Split (1)

train · 133k rows

text stringlengths 0 868k
Tissue specimens taken from patients during operations or biopsies are usually assessed by the pathologists one or two days after the surgery . However, sometimes pathological results are needed urgently during the operation, while the patient is still on the operation table . In neurosurgical operations the need of a rapid diagnosis during the operation can be met by intraoperative consultation examinations . During surgeries, the use of touch preparation technique, known as touch preparation as an intraoperative consultation examination technique is now well established . A good intraoperative consultation examination technique should preserve good amount of tissue for paraffin embedded sections, and should be accurate and rapid . Frozen section is another intraoperative consultation examination technique that needs more tissue and has some freezing artifacts . The architecture of tissues in frozen section closely approximates permanent histology sections, and enables a degree of comfort . Touch preparation has been found quite reliable and useful in the determination of surgical resection margins, sentinel lymph nodes, adenomatous goiter, and confirmation of parathyroid tissue . Various diagnoses can be well made by an expert pathologist using touch preparation technique, because the cytomorphological features of smears in every malignant or benign lesion are specific . The objective of the present study was to evaluate four years (2007 - 2011) of using touch preparation technique by shahid beheshti hospital pathologists to examine benefits and possible defects of the technique in determining the diagnosis of central nervous system biopsies taken during operations . The accuracy of the technique was judged against the diagnosis made by final pathological diagnosis . This study aimed at assessing the value of diagnosis made by touch preparation technique in 2007 - 2011 . All of the patients signed the written informed consent to include their data in the study . Biopsies taken from lesions were grossly examined, and hemorrhagic and necrotic areas were sampled and prepared for the touch preparation technique . At least two smears were taken from each case by using two clean grease - free glass slides . The smears were fixed with absolute alcohol and were stained with geimsa and papanicolau . After the surgeries, remaining tissues were processed for paraffin - embedded sections, haematoxylin and eosin staining, and microscopic examination . The microscopic examination of paraffin sections, and touch preparation were made blindly by two pathologists . To examine the accuracy of diagnosis by touch preparation technique, the diagnoses obtained by this technique were compared with those obtained by microscopic examination of the smears . The findings were analyzed using statistical package for social sciences (spss version 16). During the study, 139 lesions, which had been sent for intraoperative consultation, were evaluated . The average patients age was 57, and there were 70 males and 69 females . Errors in diagnosis were seen in 12% of lesions . The highest correlation (100%) was observed in five types of tumor, and no correct diagnosis was made in case of hydatid cyst . Oligodendrogliomas, haemangioblastoma, meningioma, choroid plexus papilloma, craniopharyngioma, megakaryocytic leukemia, and dermoid cyst were diagnosed totally (100%) correct (table 1). The total number of tumor and correct diagnosis in touch preparation technique the accuracy of touch preparation technique for astrocytoma, pituitary adenoma, glioblastoma multiforme, metastatic carcinoma, and giant cell tumor was 81%, 84%, 66%, 66%, 88% and 80%, respectively . Glioblastoma multiforme was misdiagnosed twice as metastasic carcinomas, and high grade astrocytoma was misdiagnosed five times as metastasic carcinomas . Two cases of astrocytoma grade i was misdiagnosed as metastasic carcinomas, and one case of meduloblastoma was misdiagnosed as meningioma . Other misdiagnosed tumors were reported as benign or malignant microscopic results or inflammation (figure 1 - 6). Low grade astrocytoma: mild nuclear pleomorphism, mild to moderate hyperchromasia, absence of mitotic activity and dyscohesive pattern, minimal derivatium in nuclear shapes . Left: permanent pathologic slide (hematoxylline eosin x10). Glioblastoma multiform . Left: permanent pathologic slide (hematoxyllin eosinx10), anaplastic and pleomorphic cells without glial processes and endothelial hyperplasia . Meningioma: meningothelial cell proliferation with whorl formation . Left: permanent pathologic slide (hematoxyllin eosin x40), indicators show whorl formation . Right: touch preparation (papanicolau 400), the indicator shows the whorl formation . Pitutary adenoma: diffuse sheet of uniform cells, fibrovascular stroma, and absence of pleomorphic cells . Left: permanent pathologic slide (hematoxyllin eosin x40). Hydatid cyst: cyst wall shows laminated layers and many scolexes . Left: permanent pathologic slide (hematoxyllin eosin x4), the structures are visible . Right: touch preparation (papanicolau 100), the structures are not visible thus the diagnosis is hard to be made . Schwannoma . Left: permanent pathologic slide (hematoxyllin eosin 10); fusiform cells with long nuclei and eosinophilic cytoplasm arranged in hypercellular and hypocellular matrix . Right: touch preparation (papanicolau x40); a cluster of schwann cells with elongated nuclei . The present study was a retrospective analysis to determine the accuracy of touch preparation technique in diagnosing the type of tumors encountered during the operation . Different authors used various stains such as 1% alcoholic toluidine blue and may - grunwald giemsa . Compared to frozen section, in touch preparation technique and a large area of tissue can be examined . Besides, touch preparation technique provides enough tissue for intraoperative and subsequent routine paraffin section diagnoses . The two techniques are complementary, but frozen section is a better technique for the tissues, which their consistency is confirmed . Unlike permanent histology, the frozen section technique, which has the accuracy rate of about 97%, can be done during the surgery . However, cryostat facility is not available at many centers in iran . Touch preparation technique provides more crisp cytologic detail than frozen sections do, and can avoid most of freezing artifacts in brain tumors, high lipid content and soft nature . . The use of frozen section during surgery can give the surgeon the opportunity to avoid the second surgery . Due to high predictive value, the touch technique can be used first in the operation room, and frozen section can be saved for cases with inconclusive diagnosis by the touch technique . This study is one of the largest studies of this technique on cns tumors in iran . Previous reports indicate that the diagnostic accuracy of cytological smears ranged from 75% to 94% . In the present study the accuracy of touch preparation technique in diagnosing brain lesions was 84%, which is lower than that of other studies that included tumors only . This may be to the inclusion of other types of tumor such as bone tumors in the studies of neurosurgical tumors . The low diagnostic accuracy of touch preparation technique in our study may be related to limited sample size . The diagnostic accuracy of touch preparation technique for high and low grade astrosytoma was 81% (39 out of 48) in our study . When a small biopsy was submitted and typical features of pilocytic astrocytoma were not present, it was difficult to correctly diagnosis, or to grade the tumor . Moreover, when vascular proliferation and atypia was interpreted without adequate clinical history, a misdiagnosis of high grade astrocytoma was made . When cellular pleomorphism, giant cells, mitoses necrosis and vascular proliferation were present, the diagnosis of glioblastoma was obvious (figure 1). Because of high cellularity, pleomorphism and the round to polygonal appearance of the cells, high grade astrocytomas and glioblastoma are often confused with metastatic carcinoma . Anaplastic and pleomorphic cells that have no glial process are the key point in the diagnosis glioblastoma multiforme . Meningothelial, transitional and psammomatous meningiomas (three types of meningiomas) usually present no diagnostic difficulty because they exhibit features of non - neoplastic arachnoid cap cells, particularly the tendency to form whorls . The nuclei of many meningiomas (especially the meningothelial types) show two types of intranuclear vacuoles . One type is formed by invagination of cytoplasm into the nucleus and the other by clearing of chromatin material from the center of the nucleus . In addition to whorls, the presence of intranuclear inclusions and calcification is of help in diagnosing meningiomas . Chordoid meningiomas were misinterpreted as chordoma and atypical meningioma with metastatic carcinoma . In haemangioblastomas, obtaining good quality smears was difficult . However, all of the cases of meningiomas and 10 out of 11 cases of schwannoma were diagnosed correctly, because of the mentioned diagnostic characteristics (figure 3 and 6). The cellular monomorphism and the absence of a significant reticulin network distinguish pituitary adenomas from non - neoplastic anterior pituitary parenchyma (figure 4). Eleven of 13 cases were diagnosed correctly, but two cases were not diagnosed correctly using touch preparation technique . In haemangioblastomas, obtaining good quality smears was difficult . The smears showed thick and dense trabeculae of elongated cells, which led to misinterpretation . All such characteristics helped correct diagnosing of all three cases of haemangioblastomas in our study . Hydatid cysts are diagnosed by the presence of scolex and a cyst with a laminated layer (figure 5). Touch preparation technique could not the two cases of hydatid cyst in our study . Touch preparation technique is a rapid diagnostic method and a good complimentary technique for frozen section . The experience of a pathologist is very important as diagnosis is made on cytology alone without any special stains and in a short time . Awareness of the cytomorphological features on smears of various lesions is important . In 64% of cases correct diagnosis could be made on smears alone, and in another 20% after clinical and radiological correlation . Touch preparation technique is a very accurate and rapid method of intraoperative diagnosis, especially when combined with frozen section . However, adequate clinical history, neuroimaging details, and the intraoperative impression of the neurosurgeon, if provided, helps the neuropathologists to improve the diagnostic accuracy.
Tai chi (tc), also known as tai chi chuan, is a traditional chinese martial art originally created for self - defense, although today it is considered a low - impact aerobic exercise (zhang et al ., 2012). Its practice consists of fluid, circular, smooth, and slow movements, with the practitioner in a semi - flexed position of the knees . The practice of this exercise requires precise and slow movements of the joints, the maintenance of postural stability, and balance (chen et al ., 2008), but also meditative aspects that are combined with breathing exercises (wang et al ., 2014). There are five main styles of tc: yang; wu; chen; hao, and sun . Each has its different focus with regard to the movements, but all share the same essential principles of the practice (lan et al ., 2013). In investigation studies, the 108-movement yang - style tc has been utilized, as well as simpler and shorter forms of tc of between 8 and 108 movements or other western variants (lan et al ., 2013). Various published studies have calculated that the expenditure of energy during the practice of tc is between 4.1 and 6.7 . Metabolic equivalents (met) according to the style of the practice (schneider and leung, 1991; zhuo et al ., 1984). Lan and collaborators quantified cardiac frequency (cf) and oxygen consumption (vo2) with the practice of tc in adults; mean cf was 58% of the cardiac frequency reserve (cfr) and a maximal vo2 55% . Thus, according to these parameters, tc can be considered an aerobic exercise of moderate intensity (cfr, 4059%) (lan et al ., 2001). There is recent evidence that supports the therapeutic effects of tc for musculoskeletal, rheumatological, neurological, and geriatric conditions (wang, 2011; 2012). Significant improvements have been reported in balance, muscular strength, cardiorespiratory function, joint and muscle flexibility, pain, and even symptoms of depression and anxiety (wang, 2012). In a study that reported the neuromuscular effects of tc in elderly subjects with alterations in equilibrium, significant progresses were demonstrated in neuromuscular control of the knee and in the organization of muscular response during walking, as well as significant improvement with respect to functional equilibrium appraised with different scales (gatts et al ., 2007). Possible mechanisms include improvement in equilibrium, caregiving, postural control, propioceptive sensitivity, and reduction of the fear of falling (hall et al ., 2009; lan et al ., 2013). Subjects trained in tc additionally present improved vestibular reactions in sensorial tests during postural changes and greater propioceptive accuracy when compared with the controls (fong and ng, 2006; gyllensten et al ., 2010). A systematic review and meta - analysis published in 2011 on the effects of tc in osteoarthritis (oa) included six randomized clinical trials (rct) that compared tc with controls and that concluded that tc was superior with respect to pain, functionality, and joint rigidity on comparing the former with conventional exercise programs or those carried out at home (kang et al ., 2011). Another systematic review, this one published in 2014, on the effects of tc on oa of the knee included six good - quality rct . The authors concluded that tc exhibited effectiveness in diminution of pain and improvement in physical function, although the review emphasized the need for conducting rct with larger sample sizes and longer follow - ups to confirm the efficacy of this intervention (ye et al ., 2014). In a recently published systematic review, the effectiveness was evaluated of physical therapy on improvement of equilibrium and reduction in the risk of falls in patients with oa of the knee . The interventions taken into account included tc, strength training, aerobic exercise, and aquatic exercise . The study concluded that tc, strength training exercises, and aerobic training improved balance and diminished the risk of falls in older adults with oa of the knee (mat et al ., 2015). In the guidelines from the european league against rheumatism (eular, 2013) for non - pharmacological management knee and hip oa, it is included the recommendation to practice tc in patients with oa, based on a systematic review of 10 good quality rct, where evidence was found of the usefulness of tc in pain reduction, with an effect size of 0.28 up to 1.67 (escalante et al ., 2010; fernandes et al ., 2013). In 2012, the american college of rheumatology (acr) established a conditioned recommendation on the practice of tc as non - pharmacological treatment of oa of the knee (hochberg et al ., 2012). Another international association, the osteoarthritis research society international (oarsi), in its guidelines of conservative management of oa, does not establish recommendations with respect to the prescription or use of tc (mcalindon et al ., recommendations have not been established for these agencies on the usefulness of tc for other pathologies . With regard to quality of life (qol), there is a systematic review on the effectiveness of tc in chronic pathologies that includes 21 rct and 1,200 patients in a meta - analysis showing positive effects on qol in these types of pathologies, specifically on cardiorespiratory, neurological, and musculoskeletal pathologies (li et al ., 2014). The properties of water promote active movement, muscle relaxation, provide greater bodily and postural support, and stimulate strengthening by means of resistance of water, permitting the training of motor and sensory skills in subjects in water (verhagen et al ., 2012). This rehabilitation technique is based on the potential benefits of hydrodynamic principles such as bouyancy, resistance, relative density, viscosity, turbulence, and hydrostatic pressure and flow, in addition to providing sensory and physiological effects by means of the water temperature (torres - ronda and del alczar, 2014). Hydrotherapy (ht) is a technique that is applied as a complementary treatment in multiple pathologies . Evidence exists on the efficacy of this intervention with respect to pain diminution of pain and musculoskeletal function improvement in affectations such as low back pain, rheumatoid arthritis, oa, and fibromyalgia, and in neurological pathologies such as multiple sclerosis (verhagen et al ., 2012). In a meta - analysis published by barker and colleagues that included 20 studies on the effectiveness of ht on musculoskeletal conditions, the authors found moderate effects on pain diminution and functionality (barker et al ., 2014). The technique and advantages of tc can theoretically be complemented with the benefits of ht . This concept has already been explored and although it is presently found in an experimentation phase, various studies have reported the efficacy of water - based postural exercise programs, suggesting positive effects on coordination and equilibrium on combining these (barker, 2014). When equilibrium training has been conducted on the floor, an individual s performance can be affected by lack of confidence, fear of falling, or joint pain . In an aquatic environment, the viscosity inherent in water serves as postural support, promoting confidence and reduction in fear of falling . The water temperature can be beneficial in pathologies that produce chronic pain, muscle contractions, or spasticity (becker, 2009). Novel techniques have been developed that combine the principles of tc and those of other disciplines similar to ht, or even techniques such as ai chi, aquatic exercise, which include tc, qui gong, shiatsu or watsu movements within an aquatic and musicotherapeutic environment . These programs have been tested in rct as measures of the outcomes of pain, functionality, and disability, with significantly better results with respect to the group only engaging in breathing and relaxation exercises outside of the water (castro - snchez et al ., 2012). Although ai chi is not synonymous with underwater tc, it does include movements of the latter with the potential benefits of ht, specifically in a pool, and variants of the technique have been developed that take advantage of the good aspects of both . Teixeira et al . (2011) conducted an rct on the effects of ai chi on equilibrium and fear of falling in older adults . Thirty participants at the daycare center of a home for the fragile elderly were randomly assigned to an ai chi class or to a control group where they received customary caregiving . The results suggested that an ai chi program produces improvement in static and dynamic equilibrium in the elderly in comparison with conventional caregiving . The ai chi group maintained the same level of fear of falls, but in the control group, this increased (teixeira et al ., 2011). In another rct, with the objective to analyze the effects of an ai chi program on equilibrium in older adults, 54 subjects aged between 60 and 85 yr were included who presented a high risk of falls . These subjects were distributed into two groups: the experimental group that participated in 12 sessions of ai chi, and the control group, the members of which carried out a conventional ht treatment in a pool . Equilibrium, joint mobility and pain were evaluated at the beginning and at the end of the intervention . Significant improvement in equilibrium in both groups was reported but, on performing the comparison between the groups, the experimental group was significantly better with respect to balance (olabe - snchez and martnez - almagro, 2014). (2009) published an rct in which the authors compared an ai chi technique with another involving floor exercises in persons with fibromyalgia; the authors concluded that there were no global differences between both groups, although there was significant improvement in symptoms and sleep quality in members of the ai chi group (calandre et al ., 2009). In a pilot study published by prez - de la cruz and colleagues (2015), the authors analyzed the results of an ai chi program conducted in the water on qol, depression, and pain in patients with fibromyalgia . Twenty patients were included, in whom functionality, pain, and qol were measured; the intervention consisted of 20 sessions of the water - based program . The authors reported significant differences in the outcome variables in favor of the experimental group (prez - de la cruz and lambeck, 2015). (2008) reported another rct in which they included 25 patients with chronic cerebrovascular - event sequelae who were assigned to two treatment groups: the experimental group underwent aquatic training, which included a combination of ai chi and halliwick (another aquatic training technique) or a control group, with gymnastic floor exercises . The authors concluded that the aquatic therapy significantly improved equilibrium (noh et al ., 2008). Tc has demonstrated, in multiple studies, its usefulness on musculoskeletal system pathologies, due to its slow movements that involve the four limbs together with the regulation of breathing, postural control, and balance, and tc is now even recommended in some evidence - based clinical guidelines . Ht has been utilized with proven benefits derived from the mechanical properties of water that combine with the effects of the exercise, improving the muscle - skeletal conditions of the subjects . Both treatment types involve the physical work of equilibrium, mobility, strength, coordination, and sensory input such as proprioception, with complementary advantages, which theoretically render them as possessing potential synergy in their benefits . In addition to this relaxation and breathing can provide a complete exercise, with low joint impact and strength work at the same time . Combined tc and ht have been tested principally in older adults with risk of falls or fragility, and in some neurological or rheumatological pathologies . It is important to know whether tc practiced in water is useful in other chronic pathologies that cause pain and alterations in walking, such as knee or hip oa . For this, it is necessary to develop good - quality rct in those included in conventional tc control groups, conventional ht groups, and in groups with both tc and ht combined, or conventional floor exercises (stretching, strengthening, equilibrium), in order to acquire general evidence that establishes whether there is an advantage on combining both techniques . In addition, it is necessary to carry out rct with adequate samples sizes and greater follow - up to observe potential medium- and long - term benefits and to observe distinct techniques and modalities of tc as well as of ht.
