the left hemisphere compared with uhr individuals with such history, although this difference was not significant . These authors suggested that these morphological abnormalities in the acc are related more to environmental factors than genetic factors (9). Several vbm studies have reported decreased acc gray matter volume in uhr individuals compared with healthy controls (12, 33). Our cortical thickness study also found a decreased acc thickness in uhr individuals compared with healthy controls (34). Recently, fornito et al . (50) suggested that acc abnormalities precede psychosis onset based on a cortical surface - based protocol for parcellating the acc . An mrs study found a lower naa / creatine ratio in the acc in uhr individuals (40), but our group found no significant differences in any metabolite between uhr individuals and healthy controls (41). Structural alterations in other brain regions have been reported in uhr individuals compared with healthy controls . Abnormalities in the hypothalamic - pituitary - adrenal (hpa) axis have been suggested in uhr individuals based on hpa - axis hyperactivity in feps and psychotic patients (51, 52). (53) found that a larger pituitary volume is associated with the future development of psychosis that suggests an increase in the activation of the hormonal stress response . Thompson et al . (54) provided evidence for hpa - axis dysfunction in uhr individuals by examining the relationships between cortisol and glucocorticoid receptor numbers and pituitary volume . Morphological abnormalities in limbic system regions such as the insular cortex and the amygdala have been suggested in uhr individuals owing to the role of these structures in emotional processing and previous findings of deficits in such processing in schizophrenia patients (10, 19, 55). An roi study indicated that insular cortex abnormalities precede the first expression of frank psychosis and progressive pathological changes occur in the insular cortex during the transition period (55). However, roi studies of amygdala volume have not found significant differences between uhr individuals and healthy controls (10, 19). Some studies have investigated the brain structures of uhr individuals, particularly the midline structures of the brain such as the cavum septum pellucidum (csp) and adhesio interthalamica (ai), in light of the early neurodevelopmental anomalies . Abnormalities of the csp, unlike subtle morphological changes in other brain regions, can be detected by visual inspection, and a high prevalence of radiological findings such as the csp were reported in uhr subjects compared with healthy controls (56). Our first mri study in uhr subjects investigated the frequency and severity of an enlarged csp in uhr individuals compared to first - degree relatives of patients with schizophrenia and healthy controls, which is one of the consistent findings in schizophrenia studies (1, 58), according to a grading system (57). Based on the grading scale, we found a significantly higher prevalence of abnormally enlarged csp in uhr individuals, but not in first - degree relatives of patients with schizophrenia, compared with healthy controls . However, based on csp length, a study by takahashi et al . (59) with a large sample (n=135) found no significant differences in the prevalence of an abnormally large csp between the groups . Takahashi et al . (60) also measured the length and prevalence of the ai in the same sample . They found a shorter ai in uhr individuals than in healthy controls, but no difference between uhr - p and uhr - np individuals . Accumulative studies of morphological changes in uhr individuals have used diverse methods to measure and identify the mri features of brain structures, such as manual and automated region of interest (rois), voxel - based morphometry (vbm), and surface - based cortical thickness methods . The manual roi method is considered the gold standard of 3d quantitative measurements due to its precision and is often used to detect subtle morphological changes . However, because it is time consuming and is specific to particular brain regions, most roi studies to date in uhr individuals have focused on the medial temporal cortex, including the hippocampus, which is one of the key regions in the neuropathology of schizophrenia (4, 6). Roi studies of hippocampal volume have frequently reported smaller volumes in uhr individuals than in healthy controls, particularly in the left hemisphere (7 - 9), although these findings have been inconsistent (10). Such abnormalities in the left hippocampus have also been reported in first - episode patients (feps) (10, 11). Findings from vbm studies in uhr individuals that have shown reduced gray matter in the hippocampus and adjacent parahippocampal cortex (12, 13) are compatible with those from roi approaches . Neurocognitive studies in uhr individuals have reported memory impairment, which is sensitive to hippocampal damage (14). The left hippocampus is known to subserve verbal memory and suggests that verbal episodic memory is a potential marker of risk for psychosis . This has been supported by several studies with relatively large samples of uhr individuals that have shown significantly poorer memory functions in uhr patients who later converted to psychosis (14 - 16). In this regard, one study examined whether interrelated structural - functional deficits of the hippocampus are present across early prodromal states (epss) and late prodromal states (lpss) of schizophrenia compared with healthy controls using a combined hippocampal volume and neuropsychological measures (rey auditory verbal learning test) (17). Both the eps and lps groups have reduced bilateral hippocampus volumes, but these reductions were correlated with a poorer cognitive test performance in only the lps group . These previous studies suggested a progressive and interrelated structural - functional pathology of the hippocampus as an index of increased risk for psychosis . Differences in hippocampal volume between uhr patients who later converted to psychosis (uhr - p) and those who did not (uhr - np) have been investigated by cross - sectional comparison, although the findings from these studies have shown contradictory results . Phillips et al . (18) reported reduced bilateral hippocampal volumes in uhr individuals and feps compared with healthy controls . In addition, uhr - p individuals were found to have a greater volume in the left hippocampus at the baseline compared with uhr - np individuals and feps . However, in contrast, a study by the same research group using a larger sample found no significant differences in the hippocampal volume between uhr - p and uhr - np individuals (10). (7) also reported no significant differences in the hippocampal volume between uhr - p and uhr - np individuals . However, they found a smaller left hippocampal volume in feps than in uhr individuals as well as healthy controls and a larger left hippocampal volume in uhr - p individuals compared with feps . Recently, witthaus et al . (19) divided the hippocampus into two regions, the head and corpus / tail, and compared the volumes of these two subregions in uhr individuals, feps, and healthy controls . Uhr individuals had a smaller volume in the bilateral hippocampus corpus and tail, but not the head, than the healthy controls . In addition, uhr - p individuals had a reduced volume in the right hippocampus corpus and tail compared with uhr - np individuals . (9) investigated the contributions of family history to hippocampal volume in uhr individuals . Those without a family history of psychosis were found to have a smaller hippocampal volume than those with a family history of psychosis . This suggests that morphological anomalies in the hippocampus are affected more by nonspecific environmental factors than by genetic factors . Magnetic resonance spectroscopy (mrs) studies have been conducted to investigate whether metabolic changes are found in the hippocampus of uhr individuals . Mrs studies have indicated normal levels of n - acetylaspartate (naa; a marker of neuronal / axonal integrity) in the hippocampus of uhr individuals (8, 20, 21). Recently, wood et al . (8) investigated hippocampal volume and mrs as well as hippocampal t2 relaxation time, which is highly sensitive to the presence of neuropathological changes . The uhr - p group had a significantly elevated t2 relaxation time for the left hippocampal head . These findings suggest that morphological anomalies in the hippocampus occur before the onset of psychosis, but are not related to transition, and the magnitude of reduced hippocampal volume matches the stage of illness (11, 13), although the study with the largest sample did not support this conclusion (10). The stg is also one of the key regions often investigated by the roi approach in schizophrenia (22, 23) and uhr individuals (24, 25). Several studies in schizophrenia and feps have reported a reduced volume in the stg, particularly in the left hemisphere, as with hippocampal deficits (1, 22, 26, 27). Volume reduction of the stg in psychosis patients is related to functional deficits, including auditory hallucinations and thought disorder (28, 29). In a longitudinal study of feps, progressive reduction in the left stg volume was highly correlated with progressive neurophysiological deficits, especially mismatch negativity (mmn) (30). Recently, we investigated mmn in the auditory cortex of uhr individuals to clarify whether mmn deficits appear before illness onset . The uhr group showed reductions in both the amplitude of mmn and the magnetic counterpart of mmn (mmnm) compared with healthy controls (31). We also found a negative correlation between the left mmnm dipole moment and clinical symptoms, in addition to a smaller right mmnm dipole moment than in healthy controls . We suggest that deficits in the early stage of auditory processing exist before illness onset . Several cross - sectional vbm studies have reported a smaller stg in uhr individuals than in healthy controls (12, 32, 33). Our recent findings in cortical thickness measurement using a surface - based method are consistent with previous vbm findings that have shown a decreased left stg cortical thickness in uhr individuals compared with healthy controls (34). In particular, the mean cortical thickness in the stg gradually decreases according to psychotic stages (i.e., in order, healthy controls, uhr individuals, and schizophrenia patients). 24) conducted a longitudinal examination of the stg subregions (planum polare, heschl's gyrus, planum temporale, and rostral and caudal regions) in uhr individuals . In cross - sectional comparisons, they found no differences in the whole stg and its subregions at the baseline between uhr individuals and healthy controls as well as no differences between uhr - p and uhr - np individuals, whereas male uhr - p individuals had a smaller planum temporale at follow - up than did the healthy controls . In longitudinal comparisons, uhr - p individuals showed a significant reduction in the planum polare, planum temporal, and caudal regions of the stg compared with uhr - np individuals and healthy controls . A more recent study from the same center with a larger sample of antipsychotic - nave individuals at uhr reported smaller bilateral stg volumes at the baseline in uhr patients compared with healthy controls, but no differences between uhr - p and uhr - np individuals (25). Speculatively, abnormalities of the stg in schizophrenia might be associated with deficits in face perception often noted in schizophrenia patients because the stg and fusiform gyrus play central roles in processing faces (35). Our group recently reported specific problems in configural face processing in schizophrenia and suggested that inadequate facial recognition in schizophrenia results from deficits in processing configuration information (36). More recently, we also found deficits in the processing of facial configuration in uhr individuals suggesting that the deficits contribute to social dysfunction in schizophrenia (37). Deficits in social functioning in uhr individuals have been assessed using the social functioning scale (38). Taken together, findings from other centers and our own group suggest that uhr individuals have structural and functional abnormalities in the stg before illness onset, particularly in the left hemisphere . In addition, it is suggested that a progressive regional pathological process in the stg occurs before the first expression of frank psychosis, and such deficits might lead to deficits in social functioning . Structural abnormalities in several frontal regions have been reported in uhr individuals, particularly in the prefrontal cortex (pfc), including the dorsolateral pfc (dlpfc), medial pfc (mpfc), and the acc . Reduced pfc gray matter has been consistently reported by our group and others (34, 39). One study found a significant elevation of the naa / creatine and choline / creatine ratios in the left dlpfc in uhr individuals, which was interpreted as a decline in creatine indicative of hypometabolism (21), whereas another study showed a significant reduction in the naa / creatine and naa / choline ratios in the left frontal lobe (40). However, our recent mrs study found no differences in the left dlpfc between uhr subjects and healthy controls (41). The discrepancies in these findings might partly have arisen from differences in sample characteristics such as age and definition of volumes of interest . Deficits in the pfc in uhr individuals might be related to cognitive dysfunction, such as working memory and attention deficits (4, 15). In particular, spatial working memory ability has been suggested as a marker of risk for psychosis (42). In this context, we recently conducted a study in which uhr individuals performed a spatial working memory task during functional mri scanning . Our data showed decreased dlpfc activation in uhr individuals compared with healthy controls (choi et al . In preparation). Abnormalities in the midline cortical structures that include the mpfc and acc have been reported (34). We recently found impaired social cognition, such as theory of mind, in uhr individuals (43). This could be the result of reduced gray matter in the mpfc, which plays a role in social cognition . A recent review suggested that alterations in cortical midline structures during the prodrome might be related to phenomenological disturbances, particularly a disrupted sense of self, based on the involvement of the mpfc and acc regions in self - related processing (44). The recently discovered default mode network (dmn) is a set of brain regions that mainly consists of the mpfc and the posterior cingulate cortex that are involved in self - referential processing (45). Thus, it is valuable to examine whether abnormalities in the dmn exist in the uhr group . Therefore, we reconstructed and compared the intrinsic organized dmn of the resting brain in uhr subjects and healthy controls based on functional mri time series correlation . Our data showed that compared to healthy controls, uhr subjects showed hyperconnectivity within the default network regions (46). Abnormalities of the acc region have been implicated in the pathophysiology of psychotic disorders (47). This region is associated with impaired cognition, such as self - monitoring and disorganization in schizophrenia patients (48). The pattern of cortical folding in this region has been investigated in uhr individuals because of the evidence for early neurodevelopmental anomalies . Uhr individuals have a poorly developed left paracingulate sulcus and an interrupted left cingulate sulcus compared with healthy controls (49). (9) examined the contribution of a family history of schizophrenia to acc morphology and found that uhr individuals without a family history of schizophrenia had reduced paracingulate folding and more frequent cingulate sulcus interruptions in the left hemisphere compared with uhr individuals with such history, although this difference was not significant . These authors suggested that these morphological abnormalities in the acc are related more to environmental factors than genetic factors (9). Several vbm studies have reported decreased acc gray matter volume in uhr individuals compared with healthy controls (12, 33). Our cortical thickness study also found a decreased acc thickness in uhr individuals compared with healthy controls (34). Recently, fornito et al . (50) suggested that acc abnormalities precede psychosis onset based on a cortical surface - based protocol for parcellating the acc . An mrs study found a lower naa / creatine ratio in the acc in uhr individuals (40), but our group found no significant differences in any metabolite between uhr individuals and healthy controls (41). Structural alterations in other brain regions have been reported in uhr individuals compared with healthy controls . Abnormalities in the hypothalamic - pituitary - adrenal (hpa) axis have been suggested in uhr individuals based on hpa - axis hyperactivity in feps and psychotic patients (51, 52). (53) found that a larger pituitary volume is associated with the future development of psychosis that suggests an increase in the activation of the hormonal stress response . Thompson et al . (54) provided evidence for hpa - axis dysfunction in uhr individuals by examining the relationships between cortisol and glucocorticoid receptor numbers and pituitary volume . Morphological abnormalities in limbic system regions such as the insular cortex and the amygdala have been suggested in uhr individuals owing to the role of these structures in emotional processing and previous findings of deficits in such processing in schizophrenia patients (10, 19, 55). An roi study indicated that insular cortex abnormalities precede the first expression of frank psychosis and progressive pathological changes occur in the insular cortex during the transition period (55). However, roi studies of amygdala volume have not found significant differences between uhr individuals and healthy controls (10, 19). Some studies have investigated the brain structures of uhr individuals, particularly the midline structures of the brain such as the cavum septum pellucidum (csp) and adhesio interthalamica (ai), in light of the early neurodevelopmental anomalies . Abnormalities of the csp, unlike subtle morphological changes in other brain regions, can be detected by visual inspection, and a high prevalence of radiological findings such as the csp were reported in uhr subjects compared with healthy controls (56). Our first mri study in uhr subjects investigated the frequency and severity of an enlarged csp in uhr individuals compared to first - degree relatives of patients with schizophrenia and healthy controls, which is one of the consistent findings in schizophrenia studies (1, 58), according to a grading system (57). Based on the grading scale, we found a significantly higher prevalence of abnormally enlarged csp in uhr individuals, but not in first - degree relatives of patients with schizophrenia, compared with healthy controls . However, based on csp length, a study by takahashi et al . (59) with a large sample (n=135) found no significant differences in the prevalence of an abnormally large csp between the groups . Takahashi et al . (60) also measured the length and prevalence of the ai in the same sample . They found a shorter ai in uhr individuals than in healthy controls, but no difference between uhr - p and uhr - np individuals . A number of structural mri studies in uhr individuals have suggested specific brain regions as potential predictive markers of illness onset based on structural differences between the brains of uhr - p and uhr - np subjects . Manual and automated roi approaches have found a smaller volume in the hippocampus (18) and insula (55), larger pituitary volume (53), and reduced thickness of the rostral limbic acc in uhr - p (50) compared with uhr - np individuals . However, several studies have found no differences in the hippocampus (7, 9, 10), acc, and amygdala volume (10) between uhr - p and uhr - np individuals . This discrepancy might have been due to methodological differences such as scanning parameters and imaging analysis methods . Alternatively, it might be considered that a certain method is more sensitive to abnormalities of a specific region than other methods (61). A recent review and meta - analysis of published data showed that uhr - p individuals have gray matter abnormalities in the pfc, acc, insula, and cerebellum before the transition to psychosis, compared with uhr - np individuals (5). It has been suggested that structural abnormalities in these regions might be the most predictive markers for a later transition to psychosis . In this regard, one recent study distinguished uhr individuals from healthy controls and uhr - p from uhr - np subjects using a whole - brain classification with a support vector machine (62). Uhr - p versus uhr - np classification relies on a pattern of gray matter volume reductions that involve the temporal and prefrontal cortices, thalamus, and cerebellum . In contrast, another study found no distinction between uhr and healthy individuals based on the patterns of changes in cortical thickness, whereas it did distinguish uhr from healthy individuals using patterns of cortical thickness asymmetry (63). Previous studies have provided evidence to support specific structural alterations in uhr individuals as potential markers of the transition to psychosis . However, most studies are limited by their cross - sectional design in particular, the dorsal frontal and parietal lobes undergo dynamic changes between adolescence and adulthood (64, 65). The group defined as uhr is between 15 and 30 yr of age and their brains are changing along a neurodevelopmental trajectory . A recently published review emphasized developmental considerations in the identification of more valid markers of the transition to psychosis (6). Longitudinal studies are needed to ascertain normal or abnormal trajectories of neurodevelopment in uhr individuals . However, only a few studies have investigated the longitudinal changes over the transition to psychosis . To the best of our knowledge, there have been only five longitudinal structural mri studies conducted on uhr individuals, two whole - brain vbm studies (66, 67), two roi studies (24, 55), and one whole - brain cortical surface - matching study (39). In the whole - brain vbm approach, pantelis et al . (66) found progressive reductions in the left orbitofrontal, parahippocampal, fusiform and cingulate cortices, and cerebellum in uhr - p individuals, whereas uhr - np subjects showed longitudinal reductions in only the cerebellum . (67) reported longitudinal volume reductions in the orbitofrontal, superior frontal, inferior temporal, medial and superior parietal cortices, and cerebellum in uhr - p individuals, whereas they found no longitudinal changes in uhr - np subjects . The authors suggested that a reduction in gray matter volume in the frontal, temporal, and parietal cortices is particularly associated with psychotic illness, rather than with vulnerability to psychosis . In longitudinal roi studies, uhr - p individuals showed greater reductions in the insular volume (55) and stg subregions including the planum polare, planum temporale, and caudal region (24) compared with uhr - np individuals . A longitudinal structural mri study using cortical pattern matching demonstrated an increasing surface contraction in the right pfc in uhr - p compared with uhr - np individuals (39). Such a change in the pfc in uhr individuals suggests the involvement of an abnormal neurodevelopmental processes, which is consistent with the acceleration of the normal development that occurs in early - onset schizophrenia (68). Over the past two decades, structural mri studies of uhr individuals have become a major approach to identify the neurobiological basis, underlying risk of, and conversion to schizophrenia . Convergent evidence from structural mri studies in uhr individuals suggest that abnormalities in the pfc and temporal cortex and the acc precede illness onset (4). These regions correspond to structural abnormalities found in schizophrenia patients (1) as well as feps (69). Regional differences between uhr - p and uhr - np and longitudinal brain changes, particularly in uhr - p, have led to suggestions that the pfc and temporal cortex may be potential markers of later psychosis (5, 6). What causes structural abnormalities in uhr individuals? Only a few studies have addressed this question by investigating the contributions of genetic factors or of stress to such brain abnormalities (9, 54). An alternative possibility, as discussed above, is that brain abnormalities in uhr individuals might represent an accelerated process of late brain maturation (6). It is still unclear whether inter - individual variation in cortical changes in healthy controls is less than the variation associated with risk of illness (70). During adolescence and early adulthood, the brain undergoes complex and dynamic changes . Cortical changes in each uhr subject could be within the range of normal variation, but those changes show an abnormal developmental trajectory . Given these assumptions and published review articles (5, 6), we could speculate that contradictory findings of previous studies might have resulted from differences in the neurodevelopmental trajectory between samples and that accelerated brain maturation is more predictive than subtle differences in specific brain regions . We suggest that some genes associated with brain development during adolescence and early adulthood affect brain alterations by accelerating the process of normal neurodevelopment (6). Further longitudinal studies should be conducted to characterize the differences in brain developmental trajectory between uhr and healthy individuals . We should also take account of the effects of antipsychotic drugs on brain structures in longitudinal studies of uhr individuals . Structural differences between uhr - p and uhr - np individuals could influence antipsychotic use in the former group . Therefore, future longitudinal comparisons should be conducted before and after illness onset while subjects are antipsychotic - nave . In conclusion, research on uhr individuals is a promising approach for furthering our understanding of the pathophysiology of schizophrenia in the context of neurodevelopment . Structural mri studies in uhr individuals have contributed to early detection and management as well as suggest predictive neurobiological markers of the transition to psychosis.
The maintenance of homeostasis is a continuous process dependent on multiple feedback mechanisms that operate around set points . For example, fluctuations in the cardiac output and peripheral vascular resistance interact continuously, leading to the relative stability of the blood pressure values . Fluctuations in the cardiac output can be assessed via heart rate variability, which has been extensively studied and is related to the prognosis of cardiac diseases.1,2 the hemodynamic and respiratory components also fluctuate continuously . In this context, variability in the respiratory components could represent a relevant physiological phenomenon, although it is rarely addressed.3,4 in the last decade, heart - lung interactions have been identified as a key issue in heart failure.5 several studies have suggested that the analysis of ventilatory parameters during exercise can add relevant information to the prognosis of heart failure patients.6 - 9 despite the increasing number of recent publications discussing ventilatory abnormalities in heart disease, little is known about the physiological patterns and timing of breathing during exercise, even in healthy individuals . Neder et al10 published the only study that normalized the pattern and timing of breathing in healthy people of various ages and both genders during a progressive exercise test using a leg ergometer . Classic respiratory parameters, such as ventilatory equivalents and the occurrence of periodic breathing, can confer relevant clinical and prognostic information in heart disease.4,9 the absence of a universally accepted definition of periodic breathing and the need to manually identify this phenomenon prevents the widespread use of periodic breathing as a prognostic criterion in heart failure.11 clinical experience has shown that some heart failure patients exhibit ventilatory oscillations during exercise tests without achieving any previously established criteria for periodic breathing.4,12 thus, it is conceivable that a time - domain analysis of variability during minute ventilation could be useful for detecting the light ventilatory oscillations that occur during exercise . However, the physiological pattern of ventilatory oscillations throughout exercise has not been previously described, despite the potential impact on the understanding of normal and abnormal physiology and its consequent clinical implications . However, most of the available ergometers depend on the function of the lower extremities . Assessing the physiological responses to upper - body exercise is the best option when evaluating both patients with lower extremity disabilities13 and high - performance kayaking, swimming and canoeing athletes.14,15 during dynamic upper - body exercise, movements of the arm and thorax may influence the pattern and timing of breathing . Therefore, the clinical status and the type of exercise performed could influence ventilation during exercise . Thus, the physiological responses to upper - body exercise testing must be described, such that tests can be correctly interpreted in clinical settings . Domain variability of the ventilatory variables (respiratory rate, minute ventilation and tidal volume) in healthy individuals during progressive cardiopulmonary exercise tests performed on cycle and arm ergometers . Twelve individuals from the population of hospital staff and university students were selected for this study . All of the selected individuals were considered healthy based upon a clinical evaluation (physical examination and clinical history) and a maximal exercise test performed on a cycle ergometer . The use of any medication (except oral contraceptives) and chronic diseases were considered to be the exclusion criteria for the study . All of the volunteers gave written informed consent to participate in the study after a full explanation of the procedures and the potential risks . The investigation conformed to the principles outlined in the declaration of helsinki and was approved by the institutional research ethics committee on human research . This study included three afternoon visits to our laboratory for each volunteer . Because the volunteers were previously accustomed to exercises performed on leg ergometers but not arm - crank exercises, each volunteer performed a maximal exercise test on an arm ergometer on the first visit . The first test was performed such that the subjects could become familiar with the laboratory and the facial mask that is used in the cardiopulmonary exercise tests . On the second visit, the volunteers performed a maximal exercise test on a cycle ergometer (excalibur sport, lode, groningen, netherlands), following an individualized ramp protocol . The initial workload was set to achieve maximal effort in 8 to 12 minutes and considered the individual's level of physical activity, gender, body mass index and age . The individuals were instructed to maintain a pedaling frequency of 605 rotations per minute . On the third visit, each individual performed a maximal cardiopulmonary exercise test on an electronically braked arm ergometer (angio, lode, groningen, netherlands) by following a linear increment ramp protocol with 2-w increments every six seconds (20 w / min), as previously validated.16 all of the tests started with a one - minute warm - up period with a workload of 30 w. each individual was carefully positioned on the ergometer such that the rotational axis of the glenohumeral joint was at the same level as the axis of the ergometer's crank arm . Thus, failure to maintain a crank rate of more than 60 cycles / minute resulted in the termination of the test . The cardiopulmonary exercise tests were performed with the gas exchange and ventilatory variables analyzed in a breath - by - breath manner using a calibrated, computer - based exercise system (ultima cardio2 system, medical graphics corporation, minnesota, usa). The o2 and co2 analyzers were calibrated before each test using a reference gas (12% o2; 5% co2; nitrogen balance). The pneumotachograph was also calibrated with a 3-l syringe using various flow profiles . During each cardiopulmonary exercise test, a 12-lead electrocardiogram was continuously recorded (cardioperfect, welch allin, usa), and the heart rate was registered . The oxygen consumption (vo2), carbon dioxide production (co2), tidal volume (vt), inspiratory time (ti), expiratory time (te), total respiratory time (ttot), duty cycle (ti / ttot), mean respiratory flow (vt / ti) and respiratory rate (rr) were registered in a breath - by - breath manner . The derived variables [minute ventilation (ve), respiratory equivalents for oxygen (ve / vo2) and carbon dioxide (ve / vco2)] were calculated online (breeze software 6.4.1, medical graphics, usa). Rr, ve, ttot, ti, te, ti / ttot and vt / ti were analyzed at 40%, 60%, 80% and 100% of the maximal ventilatory intensity for each individual . The time - domain variabilities of ve, rr and vt during exercise were calculated as the standard deviation (sd) and root mean square successive difference (rmssd) of each variable . Both calculations were normalized by the number of breaths (sd / n and rmssd / n, respectively) because the duration of the test could have influenced these results.17 statistical analysis was performed using the software statistica 7.0 (statsoft inc ., oklahoma, usa). The variables from the cardiopulmonary exercise tests were normally distributed when analyzed by the shapiro - wilk w test . The variables were obtained during the leg or arm exercises at various intervals (40%, 60%, 80% and 100% of maximal ventilation). The data were compared using two - way anova followed by the post hoc bonferroni test . The time - domain ventilatory variability variables during the exercise tests with both ergometers twelve individuals from the population of hospital staff and university students were selected for this study . All of the selected individuals were considered healthy based upon a clinical evaluation (physical examination and clinical history) and a maximal exercise test performed on a cycle ergometer . The use of any medication (except oral contraceptives) and chronic diseases were considered to be the exclusion criteria for the study . All of the volunteers gave written informed consent to participate in the study after a full explanation of the procedures and the potential risks . The investigation conformed to the principles outlined in the declaration of helsinki and was approved by the institutional research ethics committee on human research . This study included three afternoon visits to our laboratory for each volunteer . Because the volunteers were previously accustomed to exercises performed on leg ergometers but not arm - crank exercises, each volunteer performed a maximal exercise test on an arm ergometer on the first visit . The first test was performed such that the subjects could become familiar with the laboratory and the facial mask that is used in the cardiopulmonary exercise tests . On the second visit, the volunteers performed a maximal exercise test on a cycle ergometer (excalibur sport, lode, groningen, netherlands), following an individualized ramp protocol . The initial workload was set to achieve maximal effort in 8 to 12 minutes and considered the individual's level of physical activity, gender, body mass index and age . The individuals were instructed to maintain a pedaling frequency of 605 rotations per minute . On the third visit, each individual performed a maximal cardiopulmonary exercise test on an electronically braked arm ergometer (angio, lode, groningen, netherlands) by following a linear increment ramp protocol with 2-w increments every six seconds (20 w / min), as previously validated.16 all of the tests started with a one - minute warm - up period with a workload of 30 w. each individual was carefully positioned on the ergometer such that the rotational axis of the glenohumeral joint was at the same level as the axis of the ergometer's crank arm . Thus, failure to maintain a crank rate of more than 60 cycles / minute resulted in the termination of the test . The cardiopulmonary exercise tests were performed with the gas exchange and ventilatory variables analyzed in a breath - by - breath manner using a calibrated, computer - based exercise system (ultima cardio2 system, medical graphics corporation, minnesota, usa). The o2 and co2 analyzers were calibrated before each test using a reference gas (12% o2; 5% co2; nitrogen balance). The pneumotachograph was also calibrated with a 3-l syringe using various flow profiles . During each cardiopulmonary exercise test, a 12-lead electrocardiogram was continuously recorded (cardioperfect, welch allin, usa), and the heart rate was registered . The oxygen consumption (vo2), carbon dioxide production (co2), tidal volume (vt), inspiratory time (ti), expiratory time (te), total respiratory time (ttot), duty cycle (ti / ttot), mean respiratory flow (vt / ti) and respiratory rate (rr) were registered in a breath - by - breath manner . The derived variables [minute ventilation (ve), respiratory equivalents for oxygen (ve / vo2) and carbon dioxide (ve / vco2)] were calculated online (breeze software 6.4.1, medical graphics, usa). Rr, ve, ttot, ti, te, ti / ttot and vt / ti were analyzed at 40%, 60%, 80% and 100% of the maximal ventilatory intensity for each individual . The time - domain variabilities of ve, rr and vt during exercise were calculated as the standard deviation (sd) and root mean square successive difference (rmssd) of each variable . Both calculations were normalized by the number of breaths (sd / n and rmssd / n, respectively) because the duration of the test could have influenced these results.17 the variables from the cardiopulmonary exercise tests were normally distributed when analyzed by the shapiro - wilk w test . The variables were obtained during the leg or arm exercises at various intervals (40%, 60%, 80% and 100% of maximal ventilation). The data were compared using two - way anova followed by the post hoc bonferroni test . The time - domain ventilatory variability variables during the exercise tests with both ergometers were compared using paired student's t - tests . Twelve healthy individuals completed the study (6 males; age, 271 years; body mass index, 22.70.7 kg / m). All of the tests were maximal, with a respiratory quotient greater than 1.1 (table 1). Although there was no difference between the peak heart and respiratory rates when both tests were compared, the peak vo2 was greater when the leg exercise was performed, as expected . The analysis of the ventilatory variables normalized to the peak power (table 1) clearly shows that the same load elicits more ventilatory responses during arm exercise than during leg exercise . Figure 1 shows there was no difference in the timing of breathing throughout the exercise when both ergometers were compared (p>0.05), but the analysis in table 2 shows greater time - domain variability in the ventilatory parameters during arm - crank exercise than during leg exercise . Neder et al10 have previously described the timing of breathing in healthy volunteers ranging from 20 to 80 years old . Although this normative study10 provided us with clinically relevant reference values that enabled the comparison and evaluation of the timing of breathing during exercise tests performed on the cycle ergometer, there was still a lack of knowledge regarding whether similar results would be found in other types of exercise . The analysis of the results of this study shows that the type of exercise (dynamic leg or arm exercise) does not influence the timing of breathing during maximal progressive exercise tests, even during maximal ventilation . Cerny & ucer18 found that heavy arm exercise elicits a greater respiratory rate than leg exercise . We believe that their results18 concerning the respiratory rates and inspiratory and expiratory times during heavy exercise differ from ours because heavy exercise is defined differently between the studies . Our study compared arm and leg exercise in the same fraction of maximal minute ventilation . In their study, thus, in their study,18 when the volunteers were pedaling at the same maximal minute ventilation achieved during arm cranking, their effort was not as intense as the effort described in our study . Given that the peak power output is much greater during leg exercise than during arm exercise, it is necessary to evaluate the variables and normalize them to the peak power output . Arm exercise elicits greater minute ventilation, respiratory rates and tidal volumes than leg exercise at the same level of effort, as previously shown by sawka et al.19 the cardiopulmonary exercise test is increasingly being used as a diagnostic and prognostic tool in clinical practice . Recently, more attention has been paid to the exercise ventilatory responses of patients with heart disease . A recent study9 emphasized the role of the ventilatory equivalent of the carbon dioxide output in determining prognosis of heart failure patients . After evaluating the various classical prognostic predictors, the same study9 concluded that the most powerful predictive model of early mortality and morbidity in heart failure is the combination of the lowest elevated ve / vco2 and the presence of periodic breathing during exercise tests . Nevertheless, the absence of a universally accepted definition of periodic breathing and the need to manually identify this phenomenon impairs the widespread use of periodic breathing as a prognostic criterion for heart failure.11 it is unknown whether a graded or quantitative assessment of periodic breathing would be able to refine the prognostic information that is usually produced by the presence or absence of this phenomenon . We decided to apply mathematical methods that are traditionally used to evaluate time - domain heart rate variability to analyze the ventilatory variability during exercise because periodic breathing is diagnosed by criteria that, together, depict the variability of ventilation throughout a graded exercise test . We have previously used the same methods to study time - domain ventilatory variability in cardiac disease.17 we found that breath - by - breath minute ventilation and respiratory rate variability during exercise are inversely correlated to the left ventricular ejection fraction in heart failure . Hence, patients with lower ejection fractions exhibit more ventilatory variability during a graded symptom - limited exercise test . In this study, we applied the same method and found that the ventilatory variability of healthy individuals is greater during arm exercise than during leg exercise . To our knowledge, this is the first study to evaluate ventilatory variability during arm exercise but was not designed to determine the mechanisms of this phenomenon . It is important to note that all of the volunteers evaluated in this study were healthy . This is the first study to describe the physiological ventilatory variability responses in healthy individuals during upper- and lower - body exercises . Although this study does not have the characteristics of a normative study, its results can be used as reference values when ventilatory variability is evaluated in other populations . The mechanisms involved in cheyne - stokes respiration and periodic breathing, such as hypocapnia, increased central and peripheral chemosensitivity20 and pulmonary blood flow fluctuations21 (key mechanisms in heart failure), are probably not useful for understanding physiological ventilatory variability during exercise in healthy subjects . It remains to be discovered why the respiratory variables are unstable during exercise and why there are differences in the time - domain ventilatory variabilities of leg and arm exercise . The responses of the respiratory system to physical exercise represent one of the main challenges in the study of homeostasis.22 arm exercise elicits more lactate accumulation than leg exercise at the same power output,23 a greater rate of perceived effort and more stimulation to breathe from force - sensing mechanoreceptors in the joints or from greater sympathetic stimulation.23,24 such factors are usually accepted as the reasons for the elevated sensations of breathlessness during arm work.18 the increased perturbation in the autonomic system, the blood ph and the effort perception elicited by arm exercise when compared to leg exercise at the same output could lead to an increasingly difficult equilibrium in the respiratory responses, which might explain the greater ventilatory variability during progressive arm exercise . Arm exercise elicits more inputs from the afferent muscle fibers than leg exercise, leading to different autonomic responses when both types of exercise are compared . This difference is independent of the active muscle mass but relies on the number and/or sensitivity of the afferent receptors in the upper body . This describes a condition in which heartbeats entrain the respiratory rhythm, triggering inspiratory onset by unknown afferent cardiovascular pathways.25,26 thus, changes in autonomic cardiovascular modulation and heart rate variability could potentially influence the respiratory rhythm and ventilator variability . There is more sympathetic nervous activity during maximal27 or submaximal28 lower - body exercise than during upper - body exercise . Leicht et al29 demonstrated that, during moderate steady - state exercise, the heart rate variability was reduced from its resting levels but with more heart rate variability during upper - body exercise than during lower - body exercise . The increased heart rate variability during arm exercise might reflect more respiratory sinus arrhythmia.29 in contrast, tulppo et al27 found that dynamic arm exercise results in more a rapid withdrawal of the vagal outflow than dynamic leg exercise . We have studied the time - domain variability of ventilation during a graded maximal exercise test, from rest to peak exercise . Hence, our analysis included the moments during the exercise test in which the vagal activity was minimal . Nevertheless, the increased vagal modulation during arm exercise between rest and moderate effort may, at minimum, have the influenced ventilatory variability throughout the test . Although evaluating autonomic modulation during exercise was beyond the scope of this study, it is a potential mechanism and remains to be studied . The subjects were not subjected to rest pulmonary function tests before entering the study . Given that none of the subjects had any history of pulmonary disease or smoking and that individual tests were used in the comparisons, the absence of rest pulmonary function tests does not seem to be a major issue that influenced the results . All of the breath - by - breath data were collected with a face mask . Thus, the use of the face mask cannot explain the different results when the arm and legs exercise were compared . The use of a mouthpiece and nose clip is known to influence the depth and rate of breathing.30 although this effect appears to be restricted to the lower levels of exercise,31 it seems reasonable not to interchangeably compare the ventilatory variability results recorded using the mask, mouthpiece and canopy . Trained volunteers sometimes tend to match their breathing pattern to the cycling rate.32 the pedaling and arm - crank rotation rates were fixed at values of more than 60 cycles per minute . Given that the respiratory rates did not reach such high frequencies, it is clear that the cycling rate could not have influenced the ventilatory variability in this study . Thus, we were unable to evaluate the inter - test reproducibility of the respiratory responses during exercise . Given that the methods used to quantify the ventilatory variability (rmssd and sdnn) are purely mathematical calculations and are not evaluator - dependent, the intra - test reproducibility would be meaningless and, thus, was not measured . The subjects were not subjected to rest pulmonary function tests before entering the study . Given that none of the subjects had any history of pulmonary disease or smoking and that individual tests were used in the comparisons, the absence of rest pulmonary function tests does not seem to be a major issue that influenced the results . All of the breath - by - breath data were collected with a face mask . Thus, the use of the face mask cannot explain the different results when the arm and legs exercise were compared . The use of a mouthpiece and nose clip is known to influence the depth and rate of breathing.30 although this effect appears to be restricted to the lower levels of exercise,31 it seems reasonable not to interchangeably compare the ventilatory variability results recorded using the mask, mouthpiece and canopy . Trained volunteers sometimes tend to match their breathing pattern to the cycling rate.32 the pedaling and arm - crank rotation rates were fixed at values of more than 60 cycles per minute . Given that the respiratory rates did not reach such high frequencies, it is clear that the cycling rate could not have influenced the ventilatory variability in this study . Thus, we were unable to evaluate the inter - test reproducibility of the respiratory responses during exercise . Given that the methods used to quantify the ventilatory variability (rmssd and sdnn) are purely mathematical calculations and are not evaluator - dependent, the intra - test reproducibility would be meaningless and, thus, was not measured . The timing of breathing was not influenced by the type of exercise performed when dynamic arm and leg exercises were compared . The time - domain ventilatory variabilities of young, healthy, sedentary individuals was greater during the maximal graded exercise test performed on the arm ergometer when compared to the leg ergometer . The mechanisms that influence ventilatory variability during exercise remain to be studied.
We present a unique case of a patient presenting with abdominal pain, obstructive jaundice and upper gastrointestinal haemorrhage resulting from a ruptured cystic artery pseudoaneurysm and concomitant cholecystojejunal fistula . An 86-year - old male presented to the emergency department with a two - day history of colicky right upper quadrant (ruq) pain associated with bilious vomiting . The patient was icteric with an associated pyrexia of 38 c, hypotension and tachycardia . Laboratory investigation revealed raised inflammatory markers with a white blood cell count of 24.0 10l and c - reactive protein of 95 mg / l (normal range: <7.5 mg / l). Liver function tests (lfts) were also deranged with an alkaline phosphatase of 450 /l (46111 /l), alanine transaminase of 142 /l (<45 /l) and bilirubin of 60 mol / l (<20 an ultrasound examination revealed a 5.7 cm calculus within the gallbladder surrounded by heterogeneous material; a diagnosis of cholangitis was made . The patient received fluid resuscitation with intravenous crystalloid and was commenced on broad - spectrum antibiotics . Subsequently, the patient passed a significant volume of malaena and fresh blood per rectum (pr), associated with cardiovascular instability . Emergency oesophagogastroduodenoscopy (ogd) revealed fresh blood in the second part of the duodenum and a tubular clot adherent to the medial wall (fig . This was assumed to be originating from a duodenal ulcer and apparent haemostasis was achieved with injection of 15 ml of 1:10,000 adrenaline . However, the patient continued to pass malaena and pr blood following the procedure . As such, a contrast - enhanced computed tomography (ct) scan was performed, demonstrating: (1) small bowel obstruction secondary to a gallstone impacted in the distal ileum (fig . 2a) (2) a thick - walled and inflamed gallbladder with evidence of recent intra - cholecystic bleeding (fig . 2b), and (3) a 12 mm pseudoaneurysm emanating from the cystic artery (fig . 2c and d). In retrospect, the blood clot seen at ogd was likely to be haemobilia originating from the ampulla of vater . The patient underwent emergency laparoscopy and the gallbladder was found to be necrotic and surrounded with dense adhesions . Division of these exposed a cholecysto - jejunal fistula containing clotted blood that was extending into the gallbladder . Evacuation of this clot revealed a 1 cm 2 cm pseudoaneurysm originating from the cystic artery, which began to bleed during dissection and the procedure was subsequently converted to an open laparotomy via a kocher incision . A subtotal cholecystectomy was performed with oversewing of hartmanns pouch and the aneurysm was successfully resected from the gallbladder fossa . The diseased jejunal loop was mobilised and the defect from the fistula was oversewn . Despite detailed examination of the small bowel the laparotomy wound was therefore closed under the assumption that the stone had passed spontaneously . The patient was discharged following a fifteen - day inpatient stay and remained well at six - week outpatient follow - up . Cystic artery pseudoaneurysms remain a rare cause of upper gastrointestinal bleeding, with only twenty - two documented cases in the english literature . They develop primarily as a consequence of adventitial damage and thrombosis of the vasa vasorum, resulting in damage to the muscular and elastic components of the media and intima with ensuing extravasation of arterial blood, progressive enlargement and eventual rupture, as governed by the law of laplace . This can occur secondary to inflammatory conditions (e.g. Cholecystitis, pancreatitis), malignancy, biliary tract manipulation or trauma . Formation may be further accelerated by patient factors, such as atherosclerosis, hypertension, bleeding disorders and vasculitis . Cystic artery pseudoaneurysms tend to enlarge and erode into the gallbladder and adjacent biliary tree with approximately 45% bleeding into the biliary system (haemobilia). The clinical presentation is that of biliary colic (70% of cases), obstructive jaundice (60%) and upper gastrointestinal bleeding (100%). 3240% of patients will present with all three symptoms quincke's triad . In the presented case, the patient had clinical and ct - confirmed cholecystitis in the presence of fistulating gallstones . Visceral inflammation adjacent to the cystic arterial wall is likely to have produced serosal ulceration and partial erosion of the elastic and muscular components of the arterial wall, thus leading to the formation and subsequent rupture of the pseudoaneurysm . The pathological process of cholecystitis causing pseudoaneurysm formation is very rare, as inflammation usually results in cystic artery thrombosis . Therefore discuss that pseudoaneurysm formation is likely to be due to inflammation in the presence of a large gallstone eroding into the cystic artery, as may be the cause in our case . Haemorrhage from this pseudoaneurysm into the gallbladder thus resulted in haemobilia, with subsequent biliary colic and obstructive jaundice, as highlighted by lfts on admission . Cholecystoenteric fistulas alone are a rare complication of gallstone disease, with a reported incidence of 0.154.8% in patients with cholelithiasis undergoing biliary surgery, of which the majority are cholecystoduodenal (7180%). One series examined over 15,000 laparoscopic cholecystectomies and highlighted the incidence of cholecystoenteric fistulae as being 0.2% (n = 34) with only five fistulae communicating with jejunum (14.7%) fistulae arise when an obstructed cystic duct become repeatedly inflamed, resulting in adhesion of the gallbladder to an adjacent viscus, in this case the jejunum, with erosion of the intervening tissues and eventual fistulation . This may be mediated by gallbladder wall necrosis from mechanical pressure due to an impacted gallstone . Most patients present with features of general gallstone disease but, less commonly, patients may present with cholangitis, severe upper gastrointestinal haemorrhage or gallstone ileus . In the reported case, the fistula resulted in gallstone ileus and rupture of the pseudoaneurysm produced haemobilia and upper gastrointestinal haemorrhage via the cholecystoenteric fistula . Describes a similar presentation in a patient presenting with lower gastrointestinal bleeding as the result of a ruptured cystic artery pseudoaneurysm with a concomitant cholecystocolonic fistula . To the best of the authors knowledge, this report describes the first case of a synchronous cystic artery pseudoaneurysm and cholecystojejunal fistula . The initial investigation for a patient presenting in this manner is colour doppler ultrasonography, which will demonstrate a pseudoaneurysm as an anechoic lesion with colour flow through it . This, however, has a low sensitivity and is limited when visualising sub - centimetre lesions, with one series demonstrating a detection rate of only 27% . Such was the case with our patient where ultrasound revealed a distended gallbladder with internal echogenicity but failed to identify the 12 mm pseudoaneurysm . An ogd was subsequently performed revealing blood in the second part of the duodenum, which was likely to be arising from the ampulla of vater due to haemobilia . Upper gastrointestinal endoscopy is the best means of identifying haemobilia and, if seen, limits the focus to a hepato - biliary source of the bleeding . However, endoscopy offers no means of intervention for haemobilia and, if intermittent, then this sign may be missed . Subsequent investigation is disputed in the literature between contrast - enhanced ct scanning and digital subtraction angiography . Argue that contrast - enhanced ct scanning and 3-dimensional ct angiography should replace arteriography as a non - invasive method of establishing a definitive diagnosis . However, many sources state that, although invasive, selective hepatic artery angiography is the gold standard for diagnosis, with a sensitivity of 80% and the ability to define aneurysms <10 mm . Diagnostic angiography can then be combined with therapeutic arterial embolisation with foam, thrombin or micro - coils, either as definitive management or as a method of haemostasis prior to cholecystectomy and aneurysm repair . There is a general consensus in the literature that emergency cholecystectomy is the treatment of choice in haemobilia due to cholecystitis, gallstones or resectable neoplasms, or if embolisation fails . Where possible, however, a two - stage approach should be adopted to managing cystic artery pseudoaneurysms: with embolisation of the bleeding pseudoaneurysm first in order to stabilise the patient followed subsequently by cholecystectomy . In our case, it was not possible to perform diagnostic angiography and so contrast - enhanced ct angiography was the investigation of choice . This not only clearly demonstrated the cystic artery pseudoaneurysm but also revealed gallstone ileus and the associated fistula . If available, arteriography and embolisation would have been appropriate to stabilise the patient but these pathologies identified on ct - imaging required urgent operative intervention and, as such, emergency laparoscopy with subsequent conversion to laparotomy was performed . In conclusion, we present a unique case of a ruptured cystic artery pseudoaneurysm causing haemobilia and upper gastrointestinal bleeding through a concurrent cholecystojejunal fistula . We have demonstrated the success of surgical management alone in the treatment of such a case but accept that, when available and clinically indicated, a combined therapeutic approach with angiography should be considered in the first instance.
Evidence and awareness of climate change has led to an increasing need to adapt our use of land and other resources to limit risks and vulnerabilities that originate from global change (adger et al.2005; foley et al.2005). Changes in precipitation and temperature give rise to changes in the hydrology of river systems . At the same time human - induced land use changes, e.g. Deforestation of upstream catchments, lead to changes in run - off conditions . The combined effects of land use change and climate change may lead to increased flood risk and changes in ecosystem service delivery (bouwer et al.2010; hurkmans et al.2009; metzger et al.2008). However, the increasing population densities in floodplain areas together with increased assets located in flood - prone regions leads to an ever - increasing vulnerability of people and financial damage upon flooding (barredo 2009; de moel et al.2011). Given these conditions, adaptation and mitigation strategies to reduce flood risk and exposure to flooding many measures for adaptation to climate change are related to changes in planning and management of land use (dawson et al.2011). Measures can include restrictions on residential and commercial functions in areas sensitive to flooding, reforestation of sloping land in the upper part of catchments and the allocation of retention areas . The claims made on land resources for such measures may, especially in densely populated delta regions, conflict with other claims for land, e.g. Those for food and energy production, for urban development or for biodiversity conservation . Planning of adaptation policies, therefore, requires a careful analysis of possible tradeoffs of such measures in other domains . At the same time it is expected that adaptation measures not only contribute to climate and water regulation, but have synergistic effects on other ecosystem services . Conservation and restoration of riverine wetlands does not only benefit flood regulation but also provides carbon sequestration and habitat functions (vos et al.2010). A careful choice of the adaptation measures fitted to the context of a specific region will benefit other ecosystem services while avoiding unintended tradeoffs . Insight into the possible synergies and tradeoffs may help the design of more integrated policy packages that can be implemented at the appropriate institutional levels (helbron et al.2011). Land use and land use planning play a critical role in the evaluation of possible strategies to adapt to the consequences of climate change and increased flooding in particular (fig . 1). Land use change is a driver of changes in the hydrological system (interaction 1 in fig . 1) and it influences the potential damage and vulnerability of people and assets (interaction 2). However, at the same time, land use and land use planning are a means of adaptation (interaction 3). Assessments of land use change scenarios have provided insight in the evolution of future land use and related impacts on ecosystem services through the simulation and analysis of exploratory scenarios (kienast et al.2009; rounsevell et al.2006; sohl et al.2007; verburg et al.2010). However, to further assist planning and implementation of adaptation policies a more targeted scientific approach is needed . (2010) argues that scientific assessments in the field of ecosystem services and biodiversity should aim at evaluating the impacts of specific (combinations of) measures rather than focus on broad overarching scenarios . The authors argue that explicit attention should be given to the identification of potential synergies and tradeoffs of such measures on ecosystem services and biodiversity.fig . 1interactions between land use and the vulnerability / damage as result of changes in flood occurrence interactions between land use and the vulnerability / damage as result of changes in flood occurrence this paper intends to take such an approach by analyzing the land use consequences of a policy package of adaptation measures for the territory of the european union . The results are used to analyze to which extent these measures have synergetic effects on biodiversity and ecosystem conservation . To analyze the land use consequences of adaptation measures two scenarios are analyzed for a 30 year period (20002030). The first scenario is a reference scenario that represents a continuation of ongoing economic and demographic trends and includes a number of important ongoing policy developments affecting land use . The second scenario is based on the same macro - level assumptions but includes a package of spatial policies that are related to adaptation measures . Both scenarios were evaluated with a series of models that translate scenarios of macro - economic change to spatial patterns of land use change . Finally four indicators of impacts on ecosystem services were calculated: flood risk, carbon sequestration, biodiversity and habitat connectivity . Based on these indicators 2overview of the methodology overview of the methodology for the development of the reference scenario use is made of the well - known b1 scenario of ipcc - sres (ipcc 2000) and elaborated for the european conditions by westhoek et al . The scenario accounts for global scale drivers influencing european land use like: increasing food and feed demand in emerging countries, i.e. The bric countries (brazil, russia, india and china);changing trade regimes because of increasing competitiveness of asian and latin - american regions;changing environmental constraints because of resource scarcity and climate change (following climate change calculations by the image model (bouwman et al.2006);demographic changes . Increasing food and feed demand in emerging countries, i.e. The bric countries (brazil, russia, india and china); changing trade regimes because of increasing competitiveness of asian and latin - american regions; changing environmental constraints because of resource scarcity and climate change (following climate change calculations by the image model (bouwman et al.2006); the b1 scenario as specified by westhoek et al . (2006) includes a number of important policy developments that correspond to ongoing changes in policies, such as the reform of the european union common agricultural policy . As compared to the assumptions of the other scenario storylines prepared before the financial crisis, it includes for europe a modest economic growth which is realistic for the economic conditions after the economic crisis of 20072008 . Some of the specific european environmental policies in this scenario were modified from the original description by westhoek et al ., it may be interpreted as a business - as - usual type of scenario . An overview of the most important socio - economic assumptions and key characteristics for the eu is provided in table 1.table 1reference scenario socio - economic assumptions and key characteristics for the euaspectscenario assumptionspopulation eu-27 in 2030500 millionpopulation change since 20004%eu-15 gdp yearly growth1.3%eu-12 gdp yearly growth3.4%trade of agricultural productsexport subsidies and import tariffs phased out . Slight increase in non - tariff barriersproduct quotaphased out; abolished by 2020farm paymentsfully decoupled and gradually reduced (by 50% in 2030)intervention pricesphased out; abolished by 2030 reference scenario socio - economic assumptions and key characteristics for the eu in addition to these macro - level conditions in terms of economic change, trade agreements, the common agricultural policy and demography, also policies that directly affect the spatial patterns of land use are included in the scenario specification . Important examples are the less favoured areas (lfa) support (compensation to farmers in regions with constraints for agricultural use), and current protected nature areas (including the eu defined natura 2000 areas, forests and other natural areas). In this way the reference scenario offers business - as - usual baseline conditions that allow a proper assessment of the impacts of policy alternatives . An alternative policy scenario was developed to evaluate the spatial planning of land use for the conservation of soil and regulation of water in connection to climate change . The macro - level socio - economic developments (table 1) and climate change assumed were identical to the reference scenario . This scenario is based on policy themes that are currently being discussed within the european union (table 2). The specification of the scenario was achieved as a joint process between modellers and policy makers at the european commission in brussels . This process ensured a good correspondence between the scenario assumptions and the ongoing policy discussion . In the first step a number of broad issues and policy themes were identified that should be addressed in the scenarios . This list was elaborated with qualitative descriptions of the policy ambitions and actions possible within this theme based on policy documents and public discussion . The final step accounted for the translation of these qualitative descriptions into settings of the model . A lack of clarity in the specification of the measures was revealed and in a number of cases the policy makers were requested to specify more clearly the actual functioning of the proposed policy mechanisms . This resulted in a jointly agreed set of scenario conditions that could easily be implemented in the model framework . For all identified policy themes both the reference scenario and the policy alternative were specified . A selection of the most important qualitative descriptions related to climate adaptation is provided in table 2 . A full overview of all scenario specifications and model settings is provided by prez - soba et al . (2010).table 2overview of the current spatial policy ambition level incorporated in the reference scenario and the more ambitious policies in the policy alternativepolicy themecurrent ambition levelpolicy alternativeflood damage reductioncurrent national and ec (flood directive) policies based on current flooding statisticsdiscouraging urbanisation in areas that are likely to become more flood prone due to climate change . Promotion of extensive agriculture and nature in these areasrestore water balance (limits probability on floods and droughts)water framework directivediscourage urbanisation and promote forest, nature and extensive forms of agriculture (grassland) in upstream parts of catchment areasprotection permanent pasturesome incentives to avoid conversion of permanent pasture; maximum decrease in total permanent pasture areastrict protection of permanent pasture areas.protection peatlandno policiesland conversions in peaty areas are not allowedsoil protectionthematic strategy for soil protection communicationspatial planning to promote more compact forms of urbanisation to reduce soil sealingerosion preventionlimited incentive to convert arable land on erosion sensitive places to grassland and forestry (current common agricultural policy measure)strong incentive to convert arable land on erosion sensitive places to grassland and forestry overview of the current spatial policy ambition level incorporated in the reference scenario and the more ambitious policies in the policy alternative the adaptation measures accounted for different aspects of the relation between land use and vulnerability to flooding . The directive 2007/60/ec on the assessment and management of flood risks (ec 2007) requires member states to assess if water courses and coast lines are at risk from flooding, to map the flood extent, assets and humans at risk in these areas, and to take adequate and coordinated measures to reduce this flood risk . It also requires member states to take into consideration long - term developments, including climate change, as well as sustainable land - use practices in the flood risk management cycle addressed in this directive . One of the measures we have accounted for in this scenario is more regulation of land use planning in flood prone areas . Flood prone areas are defined by those areas in which a minimum of 25% of the 1 km pixel is designated as experiencing an inundation of 50 cm or more in a 100 year flood event according to a map prepared by the ec joint research center (barredo et al.2007). In those areas no new urban land use is allowed while extensive agriculture (grassland) and nature are favoured above intensive agriculture . Such measures are especially aimed at reducing the potential damage of flood events rather than reducing the flood risk itself . Increased variability in precipitation and higher summer temperatures will, most likely, also lead to more pronounced water shortages in summer time . This is likely to impact, for example, agricultural practices and shipping on the major rivers . In recognition of the acuteness of the water scarcity and drought challenges in europe, the european commission adopted a communication addressing the challenge of water scarcity and droughts in the european union (com/2007/414). The communication provides a fundamental and well - developed first set of policy options for future action, within the framework of eu water management principles, policies, and objectives . To implement such notions it is suggested to promote the storage of rainwater in the hydrological system (surface and groundwater) in upstream areas to secure a more constant delivery of water to river systems . This policy has the potential of reducing the peeks in river discharge and thus limits the chance of flooding . The policy objective of increasing the amount of rainwater retention and infiltration can be implemented in the model through the promotion of nature, forest and extensive forms of agriculture in upstream areas . Upstream areas are, arbitrarily, delineated by the upper 10% of the height range in each catchment area . Policies to avoid the conversion of permanent pasture not only favour carbon sequestration (schulp et al.2008) but also lead to lower peak flows due to reduced run - off in sloping areas . Similarly it is assumed that in the policy alternative land conversions on peat soils are not allowed given the role of these soils in regulating water quantity . In line with the thematic strategy for soil protection of the european commission, soil sealing, leading to fast run - off after precipitation, is prevented by promoting compact urbanization in land use planning . In mountainous areas incentives of the common agricultural policy to convert arable land on erosion sensitive slopes to forest or grassland are assumed to be reinforced . The spatial representation of erosion sensitive locations is based on a calculation of current erosion risk given slope, climate and soil conditions following the universal soil loss equation (wischmeier 1976). The methodology for assessing land use changes is based on a multi - scale, multi - model approach that integrates the economic, demographic and environmental drivers of land change in a consistent modelling framework described by verburg et al . Global scale drivers of land use change originating from changes in demography, consumption patterns, economic development, trade and climate change are analyzed with the combined application of the global economy model leitap and the global integrated assessment model image . A detailed description of the interaction between these two models is provided by van meijl et al . These global scale models provide output in terms of changes in agricultural area (distinguishing arable land and grassland) at the level of individual countries within the european union . These changes in agricultural area are integrated with claims from the urban / industry sectors which are based on simple analysis of overall relations between urban area, population and gdp using the scenario specific demographic and economic projections . The land allocation model translates the national scale land areas to a 1 km grid . The model distinguishes arable land, irrigated arable land, permanent crops, grassland, recently abandoned agricultural land, scrubland, forest, build - up land, and a number of smaller classes that are assumed to be more or less static in time . Based on the thus derived land cover maps a number of indicators for the impacts of land use changes the core of the modelling framework including the land allocation model and the indicator models are integrated into a consistent modelling interface called the clue - scanner . The land allocation model is the dyna - clue model (verburg and overmars 2009) using the numerical algorithms of the land use scanner model (koomen et al.2008). The translation of the national level changes in agricultural area from the leitap model to input of the dyna - clue model requires a number of corrections to ensure consistency between the models . While leitap is based on agricultural statistics the dyna - clue simulations are based on land cover data derived from clc2000 . Large differences in agricultural areas between the two data sources are the result of differences in definition, observation technique, data inventory bias etc . These difference can be corrected as they relate to differences in definition of land cover classes . Absolute changes in agricultural area in leitap are corrected for known, structural, differences in representation and then serve as input to the dyna - clue model . The net change in agricultural and urban area will determine the overall area left for semi - natural land use types and forestry . From the image model climate change data are used as one of the location factors considered in the dyna - clue model . Changes in climate, resulting from the image model calculations, are at a coarse spatial resolution (50 50 km) and are downscaled to 1 1 km and superimposed on the more detailed worldclim data (hijmans et al.2005) for use in the simulations . The dyna - clue model is a recent version of the clue model (verburg et al.1999; verburg et al.2002; verburg and overmars 2009). Clue is one of the most used land allocation models globally and is highly applicable for scenario analysis (pontius et al.2008). The use of the model in many case studies at local and continental scale by different institutions worldwide (e.g. (castella et al.2007; wassenaar et al.2007) has proven its capacity to simulate a wide range of scenarios and provide information for indicator models . The land allocation procedure allocates for each pixel the land cover type with the highest local suitability at that location, constrained by the macro - level demand for the land cover types, the land use history and a set of rules that represent spatial restrictions (e.g. Nature reserves). At the same time autonomous changes in land cover can occur through re - growth of natural vegetation given the location specific vegetation growth rates (verburg and overmars 2009). Suitability maps that define the specific suitability for each land use type are based on empirical analysis of relations between location of land use and a set of socio - economic and physical properties . For example, the european soil map is translated into functional properties such as soil fertility and water retention capacity . 