Acute cerebral ischemic reperfusion injury (ciri), a hotspot for clinical research, is a pathophysiologic phenomenon commonly encountered in the field of emergency medicine, especially during the perioperative periods . The brain can store so little energy reserves that it is highly sensitive to ischemia and hypoxia . Studies have shown that interrupting the cerebral blood flow for 10 s can lead to loss of consciousness . If cerebral blood flow is blocked for more than 5 min, permanent brain damage is inevitable . Phosphocreatine (pcr) has been used as cardioplegic and cardioprotective agents during cardiopulmonary bypass and also ischemic events . In recent years, some reports showed that pcr improved the outcome after stroke and neonatal hypoxic ischemic encephalopathy . There have been no studies done to investigate the effect of pcr during acute ciri . So we designed this research using acute rat ciri model to observe the effect of pcr and investigate its possible mechanism . All experimental procedures were done in accordance with the guide for the care and use of laboratory animals . All surgical procedures have been approved by the committee for experimental animals of centre for disease control and prevention of hubei province . 36 male wistar rats weighing 200220 g were acquired from the experimental animal center of hubei province, wuhan, china . 36 wistar rats were randomly divided into 3 groups: sham - operated group (sham group, n = 12), ischemia - reperfusion group (i / r group, n = 12), pcr preconditioning group (pcr group, n = 12). Ciri rat models were produced by electrocauterizing bilateral vertebral arteries and occlusion of bilateral common carotid arteries using atraumatic clasps . The clasps were released 10 min later and followed by a 48-hour reperfusion . In sham group, pcr 150 mgkg was administered intravenously 60 min before the bilateral common carotid arteries were occluded; normal saline was administered intravenously in i / r group simultaneously . Core body temperatures were monitored with a rectal probe and maintained between 36.5c~37.5c during the whole procedure . 3 rats from i / r group and 1 from pcr group were excluded within 24 h while the remaining ones were regarded as successful models . After routine he staining, pathological changes of the brain tissue were observed under a light microscopy (400). The level of cell apoptosis was determined with a roche in situ cell - apoptosis - assay kit with nuclei stained in brown particles (shanghai runwell technology co., china). 10 high - power fields (400) were randomly selected, and the number of apoptotic cells was counted for each field . Cam activity (mmoll) was measured using rat cam elisa kit (r & d company, us); mda content (nmoll) was detected with mda kit; protein content (mgl) in corresponding tissue was detected with coomassie brilliant blue protein assay kit (both from nanjing jiancheng bio co., china). Mda content in the tissue was calculated using the following formula: (1)mda (nmolmgprot1)=mda content (nmoll1)protein content (mgl1) in corresponding tissue5 . Results were expressed as mean sd . Data were statistically evaluated by one - way anova (snk) tests and dunnett's tests, with the level of significance chosen as p <.05 . In sham group, the cortical neurons are arranged in neat rows with abundant cytoplasm, and the nuclei are round and basophilic . In i / r group, the cytoplasm is light red with uneven distribution and vacuoles, nuclei are condensed . In pcr group, however, the cell structure is normal . Most of the neurons have complete membrane integrity and the nuclei are clear (figure 1). A few tunel - positive cells were observed in the cortex of rats in sham group whereas a large number of tunel - positive cells was observed in the cortex of rats subject to i / r injury; compared with i / r group, the number of tunel positive cells was significantly reduced in the cortex of pcr group (figures 2 and 3). The cam activity of i / r group and pcr group was significantly increased at 48 hours after reperfusion compared with sham group whereas cam activity was significantly decreased in the cortex of pcr group compared with i / r group (figure 4). Mda in i / r group and pcr group was significantly increased at 48 hours after reperfusion compared with sham group, but compared with i / r group, mda content was significantly decreased in the cortex of pcr group (figure 5). Rapid exhaustion of energy is one of the important etiological factors of ischemia - reperfusion injury [5, 6]. We hypothesized that supplication of an exogenous energy substrate before ischemic reperfusion might be an important logical therapeutic step . Pcr is a very important energy substrate, it can go through the blood - brain barrier, even through the cell membrane, to supply energy to cells directly ., we have demonstrated that pcr preconditioning attenuated cell apoptosis and the morphological damage during cerebral ischemia - reperfusion in rats . In ischemia - reperfusion injury brain, the cytoplasm is light red with uneven distribution and vacuoles, and nuclei are condensed under light microscopy after reperfusion for 48 h. compared with i / r group, the number of apoptotic cells was significantly decreased and cerebral ischemia - reperfusion injury was alleviated in pcr group . Imbalance of neuronal calcium homeostasis and increase in oxygen free radical are important aggravating factors of cerebral ischemic reperfusion injury . Energy deficiency causes intracellular calcium overload and an increase in oxygen free radical . To assess the intracellular ca overload and oxygen free radical level, cam activity and cerebral mda content were determined . It combines with ca reversibly, and regulates transmembrane calcium transportation, absorption, and secretion . An increase in activity of cam means an elevation of intracellular ionized ca concentration, hence causing calcium imbalance in the cells . Mda is a stable lipid peroxide end product produced during the oxidation of membrane lipid unsaturated fatty acid by oxygen free radical . The central nervous system is rich in unsaturated fatty acids that interact with oxygen free radical during reperfusion after an ischemic event, which generates a large amount of mda . Therefore, mda level indirectly reflects the level of oxygen free radical and the degree of lipid peroxidation in the brain tissue . We found that the cam activity was elevated in i / r group compared with sham group, indicating the increase of ca influx, ca overload, and ca balance disturbance . The high mda content in i / r group suggested that oxidative stress occurred and a large amount of lipid peroxide was produced . Thus, there were lower incidences of ca reflux, ca overload, and complex pathological changes induced by ca overload . Pcr group also had lower mda level, indicating that pcr induced a significant suppression in the generation of free radical and provided an antioxidative protection to the cell and organelle membranes, hence attenuating cellular necrosis and apoptosis . During ischemia - reperfusion we have found that pcr preconditioning decreases cam activity, thus preventing calcium overload, reducing the production of oxygen free radical indirectly . As an atp precursor, pcr releases high - energy phosphate bond to synthesize atp, supplying neurons with energy, reducing the production of lactic acid, and maintaining the function of na - ca exchange . It is suggested that pcr preconditioning ensures sufficient atp supply, keeps ca pump working, and sustains ca balance . It can also inhibit the formation of hypoxanthine, thereby reducing the production of oxygen free radicals . The drawback of clinical application of mechanical preconditioning is the difficulty in predicting the onset of any ischemic event . Even if it's predictable, the application of a transient mechanical preconditioning is impractical before cerebral ischemia . Therefore, the clinical application of mechanical preconditioning was limited . One of the important etiological factors of ischemia - reperfusion injury is due to the rapid exhaustion of energy [5, 6]. Therefore, a supply of an exogenous energy substance during ischemic reperfusion may be an important logical therapeutic step . It acts as an energy reserve, and it is mainly synthesized by the kidneys . The finding of the current study provides a promising method for the treatment of cerebral ischemia - reperfusion injury . Future study will be needed to further evaluate the effect of pcr on brain infarct size, neurological score and so forth . The assessment of functional and histological endpoints as well as multiple neurological outcomes will allow better understanding of the pcr's role in brain ischemia . In summary, we demonstrated the protective effect of pcr during cerebral ischemic reperfusion injury . Based on the pharmacokinetic characteristics of pcr, we speculate that pcr should be administered preoperatively to hemodynamic unstable patients, such as aortic aneurysm surgical patients, who may develop cerebral ischemia during surgery when the major arteries are clamped . Other patients with severe head injury, hemorrhagic shock, cerebral vasospasm, and respiratory and cardiac arrest
Breast conservation surgery (bcs) followed by whole breast irradiation has become the standard of care for early breast carcinoma [14]. However, the duration of treatment remains between 5 to 6 and a half weeks . The need for whole breast irradiation has been questioned and several centres have evaluated the feasibility and efficacy of accelerated partial - breast irradiation (apbi) [57]. Accelerated partial - breast irradiation represents a technique that allows for the delivery of adjuvant therapy after bcs in 1 week or less with multiple techniques being available at this time . To date, at least seven phase iii trials comparing different techniques of apbi to conventional wbi have been initiated [812]. . Demonstrated excellent long - term local tumour control, survival, and cosmetic results with a low - rate of long - term toxicity in a 12 year prospective study using multicatheter interstitial brachytherapy . Currently, the american brachytherapy society recommends proper patient selection for apbi and the current guidelines are for apbi in age (> 50 years old), tumor size (<3 cm), histology (all invasive subtypes and ductal carcinoma in situ), surgical margins (negative), lymphovascular space invasion not present, and negative nodal status . The ability to consistently and reproducibly localize and fully irradiate the tumor site is very important in radiation therapy . Patient immobilization has many aspects, ranging from limiting movement of the patient's body to specific tissue immobilization devices . The kuske breast applicator (nucletron, an elekta company, elekta ab, stockholm, sweden) is currently widely used in multicatheter interstitial brachytherapy as an immobilization device . It is an adjustable template with integrated guiding plates that are used to compress the breast and guide placement of brachytherapy needles . Another technique that has been used in multicatheter interstitial brachytherapy is the ultrasound guided free hand method, in which ultrasound guided visualisation of the cavity is used to guide catheter insertion into the cavity with needle placement being marked on the skin prior to the insertion . While both techniques have their advantages and remain popular at different centres, there is no published data that compares the two techniques . In this study, we look at both techniques comparing the insertion time, planning time, and the dosimetric outcomes . Between august 2008 and march 2010, 20 consecutive patients treated with apbi with multicatheter hdr interstitial brachytherapy were included in the study . All patients underwent lumpectomy and axillary nodal evaluation either by sentinel node biopsy or axillary clearance . Patients were selected as per the criteria of european society of radiotherapy and oncology (estro) apbi consensus guidelines, which included: 1) tumours of less than 3 cm in size; 2) no lymph node involvement; 3) negative surgical margins; 4) no multicentric disease or extensive intraductal component; 5) patients> 40 years of age with no prior history of cancer . Institutional ethics approval was obtained and informed consent was attained from each patient . Within 8 weeks of lumpectomy and axillary nodal evaluation, patients underwent an interstitial implant using either an ultrasound guided free hand method (non - template) or a template method . Both methods were performed in the supine position . In the non - template method, the target volume was first mapped out on the skin surface with ultrasound visualisation of the lumpectomy cavity (fig . Needles were placed using the paris system parallel to each other, ensuring adequate coverage of the cavity with generous use of a local anaesthetic mixture . Initially, a deep plane of needles was placed on the pectoralis major fascia with real - time ultrasound guidance . This was followed by at least one superficial plane resulting in a multiplane implant for adequate geometric coverage of the target volume . Ultrasound localization of the target volume in the free hand technique in the template method, once the cavity was localized, the ipsilateral breast area was surgically prepared under sterile conditions . To avoid injury to the underlying chest wall structures or causing a pneumothorax, the overlying breast was pinched and gently lifted off the chest wall before applying the template and securing it . 3 - 5 anchoring needles were then placed in an asymmetric pattern usually involving c-12 . C-12 was the grid coordinates of the template that corresponded to the center of the template . The purpose of the asymmetric pattern is to aid easy orientation of the template in reference to the patient's anatomy, as well as to secure and prevent slipping of the template from the breast (fig . These images were then reconstructed on the oncentra planning system (nucletron, an elekta company, elekta ab, stockholm, sweden). Insertion of catheters with the use of a template the planning target volume (ptv) was formed by expanding 20 mm from the clinical target volume (ctv), which was determined from the contrast enhanced tumor cavity and any surrounding surgical clips . The ptv - eval was formed by excluding the 5 mm skin rind, as well as the underlying chest wall muscle layer . The skin was also contoured on the sagittal slice depicting the largest breast contour (usually the slice showing the nipple), and the most anterior chest wall surface was also contoured . The images were then reoriented in oncentra to depict the template view to determine the location of the remaining catheters . Next, an overlying photocopy of the template on a transparency was placed on top of the screen and the template view template magnification was matched 1: 1 to the overlaid template transparency (fig . The corresponding anchoring needle positions were then marked on the overlaid transparency and the chest wall, and ptv - eval contour were outlined onto the transparency . Once done, the catheter placement for the remaining catheters was easily determined . Use of an overlaid transparency to mark the chest wall contour and the cavity in both procedures, the final step required replacing the needles with polyethylene tubing with a hemispheric button at each end . Extra attention was given to make sure that the button on the connector side of the remote afterloader was flush to the skin . After each catheter was trimmed and numbered, an en face picture of the implant showing the catheter numbers with respect to the breast anatomy was obtained to aid in the reconstruction of the catheters . Ct - based simulation of the patient was performed with the patient in supine position and the images were then transferred to the oncentra (nucletron, an elekta company, elekta ab, stockholm, sweden) treatment planning system . A total of 34 gy in 10 fractions, two fractions per day, 3.4 gy per fraction, separated by at least 6 hours, given on 5 treatment days was delivered via a ir remote afterloader in supine position . Target coverage was 90% of the prescribed dose covering 90% of the ptv - eval (d90 90%). Care was taken to ensure that the skin dose did not exceed the prescription dose . In our study, the dose constraint for the skin was set as less than 100% of the prescribed dose . To assure appropriate dose homogeneity throughout the implant, two parameters were used: the volume of tissue receiving higher doses and a dose homogeneity index (dhi). The actual volume of tissue receiving 150% (v150) and 200% (v200) of the prescribed dose was limited to 70 cc and 20 cc, respectively . The dhi, as represented by the volume ratio (1 v150/v100), will be 0.75 . (v150 represented the volume of tissue receiving 150% of the prescribed dose, and v100 represented the volume of tissue receiving the prescribed dose). The maximum skin dose (msd) and maximum chest wall dose (mcd) were also recorded for each patient . In addition, <60% of the ipsilateral whole breast reference volume received 50% of the prescribed dose . The online breast atlas from the rtog website was used to target the whole breast reference volume . Insertion time was defined as the time taken from start of patient's clean and drape sterile prep to the time when the ct simulation images were acquired . Planning time was defined from the start of contour voluming to the time of plan approval . The results were analysed statistically using the stata v11.0 (statacorp usa). The two - sample wilcoxon rank sum (mann whitney u test) within 8 weeks of lumpectomy and axillary nodal evaluation, patients underwent an interstitial implant using either an ultrasound guided free hand method (non - template) or a template method . Both methods were performed in the supine position . In the non - template method, the target volume was first mapped out on the skin surface with ultrasound visualisation of the lumpectomy cavity (fig . Needles were placed using the paris system parallel to each other, ensuring adequate coverage of the cavity with generous use of a local anaesthetic mixture . Initially, a deep plane of needles was placed on the pectoralis major fascia with real - time ultrasound guidance . This was followed by at least one superficial plane resulting in a multiplane implant for adequate geometric coverage of the target volume . Ultrasound localization of the target volume in the free hand technique in the template method, once the cavity was localized, the ipsilateral breast area was surgically prepared under sterile conditions . To avoid injury to the underlying chest wall structures or causing a pneumothorax, the overlying breast was pinched and gently lifted off the chest wall before applying the template and securing it . 3 - 5 anchoring needles were then placed in an asymmetric pattern usually involving c-12 . C-12 was the grid coordinates of the template that corresponded to the center of the template . The purpose of the asymmetric pattern is to aid easy orientation of the template in reference to the patient's anatomy, as well as to secure and prevent slipping of the template from the breast (fig . These images were then reconstructed on the oncentra planning system (nucletron, an elekta company, elekta ab, stockholm, sweden). The planning target volume (ptv) was formed by expanding 20 mm from the clinical target volume (ctv), which was determined from the contrast enhanced tumor cavity and any surrounding surgical clips . The ptv - eval was formed by excluding the 5 mm skin rind, as well as the underlying chest wall muscle layer . The skin was also contoured on the sagittal slice depicting the largest breast contour (usually the slice showing the nipple), and the most anterior chest wall surface was also contoured . The images were then reoriented in oncentra to depict the template view to determine the location of the remaining catheters . Next, an overlying photocopy of the template on a transparency was placed on top of the screen and the template view template magnification was matched 1: 1 to the overlaid template transparency (fig . Were then marked on the overlaid transparency and the chest wall, and ptv - eval contour were outlined onto the transparency . Use of an overlaid transparency to mark the chest wall contour and the cavity in both procedures, the final step required replacing the needles with polyethylene tubing with a hemispheric button at each end . Extra attention was given to make sure that the button on the connector side of the remote afterloader was flush to the skin . After each catheter was trimmed and numbered, an en face picture of the implant showing the catheter numbers with respect to the breast anatomy was obtained to aid in the reconstruction of the catheters . Ct - based simulation of the patient was performed with the patient in supine position and the images were then transferred to the oncentra (nucletron, an elekta company, elekta ab, stockholm, sweden) treatment planning system . A total of 34 gy in 10 fractions, two fractions per day, 3.4 gy per fraction, separated by at least 6 hours, given on 5 treatment days was delivered via a ir remote afterloader in supine position . Target coverage was 90% of the prescribed dose covering 90% of the ptv - eval (d90 90%). Care was taken to ensure that the skin dose did not exceed the prescription dose . In our study, the dose constraint for the skin was set as less than 100% of the prescribed dose . To assure appropriate dose homogeneity throughout the implant, two parameters were used: the volume of tissue receiving higher doses and a dose homogeneity index (dhi). The actual volume of tissue receiving 150% (v150) and 200% (v200) of the prescribed dose was limited to 70 cc and 20 cc, respectively . The dhi, as represented by the volume ratio (1 v150/v100), will be 0.75 . (v150 represented the volume of tissue receiving 150% of the prescribed dose, and v100 represented the volume of tissue receiving the prescribed dose). The maximum skin dose (msd) and maximum chest wall dose (mcd) were also recorded for each patient . In addition, <60% of the ipsilateral whole breast reference volume received 50% of the prescribed dose . The online breast atlas from the rtog website was used to target the whole breast reference volume . Insertion time was defined as the time taken from start of patient's clean and drape sterile prep to the time when the ct simulation images were acquired . Planning time was defined from the start of contour voluming to the time of plan approval . The results were analysed statistically using the stata v11.0 (statacorp usa). The two - sample wilcoxon rank sum (mann whitney u test) of the 20 patients in the study, 12 underwent the non - template method and 8 underwent insertion using the template method . A median of 18 catheters was used per patient (range 16 - 24) and median time to insertion was 2 weeks post surgery . Average breast volume was 846 cm (range 526 - 1384) and the average ptv - eval volume was 256 cm (range 182 - 416). There were 16 patients with t1 - 2 breast tumours and 4 patients with dcis treated in our study group . The average breast size of our patients was 816.5 cc (range 526.4 - 1384.7). We found that insertion time and planning time was significantly longer for the non - template method compared with the template method . The difference was 60 minutes longer on average for insertion and 90 minutes longer for planning . When we compared dosimetry from the plans, we found that the d95 was 3.13 gy (92% of the prescribed dose) on average with the non - template method, which was significantly lower compared to 3.3 gy (97% of the prescribed dose on average) with the template method (p value <0.01). Other dosimetric parameters such as the v200, msd and dhi were not significantly different between the two techniques . See table 1 . There were 16 patients with t1 - 2 breast tumours and 4 patients with dcis treated in our study group . The average breast size of our patients was 816.5 cc (range 526.4 - 1384.7). We found that insertion time and planning time was significantly longer for the non - template method compared with the template method . The difference was 60 minutes longer on average for insertion and 90 minutes longer for planning . When we compared dosimetry from the plans, we found that the d95 was 3.13 gy (92% of the prescribed dose) on average with the non - template method, which was significantly lower compared to 3.3 gy (97% of the prescribed dose on average) with the template method (p value <0.01). Other dosimetric parameters such as the v200, msd and dhi were not significantly different between the two techniques . See table 1 . Our study shows that using the template had the advantages of saving both planning and insertion time, as well as a dosimetric benefit of superior dose coverage . Individually, our results compared well with centres that specialized in either technique . For departments wishing to start multicatheter interstitial breast brachytherapy, we believe that the template approach offers superior dosimetric outcomes and shorter treatment procedure times compared to the non - template approach even in novice hands . Multicatheter interstitial brachytherapy has been gaining popularity as an adjuvant treatment in early breast cancer due to its short time of delivery, good outcomes, and excellent cosmesis [21, 22]. There are many techniques currently in use at different centres . Despite this, there are no studies that compare the different techniques and look at the advantages of one technique over another . While preference of technique is dependent on a large number of factors including staff training, tumour location, and patient breast size, our comparison shows significant gains of the template method in saving time and improving dosimetry . In our centre, our radiation oncologists were trained in both techniques giving flexibility in technique selection for each patient . The current radiation therapy oncology group trial rtog 04 - 13 technical guidelines for interstitial brachytherapy are a target coverage of (90% dose received by 90% target volume, v150 <70 cm, v200 <20 cm and dose homogeneity index 0.75) and skin dose volume histogram parameters (maximum 100% of prescribed dose). We compared the results of our non - template technique and our template technique with the results from the university of wisconsin and tufts university, respectively . Comparison of our results with other institutions personal communication with dr patel as technique selection was not randomised in this study, there were some patients in whom the non - template technique was used because of small breast size or because the tumour cavity was located very medially or laterally . Apbi in the technically difficult patient is a field of further study and development that we are researching . In this study, only 16 patients were recruited as this is a pilot study comparing two different techniques . Subsequent studies into apbi should compare various techniques of catheter insertion and dose delivery, as well as planning techniques to decrease planning and insertion time . Current developments in other breast brachytherapy techniques include multilumen balloon catheters (contura, senorx corp, usa), which do not require a template and may be suitable in certain patients . The apbi program in our centre was introduced 5 years ago and since then we have treated over one hundred patients in the program using either technique, but predominately favouring the template approach . We have no local recurrences or grade 3 toxicity in our patients and the cosmesis of this procedure at our centre remains excellent . Our experience shows that adequate training of staff, exposure, and use of various techniques in brachytherapy can allow diversity in a centre and allow comparisons between techniques . As technique selection was not randomised in this study, there were some patients in whom the non - template technique was used because of small breast size or because the tumour cavity was located very medially or laterally . Apbi in the technically difficult patient is a field of further study and development that we are researching . In this study, only 16 patients were recruited as this is a pilot study comparing two different techniques . Subsequent studies into apbi should compare various techniques of catheter insertion and dose delivery, as well as planning techniques to decrease planning and insertion time . Current developments in other breast brachytherapy techniques include multilumen balloon catheters (contura, senorx corp, usa), which do not require a template and may be suitable in certain patients . The apbi program in our centre was introduced 5 years ago and since then we have treated over one hundred patients in the program using either technique, but predominately favouring the template approach . We have no local recurrences or grade 3 toxicity in our patients and the cosmesis of this procedure at our centre remains excellent . Our experience shows that adequate training of staff, exposure, and use of various techniques in brachytherapy can allow diversity in a centre and allow comparisons between techniques . Compared to the non - template approach, the template approach offered significantly shorter insertion and planning times with improved dosimetric ptveval coverage without significantly compromising organs at risk . This template approach should form the starting point for any department wishing to commence multicatheter interstitial breast brachytherapy.