100 factors that range from accessibility to bio - physical properties is considered as potential location factors . Subsidies offered to farmers that compensate for less favourable conditions in marginal areas can raise the suitability for agricultural use at these locations . Other scenario conditions are implemented through rules or restrictions on specific land cover conversions in delineated areas . Four indicator models were selected in this paper to evaluate the effects of land use changes on indicators connected to the provision of a number of ecosystem services . These indicators only represent a small fraction of the full range of ecosystem services provided in the region . The selection represents services closely connected to other strategies for adaptation and mitigation of climate change: carbon sequestration and biodiversity . The flood risk indicator highlights the urban areas within the potential flooding zone that are newly developed since 2000 . New urban land cover identified by the land allocation model is overlaid with a map of future flood - prone areas (100 year return period) under conditions of climate change . This assessment of potential river - flood risk does not incorporate the conditions of flood defence systems and the effects of upstream land use change on flood occurrence . Therefore, the indicator is especially meant to highlight those areas where new assets become exposed to flood risk . This indicator is based on a carbon bookkeeping approach that takes into account effects of soil and forest age on carbon stock changes . Emission factors are specified by individual countries and land cover types to account for differences in farming practice and ecosystem function across europe . Two indicators are designed to capture the impacts of land use change on biodiversity at the spatial and thematic resolution of the land use modelling results . The first indicator is a measure of the suitability of the habitat for maintaining biodiversity while the second indicator aims to provide a measure of the connectivity of the habitats . The biodiversity indicator is a mean species abundance (msa) index which is derived from land use, land use intensity (agriculture and forestry), nitrogen deposition, spatial fragmentation, infrastructure developments and policy assumptions on high nature value (hnv) farmland protection and organic agriculture . The methodology used is based on the globio3 approach initially developed for biodiversity assessments at a global scale (alkemade et al.2009), but refined for application at the level of europe (verboom et al.2007). The spatial and thematic resolution is not sufficient to discern actual habitats and capture detailed ecological processes . Instead, the above mentioned factors are used to indicate the pressures that species abundance is facing as result of the human impacts on the natural system . The index ranges from 0 to 100, and represents the species abundance compared to species abundance in the natural system without human disturbances . This index of biodiversity has clear limitations and the results do not provide a precise, local account of biodiversity (trisurat et al.2010). It does, however, provide a broad overview of the impacts of land change on biodiversity and allows for the comparison between the current and different future situations . This indicator assesses the difficulty to reach the nearest larger sized habitat from smaller habitats based on the land use allocation results . It offers an approximation of the connectivity of the landscape for species and the viability of smaller habitats within the landscape matrix . The difficulty to reach other habitats is differentiated between land use types, assuming a high resistance of urban and arable areas for the migration of species, a medium to low resistance of permanent grassland areas and a low resistance of small patches of (semi-) natural area . The overall connectivity of an area is assessed by calculating the average resistance (or travel time) to reach the larger patches of natural vegetation from the smaller patches within a neighbourhood or administrative region . As the indicator is not including information on the quality of different land use types, it only offers an indication of the potential coherence of possibly valuable natural areas . The indicator has been defined in such a way to be as much as possible independent of the area of natural land use types in the region and solely capture the spatial arrangement . Therefore, also areas with a relatively small area of nature may still have a good connectivity if the green infrastructure is well - developed . Alternative indicators for landscape connectivity, such as the frequently used proximity indicator (gustafson and parker 1994), are not sufficiently sensitive to the data used at the spatial and thematic resolution of this analysis . To analyze the land use consequences of adaptation measures two scenarios are analyzed for a 30 year period (20002030). The first scenario is a reference scenario that represents a continuation of ongoing economic and demographic trends and includes a number of important ongoing policy developments affecting land use . The second scenario is based on the same macro - level assumptions but includes a package of spatial policies that are related to adaptation measures . Both scenarios were evaluated with a series of models that translate scenarios of macro - economic change to spatial patterns of land use change . Finally four indicators of impacts on ecosystem services were calculated: flood risk, carbon sequestration, biodiversity and habitat connectivity . Based on these indicators for the development of the reference scenario use is made of the well - known b1 scenario of ipcc - sres (ipcc 2000) and elaborated for the european conditions by westhoek et al . The scenario accounts for global scale drivers influencing european land use like: increasing food and feed demand in emerging countries, i.e. The bric countries (brazil, russia, india and china);changing trade regimes because of increasing competitiveness of asian and latin - american regions;changing environmental constraints because of resource scarcity and climate change (following climate change calculations by the image model (bouwman et al.2006);demographic changes . Increasing food and feed demand in emerging countries, i.e. The bric countries (brazil, russia, india and china); changing trade regimes because of increasing competitiveness of asian and latin - american regions; changing environmental constraints because of resource scarcity and climate change (following climate change calculations by the image model (bouwman et al.2006); the b1 scenario as specified by westhoek et al . (2006) includes a number of important policy developments that correspond to ongoing changes in policies, such as the reform of the european union common agricultural policy . As compared to the assumptions of the other scenario storylines prepared before the financial crisis, it includes for europe a modest economic growth which is realistic for the economic conditions after the economic crisis of 20072008 . Some of the specific european environmental policies in this scenario were modified from the original description by westhoek et al ., it may be interpreted as a business - as - usual type of scenario . An overview of the most important socio - economic assumptions and key characteristics for the eu is provided in table 1.table 1reference scenario socio - economic assumptions and key characteristics for the euaspectscenario assumptionspopulation eu-27 in 2030500 millionpopulation change since 20004%eu-15 gdp yearly growth1.3%eu-12 gdp yearly growth3.4%trade of agricultural productsexport subsidies and import tariffs phased out . Slight increase in non - tariff barriersproduct quotaphased out; abolished by 2020farm paymentsfully decoupled and gradually reduced (by 50% in 2030)intervention pricesphased out; abolished by 2030 reference scenario socio - economic assumptions and key characteristics for the eu in addition to these macro - level conditions in terms of economic change, trade agreements, the common agricultural policy and demography, also policies that directly affect the spatial patterns of land use are included in the scenario specification . Important examples are the less favoured areas (lfa) support (compensation to farmers in regions with constraints for agricultural use), and current protected nature areas (including the eu defined natura 2000 areas, forests and other natural areas). In this way the reference scenario offers business - as - usual baseline conditions that allow a proper assessment of the impacts of policy alternatives . An alternative policy scenario was developed to evaluate the spatial planning of land use for the conservation of soil and regulation of water in connection to climate change . The macro - level socio - economic developments (table 1) and climate change assumed were identical to the reference scenario . This scenario is based on policy themes that are currently being discussed within the european union (table 2). The specification of the scenario was achieved as a joint process between modellers and policy makers at the european commission in brussels . This process ensured a good correspondence between the scenario assumptions and the ongoing policy discussion . In the first step a number of broad issues and policy themes were identified that should be addressed in the scenarios . This list was elaborated with qualitative descriptions of the policy ambitions and actions possible within this theme based on policy documents and public discussion . The final step accounted for the translation of these qualitative descriptions into settings of the model . A lack of clarity in the specification of the measures was revealed and in a number of cases the policy makers were requested to specify more clearly the actual functioning of the proposed policy mechanisms . This resulted in a jointly agreed set of scenario conditions that could easily be implemented in the model framework . For all identified policy themes both the reference scenario and the policy alternative were specified . A selection of the most important qualitative descriptions related to climate adaptation a full overview of all scenario specifications and model settings is provided by prez - soba et al . (2010).table 2overview of the current spatial policy ambition level incorporated in the reference scenario and the more ambitious policies in the policy alternativepolicy themecurrent ambition levelpolicy alternativeflood damage reductioncurrent national and ec (flood directive) policies based on current flooding statisticsdiscouraging urbanisation in areas that are likely to become more flood prone due to climate change . Promotion of extensive agriculture and nature in these areasrestore water balance (limits probability on floods and droughts)water framework directivediscourage urbanisation and promote forest, nature and extensive forms of agriculture (grassland) in upstream parts of catchment areasprotection permanent pasturesome incentives to avoid conversion of permanent pasture; maximum decrease in total permanent pasture areastrict protection of permanent pasture areas.protection peatlandno policiesland conversions in peaty areas are not allowedsoil protectionthematic strategy for soil protection communicationspatial planning to promote more compact forms of urbanisation to reduce soil sealingerosion preventionlimited incentive to convert arable land on erosion sensitive places to grassland and forestry (current common agricultural policy measure)strong incentive to convert arable land on erosion sensitive places to grassland and forestry overview of the current spatial policy ambition level incorporated in the reference scenario and the more ambitious policies in the policy alternative the adaptation measures accounted for different aspects of the relation between land use and vulnerability to flooding . The directive 2007/60/ec on the assessment and management of flood risks (ec 2007) requires member states to assess if water courses and coast lines are at risk from flooding, to map the flood extent, assets and humans at risk in these areas, and to take adequate and coordinated measures to reduce this flood risk . It also requires member states to take into consideration long - term developments, including climate change, as well as sustainable land - use practices in the flood risk management cycle addressed in this directive . One of the measures we have accounted for in this scenario is more regulation of land use planning in flood prone areas . Flood prone areas are defined by those areas in which a minimum of 25% of the 1 km pixel is designated as experiencing an inundation of 50 cm or more in a 100 year flood event according to a map prepared by the ec joint research center (barredo et al.2007). In those areas no new urban land use is allowed while extensive agriculture (grassland) and nature are favoured above intensive agriculture . Such measures are especially aimed at reducing the potential damage of flood events rather than reducing the flood risk itself . Increased variability in precipitation and higher summer temperatures will, most likely, also lead to more pronounced water shortages in summer time . This is likely to impact, for example, agricultural practices and shipping on the major rivers . In recognition of the acuteness of the water scarcity and drought challenges in europe, the european commission adopted a communication addressing the challenge of water scarcity and droughts in the european union (com/2007/414). The communication provides a fundamental and well - developed first set of policy options for future action, within the framework of eu water management principles, policies, and objectives . To implement such notions it is suggested to promote the storage of rainwater in the hydrological system (surface and groundwater) in upstream areas to secure a more constant delivery of water to river systems . This policy has the potential of reducing the peeks in river discharge and thus limits the chance of flooding . As such it increases the ecosystem service of water supply and regulation . The policy objective of increasing the amount of rainwater retention and infiltration can be implemented in the model through the promotion of nature, forest and extensive forms of agriculture in upstream areas . Upstream areas are, arbitrarily, delineated by the upper 10% of the height range in each catchment area . Also synergies between climate change adaptation and other policies policies to avoid the conversion of permanent pasture not only favour carbon sequestration (schulp et al.2008) but also lead to lower peak flows due to reduced run - off in sloping areas . Similarly it is assumed that in the policy alternative land conversions on peat soils are not allowed given the role of these soils in regulating water quantity . In line with the thematic strategy for soil protection of the european commission, soil sealing, leading to fast run - off after precipitation, is prevented by promoting compact urbanization in land use planning . In mountainous areas incentives of the common agricultural policy to convert arable land on erosion sensitive slopes to forest or grassland are assumed to be reinforced . The spatial representation of erosion sensitive locations is based on a calculation of current erosion risk given slope, climate and soil conditions following the universal soil loss equation (wischmeier 1976). The methodology for assessing land use changes is based on a multi - scale, multi - model approach that integrates the economic, demographic and environmental drivers of land change in a consistent modelling framework described by verburg et al . Global scale drivers of land use change originating from changes in demography, consumption patterns, economic development, trade and climate change are analyzed with the combined application of the global economy model leitap and the global integrated assessment model image . A detailed description of the interaction between these two models is provided by van meijl et al . These global scale models provide output in terms of changes in agricultural area (distinguishing arable land and grassland) at the level of individual countries within the european union . These changes in agricultural area are integrated with claims from the urban / industry sectors which are based on simple analysis of overall relations between urban area, population and gdp using the scenario specific demographic and economic projections . The land allocation model translates the national scale land areas to a 1 km grid . The model distinguishes arable land, irrigated arable land, permanent crops, grassland, recently abandoned agricultural land, scrubland, forest, build - up land, and a number of smaller classes that are assumed to be more or less static in time . Based on the thus derived land cover maps a number of indicators for the impacts of land use changes can be calculated . The core of the modelling framework including the land allocation model and the indicator models are integrated into a consistent modelling interface called the clue - scanner . The land allocation model is the dyna - clue model (verburg and overmars 2009) using the numerical algorithms of the land use scanner model (koomen et al.2008). The translation of the national level changes in agricultural area from the leitap model to input of the dyna - clue model requires a number of corrections to ensure consistency between the models . While leitap is based on agricultural statistics the dyna - clue simulations are based on land cover data derived from clc2000 . Large differences in agricultural areas between the two data sources are the result of differences in definition, observation technique, data inventory bias etc . These difference can be corrected as they relate to differences in definition of land cover classes . Absolute changes in agricultural area in leitap are corrected for known, structural, differences in representation and then serve as input to the dyna - clue model . The net change in agricultural and urban area will determine the overall area left for semi - natural land use types and forestry . From the image model climate change data are used as one of the location factors considered in the dyna - clue model . Changes in climate, resulting from the image model calculations, are at a coarse spatial resolution (50 50 km) and are downscaled to 1 1 km and superimposed on the more detailed worldclim data (hijmans et al.2005) for use in the simulations . The dyna - clue model is a recent version of the clue model (verburg et al.1999; verburg et al.2002; verburg and overmars 2009). Clue is one of the most used land allocation models globally and is highly applicable for scenario analysis (pontius et al.2008). The use of the model in many case studies at local and continental scale by different institutions worldwide (e.g. (castella et al.2007; wassenaar et al.2007) has proven its capacity to simulate a wide range of scenarios and provide information for indicator models . The land allocation procedure allocates for each pixel the land cover type with the highest local suitability at that location, constrained by the macro - level demand for the land cover types, the land use history and a set of rules that represent spatial restrictions (e.g. Nature reserves). At the same time autonomous changes in land cover can occur through re - growth of natural vegetation given the location specific vegetation growth rates (verburg and overmars 2009). Suitability maps that define the specific suitability for each land use type are based on empirical analysis of relations between location of land use and a set of socio - economic and physical properties . For example, the european soil map is translated into functional properties such as soil fertility and water retention capacity . 100 factors that range from accessibility to bio - physical properties is considered as potential location factors . Subsidies offered to farmers that compensate for less favourable conditions in marginal areas can raise the suitability for agricultural use at these locations . Other scenario conditions are implemented through rules or restrictions on specific land cover conversions in delineated areas . Four indicator models were selected in this paper to evaluate the effects of land use changes on indicators connected to the provision of a number of ecosystem services . These indicators only represent a small fraction of the full range of ecosystem services provided in the region . The selection represents services closely connected to other strategies for adaptation and mitigation of climate change: carbon sequestration and biodiversity . The flood risk indicator highlights the urban areas within the potential flooding zone that are newly developed since 2000 . New urban land cover identified by the land allocation model is overlaid with a map of future flood - prone areas (100 year return period) under conditions of climate change . This assessment of potential river - flood risk does not incorporate the conditions of flood defence systems and the effects of upstream land use change on flood occurrence . Therefore, the indicator is especially meant to highlight those areas where new assets become exposed to flood risk . This indicator is based on a carbon bookkeeping approach that takes into account effects of soil and forest age on carbon stock changes . Emission factors are specified by individual countries and land cover types to account for differences in farming practice and ecosystem function across europe . Two indicators are designed to capture the impacts of land use change on biodiversity at the spatial and thematic resolution of the land use modelling results . The first indicator is a measure of the suitability of the habitat for maintaining biodiversity while the second indicator aims to provide a measure of the connectivity of the habitats . The biodiversity indicator is a mean species abundance (msa) index which is derived from land use, land use intensity (agriculture and forestry), nitrogen deposition, spatial fragmentation, infrastructure developments and policy assumptions on high nature value (hnv) farmland protection and organic agriculture . The methodology used is based on the globio3 approach initially developed for biodiversity assessments at a global scale (alkemade et al.2009), but refined for application at the level of europe (verboom et al.2007). The spatial and thematic resolution is not sufficient to discern actual habitats and capture detailed ecological processes . Instead, the above mentioned factors are used to indicate the pressures that species abundance is facing as result of the human impacts on the natural system . The index ranges from 0 to 100, and represents the species abundance compared to species abundance in the natural system without human disturbances . This index of biodiversity has clear limitations and the results do not provide a precise, local account of biodiversity (trisurat et al.2010). It does, however, provide a broad overview of the impacts of land change on biodiversity and allows for the comparison between the current and different future situations . This indicator assesses the difficulty to reach the nearest larger sized habitat from smaller habitats based on the land use allocation results . It offers an approximation of the connectivity of the landscape for species and the viability of smaller habitats within the landscape matrix . The difficulty to reach other habitats is differentiated between land use types, assuming a high resistance of urban and arable areas for the migration of species, a medium to low resistance of permanent grassland areas and a low resistance of small patches of (semi-) natural area . The overall connectivity of an area is assessed by calculating the average resistance (or travel time) to reach the larger patches of natural vegetation from the smaller patches within a neighbourhood or administrative region . As the indicator is not including information on the quality of different land use types, it only offers an indication of the potential coherence of possibly valuable natural areas . The indicator has been defined in such a way to be as much as possible independent of the area of natural land use types in the region and solely capture the spatial arrangement . Therefore, also areas with a relatively small area of nature may still have a good connectivity if the green infrastructure is well - developed . Alternative indicators for landscape connectivity, such as the frequently used proximity indicator (gustafson and parker 1994), are not sufficiently sensitive to the data used at the spatial and thematic resolution of this analysis . Figure 3 shows a generalized overview of the results of the land use simulations for the reference scenario and the policy alternative . The original land use modelling results for the period 2000 to 2030 have been summarized by the dominant conversion processes . The overall distribution of changes across the european countries is a direct result of the macro - economic global scale models whereas the spatial patterns within the countries are a result of the spatial allocation procedure . It is obvious that the overall pattern of change is similar for both simulations: the land use areas for individual countries were kept similar in both simulations; the measures were assumed to only affect the spatial patterns . The macro - economic models describe an overall trend of continued abandonment of marginal agricultural lands in western europe and some expansion of agricultural land in eastern europe and some localized areas in e.g. Spain . To some extent this expansion of agricultural land in eastern europe takes place at the cost of fallow land and small patches of (semi-)natural land within the main agricultural areas . However, in some cases the model also predicts expansion of agriculture at the cost of forest areas, especially in the baltic countries and poland . The results for deforestation are questionable for some countries, e.g. In poland more than 80% of the forest is state - owned (bartczak et al.2008). Deforestation may be a more important issue for countries that have experienced expropriation in the 1950s and where the forest has been transferred back to the initial owners in the 1990s, leading to very small, fragmented ownership structures which favour deforestation . Both the macro - economic models and land allocation model do not include information on the tenure status of land resources and may therefore overestimate the potential for land conversions in eastern europe . The areas identified as likely locations of agricultural abandonment correspond with areas that have frequently been mentioned as areas at risk of marginalization and in which land abandonment processes have sometimes been ongoing for the last 50 years (macdonald et al . 3main land use change processes over the period 20002030 for the reference scenario a, and the policy alternative focussed on adaptation measures b main land use change processes over the period 20002030 for the reference scenario a, and the policy alternative focussed on adaptation measures b the maps indicate that the adaptation measures are not likely to influence the overall patterns of major land change processes in europe in the coming decades . Land abandonment will still be concentrated in the most marginal areas and urbanization will take place in the already heavily urbanized regions . However, the adaptation measures will influence land change processes at selected locations and alter regional patterns of conversions . When analyzing the results in more detail the implications of the adaptation measures on land change patterns become apparent . An example of such regional differences in land use configuration resulting from the measures in the policy alternative is provided in fig . 4 . As a result of new urbanization, the urban area located on flood prone land has increased in the reference scenario while new urbanization has taken place outside the flood prone area in the policy alternative . This example directly indicates that the differences between the scenarios are not restricted to the areas where the policies are actually aimed at . The demand for urban area will be fulfilled elsewhere leading to spatial tradeoffs . In fig . 4 it can also be seen that, consistent with the specification of the policy alternative, intensive agricultural use in flood prone areas has been abandoned and replaced with semi - natural vegetation.fig . 4simulated land use maps for 2030 for an area in the netherlands (surrounding eindhoven) for the reference scenario (left) and the policy alternative (right); areas marked in blue indicate flood prone areas . The ellipse indicates an area where less urbanization occurs in the flood prone area in the policy alternative while the dashed circle indicates more urbanization outside the flood prone area simulated land use maps for 2030 for an area in the netherlands (surrounding eindhoven) for the reference scenario (left) and the policy alternative (right); areas marked in blue indicate flood prone areas . The ellipse indicates an area where less urbanization occurs in the flood prone area in the policy alternative while the dashed circle indicates more urbanization outside the flood prone area the flood risk indicator shows the success of the spatial policies in reducing the exposure to potential flooding (fig . It is likely that new urban areas will appear in flood prone areas in all major delta regions of europe . In total 599 km of new urban area is located in flood prone areas in the reference scenario while this area only amounts to 34 km in the policy alternative . The small increase in flood risk in spite of the restrictions on building in flood risk areas under the policy alternative is a result of the increase of the flood prone area during the scenario period while the land use policies are based on the area currently under risk of flooding.fig . 5increased river flood risk over the 20002030 period in reference scenario (left) and policy alternative (right). Risk is expressed here as percentage new urban area of the total land area within a 10 km circular neighborhood prone to river floods that have a statistical return period of occurring once every 100 years under future climate conditions increased river flood risk over the 20002030 period in reference scenario (left) and policy alternative (right). Risk is expressed here as percentage new urban area of the total land area within a 10 km circular neighborhood prone to river floods that have a statistical return period of occurring once every 100 years under future climate conditions the indicators of biodiversity and carbon sequestration are used to investigate if the adaptation measures lead to synergies with other ecosystem services . Figure 6 provides a map aggregated to administrative level of differences between the two scenarios in carbon sequestration at the level of the eu for 2030 . Overall the differences resulting from the adaptation measures at the level of administrative regions are small . Many of the local impacts are compensated within the same administrative unit and therefore do not show in the map . At the same time the differences between the scenarios should not be ignored: depending on the region the impacts can be considerable . While in some regions synergies between adaptation measures and carbon sequestration are experienced other regions face negative trade - offs . Positive effects in northern germany are largely due to the policies that restrict the conversion of grasslands on peat soils . However, this leads to a lower rate of abandonment of arable land in southern germany, with corresponding lower carbon sequestration . Figure 7 shows that locally differences up to 20% in the mean species abundance values appear between the two scenarios . Where some regions show a strong synergy between the adaptation measures and biodiversity other regions show a negative tradeoff . In many cases the restrictions on intensive land uses in flood prone lands lead to positive effects on biodiversity . In a number of cases the incentives to convert arable land in upper catchments also has a positive effect on biodiversity while some of the unassigned areas face increasing land use pressures leading to biodiversity losses . It should be noted that the incentives for less intensive land use practices in upper catchments have a smaller effect on biodiversity than expected . Land abandonment is also taking place in these regions in the reference scenario which already fulfills some of the requirements in the policy alternative . Furthermore the success of the voluntary measures may be reduced as result to the increase in land use pressure due to land conversion restrictions in the lower parts of the catchments.fig . 6comparison of difference in carbon sequestration (mean cumulative carbon sink per nuts3-region in ton / km over the 20002030 period) between the reference scenario and the policy alternative . 7local - level comparison of differences in mean species abundance between the reference scenario and policy alternative (weighted average within 10 km circular neighbourhood); positive values indicate higher msa values in the policy alternative comparison of difference in carbon sequestration (mean cumulative carbon sink per nuts3-region in ton / km over the 20002030 period) between the reference scenario and the policy alternative . Positive values indicate higher values in the policy alternative local - level comparison of differences in mean species abundance between the reference scenario and policy alternative (weighted average within 10 km circular neighbourhood); positive values indicate higher msa values in the policy alternative in general a decrease in the resistance to reach habitats (fig . 8) is found at locations that also have an improvement in msa value in fig . However, not all regions with an increase in msa also have an improvement in habitat connectivity . The effects on habitat connectivity are strongest in regions that have very low habitat connectivity at present while at the same time adaptation measures lead to more extensive land uses that are providing opportunities to better connect existing habitats . The results also show that beneficial or negative impacts on habitat connectivity are only found at specific locations although adaptation measures are spread over large parts of europe.fig . 8differences in habitat connectivity between the reference scenario and policy alternative; negative values indicate a lower resistance to reach a habitat in the policy alternative differences in habitat connectivity between the reference scenario and policy alternative; negative values indicate a lower resistance to reach a habitat in the policy alternative adaptation to climate change consists of a wide range of measures related to different levels of governance . Measures range from local modifications of urban sewage systems to deal with higher peak flows to changes in national scale spatial planning policies and modifications in the common agricultural policy at eu level . In many of the measures land use plays a central role . Given that land use is central to the state of the environment and is linked to multiple economic sectors it is likely that policies in other fields will affect the effectiveness of adaptation measures while at the same time adaptation measures may provide synergies or trade - offs with other sectors . This paper presented a quantitative approach to analyze this mutual interaction between climate adaptation measures and other policy objectives in the context of a multi - scale analysis of land use dynamics . The results indicate that indeed the evaluated set of adaptation measures also impacts the other ecosystem services analyzed . In this paper only a small range of measures is analyzed and the impacts are assessed based on a limited set of indicators, only representing some of the ecosystem services provided in the study area . However, the approach allows for the evaluation of different scenarios and multiple impacts on ecosystem services (kienast et al.2009). The analysis is based on a straightforward top - down assessment of land use dynamics in which no feedbacks between the effects of the modified land allocation and the macro - economic conditions are assumed . This means that the implemented measures and their impacts do not influence the overall areas of the different land cover types . However, in reality such feedbacks are likely given that some of the incentives and regulations may affect land prices and, therefore, feedback on the trade and production conditions of the different countries (verburg 2006). Currently the applied global scale models do not allow for incorporation of such feedbacks . The differences between the two scenarios simulated in this paper are, therefore, only resulting from differences in the spatial allocation of land use . Most of the impacts are found in the neighbourhood of the locations where the measures are implemented . However, the results indicate that restrictions to land use conversion at specific locations also lead to dynamics in land use elsewhere given the constant claims for land by the different sectors . Such spatial dynamics and teleconnections cause tradeoffs . While the reduction of intensity of land use in the flood plains leads to an improvement of the green infrastructure in these areas, more intensive land uses are now allocated outside these areas leading to negative impacts for biodiversity at those locations . Given that losses in biodiversity are not easily compensated by restoration elsewhere such off - site tradeoffs need to be accounted for when analyzing the synergies between climate change adaptation and biodiversity conservation . The results indicate that adaptation measures can, at least regionally, lead to a synergy with biodiversity conservation and climate regulation services through carbon sequestration . However, in regions where the land claims are high the measures frequently lead to strong tradeoffs in neighbouring regions . It would be interesting to test the sensitivity of a wider range of ecosystem services in terms of their synergies and tradeoffs . While being appropriate for place - based research the concept could be extended by accounting for spatial interactions between ecosystem services using the approach used in this paper . Such research would also require a further analysis of sensitivity of the conclusions to the drivers of the model and the allocation procedure . Unfortunately global economic and integrated assessment models are only seldom analyzed in terms of sensitivity or uncertainty to major uncertainties in the driving factors and underlying model assumptions . The algorithms of the land use allocation models have been validated and tested in more detail (messina et al.2008; pontius et al.2008). For the european application of the dyna - clue land allocation model the sensitivity to variation in macro - level drivers has been tested by tabeau et al . Overall hot - spots of land change appeared to be relatively insensitive to variations in macro - scale drivers . Validation of the european allocation has not been made due to absence of consistent land cover data across multiple time periods to serve as a reference for such validation (verburg et al.2009a). The effectiveness of the adaptation measures in reducing flood risk are not analyzed in this paper . The flood risk indicator solely indicates the exposed assets using a flood risk map that accounts for changes in climate conditions . The results make clear that in the absence of adaptation measures the urban area under flood prone conditions is likely to increase strongly . Changes in the hydrological circumstances as result of improved retention and reduced run - off in the upstream parts of the catchments are not accounted for and may reduce flood risk . Accounting for such changes would require a dynamic coupling of the land use simulations with a hydrological model . (2009) for analyzing the effects of changing climate and land use on extreme flow of the river rhine . The authors indicated that the location of the land use changes within the catchment is very important for the effects on streamflow . In addition, they found that land use effects on streamflow are highly variable by sub - catchment . While extreme discharges in some sub - catchments were highly sensitive to changes in land use there were only modest effects in other sub - catchments . Therefore, an assessment of the effectiveness of measures to enhance the regulation of streamflow through land use requires a spatially explicit analysis . The specification of the scenario options as an interactive process with the policy makers turned out to be a time - consuming process . However, during the specification an improved mutual understanding of the possible implications of the measures as well as an understanding of the capacities and limitations of assessment models to evaluate such measures was obtained . While initially defined in broad terms, the need for quantitative specification of the scenarios in the model provided a platform to discuss the more detailed implications of these policy themes for land use planning practices . In the end, the joint specification of the scenarios assisted the interpretation of the final modeling results because the policy makers had been involved in the process of specification which creates a feeling of ownership . The analysis presented in this paper shows that integrative analysis of the tradeoffs and synergies of policy measures in a dynamic scenario context can benefit the targeting and selection of adequate policy measures . The analysis provides information to support discussion between different policy fields and allows to better explore the potential synergies and avoid unforeseen trade - offs . The process of scenario and model specification as a collaborative effort revealed the challenges of effective science - policy communication . While simple straightforward answers and assessments were preferred by the policy makers the discussion of the specification and implementation of scenario options in the model helped policy makers to understand the need for a clear specification of the broader policy objectives to be able to assess their impacts . Trade - offs and synergies between adaptation measures and ecosystem service indicators are location and context dependent and land change assessments therefore do not always provide crisp and uniform answers to the questions of policy makers . As such, the science - policy interface emerged into a joint learning process in which the role of specific policies in complex human - environment interactions becomes clearer to both scientists and policy makers . The approach presented in this paper is an example of operationalizing the ecosystem services approach to inform policy (daily et al.2009). The multi - sectoral and multi - scale characteristics of the results are an inherent characteristic of the ecosystem services approach and therefore require novel ways of science - policy interaction . The results indicate that although a generic adaptation strategy for europe as a whole has a lot of benefit, it is at the local and regional level that the actual measures and implementations need to be designed in order to avoid unintended tradeoffs between services or conflicts with other policies . However, local measures should, at the same time, be analyzed in the context of regional and european impacts given the occurrence of spatial tradeoffs and the spatial distance between the locations where the measures are taken and the location of the beneficiaries of the adaptation measures and ecosystem services . As land use is both a driver and result of human - environment interactions it provides a proper platform for discussing the way we can best adapt to changes in the earth system and secure the ecosystem services provided by the land.