Relevant studies were identified by searching medline and embase databases for all published articles up to 31 october 2012, using the search terms vitamin d, calcidiol, calcitriol, insulin resistance, insulin secretion, insulin sensitivity, glucose intolerance, glucose metabolism, beta - cell function, type 2 diabetes, and diabetes . The search was further restricted to english - language articles, human studies, and adult subjects aged 19 years . All prospective studies on this topic were considered eligible if they provided data on the relationship between baseline circulating levels of 25(oh)d and risk of type 2 diabetes . In the first round of screening (n = 542), 470 articles were excluded for at least one of the following reasons: studies that did not study circulating 25(oh)d as an exposure or type 2 diabetes as an outcome (200 articles), studies among children and adolescence populations (4 articles), nonhuman studies (15 articles, including chemistry, animal, cell line, and isolated tissue studies), reviews / editorials / guidelines / letters / commentaries (185 articles), cross - sectional or retrospective studies (61 articles), and case reports (5 articles) (fig sixty - three articles were further excluded for at least one of the following reasons: updated data available from other studies in the same population or duplicate publications (3 articles), diabetes complications as major outcomes (33 articles), association measures for diabetes - related risk factors (19 articles), and lack of directly measured 25(oh)d levels (2 articles using predicted score). Our search strategy and inclusion / exclusion criteria resulted in a total of 21 independent prospective studies (extracting from 15 articles) being included in the current meta - analysis ., l.w ., and l.c.d.g .) Independently reviewed each eligible article and extracted relevant data examining the prospective associations of circulating levels of 25(oh)d with type 2 diabetes risk . Data extracted include population source, study design, follow - up period, sample size, subject characteristics (age, sex, and comorbid conditions), 25(oh)d assay methods, diabetes end points, and main study findings . When results were available only on different subpopulations in the same study (13,14,23), we separately extracted data for each subpopulation (study characteristics described in supplementary table 1). To provide quantitative evidence from all studies and maximize statistical power for hypothesis testing, we performed meta - analyses using dersimonian and laird s random - effects model with inverse - variance (se) weighting of individual study results (24) when data could be combined . The summary relative risks (rr) with 95% ci were calculated for the highest versus the lowest category of 25(oh)d levels . We also performed subgroup meta - analyses to explore potential effect modification by prespecified factors, including sex, follow - up duration, sample size of cases, adjustment for bmi, adjustment for bmi and other metabolic parameters (including hypertension, lipids, or inflammatory biomarkers), and 25(oh)d assay methods . Because the cochran q statistic has low statistical power (25), we also calculated the i and h statistics to reflect between - study heterogeneity . The percentage of i 25 (i = 25), 50 (i = 50), and 75 (i = 75) indicates low, medium, and high heterogeneity, respectively (26). The h statistic is a complement to the i statistic in assessing study heterogeneity; an h <1.2 indicates little heterogeneity, and an h> 1.5 raises caution regarding notable heterogeneity (26). We visually assessed publication bias using begg modified funnel plots, in which the rr was plotted on a logarithmic scale (log[rr]) against its se from each study . Publication bias was also assessed by two formal tests: begg adjusted rank correlation test and egger regression asymmetry test (27,28). The former was used to examine if there was significant correlation between the effect estimates and their variances, and the latter uses an inverse - variance weighted regression of the effect sizes on their precision (the inverse of se) to test whether the intercept deviates significantly from zero . We tested for possible nonlinear association between circulating 25(oh)d levels and type 2 diabetes using a quadratic polynomial spline regression analysis, considering a possibility of data perturbation at an extreme end of the exposure range (29). We also used the method described by greenland and longnecker (30) for the dose - response analysis to compute the linear trend from the correlated rrs and 95% cis across categories of 25(oh)d . The median level of 25(oh)d in each category was assigned to the corresponding rr when reported in the study . If not reported, the values assigned were the means or the midpoint of the lower and upper bound in each category . For extreme open - ended categories, half the width of the adjacent category was subtracted (for the lowest category) or added (for the uppermost category) to obtain the midpoint . The numbers of case and control subjects or person - years by category were also collected if available . All analyses were performed using the stata statistical software (version 10.1; stata corp ., college station, tx). Relevant studies were identified by searching medline and embase databases for all published articles up to 31 october 2012, using the search terms vitamin d, calcidiol, calcitriol, insulin resistance, insulin secretion, insulin sensitivity, glucose intolerance, glucose metabolism, beta - cell function, type 2 diabetes, and diabetes . The search was further restricted to english - language articles, human studies, and adult subjects aged 19 years . All prospective studies on this topic were considered eligible if they provided data on the relationship between baseline circulating levels of 25(oh)d and risk of type 2 diabetes . In the first round of screening (n = 542), 470 articles were excluded for at least one of the following reasons: studies that did not study circulating 25(oh)d as an exposure or type 2 diabetes as an outcome (200 articles), studies among children and adolescence populations (4 articles), nonhuman studies (15 articles, including chemistry, animal, cell line, and isolated tissue studies), reviews / editorials / guidelines / letters / commentaries (185 articles), cross - sectional or retrospective studies (61 articles), and case reports (5 articles) (fig sixty - three articles were further excluded for at least one of the following reasons: updated data available from other studies in the same population or duplicate publications (3 articles), diabetes complications as major outcomes (33 articles), association measures for diabetes - related risk factors (19 articles), and lack of directly measured 25(oh)d levels (2 articles using predicted score). Our search strategy and inclusion / exclusion criteria resulted in a total of 21 independent prospective studies (extracting from 15 articles) being included in the current meta - analysis . Three investigators (y.s ., l.w ., and l.c.d.g .) Independently reviewed each eligible article and extracted relevant data examining the prospective associations of circulating levels of 25(oh)d with type 2 diabetes risk . Data extracted include population source, study design, follow - up period, sample size, subject characteristics (age, sex, and comorbid conditions), 25(oh)d assay methods, diabetes end points, and main study findings . When results were available only on different subpopulations in the same study (13,14,23), we separately extracted data for each subpopulation (study characteristics described in supplementary table 1). To provide quantitative evidence from all studies and maximize statistical power for hypothesis testing, we performed meta - analyses using dersimonian and laird s random - effects model with inverse - variance (se) weighting of individual study results (24) when data could be combined . The summary relative risks (rr) with 95% ci were calculated for the highest versus the lowest category of 25(oh)d levels . We also performed subgroup meta - analyses to explore potential effect modification by prespecified factors, including sex, follow - up duration, sample size of cases, adjustment for bmi, adjustment for bmi and other metabolic parameters (including hypertension, lipids, or inflammatory biomarkers), and 25(oh)d assay methods . Because the cochran q statistic has low statistical power (25), we also calculated the i and h statistics to reflect between - study heterogeneity . The percentage of i 25 (i = 25), 50 (i = 50), and 75 (i = 75) indicates low, medium, and high heterogeneity, respectively (26). The h statistic is a complement to the i statistic in assessing study heterogeneity; an h <1.2 indicates little heterogeneity, and an h> 1.5 raises caution regarding notable heterogeneity (26). We visually assessed publication bias using begg modified funnel plots, in which the rr was plotted on a logarithmic scale (log[rr]) against its se from each study . Publication bias was also assessed by two formal tests: begg adjusted rank correlation test and egger regression asymmetry test (27,28). The former was used to examine if there was significant correlation between the effect estimates and their variances, and the latter uses an inverse - variance weighted regression of the effect sizes on their precision (the inverse of se) to test whether the intercept deviates significantly from zero . We tested for possible nonlinear association between circulating 25(oh)d levels and type 2 diabetes using a quadratic polynomial spline regression analysis, considering a possibility of data perturbation at an extreme end of the exposure range (29). We also used the method described by greenland and longnecker (30) for the dose - response analysis to compute the linear trend from the correlated rrs and 95% cis across categories of 25(oh)d . The median level of 25(oh)d in each category was assigned to the corresponding rr when reported in the study . If not reported, the values assigned were the means or the midpoint of the lower and upper bound in each category . For extreme open - ended categories, half the width of the adjacent category was subtracted (for the lowest category) or added (for the uppermost category) to obtain the midpoint . The numbers of case and control subjects or person - years by category were also collected if available . All analyses were performed using the stata statistical software (version 10.1; stata corp ., college station, tx). We included 15 publications (1116,18,19,23,3133) that met our inclusion criteria in our meta - analysis, which provided data from 21 independent studies [11 cohort studies (1113,17,18,20,21,3133), 8 nested case - control studies (14,15,19,23), and 2 case - cohort studies (16,33)] (fig . 1). These prospective studies comprised a total of 76,220 participants and 4,996 incident diabetes cases . As summarized in supplementary table 1, 13 studies were population - based (1214,16,17,20,21,23,32,33), and 2 studies included postmenopausal women only (18,19). Nineteen studies included largely whites (1118,20,21,23,32,33), and 2 studies included multiple racial / ethnic populations (19,31). The outcome of diabetes was ascertained using a combination of criteria, including diabetes - specific pharmacotherapy, diabetes - related hospitalization, self - report, and glycemic status information (1116,18,19). Five studies used the american diabetes association glycemic criteria for diagnosis (20,21,23,31,33). The assay method for 25(oh)d varied across studies . Radioimmunoassay was used in 8 studies (14,15,18,21,33), chemiluminescent immunoassay was used in 10 studies (1113,16,17,19,23,32), and only 3 studies used liquid chromatography tandem mass spectrometry, which is the gold standard to measure 25(oh)d (20,31,33). 2 shows the summary rr of type 2 diabetes comparing the highest to lowest category of 25(oh)d levels for hypothesis testing . The summary rr was 0.62 (95% ci 0.540.70), indicating a significant inverse association between baseline 25(oh)d levels and risk of type 2 diabetes . The p value for the cochran q test was 0.21, the h statistic was 1.1 (1.01.5), and the i statistic was 19% (053), indicating no evidence of significant between - study heterogeneity . The begg funnel plot for the visual assessment of publication bias showed that smaller rrs with large ses tended to be above the horizontal line, indicating a possibility of publication bias in favor of small studies with null findings (data not shown). However, the egger test (p = 0.39) and the begg test (p = 0.99) did not show evidence of publication bias . A random - effects meta - analysis of 21 independent prospective studies with adjusted rr and 95% ci of type 2 diabetes in relation to serum 25(oh)d levels (the highest category versus the lowest category). Ausdiab, australian diabetes, obesity and lifestyle study; dpp, diabetes prevention program; ely, medical research council ely study; epic, european prospective investigation into cancer - norfolk study; fmc, finnish mobile clinic health examination survey; hoorn, hoorn study; inter99, inter99 study; mfh, mini - finland health survey; monica1, danish monica1 survey; monica / kora, monitoring of trends and determinants in cardiovascular disease / cooperative health research in the region of augsburg study; nhs, nurses health study; ps, pizarra study; sdpp, stockholm diabetes prevention program . We conducted a sensitivity analysis to assess the extent to which individual studies with extremely large rrs influenced the summary rr . The exclusion of the study by anderson et al . (11) that included the largest sample size and rr estimate reduced between - study heterogeneity but did not appreciably change the summary rr (0.64; 95% ci 0.560.73; p for q statistic = 0.27, h = 1.1 [1.01.4], and i = 15% [050]). Omitting four studies from the earliest publication by knekt et al . (14), which included small sample size and heterogeneous results, also did not substantially influence the summary rr (0.61; 95% ci 0.550.68; p for q statistic = 0.46, h = 1.0 [1.01.4], and i = 0% [051]). The most recent study with the smallest number of cases (n = 37) yielded large variance in the effect estimate; removing this study led to almost the same summary rr (0.62; 95% ci 0.560.70; p for q statistic = 0.35, h = 1.0 [1.01.3], and i = 9% [044]). The inverse association between 25(oh)d and diabetes risk was consistently observed in men, women, and a mixed population of men and women . Associations tended to be stronger for men than for women alone, but the difference did not reach statistical significance . Nor did duration of follow - up, study sample size, diabetes diagnostic criteria, and 25(oh)d assay methods influence the summary rrs . Several studies presented rrs for 25(oh)d levels and type 2 diabetes with and without adjustment for metabolic variables, including bmi, hypertension, markers of glycemia and insulin sensitivity, plasma lipid levels, or inflammatory markers . The associations between 25(oh)d levels and diabetes risk were attenuated but remained statistically significant after adjustment for bmi and hypertension and/or other biomarkers: the rrs were 0.52 (95% ci 0.460.58) and 0.63 (0.560.72) in the models without and with adjustment for these covariates, respectively (p for interaction = 0.02). Likewise, adjustment for bmi alone slightly attenuated the association (p for interaction = 0.06). 3 shows the dose - response relation between circulating 25(oh)d and risk of type 2 diabetes . Overall, the test for a linear relation across the range of 25(oh)d from 20 up to 160 nmol / l was significant (p <0.0001). The rr for type 2 diabetes was 0.96 (95% ci 0.940.97) per 10 nmol / l increment in 25(oh)d . A significantly lower risk of type 2 diabetes became evident when 25(oh)d approximated 50 nmol / l . Because most studies had 25(oh)d ranges <100 nmol / l, current evidence for the relation of 25(oh)d of> 100 relation between the risk of type 2 diabetes and baseline levels of 25(oh)d in 18 independent prospective studies included in the meta - analysis . The circle size is proportional to the precision of the rr (inverse of variance). 2 shows the summary rr of type 2 diabetes comparing the highest to lowest category of 25(oh)d levels for hypothesis testing . The summary rr was 0.62 (95% ci 0.540.70), indicating a significant inverse association between baseline 25(oh)d levels and risk of type 2 diabetes . The p value for the cochran q test was 0.21, the h statistic was 1.1 (1.01.5), and the i statistic was 19% (053), indicating no evidence of significant between - study heterogeneity . The begg funnel plot for the visual assessment of publication bias showed that smaller rrs with large ses tended to be above the horizontal line, indicating a possibility of publication bias in favor of small studies with null findings (data not shown). However, the egger test (p = 0.39) and the begg test (p = 0.99) did not show evidence of publication bias . A random - effects meta - analysis of 21 independent prospective studies with adjusted rr and 95% ci of type 2 diabetes in relation to serum 25(oh)d levels (the highest category versus the lowest category). Ausdiab, australian diabetes, obesity and lifestyle study; dpp, diabetes prevention program; ely, medical research council ely study; epic, european prospective investigation into cancer - norfolk study; fmc, finnish mobile clinic health examination survey; hoorn, hoorn study; inter99, inter99 study; mfh, mini - finland health survey; monica1, danish monica1 survey; monica / kora, monitoring of trends and determinants in cardiovascular disease / cooperative health research in the region of augsburg study; nhs, nurses health study; ps, pizarra study; sdpp, stockholm diabetes prevention program . We conducted a sensitivity analysis to assess the extent to which individual studies with extremely large rrs influenced the summary rr . (11) that included the largest sample size and rr estimate reduced between - study heterogeneity but did not appreciably change the summary rr (0.64; 95% ci 0.560.73; p for q statistic = 0.27, h = 1.1 [1.01.4], and i = 15% [050]). Omitting four studies from the earliest publication by knekt et al . (14), which included small sample size and heterogeneous results, also did not substantially influence the summary rr (0.61; 95% ci 0.550.68; p for q statistic = 0.46, h = 1.0 [1.01.4], and i = 0% [051]). The most recent study with the smallest number of cases (n = 37) yielded large variance in the effect estimate; removing this study led to almost the same summary rr (0.62; 95% ci 0.560.70; p for q statistic = 0.35, h = 1.0 [1.01.3], and i = 9% [044]). The inverse association between 25(oh)d and diabetes risk was consistently observed in men, women, and a mixed population of men and women . Associations tended to be stronger for men than for women alone, but the difference did not reach statistical significance . Nor did duration of follow - up, study sample size, diabetes diagnostic criteria, and 25(oh)d assay methods influence the summary rrs . Several studies presented rrs for 25(oh)d levels and type 2 diabetes with and without adjustment for metabolic variables, including bmi, hypertension, markers of glycemia and insulin sensitivity, plasma lipid levels, or inflammatory markers . The associations between 25(oh)d levels and diabetes risk were attenuated but remained statistically significant after adjustment for bmi and hypertension and/or other biomarkers: the rrs were 0.52 (95% ci 0.460.58) and 0.63 (0.560.72) in the models without and with adjustment for these covariates, respectively (p for interaction = 0.02). Likewise, adjustment for bmi alone slightly attenuated the association (p for interaction = 0.06). 3 shows the dose - response relation between circulating 25(oh)d and risk of type 2 diabetes . Overall, the test for a linear relation across the range of 25(oh)d from 20 up to 160 nmol / l was significant (p <0.0001). The rr for type 2 diabetes was 0.96 (95% ci 0.940.97) per 10 nmol / l increment in 25(oh)d . A significantly lower risk of type 2 diabetes became evident when 25(oh)d approximated 50 nmol / l . Because most studies had 25(oh)d ranges <100 nmol / l, current evidence for the relation of 25(oh)d of> 100 relation between the risk of type 2 diabetes and baseline levels of 25(oh)d in 18 independent prospective studies included in the meta - analysis . The circle size is proportional to the precision of the rr (inverse of variance). On the basis of 21 prospective studies including 4,996 incident cases of type 2 diabetes and 76,220 nondiabetic controls, our meta - analysis showed a significantly inverse association between 25(oh)d levels and incidence of type 2 diabetes . The association was consistent and did not differ appreciably by sex, study size, follow - up duration, diabetes diagnosis criteria, or 25(oh)d assay methods . Blood 25(oh)d levels, which reflect all sources of vitamin d exposure and have a half - life of 2 to 3 weeks, have been widely used as a surrogate of vitamin d status (2,3). Due to differences in assay methods and population characteristics, vitamin d insufficiency has been previously reported to range from levels of 4075 nmol / l (1630 ng / ml), and vitamin d deficiency is generally defined as levels of <50 nmol / l (20 ng / ml) (2,34). Using 25(oh)d levels 50 nmol / l (20 ng / ml) to define vitamin d deficiency, data from 4,495 adults in the national health and nutrition examination survey 20052006 showed that the overall prevalence of vitamin d deficiency was 41.6%, with the highest rate found in blacks (82.1%), followed by hispanics (62.9%), others (57.6%), and whites (30.9%) (35). The iom s new guidelines for vitamin d intake and desirable blood levels, which were based on a systematic scientific review of available evidence at the time (1,22), state that a level of 50 nmol / l (20 ng / ml) of serum 25(oh)d is needed to maintain bone health for most individuals . The iom report called for additional research to clarify the relation of vitamin d levels with nonskeletal outcomes (1,22) epidemiological evidence relating lower circulating vitamin d levels to hyperglycemia, insulin resistance, or type 2 diabetes primarily derives from cross - sectional reports (4,810). Our dose - response curve showed an inverse and significant relation between 25(oh)d and type 2 diabetes across a broad range of 25(oh)d levels in diverse populations . Our results also confirmed that baseline 25(oh)d levels 50 nmol / l were significantly associated with a lower risk of type 2 diabetes, although further studies with higher power are required to provide more stable estimates of this association . The observed inverse association did not differ by sex, study sample size, duration of follow - up, diabetes diagnosis criteria, and 25(oh)d assay methods . An early pooled analysis of 2 nested case - control studies of 412 incident cases of type 2 diabetes and 986 control subjects found a strong inverse association in men but not in women (14). However, this finding of sex - specific relation of 25(oh)d with type 2 diabetes was not confirmed by subsequently published studies nor by our meta - analysis . It is likely that such sex difference resulted from residual confounding or statistical fluctuation due to small sample size . Increased storage of 25(oh)d in adipose tissue and less sun exposure due to limited mobility and/or excessive subcutaneous fat deposits in obese individuals will lead to low circulating levels of 25(oh)d (2,3). Conversely, vitamin d may directly affect adiposity and other metabolic parameters such as dyslipidemia, hypertension, and systemic inflammation that mediate the pathway from vitamin d status to type 2 diabetes (36,37). In this sense adjustment for adiposity and other obesity - related metabolic parameters may be an overadjustment, possibly underestimating the true association . Finally, with the exception of one study (31), all studies used a single measurement of 25(oh)d at baseline, which is not a time - integrated measure of vitamin d status . However, the summary rr of type 2 diabetes in relation to 25(oh)d did not differ by assay methods . Our findings of an inverse relation between 25(oh)d and type 2 diabetes are supported by biological evidence that vitamin d may be implicated in the pathogenesis of diabetes and its complications (36,37). A large body of literature has suggested that optimal vitamin d homeostasis is essential for insulin action and secretion (2,3), two fundamental features in the pathogenesis of type 2 diabetes . Clearly, direct evidence from ongoing (39) and future clinical trials of higher - dose vitamin d supplementation is warranted to clarify any beneficial effects of vitamin d on primary prevention of type 2 diabetes . Findings from our meta - analysis of observational studies will augment and complement findings from randomized trials of the effect of vitamin d supplements on type 2 diabetes . Although randomized trials are critical for establishing cause - and - effect relationships between vitamin d supplementation and health outcomes, they will not address all the potential questions because of their fixed dose (or at most, a few doses) of vitamin d and narrow range of 25(oh)d levels achieved by supplementation . Prospective observational studies allow us to assess 25(oh)d thresholds for diabetes risk across a broad spectrum of 25(oh)d levels . The largest randomized trial of vitamin d supplement to date, the women s health initiative (whi) clinical trial, has evaluated vitamin d plus calcium supplementation for fracture prevention in> 36,000 postmenopausal women (40). Secondary analysis of the whi trial with 33,951 initially nondiabetic women did not observe any effect from daily intake of 1,000 mg elemental calcium plus 400 iu vitamin d3 on incident diabetes over 7 years of follow - up (40). Of note, a dose of 400 iu / day vitamin d in the whi raised median levels of serum 25(oh)d from 42.3 to only 54.1 nmol / l (12 nmol / l), which is below the optimal value of 75 nmol / l or more for skeletal and nonskeletal health including type 2 diabetes (41). Similarly, secondary analysis of another large randomized trial, the randomized evaluation of calcium or vitamin d (record) trial, did not observe any effect from daily intake of 800 iu vitamin d3 on incident diabetes over 25 years, although such a daily dose raised serum 25(oh)d from 38 to 62 first, the observational nature of prospective studies included in our analysis cannot rule out residual confounding, although the consistency of our results across multiple strata and sensitivity analyses minimizes the likelihood that residual confounding explains the findings . Second, as in any meta - analysis, publication bias is possible, although our visual examination and formal tests did not suggest the presence of substantial publication bias . Finally, limited data from existing prospective studies lacked sufficient power to detect potential sex- or ethnicity - specific 25(oh)d thresholds or dose - response relations . In conclusion, our meta - analysis of 21 prospective studies demonstrates a significant inverse association between circulating 25(oh)d levels and risk of incident type 2 diabetes in a dose - response manner across a wide spectrum of 25(oh)d levels . Direct evidence from future randomized trials is warranted to clarify a cause - and - effect relationship between vitamin d and type 2 diabetes.
Bovine conceptuses were collected at day 18 post - insemination (or dpi; day of insemination as day 0). For each conceptus, the embryonic disc was dissected out and the extra - embryonic tissues stored in dmem supplemented with 10% fetal calf serum (fcs), on ice, until tissue digestion . Animal use and care were performed in accordance with the international guiding principles for biomedical research involving animals at the inra experimental farm (registered under no . Frtb910 in the national registry) and the protocols for these studies were approved by the local ethics committee (comit d'ethique en exprimentation animale du centre inra de jouy - en - josas et agroparistech (or comethea), registered as 12/084 and 12/086 in the national ethics committee registry . For the microarray analyses, 3 independent isolation and culture procedures were performed, each starting from 10 to 12 d18 embryos . Each derivation included the three cell types which were grown for up to 1 week . Btcs, bxecs, and bxmcs were isolated as previously described for human trophoblast cells . Briefly, the extra - embryonic tissues were digested with a sterile 0.05% (w / v) collagenase / trypsin solution (gibco life sciences) at 37 c . The pelleted cells were resuspended in dmem and filtered through a sterile 70-m filter (bd biosciences) prior to separation on a 55%20% percoll density gradient . All fractions were collected and cell viability was determined with trypan blue dye (invitrogen). Btcs were grown either on collagen iv- or matrigel - coated culture dishes, whereas bxecs and bxmcs were grown directly on plastic culture dishes in dmem (supplemented with 10% fcs, 2 mm glutamine, 100 iu / ml penicillin, and 100 g / ml streptomycin). Btcs, bxecs, and bxmcs were scraped off the culture dishes, put into 1.5 ml tubes, and centrifuged, and the cell pellets were snap - frozen and stored at 80 c until used . To isolate the three extra - embryonic cell populations, frozen d18 bovine conceptuses were sectioned into 10-m slices . From these, the trophoblast, extra - embryonic endoderm, and extra - embryonic mesoderm cells were micro - dissected, using the laser pressure catapulting technique adapted from a previous study . Total rna was isolated using the rneasy mini kit with in - column dnase digestion (qiagen) and t7 linear amplification was performed using the messageamp arna kit (ambion) after bias assessment . Briefly, 1 g of total rna was incubated with 500 ng of an anchored t7-(dt) primer in 12 l (water) at 70 c for 10 min . The 1st cdna strand was synthesized by the addition of 2 l first - strand buffer, 1 l rnase inhibitor, 4 l dntp mix and 1 l reverse transcriptase mix and incubation at 42 c for 2 h. the second strand synthesis was performed by the addition of 63 l depc - treated water, 10 l second - strand buffer, 4 l dntp mix, 2 l dna polymerase, 1 l rnase h and incubation at 16 c for 2 h. dna was extracted with phenol: chloroform: isoamyl alcohol and precipitated in ethanol with 20 g glycogen (ambion). In vitro transcription was carried out at 37 c for 10 h in a 20 l reaction volume . 1 l dnase was added and incubated at 37 c for 30 min . Rna was purified on mini quick spin rna columns (roche diagnostic) and its quality verified on rna 6000 lab - chips (bioanalyser 2100; agilent technologies). Briefly, 500 ng of amplified rna (arna) was labeled with [p] datp by reverse - transcription and hybridized to an inra bovine 10k array (gpl7417) using expresshyb hybridization solution (clontech) at 68 c overnight . Arrays were washed four times in 2 ssc, 1% sds and once in 0.1 ssc, 0.5% sds at 68 c for 30 min each . The hybridization signals were quantified with imagene 5.5 software (biodiscovery) on the pict / ice platform . These datasets are available in the gene expression omnibus database (http://www.ncbi.nlm.nih.gov/geo, gse52967). Bovine conceptuses were collected at day 18 post - insemination (or dpi; day of insemination as day 0). For each conceptus, the embryonic disc was dissected out and the extra - embryonic tissues stored in dmem supplemented with 10% fetal calf serum (fcs), on ice, until tissue digestion . Animal use and care were performed in accordance with the international guiding principles for biomedical research involving animals at the inra experimental farm (registered under no . Frtb910 in the national registry) and the protocols for these studies were approved by the local ethics committee (comit d'ethique en exprimentation animale du centre inra de jouy - en - josas et agroparistech (or comethea), registered as 12/084 and 12/086 in the national ethics committee registry . For the microarray analyses, 3 independent isolation and culture procedures were performed, each starting from 10 to 12 d18 embryos . Each derivation included the three cell types which were grown for up to 1 week . Btcs, bxecs, and bxmcs were isolated as previously described for human trophoblast cells . Briefly, the extra - embryonic tissues were digested with a sterile 0.05% (w / v) collagenase / trypsin solution (gibco life sciences) at 37 c . The pelleted cells were resuspended in dmem and filtered through a sterile 70-m filter (bd biosciences) prior to separation on a 55%20% percoll density gradient . All fractions were collected and cell viability was determined with trypan blue dye (invitrogen). Btcs were grown either on collagen iv- or matrigel - coated culture dishes, whereas bxecs and bxmcs were grown directly on plastic culture dishes in dmem (supplemented with 10% fcs, 2 mm glutamine, 100 iu / ml penicillin, and 100 g / ml streptomycin). Btcs, bxecs, and bxmcs were scraped off the culture dishes, put into 1.5 ml tubes, and centrifuged, and the cell pellets were snap - frozen and stored at 80 c until used . To isolate the three extra - embryonic cell populations, frozen d18 bovine conceptuses were sectioned into 10-m slices . From these, the trophoblast, extra - embryonic endoderm, and extra - embryonic mesoderm cells were micro - dissected, using the laser pressure catapulting technique adapted from a previous study . Total rna was isolated using the rneasy mini kit with in - column dnase digestion (qiagen) and t7 linear amplification was performed using the messageamp arna kit (ambion) after bias assessment . Briefly, 1 g of total rna was incubated with 500 ng of an anchored t7-(dt) primer in 12 l (water) at 70 c for 10 min . The 1st cdna strand was synthesized by the addition of 2 l first - strand buffer, 1 l rnase inhibitor, 4 l dntp mix and 1 l reverse transcriptase mix and incubation at 42 c for 2 h. the second strand synthesis was performed by the addition of 63 l depc - treated water, 10 l second - strand buffer, 4 l dntp mix, 2 l dna polymerase, 1 l rnase h and incubation at 16 c for 2 h. dna was extracted with phenol: chloroform: isoamyl alcohol and precipitated in ethanol with 20 g glycogen (ambion). In vitro transcription was carried out at 37 c for 10 h in a 20 l reaction volume . 1 l dnase was added and incubated at 37 c for 30 min . Rna was purified on mini quick spin rna columns (roche diagnostic) and its quality verified on rna 6000 lab - chips (bioanalyser 2100; agilent technologies). Briefly, 500 ng of amplified rna (arna) was labeled with [p] datp by reverse - transcription and hybridized to an inra bovine 10k array (gpl7417) using expresshyb hybridization solution (clontech) at 68 c overnight . Arrays were washed four times in 2 ssc, 1% sds and once in 0.1 ssc, 0.5% sds at 68 c for 30 min each . The hybridization signals were quantified with imagene 5.5 software (biodiscovery) on the pict / ice platform . These datasets are available in the gene expression omnibus database (http://www.ncbi.nlm.nih.gov/geo, gse52967).