Acute cholecystitis is an inflammation of the gallbladder due to obstruction of the neck or cystic duct, primarily caused by gallstones . Acute cholecystitis is characterized as a combination of local and systemic inflammation, and its treatment is dependent on the severity, although it is often treated conservatively with antibiotics . When acute cholecystitis becomes severe, it is treated surgically, while for some patients, percutaneous transhepatic gallbladder drainage (ptgbd) is an alternative to surgery . An accurate assessment of the severity is critical for the appropriate management of acute cholecystitis . Abdominal ultrasonography (us) is useful for the diagnosis of diseases of the abdominal cavity . With abdominal us, however, this condition can be treated more appropriately if the severity is evaluated, using diagnostic imaging prior to the occurrence of organ failure or worsening of blood test variables . With regard to diagnostic imaging, wall thickening is representative of edema and correlates with the severity of acute cholecystitis, while inflammation is indicated by both edema and increased blood flow . If blood flow is assessed using abdominal us, it is possible to more accurately evaluate the severity of acute cholecystitis . Superb microvascular imaging (smi) is based on color doppler imaging of abdominal us and enables the visualization of very slow blood flow without requiring contrast medium . It is composed of color - coded (csmi) and monochrome smi (msmi), where csmi visualizes pulsatory signals such as color doppler images and msmi enhances the blood flow signal by suppressing background signaling ., we present the changes observed using csmi and msmi over the course of an acute cholecystitis in 1 patient . An 84-year - old man was admitted to the national hospital organization shimoshizu hospital with right upper abdominal pain that persisted for 3 days . White blood cell count (wbc) and c - reactive protein (crp) levels were 11.4 10/l and 15.3 mg / dl, respectively . Total bilirubin, alkaline phosphatase, aspartate aminotransferase, alanine aminotransferase, and -glutamyl transpeptidase levels were 1.5 mg / dl, 206 iu / l, 20 iu / l, 10 iu / l, and 10 the possibility of obstructive jaundice was low . To clarify the cause of inflammation, computed tomography (ct) scans (somatom emotion 16; siemens, munich, germany) were performed, which showed slight thickening of the gallbladder wall (fig . 1a). To confirm the results of the ct scans, the patient was subjected to abdominal us (applio 400; toshiba medical, ohtawara, japan) with a curved array transducer (pvt-375bt) at 3.75 mhz (toshiba medical). The severity was classified as mild as the patient showed no signs of organ failure . Diagnostic imaging found no evidence of marked local inflammation such as pericholecystic or hepatic abscess . The patient was treated conservatively with antibiotics (cefazolin sodium 3 g / day) intravenously from the date of admission . After 2 days of treatment, right upper abdominal pain still persisted, and his body temperature rose to 38.7c . Wbc and crp levels rose to 15.6 10/l and 19.6 mg / dl, respectively . These data indicated that the acute cholecystitis had worsened . To evaluate the acute cholecystitis morphologically, abdominal us showed that the wall thickness of the gallbladder had increased and a sonolucent area was visible (fig . Complications, such as liver abscess or peritonitis, were considered possible . To avoid complications and promote recovery, seven days after ptgbd, wbc and crp levels were 6.8 10/l and 1.2 mg / dl, respectively, also confirming recovery ., csmi showed a pulsatory signal on the wall of the gallbladder with the curved array transducer (2.0 cm / s; pvt-375bt) at 3.75 mhz (fig . 2a), whereas no such signal was observed on the wall with msmi (2.2 cm / s) (fig . When his acute cholecystitis had worsened, this signal became more evident with csmi (fig . After ptgbd, the gallbladder shrank due to drainage of the gall and the pulsatory signal was no longer visible with either csmi (fig . Abdominal us is recommended as a first - line diagnostic imaging tool for the diagnosis of acute cholecystitis; however, false negatives are a known issue of this technique . In our case, a pulsatory signal was observed on the wall of the gallbladder on the day of admission, which suggested positive csmi, even when wall thickening was minimal . Smi is expected to reduce the incidence of false negatives when diagnosing this condition . In the present case, the strength of the pulsatory signals correlated with the severity of the gallbladder inflammation, as illustrated using both csmi and msmi . The results suggest that the signal intensity of csmi and msmi is correlated with the severity of inflammation . Our case shows that both csmi and msmi are useful for the diagnosis and evaluation of the severity of acute cholecystitis . Contrast - enhanced abdominal us shows a strong enhancement that successfully differentiates acute cholecystitis from a healthy gallbladder and chronic cholecystitis . However, unlike contrast - enhanced abdominal us, smi does not require contrast medium and is therefore suitable for the management of acute cholecystitis . A primary limitation of the present study is that it is based on just 1 case of acute cholecystitis . In order to confirm the usefulness of smi for the evaluation of the severity of acute cholecystitis, more patients should be enrolled in larger studies and smi findings for acute and chronic cholecystitis compared . Furthermore, signal intensity should be stratified against the severity of acute cholecystitis . In conclusion, a strong pulsatory signal correlated with the severity of acute cholecystitis with both csmi and msmi and may be suitable for the evaluation of the severity of this condition . This report was approved by the ethical committee of the national hospital organization of shimoshizu hospital . The study was considered an element of daily clinical practice as opposed to a clinical trial . Written informed consent was obtained for the performance of contrast - enhanced ct and ptgbd . The patient's records were anonymously and retrospectively analyzed, and written informed consent was obtained for their use in this report.
The most common adverse effects are indigestion, bleeding disorders, rash, diarrhea, and, rarely, taste disorders . Here, we report a case of clopidogrel - induced ageusia notified in sfax pharmacovigilance center on march 13, 2009 . A 46-year - old man was admitted in the department of cardiology in sfax tunisia in january 2009 for coronary artery disease and underwent coronary artery stenting . Clopidogrel (150 mg / day) was initiated on january 8, 2009, with lysine acetylsalicylate (one bag / day) and molsidomine (60 mg / day). However, the sense of smell was not affected . The ear nose throat (ent) examination ruled out abnormality (dryness, atrophy, or infection) of buccal mucosa and cranial nerve lesion . It was considered that simvastatin could be responsible for this adverse effect and it was then stopped it is indicated for secondary prevention in patients with atherosclerosis, coronary artery disease, and cerebral event such as transient ischemic attack . The caprie study demonstrated that clopidogrel has a favorable efficacy / safety ratio and provides an additional 8.7% relative - risk reduction for thrombotic events over lysine acetylsalicylate and is safer than ticlopidine . In addition, several other clinical studies have shown that clopidogrel reduces the overall rate of thromboembolic events in patients with recent myocardial infarction, stroke, or peripheral arterial disease compared with aspirin . Side effects of new medicines are often not revealed during the initial clinical trials but are discovered when their use becomes a standard of care and, therefore, widespread . Indeed, in the present case, an enquiry of pharmacovigilance was done according to french imputation method . Besides psychogenic, systemic, oral, and neurological pathologies, medicines are the most common cause of taste disturbance . The fact that a large variety of medications affect the sense of taste is evidence of the complexity of the gustatory systems . The reception, transduction, propagation, and perception of a chemical tasting or odorant require the effective operation of numerous mechanisms . . Thus, drug - induced adverse taste effects can reflect the taste of the drug itself, destroy mitosis in a replicating receptor cell, block the apical ion channels on a taste bud as a diuretic, and lead to candidal overgrowth on the tongue surface as immunosuppressants and steroids . These can also inhibit cytochrome p450-dependent enzymes at the level of receptors as an antifungal, disturb neuronal impulse propagation, cause changes in the neurotransmitter function, as well as alter higher order cortical processing of taste - related sensory information, production, and chemical composition of saliva and mucosal elements . The time of appearance of this side effect in the present case was similar to that reported in literature between two to eight weeks . This observation reminds the dose - related mechanism that remit spontaneously after drug discontinuation, albeit sometimes weeks or months after discontinuing a drug . The present case confirms the hypothesis and the suspected causal drug clopidogrel in the genesis of ageusia . Although not a life - threatening side effect, loss of taste can produce significant changes in quality of life of a patient . It can lead to loss of appetite, weight, and may require discontinuation of drug administration in already compromised patients.
Measurements of nitrogen and sulfur dioxide using passive sampler over 12 months in samsun, turkey, are compared with so2 and no2 concentrations obtained from a co - located chemiluminescence analyzer . The concentrations of sulfur and nitrogen dioxide in the ambient air during the period from november 2009 to september 2010 are analyzed . The highest value for annual no2 and so2 averages of passive sampler was 29.65 g / m and 21.01 g / m for exposures of 2-weeks at an industrial site . The maximum monthly concentration for so2 was observed at the 10 measurement station with 44.19 g / m for august . The maximum monthly concentration for no2 was observed on the 3 measurement station with 42.83 g / m for november . A negative correlation between nitrogen dioxide concentrations and temperature (r = 0.5489) was estimated . A positive correlation between nitrogen dioxide measurement with passive sampler and continuous measurement (r = 0.6571) was estimated . Industrial establishments operating in the samsun industrial zone for years, activities of the mobile power plants opened but then closed down and natural gas combined cycle plant scheduled to be reactivated require detailed studies of the region in terms of air pollution . The readings of the measurements made with uninterrupted system measurement devices at one single location revealed that the limit values of the european union were exceeded seasonally in terms of nitrogen dioxide . However sulfur dioxide values did not exceed national and international legislations in any period (see table 1). National and international ambient air quality standards for so 2 and no 2 (as ppb) in the first instance the passive sampler was developed in america as an on - person air sampler by palmes et al . (1976), it ensures that gas or vapor on the atmosphere is carried by molecular diffusion with a physical process and kept in a membrane . Here, the effective power is concentration change between the absorption surface and the air surrounding it and the amount of diffusion occurred is given on 1 fick rule on equation (1). (1)f=d.dc / dl where; f is the molar flux (g.cm.min), d is the diffusion coefficient (cm / min), c is the concentration (g.cm), and l is the diffusion path (cm). The contaminant concentration kept in the passive sampler depends of the period of atmosphere exposure, quantity of total gas transfer collected in the passive sampler tube, geometric structure of the tube and diffusion coefficient, ambient temperature, ambient humidity, sorbent strength and face velocity . Passive sampler is a preferred method since it does not require power supply, has cost - efficient investment, light, simple analysis procedure as well as not requiring calibration, and suitable for simultaneous multipoint measurement of ambient air pollution . Passive samplers are extremely useful to assess long - term concentration trends (e.g., yearly) and are small, light, re - usable, and soundless . Nitrogen dioxide has an irritant effect on the respiratory organs, and long exposures can increasingly lead to airway disorders, such as chronic bronchitis . The major health impact of sulfur dioxide include effects on breathing, respiratory illness, weakness of lung defenses, increase in the effects of existing respiratory and cardiovascular disease, and death . Explanations of effects of pressure, temperature, and wind speed on the samplers for no2 and so2 have been reported, . Diffusive sampling can be used if the average, instead of the real - time, pollutant concentration is adequate for the purpose of monitoring . The measurements took place at an industrial zone located in samsun tekkekoy district, selyeri locality . The area is enclosed in the north by the black sea . The area is also crossed by one of the main samsun and turkey highways, the d010 (figure 1, yellow line). The industrial zone digital map of samsun tekkekoy district, scale 1:50000, is used at the gis - software arcgis (version 9.2, esri, ca, usa). The measurement results were introduced in the esri geographic information system software arcgis and the extension geostatistical analyst was used to obtain distribution maps . The geostatistical analyst, an extension to arcgis, a product of the environmental systems research institute (esri), california, usa, can be applied to analyze the data from air quality monitoring networks and to generate maps of spatial distribution of the monitored air pollutants . For the pilot study, there were 10 samplers available for field sampling and the sampling area was approximately 20 km; therefore; samplers were distributed through background locations only using a systematic grid of 11 km, as can be seen in figure 1 . The samplers of site were identified and tracked using a global positioning system (magellan mobile mapper tm6). Measurement points and coordinates the passive samplers used for the measurements are from english gradko company and the technical specifications are explained in detail on table 3 . The analysis of nitrogen dioxide and sulfur dioxide passive samplers were conducted at gradko s laboratory in england . All air analyses have been all conducted by ukas accredited methods, working to iso 17025 . The calibration of sampling tubes was made with gradko environmental laboratory accredited by united kingdom accreditation service (ukas). The concentrations of nitrite ions and hence no2 chemically adsorbed (the grid made of stainless steel impregnated with 20% triethanolamine) are quantitatively determined by uv / visible spectrophotometry (camspec m550 spectrophotometer) with reference to a calibration curve derived from the analysis of standard nitrite solutions (ukas accredited methods) which is measured colorimetrical . Likewise, for the sulfur dioxide analysis, the grid made of stainless steel impregnated with potassium hydroxide was extracted and then measured with dionex ic 3000 ion chromatography . Determined by an overall m.o.u of 14.081% + / and a limit of detection of 0.026 g s for sulfur dioxide . Determined by an overall m.o.u of 10.907% + / and a limit of detection of 0.021 g no2 for nitrogen dioxide . Properties of passive samplers in order to compare passive samplers with the results of uninterrupted system measurement method operated with chemical optical spectroscopic methods, the data of the measurement station owned by the ministry of environment and forestry was used (station no.3). The station no.3 where the reference method chemiluminescence and uv fluorescence method for automatic measurement of no2 and so2 concentrations and are in use . An automatic ambient so2 analyzer (af22 m, environnement s.a, france) and a ambient no2 analyzer (ac32 m, environnement s.a, france) were used to measure the average concentrations of sulfur dioxide and nitrogen dioxide . The fixed measurement station data was obtained from air quality monitoring network database . The data were compiled as 14-day average data and then compared with the passive sampler readings . The passive samplers were located far from walls and 2.0 m above the ground . While selecting the locations of passive samplers used for the measurements, several particulars were taken into consideration such as; exactly determining the industrial contamination in the region, taking into consideration the impact areas by bearing in mind the dominant wind direction, taking into consideration the impacts of significant point contaminants, preventing the impact of pollution caused by vehicles, minimizing the intervention on parks and of wind, comparing the results with uninterrupted measurement system and ensuring ease and safety of passive sampler installation . The measurement readings obtained for nitrogen dioxide and sulfur dioxide from all measurement stations are given separately on figures 2 and 3, and seasonal variation of sulfur dioxide and nitrogen dioxide for all stations on figures 4 and 5 . The highest average concentrations were in winter for nitrogen dioxide and sulphur dioxide (figures 4 and 5). The values of so 2 and no 2 for 1 5 stations . The values of so 2 and no 2 for 6 10 stations . When a digital map of the readings regarding monthly averages of sulfur dioxide measurements between october 2009 and october 2010 was formed by using arcgis software, it was observed that the values obtained in august 2009 were the highest and reached up to 154.49 g / m (figure 6). As for the sulfur dioxide; the overall result observation the digital maps prepared by using arcgis software was that the level of pollution at measurement locations number 1, 2, 3, 4, 5 and 10, in other words on the south - west and north - west of the region, is higher . Results of measurement of averaga sulfur dioxide for august 2010 (as the highest mount). According to the measurement readings calculated for nitrogen dioxide, the highest no2 values reached up to 43.27 g / m in november 2009 (figure 7). Results of measurement of average nitrogen dioxide for november 2009 (as the highest mount). G / m and 21.01 g / m for so2 (figure 8). Dispersion of annual average no 2 and so 2 pollutants in samsun in 20092010 . In order to compare the results obtained with passive sampler method with the measurements made with uninterrupted measurement devices, passive samplers were located at the fixed measurement station of ministry of forestry and water works, namely sampling station number 3 . The measurement readings were obtained from air quality monitoring network web page as the reference method of chemiluminescence . The arithmetical averages of the 14-day exposure period of the passive samplers were calculated by taking into consideration the daily arithmetical averages of the values . The results of sulfur dioxide and nitrogen dioxide according to two measurement methods so compared are given on figure 8 . Statistically, regression analysis carried out to show the degree of correlation between the continuous monitor and the diffusion tubes gave different regression coefficients . Correlation analysis between passive samplers and the continuous monitor (figure 9) gave a correlation coefficient (r) of value . According to the uninterrupted system and passive sampler methods used at measurement station number 3, there is a low - level relationship in terms of sulfur dioxide measurement methods (r = 0.1827) but the relation in terms of nitrogen dioxide measurements is confirmed to be r = 0.6571 (figure 9). Correlation of passive sampler with continous monitor for so 2 ve no 2 . Box - plots of yearly concentrations of so2 and no2 measured at the sampling points are given in figure 10 . Each vertical box covers 50% of the measured values between the lower and highest quartiles . The horizontal line inside the box and the cross represent the median and mean values . No2 can be seen in figure 10 to be associated with significantly higher pollution concentrations than so2 . The measurement readings were interpreted according to the data obtained from aramba airport meteorology station which is the closest one to the region . The coordinates of aramba airport meteorology station are 4115'23.92 " n and 3633'23.74 " w, and the distance to the closest measurement locations, namely 6 and 8, is approximately 5.5 kilometers . The measurement data obtained by the station on the measurement dates are given on table 4 and the wind rose is given on figure 11 . The wind rose show that the dominant directions of surface wind in caramba during period of measurement is s. at a typical meteorological condition of average wind speed 2.8 - 3.2 m / s . Samsun aramba airport meteorology station inputs (october, 2009 - september 2010) values of daily average wind rose between of october 2009 with september 2010 in aramba air port meteorology stations . The correlation between no2 and so2 concentrations and meteorological parameters like air temperature, wind speed, and relative humidity was also calculated for the caramba airport meteorology station . The other parameters (wind speed, wind direction, and relative humidity) is a bad correlation of no2 and so2, which plays an important role in the distance from the meteorology station . Therefore, the results of correlation of wind speed, wind direction and relative humidity correlation had not been given in here . The uninterrupted measurement station values and passive sampler readings are compared at the measurement station of the ministry of forestry and water works . A correlation of 69.24% according to this correlation, the annual nitrogen dioxide average is calculated as 42.36 g / m . However, as mentioned on the literature, meteorological parameters have significant impact on the correlation and it was not possible to make meteorological measurements at the measurement location during this study . When the digital map regarding the nitrogen dioxide measurements are reviewed, it is observed that the highest level of pollution is at measurement station of station no.3 and expands around from that location . Besides, the nitrogen dioxide values of the measurement point number 5 at yesilyurt port administration vary between 26 to 29 g / m . It is observed that the nitrogen dioxide is intensified at locations 1, 2, 5 and 10 on the west side, starting from measurement station number 3 and expanded towards the black sea from location 5 or towards the inner regions of tekkekoy from location 3 . 4 . When the passive samplers are compared with uninterrupted measurement results at the measurement location number 3, in terms of sulfur dioxide, a correlation could not be established . Since the results obtained from both passive samplers and uninterrupted measurements are significantly low, we should consider the possibility of errors arising from factors having an impact on sulfur dioxide measurements and devices used . The reason for this, the sulfur dioxide concentration effected not only passive sampler measurements but also meteorological parameters . It is observed that the sulfur dioxide distribution heads from south to north - west, towards the black sea from measurement station number 5 . This work was financed by a scholarship of the ondokuz mays university for support of scientific research (project no . The author thank to assistant professor aziz iman, assistant professor nevzat beyazt, and serkan cengel for preparing of digital mapping ., blacksea agricultural research institute, milangaz, ulusoy maritime high school, tekkeky municipality, and yeilyurt company.
The human gut harbors trillions of bacteria that contribute to host physiological and immunological functions such as nutrient acquisition, maintenance of the gut immune system, and protection against exogenous pathogens (123). One of the recent notable findings is the contribution of gut microbiota to the development and homeostasis of the immune system (13). The effects of microbiota on the host immune system have been determined by studies in germ - free (gf) animals (45). Gf mice showed reduced numbers and size of peyer's patches (5), less lamina propria cd4 t cells (6), reduced levels of the class - switched antibodies iga and igg (78), and they lacked a developed gut - associated lymphoid tissue (910). Thus, maturation of the gut immune system generally takes place following the colonization of gut microbiota suggesting a mutual relationship between the immune system and the microbiota . The gut microbiota consists of bacterial components and metabolites, both of which are important for the development and maintenance of the host immune system . Resident microbiota contains pathogen - associated molecular patterns (pamps) such as lipopolysaccharide (lps), peptidoglycan, flagellin, and bacterial dna and rna that are recognized by pattern recognition receptors (prrs). Prrs are expressed on immune cells, including antigen - presenting cells (apcs), and they play crucial roles in the activation of innate immunity . Toll - like receptors (tlrs) (11) and nod - like receptors (nlrs) (12) are the main prrs that recognize bacterial components . While the importance of microbial sensing and activation by the innate immune system has been well recognized, recent work has also uncovered an important role of bacterial metabolites in the gut immune response . Short - chain fatty acids (scfas) are the end products of fermentation of dietary fibers by the anaerobic gut microbiota and have been shown to exert multiple beneficial effects on host immune homeostasis (13). For example, butyrate - induced signaling inhibits histone deacetylases (14), increases the size, and enhances the function of the colonic regulatory t cell pool (15). Collectively, microbiota - derived molecules, including both bacterial components and metabolites, influence the host immune function . Based on the role of gut microbiota in development of the immune system although there is little evidence in this regard so far, several reports have indicated that the microbiota could influence vaccine efficacy and adjuvant activity . Vaccines display a protective effect against a broad range of diseases including infection, cancer, and allergy . Multiple reports have shown that people in developing countries exhibit reduced responses to oral vaccines . The efficacy of rotavirus (16), poliovirus (1718), and cholera (1920) vaccines in developing countries with poor sanitation is lower than that in industrialized nations . Nicaraguan children were shown to have blunted antibody responses to oral cholera vaccine as compared to swedish children (21). Similarly, children in poorer regions of north india displayed reduced mucosal immune responses compared to children in other parts of the country (22). Furthermore, growing evidence suggests that the gut microbiota, which is known to be different in children from developed and developing countries (23), plays an important role in determining vaccine efficacy . For example, an abundance of stool actinobacteria including bifidobacterium was shown to be positively correlated with higher responses to oral and parenteral vaccines and a larger thymus in bangladeshi infants . Conversely, a high abundance of clostridiales, enterobacteriales, and pseudomonadales was associated with neutrophilia and lower vaccine responses (24). Furthermore, small intestinal bacterial overgrowth (sibo), which is defined as excessive bacteria in the small intestine and is common in children in developing countries but rare in industrialized settings, contributed to lower antibodies to cholera toxin after immunization (25). Since sibo presents malabsorption and systemic symptoms, competition between the host and microbiota for nutrients and defects in the intestinal barrier may cause reduced vaccine responses . Indeed, whole blood cells derived from south african infants aged 2 years were shown to be severely hyporesponsive to tlr ligands including lps and secreted lower levels of cytokines and chemokines in response to stimulation of tlrs than the age - matched children from north america, south america, and europe (2627). In summary, factors that affect gut microbial communities, such as malnutrition, poor sanitation, increased antigen exposure, antibiotic treatment, nutritional status, and lack of breast milk antibodies, could influence vaccine efficacy . Mice treated with clarithromycin or doxycycline showed reduced antibody induction against the hepatitis b virus surface antigen (hbsag) vaccine . In contrast, mice treated with the same antibiotics exhibited increased antibody responses to live attenuated salmonella enterica serovar typhi (ty21a) vaccine (28). Macaques, showing a high level of diversity in the intestinal microbial composition, had improved protection upon challenge with virulent shigella dysenteriae after immunization with live attenuated s. dysenteriae vaccine . In addition, oscillospira and streptococcus were found to be positively and negatively correlated, respectively, with vaccine - specific igg and iga induction and pro tective responses (29). These findings suggest that intes tinal microbial diversity and particular microbiome compositions can influence antibody responses . It has also been suggested that prebiotics (compounds that increase the number of certain commensals) could enhance the efficacy of oral vaccines . Prebiotic fructo - oligosaccharide (fos) has been shown to improve the efficacy of a vaccine against salmonella infection . Treatment with fos prior to vaccination resulted in improved host responses and enhanced protection against infection (30). Another study showed that a prebiotic mixture containing galacto- and fructo - oligosaccharides (gos and fos) enhanced systemic immune responses to influenza vaccine . In addition, the prebiotic mixture increased proportions of certain members of the microbiota, suggesting a role for the specific microbial community in the increased host immune responses (31). Since bacteria - derived components have potent immunostimulatory capacity, they constitute a major potential source of adjuvants . For example, lipopolysaccharide (lps), peptidoglycan (pgn), cpg dna, and trehalose dimycolate (tdm) are known to enhance the immune response against co - administered antigens (32). This adjuvant activity is mediated through the activation of tlrs, nlrs, and clrs (c - type lectin receptors) that mediate signals responsible for activation of the host innate immune system (111233). A systems biology approach to study the innate and adaptive response induced by vaccination of humans with non - adjuvanted influenza subunit vaccine (trivalent inactivated vaccine, tiv) revealed that tlr5 levels within three days of receiving the vaccine were positively correlated to the strength of the antibody response against the virus (34). Tlr5 is a cell - surface receptor specific for flagellin, the monomeric component of bacterial flagellum used for cell motility, and has not been associated with viral recognition . Oh et al . Found that knockout mice lacking the tlr5 protein produced significantly lower levels of antibodies after receiving tiv than wild - type mice (35). Because tiv does not interact directly with tlr5, the authors turned their focus to the microbiome in order to clarify the role of tlr5 signaling in vaccine efficacy . Indeed, gf mice and antibiotic - treated mice showed impaired responses to tiv . Furthermore, colonization of gf mice with flagellin - expressing, but not flagellin - lacking, bacteria was sufficient to enhance the vaccine efficacy . Results of this study indicate that flagellin from the gut microbiota acts as a natural adjuvant to enhance protective immune responses to the tiv vaccine . Cholera toxin (ct), derived from vibrio cholerae, is widely used as a mucosal adjuvant in animal immunology . Ct is composed of pentameric b subunits that bind to the cell surface gm1 ganglioside receptor, and a monomeric a catalytic subunit that activates the heterotrimeric guanine nucleotide binding protein gs, which in turn stimulates camp production by adenylate cyclase . This mechanism is thought to be responsible for the adjuvant effect of ct (3637). Although the toxicity of ct prevents its clinical application, elucidation of the mechanisms of its potent adjuvant activity may lead to the development of nontoxic and effective mucosal adjuvants for vaccination . We have shown that the mucosal adjuvant activity of ct relies on nod2 signaling induced by endogenous microbiota (38). Nasal or oral immunization of gf and antibiotic - treated mice with human serum albumin (hsa) + ct exhibited reduced levels of antigen - specific igg1, recall - stimulated cytokine responses, and reduced follicular helper t (tfh) and plasma cells . Furthermore, the effect of the endogenous microbiota on the adjuvant activity of ct was impaired in ripk2 (the adaptor molecule required for nod1 and nod2 signaling)-deficient or nod2 (recognizes peptidoglycan molecules, muramyl dipeptide (mdp))-deficient mice, but not in myd88 (the adaptor molecule required for tlr signaling)-ko or nod1 (recognizes peptidoglycan molecules, diaminopimelic acid (dap))-ko mice . Gf mice immunized with a combination of hsa + ct and mdp produced high levels of antigen - specific igg1, suggesting that nod2 signaling promotes the adjuvanticity of ct . Furthermore, several members of the mdp - rich endogenous microbiota such as staphylococcus sciuri promoted the adjuvant activity of ct in gf mice in a nod2-dependent manner . This study indicates that the adjuvanticity of ct relies on nod2 signaling triggered by the mdp - rich endogenous microbiota . Thus, it can be suggested that environmental factors that affect the composition of the microbiota and stimulatory activity that bacterial components exert on host prrs may be important to determine the capacity of mucosal vaccines to provide protective immunity . It is well known that the efficacy of oral vaccines depends on several factors such as genetic background, prior exposure to antigen via natural infection or vaccination, and nutritional status . Current findings suggest that the low responses to oral vaccines could be due to differences in the microbiota composition as a result of genetic, environmental, and nutritional variation . Indeed, growing evidence indicates that the microbiota influences vaccine and mucosal adjuvant efficacy (fig . 1). However, investigations of the relationship between the microbiota and the efficacy of vaccines are at an initial stage, and data accumulated so far are limited . Therefore, further understanding of the impact of the microbiota on vaccine effectiveness is necessary . Detailed analysis of the role of particular species within communities in vaccine responses will provide novel insights into the development of strategies for improved vaccine efficacy.
High dose rate (hdr) brachytherapy in the treatment of cervical cancer with or without external radiotherapy is an essential component of management . It has a high therapeutic index delivering a high dose to primary cervical lesion and lower doses to adjacent organs [13]. In brachytherapy, an exact knowledge of the applicator geometry is necessary for an accurate calculation of dose to tumor and critical organs . The traditional ways to reconstruct the brachytherapy catheters are either using a semi - orthogonal film method with a reconstruction jig or a pair of isocentric orthogonal or variable angle x - ray imaging method . X - ray images are obtained by using a therapy simulator or an integrated brachytherapy unit (ibu). Except ibu, the procedure requires that the patient is transferred after the application to the x - ray unit room for obtaining the reconstruction images and needs to be transported back to the brachytherapy treatment room to administer the irradiation . A modern approach in treatment planning for cervical cancer is based on computed tomography (ct) or magnetic resonance (mr) images and on a 3d dose calculation . Since 2004, several guidelines for image based brachytherapy for cervical cancer have been published [2, 5, 6]. At our centre, intracavitary brachytherapy (icbt) planning has been carried with the 2d x - ray film method using a reconstruction jig and semi orthogonal reconstruction . The present study was carried out with the intention of changing over to ct based 3d planning . The treatments delivered using 2d film planning were also planned with ct imaging keeping the same source configuration . The doses to organs at risks i.e. Bladder and rectum were computed by both the methods for further analysis . To our knowledge, there has been limited published data or literature available regarding the dosimetric comparison of semi orthogonal reconstruction of non isocentric x - rays with orthogonal x - rays or ct - mri brachytherapy treatment planning in cervical cancers . Ten patients with cervical cancer (stage iib 4 patients, stage iiib 4 patients, stage iva 2 patients) who underwent 30 intracavitary brachytherapy insertions at our centre were included in this study . The standard treatment protocol for cervical cancers at our centre consists of external beam radiotherapy (50 gy/ 25 fractions) with concomitant chemotherapy and icbt . After 7 - 10 days of completion of external chemo - radiotherapy to the pelvis, patients were taken for hdr - icbt and a total dose of 21 gy in three equal fractions of 7 gy each at weekly intervals was given . The fletcher williamson applicators (nucletron, veenendaal, the netherlands) were used for intracavitary brachytherapy application consisting of uterine tandem and a pair of ovoids . Standard metallic applicators were used without special modification for ct / mri compatibility . Before each application, a urinary catheter was inserted and the catheter balloon inflated with contrast and normal saline (7 ml) for visualizing the bladder . Appropriate packing was done to fix the applicator in position and to push the bladder and rectum away from the vaginal applicators . After insertion of the applicators, x - ray images were taken with patient in supine position (ap and lateral views) for conventional planning with a reconstruction jig . To minimize patient movement during radiographs, the reconstruction jig base plate was kept below the patient and it remained there till the treatment was completed . 1) was supplied by nucletron and comprises of a base plate and a c shaped mountable structure . The x - ray tube is focused on the markers on upper c - shaped plate . The base plate also has a provision for holding the radiographic film cassettes for lateral as well as ap radiographs . The brachytherapy treatment planning systems require setup parameters, with magnification factors of the images . This method allows the use of a non isocentric x - ray unit to take the two reconstruction radiographs . Truly orthogonal orientations are not easily obtained with non isocentric x - ray unit . A localization jig with ap and lateral cross wires the semi orthogonal reconstruction method accepts x - rays beams whose central axes do not intersect and are not perpendicular to one another . The only requirement is that the projections of the cross - wires on the two corresponding box faces are visible on the radiographs (fig . X - ray images were taken with patient in supine position (ap and lateral views) for conventional planning the semi orthogonal reconstruction method accepts x - rays beams whose central axes do not intersect and are not perpendicular to one another geometrical reconstruction of applicator and dose computation was carried out using plato sunrise (brachytherapy v14.3.5, nucletron, the netherlands) brachytherapy treatment planning system using vidar dosimetry pro scanner . Point a was defined on the radiographs as being 2 cm superior (along the tandem) to the flange abutting external cervical os and 2 cm lateral from the axis of the tandem . The source positions were loaded as per the standard loading pattern in accordance with the manchester system . These dwell positions were then optimized to minimize the dose to rectal and bladder points . The 7 gy dose was prescribed to point a. the doses to point a, bladder and rectum were calculated . In the planning process, bladder and rectum point doses were planned to keep below 80% of dose to point a for each planned fraction . A ct scan (somatom sensation 4, siemens) with 3 mm slice thickness through the pelvis was performed for 15 cases out of 30 icbt insertions . The ct images were transferred to oncentra virtual simulation system (oncentra masterplan version 3.3, nucletron) via networking and subsequently to the plato treatment planning system (nucletron). Subsequently the radiation oncologist delineated the bladder and rectum (oars) in each slice of all the ct images . Although few ct slices contained artefacts, but this was not a serious impediment to contouring bladder and rectum in this study . Rectum was contoured from above the anal sphincter to the level of transition to sigmoid . After catheter reconstruction, for each application, the corresponding optimized dwell positions used in conventional 2d planning were duplicated for 3d planning with the contours now drawn . Dvh parameters for minimum dose to the most irradiated contiguous volume of 0.1cc, 1cc and 2cc (d0.1cc, d1cc and d2cc, respectively) were produced for each oar with 100 000 sample points . The paired student's t - test was performed for comparison of icru point doses and d2cc volume doses for bladder and rectum . Ten patients with cervical cancer (stage iib 4 patients, stage iiib 4 patients, stage iva 2 patients) who underwent 30 intracavitary brachytherapy insertions at our centre were included in this study . The standard treatment protocol for cervical cancers at our centre consists of external beam radiotherapy (50 gy/ 25 fractions) with concomitant chemotherapy and icbt . After 7 - 10 days of completion of external chemo - radiotherapy to the pelvis, patients were taken for hdr - icbt and a total dose of 21 gy in three equal fractions of 7 gy each at weekly intervals was given . The fletcher williamson applicators (nucletron, veenendaal, the netherlands) were used for intracavitary brachytherapy application consisting of uterine tandem and a pair of ovoids . Standard metallic applicators were used without special modification for ct / mri compatibility . Before each application, a urinary catheter was inserted and the catheter balloon inflated with contrast and normal saline (7 ml) for visualizing the bladder . Appropriate packing was done to fix the applicator in position and to push the bladder and rectum away from the vaginal applicators . After insertion of the applicators, x - ray images were taken with patient in supine position (ap and lateral views) for conventional planning with a reconstruction jig . To minimize patient movement during radiographs, the reconstruction jig base plate was kept below the patient and it remained there till the treatment was completed . The reconstruction jig (fig . 1) was supplied by nucletron and comprises of a base plate and a c shaped mountable structure . The x - ray tube is focused on the markers on upper c - shaped plate . The base plate also has a provision for holding the radiographic film cassettes for lateral as well as ap radiographs . The brachytherapy treatment planning systems require setup parameters, with magnification factors of the images . This method allows the use of a non isocentric x - ray unit to take the two reconstruction radiographs . Truly orthogonal orientations are not easily obtained with non isocentric x - ray unit . A localization jig with ap and lateral cross wires the semi orthogonal reconstruction method accepts x - rays beams whose central axes do not intersect and are not perpendicular to one another . The only requirement is that the projections of the cross - wires on the two corresponding box faces are visible on the radiographs (fig . X - ray images were taken with patient in supine position (ap and lateral views) for conventional planning the semi orthogonal reconstruction method accepts x - rays beams whose central axes do not intersect and are not perpendicular to one another geometrical reconstruction of applicator and dose computation was carried out using plato sunrise (brachytherapy v14.3.5, nucletron, the netherlands) brachytherapy treatment planning system using vidar dosimetry pro scanner . Point a was defined on the radiographs as being 2 cm superior (along the tandem) to the flange abutting external cervical os and 2 cm lateral from the axis of the tandem . The source positions were loaded as per the standard loading pattern in accordance with the manchester system . These dwell positions were then optimized to minimize the dose to rectal and bladder points . The 7 gy dose was prescribed to point a. the doses to point a, bladder and rectum were calculated . In the planning process, bladder and rectum point doses were planned to keep below 80% of dose to point a for each planned fraction . A ct scan (somatom sensation 4, siemens) with 3 mm slice thickness through the pelvis was performed for 15 cases out of 30 icbt insertions . The ct images were transferred to oncentra virtual simulation system (oncentra masterplan version 3.3, nucletron) via networking and subsequently to the plato treatment planning system (nucletron). Subsequently the radiation oncologist delineated the bladder and rectum (oars) in each slice of all the ct images . Although few ct slices contained artefacts, but this was not a serious impediment to contouring bladder and rectum in this study . Rectum was contoured from above the anal sphincter to the level of transition to sigmoid . After catheter reconstruction, for each application, the corresponding optimized dwell positions used in conventional 2d planning were duplicated for 3d planning with the contours now drawn . Dvh parameters for minimum dose to the most irradiated contiguous volume of 0.1cc, 1cc and 2cc (d0.1cc, d1cc and d2cc, respectively) were produced for each oar with 100 000 sample points . The paired student's t - test was performed for comparison of icru point doses and d2cc volume doses for bladder and rectum . The mean age of the patients was 55 (range 45 - 60) years . Tumor stage was evaluated according to the international federation of gynaecology and obstetrics (figo) classification . The mean contoured volume of bladder and rectum was 104 (64) cc and 48 (13) cc, respectively . Table 1 shows the mean icru point doses and d2cc volume doses for bladder and rectum from this study . The mean d2cc of the bladder obtained from the ct plan was 6.91 gy (2.9 - 12.2 gy). The mean icru bladder dose obtained for our patients was 3.08 gy (1.9 - 5.9 gy). Our results reveal that icru bladder dose is less than bladder d2cc dose by a ratio of 2.24 (fig . 3). Mean icru and d2cc doses calculated show a statistically significant difference for bladder (p = 0.000). Comparison of bladder dose by conventional and ct planning mean icru point doses and d2cc volume doses in bladder and rectum in our study (semi orthogonal method) icru international commission on radiation units and measurements; d2cc dose received by 2cc of the volume of the bladder calculated from image based ct planning; ci confidence interval the mean d2cc of the rectum obtained from the 3d plan was 4.2gy (2.8 - 5.9 gy). The mean icru rectal dose obtained from the conventional plan for all patients was 3.8 gy (2.4 - 4.45 gy) (table 2, fig . 4). Mean icru and d2cc doses calculated did not reveal a statistically significant difference for rectum (p = 0.08). Physical doses (ebrt + hdr) for oars at icru points as well d2cc were converted to a biologically equivalent dose and normalised to conventional 2gy (/ = 3), eqd2 (table 3). Comparison of rectal dose by conventional and ct planning mean icru point doses and d2cc volume doses in bladder and rectum (orthogonal method) icru international commission on radiation units and measurements; d2cc dose received by 2cc of the volume of the bladder calculated from image based ct planning biologically normalized total dose eqd2 for bladder and rectum (/ = 3) in our study the treatment planning for the delivery of radiation is dependent on the imaging modality used as well as the method of reconstruction of the applicators and organ at risk . However, semiorthogonal reconstruction especially in the context of c - arm based brachytherapy planning has also been used . There is limited literature available on non - isocentric radiography based intracavitary brachytherapy planning especially with respect to volumetric dosimetry . Extensive literature is available which clearly suggests that image based brachytherapy is better than point based brachytherapy . The starting point was to retrospectively evaluate our clinical practice by applying 3d assessment of the oars using ct scans . Fung has evaluated the reconstruction jig with a c - arm based mobile fluoroscopic unit and found that the jig not only has an excellent accuracy of reconstruction, but it also resolves problems encountered while using c - arm . Both fung and cuijpers have suggested that using the jig resolves the problem such as distortion, ill defined planes and sagging, which are issues with image intensifier used in c - arm fluroscopic units . They have reported that the reconstruction jig is narrow and the localization of the marker point becomes difficult for very bulky patients . Nevertheless, in our study our patients did not experience any difficulty in fitting within the jig possibly due to the smaller built of the indian females as compared to the western population . In the radiographs taken with the help of reconstruction jig, the bladder and rectal markers were properly visualized in both ap as well as lateral radiographs . However, in some patients the radio opaque markers and contrast in bulb of foley's catheter were faintly visualized with usual exposure factors and required increasing of the exposure factors (kv, mas). For image the artefacts produced by metal applicators were reduced up to some extent by manipulating the ct window and level setting during ct scan . The accuracy of ct reconstruction was compared with the radiograph based reconstruction of the applicator by overlaying ct reconstruction on radiograph reconstruction . The maximum variation of 6 mm was observed between these two with respect to point a. this is attributed to shifting of patient between x - ray room and ct room . It has been shown by grigsby et al . That movement of reference points relative to bony structures during the interval time of two intracavitary implants led to an average shift of 10 - 15 mm and dose differences of up to 35% have also concluded that any movement of patient should be avoided as this can produce large changes in dose to bladder and rectum . We compared our results of non isocentric film based icbt using semiorthogonal reconstruction with the data available in the literature where icbt was performed with orthogonal reconstruction delivering a dose 7 gy at similar point a (table 4). We found that our calculations with semiorthogonal radiographs for bladder and rectal doses were comparable to the doses calculated with orthogonal radiography based studies such as onal et al . (62 hdr applications), jamema et al ., (22 hdr applications) (both authors prescribed 7 gy dose at point a) as well as with tan et al . When we compared our results for the mean icru point doses obtained using semi orthogonal approach and the d2cc doses for rectum and bladder on ct scans, we found that the average ratio of icru rectal dose to d2cc (rectum) by our approach was 1.10 which is similar to the ratios obtained such as 1.66, 1.11 and 1.07 by other authors [1214] for rectum, respectively . However, the icru bladder point underestimated the bladder d2cc dose by a ratio of 2.24 in our study as compared to 1 .51, 1.56 and 1.34 [1214] (table 2), but it was comparable with schoeppel et al . And barillot et al . . Other authors such as hunter et al . Have also found that the ratio of max bladder dose (from ct images) to icru reference dose (calculated from radiographs) varied from 1.01 to 3.59 . Has reported average ratios of 2.3 (range 1.4 - 2.7) for the bladder and 1.3 (range 0.9 - 2.1) for the rectum . Used ultrasonography for evaluating the bladder doses and found that maximum doses in the bladder were on an average 2.7 times higher than the doses at the icru reference points (calculated from radiographs). Comparison of mean icru point doses (gy) for bladder and rectum using semi - orthogonal method and orthogonal method n number of brachytherapy insertions (for a prescription dose of 7 gy to point a). Our results are similar with published data for rectal doses, however there is a broad range for bladder doses . Fellner et al . Has attributed the wide range of ratios for the bladder to different methods used like radiographs, ultrasound, ct to evaluate the doses and the difference in individual patient anatomy . Treatment planning based on semi - orthogonal films obtained with a non - isocentric x - ray unit with the help of a reconstruction jig is comparable to true orthogonal films on an isocentric x - ray unit . Icru reference point doses by semiorthogonal reconstruction underestimated the bladder d2cc volume doses, but no significant difference was found for rectum . Ct/ mri based 3d volume based planning should be used wherever feasible as it is better in assessing the doses to oar volumes than conventional film point based 2d planning and has today become the standard of care in many institutions.
Lumbosacral radicular pain is a common and disabling condition in adults with pathology of the bones in the distal spine, and it represents a significant quality - of - life issue.1 lower back pain is not always associated with radicular symptoms . Clinical findings of neuropathy may vary significantly, depending on the pathogenesis of the pain symptoms . Neuropathic pain is still a dark zone for neuroscientists and treatment remains challenging for clinicians . It has been described as a direct consequence of involvement of the somatosensory system, with a population prevalence between 7 and 10%, thus stressing the importance of a standardized approach for its recognition.2 pharmacological therapies have often proved ineffective, surgery has poorly characterized indications, and the use of interventional neuromodulation (eg, pulsed radiofrequency and spinal cord stimulation) is still debated or not always applicable.3 some older studies reported that opioids have poor efficacy for neuropathic pain, although this conclusion has been progressively questioned because of the lack of compelling evidence, and several reports arguing that a substantial proportion of patients with neuropathic pain might significantly respond to opioids.4 some investigators have evaluated the additional efficacy of local anesthetics, stressing evidence for the development of synergistic effects after coadministration with opioids, and found that bupivacaine and morphine together showed better results than either alone, in terms of patient satisfaction, medication intake, and pain clinic admissions.5 different routes of administration have been tested, and epidural and intrathecal drug delivery confers benefits in comparison with other routes . For instance, these routes avoid first - pass metabolism and the blood brain barrier and allow the use of lower doses at comparable efficacy, given that the medications are deposited directly at the spinal cord.68 considering that epidural administration can be maintained for longer periods with lower risks relative to the intrathecal route, it may be possible to utilize other analgesics to obtain adequate analgesia for prolonged periods . To the best of our knowledge, no previous study has assessed how epidural therapy with combined opioids and local anesthetics might provide long - lasting pain modulation . The aim of this study was to investigate the effectiveness of epidural morphine and bupivacaine in patients with chronic neuropathic pain associated with lumbosacral radiculopathy . The research protocol was approved by the institutional review board committee of the santa maria maddalena hospital, occhiobello (ro), italy . Informed consent was obtained from each patient, and the patients enrolled in the research were allowed to withdraw from the study at any point if they wished . Prior to the enrollment, every patient was evaluated to confirm probable or definite neuropathic involvement.9 the following criteria were adopted as inclusion criteria for the study subjects: severe pain intensity assessed with a numeric rating scale (nrs) score of 7/10.definite or probable neuropathic involvement as assessed by clinical examination and grading system.chronic lower extremity radicular pain lasting for> 6 months.clinical examination suggestive of radicular pain with 1 positive provocation tests (eg, straight leg raise test).poor response to pharmacological therapy, physical therapy, or epidural injection of anti - inflammatories (ie, pain reduction in nrs 30% during the 6 months before enrollment).magnetic resonance imaging and/or electromyographic test suggestive of radiculopathy . Severe pain intensity assessed with a numeric rating scale (nrs) score of 7/10 . Definite or probable neuropathic involvement as assessed by clinical examination and grading system . Clinical examination suggestive of radicular pain with 1 positive provocation tests (eg, straight leg raise test). Poor response to pharmacological therapy, physical therapy, or epidural injection of anti - inflammatories (ie, pain reduction in nrs 30% during the 6 months before enrollment). Magnetic resonance imaging and/or electromyographic test suggestive of radiculopathy . The following exclusion criteria were applied: possible or unlikely neuropathic pain.positive response to previous treatments.comorbid neurological or psychiatric disorders.significant motor deficits . . Significant motor deficits . The procedure was performed in a suitable operating room, with disinfection and sterilization of all devices . A sterile operative field was maintained while each patient was lying on a fluoroscopy table in the prone position for needle introduction . After injection of local anesthetic to numb the operative zone, a 16-g hollow needle was inserted through the paramedian tissues at a 40 angle, with the skin and epidural space located by standard loss of resistance to air techniques . An epidural catheter was inserted at the t12l1 intervertebral space, with the correct placement verified by fluoroscopy . The position of the catheter tip was confirmed by injection of x - ray contrast medium (iopamiro 300; bracco imaging, s.p.a ., the catheter was tunneled for 5 cm subcutaneously and then fixed at 10 cm in the abdominal skin, and the patient was transported to the recovery room (figure 1). On the following day, each patient received an epidural analgesic injection followed by a 2 ml flush with normal saline . The injection solution was composed of morphine chlorhydrate (0.1 mg / ml) and bupivacaine (1 mg / ml), and the dose was progressively increased to 3 ml three times a day (total dosage per day: morphine 0.9 mg and bupivacaine 9 mg). A variable ratio of the opioid and local anesthetic agents was used, such that the dosages of the two drugs were adjusted in order to obtain the optimal analgesia with the fewest side effects in comparison to the postoperative pain treatment (ie, morphine 24 mg / day and bupivacaine 0.125%).10 the medication was administered in the hospital for the first week and self - administered by the patient in the outpatient setting for the following 3 weeks . Proper medication intake and catheter functioning were evaluated every week by an expert nurse and a pain physician . On the 30th day, the catheter was removed and an appointment for clinical follow - up in 1 month was scheduled . Each patient was evaluated for pain levels by two independent reviewers not involved with catheter placement and drug administration, before catheter placement and at 1 month after removal . Pain intensity was assessed with the 010 nrs and by the italian version of the mcgill pain questionnaire (quid), which has 42 descriptors divided into four main pain rating index ranks (sensory, affective, evaluative, and mixed). The total prir (prir - t) value, given by the sum of all the rank values, describes and quantifies the pain.11,12 response to treatment was considered successful with a pain reduction in nrs> 30% at follow - up . The wilcoxon s rank sum test was applied to evaluate changes in nrs and prir - t, comparing baseline and follow - up levels . Moreover, differences between the four prir coefficients describing sensory (prirc - s), affective (prirc - a), evaluative (prirc - e), and mixed (prirc - m) aspects of pain were compared in the responders and nonresponders . The association between pain variation in nrs and quid at the follow - up was calculated using the spearman s test . The kolmogorov the sample size was chosen in order to obtain a pain reduction> 30% at follow - up in patients with a pretreatment nrs pain intensity 7/10 . Considering an alpha level of <5%, a study group of 20 patients allowed achievement of a statistical significance of> 95% with statistical power of> 80% . The research protocol was approved by the institutional review board committee of the santa maria maddalena hospital, occhiobello (ro), italy . Informed consent was obtained from each patient, and the patients enrolled in the research were allowed to withdraw from the study at any point if they wished . Prior to the enrollment, every patient was evaluated to confirm probable or definite neuropathic involvement.9 the following criteria were adopted as inclusion criteria for the study subjects: severe pain intensity assessed with a numeric rating scale (nrs) score of 7/10.definite or probable neuropathic involvement as assessed by clinical examination and grading system.chronic lower extremity radicular pain lasting for> 6 months.clinical examination suggestive of radicular pain with 1 positive provocation tests (eg, straight leg raise test).poor response to pharmacological therapy, physical therapy, or epidural injection of anti - inflammatories (ie, pain reduction in nrs 30% during the 6 months before enrollment).magnetic resonance imaging and/or electromyographic test suggestive of radiculopathy . Severe pain intensity assessed with a numeric rating scale (nrs) score of 7/10 . Definite or probable neuropathic involvement as assessed by clinical examination and grading system . Clinical examination suggestive of radicular pain with 1 positive provocation tests (eg, straight leg raise test). Poor response to pharmacological therapy, physical therapy, or epidural injection of anti - inflammatories (ie, pain reduction in nrs 30% during the 6 months before enrollment). Magnetic resonance imaging and/or electromyographic test suggestive of radiculopathy . The following exclusion criteria were applied: possible or unlikely neuropathic pain.positive response to previous treatments.comorbid neurological or psychiatric disorders.significant motor deficits . . Significant motor deficits . The procedure was performed in a suitable operating room, with disinfection and sterilization of all devices . A sterile operative field was maintained while each patient was lying on a fluoroscopy table in the prone position for needle introduction . After injection of local anesthetic to numb the operative zone, a 16-g hollow needle was inserted through the paramedian tissues at a 40 angle, with the skin and epidural space located by standard loss of resistance to air techniques . An epidural catheter was inserted at the t12l1 intervertebral space, with the correct placement verified by fluoroscopy . The position of the catheter tip was confirmed by injection of x - ray contrast medium (iopamiro 300; bracco imaging, s.p.a ., the catheter was tunneled for 5 cm subcutaneously and then fixed at 10 cm in the abdominal skin, and the patient was transported to the recovery room (figure 1). On the following day, each patient received an epidural analgesic injection followed by a 2 ml flush with normal saline . The injection solution was composed of morphine chlorhydrate (0.1 mg / ml) and bupivacaine (1 mg / ml), and the dose was progressively increased to 3 ml three times a day (total dosage per day: morphine 0.9 mg and bupivacaine 9 mg). A variable ratio of the opioid and local anesthetic agents was used, such that the dosages of the two drugs were adjusted in order to obtain the optimal analgesia with the fewest side effects in comparison to the postoperative pain treatment (ie, morphine 24 mg / day and bupivacaine 0.125%).10 the medication was administered in the hospital for the first week and self - administered by the patient in the outpatient setting for the following 3 weeks . Proper medication intake and catheter functioning were evaluated every week by an expert nurse and a pain physician . On the 30th day, the catheter was removed and an appointment for clinical follow - up in 1 month was scheduled . Each patient was evaluated for pain levels by two independent reviewers not involved with catheter placement and drug administration, before catheter placement and at 1 month after removal . Pain intensity was assessed with the 010 nrs and by the italian version of the mcgill pain questionnaire (quid), which has 42 descriptors divided into four main pain rating index ranks (sensory, affective, evaluative, and mixed). The total prir (prir - t) value, given by the sum of all the rank values, describes and quantifies the pain.11,12 response to treatment was considered successful with a pain reduction in nrs> 30% at follow - up . The wilcoxon s rank sum test was applied to evaluate changes in nrs and prir - t, comparing baseline and follow - up levels . Moreover, differences between the four prir coefficients describing sensory (prirc - s), affective (prirc - a), evaluative (prirc - e), and mixed (prirc - m) aspects of pain were compared in the responders and nonresponders . The association between pain variation in nrs and quid at the follow - up was calculated using the spearman s test . The sample size was chosen in order to obtain a pain reduction> 30% at follow - up in patients with a pretreatment nrs pain intensity 7/10 . Considering an alpha level of <5%, a study group of 20 patients allowed achievement of a statistical significance of> 95% with statistical power of> 80% . Eighty - three consecutive patients, diagnosed with radicular lumbosacral pain between january 2014 and december 2015, were evaluated in the pain medicine unit of santa maria maddalena hospital . Oral medications that were prescribed for therapy before the enrollment included non - steroidal anti - inflammatory drugs, antidepressants, anticonvulsants, and opioids, and the pre - enrollment physical therapy was based on a progressive specific exercise program involving the training of the deep abdominal and lumbar muscles . Radicular epidural injection with triamcinolone 40 mg / ml and lidocaine 2% 0.3 ml was performed with ultrasound guidance.13,14 fifty - three patients did not meet inclusion criteria and were excluded from the study . Two patients were excluded during the treatment period after malfunction and subsequent removal of the epidural catheter, and six patients reported no improvement in pain level at the fourth week and were removed from follow - up . Ultimately, 22 patients remained enrolled in the study, and most (73%) of these patients reached significant pain relief during treatment . The study profile and the epidural treatment effect on pain scores are summarized in figure 2 and table 2, respectively . Nrs and prir - t were significantly reduced at follow - up (p=0.001 and p=0.03, respectively). These data were confirmed by the parallel evolution in the two scores (r=0.75, p<0.001), strengthening marked pain relief lasting up to 1 month after treatment cessation (figure 3). If the four pain rating coefficients were analyzed, none of the single items was significantly modified compared to the others either in responders or in nonresponders . The oswestry disability index was applied for clinical purposes and showed an overall improvement at follow - up . Nevertheless, considering the frequent association with low back pain, disability caused by axial pain therefore, we chose not to include this index in the study due to the complex nature of lumbosacral radicular pain . A successful clinical outcome was observed in eleven of the 22 patients at the follow - up, with 50.4% of effect size and 97.2% of statistical power . In this study, we evaluated pain improvement after the cessation of epidural treatment with morphine and bupivacaine . At follow - up, half of the patients suffering from moderate - to - severe pain at baseline reported a significant improvement, which was confirmed with two validated scores, affecting the sensory and evaluative as much as affective aspects of pain . To our knowledge, this is the first study to report the effectiveness of epidural treatment with combined opioids and anesthetics persisting after catheter removal . If pain improvement had occurred, it was maintained for 1 month after therapy cessation, thereby suggesting a potential role for modifying the natural history of the disease . Although the protocol was complex, involving hospital admission, placement of epidural catheter in the operating room, and the administration of medications for 4 weeks, all the patients included in the study had severe chronic pain that was refractory to several standard treatments . Opioid infusion has increasingly been used as a treatment in noncancer pain and more recently has been assessed in patients with chronic pain . Pain levels improve significantly with higher doses, but these levels can promote the risk of abuse and often burden the patient with adverse effects . One of the main pitfalls in opioid therapy lies in the progressive development of tolerance, which is responsible for decreasing efficacy.15 epidural delivery of anesthetics may be associated with prolonged analgesia and reduced mechanical allodynia in rats with nerve injury, whereas similar effects have also been described in humans with neuropathic pain after lidocaine administration.16 in other trials, the combination of intrathecal bupivacaine and morphine showed good efficacy in most cancer and nonmalignant pain patients with neuropathic or mixed pain . In addition to enhancing analgesia, bupivacaine combinations seem to be responsible for opioid - sparing regimens with diminished adverse effects.17 opioids are usually claimed to target dorsal horn cell receptors and cause pre- and postsynaptic modulation of pain, although peripheral effects have also been taken into account due to the identification of opioid receptors on peripheral sensory neuron processes.18 a previous study has also shown that microinjection of opioids into the brainstem may elicit powerful antinociceptive effect in animals and humans, likely involving the periaqueductal gray (pag) and the rostro - ventromedial medulla (rvm).19 although the cellular mechanisms and sites of action are still debated, many local anesthetics block ion channels at the dorsal entry root zone and antagonize pain transmission via ad and c fibers.20 moreover, bupivacaine may inhibit spinal glutamatergic transmission, and its analgesic effect might also be subsequent to the modulation of n - methyl - d - aspartate receptors in the superficial dorsal horn.21 compelling evidence suggests that ectopic neural discharge may represent an underlying mechanism of neuropathic pain . These abnormal impulses may arise at the site of nerve injury or far from it, in apparently intact axons or structures, driven by abnormal discharges in ab or c fibers.22 in this regard, the role of the dorsal root ganglion (drg) has been widely investigated, due to its location as a border area between spinal cord and peripheral nerves . Abnormal discharges in the drg tend to be more sensitive to lidocaine injection than those at the site of nerve injury . Several studies highlighted that hyperexcitable drg neurons begin to show ongoing activity that lasts many days or weeks after nerve injury . In turn, this pathological activity might induce reversible central sensitization.23 in experimental models, systemic lidocaine silences the drg ectopic discharges without blocking nerve conduction, whereas local anesthetic agents applied intrathecally and to the drg surface in patients with phantom limb pain produce transient improvement of painful and nonpainful sensations in the majority of subjects, strengthening the conclusion that lidocaine can antagonize spontaneous bursting action potential discharge and sensitization.24 despite the distance from the catheter tip, sensitized drg might therefore have responded to low - dose bupivacaine and, because of a lack of efficient neurovascular barriers, it could be considered as a potential target in our study . In addition, ion channels are widely expressed in the central nervous system as much as in the periphery . The number of sodium channels (eg, nav 1.3) has been found to be increased in dorsal horn and thalamic neurons after traumatic spinal cord injury, producing central pain . Blocking the expression of such channels may reverse the excitability changes in either the central nervous system or the peripheral nervous system, whereas injection of lidocaine into the rvm blocks tactile and thermal hyperesthesia.25 increasing evidence is also documenting the anti - inflammatory properties of anesthetics, resulting from their modulating action on the immune system . Manchikanti et al26 showed comparable long - lasting efficacy of epidural steroids and anesthetics in patients suffering from chronic lumbar disk herniation . This result might explain the improvement in low - back pain with radicular involvement, which often combines mixed features of nociceptive and neuropathic effects . How can we explain the maintenance of pain control efficacy in our results, lasting up to 1 month after the cessation of treatment and catheter removal? Several experiments showed that administration of systemic or local anesthetics may improve symptoms related to neuropathic pain for variable amounts of time after the end of therapy.27 some data stress the important role of bupivacaine in pain control: 1) the common tendency to increase the dose of opioids to optimize pain control, whereas in our study, it was maintained at a constant dose, and 2) the reported pain improvement after the addition of intrathecal bupivacaine in patients unresponsive to opioid alone.28 bupivacaine may enhance the analgesic effect of opioids through its action on voltage - gated calcium channels, changing opioid pharmacokinetics and receptor conformation.29 moreover, chronic pain has been associated with structural and functional changes in the human cortex and with dysfunctional descending pain modulation, which may be affected by medications and pain resolution, suggesting cortical plasticity processes.30 epidural addition of bupivacaine to opioids might help in restoring physiological antinociceptive mechanisms, therefore preventing or antagonizing chronic neuropathic pain.31 because our patients were suffering from refractory neuropathic pain, we considered a reduction of pain> 30% (at follow - up) as utilized in clinical trials, as significant.32 the analysis of quid coefficients failed to disclose significant pain variation among prirc - s, prirc - a, prirc - e, and prirc - m . The treatment improved sensory pain as much as affective quality of pain in responders, whereas none of these items changed compared to the others in poor responders . Nevertheless, the use of pain coefficients is not sufficient to rule out placebo effects, which may play an important role in the subjective response to treatments.33 the heterogeneous and small number of patients may be another issue, given that neuropathic pain may develop from different disorders and etiologies, making tighter criteria too restrictive . Nevertheless, we believe that the statistical power in this study was strong enough to support reliable results . Finally, the short duration of follow - up in this study does not allow us to comment on the potential for long - term pain relief . In animal models, intravenous infusion of lidocaine was able to eliminate mechanical allodynia for at least 3 weeks after treatment, but the maximal duration in humans needs to be elucidated in further studies . The present results showed significant efficacy of combined epidural morphine and bupivacaine in the treatment of radicular neuropathic pain, which was maintained for up to 1 month after the end of administration . As a result of multiple pathophysiological events, central and peripheral neural changes may produce clinical symptoms and lead to chronic pain . Maintaining significant pain relief with low doses of epidural bupivacaine / opioid may allow the physician to minimize adverse effects, neurotoxicity, and drug dosages, or to adopt more conservative approaches (eg, physical therapy) in pain management . Therefore, further studies are needed to evaluate the safety and reliability of this regimen over long periods, to promote the use of epidural treatment in selected cases, or ultimately to develop new implantable pump systems engineered to provide infusions for extended pain relief.