Citing statistics from the american cancer society, harold varmus noted that we have made depressingly little progress in combating cancer . While over the past 50 years dramatic strides have been made against cardiovascular and infectious diseases, age - adjusted mortality in patients with cancer has declined only slightly, with the decrease mostly related to the drop in lung cancer - caused deaths due to aggressive efforts to discourage cigarette smoking . The discovery of the first oncogene in 1976 triggered a wave of discoveries into oncogenes (genes which increase the risk of developing cancer when mutated) and tumor suppressor genes (tsgs, genes which typically appear in pathways controlling cell growth and regulation). In succeeding decades, these insights were exploited by drug discovery researchers, aiming to displace standard chemotherapeutic drugs (empirically discovered cytotoxics) with agents targeting oncogenes (molecular targeted drugs). This approach led to one notable success, novartis' gleevec for chronic myelogenous leukemia (cml), a disease linked to the philadelphia chromosome, an aberration of chromosomes 9 and 22 . Overall, however, the new wave of chemotherapeutic research has been described by researchers at the dana - farber cancer institute as neocytotoxics, a reference to their tendency to show unacceptable toxicity at therapeutic doses like the older drugs . This relative lack of success in discovering novel chemotherapeutic drugs prompts the questions of how well we really understand the basic mechanisms underlying cancer and whether there are other avenues of exploration worthy of greater attention . In this review, i focus on the intertwined mechanisms of protein folding and proteostasis and on the balance between production and destruction of proteins in cells . What draws our attention here are two distinct advances: first, the recent clinical successes of velcade (bortemozib), a drug that inhibits the protein destruction pathway, which was approved in 2003 by the food and drug administration (fda) of the us for use in refractory multiple myeloma; and second, the multiplicity of hsp90 inhibitors in phase ii clinical trials (hsp90 is one of the chaperone proteins intimately involved in protein folding mechanisms). Based on these developments and a better understanding of protein homeostasis, i aim here to provide information that may lead to a novel perspective on cancer, with a focus on the dynamic state of the proteome as it relates to cancer . This perspective yields intriguing insights into why so little progress has been made in the development of cancer chemotherapies and indicates alternative directions . In particular, this perspective provides a focus on the work of whitesell and lindquist who have proposed, in essence, a novel theory of cancer, asserting that cancer cells acquire a hyper - mutating phenotype and further claiming that control of cancer will best be achieved by modulating cells' ability to adapt and evolve in response to selection pressures . One can best understand and appreciate this perspective after an overview of basic biochemical and cellular processes . I start with a review of in vitro protein folding, describing the spontaneous process by which a linear chain of amino acids acquires the precise three - dimensional (3d) structure required for the protein's function . Next, i describe how this folding occurs in the crowded and chaotic internal environment of the cell: this is not a simple spontaneous process; rather, this process is mediated by a class of proteins, chaperones or heat - shock proteins (hsps), as a mechanism to reduce the likelihood of misfolding and loss of function. The third section describes why protein folding is only one part of the broader mechanism of proteostasis (protein homeostasis) (figure 1), by which proteins in the cell are constantly degraded and created anew, and that degradation is a specific atp - dependent process occurring in the ubiquitin - proteosome system . The first clue to this link between proteostasis and cancer emerged in 1981, when hsps were first linked to cancer by oppermann et al ., who found that hsp90 coimmunoprecipitated with the src oncogene protein . Another observation linking these proteostasis processes to cancer is that, while most proteins have cellular half - lives of 12 h, many oncogene proteins and tsg proteins have half - lives of a few minutes . Of a particular note, p53, which has been nicknamed the guardian of the genome for its role in dna repair and is a protein that is mutated in over 50% of all cancers, has a half - life of only 20 min . P53 is constantly being synthesized, folded, and degraded, and its half - life is extended in response to various cellular stresses. The final section concludes by describing how this understanding that linking protein folding, proteostasis, and cancer may point to future directions in the discovery and development of cancer chemotherapy . The hallmarks of cancer are all phenotypic . Yet the standard perspective states cancer is a disease of the genes, which places the focus purely on the genotype . In the perspective presented here, it does not suffice to focus purely on the genotype we must also understand the means by which the phenotype results from the genotype, both in the cases where the genotype is normal and in those cases where the genotype has undergone changes that characteristic of cancer . Protein folding and proteostasis are the central mechanisms by which the phenotype emerges from the genotype . In this section, we delve into how protein folding functions in vitro (pathway #1, figure 1), that is, when the genome is pristine and is in a state that does not yet require the cellular apparatus designed to assist folding under stress conditions . With this as background knowledge, we can proceed in following sections to elaborate how protein folding functions in vivo, under stress conditions such as elevated temperature or mutations, and explore how this may relate to cancer . Christian anfinsen shared the 1972 nobel prize in chemistry for his work on protein folding . His nobel lecture, studies on the principles that govern the folding of protein chains, succinctly describes conclusions that set the paradigm for in vitro protein folding to this day . A random conformation of a polypeptide chain in an aqueous environment will acquire a specific, unique 3d conformation . With a modest increase in temperature, a protein will lose its original 3d structure but will recover it when the temperature returns to normal . With modest increases in temperature (1c2c), however, this conformation will turn into a random set of conformations, and it may not revert to the original 3d structure because of denaturation (as in cooking an egg). Anfinsen studied the protein ribonuclease, with its multiple disulfide bridges, and focused on the reversibility of its heat - induced denaturation . Based on these results, he concluded that the primary sequence of a protein completely determines its 3d conformation, and that the process of protein folding was based strictly on thermodynamics . He phrased this the thermodynamic hypothesis: this hypothesis states that the three - dimensional structure of a native protein in its normal physiological milieu (solvent, ph, ionic strength, presence of other components such as metal ions or prosthetic groups, temperature, etc .) Is the one in which the gibbs free energy of the whole system is lowest; that is, that the native conformation is determined by the totality of interatomic interactions and hence by the amino acid sequence, in a given environment . From this thermodynamic hypothesis, anfinsen also concluded that the 3d structure would not be significantly altered by mutations of residues on the surface of a protein, or mutations of an inner residue when changed to a residue of comparable size, hydrophobicity, etc . Conversely, mutations on inner residues which change the size or hydrophobicity (e.g. An ala glu or an ala ser mutation) had potential to alter the folding from the wild - type 3d structure . Even with anfinsen's thermodynamic hypothesis, the kinetics of protein folding, the rate at which this thermodynamic optimum is achieved, remains a puzzle . The number of conformations that should be sampled from a polypeptide chain to find the correct 3d conformation is astronomical, greater than the number of atoms in the universe . The levinthal's paradox is the name given to the puzzling question of how a protein can fold in a few minutes, given the vast number of conformations randomly sampled . Whereas anfinsen assumed there must be some types of nucleation events (small subsequences folding into specific 3d structures which seed the formation of the full protein structure), subsequent theoretical and experimental studies on the kinetics of protein folding led to the notion of protein folding funnels (figure 3a). The notion that a folding pathway is funnel - shaped means that a huge number of conformations are initially explored by many paths in parallel (wide top of the funnel), with a steady winnowing out of the least - promising sets of conformations (middle of the funnel) and final selection of the thermodynamic optimum proceeding via a small number of folding pathways (bottom of the funnel). Figure 3a illustrates a smooth folding funnel that pertains to small proteins, ones which fold extremely fast in a few microseconds, near the theoretical folding speed limit . The smooth funnel indicates that there are few if any kinetic traps, namely conformations that are stable but will not lead to the final global thermodynamic optimum . Figure 3b depicts a rugged landscape, a protein folding funnel with many kinetic traps . As shown in figure 3c, if dependent solely on random motion of molecules, it would take a long time for the rare occurrence that will permit a conformation to jump out of this trap . Figure 4 shows a schematic of what such a kinetic trap might look like; one pair of hydrophobic interactions is satisfied in a way that doesn't permit the other pair to form . Another insight that emerged from recent theoretical studies of protein folding is that the dominant driving force consists of hydrophobic interactions, the tendency for hydrophobic sidechains (val, leu, ile, ala, phe, tyr, trp) to escape an aqueous environment and seclude themselves with similarly hydrophobic sidechains in a hydrophobic interiorhydrophobic collapse . Pauling made the spectacular prediction of the alpha - helix, as a regular motif for protein structures a decade before the first experimental structure was elucidated . This was based on the assumption that hydrogen - bonds would form along backbone peptide units spaced three residues apart . By contrast, it is now thought that helices (and other elements of secondary structures) begin to form as a result of constraints imposed by hydrophobic collapse, with hydrogen - bonds rigidifying these helices but their overall effect being secondary to the much stronger hydrophobic forces . An interesting test of anfinsen's hypothesis was done in 1992, when a series of d - amino acids (mirror image of standard l - amino acids) were chemically linked according to the sequence of human immunodeficiency virus (hiv) protease . As expected, this led to a protein that was in every way the mirror image of the native hiv protease: it cleaved mirror image substrates with the same specificity, it bound mirror image inhibitors with the same affinity, achiral physicochemical measurements were the same, and chiral ones were of the opposite sign . This section on protein folding in vitro concludes with the observation that the types of conformations shown in figure 4 are prone to aggregation, as depicted in figure 5 . When hydrophobic elements are exposed on the surface of a protein, they may interact with hydrophobic elements of other proteins to escape the aqueous environment . When multiple such surface - exposed hydrophobic elements are present, the potential exists for protein aggregation, forming insoluble aggregates that are often toxic to cells . Protein folding in vivo is quite different from that in vitro . For medium- to large - sized proteins it occurs much faster than one might expect, typically in the range of milliseconds to seconds . It takes place in the crowded internal environment of the cell, where many intermolecular interactions could potentially disrupt the normal protein folding pathway . Protein folding in vivo is facilitated by chaperones, also known as hsps or stress proteins . Hsps were first isolated in 1975 by lindquist et al .. the first speculation about the function of hsps evidently was published in 1986 by pelham in a breathtaking leap of insight . He had found that the heat - shocked nucleoli recovered more rapidly after overexpression of hsp70 in an atp - dependent manner . Pelham's model proposes that during heat shock, proteins become partially denatured, exposing hydrophobic regions which then interact to form insoluble aggregates . By binding tightly to hydrophobic surfaces, hsp70 limits such interactions and promotes disaggregation . The term the proportion of proteins that spontaneously fold in the cell is thought to be approximately 10%; the rest rely on chaperoned folding . Chaperones are highly conserved, being present in prokaryotes and eukaryotes, and, as i will note below, are important for the folding of the equally conserved oncogenes and tumor suppressor genes . Chaperones are ubiquitous and up - regulated in response to a variety of cell stresses, such as heat, mutations, heavy metals, etc . Chaperones constitute 1%2% of the total weight of proteins in a cell, and they range in size from the 1530 kda small hsps, to the over 100-kda hsp100/cip family ., one can think of them as converting a rugged protein folding funnel into a smooth one, eliminating kinetic traps and speeding up achievement of the thermodynamic optimum . This leads to a profound proposition concerning the role of hsps in cellular evolution, namely that hsps act as a buffer, hiding the natural phenotypic variations present in cells, which are unmasked in response to stress . In this view, hsps expedite the cell' s ability to evolve in response to stress . For example, hsp70 overexpression has been shown to correlate with certain types of drug resistance, as a response to the stress of drug therapy . Hsps act as a buffer in four stages (figure 6): (1) as the nascent polypeptide chain emerges from the ribosome, chaperones protect it from premature folding; (2) the polypeptide chain acquires the approximate overall 3d conformation; (3) the polypeptide chain iteratively folds and re - folds in a confined cage until the final 3d conformation is achieved . In addition, it may make sense to describe a fourth category; and (4) chaperones unfold a misfolded and/or aggregated protein . Misfolded proteins that cannot be properly folded are marked for degradation, the topic of the next section . (1) in bacteria, a chaperone called the trigger factor (tf) is found proximal to the ribosome and protects the nascent chain from premature folding . In eukaryotes, the homologous factor is the ribosome - associated complex (rac), sometimes in association with nascent chain - associated complex (nac). The protection is a necessary step, as ribosomal synthesis occurs at a rate of about 10 residues / sec, whereas the rate of folding in vitro is 10 residues / microsec . (2) in eukaryotes, as the full protein is released from the ribosome, hsp40 and hsp70 assist in ensuring the overall 3d conformation is approximately achieved . (3) the final stage of folding occurs iteratively, in which the partially - folded protein interacts with a chaperone and is then released . One way this is accomplished is by the pre - folded protein entering the cavity of barrel - shaped complexes termed groes / groel in bacteria and tric / cct in eukaryotes (figure 7). This creates a protected environment in which the protein can properly fold in a way that may be understood conceptually as an anfinsen cage, where the compact environment limits the range of possible extended conformations that may be sampled . Another path in this final stage of folding is via interactions with hsp90, a dimeric protein with each monomer containing three regions: an n - terminal atp - binding domain, a linker, and a c - terminal dimerization domain (figure 8). The precise nature of hsp90 interactions with a pre - folded protein has not been resolved . (4) members of the hsp100/cip family of chaperones appear to interact with misfolded and/or aggregated protein, in effect undoing the damage . As part of a broad network of chaperones, they appear to be able to disassemble stable complexes; to unfold highly stable native protein domains; and to help to resolubilize and refold non - native proteins trapped in a high molecular weight aggregate . The function of hsp104 has been described as a molecular crowbar: it functions by prying apart aggregates . Hsp104, which has multiple binding sites, can bind multiple components within the same aggregate . The hsp104 domains that contact the aggregate undergo an atp - driven conformational change that separates or further unfolds the misfolded aggregates and then releases them . Newly exposed hydrophobic elements, shielded by chaperones such as hsp70 and hsp40, are transiently protected from reaggregation . Hsp104 acts iteratively, eventually resulting in the release of hsp70-bound folding intermediates that have a renewed opportunity to proceed to the native state . From the perspective of identifying novel drug targets for cancer, this multiplicity of hsps throughout protein folding provides many opportunities for modulating these stages of folding with therapeutic agents . Agents targeting hsp90 have been tested in phase iii clinical trials, whereas hsp70 is still in basic research phase . There are seemingly endless variations on the overall protein - folding processes as outlined above . Transporting the protein across membranes may require one pre - folded conformation; final folding then occurs after the protein is in the target organelle (e.g. The endoplasmic reticulum). Exemplified by estrogen receptor, final folding occurs only when that protein is in complex with hsp90 and other factors, and its ligand, progesterone (figure 9). Hsp90 forms complexes with many distinct factors, probably explaining its ability to assist the folding of a huge variety of proteins, such as p53 . The previous sections discussed the processes by which proteins are created, and acquire their functional 3d structure . Once it became clear that proteins constantly turn over, with degradation occurring rapidly, specifically, and in an atp - dependent manner, attention focused on the processes of protein degradation . This ultimately led to the isolation of a cell - free system for atp - dependent proteolysis in 1978, now called the ubiquitin - proteasome system (ups), which is responsible for most proteolysis in the cell . Attention was drawn to the ups as a cancer drug target by the 2003 approval of the proteosome inhibitor velcade / bortemozib for multiple myeloma . One year later, the discovery of the ups was rewarded by the nobel prize to ciechanover, hershko, and rose; their lectures represent a concise introduction to this system. The proteolytic machinery of the ups is comprised of the proteosome, a 2.5-mda multicomponent system consisting of a barrel - shaped 20s catalytic core particle with a 19s regulatory particle capping both sides of the core particle (figure 10). A protein tagged with a poly - ubiquitin tail is recognized by the proteosome and unfolded near the cap, with proteolysis occurring deeply within the core particle . Tagging for protein degradation is accomplished in a series of steps, ultimately resulting in a poly - ubiquitin sequence tag covalently attached to a lysine of the substrate protein . This pathway, summarized in figure 11, involves a series of enzymes: e1 (ubiquitin - activating enzyme), e2 (ubiquitin - conjugating enzyme), and e3 (ubiquitin - protein ligase). Step 2 uses the e1-ubiquitin complex, e2, e3, and s (the substrate protein to be tagged for degradation), to form the complex ubi.e2.e3.s . Step 4 cleaves this poly - ubiquitinated complex to form the final tagged substrate, recognized by the proteosome . The ups is also becoming recognized as an important component that is involved in biological processes which are related to a variety of disorders with cancer - related phenotypes . One example is von - hippel - lindau (vhl) syndrome, which is a rare autosomal - dominant condition with hemangioblastomas in the kidneys, retina, cerebellum, and spinal cord, resulting from a mutation in the vhl tumor suppressor gene . The mechanism by which vhl gene functions involves the ups, whereby the protein product of this gene interacts with the hypoxia - inducible factor-1 (hif-1) in response to the cell stress of insufficient oxygen (hypoxia). Under normal conditions, in the presence of oxygen, hif-1 is synthesized, rapidly converted into a form which is recognized by pvhl (the protein product of the vhl gene), and subjected to ubiquitination and proteosomal degradation, with an overall half - life of 10 min . Under hypoxic conditions, hif-1 remains in a form not recognized by pvhl, and hence is not degraded . Thus hif-1 is free to promote transcription of genes such as vascular endothelial growth factor (vegf), a feedback signaling factor that promotes vascularization to facilitate the return to normal conditions (figure 12). Another point of interest about pvhl degradation is that chaperones can be involved: e.g. Chaperone hsp90 is not involved in vhl folding but is essential for its degradation . This is an intriguing example of where chaperones are involved in the degradation process rather than the protein folding process; and, here, degradation of a protein involved in a disease is associated with cancer formation, and links proteostasis with cancer and with chaperones in particular . The ups also plays a key role in regulating cellular levels of p53, with a half - life of only 20 min in normal cells . P53 is the protein which functions as the guardian of the genome, and is mutated in over half of all cancers . In response to dna damage stress such as ultraviolet radiation, p53 levels rise and cells are driven to apoptosis (programmed cell death). P53 acts as a transcription factor that induces the expression of many genes, one of which is mdm2, that codes for a protein mdm2 that shepherds translocation of p53 from the nucleus to the ups for degradation . This feedback loop has a transcriptional delay that ensures a brief burst of elevated p53 levels in response to stress . A final point on the ups is that misfolded proteins are subjected to a higher rate of degradation than are normal proteins, but these recognition processes are incompletely understood . How the cell distinguishes properly - folded proteins from misfolded ones, given its complexity, is an intellectually fascinating puzzle . It is difficult to even imagine all the types of molecular recognition processes that must be involved to maintain a careful balance . We recently have been reminded all cancers arise as a result of changes that have occurred in the dna sequence of the genomes of cancer cells . An alternative, and perhaps an important addition, to this hypothesis would be to consider and focus on the dynamic cellular processes centered on the proteome, and the process of proteostasis outlined above . The links between chaperones and cancer were first identified almost 30 years ago, and the evidence continues to grow, indicating that chaperones and protein homeostasis likely play an important role in cancer formation, and thus, present multiple opportunities for therapeutic intervention . In 1981, shortly after the discovery of oncogenes, researchers observed that hsps co - immunoprecipitated with the src oncogene . The authors concluded it would also seem wise to search for other overlaps between the heat shock response and virus - induced neoplastic transformation a dramatic leap forward occurred in 1994 when whitesell et al . Identified the mechanism of geldanamycin - induced reversal of the neoplastic transformation as inhibition of hsp90 . Many hsp90 inhibitors are now undergoing evaluation in clinical trials. The 2003 approval of the proteosome inhibitor velcade / bortemozib for multiple myeloma further supports the ups as a cancer drug target . Is replete with well - known oncogenes and tumor suppressor genes: src, akt, bcr - abl, etc . Hsp90 levels often are higher in cancer cells than in normal cells, and hsp expression in breast or gastric cancer is associated with poor prognosis and resistance to chemotherapy or radiotherapy . The connections between the hemangioblastomas of vhl syndrome and hsp90's involvement in pvhl degradation were mentioned above . Other hsps are also suspected to be involved in cancer formation: e.g. Down - regulation of hsp70 has been shown to increase apoptosis in cancer cells, while leave normal cells unaffected which raises an intriguing idea of considering hsp70 as a potential cancer - specific target . Mdm2, mentioned above as a protein involved in p53 degradation, is one example: inhibitors (nutlins) of the p53/mdm2 interaction were reported in 2004 to shrink tumors in xenograft models . Nedd8 is another protein involved in the ups; inhibitors of the enzyme which activates nedd8 were recently found to be effective in suppressing the growth of human tumor xenografts in mice . The homeostatic regulation of p53 illuminates how the dual processes of protein synthesis / folding and protein degradation may be directly connected to neoplastic transformation . The 20-min half - life of p53 in the cell is unusually short and its levels, regulated by proteostasis, rise very quickly in response to stressors even though its mrna levels remain constant . Mutations in p53 gene are found in 30%50% of all cancers, and the mutations predominate in a particular class, i.e. Point mutations in its dna - binding domain . Chaperoned folding of p53 is especially complex, involving a variety of co - chaperones . Cancer cells, even those homozygous for mutations in p53, often have high levels of p53, which may facilitate a variety of mutation - induced mechanisms to run amok . In this regard, application of hsp90 inhibitors has been demonstrated to lower p53 levels and induce apoptosis . In 1994, whitesell et al . Identified the mechanism of geldanamycin - induced reversal of the neoplastic transformation as inhibition of hsp90 . In 1998, taking these two findings together, whitesell and lindquist have proposed a novel theory of cancer, centered on the role of chaperones . Hsp90 can conceal inherent genetic variation within populations of cells, allowing polymorphic variants of crucial signaling pathways to accumulate cryptically while the overall normal phenotype is maintained . This buffering capacity of hsp90 funnels complex developmental processes into discrete outcomes despite underlying genotypic variations . Under stress, some of the unstable hsp90 clients may become more unstable, increasing the demand for hsp90 to facilitate refolding of its usual clients and that of these new stress - destabilized proteins . New phenotypes can emerge when this buffering capacity of hsp90 is exceeded, exposing previously hidden genetic variations to natural selection . In cancer, hsp90 might function as a buffer of the extensive genetic heterogeneity common to cancer . Furthermore, whitesell and lindquist explain hsp90 has a more complex role in facilitating neoplastic transformation than simply inhibiting apoptosis . The dynamic, low - affinity interactions of hsp90 with its client proteins such as hormone receptors, transcription factors and kinases maintain them in a latent but readily activated state . Oncogenic mutation of such clients, however, leads to higher requirements for hsp90 function, presumably because of an exaggerated conformational instability of the mutant . Molecular targetingusing genetic information that links specific proteins to cancer has led to one spectacular success: novartis' gleevec is effective against cml, a disease linked to the philadelphia chromosome with a frequency exceeding 95% . Approved in 2001 to much justifiable acclaim, gleevec promised to be a harbinger of a new wave of molecularly - targeted therapeutics the magic bullet for cml, designed to inhibit the tyrosine kinase bcr - abl, the oncogene activated via the philadelphia chromosome . Even oncology researchers at novartis now conclude that gleevec may be more an outlier than a standard - bearer for the next wave of therapy . Gleevec is the great exception; most new chemotherapies could be considered to be neocytotoxics, an unflattering reference to their tendency to show unacceptable toxicity at therapeutic doses (i.e. They have a marginal therapeutic index). Chemotherapy for cancer has the highest attrition rate of any therapeutic area: fewer than 10% of drug candidates entering phase i trials are ultimately approved for commercial use . Fallout in the clinic is primarily due to drug toxicities, i.e. Their inability to achieve an advantageous therapeutic index . If we are to make significant progress against cancer, we need to move beyond developing more neocytotoxics . The standard paradigm often leads to drug candidates that inhibit rapidly dividing cells, which hits both cancer cells and the rapidly dividing cells of the epithelia, leading to the harsh side - effects of chemotherapy . This approach naturally leads to a low therapeutic index and the duration of efficacy is frequently only 612 months, as cancer cells appear to evolve in response to the selection pressure of the drug . Whitesell and lindquist clearly recognized the implications of the theory of cancer: such an evolutionary view of the malignant progression problem suggests that definitive control of a cancer will probably be achieved most effectively by altering the key determinants that shape its ability to adapt and evolve . Consequently, hsp90 might provide a broader, more effective target for anticancer therapies than single, oncogenically activated but dispensable signaling pathways that are the focus of most current drug - discovery efforts . This is a very provocative suggestion saying that the key to controlling cancer is to modulate a cell's ability to evolve . This is a testable hypothesis, and one that, if true, would significantly alter our approach towards the discovery and development of chemotherapeutic agents . That cancer cells are hyper - evolving may also explain the difficulty in finding chemotherapies whose effectiveness extends beyond 612 months: cancer cells may be evolving away from the selection pressure of a drug . Appreciating the role of proteostasis in the cell, including the role of chaperones in facilitating proper protein folding and the role of the ups in protein degradation, yields a novel perspective on cancer, which focuses on the dynamic state of the proteome and the evolving phenotypes of cancer cells . Research on this proteostasis network has yielded one approved drug, with many others undergoing clinical evaluation . We may well be in the early days of fully exploiting protein folding and proteostasis to devise better cancer chemotherapeutic agents . There are many outstanding questions in this area, the subjects of much current researches: how do chaperones recognize improperly folded proteins? What is the precise mechanism by which hsp90 inhibition by geldanamycin diminishes p53 levels? (hsp70, from early studies, certainly seems of potential interest .) Of all possible intervention points in the proteostasis network, which are best for chemotherapy? Which have sites most amenable to inhibition by an orally - available small molecule? Which will provide the best therapy with the least toxicity? What are the full implications of the notion of hsps' buffering evolutionary change? How can this hypothesis be properly evaluated as a theory of the origin of cancer? What is the precise mechanism of the neoplastic transformation, and what roles do chaperones specifically play? Understanding protein misfolding and proteostasis should lead to their exploitation in the development of novel and improved cancer chemotherapeutics.