A 39-year - old woman, (gravida 7, para 1, [weight 67 kg, height 152 cm]) at 38 weeks of gestation, was admitted for an elective cesarean section . She had a history of self - limited palpitation, about 3 - 5 times per day . This palpitation began approximately 10 years ago and usually stopped within a few seconds, without other significant symptoms . During pregnancy, she had experienced new symptoms: episodes of sudden nausea, general weakness, and dizziness after prolonged standing . These symptoms were easily relieved by sitting or squatting . The preoperative blood test, urinalysis, chest x - ray, electrocardiogram (ecg), and echocardiogram were all normal . However, her 24 hour holter monitoring revealed one episode of non - sustained ventricular tachycardia (nsvt). Five to six hours before the surgery, she felt the same self - limited palpitation, but no other symptoms were observed . We started our routine monitoring with ecg, noninvasive arterial pressure, and oxygen saturation . Supplemental oxygen was administrated by a facial mask with a reservoir bag at the rate of 6 l / min . Her vital signs were a heart rate (hr) of 92 - 95 bpm with normal sinus rhythm, 103 - 104/63 - 64 mmhg of blood pressure (bp), and 100% of oxygen saturation (spo2). Because she had a history of nsvt, a 20-gauge catheter was inserted, at her left radial artery, for continuous arterial pressure monitoring . After positioning the patient to the right lateral decubitus, 8 mg of 0.5% hyperbaric bupivacaine, mixed with 20 g of fentanyl, was injected with a 25-gauge spinal needle at l4 - 5 interspace . Her vital signs were 92 bpm of hr, 102/63 mmhg of bp and 100% of spo2, immediately after spinal anesthesia . Then, the patient was put in a supine position with a left lateral tilt, and was given 50 g of prophylactic phenylephrine intravenously for the prevention of hypotension after the spinal anesthesia . The initial block level, 2 minutes after the introduction of spinal anesthesia, was at t10 checked with cold sense using an alcohol swab . As the block height went higher, the patient showed hypotension of 88/40 mmhg with 95 bpm of hr, and complained of nausea . Thus far, 700 ml of ringer's lactated solution had been administrated intravenously . Relative hypovolemia, caused by alpha - blocking effect of spinal anesthesia, was the suspected cause of hypotension . Therefore, we immediately injected phenylephrine twice (50 g each), and continued hydration with hydroxyethyl starch (voluven, fresenius kabi, germany). Her vital signs were stabilized with 96 bpm of hr and 140/74 mmhg of bp, without showing arrhythmia or reflex bradycardia, after phenylephrine administration, as well as her nausea stopped . Sensory level to alcohol swab to the t3 was noticed, 10 minutes after the spinal anesthesia . Within 10 minutes of the skin incision, a 3.9 kg female was delivered with apgar scores of 9 at both 1 and 5 minutes . Her vital signs were 98 bpm of hr with normal sinus rhythm, 128/68 mmhg of bp, and 100% of spo2 . One gram of cefazolin (cefamezin, dong - a pharm, korea), mixed with 10 ml of normal saline, was administrated intravenously after a confirmation of a negative antibiotic skin test result . Then she suddenly deteriorated with cardiovascular collapse, respiratory arrest, and loss of consciousness . The qrs complex disappeared with only p - waves being observed; eventually asystole occurred . Cardio - pulmonary resuscitation (cpr) was started immediately with external cardiac compression, manual ventilation with 100% oxygen with ventilator mask, rapid hydration, and trendelenburg position . After the injection of 1 mg of epinephrine, along with 1 minute of cpr, the ecg showed narrow qrs complexes with irregular r - r interval . However, her systolic pressure remained at 30 - 40 mmhg, without external cardiac compression . Approximately 3 minutes after cpr, the hr recovered up to 80 - 90 bpm with regular narrow qrs complex and an effective arterial pressure (80 - 90/70 - 80 mmhg). The patient gradually recovered her consciousness, spontaneous breathing, and orientation within a few minutes, and was placed horizontally with caution . Ephedrine 10 mg was administrated twice, when the systolic pressure was lower than 80 mmhg, followed by continuous infusion of dopamine at the rate of 5 g / kg / min . The total operation time was 80 minutes, in addition, 700 ml of hartmann solution and 500 ml of hydroxyethyl starch (voluven, fresenius kabi, germany) were infused . After the operation, she was transferred to the surgical intensive care unit (sicu) for an intensive cardiovascular monitoring . The postoperative arterial blood gas analysis, complete blood count, electrolyte, and coagulation tests were normal and only serum troponin i was mildly elevated (0.298 ng / ml). Also, the ecg and chest image showed no abnormality . After 27 hours of close observation in the sicu, she was transferred to the general ward . In this case, the possible cause of cardiac arrest includes: vasovagal response; ventricular arrhythmia; amniotic fluid embolism (afe); and anaphylaxis after the administration of cefazolin . We believe that the vasovagal response should be the most probable cause of her cardiac arrest . Firstly, although the history of nsvt, of course, was one issue for abnormal cardiac activity, it was not the direct cause of cardiac arrest . In addition, the progressively slowing hr, immediately before the cardiac arrest, suggests their supraventricular origin . Secondly, unique characteristics of afe, such as disseminated intravascular coagulation, pulmonary edema, and heart failure, were not observed . Her postoperative coagulation test, chest radiography, and echocardiography were all within normal limits . Also, the patient had a good response to cpr and recovered without complication, while cardiac arrest originated from afe usually has a poor response to cpr, and thus, exhibits a high mortality rate . Anaphylaxis is a severe systemic allergic reaction, and is typically presented with multi - organ system involvement . Nausea is a common gastrointestinal symptom of anaphylaxis, and acute anaphylactic shock can trigger bezold - jarisch reflex . However, her preoperative allergy skin test (ast) result was negative for cefazolin, and there was no other evidence of anaphylaxis; itchiness, flushing, or swelling of the skin and mucosa, as well as wheezing or stridor in the respiratory system . On the other hand, many factors in this case support vasovagal response, as the cause of sudden cardiac arrest (fig . 1). The patient was a full term woman, and had several vasovagal episodes before the surgery; she was more susceptible for vasovagal response . Term pregnant women experience aortocaval compression in the supine position, followed by a decrease in the right atrial filling pressure . In about 8% of the pregnant women, cardiovascular system cannot compensate for severe abrupt drops in venous return, and hence, the supine hypotensive syndrome develops . Furthermore, term pregnant women present significant decrease in systemic vascular resistance (-25%) by the development of a low resistance vascular bed in the placenta and vasodilation caused by prostacyclin, estrogens, and progesterone . Not only an increase in the plasma volume (+ 50%), but also a compensatory sympathetic activation with increased hr (+ 25%), stroke volume (+ 25%), and cardiac output (+ 50%) maintain hemodynamic stability . However, this compensatory sympathetic activity is blocked during neuraxial anesthesia . In cesarean section, due to a lower maternal mortality and complication rate a mid- or high - thoracic level block (t4) is necessary to comfort the patient . Therefore, the incidence of hypotension (63%) and severe bradycardia (6.7%) are much higher . Introduction of the left lateral tilting position, and a massive pre - hydration before neuraxial anesthesia (10 - 20 ml / kg of crystalloid solution or 250 - 500 ml of colloid solution) have reduced the incidence of hypotension and cardiac arrest during a cesarean section . The patient's block level was t3; in this block level, the sympathetic vasomotor tone, arising from t5 to l1, is completely blocked, while the sympathetic cardiac accelerator fibers that are arising from t1-t4 are only partially blocked . When the patient showed nausea and mild hypotension after a spinal anesthesia, judging from the hr, we administrated crystalloid and phenylephrine . It was effective, and she showed stable vital signs, until the beginning of placental expulsion . However, similar to that of the previous reports, this case showed an abrupt onset of severe sinus bradycardia, and cardiac arrest in a patient who was hemodynamically stable, well oxygenated, and comfortable . We suggest an inversion and traction of the uterus, during the placental expulsion, as the triggers of catastrophic vasovagal response . A transient uterine inversion occurred during the placental expulsion, and immediately after that, cardiac arrest occurred . There are some case reports of hemodynamic instability, during the placental expulsion, due to an inversion or traction of the uterus . During a uterine manipulation, stretching of the peritoneal and broad ligaments around the uterus can result in a secondary stretching of infundibulopelvic ligaments; which then can cause vasovagal reflex via the afferent nerve stimulation . In these cases, patient's hemodynamic status improved dramatically, immediately after the reposition of the uterus, which suggests a vasovagal response . Our patient's cardiovascular system could not compensate for this vasovagal response, potentiated by a high neuraxial anesthesia with impaired reflex tachycardia and vasoconstriction in blocked segment; eventually leading to a cardiac arrest . Acute hemorrhage, during placental expulsion, may have played a role in vasovagal response, which decreased the venous return . However, it does not seem to be the main cause of vasovagal cardiac arrest . The total estimated blood loss of this case was about 500 ml; which is less than the average blood loss during a cesarean section . Anxiety and fear make the management of a patient difficult, and can cause vasovagal response . On the other hand, due to the risk of maternal desaturation, neonatal sedation and respiratory problem, our hospital provides intraoperative sedation, after the confirmation of an uneventful childbirth and placental expulsion . Alert patients can give us important information by complaining their symptoms that cannot be obtained by monitoring vital signs . Also, alert patients can experience and remember the moment of childbirth and the first contact between mother and baby . In this case, the patient did not let out her feelings through the operation; she did not seem to be anxious, nervous or restless . However, cesarean section in an unfamiliar environment would have put an extremely heavy burden on the patient, and childbirth may cause huge emotional change . After childbirth, she smiled at her baby being examined by the nurses, and consequently, began to tear . Anxiety and emotional change may have played an important role in triggering or exaggerating a vasovagal response . Aggressive treatments, during cpr, including intravenous administration of epinephrine, rapid hydration and trendelenburg position, were effective in this case, and no postoperative complications were observed . Similar rapid recovery and relatively satisfactory outcomes were reported in the previous cases of vasovagal cardiac arrest . Their treatment included early recognition, chest compression, manual ventilation with 100% oxygen, rapid hydration, and administration of atropine, ephedrine, phenylephrine and epinephrine . Firstly, a careful history taking regarding fainting or syncope, and proper preoperative evaluations, such as head - up tilt test would have reduced the risk of unprepared vasovagal reaction . Secondly, a careful and slow induction of epidural anesthesia would have reduced the risk of high neuraxial anesthesia . Thirdly, maintenance of adequate preload with sufficient hydration, before neuraxial anesthesia, and placental expulsion would have prevented sudden decrease in the venous return . Fourthly, intravenous administration of ephedrine, rather than phenylephrine, after neuraxial anesthesia induced hypotension would have prevented severe reflex bradycardia, by stimulating both alpha- and beta - adrenergic receptor systems . Finally, appropriate intraoperative sedation would have reduced the anxiety of the patient, and possibility of a vasovagal response . Vasovagal response is just a reflex, making it difficult to predict; hence, hard to prevent . The hemodynamic collapse during a severe vasovagal response takes place in an instant; in the present case, asystole occurred in less than 5 - 10 seconds . Without constant and careful attention, and appropriate preparation, early recognition and treatment are unlikely to be achieved . Fortunately, we continuously monitored the patient's invasive arterial pressure in preparation for ventricular arrhythmias, so that immediate assessment and treatment were possible . However, monitoring of an invasive arterial pressure is not indicated for routine cesarean section, and pain and/or anxiety, during arterial cannulation, can trigger the vasovagal response . Thus, the risks and benefits of invasive pressure monitoring should be considered, carefully, before making any clinical decision, based on the individual patient's condition and characteristics of previous vasovagal episodes . In conclusion, we described a patient with severe vasovagal cardiac arrest, during the spinal anesthesia for cesarean section . In korea, this is the first case report of vasovagal cardiac arrest, during a spinal anesthesia for cesarean section . This case illustrates a serious potential risk of vasovagal response superimposed on neuraxial anesthesia, during a cesarean section . Vasovagal response should be suspected, among the many potential causes of cardiac arrest during a cesarean section, especially when cardiac arrest occurs during placental expulsion . Careful history taking and preoperative evaluation, appropriate preload management, early recognition of vasovagal response by vigilant monitoring, and prompt treatment of hemodynamic collapse, were important lessons we have learned in this case.
In 1908, george coats described an ocular entity characterized by unilateral retinal vascular abnormalities and retinal exudation usually in boys . Coats disease is associated with excessive production of yellowish intraretinal and subretinal exudates and can cause retinal detachment and severe visual loss . Proposed the most recent classification with the following stages: stage 1, telangiectasia only; stage 2, telangiectasia and exudation (2a, extrafoveal exudation; 2b, foveal exudation); stage 3, exudative retinal detachment (3a, subtotal; 3b, total); stage 4, total detachment and secondary glaucoma; and stage 5, advanced end - stage disease . Multiple modalities have been employed to treat coats disease, including diathermy, laser photocoagulation, cryotherapy, subretinal fluid drainage, scleral buckling surgery, pars plana vitrectomy, and intravitreal anti - vascular endothelial growth factor (vegf) therapy [68]. First reported selective photocoagulation and young coats patients responded quickly to laser treatment . In advanced cases with serous retinal detachment, laser photocoagulation may not be able to reach the vessels, leading to persistence of subretinal fluid and necessitating multiple courses of treatment . Eyes with advanced coats disease and total retinal detachment may require pars plana vitrectomy with internal or external drainage of subretinal fluid, laser photocoagulation, and silicone oil tamponade . The purpose of this retrospective study was to assess the effectiveness of endolaser photocoagulation by a two - port pars plana nonvitrectomy approach for treating coats disease with moderate - to - severe serous retinal detachment . Medical records of 24 patients (25 eyes) with stage 3 coats disease diagnosed from december 2012 to may 2014 at a single center were reviewed . All of them presented with serous or total retinal detachment that could not be reached by regular laser photocoagulation and thus undertook minimally invasive operations of endolaser photocoagulation . Some cases were treated combined with drainage of the subretinal fluid, intravitreal triamcinolone injection or anti - vegf injection . Clinical information, including birth history, age, gender, family history, medical history, and systemic and other ocular anomalies, was assessed . All patients routinely underwent indirect ophthalmoscopy . Wide - angle retina photography (retcam; clarity medical systems, pleasanton, ca, usa) was performed in patients younger than 5 years and fundus photography (optos 200tx; optos, dunfermline, scotland, uk) was performed in older cooperative patients . Two 23- or 25-gauge incisions were made 3 mm posterior to the corneal limbus and the retina was examined . The surgical procedure commenced with the examine of the retinal vessels, followed by laser directly on the entire network of telangiectatic vessels and the injection of viscoelastics afterwards to minimize vitreous traction at the side ports (figs . 1 and 2). Telangiectasias were ablated with a 532-nm green endolaser; the power was adjusted according to the retinal reaction to laser spots . 1illustration of the surgical procedure of a 4-year - old boy with stage 3a coats disease (os). 2drainage of subretinal fluid of a 2-year - old boy with stage 3b coats disease (os) illustration of the surgical procedure of a 4-year - old boy with stage 3a coats disease (os). Bottom right anti - vascular endothelial growth factor (vegf) injection drainage of subretinal fluid of a 2-year - old boy with stage 3b coats disease (os) additional treatments such as intravitreal triamcinolone or anti - vegf injection and further surgery were performed based on findings of fundus fluorescein angiography, conditions during endolaser photocoagulation, and postoperative outcomes . Therapeutic effects were determined according to the patients visual acuity, intraocular pressure, fundus and abnormal vascular changes . All the patients were born at full term or late preterm, with a birth weight above 2,500 g. none had a related family history . The study population comprised 23 boys (95.83%) and one girl (4.17%); patient age ranged from 2 to 17 years (mean, 6.21 years). Patients were divided into three groups according to the severity of the disease and previous treatment regimens and the data are presented in table 1.table 1patient informationgrouppatienteyegenderage at presentation (years)follow - up duration (months)a1osm3182odm2163odm8144odm17145oum3156osm1177osm568odm549odm31b1osm13182osm9173odm5164osm9165odm2146osm3127odm648osm549odm9310odm6311odm92c1osm4202oum3153osm2114odm445osf63 group a (nine eyes) received laser photocoagulation and/or cryopexy before, however, the treatment above could not stop the vascular abnormalities, thus these patients received the endolaser . Group b (11 eyes) was initiated with endolaser treatment regimen due to the presence of serous retinal detachment . Patients in group c (five eyes) were in stage 3b, received external drainage of subretinal fluid plus non - vitrectomized vitrectomy . Additionally, triamcinolone and anti - vegf were injected according to the condition of abnormal vessels . Visual acuity, intraocular pressure, eye position, slit - lamp microscope, indirect ophthalmoscope, and color fundus imaging were followed up (average, 10.08 months, range, 120 months). At the end of the follow - up period, 24 (96%) eyes had the retina reattached, telangiectasias were resolved, and no severe complications occurred . In groups regular laser therapy under indirect ophthalmoscopy was barely effective on the abnormal vessels with exudative retinal detachment and serous retinal detachment and endolaser could shorten the period of recovery . The average sessions to full treatment of active telangiectasia and retinal reattachment was 4 months (range, 110 months); only one (4.17%) eye progressed to retinal detachment due to lack of follow - up . Each eye received 15 sessions of treatments (average, 1.96 times) (table 2). Increased intraocular pressure in one (4.17%) eye after surgery was controlled with eye drops.table 2patient treatmentsgrouppatientrange of exudation (quadrant)treatments (sessions)a122242332434544621743821923b14122133144154164274184192210411141c142245343442542 seven and 17 eyes required subsequent intravitreal triamcinolone and anti - vegf injections, respectively . These injections were not associated with endophthalmitis or systemically observed complications . Among the 17 patients who would cooperate with visual examination, five (29.41%) had improved visual acuity at the end of the treatment session . Because of recurrence of miliary aneurysms, two (22.22%) eyes in group a and two (18.18%) eyes in group b had consecutive regular laser ablation at 1 to 6 months (average, 2.25 months) afterward the endolaser treatment . Most exudation was absorbed with a flat retina until the last follow - up (fig . The five patients in group c who presented with total retinal detachment, undertook drainage of the subretinal fluid combined with anti - vegf injection, received two - port endolaser ablation and regular laser or other treatments afterwards (fig . 4). Among them, one eye developed fibrosis in the peripheral retina 4 months after endolaser treatment, so three - port pars plana vitrectomy was performed and the retina finally reattached after three sessions without obvious telangiectasia and the exudation absorption . 3fundus views of a 2-year - old boy with stage 3a coats disease (od). 4fundus views of a 3-year - old boy with stage 3b coats disease (od). Bottom right view at 2 months after supplementary laser fundus views of a 2-year - old boy with stage 3a coats disease (od). Right postoperative view at 13 months fundus views of a 3-year - old boy with stage 3b coats disease (od). The overall aims of treatment in mild disease are ablation of abnormal retinal vasculature, preservation of vision, and prevention of retinal detachment . In advanced cases,, we performed the two - port endolaser with the help with noncontact wide - angle viewing system and fluorescein fundus angiography to guarantee the treatment . Schefler et al . Showed that 50% of the patients with coats disease can retain useful vision with aggressive repetitive diode laser therapy even if the disease is advanced at presentation . The difference in outcomes can be explained by the disease severity: the present study included patients with stage 3 coats disease with local or total exudative retinal detachment . According to our experience, this stage is considered less responsive to laser therapy under indirect ophthalmoscopy and the prognosis is worse than those of stages 1 and 2 . Further, exudation in the macular area took longer to absorb than peripheral retinal exudation and vision of eyes with macular exudation was not satisfactory in the study . In this study kranias and krebs reported successful management of advanced coats disease with pars plana vitrectomy and air fluid exchange . Susskind et al . Used ppv, including a modified technique of exocryotherapy applied after fluid air exchange to reduce associated side effects and improve the rehabilitation process of advanced coats disease patients . In the present study, stage 3b coats disease was treated by subretinal fluid drainage, endolaser photocoagulation, and anti - vegf injection . Cryotherapy and silicone oil tamponade was not performed to avoid the damage to the eyeball and the need for secondary surgeries . In two cases, endolaser photocoagulation the other patients underwent the procedure 1 week after drainage . To our knowledge, this is the first time the two - port pars plana nonvitrectomy approach for treating coats disease has been reported in the literature . First, it resolves the problem associated with laser ablation in eyes with serous retinal detachment where telangiectasias cannot be reached by regular laser ablation . We applied a laser directly to telangiectasia within the retina without targeting the rpe to create thermal injury . Second, it is non - vitrectomized and is much less invasive than three - port pars plana vitrectomy . Third, when combined with peripheral retinal examination, the procedure could be more thorough and efficient, so the number of treatment sessions could be reduced . To minimize vitreous traction at the side ports, injection of viscoelastics was performed afterwards and turned out to be an effective measure . Reported that carefully selected treatment can anatomically stabilize eyes or improve coats disease in 76% of the cases . The present treatment yielded better results: 96% of the eyes showed retinal reattachment and no active telangiectasias . Bevacizumab and ranibizumab should be used cautiously in patients with coats disease to avoid vitreoretinal fibrosis and tractional retinal detachment . A taiwanese study showed that cryotherapy combined with intravitreal bevacizumab injection in severe cases of exudative retinal detachment carries the risk of vitreoretinal fibrosis and tractional retinal detachment . In the present study, only one eye developed vitreoretinal fibrosis 4 months after anti - vegf injection, which was in group c and the fibrosis might be connected with the serious disease or the treatments received . Extended serial follow - up is important to evaluate the safety of this treatment and usage of anti - vegf injection . Endolaser photocoagulation by two - port pars plana nonvitrectomy is a safe and effective approach in treating advanced coats disease with serous retinal detachment this research was supported by the national natural science foundation project of china (81070760, 81271045). All authors certify that they have no financial interests (such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this manuscript.