Pathological femoral shaft fractures are mainly attributed to osteoporosis, preexisting femoral pathology, etc . [1, 2]. Uncommonly, there can also be stress fractures of the diaphysis of femur . Treatment includes intramedullary nailing or surface fixation depending on the age, etiology of fracture, surgeon s preference, and clinical scenario . Resection arthroplasty of hip includes removal of necrotic bone in proximal femur along with the prosthesis and cement if present . Although uncommonly done nowadays, it is described as a treatment option in cases of periprosthetic recalcitrant infection, septic sequelae, recurrent hip dislocation, etc . . Pseudarthrosis of neck of femur is a common occurrence because of precarious blood supply to neck of femur, lack of cambium layer in periosteum, inadequate fixation, lack of anatomical reduction, etc . . Resection arthroplasty of hip and pseudarthrosis of neck presents as loss of proximal fulcrum for fracture diaphysis of femur to occur . We present two cases with the unique scenario of fracture diaphyseal femur concurrent with resection arthroplasty of hip / pseudarthrosis neck of femur operated surgically . Till date, only one similar case is reported of subtrochanteric fracture in femur post - girdlestone arthroplasty treated with intramedullary nail . In this report, we intend to highlight the unusual occurrence, probable mechanism of injury, risk factors, and clinical decision - making in the surgical management of such a condition . A 70-year - old lady came to trauma center with pain and swelling in the left thigh . She gave history of slip and fall at home with thigh directly hitting the table . Radiographs of thigh suggested diaphyseal fracture left shaft femur with greater trochanter as a separate fragment and ipsilateral excision arthroplasty of the hip (fig . There was no other associated injury, and distal neurovascular examination was within normal limits . She had resection arthroplasty done in ipsilateral hip 15 years ago for an infected total hip replacement arthroplasty (cemented). Before fall she was operated in the form of open reduction internal fixation with locking compression plate (fig . (a) radiograph showing fracture shaft femur with butterfly fragment and ipsilateral resection arthroplasty done with greater trochanter as separate fragment . (b) immediate post - operative radiograph showing fracture fixation with locking compression plate . A 65-year - old lady presented with spiral proximal diaphyseal fracture following a trivial fall at home . Further radiographs suggested that she had pseudarthrosis at neck of femur due to neglected fracture neck of femur (fig . After adequate pre - operative work up and planning, she was operated with closed intramedullary nailing (fig . (a) radiograph showing spiral fracture proximal diaphysis femur with ipsilateral pseudarthrosis of neck of femur . (b) immediate post - operative radiograph showing fracture fixation with intramedullary nail . (c) after surgery, both patients were mobilized nonweight bearing for 6 weeks followed by gradual weight bearing walking . Knee range of motion exercises and quadriceps strengthening was started in immediate post - operative phase . At 3 months, radiograph showed good callus formation and full weight bearing walking was started (fig . 2c). Presently, at 1 year follow - up, both patients are full weight bearing walking with a stick support and full range of motion of the knee . A 70-year - old lady came to trauma center with pain and swelling in the left thigh . She gave history of slip and fall at home with thigh directly hitting the table . Radiographs of thigh suggested diaphyseal fracture left shaft femur with greater trochanter as a separate fragment and ipsilateral excision arthroplasty of the hip (fig . There was no other associated injury, and distal neurovascular examination was within normal limits . She had resection arthroplasty done in ipsilateral hip 15 years ago for an infected total hip replacement arthroplasty (cemented). Before fall she was operated in the form of open reduction internal fixation with locking compression plate (fig . (a) radiograph showing fracture shaft femur with butterfly fragment and ipsilateral resection arthroplasty done with greater trochanter as separate fragment . (b) immediate post - operative radiograph showing fracture fixation with locking compression plate . A 65-year - old lady presented with spiral proximal diaphyseal fracture following a trivial fall at home . Further radiographs suggested that she had pseudarthrosis at neck of femur due to neglected fracture neck of femur (fig . After adequate pre - operative work up and planning, she was operated with closed intramedullary nailing (fig . (a) radiograph showing spiral fracture proximal diaphysis femur with ipsilateral pseudarthrosis of neck of femur . After surgery, both patients were mobilized nonweight bearing for 6 weeks followed by gradual weight bearing walking . Knee range of motion exercises and quadriceps strengthening was started in immediate post - operative phase . At 3 months, radiograph showed good callus formation and full weight bearing walking was started (fig . 2c). Presently, at 1 year follow - up, both patients are full weight bearing walking with a stick support and full range of motion of the knee . The mechanism of injury in case of femoral diaphyseal fractures is usually due to direct blow to femoral shaft . Femur like other bones gives away in tension, depending on the direction of force . Elderly patients typically present with spiral fracture due to torsional forces, whereas axial and bending forces act on young patients to produce fractures . In case 1, since there was a resection arthroplasty of hip done and in case 2, there was pseudarthrosis at neck of femur suggesting loss of fulcrum proximally for axial, bending, or torsional forces to act and produce fractures . Therefore, biomechanically, there were fewer chances of fracture . We feel that probable mechanism in case 1 was direct blow to femur due to fall, and in case 2, it was twisting injury due to fall . The long - standing fibrosis would have provided enough leverage for torsional forces to act and produce spiral fracture in pathologically weak bone . Moreover, the femur bone appeared to be weakened due to senile osteoporosis and previous attempt of cement removal during resection arthroplasty (case 1). Dunn et al . Cited similar risk factors of weakening of bone for subtrochanteric fracture in their case . The goal of resection arthroplasty is to create stable pseudarthritis site with eradication of infection and pain . Resection arthroplasty of hip leads to instability, limb length discrepancy, abductor weakness, etc . The technique of girdle stone arthroplasty has undergone modification with emphasis on preserving as much bone as possible [4, 9]. However, it is not always possible to preserve bone while removing the earlier prosthesis and cement . In case 1, resection arthroplasty lead to severe bone loss with excision of the proximal end of femur up to subtrochanteric level . Management of this unique case scenario posed several challenges . Clinical decision - making in formulating treatment plan included taking various factors into account such as the presence of resection arthroplasty of hip at subtrochanteric level with greater trochanter as a separate fragment (case 1), pseudarthrosis at neck of femur with intact greater trochanter (case 2) osteoporosis, and post - operative ambulation and rehabilitation . As in case 1, the greater trochanter was not intact, so we did not choose an intramedullary interlocking nail . Furthermore, there was a concern about disturbing a stable pseudarthrosis site while doing intramedullary nailing . In case described by dunn et al ., the greater trochanter was intact and they performed open intramedullary nailing . However, they cited several problems like getting a closed reduction due to lack of adequate traction and difficulties in reaming the canal . Retrograde femoral nailing could have been an option in such cases if intramedullary device is preferred and greater trochanter is shattered . However, this method would also pose problems with traction and getting a closed reduction . Furthermore, there was concern about opening the knee joint which is already arthritis in old age . For these reasons, we chose plate fixation as a modality of fracture fixation . As the fixation was stable and proximal pseudarthrosis site was not disturbed, we could start early joint mobilization and subsequently patient returned to pre - operative ambulatory status . In case 2, since the greater trochanter was intact, we preferred intramedullary fixation . However, the main advantage was that biology of fracture was preserved due to closed technique which aids in union . Thus, we conclude that ipsilateral diaphyseal femur fracture with resection arthroplasty / pseudarthrosis is a rare case scenario the case requires careful consideration and analysis of various factors in formulating the plan of management . Fracture diaphyseal femur can occur after following nonunion neck femur or resection arthroplasty of hip.
Cellulose, a structural carbohydrate of the plant cell wall, is an abundant and ubiquitous polymer . The use of cellulose for the second generation biofuel production involves the hydrolysis of cellulosic biomass, that is, saccharification, to form simple sugar monomers for the fermentation into bioethanol [13]. Cellulases are the group of enzymes involved in the conversion of cellulosic substrates to fermentable sugars . Main members of this group include endoglucanase (ec 3.2.1.4), exoglucanase or cellobiohydrolase (ec 3.2.1.91), and -glucosidase (ec 3.2.1.21). The endoglucanase hydrolyzes -1,4 bonds in cellulose molecule, whereas exoglucanase cleaves the ends to release cellobiose, and -glucosidase converts cellobiose to glucose . Several cellulase producing fungi such as aspergillus, rhizopus, and trichoderma species [6, 7] and bacteria such as bacillus, clostridium, cellulomonas, thermomonospora, ruminococcus, bacteroides, erwinia, and acetivibrio species [810] have been identified . However, the isolation and characterization of novel cellulose hydrolyzing enzymes from bacteria are still a highly active research area, because bacteria have a higher growth rate than fungi, leading to greater production of enzymes . Also, the habitat of bacteria covers different environmental niches, which favors the existence of versatile strains such as thermophiles, psychrophiles, alkaliphiles, and acidophiles . The culturable cellulase producing bacteria have been isolated from the variety of sources such as composting heaps, decaying agricultural wastes, the feces of cow and elephant, gastrointestinal tract of buffalo and horse, soil, and extreme environments like hot - springs . Varga and kovler have reported that the feed fibers were not completely converted to animal product in intensive animal farming, and 2070% undigested cellulose was carried out with feces . Some studies have explained that the crude fiber degradation in gut is not optimal, and the fiber content of feces is still high, which can be utilized efficiently by microbes present in the feces of the herbivores . Rhinoceros are presumed to have an efficient system for cellulose digestion, as its main food wild grass primarily consists of cellulose . In this study, the dung of the pachyderm from kaziranga national park, assam, india, has been used as the source of cellulolytic bacteria . Carboxymethylcellulose (cmc) (low viscosity, 50200 cp) was procured from sigma aldrich (st . Louis, mo, usa). Medium components and congo red (analytical grade) were procured from hi - media pvt . Ltd ., the dung sample of one - horned indian rhinoceros (rhinoceros unicornis) was collected from its natural habitat, kaziranga national park, assam, india . Presterilized spatula and plastic bags were used for sample collection, and before bacterial isolation the samples were stored at 4c in ice box for approximately 12 h. dung sample (0.5 g) was suspended with 50 ml 0.85% (w / v) sterile nacl solution in a 250 ml conical flask, which was shaken at 180 rpm for 1 h at 37c . An aliquot of 100 l of each dilution was spread plated onto bushnell haas medium (bhm) agar plates amended with carboxymethylcellulose (cmc) (ph 7.0) containing (g / l) cmc (10.0), k2hpo4 (1.0), kh2po4 (1.0), mgso47h2o (0.2), nh4no3 (1.0), fecl36h2o (0.05), cacl2 (0.02), and agar (20.0) [19, 20]. The plates were incubated at 37c for 96 h. morphologically dissimilar and discrete colonies were picked from different dilution plates and streaked on separate bhm - cmc plate with grids drawn over it and incubated at 37c for 96 h. the replica plates were also prepared separately for staining . The stain was poured off, and the plates were washed with 1 m nacl . The isolates showing clear zone around the colonies were picked from master plate and further used for the enzyme production in liquid medium . The selected cultures were maintained on nutrient agar slants containing (g / l) peptone (5.0), beef extract (1.0), yeast extract (2.0), nacl (5.0), and agar (20.0). The isolates, selected on the basis of plate staining method, were grown in 50 ml enzyme production medium (at ph 7.0) containing the following components (g / l): cmc (10.0), k2hpo4 (1.0), kh2po4 (1.0), mgso47h2o (0.2), nh4no3 (1.0), fecl36h2o (0.05), cacl2 (0.02), and yeast extract (5.0). This medium is the same as the previously used medium during isolation, with the only difference of addition of yeast extract . 50 ml medium (containing 2% inoculum) was taken in 250 ml erlenmeyer flask and incubated at 37c at 180 rpm for 72 h. after every 6 h, the culture was centrifuged at 12000 g for 20 min at 4c . The cell - free culture broth containing the crude enzyme was used for estimation of cmcase activity . Based on the higher cmcase activity (as described later), an isolate ss35 (named after its colony number) was selected for further characterization and identification . The enzyme production by the isolate ss35 was monitored with cell growth at 600 nm using uv - visible spectrophotometer (perkin elmer, model lambda-45). The cmcase activity (u / ml) was measured by estimation of reducing sugars liberated from cmc . The enzyme assay was carried out by incubating the enzyme with cmc for 15 min at 37c . The reaction mixture (100 l) contained 50 l of enzyme and 1.0% (w / v) final concentration of cmc in 50 mm phosphate buffer (ph 7.0). The reducing sugar was estimated by the method of nelson and somogyi [23, 24]. The absorbance was measured at 500 nm using a uv - visible spectrophotometer (perkin elmer, model lambda-45) against a blank with d - glucose as standard . One unit (u) of cellulase activity is defined as the amount of enzyme that liberates 1 mol of reducing sugar (glucose) in 1 min at 37c and ph 7.0 . Morphological and biochemical properties of the isolate were identified, evaluated, and compared, as described in bergey's manual of systematic bacteriology . The cell morphology of the selected isolate was observed under scanning electron microscope (leo 1430 vp, leo electron microscopy ltd ., gram staining, endospore staining, and urease test were done as per standard protocol . The catalase activity was determined adding few drops of 3% (v / v) h2o2 to 5 ml of 18 h grown culture . The nitrate agar slants (m072, himedia) were used to test nitrate reducing property of the isolate ss35 . Triple sugar iron (tsi) slants (m021i, himedia) containing three sugars, namely, glucose, lactose, and sucrose, were used for acid and h2s production test . Acid production after carbohydrate fermentation was detected by the visible change in color from red to yellow . The temperature tolerance test was performed by growing the isolate in nutrient broth and incubating at the temperatures ranging 2050c . 16s rdna and partial gyrase a gene sequencing of bacterial culture were done in xcelris labs limited, ahmedabad, india . The genomic dna of the isolate ss35 was extracted using qiagen dna extraction kit and purified by qiaamp dna purification kit (qiagen) for nucleotide sequence analysis . The universal 16s rdna primer 8f (5 agagtttgatcctggctcag 3) and 1492r (5 acggctaccttgttacgactt 3) were used for amplification of genomic dna by polymerase chain reaction (pcr). The gyra region was amplified using the primers, p - gyra - f (5 cagtcaggaaatgcgtacgtcctt 3) and p - gyra - r (5 caaggtaatgctccaggcattgct 3). The concentration of each primer in 25 l pcr reaction mixture was 10 pmol and 1x pcr master mix (mbi fermentas). The pcr reaction was run for 30 cycles in a thermal cycler (eppendorf), and the thermal profile used for the pcr was as follows: initial denaturation at 95c for 2 min, final denaturation at 94c for 30 s, primer annealing at 52c for 30 s, and extension at 72c for 90 s. full extension of the products was ensured by running a final cycle that included extension for 10 min at 72c . Pcr product of 5 l from each tube was mixed with 1 l of 6x gel loading dye, and this mixture was subjected to electrophoresis on 1.2% agarose gel to confirm the targeted pcr amplification . The amplified product was excised from the gel and purified using qiaamp dna purification kit (qiagen). The concentration of the purified dna was determined, and it was subjected to automated dna sequencing on abi 3730xl genetic analyzer (applied biosystems, usa). The cycle sequencing was carried out using bigdye terminator v3.1 cycle sequencing kit following manufacturer's instructions . The cycle sequencing was carried out in a final reaction volume of 20 l using 200 l capacity pcr tube . The cycling protocol was designed for 25 cycles as follows: denaturation at 96c for 10 s, annealing at 52c for 5 s, and extension at 60c for 4 min . After cycling, the extension products were purified and mixed well in 10 l of hi - di formamide . Eluted products were placed in a sample plate, heated at 95c for 5 min, chilled, and loaded into autosampler of the instrument . Both the ends of the sequences were verified with the chromatogram file, and the resulted consensus sequences were used to carry out basic local alignment search tool (blast) with nr database of ncbi genbank using megablast algorithm . Multiple sequence alignment was performed by using clustal w, and evolutionary history was inferred using the neighbor - joining method . The evolutionary distances were computed using the kimura 2-parameters method, and phylogenetic analysis was carried out with mega4 . Among 36 isolates, 9 cellulose hydrolyzing microorganisms were screened on the basis of plate staining method . The isolates (no . 21, 24, 25, 28, 31, 32, 34, 35, and 36) showed clear zone around colonies after staining the plates with congo red and destaining with 1 m nacl as shown in figure 1 . However, plate - screening method is not quantitative because of poor correlation between enzyme activity and colony to clear zone ratio . The colonies showing yellow - colored halo zones were picked from replica plate and further screened on the basis of cmcase production in liquid medium . Out of 9 isolates, isolate no . 35 exhibited maximum cmcase activity of 0.079 u / ml (details given in table 1). This value was higher than activity of cmcase produced from some known natural isolates (expressed per ml of cell - free culture broth), for example, cellulomonas sp . (0.0336 u / ml, isolated from coir retting effluents), micrococcus sp . (0.0152 u / ml, isolated from coir retting effluents), bacillus sp . (0.0197 u / ml, isolated from coir retting effluents), brevibacillus sp . Jxl (0.02 u / ml, isolated from swine waste), brevibacillus sp . Duselg12 (0.02 u / ml, isolated from gold mine), geobacillus sp . Duselr7 (0.058 u / ml, isolated from gold mine), geobacillus sp . (0.0113 u / ml, isolated from sugar refinery wastewater), and bacillus subtilis as3 (0.07 u / ml, isolated from cow dung) [3337]. Have reported maximum cmcase activity of 0.079 u / ml by bacillus pumilus eb3 produced in a 2 l stirred tank reactor, which was equal to the cmcase activity of the isolate in this study . 35 was revealed to be an efficient cmcase producer species and was designated as ss35 . The growth curve of ss35 along with cmcase production profile (figure 2) revealed that the enzyme production was associated with cell growth and reached maximum at late log phase . Slight reduction in enzyme production after 48 h could be a consequence of instability of the enzyme at 37c or the activity of proteases present in the crude enzyme solution . The isolate ss35 was found to be rod - shaped cells with a width and length of 0.50.6 m and 1.51.6 m, respectively, as observed under scanning electron microscope (figure 3). The isolate was found to be a gram - positive, spore forming bacterium, and it gave positive test for catalase, nitrate reduction, and starch hydrolysis, whereas negative for urease and hydrogen sulfide production . The absence of black precipitate at the base of the tube indicated that hydrogen sulfide was not produced . The color of tsi agar slant was turned from red to yellow, which indicated that the bacterium was able to ferment the sugars glucose, lactose, and sucrose . The temperature tolerance test revealed that the isolate was able to grow at a wide temperature range 2050c . The phylogenetic tree generated using 16s rdna gene sequences of the isolate ss35 showed that the bacterium has the highest homology with bacillus amyloliquefaciens ab679994.1) (figure 4). The bacterial identification using 16s rdna gene sequence is a widely practiced technique, although with limitations for the members of closely related taxa . To overcome this limitation, several studies have been done, which concluded that some protein - coding genes such as rna polymerase (rpob) gene, rna polymerase sigma factor (rpod) gene, gyrase b (gyrb) gene, and gyrase a (gyra) gene can be used for the identification of closely related taxa, because the genetic variation in protein - coding genes are much higher . Chun and bae demonstrated that the gyra sequences, code for dna gyrase subunit a, can be used for accurate identification of bacillus amyloliquefaciens and related taxa including bacillus subtilis, bacillus vallismortis, bacillus mojavensis, bacillus atrophaeus, and bacillus licheniformis . Therefore, in this study partial gyra gene sequences have been used for the confirmation of the result obtained from 16s rdna sequence analysis . The phylogenetic analysis using partial gyra gene sequences also revealed that the isolate ss35 has the highest homology with bacillus amyloliquefaciens fzb45 (genbank accession no . : fn662840.1), as shown in figure 5 . Numbers at nodes of the tree are indications of the levels of bootstrap support based on a neighbor - joining analysis of 1,500 resampled datasets . The 16s rdna and gyra gene sequences of the isolate b. amyloliquefaciens ss35 have been deposited in the ncbi nucleotide sequence database under the accession nos . Cellulose hydrolytic bacteria have been isolated from rhinoceros dung, and some potent cellulose degrading bacteria have been identified . Among all cellulolytic bacteria, bacterium has been identified as bacillus amyloliquefaciens ss35 on the basis of 16s rdna and partial gyrase a gene sequence analyses . The cmcase production has been observed to be associated with cell growth and has maxima at the late exponential phase of growth . Optimization of medium composition and fermentation parameters can further increase the cellulase production from b. amyloliquefaciens ss35 . These attributes also make b. amyloliquefaciens ss35 a potential candidate in solid state fermentation for cmcase production using cellulosic biomass.