Historically, presence of heterotopic gastric mucosa in the intestinal tract has never aroused particular interest among clinicians . Apart from its occurrence in the meckel s diverticulum, the condition is regarded as clinically insignificant . Gastric metaplasia in the duodenum has been described by several authors, however, the significance of its occurrence remains unknown . Extensive use of gastroduodenal fibroscopy enabled the authors to obtain biopsies of the duodenal mucosa . This paper will describe the incidence of gastric metaplasia in duodenum in various gastroduodenal diseases and discuss the pathogenetic role of gastric metaplasia in peptic ulcer . The authors obtained two or three pieces of random biopsy specimens from apparently normal mucosa in the anterior wall of duodenal bulb using gastroduodenal fiberscope on 65 subjects . All biopsies were immediately fixed in 10% formalin solution, embedded in paraffin, and 5 mm thick sections were stained with haematoxylin and eosine and pas, as described by mark and drysdale for sharp distinction of gastric metaplasia . The authors attempted to locate the fundic gland in all specimens but failed . Consequently, the possibility of gastric heterotopia was excluded . The surface epithelium of gastric mucosa stained strongly with pas reaction contrasting sharply against the duodenal epithelium, where only goblet cells and the brush border disclosed a positive reaction (fig . Duodenal ulcer and prepyloric ulcers are grouped together since they have the same pathogenetic mechanism as proposed by johnson . The gastric ulcer group consisted solely of patients with ulcers located at the body, angle, or proximal antrum: two of the subjects in this group were additionally diagnosed with duodenitis . The incidence of gastric metaplasia according to its underlying diseases gastric metaplasia was not observed in normal subjects with exception to one (5.2%). In patients with duodenal and/or prepyloric ulcer (s), its incidence was 72.2%, which was higher than in normal controls (5.2%) and those with gastric ulcer (36.4%), nevertheless the difference lacked statistical significance (p<.25). Three of 7 patients with duodenitis (42.8%), and one of 8 patients with gastric erosions (12.5%), had gastric metaplasia . The incidence of gastric metaplasia in the patients with gastic ulcer seemed to be varied according to the location of ulcer . Although the number of cases was too low to evaluate it more thoroughly, the incidence of metaplasia was higher (66.7%) in the patients with ulcers located in lower portion of the stomach (prepyloric and pyloric) than ulcers located in lower portion of the stomach (prepyloric and pyloric) than ulcers located in upper portion of the stomach (57.1% in those with ulcers located in angle and proximal antrum: 0% in those with body ulcer). The gastric mucosa in the duodenum can be classified into congenital heterotopic gastric mucosa and acquired gastric metaplasia as shown in table 3 . Until now, many authors have made the mistake of combining metaplasia and true heterotopic gastric mucosa . Since taylor reported earlier (in 1927) two cases of gastric heterotopia in the duodenum, many authors described heterotopic gastric mucosa in duodenum as slightly raised patches consisting of chief cells and parietal cells . As true gastric heterotopia is frequently seen in meckel s diverticulum, and occasionally in rectum and small intestine, it is usually regarded as congenital in origin . The gastric metaplasia, a term which was first suggested by lessels, is an incomplete form of gastric heterotopia, and is composed of foveolar and pyloric gland: it can be identified only with microscopy . The incidence of true gastric heterotopia is suggested to be present in approximately 2% of the population . However, microscopic gastric metaplasia is far more frequently seen than true heterotopia and it is especially common in duodenal ulcer patients . The incidence of gastric metaplasia in duodenal ulcer patients was reported to be 51.9% by johansen, 74.3% by urakami and 72.2% by these authors series, which was quite similar to previous reports . It is unknown whether the gastric metaplasia has a protective role or a harmful effect in the formation of duodenal ulcer . The presence of gastric epithelium in the duodenum could indicate a simple protective response to excessive acid secretion . Urakami reported that the gastric metaplasia is less frequent in the active stage of duodenal ulcer, and its incidence increases in the ulcer s healing stage . Jochi found that gastric metaplasia was frequently seen in the margin of the ulcer and appeared to occur with the healing process of the ulcer . Suzuki divided the gastric metaplasia into three types: foveolar cell metaplasia, parietal cell metaplasia, fully developed fundic gland metaplasia: he reported that each incidence had been 79.2%, 10.4% . And this study was intended only to reveal the incidence of gastric metaplasia in various gastroduodenal disease patients . The study could be expanded to clarify possible relations between acid secretion, stage of peptic ulcer, and stomach cancer.
Pure gonadal dysgenesis is a condition with a normal set of chromosomes, that is, 46xx or 46xy, and the latter is better known as swyer syndrome, named after doctor swyer, who first described the anomaly in 1955 . The condition is usually diagnosed in early adolescence during the workup for the chief complaint of primary amenorrhea . The incidence of swyer syndrome is 1 in 100,000, whereas its combination with gonadoblastoma is rarer and reported to be present in 5% of the cases . In this report, we present a rare case of swyer syndrome with germ cell tumor, wherein the emphasis is on both the clinical and the radiological manifestations, which shall prove to be useful for a clinician and an imaging specialist . The case also describes the importance of the early management of such types of embryological abnormalities for evasion of the malignant differentiation of the streak gonads . A 36-year - old, married female presented with the complaints of primary amenorrhea, pelvic pain, and a feeling of lump on the right side of the lower abdomen for the last 2 months . The patient s height was 164 cm, weight was 60 kg, and no clinical stigmata of turner syndrome were identified . The background knowledge of the patient revealed that she had no uterus (based on the previous workup by a local clinician). The clinical examination showed the female phenotype with relatively underdeveloped breasts (tanner stage iii), sparse pubic hair, and normal external female genitalia . The per vaginal examination showed a red and dry vagina with a feeling of lump in the right adnexal region . Pelvic ultrasound (us) was performed, wherein a solid mass was seen in the right adnexa [figure 1] with the nonvisualized uterus and the ovaries . The patient was convinced for pelvic magnetic resonance imaging (mri), which revealed a hypoplastic uterus with a solid right adnexal mass [figure 1]. Luteinizing hormone (lh) and follicle stimulating hormone (fsh) were high (300 and 150 miu / ml, respectively) with low levels of serum estradiol (10 pg / ml). Further evaluation was performed with karyotyping and serum testosterone levels, which revealed 46xy pattern genotype [figure 2] and low serum testosterone levels (0.45 ng / dl). (b, c) axial t1w and t2w mri showing a large isointense - to - hypointense mass (white asterisk) in the right lower abdomen and the adnexal region compressing the urinary bladder (black asterisk). (d) sagittal t2w mri showing a small hypoplastic uterine tissue / mullerian remnant (black arrow) behind the urinary bladder (black asterisk) karyotyping of the patient shows normal male genotype (46xy) hypergonadotropic hypogonadism with 46xy karyotype associated with the hypoplastic uterus confirmed the diagnosis of swyer syndrome with pelvic mass likely to be germ cell tumor . Tumor markers such as serum beta human chorionic gonadotropin, lactate dehydrogenase, alpha feto - protein, and ca-125 were within normal limits . Exploratory laparotomy was performed, and the right - sided tumor and the left - sided streak gonad were extirpated with peritoneal wash cytology . Histopathological analysis showed the right - sided gonadoblastoma and the left - sided streak gonad of ovarian origin [figure 3]. Complex neoplasm composed of a mixture of large primordial germ cells, immature sertoli cells, and gonadal stroma (black arrow). (b) the streak gonad showing the loss of gonadal stroma (black arrow) with paucity of the germ cells swyer syndrome is 46xy type of the pure gonadal dysgenesis manifesting as primary amenorrhea with female phenotype . Mutation in the sry gene (the sex - determining region of the y chromosome) is noted in 1015% of the cases, whereas the rest are unexplained . Despite the presence of the y chromosome, there is underexpression of the antimullerian hormone (amh) and the androgenic hormones due to the dysgenetic gonads, leading to female type of internal and external genitalia . The syndrome also manifests with poorly developed secondary sexual characteristics in the form of sparse pubic hair and underdeveloped breasts . The hormonal parameters are indicative of hypergonadotropism (increased lh and fsh) with normal or low testosterone levels as present in our report . Primary amenorrhea with female phenotype can be approached in a systematic manner with a clinical- and imaging - based algorithm [figure 4]. After excluding pregnancy stage and other hormonal causes of primary amenorrhea such as hyperprolactinemia and hyperthyroidism, the diagnostic possibilities should be narrowed down to the congenital causes of the outflow tract obstruction (the imperforate hymen and the transvaginal septum) and primary ovarian insufficiency . Serum levels of luteinizing hormone (lh), follicle stimulating hormone (fsh), thyroid stimulating hormone (tsh), and prolactin . Red stars denote the case under study the major causes of primary amenorrhea due to congenital or structural causes of ovarian insufficiency with female phenotype can be enumerated as turner syndrome, mayer rokitansky kuster hauser (mrkh) syndrome, and androgen insensitivity syndrome (ais), with the rarest being the swyer syndrome . The most common among them is the turner syndrome, which also shows elevated fsh and lh; however, the clinical features of short stature, webbed neck, and 45xo karyotype are diagnostic features and thus excluded in this patient s profile . The other two major causes, that is, mrkh syndrome and ais, can be excluded based on the us and mri findings of the hypoplastic uterus, which is not present in both the syndromes . Individuals with mrkh syndrome exhibit normal, symmetrical breast and pubic hair development, with no visible vagina and sometimes rudimentary uteri with nonfunctional endometrium . The majority of the patients have normal ovaries and a karyotype of 46xx contrary to our case . Ais shows the male karyotype similar to the swyer syndrome, that is, 46xy; however, the levels of amh and testosterone are modestly elevated, whereas they are reduced in the swyer syndrome . Gonadal dysgenesis with the y chromosome is found to be associated with the occurrence of the germ cell tumors with a reported incidence of 1030% . The most prevalent tumors associated with swyer syndrome are the gonadoblastoma, dysgerminoma, and sometimes seminoma . A total of 510% of the cases of turner syndrome are also associated with gonadoblastoma . The risk of the tumor development increases with age; it is reported that the risk is 5070% in the third decade of life while being as high as 80% in the fourth decade of life . Hence, the laparoscopic extirpation of the gonads at an early stage in the cases of primary amenorrhea and y chromosome is of prime consideration . The early cases of gonadoblastoma are surgically removed as was performed in the present case; however, chemotherapy / radiotherapy is required for the metastatic tumors, which are reported in 10% of the cases . In this case report, a rare combination of a case with its complication is evaluated, highlighting the importance of early removal of the gonads . The role of clinical assessment and imaging (us and mri) is of utmost importance in narrowing down the diagnosis, to delineate the internal genital anatomy, and to correlate the biochemical as well as the genetic markers . Algorithm - based assessment of a case of primary amenorrhea should be performed to reach a confident diagnosis.
There have been a number of internal fixation procedures used for instability of the cervical spine . Recently, developed posterior fixation procedures have been performed in the cervical spine by using a lateral mass screw or a pedicle screw . Both of these procedures, which do not require that the lamina be used for stabilization, are useful in patients undergoing one - stage posterior decompression and stabilization of the cervical spine . Lateral mass plating has become the technique of choice for posterior cervical fixation for a long time and effective surgical technique . Although these systems are safe and reliable, they can be difficult to use in patients with cervical spondylotic myelopathy; lateral screw placement can be compromised by the fixed hole spacing of the plate; screw back - out and other forms of implant failure can occur; and late kyphosis may occur in osteoporotic spine . There is superior biomechanical stability with cervical pedicular fixation (cpf) compared to use of lateral mass screws. [13] during the last decade, cpf has been used in the treatment of degenerative disorders, as well as in trauma surgery . Since 1994 based on current experimental and clinical studies[59] computer - assisted surgery systems are suggested to be the safest procedures for cpf. [1014] appealing clinical results were achieved with cpf . However, in laboratory studies pedicle perforation could not be completely prevented with any technique. [781618] some authors have been more critical of this technique(cpf) with used to stereotactic or computed tomographic (ct) guidance . Many surgical procedures may be performed for cervical spondylotic myelopathy or ossification of the posterior longitudinal ligament, and associated with a high incidence of neurologic morbidity, construct failure, and pseudoarthrosis in lateral mass screw placement. [1618] we theorized that laminectomy and stabilization of the cervical spine with cpf would obviate the advantages in osteoporotic cervical spine decompression, prevent the development of kyphotic deformity . The purpose of this study is to evaluate the feasibility and accuracy using of fluoroscopy cpf in a standardized clinical protocol for patients with spinal spondylotic myelopathy treated by laminectomies . We performed a total of 70 posterior cpfs in 10 cases in a clinical study held in our clinic between 2006 and 2009 . Two of these were at the c5c6 segments, while the other 4 were at the c4c5 segments . Five of the degenerative cases had cervical spondylotic myelopathy in all cervical levels (c3c7). The most common indications of cervical pedicle screw fixation was both osteoporosis and cervical kyphosis the exclusion criteria was transverse foramen stenosis . All the cases were monitored for anterior additional pathologies in the preoperative evaluation by magnetic resonance imaging (mri). Detailed pedicle length and diameters, and frontal, sagittal, and longitudinal angles of all pedicles were calculated prior to the operations with 3d ct . Grade i: screw centered in the pedicle causing only minor plastic deformation of the pedicle cortex at most . Grade iia: screw threads or less than one - fourth of the screw cross section penetrating the cortex; no contact of the screw with the spinal cord, nerve root, or vertebral artery . Grade iib: more than one - fourth of the screw cross section penetrating the cortex but no contact with neurovascular structures . Grade iii: screw position according to grade ii, however, in contact with neurovascular structures . A case of a 64-year - old man who underwent right nephrectomy 5 years ago due to renal clear cell carcinoma . Both ct and mri showed marked spinal stenosis due to degenerative spondyloarthropathy [figures 2 and 3]. The portion projecting into the posterior decompression was performed in the prone position, and fusion technique with the graft obtained from the iliac wing was performed after c3c6 [figure 4]. Postoperative ct showed correct position transpedicular insertion in the cervical pedicle spine [figure 5]. The patient's vas score was 3, and nurick scale was 1 at the 20-month follow - up . Cervical plain lateral (a) and anterior posterior radiography images (b) demonstrating degenerative cervical spine preoperative sagittal ct scan showing spondylotic degenerative changes both spondylolisthesis and stenosis at the level of cervical spine preoperative sagittal (a) and axial (b) mri showing spondylotic degenerative changes stenosis at the level of cervical spine intraoperative appearance demonstrating at the final fixation, showing autologous iliac graft and well - maintained cervical decompression postoperative lateral (a) and axial ct (b) scan showing total laminectomies with transpedicular screw / rod system; (c) postoperative ct scan demonstrating accurate pedicle screw placement in c7 bilaterally the head is fixed in natural prone position . Only the facet joint surfaces to be operated are decorticated to thoroughly clean up the capsule . The dominant vertebral arteries of all patients were detected at the preoperative stage, and screw fixation was applied at the nondominant side of the same level . Following nonproblematic insertion of the first screw, in other words after seeing that there is no rupture, the screw of the dominant side was placed . This process is applied before the screw is placed, in the cases to go through laminectomy . This way, the position of the screw inside the spinal canal can be observed . The entry point of the pedicles between c3 and c7 is 2 mm lateral to the superior articular process midpoint . In the sagittal plane, it is angled nearly 10 at c3, whereas it is kept neutral or angled 2 at c7 . The medial orientation angle of the pedicle, on the other hand, is 45 on average . After biplanar control of the position of the deformity and the screws with scopy image, bone grafts obtained from the iliac wing are placed at the decorticated areas . Grade i: screw centered in the pedicle causing only minor plastic deformation of the pedicle cortex at most . Grade iia: screw threads or less than one - fourth of the screw cross section penetrating the cortex; no contact of the screw with the spinal cord, nerve root, or vertebral artery . Grade iib: more than one - fourth of the screw cross section penetrating the cortex but no contact with neurovascular structures . Grade iii: screw position according to grade ii, however, in contact with neurovascular structures . A case of a 64-year - old man who underwent right nephrectomy 5 years ago due to renal clear cell carcinoma . Both ct and mri showed marked spinal stenosis due to degenerative spondyloarthropathy [figures 2 and 3]. The portion projecting into the posterior decompression was performed in the prone position, and fusion technique with the graft obtained from the iliac wing was performed after c3c6 [figure 4]. Postoperative ct showed correct position transpedicular insertion in the cervical pedicle spine [figure 5]. The patient's vas score was 3, and nurick scale was 1 at the 20-month follow - up . Cervical plain lateral (a) and anterior posterior radiography images (b) demonstrating degenerative cervical spine preoperative sagittal ct scan showing spondylotic degenerative changes both spondylolisthesis and stenosis at the level of cervical spine preoperative sagittal (a) and axial (b) mri showing spondylotic degenerative changes stenosis at the level of cervical spine intraoperative appearance demonstrating at the final fixation, showing autologous iliac graft and well - maintained cervical decompression postoperative lateral (a) and axial ct (b) scan showing total laminectomies with transpedicular screw / rod system; (c) postoperative ct scan demonstrating accurate pedicle screw placement in c7 bilaterally only the facet joint surfaces to be operated are decorticated to thoroughly clean up the capsule . The dominant vertebral arteries of all patients were detected at the preoperative stage, and screw fixation was applied at the nondominant side of the same level . Following nonproblematic insertion of the first screw, in other words after seeing that there is no rupture, the screw of the dominant side was placed . This process is applied before the screw is placed, in the cases to go through laminectomy . This way, the position of the screw inside the spinal canal can be observed . The entry point of the pedicles between c3 and c7 is 2 mm lateral to the superior articular process midpoint . In the sagittal plane, it is angled nearly 10 at c3, whereas it is kept neutral or angled 2 at c7 . The medial orientation angle of the pedicle, on the other hand, is 45 on average . After biplanar control of the position of the deformity and the screws with scopy image, bone grafts obtained from the iliac wing are placed at the decorticated areas . As a result of 70 pedicles applications on a total of 10 patients, the pedicle screws were at their correct positions 100% of the time . The screws were of length 31.4 mm for c3c7, and overall thickness was measured to be 3.0 mm . Two patients had screw malposition, which did not require reoperation due to minor breaking . The cases were followed - up for an average of 35.7 months (3037 months). Preoperatively, we obtained imaging studies in all patients by using plain cervical roentgenography, biplanar ct scanning through bone windows, and mri . Usg was preoperatively performed in all patients to determine the side of the dominant vertebral artery . Bilateral oblique plain x - ray films were routinely obtained to evaluate the condition and size of pedicles of each vertebra . The placement of pedicle screws were inspected on postoperative ct scans (in general, 2 mm slices) within the first day of surgery, at later follow - up visits, stability was assessed on flexion extension radiographs and standard lateral and posterior anterior views . The follow - up imaging studies were carefully interpreted to identify screw and rod loosening or breakage . Preoperatively and postoperatively, kyphotic deformity at the affected segment, which averaged to 23 (1643), was revealed in 9 patients, which was corrected to 1.2 lordosis after surgery and 0.8 lordosis at the final follow - up examination . Controls were performed by x - ray imaging as a standard application, and tomography for postoperative pedicle - screw harmony . The cases were followed - up for an average of 35.7 months (3037 months). Preoperatively, we obtained imaging studies in all patients by using plain cervical roentgenography, biplanar ct scanning through bone windows, and mri . Usg was preoperatively performed in all patients to determine the side of the dominant vertebral artery . Bilateral oblique plain x - ray films were routinely obtained to evaluate the condition and size of pedicles of each vertebra . The placement of pedicle screws were inspected on postoperative ct scans (in general, 2 mm slices) within the first day of surgery, at later follow - up visits, stability was assessed on flexion extension radiographs and standard lateral and posterior anterior views . The follow - up imaging studies were carefully interpreted to identify screw and rod loosening or breakage . Preoperatively and postoperatively, kyphotic deformity at the affected segment, which averaged to 23 (1643), was revealed in 9 patients, which was corrected to 1.2 lordosis after surgery and 0.8 lordosis at the final follow - up examination . Controls were performed by x - ray imaging as a standard application, and tomography for postoperative pedicle - screw harmony . The cases were followed - up for an average of 35.7 months (3037 months). The various posterior fixation techniques, spinous process wiring, triple - wire technique, and sublaminar wiring require use of the lamina as the stabilizing anchor . These techniques allow simultaneous posterior decompression with fixation and stabilization in patients who have undergone previous laminectomy in the cervical spine however, postoperative rigid external support using a halo vest was required for many patients . Modifications of cervical facet fusion, which is supplemented by rods as longitudinal connectors, may provide some stabilizing effect but stability is not sufficient enough to preclude the need for postoperative external support . Biomechanical studies have revealed that posterior fixation devices have an advantage over anterior devices for the fixation of posterior instability after laminectomy anterior surgical approaches did not provide sufficient correction of postlaminectomy kyphosis in the cervical spine . Kotani et al ., have shown that of all the fixation devices only the pedicle screw system provide adequate stability in a three - column injury model . Joner et al . Have provided evidence of greater resistance of pullout of pedicle screws compared with lateral mass screws . In addition, cervical lordosis reconstructed with pedicle screw fixation systems may provide adequate stability, because lordotic spinal alignment allows the gravity axis to pass through the posterior structures that are reconstructed by rigid instrumentation . Therefore, cpf may obviate the need for anterior surgery in some patients, such as those with metastatic vertebral tumor who might otherwise require a combined surgery (anterior posterior). Some of the reports on lateral mass screw procedures have described several cases of screw loosening that resulted in pseudoarthrosis and loss of kyphosis correction between 2006 and 2009. [2224] but, our findings suggest that screws inserted into the cervical pedicle provide a more rigid anchor for internal fixation than lateral mass screws, as suggested by in vitro biomechanical studies . We did nt observe any complications, such as pseudoarthrosis or loosening of the screw in our cases who had been operated with cpf . Strong fixation to the vertebra by pedicle screw enables application of distraction force to the cervical spinal segment . Therefore, cpf system can be safely used to reduce spondylotic changes in cervical spine in one - stage surgery, precluding the need for anterior decompression of the spinal canal . Shows that 45 (6.9%) of 669 screws significantly perforated the pedicle . In a comparative study of 3 different techniques for ps placement in human cadaveric cervical spines, ludwig et al . Reported a 65% rate of critical pedicle breaches with insertion based on the morphological data alone, a 40% rate of breaches with supplemental visual and tactile cues provided by minilaminotomy, and an 11% breach rate using a computer - assisted surgical guidance system . In another in vitro study, they found an incidence of ps misplacement with a critical breach of 18% using frameless stereotactic guidance, and of 12% using abumi and colleagues fluoroscopically assisted technique of probing and tapping the pedicle . Richter et al . Reported 92% accuracy using image - guided drilling of 2.5 mm holes in the c3 and c4 pedicles in human cadaveric specimens . Our results after this technique of cps insertion with an obvious cortical breach incidence of 13.5%, including a critical breaking rate of 0.9%, are somewhat similar to those of the large series (116 cervical pedicle) of rath et al . We report a 0.9% incidence of vertebral foramen penetration (100%) in a clinical series of 105 pedicles . We would think of using the intraoperative image - guided or stereotactic guidance, which may improve accuracy and significantly reduce the risk of neurovascular injury, especially in the cervical pedicle . However, the current technology is at its limits and we are not able to use these techniques . A lot of clinical series have been published in the literature about cpf, but no vascular complications of cpf have been reported however, including our series, cases with massive encroachment of the transverse foramen by screw misplacement have been described . Included 9 cases with lateral screw perforation in their study, all without vertebral artery (va) injury the va does not occupy the entire transverse foramen, and the risk of injury may not be as high as most authors fear, although devastating sequelae may result from an acute lesion to this vessel careful drilling and tapping as well as cautious screw insertion seem only to displace the va without damaging or obliterating it . Within the cervical spinal foramen, the nerve roots are located in the inferior half of the disc . This can be explained by the fact that cervical pedicles have an oval shape with a significantly greater height than width at all levels peroperational neural injury or damage is a rather rare complication of cpf placement . The incidence of nerve injury is reported only as 1%. [52831] with this technique by experienced surgeons, the incidence of neural injury was 0% in our series . Use of the cpf provides a very strong three - column stabilization but also carries vascular injury without nerve damage . This technique yielded good fusion rate without complications and can be considered as a good alternative compared to other techniques.
Congenital anomalies of the oval window are due to malformations of the second branchial arch, in which there is not a full connection between the stapes and otic capsule, thereby preventing the oval window from being formed normally.1) congenital anomalies of the oval window have been reported in 0.5 - 1.2% of children with conductive hearing loss.2) various treatments for this anomaly have been introduced: hearing aids,3,4) vestibulotomy,5) fenestration of the horizontal semicircular canal,6,7) and formation of a neo - oval window.8) also, as fisch9) reported, incudostapedotomy and malleostapedotomy have been used successfully to treat patients with congenital oval window anomalies.10) however, in patients with accompanying malformations of the ossicles or abnormal routes of the facial nerve, the hearing improvement with previous procedures has not been sufficient . In our institute, instead of incudostapedotomy, we have performed malleostapedotomy, a safe and effective procedure for patients with oval window anomalies with accompanying ossicular malformations or facial nerve abnormalities . Here, we report two cases of malleostapedotomy performed in patients with hearing loss due to congenital anomalies of the oval window . A 40-year - old male visited our outpatient clinic with right - sided hearing loss since childhood . The patient had no previous history of trauma, and showed conductive hearing loss with an air - bone gap (abg) of 50 db (60/10 db; fig . Temporal bone computed tomography (tbct) showed normal images of the malleus, but revealed atresia of the right - side oval window, with abnormal placement of the facial nerve (fig . First, ossiculoplasty using a total ossicular replacement prosthesis (torp) was performed, with no hearing improvement . The tympanic cavity was exposed through an endaural approach and the posterior wall of the external auditory canal was leveled down with a mallet and gauge to expose the stapes . During the operation, a normal structure of the malleus was noted, but the long process of the incus was short . Additionally, the stapes was missing, and the facial nerve was covering the oval window . The facial nerve was displaced towards the cephalic side using a fine swab, and a 0.6-mm window was drilled in the obstructed oval window using a 0.4-mm skeeter drill . The facial nerve was then put back in the original position . Because the malleus was placed anterior to the stapes footplate, the piston wire prosthesis was bent 20, modified to a 7-mm length, and fixed on the normal malleus (fig . Following the operation, pure tone audiometry showed improvement of the abg, from 50 to 30 db (fig . A 10-year - old male visited our outpatient clinic with bilateral hearing loss for several years . 2a), and tbct revealed bilateral atresia of the oval window, with an abnormal array of the facial nerve (fig . Explo - tympanoplasty was performed primarily on the left ear with an ossiculoplasty using a torp; there was no hearing improvement . The malleus showed normal images, but the long process of the incus was short . In addition, the stapes were missing, and the facial nerve was lying over the obstructed oval window . The facial nerve was cephalically rotated using the " facial roll " method, and a 0.6-mm window was created at the center of the stapes footplate using a 0.4-mm skeeter drill . A 7-mm - long piston wire was fixed on the malleus and tightened with piston forceps (fig . Immediately postoperatively, the patient showed no dizziness or loss of taste, but mild facial palsy, house - brackmann grade iii, was noted . By 1 month later, the facial palsy had recovered, to grade i, and the abg was reduced, from 40 db (pre - operative) to 15 db (6 month post - operative) on pure tone audiometry (fig . A 40-year - old male visited our outpatient clinic with right - sided hearing loss since childhood . The patient had no previous history of trauma, and showed conductive hearing loss with an air - bone gap (abg) of 50 db (60/10 db; fig . Temporal bone computed tomography (tbct) showed normal images of the malleus, but revealed atresia of the right - side oval window, with abnormal placement of the facial nerve (fig . First, ossiculoplasty using a total ossicular replacement prosthesis (torp) was performed, with no hearing improvement . The tympanic cavity was exposed through an endaural approach and the posterior wall of the external auditory canal was leveled down with a mallet and gauge to expose the stapes . During the operation, a normal structure of the malleus was noted, but the long process of the incus was short . Additionally, the stapes was missing, and the facial nerve was covering the oval window . The facial nerve was displaced towards the cephalic side using a fine swab, and a 0.6-mm window was drilled in the obstructed oval window using a 0.4-mm skeeter drill . The facial nerve was then put back in the original position . Because the malleus was placed anterior to the stapes footplate, the piston wire prosthesis was bent 20, modified to a 7-mm length, and fixed on the normal malleus (fig . Following the operation, pure tone audiometry showed improvement of the abg, from 50 to 30 db (fig . A 10-year - old male visited our outpatient clinic with bilateral hearing loss for several years . 2a), and tbct revealed bilateral atresia of the oval window, with an abnormal array of the facial nerve (fig . Explo - tympanoplasty was performed primarily on the left ear with an ossiculoplasty using a torp; there was no hearing improvement . The malleus showed normal images, but the long process of the incus was short . In addition, the stapes were missing, and the facial nerve was lying over the obstructed oval window . The facial nerve was cephalically rotated using the " facial roll " method, and a 0.6-mm window was created at the center of the stapes footplate using a 0.4-mm skeeter drill . A 7-mm - long piston wire was fixed on the malleus and tightened with piston forceps (fig . 2c). Immediately postoperatively, the patient showed no dizziness or loss of taste, but mild facial palsy, house - brackmann grade iii, was noted . By 1 month later, the facial palsy had recovered, to grade i, and the abg was reduced, from 40 db (pre - operative) to 15 db (6 month post - operative) on pure tone audiometry (fig . Congenital anomalies of the oval window are rare; they are found in 0.5 - 1.2% of children with conductive hearing loss.1,2) cremer classified this congenital anomaly into four groups according to the abnormal structure of the middle ear.8) type i was defined as fixation of the stapes footplate alone, and type ii with stapes footplate fixation accompanied by other ossicular anomalies . Mobile stapes footplates with anomalies of other ossicles were classified as type iii, aplasia of the oval or round window as type iva, and an anomaly with dysplasia as type ivb . Here, patient 1 had a unilateral anomaly of type iva, and patient 2 was also type iva, but bilateral . Several methods have been suggested to treat patients with congenital anomalies of the oval window and stapes . Herman used bone - anchored hearing aids in five patients with aplasia of the oval window,3) and reiber and schwaber4) proposed using bilateral hearing aids in patients with ossicular anomalies, preserving the facial nerve . Several surgical treatments, such as vestibulotomy, fenestration of the horizontal semicircular canal, and formation of a neo - oval window, were introduced subsequently . Lambert5) performed vestibulotomies in six patients with congenital anomalies of the oval window by making a hole in the oval window and reconstructing the ossicles . Yi, et al.7) reported two cases with improved hearing after perforating the horizontal semicircular canal in patients with aplasia of the stapes and the oval window . Teunissen and cremers8) reported 14 cases with aplasia of the oval window: a neo - oval window was formed in four patients, and teflon inserts were placed with successful results in two patients . De alarcon, et al.11) described 17 patients; of them, 9 of 17 showed hearing improvement after neo - oval window formation and ossiculoplasties . Finally, stapes surgery has been performed in cases of congenital anomalies of the oval window . Three patients underwent incudostapedotomies, and only one (33%) showed an abg improvement, of 20 db . The abg improved, with a 46-db difference, but in the other patient, the footplate of the stapes was obstructed and the malleus was broken . Stapedotomies, including incudostapedotomy and malleostapedotomy, are usually performed in otosclerosis patients and congenital ossicular anomaly patients . Malleostapedotomy involves connecting the malleus directly to the vestibule through the oval window, instead of connecting the incus and the stapes . This operation is used in cases where an incudostapedotomy is not possible because the malleus head or the incus is missing or fixed . It can also be used in cases that need a second operation after an ossiculoplasty or where the lenticular process is necrotized after an incudostapedotomy.12) in 90% of stapedotomy cases, the facial nerve is exposed with no problem, but in a few cases the facial nerve covers the oval window, blocking the approach to the stapes footplate . In these cases, the " facial roll " method, rolling the facial nerve gently upwards, can be used to ease the approach to the oval window . Even if the facial nerve is abutting the piston wire prosthesis, it is known to cause no facial nerve or hearing dysfunction.13) in both cases in this report, we used the facial roll method to expose the oval window; mild facial palsy was noted in the second case, but recovered fully . If attention is paid to minimizing nerve traction in this procedure, good exposure can be achieved without facial palsy . There has been no previous report in korea of the results of the malleostapedotomy technique in patients with congenital oval window anomalies and accompanying ossicular malformations and abnormal routes of the facial nerve . The follow - up period after the surgery was short in these two cases, and longer - term follow - up assessments are necessary . However, through this easy and safe surgical method, hearing improved in a short period of time . Malleostapedotomy has the potential to replace previous procedures and is safe and effective in patients with congenital oval window anomalies.
Lasers have been used in laryngeal surgeries since 1972, when strong and jako first reported the use of carbon dioxide laser (co2) in the human larynx.1 despite initial criticism, endoscopic laser treatments have achieved universal acceptance and been successfully used in endolaryngeal microsurgery (ems).2 most of the laser procedures involve either excision or tissue vaporization, depending on the interaction between the wavelength () and the chromophores of the tissue . For years, the co2 (= 10600 nm) seemed to be the preferred laser for transoral laser microsurgery due to its precise cut,3 given that it is better absorbed by water . However, there are some disadvantages of the co2 device, namely, its straight line beam delivery from surgical microscope, narrow penetration depth to tissue, difficult transportation, and increased cost . These drawbacks favored the study and application of other wavelengths in larynx, such as thulium yag (= 2000 nm), nd: yag (neodimium: yttrium - aluminum - garnet - = 1064 nm), diode (= 805 - 980 nm), pdl (pulsed dye laser - = 585 nm) and ktp (potassium titanyl phosphate - = 532 nm).3 4 the diode laser has excellent hemostatic properties as a result of high absorption by hemoglobin and particularly by oxyhemoglobin . It is also absorbed by water, but less so than the co2 laser.5 furthermore it is portable, small, relatively inexpensive, and simple to use . It also has stable power output, long lifetime, and low installation and maintenance costs.2 6 moreover, the diode laser is delivered down by a fine glass fiber that allows the surgeon to hold it in a pencil - like holder for accurate manipulation.2 the fiber guidance system tip can be angled, which allows access to areas that are difficult to handle with the co2 laser.7 as a result, the use of diode laser in ems has increased in recent years.8 nonetheless, the ideal parameters of diode laser in ems and long - term results remain unclear . Therefore, we conducted a systematic review to clarify the use of diode laser in laryngeal diseases and outcomes shown so far . A systematic search was performed in pubmed, cochrane library, ovid, web of science, and scielo databases . Airway or laryngeal surgery or vocal fold and diode laser . We considered all studies relating to human laryngeal pathologies (from superior edge of epiglottis to inferior edge of cricoid cartilage). We only included studies that provided information on patient and lesion characteristics, treatment (diode laser's parameters used in surgery at least two items described among wavelength, fiber diameter, output power, frequency, wave radiation, and contact mode), and outcomes related to the laser surgery performed . Outcomes could be cure of the initial pathology, need of complementary operation, recurrence of the lesion, or even complications or adverse / side effects . Studies were excluded if they consisted of less than two subjects or case report . Finally, studies that described the use of diode laser with non - surgical intent were excluded . We collated data from included studies using an excel (microsoft, redmond, washington) spreadsheet . Specifically, data on sample demographics and clinical characteristics, sample size, diode laser parameters used, duration of follow - up, main outcome findings, and complications were extracted from each study . Article authors were contacted directly to obtain further information in cases of incomplete reported data . We identified no randomized clinical trial and only two experimental controlled studies (not randomized) were included . Our search strategy yielded a total of 284 articles (including duplicates). By screening the titles alone, 234 articles could be excluded, as they were either review articles, obviously not relating to the use of diode laser in larynx, or clearly not eligible for inclusion (for example, studies looking at diode laser in animals). After reading the abstracts, one was removed due to its focus on endobronchial diseases . Then, the 13 eligible articles were full - text assessed, but two more were excluded due to failure to meet eligibility criteria (one that did not describe the laser parameters used at one single surgery and another that included patients with lesions outside the larynx). We manually searched reference lists for further relevant articles, but none was eligible (fig . The 11 studies selected for inclusion were published between 2003 and 2014 and originated from 5 different countries . Two studies were experimental controlled but not randomized8 9 and another one was a prospective experimental uncontrolled study.7 the other studies comprised of 8 retrospective reviews.2 3 5 6 10 11 12 13 we found no randomized controlled trial or multicenter trials . A total of 357 subjects made up the study population from the 11 included studies . The laryngeal pathologies included were suprastomal granuloma, laryngomalacia, ventricular dysphonia, vocal polyp, glottic web, papillomas, glottic carcinoma, bilateral cord palsy, subglottic cysts, subglottic stenosis, and subglottic hemangioma / lynfangioma . Abbreviations: m, months; y, years f = female m = male . Intervention included diode laser surgery performed in various combinations of parameters between wavelength, fiber diameter, output power, frequency, wave radiation and contact mode, as illustrated in table 2 . The minor fiber diameter described was 300 m and the isolated major one was 1400 m . The output power varied from 3 w to 60 w. all authors with available data opted for the direct contact of the fiber to the tissue as well as the continuous mode of energy . Length of follow - up was variable among the studies, ranging from two to 86 months . Five of 11 authors (46%) declared to have experienced no complications or side effects by the use of the diode laser . Granulation and posterior synechia were described related to treatment of vocal fold paralysis.10 tracheal posterolateral bridge synechia and laser - induced subglottic granuloma related to treatment of subglottic hemangioma / lynfangioma.5 regarding glottic cancer surgeries, no authors reported edema requiring tracheostomy . Intraoperatively, thyroid cartilage exposure was described and laser - induced fire occurred due to thermal injury of the laser on the intubation tube . Two patients developed cutaneous emphysema that resolved in one day without intervention.12 in the postoperative period, synechia and granuloma formation was reported.7 some rare side effects were infection, foul smelling halitosis (in whom relatively more extended laser surgery was performed), laryngeal stenosis,12 hemorrhage, and fistula formation.7 however, it has some limitations, such as increased cost and difficulty in the management of deep and curved areas . In addition, it has short penetration in tissues (0.10.3 mm on average), which reduces effective sealing of vessels (it coagulates vessels of calibers smaller than 0.5 mm), thus, increasing bleeding during surgery.3 4 the diode laser emits wavelengths that are absorbed predominantly by hemoglobin and melanin (near infrared spectrum). The penetration depth depends on the concentration of these chromophores and, generally, it reaches 0.31.0 mm in diode laser application, which makes it ideal for photocoagulation.4 6 14 in conformity to that, some authors advocate that the diode laser 35w allows thermal coagulation that had been unimaginable with the co2 laser.10 all of these characteristics, according to some authors, confer on diode laser a surgical precision only slightly inferior to the co2 laser one, but with a superior coagulation capability for treating laryngeal vascular lesions.5 compared with other devices, diode laser also appears to be more precise and less invasive . For instance, the cutting precision of the ndyag (1064 nm) is considerably lower, and the instrument also led to greater immediate and deferred inflammatory damage due to thermal diffusion (high penetration capacity of up to 4 mm).3 10 furthermore, the diode laser's beam, in contrast to the carbon dioxide laser, is carried by flexible optic fibers that can be coupled with telescopes permitting access to sites that are difficult to explore with other techniques, such as the subglottic region.5 recently, a co2 laser beam delivered through a flexible hollow tube has become available that delivers the beam close to the target.15 however, the use of diode laser by contact (or extremely close distance) makes it much safer than other laser sources by avoiding damage due to beam scape in an open field.5 as this review shows, the diode laser can be a useful tool for treatment of different laryngeal pathologies, such as suprastomal granuloma, laryngomalacia, ventricular dysphonia, vocal polyp, glottic web, papilloma, glottic carcinoma, bilateral cord palsy, subglottic cyst, subglottic stenosis, subglottic hemangioma and lymphangioma . In this sense, the laser parameters must be set depending on the goal (vaporization, section or coagulation) and the clinical problem . With respect to output power, diameter of fiber and wavelength, the articles selected in this review presented different arrangements for diode laser . This reveals the lack of standardization in setting the best parameters of diode laser for laryngeal surgery . Although these parameters may influence collateral tissue damage, the studies are difficult to compare, based on the following concepts of laser's physics . Power, given in watts (w), measures the rate that the laser beam transmits . Beam energy, measured in joules (j), can be found by multiplying the power (w) by exposure time (in seconds). Power density, also called irradiance or spot brightness, determines the rate at which tissue is removed at the surgical site, measured in units of watts per square centimeter (w / cm2). Fluence is a key parameter once it combines previously mentioned parameters of power density and dosage, and is measured in units of joules per square centimeter (j / cm2). It is important to understand this to provide minimal damage to tissues adjacent to the incision site, as using a higher pulse power for a shorter period of time results in less tissue damage than using lower power for a longer period of time . Tissue damage is dependent upon the tissue absorption coefficient, the wavelength of the laser, power density, and the length of time over which the energy is delivered, which is largely technique dependent.16 these data were not provided by any of the included studies . An additional property that can affect the severity of tissue damage is thermal relaxation time, the time required for tissue to lose 50% of its heat through diffusion.17 one can decrease tissue damage by allowing heated tissue to cool during a procedure . However, it could be accomplished through the use of a pulsed laser, spacing out laser impact, even for a continuous incision, that decreases thermal damage by allowing time for the tissue to cool between impacts.16 in contrast, the authors of studies included in this review opted for the continuous wave radiation, some followed by manual tissue cooling . Special attention must be given to laser surgery for the treatment of glottic cancer, once it can be more cost - effective than cold surgery when managing laryngeal tumors, as they allow briefer hospital stays and shorter wound recovery periods.18 the co2 laser surgery was presented as one of the most accepted treatment options of early glottic carcinoma due to its high local control rates, low morbidity, and good postoperative voice quality.19 however, if the surgeon has difficulty in managing laryngeal anterior commissure tumors, he or she is encouraged by some authors to avoid co2 laser microsurgery . Alternatively, the 810 nm diode laser has been recently used for the treatment of glottic tumors and may allow better exposure and resection of tumors in the anterior commissure . The first to establish long - term results for glottic cancer treatment were ferri et al, in 2008 . However, it seems that diode laser has not been well accepted worldwide for laryngeal surgery, as our review shows a gap of publications between 2008 and 2013 . According to that, we speculate that most institutions continued using the co2 laser, due to doctors' familiarity with its use, capabilities, and limitations.9 16 on the other hand, the 980 nm diode laser is a new technology, and has been reported for the treatment of early glottic tumors and vocal fold polyps since 2013.7 8 9 the main difference between these two diode laser wavelengths is their distinct absorption by the vocal fold, as the 980 nm is slightly more absorbed by water than the 810 nm one . The three studies that used the 980 nm diode laser were among those with a better design in our review . Two referred to controlled trials8 9 and the other was an uncontrolled trial.7 these studies showed good efficacy results and low rates of major complications . Concerning functional outcomes, as measured by the voice handicap index (vhi), karasu et al showed good results of 980 nm diode laser in treating vocal fold polyps.8 a comparison between diode and co2 laser could be quite useful to highlight the differences and compare the results, especially the functional ones . The ideal comparison to assess both types of lasers would involve a randomized clinical trial with these two techniques, which is nonexistent in the literature . Even though the comparison of non - controlled studies of two different techniques can involve bias, in table 4 we show some results of some authoritative works related to the use of co2 laser for larynx surgery in the literature in similar conditions to those with diode laser on our review, so that the reader can grossly compare with table 3.17 20 21 22 23 abbreviations: m, months; y, years . Regarding safety issues, five authors reported no complications or side effects by the use of the diode laser, but none of these studies was related to glottic cancer or extensive procedures . The major complications were related to more extensive surgeries and with anterior commissure involvement.7 possibly the most feared complication is the endotracheal tube airway fire, which can be catastrophic or even fatal.24 to avoid that, some authors use reinforced tubes for laser surgery6 while others described the tube being inflated using saline with methylene blue dye, so that a puncture could be immediately diagnosed.7 this review highlights the lack of good evidence for the use of diode laser in laryngeal surgery . Furthermore, it is clear that there is wide variation in how it is used around the world . The 980 nm diode laser seems to be a promising laser device, so we would expect that, as experience increases, it will be more extensively used as well as new lasers wavelengths can emerge.8 despite the heterogeneous populations, varied inclusion criteria, and retrospective designs of most the studies considered in this review, they do provide useful information to the surgeon who intends to use diode laser for transoral laser microsurgery . The evidence from recent studies suggests an improvement in diode laser technology (especially the 980 nm wavelength). Further long - term multicenter prospective research is needed, although the findings of this review suggest that diode laser is a useful tool that should be considered in laryngeal surgeries.
After filling, the absence of infection in the root canal system is a fundamental factor for the prognosis of endodontic treatment . To achieve this goal, the filling material should allow sealing of the root canal at both the tooth apex and the crown . In the constant search for an ideal material, root canal obturation has been performed with gutta - percha points and endodontic sealers, which act as an agent to bond the points to each other and to the root canal walls . Thus, the endodontic sealer should present properties that render the root canal system impermeable . Grossman9 (1958) described eleven requirements that an endodontic sealer should meet, highlighting that it should provide hermetic sealing and be insoluble in the oral fluids . A frequent concern of dentists is the possibility of exposure of the filling materials to the oral environment . Though undesirable, this clinical situation may occur and can dissolve the endodontic sealer, making the root canal obturation permeable to saliva favoring the communication between irritating agents from the oral cavity and the periradicular tissues, via the apical foramen or lateral canals . The required period of exposure to the oral environment to occur such failure has been studied in vitro using different methodologies by swanson and madison24 (1987), torabinejad, et al.26 (1990), magura, et al.17 (1991), khayat, et al.11 (1993), gish, et al.8 (1994), trope, et al.27 (1995), barrieshi, et al.3 (1997), alves, et al.1 (1998), siqueira junior, et al.21 (1999), timpawat, et al.25 (2001) and zucco30 (2001). One aspect that may influence the time required to occur communication of irritating agents between the oral cavity and the periapical tissues is the type of endodontic sealer employed for obturation . This property of different endodontic sealers has been evaluated using several methodologies by leal, et al.14 (1987), madison, et al.15 (1987), madison and wilcox16 (1988), kuga, et al.13 (1990), siqueira junior, et al.19 (1995), hakel, et al.10 (1999), de almeida, et al.5 (2000), valera, et al.28 (2000), timpawat, et al.25 (2001), zucco30 (2001), obankara, et al.4 (2002), barbosa, et al.2 (2003), genoglu, et al.7 (2003), kopper, et al.12 (2003). Yet, there are few studies in the literature evaluating the relationship between the sealing ability of endodontic sealers and the time during which the material is left in contact with the oral fluids . Siqueira junior, et al.21 (1999), timpawat, et al.25 (2001) and zucco30 (2001), employing different endodontic sealers, achieved results that allow this correlation . Most aforementioned studies were in vitro investigations, in which the experimental conditions impair reproduction of the biocharacteristics of the oral cavity . The masticatory activity, thermal cycling, oral microbiota, variations in the salivary flow and food impaction, which may occur if the root canal is left unsealed, constitute situations in the oral environment that are hardly reproduced in the laboratory . In an attempt to complement the existing literature and minimize the limitations of in vitro investigations, the present study comprised an in vivo evaluation of the sealing ability of a resin - based sealer (ah plus) and a zinc oxide - eugenol sealer (endofill) in dogs' teeth exposed to the oral environment for either 45 or 90 days, testing the hypothesis that the resin - based sealer result in lower leakage than the zinc oxide - eugenol sealer after 90 days . The present study was approved by the research ethics committee of the dental school of the university of passo fundo (cep n. 290/2004). Dogs have three lower incisors at each hemiarch (central, intermediate and lateral incisor), with only one canal each . Thus, the total study sample was 48 root canals . Initially, treatment was performed in the lower right incisors, which were left exposed to the oral environment for 90 days . Forty - five days later, the same dogs had their lower left incisors treated and these root canals were left exposed for 45 days . The two afore mentioned experimental procedures, the dogs were submitted to general anesthesia, receiving, initially, an intra - muscular injection of 15ml / kg of ketamine (francotar - virbac do brasil indstria e comrcio ltda ., roseira, brazil), 1ml / kg of xylazine hydrochloride (virbaxyl 2% - virbac do brasil indstria e comrcio ltda ., so paulo, brazil) and 0.044ml / kg of atropine sulfate (atropina 1% fraga - farmagrcola s.a . Following, the dogs received 0.9% sodium chloride (nacl) intravenously (laboratrio jp . - indstria farmacutica s.a . Anesthesia was maintained by intravenous application of 5ml / kg of ketamine and 0.33ml / kg of xylazine hydrochloride, at 30-min intervals 12 . Before onset of the clinical procedures, antisepsis of the soft tissue and teeth was performed with a gauze soaked in iodine alcohol (farmcia escola ulbra, canoas, brazil), and the lower incisors were radiographed . To access the root canal, a coronal opening was performed on the buccal side of teeth using a round diamond bur n. 1012 (metalrgica fava indstria e comrcio ltda ., francisco da rocha, brazil) at high - speed and under water cooling . Odontometry was conducted by the radiographic technique, establishing the real working length (rwl) at 1 mm short of the radiographic apex . The reference point in all cases was the incisal edge of the tooth being treated . Root canal instrumentation was performed with 1 series flexofile files (maillefer instruments sa, ballaigues, switzerland). Instrumentation initiated with the file that tightly penetrated to the rwl, finishing up using file n. 40 . Root canal irrigation was performed alternating between 1% sodium hypochlorite (farmcia escola - ulbra, canoas, brazil) and 17% trisodium edta (farmcia escola - ulbra, canoas, brazil) at ph 7.3, using 1.8 ml of solution per change of instrument . The irrigation procedure always initiated and finished using 1% sodium hypochlorite solution 22 . Finishing the chemical - mechanical preparation, the root canals were dried using absorbent paper points n. 40 (dentsply indstria e comrcio ltda ., root canal obturation was performed by the lateral condensation technique, using primary gutta - percha points (dentsply indstria e comrcio ltda ., petrpolis, brazil) and b7 accessory gutta - percha points (tanari - tanariman industrial ltda ., manacapuru, brazil) and one of the following endodontic sealers: endofill (dentsply, indstria e comrcio ltda ., petrpolis, brazil) or ah plus (dentsply detrey gmbh, konstanz, germany). A stratified randomization determined, previously, the endodontic sealer to be used in each canal . Eight charts, one for each unknown dog, were set before the experimental procedures . Once the chemical - mechanical preparation of the root canals of one dog was completed, a chart was randomly assigned to that dog . This random assignment was followed until there was only one chart, which was assigned to the last dog submitted to treatment . The experimental period, teeth and endodontic sealer employed in each canal were recorded in the charts . The randomization method contemplated a uniform distribution of the sealers between the groups of teeth (central, intermediate and lateral incisors) at each study period . Yet, none of the dogs had all root canals filled with same sealer . Therefore, the 4 study groups used 12 root canals (n = 12), summarized as follows: a45- root canal sealed with ah plus and exposed to the oral environment for 45 days; a90- root canal sealed with ah plus exposed for 90 days; e45- root canal sealed with endofill exposed for 45 days; and e90- root canal sealed with endofill exposed for 90 days . After completion of lateral condensation, a periapical radiograph was taken to check if the root canal filling was radiographically adequate . The gutta - percha points were sectioned with aid of a plugger (duflex - ss white artigos dentrios ltda ., rio de janeiro, brazil) heated over a flame (standar evang indstria e comrcio ltda, so paulo, brazil), removing the excess material from the interior of the pulp chamber . Mild pressure was then applied in apical direction (vertical condensation) with a paiva plugger n. 2 (golgran indstria e comrcio de instrumentos odontolgicos ltda ., pirituba, brazil). Paiva pluggers n. 1 and n. 2, heated over a flame, were used to section the remaining obturation material at the cervical level leaving a 10-mm long obturation material inside the root canal . To achieve this length of remaining material, the bidigital spacer a (maillefer instruments sa, ballaigues, switzerland) was calibrated, with silicone stops, to the dimension of the rwl minus 10 mm . Sectioning of the filling material was done when the stop of the bidigital spacer a touched the reference point . A cotton pellet was placed into the pulp chamber, over the root canal treatment, and a temporary seal with glass ionomer cement (vidrion r - ss white artigos dentrios ltda ., rio de janeiro, brazil) was applied over it for 24 h. this material was prepared according to the manufacturer's instructions and was placed using a centrix mark iii syringe (centrix incorporated, usa) to fill the entire coronal cavity . After 24 h, the dogs were once again anesthetized with a single intramuscular injection of 15ml / kg of ketamine and 1ml / kg of xylazine hydrochloride, and the coronal sealing was removed with a diamond bur n. 1012 at high - speed, under cooling . After the experimental period, the dogs were submitted to surgical procedures conducted by students of the discipline of experimental anatomy of the medical school of upf, the dogs received an excessive dose of 3% sodium pentobarbital (hypnol, cristalia, produtos qumicos e farmacuticos ltda . Important to mention that eight dogs were previously assigned to the surgical procedures in the medical school then the authors got permission from the ethics committee to assign these dogs to this research project . With a handle n. 4 (j.o.n ., so paulo, brazil) and blade n. 22 (becton dickinson indstrias cirrgicas ltda ., juiz de fora, brazil), the soft tissues in the mandible were dissected until the periosteum was reached . The mandible was sectioned bilaterally using a saw (tdv dental ltda ., pomerode, brazil) between the canine and the first premolar, making three jaw blocks, being one anteriorly, used in this study, and two posteriorly, used in other studies, following the same line of investigation . The lower incisors were extracted using, initially, a carbide bur n. 8 (kg sorensen ind . Ltda ., barueri, brazil), at high - speed under cooling, to remove the buccal bone plate until close the teeth roots . Then, a le cron instrument (duflex - ss white artigos dentrios ltda ., rio de janeiro, brazil) was employed to completely remove the buccal bone plate ., rio de janeiro, brazil) was placed at the proximal aspects of the tooth and, with levering movements, the tooth was displaced from its socket . After extraction the pulp chamber of each tooth was thoroughly irrigated with distilled water (farmcia escola - ulbra, canoas, brazil) using a 5-ml disposable plastic syringe (becton dickinson indstrias cirrgicas ltda ., juiz de fora, brazil) and a hypodermic needle 25/4 (ibras indstrias cirrgicas s.a, campinas, brazil). Simultaneously to the irrigation procedure, aspiration was performed with a suction canula n. 20 (becton dickinson indstrias cirrgicas ltda, juiz de fora, brazil). When the distilled water flowed back clear from the pulp chamber the irrigation was interrupted and suction was kept for nearly 10 s. the roots were coated with two layers of clear nail varnish (risqu niasi s / a, so paulo, brazil), including the apical foramen, and allowed to dry . Indstria de preciso, itapu, brazil) at neutral ph for 96 h and washed under tap water for 1 h. the specimens were rendered transparent using the diaphanization technique described by garberoglio and bassa6 (1983). The transparent teeth were analyzed under stereomicroscopy (gsz, zeiss, germany) with 10x magnification and a measuring ocular . The india ink leakage was measured (in mm), considering each root as a whole . However, only the largest value, divided by the magnification (10), was considered for each specimen . Results were statistically analyzed using two - way analysis of variance (anova) and mean differences were analyzed by tukey test for multiple comparisons (sas software version 8.0) at 5% significance level (a=0.05). Two teeth, one from group a45 and another from group e90, fractured during the extraction procedure . Mean and standard deviation values (mm) of dye penetration for the experimental groups, and the statistical groupings are presented in table 1 . Mean values followed by different letters are significantly different at the significant level of 5% . Two - way anova revealed significant interaction between time and sealer, meaning that there is a combined effect of these two factors in leakage . Tukey test for multiple comparisons showed that the mean leakage value of group e90 is significantly higher than the mean values of all other groups . Preventing contamination or recontamination of the root canal system after completion of endodontic therapy is still a challenge for the dental professional . In the absence of impermeable sealing of the root canal system, evidences indicate that the endodontic failure is closely related to the constant presence of microorganisms in the root canal and periapical tissues after obturation18,23 . Such contamination may occur because of the ability of these microscopic organisms to permeate the obturation mass, inducing or maintaining a periapical lesion . The microbial leakage occurs both in apical - cervical and cervical - apical directions; the following situation may occur when there is absence of coronal sealing with consequent exposure of the root canal to the oral fluids, allowing communication of the components of the oral microbiota with the obturation material . The time of exposure to the oral environment, associated to the type of endodontic sealer employed for root canal obturation, are important factors that may interfere with the success of endodontic therapy when the afore mentioned clinical condition occurs . The present study attempted to correlate these two factors (time and type of sealer) at two study periods (45 and 90 days) and two endodontic sealers: a grossman sealer (endofill), which acted as control, since it is the most widely investigated sealer in the history of endodontics, and a resin - based sealer (ah plus), which has demonstrated good outcomes as to its sealing ability5,10,12,30 . As in the present investigation, previous in vitro studies also associated the afore mentioned factors21,25,30 . Despite allowing the control of important variables that may interfere with the outcomes, such studies conducted in laboratory present some limitations, as the fact that they do not allow association of all situations occurring in the oral cavity, such as: chewing activity, thermal cycling, oral microbiota, variations in salivary flow, and food impaction . The present study aimed to minimize the limitations of such studies, simulating the conditions of the oral environment, using dogs as an experimental model . A similar model was used by barbosa, et al.2(2003) and kopper, et al.12(2003). Barbosa, et al.2(2003) used histological sections from dog's teeth and evaluated the healing process . This method provides good understanding of the impact of contamination on the tissue surrounding the periapical area of the tooth . However, it does not give a three - dimensional view of the sealing ability, as given by kopper, et al.12(2003). It should be highlighted that, before onset of the clinical procedures, the dogs received atropine sulfate and were intubated . These conditions allowed accomplishment of endodontic therapy without utilization of rubber dam, since the tube prevented interference from breathing and the atropine inhibited the salivary flow . As in the studies of swanson and madison24 (1987), madison, et al.15 (1987), madison and wilcox16 (1988), magura, et al.17 (1991) and kopper, et al.12 (2003), the teeth were rendered transparent via diaphanization to allow for the observation of dye leakage, providing a three - dimensional image of the root canals . This procedure allowed for the quantification of the highest degree of leakage in each root canal . The results of this study confirm the inability of the root canal filling to keep an impermeable sealing after the exposure to the oral environment as soon as 45 days . The two endodontic sealers used in this study were unable to prevent dye leakage, indicating that there was room in the obturation mass for possible microbial leakage to some extent . As shown in table 1, there is no significant differences in mean leakage values between the sealers at 45 days (groups a45 and e45). This finding disagree with those of kopper, et al.12 (2003), who employed a similar experimental model as the present study and observed that ah plus presented a lower mean leakage value compared to the mean value of endofill at 45 days . However, in the kopper, et al.12 (2003) study, the root canals were additional prepared for post, which is not the case of the present study . Specimens in group e90 showed the highest mean leakage value . This finding suggests that the oral environment exposure time and the type of endodontic sealer are important factors that, in combination, may interfere with the success of endodontic therapy . Analysis of the data reveals that the chances of failure in root canals obturated with gutta - percha and endofill, exposed to the oral environment for 90 days (group e90) are higher than in root canals obturated with gutta - percha and ah plus, submitted to the same clinical conditions (group a90). This observation is in accordance with the findings of zucco30 (2001), who observed, in vitro, a higher sealing ability for the ah plus compared to the endofill, at an experimental period of 90 days . Based on the present and previous studies, the endodontic filling materials investigated cannot provide an impermeable obturation, as recommended by grossman9 (1958), who described the characteristics of an ideal endodontic sealer . Yet, several experimental models have been employed to evaluate the sealing ability of these materials, yielding different resuts29 . The experimental model employed provided an adequate insight on the effect of oral conditions on endodontically treated teeth left without coronal sealing for 45 and 90 days . Future studies on the periapical tissue response along with the information achieved in this study may contribute for an understanding of the phenomena interfering with the success of endodontic therapy . Based on the research protocol and results of the present study, it can be stated that: after 45 days of exposure to the oral environment, the endodontic sealers tested were not able to keep the root canal impermeable and prevent coronal dye leakage . The endodontic sealer, endofill, after 90 days of exposure to the oral environment, presented lower sealing ability compared to the 45-day period and with ah plus at both periods.