Maintenance of motion following arthroplasty can be hindered by the development of heterotopic ossification (ho), whose causes remain uncertain.1,2,3,4,5 whether the formation of ho following cervical disc arthroplasty is of clinical or functional importance is also unknown . The aims of this study are to investigate the rate of ho at a longer follow - up (mean 3 years), to determine if the presence of ho negatively affects functional outcome and to identify factors that may precipitate the formation of ho following cervical disc arthroplasty . What is the incidence of ho following cervical arthroplasty? Does the development of ho negatively influence the clinical outcome in patients receiving arthroplasty? Inclusion criteria: patients suffering from radiculopathy, myelopathy or myeloradiculopathy secondary to soft disc hernia and/or mild degree spondylosis operated between october 2004 and december 2006 . 1) thirty - nine patients suffering from cervical radiculopathy and/or myelopathy treated with anterior disc replacement (adr) were selected . Nine patients were excluded from this analysis because of insufficient outcome data at different time intervals (n = 7) or were not available for follow - up (n = 2). Outcomes and analysis evidence of ho using the mcafee grading system6 (table 1). Rom was calculated by using two lines parallel to the prodisc - c keels, or to the endplates of the prestige lp, and measuring the intervening angle in flexion and extension on lateral radiographs . Lordosis was assigned a negative value and kyphosis a positive one; the difference between the two values gave the final rom . Ct scan on patients with grade two or higher ho to assess localization of ho . A comparison of scores was made between those who developed ho and those who did not using a two - sided student t - test . All images were independently reviewed by both a radiologist and a neurosurgeon not directly involved in the surgical procedures . Forty - five disc prostheses (seven prestige - lp and 38 prodisc - c) were implanted in 30 patients (18 males) ranging in age from 2863 years (mean age 40.9). The underlying disease included radiculopathy (n = 13), myelopathy (n = 4) or myeloradiculopathy (n = 13), secondary to soft - disc hernia (n = 17), spondylosis (n = 8) or a combination of disc hernia and spondylosis (n = 5). Nineteen patients received one - level disc replacement, seven patients received two - level and four patients received three level disc replacement . The following distribution of prostheses / level was recorded: c34:5; c45:4; c56:23; c67:13 (table 2). The incidence rate of ho using the number of prostheses as the denominator was 42.2% (19 levels in 16 patients, fig . The risk of a patient developing ho after receiving one or more prostheses was 53.3% (16/30). Ten patients showed progressive ossification over time: in six patients de novo ho was demonstrated at 2346 months (mean 33.3) postoperatively (figs . 2, 3). Among the 16 patients with ho, 15 (93.8%) demonstrated a range of motion 3 (fig . Comparison of pre- and postoperative sf-36 and ndi scores revealed functional improvement from baseline to follow - up at 3, 6, 12, 18, 24, and 36 months . There was no significant difference in functional scores between those who did and those who did not develop ho, p>.05 (fig . Risks and relative risks by factor related to patient characteristics associated with ho formation were analyzed: males tended to develop ho more than females (twice as likely), though this did not reach statistical significance (table 3). No patients required revision surgery for adjacent segment disease or persisting / recurrent symptoms . Patient population and intervention double - level arthroplasty with prodisc - c at c56 and c67 . Absence of ho at 1 month after surgery (left), presence of grade two ho 1 year postoperatively (middle) and of grade three ho (right) 3 years postoperatively, respectively . Note the progression of ho at the c45 disc space at 1 month (left), 12 (middle) and 48 (right) months, respectively, postoperatively (arrow). Flexion and extension x - rays (same patient as in fig 3) showing mobile disc prostheses at 48-months follow - up despite the presence of heterotopic ossification . Our rate of grade two and three ho (42.2%) is consistent with that previously reported.7 it is higher than in other series8,9 but lower than sola's et al.10 ho is prevalent on the anterolateral surface of vertebral bodies (fig . Strengths: this study reports 3 years mean follow - up data, to date the longest available . For all included patients complete follow - up data are available . Furthermore, we have shown that a delayed progression, or de novo onset, of ho is possible . Limitations: this study was not conducted prospectively and is based on a relatively small albeit consecutive sample size . Lack of potential prognostic factors available for analysis and a 77% follow - up rate are further limitations . A longer follow - up is necessary to assess whether arthroplasty can reach the goal of maintaining motion and if development of high - grade ho at the target level infers an increased risk of adjacent segment degeneration . Clinical and functional improvement following cervical disc arthroplasty is maintained despite the presence of ho . Preventative measures such as prophylactic nonsteroidal medications, local application of bone wax or intentional early range of motion measures were not routinely utilized in our study . While these are interesting factors, axial ct scan showing the presence of laterally sited ho (arrows) at c45 level (a) and at c67 level (b) number of ossified levels and stratification for mcafee ossification grades (ho: heterotopic ossification) differences of pre- and postoperative functional outcome in the two groups disc replacement offers a new interventional option and long - term data on the potential complications to artificial disc replacement compared with fusion are very much needed . This prospective study's contribution to the literature regarding heterotopic ossification (ho) following cervical arthroplasty is appreciated . As the authors note, the causes of ho in disc arthroplasty remain unclear and are probably multifactorial . Ho frequency: the authors report a ho rate of 42% following artificial disc replacement in 32 patients, a higher overall rate than is reported in most other studies . Ho rates in the may 2008 ebss special edition on cervical arthroplasty were summarized as follows: there were no ho cases reported in two rcts, with follow - up of 24 months in one study and other being a preliminary report with most patients having only 12-months follow - up . Ho was, however, common in two case series with one reporting an overall 18% rate or 7% cases when restricted to grades iii or iv . The other series of patients with 1, 2, or 3 level disease reported that 8% of segments had grade i, 39% of segments had grade ii, 10% had ho leading to restricted movement and 9% experienced spontaneous fusion . There are several factors which may partially explain discrepancies in ho rates across studies, aside from differences in length of follow - up . It is possible that increased attention to radiographic detail may go hand in hand with increased reporting . Grading the severity of ho is not an exact science . There is some subjectivity which may translate into difficulty in distinguishing between adjacent grades (eg, between grades 2 and 3) and overlap in classification . The grading of ho has so far not been subjected to inter- and intra - observer reliability evaluation and is not known to correlate with any health - related quality of life (hrqol) outcomes measures . Study specifications and protocols: use of structured measures and protocols in a prospective study, which are consistently applied to all patients, is important to decrease study bias . While the authors suggest that structured protocols were used, no details were provided . Reporting detail about protocols assists in determining the extent to which various factors may or may not have influenced the results . For studies of ho, important protocol details should include whether or not bone waxing was done at the osteotomy site as well as specifics for radiographic measurements and use of antiinflammatory medications . It is unclear whether early initiation of range of motion creates an inflammatory response which contributes to ho formation or if it facilitates functional outcome . Strengths: the use of validated outcomes measures (ndi and sf-36) is commendable as is the authors' acknowledgment of small sample size and a relatively low follow - up rate (77%) as study limitations.
Paget's disease (pd) of bone is a focal, progressive disorder of accelerated bone remodeling and can lead to bone pain and several complications, including deformities, fractures, and secondary osteoarthritis . Although the pathophysiology of pd is very complicated and not well known, the primary lesion is the abnormally increased and activated osteoclast in pd . Bisphosphonates, which is the most potent anti - resorptive drug, have been the most effective agents available for the treatment of pd . Among the bisphosphonates for osteoporosis treatment, zoledronate is a nitrogen - bound intravenous bisphosphonate with highest potency and longest administration interval . We reported a patient with pd, who had inadequate responses to therapy with pamidronate, has had a clinical remission with intravenous zoledronate . In may, 2010, a 49-year - old woman presented with 4 year history of both buttock pain . Iu / l (reference range, 30 to 115 iu / l). A bone scan, which undergone at outside hospital 4 year ago, confirmed pagetic changes in the left ilium (fig . 1). And, pelvis anterior - posterior radiograph obtained at our hospital revealed a typical mosaic pattern of pd in her pubic and left ilium (fig . Her weight was 61.4 kg, height was 162 cm, and body mass index was 23.4 kg / m . Range of motion at left hip was decreased due to pain, and she walked with a mild limp . Although the level of alp was within reference range, pamidronate treatment was started orally for 3 months, because she had a severe pain . However, her pain intensity level increased . Iu / l, and bone scan show still hot uptake in her both ilium and lumbar vertebrae (fig . Subsequently, she received intravenous zoledronate (5 mg) in a single dose at august, 2010 . After this treatment, we evaluated clinical and biochemical remission and improvement in bone scan . Three months after administration zoledronate, alp decreased 26 iu / l, and a severe pain and limping gait disappeared . Six months after intravenous zoledronate, alp decreased 21 u / l, and bone scan showed the improvement, which means a response of zoledronate (fig . Iu / l, and bone scan showed hot uptake in both ilium and lumbar vertebrae (fig . We report a patient with pd of bone, resistant to pamidronate treatment in whom intravenous zoledronate produced clinical remission and an improvement in the bone scan during 3 years . In united states population over 55 years, the incidence of pd is estimated to approximately 2 - 5% . However, the incidence is very low, and had not been well - known in korea . Serum alp is an indicator of osteoblast activity and the primary marker for assessment of pd . However, this patient had low alp at initial presentation, which cannot allow physician to suspect pd by a screening laboratory profile . Bone scan can be used as a complementary method to diagnose and monitor the activity of pd . Recent treatment guidelines recommend an use of bisphosphonate for pd to prevent disease progression and associated - complications, even in asymptomatic patients, especially with critical anatomic location such as skull, spine, weight - bearing bones, or the acetabular regions . Oral bisphosphonate has been traditionally used for this, but compliance of oral bisphosphonate is too low, because of complex ingesting methods and gastro - esophageal irritation . Therefore, annually intravenous zoledronate could be alternative optional . A clinical trial reported that a single 5 mg zoledronic acid infusion normalized alp levels in 89% of patients, compared with 58% in the control group administered oral risedronate, 30 mg / day for 60 for 2 months . Although advantages of zoledronate include the convenience of a 15 minute infusion, approximately 40% of patients experienced zoledronate - associated symptoms (flu - like illness, pyrexia, myalgia, arthralgia, bone pain), typically within the first 3 days after the infusion, with most symptoms resolving within 3 days after onset . This case study demonstrated that a patient with pd who had been treated unsuccessfully with oral bisphosphonates was effectively treated with a 5 mg infusion of zoledronate . The ability of zoledronate to provide a sustained remission offers many advantages for patients with pd and may lead to considerable benefits for the long term in preventing or minimizing complications.
Maternal diabetes during pregnancy, also called gestational diabetes mellitus (gdm), is an important risk factor for foetal overgrowth, termed macrosomia, which is influenced by maternal hyperglycemia and endocrine status through placental circulation . In humans, macrosomia has generally been defined as a birth weight greater than or equal to the 90th percentile birth weight for gestational age, that is, infants who weigh> 4000 g at delivery, regardless of gestational age or sex [24]. Infants born to diabetic mothers are at an increased risk for hypoglycaemia, respiratory distress syndrome, hyperbilirubinemia, and hypertrophic cardiomyopathy . It seems that maternal hyperglycaemia leads to foetal hyperglycaemia, which stimulates foetal pancreatic islet cells and, consequently, induces foetal hyperinsulinaemia . Moreover, there exists a correlationship between maternal and foetal plasma cholesterol levels in 5 - 6-month - old human foetuses [5, 6]. It is noteworthy that several alterations in the metabolism of carbohydrates and lipids, observed in newborn babies of diabetic mothers, also persist postnatally [79]. It is possible that foetal hyperinsulinaemia may be an endogenous teratogen factor during critical periods of foetal development, leading to permanent structural or functional changes and consequent programming of metabolic memory . Hyperinsulinemia in utero may affect the induction and activity of various hepatic enzymes associated with fat and carbohydrate metabolism . This phenomenon may be accompanied, in placenta, by modifications in the expression of the transcriptional factors such as sterol regulatory element binding protein-1c (srebp-1c), known to induce expression of genes involved in lipogenesis . In 1995, barker proposed that disproportionate foetal growth induced by foetal malnutrition, which could happen either in the middle or in a later period of the gestation, programmed coronary diseases in adulthood . The in utero programming seems to create a kind of metabolic memory as the physiological abnormalities, observed during the gestational period, are responsible for the induction of diseases associated with the metabolic syndrome such as type 2 diabetes (t2d) and obesity in adulthood . Indeed, in human gdm, there exists a correlationship between gdm and 6-month - old foetal plasma cholesterol levels and other abnormal lipid parameters, including high concentrations of triglycerides (tag), apob100, very - low - density lipoprotein (vldl), and low - density lipoprotein (ldl), which often persist in macrosomia . Leptin, an adipocyte - derived hormone, by decreasing food intake and increasing energy expenditure, stabilizes body adiposity . A transient increase in leptin during neonatal life, called neonatal leptin surge, has been shown to exert a neurotrophic effect and the development of energy - regulation circuits in mouse hypothalamus . Furthermore, experimental premature leptin surge from day 5.5 to day 10.5 of life in mice pups led to decreased hypothalamic leptin sensitivity and accelerated weight gain when pups were fed a high - fat diet . In healthy women, both maternal and foetal leptin concentrations reference reported that leptin levels were always higher in overweight than in normal weight newborns, and plasma leptin level was correlated with birth weight . Hence, it is conceivable that foetal leptin plays a role in in utero programming . In utero nutritional environment epigenetic regulation is mediated by methylation and acetylation of histones . As far as foetal nutrition is concerned, it has been reported that dietary methyl - group intake (choline, methionine, and folate) during critical periods of development can alter dna and histone methylation which may result in lifelong changes in gene expression . Hence, these epigenetic mechanisms might contribute to the development of macrosomia and its related adulthood pathologies such as obesity and t2d . Growth factors might be implicated in gdm and in the pathology of macrosomia via materno - foeto - placental axis . We have conducted a clinical study in which we have determined circulating growth factors and the expressions of their genes in placenta in gdm mothers and their macrosomic babies . We observed that serum concentrations of igf - i, igf - bp3, egf, fgf-2, and pdgf - b were higher in gdm dames and their macrosomic babies as compared to their respective controls . Besides, the placental expression of the mrna of growth factors (fgf-2 or pdgf - b) and growth factor receptors, that is, igf - ir, egfr, and pdgfr - beta, was upregulated in gdm women compared to controls . The immune system is composed of two major subdivisions, the innate (phagocytic cells and nk cells) and adaptive immune responses . Though the interactions between innate and adaptive immunity are complex, the innate mechanisms control both the initiation and the type of adaptive response (th1/th2). It has been shown that the abnormalities in humoral and cell - mediated immunity in t1d females may persist during pregnancy and, hence, may complicate immune - foetal interaction . Though pancreatic autoimmunity does not seem to represent a typical marker of gdm, high prevalence of autoantibodies, such as anti - gad65 and anti - ia2 antibodies, has been observed in gdm subjects . On the contrary, it has been reported that foetal exposure to maternal t2d protects offspring, during the first 2 decades of life, from the development of islet autoimmunity and diabetes in the later life . This is explained by the fact that the immune systems of children receiving autoantibodies from their diabetic mothers are primed during foetal life . Such priming is demonstrated by an increase in mhc class ii positive lymphocytes in infants of diabetic mothers compared to controls . With regard to t - cell activation, fully activated t - cells are detected in the cord blood of infants and mothers with t1d, but not in infants from normal mothers . Have reported a decrease in t - cell proliferation, associated with a decrease of plasma levels of il-2 in the offspring of diabetic mothers, as compared to those of control mothers . Also, in rat model, probably because of their priming, ex vivo t - cell proliferation is significantly lower in diabetic pregnant rats and their macrosomic offspring, as compared to control animals . This phenomenon may trigger a decrease in the number of circulating and thymus homing t - cells . In addition, the number of t- and b - cells in the neonates of diabetic mothers was significantly decreased compared to the neonates of healthy mothers . Reported an increase in the number of lymphocytes but a decrease in natural killer (nk) subset in children from gdm mothers . Another alteration in lymphocyte subset pattern is observed in gdm mothers, who had high number of cd8 cells, expressing tcr gamma / delta, and low number of cd3 cells, expressing tcr alpha / beta . Also, infants born to gdm women had higher cd8 gamma / delta cells than control babies . This immunological imbalance may correlate with a greater risk for developing t1d, later in life . T helper (th) dichotomy in gdm and macrosomia has not yet been well explored . On the basis of production of cytokines, th cells can be classified into two principal populations, th1 and th2 (figure 1). Th1 cells support cell - mediated immunity and, as a consequence, promote inflammation, cytotoxicity, and delayed - type hypersensitivity, whereas th2 cells support humoral immunity and downregulate the inflammatory actions of th1 cells . Th1 cells secrete il-2, ifn-, and tnf- while th2 cells secrete il-4, il-5, il-6, il-10, and il-13 . Analysis of t - cell markers in placenta showed an increase in t - cell infiltration that expresses gata3, a marker of th2 phenotype, in placenta of gdm women . Concerning experimental models of gdm, we would like to mention that we have developed a model by administrating streptozotocin (stz) to wistar female rats [2, 9]. We confirmed in this model a decrease in th1 cells, as observed in human gdm . Furthermore, in gdm rat, the decrease in circulating ifn- was accompanied with an increase in il-10 (th2 marker) levels, as compared to control rats [34, 35]., the shift from the th1 phenotype to the th2, during pregnancy, has been shown to encourage vigorous production of antibodies which not only combat infections during pregnancy, but also offer passive immunity to foetus . A low th1 profile in diabetic pregnant rats, associated with successful pregnancy, may also result from the elevated levels of reproductive hormones like human chorionic gonadotrophin (hcg) hormone, whose administration is known to diminish the production of the th1 cytokines . In rats, the upregulated th1 profile in macrosomic animals may be due to difference in physiological status between gdm dames and their offspring . A study conducted on tunisian women with gdm and their macrosomic babies corroborates these experimental observations . Indeed, the comparison of th1/th2 ratio showed an increase in the th2 phenotype in gdm mothers, whereas an increase in th1 phenotype was observed in macrosomic infants . The regulatory t (t - reg) cells represent a specialized population of t - cells (cd4cd25), known for their properties as potent suppressors of inflammatory responses and for their ability to mediate immune tolerance . T - reg cells induce immune tolerance throughout the production of two immunosuppressive cytokines: tgf- and il-10 . Both in humans and in mice, t - regs cells increase very early in pregnancy, a period which coincides with an intense vascular activity . The importance of t - reg cells in the success of pregnancy was demonstrated by aluvihare et al . Who reported that adoptive transfer of t - lymphocytes depleted of t - regs cells into pregnant t - cell - deficient mice led to the rejection of allogeneic foetal units . Furthermore, spontaneous abortion cases and patients with recurrent miscarriage are associated with lower systemic t - reg cells compared to normal pregnancies . In kuwaiti women, high number of t - cells expressing the activation - associated hla antigen (cd4hla - dr), memory t - cells, and t - reg cells have been observed during gdm [46, 47]. The frequency of t - reg cells is significantly higher in children born to t1d mothers than in those born to gdm or normal women [48, 49]. Indeed, in the case of t1d, the maternal autoimmunity and the transplacental passage of auto - gad antibodies may influence the generation and expansion of foetal t - reg cells, which may suppress the gad65-specific t - cell responses . Besides, the t - reg cells of children born to t1d mothers exhibit a more pronounced memory phenotype (increased ccr4 expression and downregulation of cd62l), suggesting an early activation of the foetal immune system, as a consequence of maternal autoimmunity . It seems that the suppressive activity of t - reg cells was significantly reduced in gdm patients when compared to healthy pregnancy . It is noteworthy that obesity - induced insulin resistance is associated with the development of a specialized t - reg population in visceral adipose tissue, called vat resident t - reg . Visceral adipose inflammation and insulin resistance have been associated with a dramatic reduction in vat t - reg cells in several animal models of obesity . T - reg cells, by secreting il-10, decrease the inflammatory state of adipose tissue and, thereby, improve insulin resistance . Loss - of - function and gain - of - function experiments demonstrated that vat t - reg cells are indispensable to reducing inflammation and increasing insulin sensitivity . Hence, the implication of vat resident t - reg cells deserves deep investigations in macrosomia . During t - cell activation, an increase in intracellular free calcium concentrations, [ca]i, is one of the earliest events which is triggered as a result of the hydrolysis of phosphatidylinositol - bisphosphate, catalyzed by the phospholipase c (plc). Hence, plc gives rise to inositol trisphosphate, which recruits calcium from endoplasmic reticulum pool, and diacylglycerol which activates the protein kinase c. according to capacitive model of calcium entry, first calcium is released via t - cell receptor (tcr) activation from the endoplasmic reticulum (er) and then it is extruded into the extracellular medium . In turn ionomycin opens calcium channels, leading to calcium influx from extracellular medium and thapsigargin (tg) recruits calcium which belongs to endoplasmic reticulum (er) pool . Interestingly, ionomycin - induced increases in [ca]i in t - cells of gdm dames and their macrosomic offspring were greater than those in control rats . In 0% of calcium buffer, tg induces increases in [ca]i exclusively from er pool and no influx occurs in the absence of calcium from the extracellular medium . Hence, both in 100% and in 0% calcium media, tg - induced increases in [ca]i in t - cells are higher in gdm dames and macrosomic rats than those in control animals, demonstrating that t - cell calcium signaling is altered in these two pathological situations . Tnf- and il-6 represent the main inflammatory cytokines increased in the insulin - resistant states of obesity and t2d [26, 54]. Increasing evidence suggests that gdm is a proinflammatory state similarly to t2d . Monocyte chemotactic protein-1 (mcp-1) is known to be elevated in inflammatory diseases like arthritis and lupus . The elevation of mcp-1 in the third trimester of gdm suggests an association between inflammation and gdm . Besides, it has been suggested that hyperglycaemia and its related oxidative stress are usually associated with increased proinflammatory cytokines production [57, 58]. Increased concentrations of tnf- and il-6 might not only diminish insulin sensitivity by suppressing insulin signal transduction, but also interfere with the anti - inflammatory effect of insulin (figure 2) [54, 59]. Indeed, insulin exerts its anti - inflammatory effect by decreasing the production of reactive oxygen species (ros) from mononuclear cells and nuclear nf-b translocation . The in vivo administration of insulin not only decreases the severity of t2d, but also diminishes the levels of mcp-1 and c - reactive protein (crp), the two indicators of the inflammatory state . Il-6 promotes insulin resistance in liver cells and negatively regulates insulin signaling and glucose metabolism in adipocytes . It has been suggested that the increase in tnf- and il-6 in diabetic conditions might be a result of oxidative stress and inflammatory changes caused by hyperglycaemia . Il-6 and tnf- are mainly produced by adipose tissues . Indeed, during insulin - resistant state, adipocytes secrete mcp-1 which favors the infiltration of macrophages that, consequently, produce il-6 and tnf- in high quantities (figure 2) [66, 67]. We have reported that tnf- and il-6 are increased in gdm women . During pregnancy, il-6 secretion has been proposed to aggravate insulin resistance and participates in the pathogenesis of gdm . Adipocytes secrete a number of molecules, including adiponectin, leptin, and resistin, that modulate peripheral insulin sensitivity . From the immunological point of view, adiponectin exhibits anti - inflammatory properties and leptin polarizes th cytokine production toward a proinflammatory (th1) phenotype (figure 1). Since adipocytokines may play an important role in the early defects of t2d, women with gdm represent an ideal population model for studying this interrelationship . Depending on studies, elevated, constant, or decreased levels of leptin have been observed in gdm women . Hence, in contrast to obesity which leads to an inflammatory th1 state, leptin does not play an important role in gdm, marked with th2 response, probably because of the hormonal status during pregnancy . Besides hyperglycaemia, chronic foetal hypoxia, detected in gdm, may also increase the inflammatory burden incurred by the foetus . Dietary n-3 pufas have been considered as immunosuppressors and, therefore, are used in the management of a number of inflammatory and autoimmune diseases, including rheumatoid arthritis and multiple sclerosis [75, 76], as these pathologies are characterized by the presence of activated t - cells and inflammatory cytokines either at the site of tissue injury [77, 78] or in blood circulation [79, 80]. Fat-1 transgenic mice, known to convert endogenous n-6 pufas to n-3 pufas, were protected from diabetes, because of low concentrations of tnf- and il-1 . Generally, both in animal models and in humans, n-3 pufas decrease tnf- and il-6 production . N-3 pufas exert their effect on the inflammatory gene expression through the inhibition of intracellular signaling pathways that lead to nf-b activation . N-3 pufas have been shown to suppress mitogen - stimulated proliferation of lymphocytes isolated from lymph nodes, spleen, and lymphatic duct, in mice and human beings [75, 85]. Feeding the n-3 pufa - diet corrected intracellular calcium homeostasis in t - cells of diabetic pregnant dames and their macrosomic obese rats . We have assessed the th1/th2 dichotomy by dietary n-3 pufas in diabetic pregnancy and macrosomia . We observed that the n-3 pufas - diet upregulated the th2 profile in gdm rats . In macrosomic offspring, the th1 phenotype is upregulated and an n-3 pufas - diet downregulated this phenomenon . In agreement with our finding, wallace et al . Have also observed that feeding fish oil to mice induced a shift in the ifn-/il-4 ratio, by a factor of four, as compared to animals fed the low fat diets . We have investigated the molecular mechanisms by which n-3 pufas - diet controls t - reg cell suppressive capacity . We used docosahexaenoic acid (dha), the end product of -linolenic acid metabolism in animal tissues, and observed that the exposure of t - reg cells to this fatty acid or its in vivo supplementation upregulated tgf- but downregulated il-10 in these cells, suggesting that dha might be orienting the t - reg cell differentiation toward a th3 phenotype . Th3 phenotypes that infiltrate decidua are known to prevent abortion and contribute to the success of pregnancy . Furthermore, dha diminished the suppressive activity of t - reg cells on effector t - cell proliferation . It is now becoming clear that the interaction of foxp3 with other transcription factors (like naft or runx-1) or histone deacetyltransferase and class ii histone deacetylase is critical for the repression of the transcription of il-2 gene by foxp3 . Hence, we hypothesized that dha might downregulate t - reg cell activity, by interfering with the critical downstream components of the foxp3-driven suppressor pathway . Furthermore, dha reduced the migration of t - reg cells toward chemokines by downregulating the expression of chemokines receptors (ccr-4 and cxcr-4) in these cells . T - reg cell migration and activity have been found to be associated with mitogen - activated protein kinase (mapk), that is, erk1/2, activation . Besides erk1/2, the phosphatidylinositol-3-kinase (pi3k) and akt / protein kinase b (hence referred to as akt) play a critical role in the t - cell survival, expansion, and differentiation . Erk1/2 and akt phosphorylation controls the expression of p27, an inhibitor of cycline / cyclind kinase 2 that regulates cell cycle . We noticed that dha significantly diminished the mapk phosphorylation in activated t - reg cells, and this phenomenon was associated with an increase of p27 in t - reg cells . Hence, dha seems to reinforce the anergic state of t - reg cells . Concerning the molecular mechanism of action of n-3 pufas, we have previously shown that dietary n-3 pufas are incorporated into plasma membrane phospholipids . Hence, we assume that dietary n-3 pufas may exert their beneficial action by modulating cell signaling . We have recently shown that t - cell activation and t - cell calcium signaling are altered in diabetic pregnancy and macrosomia, and dietary fish oils, particularly eicosapentaenoic acid (epa) and dha, restore these t - cell abnormalities . During cell activation, a modification in the intracellular ph also plays an important role in the cell cycle progression and, hence, dha and epa have been shown to modulate this phenomenon . Dietary n-3 pufas, incorporated into plasma membrane, may also give rise to diacylglycerols which, in turn, may modulate cell activation . It has been shown that diacylglycerols, containing epa and dha, modulate pkc activation, calcium signaling, and erk1/erk2 phosphorylation . The incidence of gdm and macrosomia continues to grow worldwide and represents a major public health challenge . Except for genetic factors, physical inactivity and high caloric food are the major causing factors for these pathologies . Based on clinical studies, the dietary guidelines for americans 2005 report and several international and professional organizations have made recommendations for consumption of at least two meals, containing fish, per week or from 0.250 g to 1 g of epa and dha daily with a 5: 1 ratio of n-6 fatty acid / n-3 fatty acid . There is no doubt concerning the beneficial effects of n-3 pufas in the improvements of hypertriglyceridemia and the reduction of cardiovascular risk . Thus, the use of these fatty acids in combination with genuine drugs (lipid - lowering, anti - inflammatory, etc .) Represents a new therapeutic strategy in fighting against diabetes and obesity.
Oligonucleotides were synthesized on a 10 mol scale by standard phosphoramidite chemistry using an kta dna synthesizer and were purified by repeated dmt - on / dmt - off reverse - phase hplc, as previously described . The purities of the oligonucleotides were assessed by analytical hplc and ion spray mass spectroscopy and were found to be better than 98% by mass spectroscopy . Purified oligonucleotides were dialyzed against at least two changes of buffer containing nacl, 10 mm cacodylic acid / sodium cacodylate, and 0.1 mm na2edta to yield a final concentration of 100 mm in na cations using dispo - dialyzers with mwco = 500 da (spectrum, rancho dominguez, ca). Dna extinction coefficients of the unmodified parent sequences were determined by phosphate assay under denaturing conditions (90 c). For the abasic - site - containing oligonucleotides, extinction coefficients were determined from continuous variation titrations (job plots) with the complementary parent oligonucleotides and were found to be x(cag)6y(260nm,90c) = 368 400 m cm, y(ctg)6x(260nm,90c) = 342 900 m cm, xy(260nm,90c) = 190 400 m cm, yx(260nm,90c) = 186 200 m cm, x(cag)6y - f(260nm,90c) = 368 400 m cm, xy - f(260nm,90c) = 180 000 m cm, and yx-f(260nm,90c) = 176 000 m cm . As expected, for the 40mers, the impact of a single abasic site lesion in place of guanine is independent of lesion position and too small to result in a measurable change in extinction coefficient compared to the parent 40mer . Dsc studies were conducted using a nanodscii differential scanning calorimeter (calorimetry science corp ., lindon, ut) with a nominal cell volume of 0.3 ml. (42) oligonucleotides, at a concentration of 50 m in strand, were repeatedly scanned between 0 and 90/95 c with a constant heating rate of 1 c /min, while continuously recording the excess power required to maintain sample and reference cells at the same temperature . For the strand exchange measurements, preformed complementary -dnas were kept at 5 c and mixed 1:1 immediately prior to loading and starting the dsc instrument . After conversion of the measured excess power values to heat capacity units and subtractions of buffer / buffer scans, the raw dsc traces were normalized for dna concentration and analyzed using origin software, as previously described. (36) the calorimetric enthalpy (hcal) was derived by integration of the excess heat capacity curve, and cp was derived from the difference in the linearly extrapolated pre- and post - transition baselines at tm . S was derived by h / tm, assuming pseudomonomolecular behavior in which propagation dominates initiation . Although our constructs formally are bimolecular complexes, their concentration - dependent denaturation deviates from a molecularity of two, as generally is the case for complexes of this size. (43) the theoretical entropy correction for a strictly bimolecular reaction of 21 cal mol k at ct = 50 m falls within the uncertainties of our entropy values and is the same for all our constructs . As a result, inclusion of such a molecularity contribution simply scales the magnitudes, while not altering the relative differences in s and g between our constructs . G at the reference temperature was calculated using standard equations taking into account the nonzero heat capacity changes . Tm is defined as the temperature at the midpoint of the integrated excess heat capacity curve for a given conformational transition . At this temperature, for a process that exhibits pseudomonomolecular behavior, the sample is 50% denatured . Cd spectra as a function of temperature were recorded using an aviv model 400 spectropolarimeter (aviv biomedical, lakewood, nj). Spectra were recorded in steps of 1 nm between 360 and 200 nm with an averaging time of 10 s using a 1 mm cell, between 0 and 95 c in 5 c intervals . After subtraction of the relevant buffer scans, spectra were normalized for dna concentration as previously described(44) and analyzed further . Figure 1 shows the cd spectra, at both low and high temperatures, for the different dna constructs shown in scheme 1, including the corresponding lesion - free system . The general similarity of these spectra suggests that the presence of the lesion and its position do not significantly alter the global -dna structure, at least within the resolution of the cd profile . Small differences in the intensity of the spectra near the positive and negative peak maxima may indicate modest lesion - induced local conformational adjustments in dna structure to accommodate the absence of the guanine base . By contrast, calorimetric melting experiments reveal that the lesion can substantially alter the thermal and thermodynamic properties of the -dna construct in a manner that depends on the position of the lesion . We discuss below the position - dependent differential impact of the lesion on -dna stability, as part of our global effort to define lesion - induced energetic alterations that may modulate the processing of potential ber substrates . Cd spectra for the dna constructs shown in scheme 1: spectra for the native (solid lines, 0 c) and denatured (stippled lines, 95 c) -dna constructs with and without f abasic site lesion . The unmodified parent sequence is shown in black, whereas the spectrum of the -dna with the lesion upstream of the loop domain (cag - fstem) is shown in red and that of the lesion downstream of the loop (ctg - fstem) is in green . The spectra of the constructs with the lesion in the loop domain are shown in magenta (cag - f1), blue (cag - f3), and purple (cag - f5). Note the overall similarities in the native spectra at 0 c, indicating that the global structure is not significantly perturbed by the f lesion . Inspection of the dsc curves presented in figure 2a and the data listed in table 1a reveals that a thf lesion (f) in either of the two watsoncrick stem duplex domains adjacent to the bulge loop results in a net destabilization of the entire -dna construct, relative to the corresponding lesion - free construct . Furthermore, the presence of the lesion in either duplex domain causes the apparent heat capacities of the two lesion - containing initial states, the blue and red traces, to be similar to each other and higher than that of the corresponding lesion - free -dna construct, the black trace (see figure legend). Such behavior suggests that the abasic lesion induces an increase in dna flexibility, or degrees of freedom, relative to the corresponding lesion - free construct; that is to say, the presence of the lesions causes the initial states to more resemble the disorder of the final state . This lesion - induced enhanced flexibility may be relevant to the differential recognition of such domains by repair enzymes relative to undamaged structures . Dsc of -dnas (a) with a f abasic site in a stem duplex domain and (b) with the f lesion present at different positions in the loop . (a) excess heat capacity curves measured for the -dnas with f lesion upstream (red, cag - fstem) or downstream (blue, ctg - fstem) of the loop domain . Also shown is the excess heat capacity curve for the unperturbed parent (black) for comparison . To allow comparison, all excess heat capacity curves are set to cp = 0 kcal mol k at 90 c . The linear upper (denatured state) and lower (native state) baselines are indicated as stippled lines, revealing significant differences in cp (cp) between the native and denatured states for each -dna construct . Note also the distinct difference in magnitude of the apparent heat capacities (y - axis) of the native state of the lesion containing -dnas compared to the unmodified parent -dnas at low temperature, reflecting the increased flexibility of the lesion - containing construct . (b) excess heat capacity curves measured for the -dnas with the f lesion within the loop domain (red, cag - f1; green, cag - f3; blue, cag - f5). The excess heat capacity curve for the unperturbed parent -dna (black) is also shown for comparison . To facilitate comparison, all excess heat capacity curves are set to cp = 0 kcal mol k at 90 c . The linear upper (denatured state) and lower (native state) baselines are indicated as stippled lines, revealing significant differences in cp between the native and denatured states of each complex . Note also the change in shape of the denaturation curve not reflected in changes in tm, h, or s for the lesion - containing -dnas relative to the parent -dna construct . Note further the similarity in magnitude of the apparent heat capacities of the native state of the lesion - containing -dnas compared to the unmodified parent construct . In contrast to the heat capacity similarity of the constructs with a f lesion in one of the stem duplex domains, the details of the lesion - induced impact on overall -dna stability are position dependent . Specifically, the lesion - induced impact depends on whether the lesion is located upstream of the loop and on the same strand as the loop (the cag - fstem construct), or downstream of the loop and on the opposing strand from the loop (the ctg - fstem construct); again, this energetic distinction may be relevant to their possible differential recognition by the machinery of repair . When the lesion is positioned upstream and on the loop strand (cag - fstem), our measurements reveal three consequences (see figure 2a and data in table 1a): the overall structure is destabilized (tm = 8.2 c); the enthalpy and entropy values for melting the lesion - containing constructs are reduced relative to the unmodified cag -dna structure (h = 27 kcal mol, s = 70 cal mol k); and an apparent single melting transition is observed, albeit at lower temperature . By contrast, when the lesion is positioned downstream of the loop and on the opposite strand (ctg - fstem), the melting transition visually resolves into two domains . In these circumstances, we list in table 1a single thermodynamic parameters for the combined two transitions . The lower - temperature melting transition reflects destabilization which is even greater than that induced by the upstream lesion (tm1 = 30c). The higher - temperature melting transition reflects a less perturbed domain, exhibiting a thermal stability quite similar to that of the lesion - free construct (tm2 = + 3.6 c). Interpretations of the upstream versus downstream position - dependent, lesion - induced differential behavior should take into consideration the following realities . B - dna helical topology causes the lesion that is 5 base pairs upstream (half a helical turn) to be on the opposite side of the bulge loop domain in the overall dna helical construct, despite being on the same strand of the structure . By contrast, the opposing strand lesion that is 5 base pairs downstream (half a helical turn) topologically is on the same side as the bulge loop . For molecular interpretations of the data reported here, one must be cognizant of these perhaps counterintuitive topological facts . Another consideration is that -dna bulge loop constructs resemble imperfect three - way junctions, where one of the arms, namely the bulge loop dna three - way junctions are known to be stabilized by stacking of two of the three arms to form a continuous helix . Furthermore, curve fitting of the apparent heat capacity curves allows one to resolve the experimentally observed melting profiles into multiple subtransitions . Each resolved subtransition, however, does not necessarily reflect an independently populated discrete ensemble . Accordingly, caution should be exercised when assigning subtransitions to specific conformational states as part of efforts to characterize the energy landscapes of biopolymers . Nevertheless, this deconvolution exercise provides insight into the origins of the lesion - induced alterations in the distribution of states, as noted in the supporting information . Independent of the details of the position - dependent differential behavior we observe, the upstream abasic site and the average impact of the downstream abasic site result in a net destabilization of the duplex structures relative to the corresponding lesion - free construct . This result is consistent with expectations based on our previous studies of the impact of abasic lesions on duplex stability . However, in the -dna constructs studied here, the f - induced destabilization is greater than that observed when the lesion is present in an otherwise fully bonded watsoncrick duplex . Such enhanced lesion - induced destabilization in the construct may reflect synergistic energy coupling between the destabilizing influence of the lesion and the proximal destabilizing impact of the loop domain. (62) figure 2b shows the experimental heat capacity melting profiles for the -dna construct with the thf lesion (f) present in one of three positions within the cag loop domain . The relevant thermodynamic parameters derived by integration of these experimental excess heat capacity curves are listed in table 1b for each of the -dna constructs . By contrast to the results observed for f lesions within the stem duplex domains, we find that placing the lesion within the loop does not destabilize the melting transition relative to the unmodified parent -dna, nor does it alter the heat capacity of the initial states . The thermal and thermodynamic properties of these lesion - containing -dna constructs are essentially identical to those of the corresponding lesion - free structure, although there is some modest change in shape of the overall melting curves . Specifically, we measure the differences for the lesion at the 5 end of the loop to be tm = 0.2 c, h = 0.3 kcal mol, and s = 1 cal mol k, while for the lesion in the middle of the loop we measured the differences to be tm = 0.5 c, h = + 4.3 kcal mol, and s = + 13 cal mol k. interestingly, based on the data listed in table 1b and the heat capacity curves shown in figure 2b, when the f lesion is near the 3 end of the loop, a significant enthalpic destabilization is observed, but it is exactly balanced by a decrease in entropy, resulting in no net tm shift (tm = 0.1 c, h = 21.4 kcal mol, and s = 65 cal mol k). The reasons for the difference in thermodynamic impact of f at the 3 end of the bulge loop compared to the other two loop positions are not known, but it may reflect differential lesion - induced distributions of microstates within the -dna macrostates, as discussed below . We previously have shown the lesion - free cag -dna macrostate to be composed of an ensemble of discrete microstates with significant energy barriers between them . We propose here that the f lesion can lead to an altered distribution of these microstates without significantly affecting the ensemble average properties . The absence of a guanine base at a single site may be accommodated within an ensemble of heterogeneous structural and energetic microstates without a net change in global thermodynamics through redistribution between these microstates . In other words, we propose that the -dna state is sufficiently plastic to accommodate deletion of an individual base without a net change in global energetics . We previously have shown in the absence of abasic lesions that single - stranded cag triplet repeat loops form self - structures that enthalpically and entropically stabilize and hairpin dna structures . While atomic - level structural information for such cag self - structure is lacking, it has been argued that cag repeat structures consist of gc and cg base pairs separated by aa mismatches . This view is based on nmr measurements on isolated (cag)/(cag) segments within duplex dna, and on the known thermodynamic stability of gc base pairs in duplex dna . In this model, deletion of a g base within the loop domain, as we do here with the abasic lesion, should significantly destabilize the -dna loop, and thereby the entire -dna construct, particularly since such a disrupted nonpairing lesion site would be situated next to an already destabilizing aa mismatch . The fact that we do not observe any net impact of the loop - positioned abasic lesion on overall -dna thermodynamics (other than a modest modulation in the melting curve shape) suggests that the cag loop is able to accommodate the lesion without loss of the loop - stabilizing interactions observed in the corresponding lesion - free construct . As a result, our data do not support the gc and cg base pairs separated by aa mismatches single - stranded order model of cag repeats that is popular in the literature . Nevertheless, this base - pairing model may play a role in some of the different microstates populated in the loop, thereby explaining the presence of the relevant fingerprint signals in 1d proton nmr spectra of simple cag repeats . In general, depending on where the f lesion is located in the loop, different microstates may be differentially populated, although the ensemble average value could remain essentially constant . Such redistribution between microstates should be reflected in the shape of the calorimetric melting curve, as indeed we observed . The altered distribution of microstates may not be detected in spectroscopic measures of nucleic acid structure, such as cd measurements, due to a lack of resolution and the averaging of the signal . The ability of the -dna to accommodate base deletions through redistribution between different energetic / structural microstates represents a reasonable working hypothesis, particularly given the repetitive nature of the cag repeat sequences, the relatively small energy penalties for a plethora of non - watsoncrick base - pairing arrangements involving a, g, and c bases, and the inherent flexibility of single - stranded loops . The strand exchange reaction from -dna to complementary duplex discussed in the following section provides additional support for this hypothesis, as does the curve fitting resolution into multiple subtransitions of the experimental heat capacity curves (see supporting information). We previously have demonstrated that the lesion - free cag -dna construct and its complementary lesion - free ctg -dna are metastable . As shown in scheme 2, these two complementary lesion - free constructs can undergo thermally induced strand exchange to form fully paired 22mer and 40mer watsoncrick duplexes . The corresponding experimental heat capacity melting profiles reflective of these transformations in the presence and in the absence of the lesions located within the stem duplex domains and in the looped domain of the cag -dna construct are shown in figure 3 . Strand exchange heat capacity profiles of -dna constructs with and without the f lesion in the stem domains (a) and in the loop domain (b). The excess heat capacity curves were obtained for a 1:1 mixture of the cag -dna with and without lesions and its complementary ctg --dna . Note the unusual exotherm near 50 c present in all traces that indicates strand exchange from the metastable -dna states to the thermodynamically stable duplex states . The conventional endotherms observed at higher temperatures in these traces correspond to the melting of the 22mer and 40mer duplexes that are formed by the exchange process . (a) strand exchange when the f lesion is located in the duplex domain upstream (red, cag - fstem) or downstream (blue, ctg - fstem) of the loop domain . For comparison, (b) strand exchange when the f lesion is located within the loop domain (red, cag - f1; green, cag - f3; blue, cag - f5). Note the presence in the heat capacity profiles of the exotherms prior to endothermic global duplex melting, consistent with the general behavior observed for the corresponding lesion - free -dna constructs . This exothermic trough reflects the thermally induced strand exchange event between the two complementary metastable -dna states to form the two thermodynamically more stable watsoncrick duplexes, which subsequently melt, exhibiting their characteristic endothermic peaks . Using these experimental heat capacity profiles and the differential positions, breadths, and magnitudes of the exothermic peak, we can distinguish between the exchange behavior of those cag -dnas which contain the lesion in the watsoncrick duplex domains and those which contain the lesion in the single - stranded loop domain . When the lesion is downstream of the loop in the cag -dna duplex domain, designated as ctg - fstem, strand exchange occurs in a temperature range where a significant fraction of the overall lesion - containing cag -dna already has melted, but where melting of the lesion - free complementary ctg -dna construct has yet to occur . Under such circumstances, the exchange process may be influenced by the properties of the (partially) denatured lesion - containing cag -dna state, making this event similar to a strand displacement process, as we previously have reported. (36) this perspective also is consistent with the broad temperature range of strand exchange observed in figure 3a (the blue exotherm) for the lesion - containing cag -dna . By contrast, when the lesion is positioned upstream of the loop in the cag duplex domain (cag - fstem), the exchange transition partially overlaps the global melting of the lesion - containing cag -dna construct . As a result of this thermal overlap, one observes apparent coupling between cag -dna melting and the overall strand exchange, as reflected by the narrow transition exotherm observed in figure 3a (the red curve). Collectively, these results suggest that, in addition to lesion - induced alterations (destabilizations) of local -dna energy minima, the presence of a f lesion in duplex domains of metastable -dna constructs also modulates the overall energy landscape, influencing the strand exchange trajectory / pathway leading from the metastable -dna states to the final thermodynamically more stable duplex states . For -dnas with the f lesion in the loop domain, we find strand exchange to occur below the onset of global melting of the -dnas . This observation is consistent with an energetic decoupling of these two events, as we have observed for the lesion - free construct . We also find the exchange temperature and shape of the exotherm to exhibit subtle but real differences . These differences depend on the position of the f lesion within the loop, although the overall temperature range of strand exchange is similar, particularly compared to the impact of the lesion in the duplex domains . Collectively, these observations suggest that the energy barrier between the metastable -dna states and the final duplex states is not consequentially altered by the presence of the f lesion within the loop, in contrast to the impact when the lesion is in the duplex domains . We do find, however, that the f lesion impacts the thermal and thermodynamic properties of the lesion - containing duplex products formed by the exchange process . Given that strand exchange occurs from a metastable initial state and is dominated by the necessity to form a stable initiation complex, the energetics of the final state will only impact the overall driving force . Below we propose an overall interpretation of the differences just noted for the influence of looped lesions on the exchange temperatures, the thermal ranges, and the shapes of the -dna exchange exotherms observed in figure 3b . Consistent with our previous interpretation of the corresponding lesion - free -dna construct, we propose that the subtle differences in exchange temperature and shape of the exchange exotherm seen in figure 3b reflect lesion - induced energetic differences and population redistribution of microstates that make up the metastable -dna macrostate. (37) we observe that, for the -dna containing the f lesion near the center of the loop domain, strand exchange occurs at a slightly higher temperature and over a narrower temperature range than strand exchange for those -dnas containing the f lesion near the 3 or 5 end of the loop domain . Perhaps an abasic lesion near the center of a loop domain reduces the number of microstates that can be populated . The centered lesion also may favor the population of the lower energy microstates, resulting in a narrower temperature range during the exchange process at higher temperatures . By contrast, an abasic site either 3 or 5 of the center of the loop may increase the number of microstates that can be populated, resulting in an increase in the population of higher energy microstates, thereby giving rise to the experimental outcomes we observe . Collectively, these results provide further evidence for the roughness of the -dna energy landscape and the distribution of energetically / structurally discrete microstates that make up the -dna macrostate . In the following section, we report here a position - dependent, differential impact of abasic lesions on the population of slipped dna structures . Replacement of a guanosine by an abasic lesion within a double - helical domain destabilizes the duplex state, either for the constructs studied here or for a fully bonded duplex (unpublished results). By contrast, replacement of a guanosine by an abasic lesion within a cag single - stranded, bulge loop domain does not alter the stability of the dna state . As a consequence of this differential impact, the presence of an abasic lesion favors the cag bulge loop state relative to the duplex state, thereby increasing the probability that such damaged repeat sequences form slipped dna structures . This observation may, in part, explain why activation of ber processes results in increases in dna expansion. (17) in general, within an extended iterative sequence, migration of a looped domain can occur . When loop migration encounters an abasic lesion site, our data demonstrate that the lesion - containing looped structures will be energetically favored over those with the lesions in the adjacent duplex domains . In other words, abasic sites create thermodynamic sinks for migrating loops that trap or enhance the occupancy of slipped, bulged structures . In addition, the presence of abasic lesions in the flanking duplex domains produces regions of instability which, as we previously have shown, provide sites for enhanced protein binding and, by extension, ber activity . We also note that the interactions of proteins (e.g., pol) on regions immediately upstream or downstream of repeat domains may further enhance repeat loop formation through mechanical stress on the dna helix . The results presented here reinforce the notion that cag repeat loops are energetically and perhaps structurally heterogeneous, thereby providing a challenge for proteins that have evolved to deal with double - stranded substrates . Our proposal that an abasic lesion within cag repeat loops results in an altered distribution of microstates may be biologically relevant, since some of these energetic / structural microstates could pose challenges to or opportunities for dna processing enzymes . A lesion - induced increase in population of these states may lead to erroneous expansion of the repeat sequences, the hallmark of dna expansion diseases . The results reported here also reinforce our previous proposal of a rough energy landscape for triple repeat dnas and the potential impact of such rough landscapes on biological processes. (37) in the aggregate, our data provide a potential rationale for the in vivo observation of ber - induced enhancement of dna expansion. (17)
A retrospective, matched cohort investigation was performed by using patient records from january 2003 through august 2004 from 2 tertiary care hospitals in baltimore to examine outcomes of hospitalized patients with mdr acinetobacter infection (exposure) compared with 2 unexposed reference groups: patients with susceptible acinetobacter infection (susceptible references) and patients without acinetobacter infection (uninfected references). We chose 2 reference groups to explore the effects of multidrug resistance and mdr acinetobacter infection on patient outcomes (15). We defined mdr acinetobacter as organisms resistant to all or all but 1 antimicrobial drug classes commonly prescribed to treat gram - negative infections . Susceptibility to polymyxins was not considered in these criteria because susceptibility testing for these drugs is not routinely performed . Those patients infected with acinetobacter that was susceptible to only 2 antimicrobial drug classes were excluded . A computer - generated list was used to identify all persons from whom mdr acinetobacter had been recovered from january 2003 through august 2004 . Charts were then reviewed to determine, on the basis of criteria set forth by the national nosocomial infection surveillance system (nnis) (16), if the patient had 1 of the following infections caused by mdr acinetobacter: bloodstream, pneumonia (respiratory tract), surgical site, urine, or sterile site other than blood . Admitted patients with both healthcare - acquired (i.e., infection was diagnosed> 48 h after hospital admission) and community - acquired acinetobacter infections (i.e., infection was diagnosed within 48 h of hospital admission) were included . For the selection of matched susceptible references, microbiology records were reviewed to identify patients from whom susceptible acinetobacter had been recovered from january 2003 through august 2004 at each institution . Nnis definitions were then applied to identify acinetobacter - infected patients who were included in the study (16). To ensure that susceptible references and their matched mdr acinetobacter patients had a similar exposure time, the susceptible references had to have a preinfection length of hospital stay within 5% of the matched mdr acinetobacter patient s preinfection length of stay . The second reference group, uninfected patients, included patients without acinetobacter infection who had a length of hospital stay (time between admission and discharge) at least as long as the preinfection length of stay of the respective matched patient infected with mdr acinetobacter . The matched uninfected patient also had to be present in the ward where the patient infected with mdr acinetobacter was located within 30 days of becoming infected with mdr acinetobacter . Data abstracted from medical records included demographic information; presence of prior and concurrent medical conditions; dates of admission and discharge to the icu and hospital; date and time of acinetobacter culture; acinetobacter antimicrobial susceptibility pattern; length of stay before infection (exposure time); presence or absence of concordant antimicrobial therapy on the day of the acinetobacter culture (based on the susceptibility pattern of the organism); patient status on day of discharge; and date and cause of death if applicable . Data were collected on the following outcomes: in - hospital mortality rates and total number of days in hospital and icu after the index day (i.e., length of stay after the exposure). We defined the index day as either the day of hospitalization on which acinetobacter infection was diagnosed for patients infected with mdr acinetobacter and for susceptible reference patients or the same day of hospitalization for uninfected patients . For example, if an mdr acinetobacter infection was diagnosed on hospital day 15, that would be the index day for the mdr acinetobacter patient and for the matched, uninfected patient . To control for severity of illness before acinetobacter infection, data were collected to calculate a modified acute physiology and chronic health evaluation iii (apache) score (17,18) 48 h before the index day . Our modified apache score did not include blood ph, pulmonary arterial oxygen saturation, pulmonary arterial gradient, urine output, or scoring for neurologic abnormalities . These parameters were excluded because they were not uniformly available for all patients in the study, particularly for those not in the icu . To control for underlying disease, a charlson comorbidity index (19) was calculated by using data from the medical history recorded on the chart . All data were collected on standard forms, entered into an access database (microsoft, redmond, wa, usa) and analyzed with sas software (sas institute, cary, nc, usa). Demographic data were analyzed with mantel - haenszel relative risks and 95% confidence intervals (cis) to compare categorical variables and the wilcoxon 2-sample test with t approximation to compare continuous variables . Multivariable analysis controlling for severity of illness with the apache score and underlying diseases with the charlson index was performed by using conditional logistic regression to evaluate in - hospital mortality rate and hospital and icu length of stay . To create a dichotomous variable for icu and hospital lengths of stay, we compared the number in each comparison group that had a length of stay greater than the combined mean of the 2 groups being compared . For example, the combined group of mdr acinetobacter infected and susceptible acinetobacter references had a mean hospital length of stay of 23 days after the index day (day of infection). The number of mdr acinetobacter patients who had a hospital length of stay> 23 days was then compared with the number of susceptible references who had a hospital length of stay> 23 days, while controlling for severity of illness and associated underlying diseases in the multivariable model . We chose to compare against the mean rather than the median length of stay to account for outliers . Unmatched mdr acinetobacter infected and reference patients were excluded from the groups before the mean was calculated . A linear regression model and an ordinal logistic regression model were also attempted; however, these models could not be used because the outcome data were not normally distributed and could not be transformed appropriately for linear regression and because the assumptions for the ordinal logistic regression model could not be satisfied . To examine the effect of discordant empiric antimicrobial drug therapy on clinical outcomes, multivariable analysis was performed on the mdr acinetobacter patients alone; the exposure evaluated was concordant versus discordant empiric antimicrobial drug therapy . We defined discordant empiric antimicrobial drug therapy as the administration of antimicrobial drug(s) to which the acinetobacter strain was not susceptible . Concordant empiric antimicrobial drug therapy is defined as the administration of antimicrobial drug(s) to which the acinetobacter strain was susceptible . Apache and charlson index scores were included in the model to control for their effect on outcomes . Effect modification between mdr acinetobacter reference groups and apache and charlson index variables was evaluated by testing appropriate interaction terms for statistical significance . All statistical tests were 2-tailed; a p value <0.05 was considered statistically significant . A retrospective, matched cohort investigation was performed by using patient records from january 2003 through august 2004 from 2 tertiary care hospitals in baltimore to examine outcomes of hospitalized patients with mdr acinetobacter infection (exposure) compared with 2 unexposed reference groups: patients with susceptible acinetobacter infection (susceptible references) and patients without acinetobacter infection (uninfected references). We chose 2 reference groups to explore the effects of multidrug resistance and mdr acinetobacter infection on patient outcomes (15). We defined mdr acinetobacter as organisms resistant to all or all but 1 antimicrobial drug classes commonly prescribed to treat gram - negative infections . Susceptibility to polymyxins was not considered in these criteria because susceptibility testing for these drugs is not routinely performed . Those patients infected with acinetobacter that was susceptible to only 2 antimicrobial drug classes were excluded . A computer - generated list was used to identify all persons from whom mdr acinetobacter had been recovered from january 2003 through august 2004 . Charts were then reviewed to determine, on the basis of criteria set forth by the national nosocomial infection surveillance system (nnis) (16), if the patient had 1 of the following infections caused by mdr acinetobacter: bloodstream, pneumonia (respiratory tract), surgical site, urine, or sterile site other than blood . Admitted patients with both healthcare - acquired (i.e., infection was diagnosed> 48 h after hospital admission) and community - acquired acinetobacter infections (i.e., infection was diagnosed within 48 h of hospital admission) were included . For the selection of matched susceptible references, microbiology records were reviewed to identify patients from whom susceptible acinetobacter had been recovered from january 2003 through august 2004 at each institution . Nnis definitions were then applied to identify acinetobacter - infected patients who were included in the study (16). To ensure that susceptible references and their matched mdr acinetobacter patients had a similar exposure time, the susceptible references had to have a preinfection length of hospital stay within 5% of the matched mdr acinetobacter patient s preinfection length of stay . The second reference group, uninfected patients, included patients without acinetobacter infection who had a length of hospital stay (time between admission and discharge) at least as long as the preinfection length of stay of the respective matched patient infected with mdr acinetobacter . The matched uninfected patient also had to be present in the ward where the patient infected with mdr acinetobacter was located within 30 days of becoming infected with mdr acinetobacter . Data abstracted from medical records included demographic information; presence of prior and concurrent medical conditions; dates of admission and discharge to the icu and hospital; date and time of acinetobacter culture; acinetobacter antimicrobial susceptibility pattern; length of stay before infection (exposure time); presence or absence of concordant antimicrobial therapy on the day of the acinetobacter culture (based on the susceptibility pattern of the organism); patient status on day of discharge; and date and cause of death if applicable . Data were collected on the following outcomes: in - hospital mortality rates and total number of days in hospital and icu after the index day (i.e., length of stay after the exposure). We defined the index day as either the day of hospitalization on which acinetobacter infection was diagnosed for patients infected with mdr acinetobacter and for susceptible reference patients or the same day of hospitalization for uninfected patients . For example, if an mdr acinetobacter infection was diagnosed on hospital day 15, that would be the index day for the mdr acinetobacter patient and for the matched, uninfected patient . To control for severity of illness before acinetobacter infection, data were collected to calculate a modified acute physiology and chronic health evaluation iii (apache) score (17,18) 48 h before the index day . Our modified apache score did not include blood ph, pulmonary arterial oxygen saturation, pulmonary arterial gradient, urine output, or scoring for neurologic abnormalities . These parameters were excluded because they were not uniformly available for all patients in the study, particularly for those not in the icu . To control for underlying disease, a charlson comorbidity index (19) was calculated by using data from the medical history recorded on the chart . All data were collected on standard forms, entered into an access database (microsoft, redmond, wa, usa) and analyzed with sas software (sas institute, cary, nc, usa). Demographic data were analyzed with mantel - haenszel relative risks and 95% confidence intervals (cis) to compare categorical variables and the wilcoxon 2-sample test with t approximation to compare continuous variables . Multivariable analysis controlling for severity of illness with the apache score and underlying diseases with the charlson index was performed by using conditional logistic regression to evaluate in - hospital mortality rate and hospital and icu length of stay . To create a dichotomous variable for icu and hospital lengths of stay, we compared the number in each comparison group that had a length of stay greater than the combined mean of the 2 groups being compared . For example, the combined group of mdr acinetobacter infected and susceptible acinetobacter references had a mean hospital length of stay of 23 days after the index day (day of infection). The number of mdr acinetobacter patients who had a hospital length of stay> 23 days was then compared with the number of susceptible references who had a hospital length of stay> 23 days, while controlling for severity of illness and associated underlying diseases in the multivariable model . We chose to compare against the mean rather than the median length of stay to account for outliers . Unmatched mdr acinetobacter infected and reference patients were excluded from the groups before the mean was calculated . A linear regression model and an ordinal logistic regression model were also attempted; however, these models could not be used because the outcome data were not normally distributed and could not be transformed appropriately for linear regression and because the assumptions for the ordinal logistic regression model could not be satisfied . To examine the effect of discordant empiric antimicrobial drug therapy on clinical outcomes, multivariable analysis was performed on the mdr acinetobacter patients alone; the exposure evaluated was concordant versus discordant empiric antimicrobial drug therapy . We defined discordant empiric antimicrobial drug therapy as the administration of antimicrobial drug(s) to which the acinetobacter strain was not susceptible . Concordant empiric antimicrobial drug therapy is defined as the administration of antimicrobial drug(s) to which the acinetobacter strain was susceptible . Apache and charlson index scores were included in the model to control for their effect on outcomes . Effect modification between mdr acinetobacter reference groups and apache and charlson index variables was evaluated by testing appropriate interaction terms for statistical significance . All statistical tests were 2-tailed; a p value <0.05 was considered statistically significant . From january 2003 through august 2004, a total of 166 patients had cultures that grew mdr acinetobacter, and 96 (58%) met the nnis criteria for an mdr acinetobacter infection (16). We identified 91 reference patients infected with susceptible acinetobacter who had similar lengths of hospital stay before the index day as mdr acinetobacter infected patients were excluded from the analysis because reference patients could not be identified due to a lack of susceptible references who were hospitalized for long periods . Mdr acinetobacter patients and susceptible references were similar in age and sex; however, mdr acinetobacter patients had higher baseline mean apache and charlson index scores than susceptible references (table 1). The distribution of culture sites among mdr acinetobacter and susceptible reference patients was similar; 50% of each group had respiratory infections, 31% in each group had bloodstream infections, and <10% of both groups had surgical wound, urinary tract, or other sterile site infections (p not significant for all comparisons). A total of 78 (81%) mdr acinetobacter infections and 73 (80%) susceptible acinetobacter infections were identified> 48 h after hospital admission and thus met criteria for nosocomial infection . * apache iii, acute physiology and chronic health evaluation iii . Infected patients had higher mean lengths of hospital stay and icu stay after the index day than susceptible and uninfected references (table 2). In - hospital mortality rates for patients with mdr acinetobacter infections (26%) were higher than for susceptible references (18%) and uninfected references (11%). However, only the difference between mdr acinetobacter when controlling for severity of illness with the apache score and for underlying disease with the charlson index in a conditional logistic regression model, association with a longer hospital and icu length of stay was approximately twice as likely for patients with mdr acinetobacter infection as for susceptible references (table 3). Multivariable analysis controlling for severity of illness with the apache score and underlying diseases with the charlson index showed a trend toward more deaths associated with infection with mdr acinetobacter than with infection with susceptible acinetobacter, but the difference was not statistically significant (relative risk 2.6, 95% ci 0.326.1) (table 3). * or, odds ratio; ci, confidence interval . Models include modified acute physiology and chronic health evaluation iii score to control for severity of illness and charlson index to control for underlying disease . When we controlled for severity of illness and underlying diseases, we found that initial discordant antimicrobial drug therapy was not associated with increased mortality rates or hospital length of stay among patients infected with mdr acinetobacter (table 4). However, patients infected with mdr acinetobacter who were treated with initial discordant antimicrobial drug therapy were> 5 as likely to be associated with an increased icu length of stay . * or, model includes modified acute physiology and chronic health evaluation iii score to control for severity of illness and charlson index to control for underlying disease . Reference patients were not identified for 7 mdr acinetobacter patients because there were not enough uninfected patients with extensive hospital length of stay . However, patients with mdr acinetobacter infection had higher baseline mean apache and charlson index scores than references (table 1). Matched univariate analysis of patient outcomes showed that patients with mdr acinetobacter had higher in - hospital mortality rates (26% vs. 11%, p<0.01) and mean hospital and icu lengths of stay after the index day than uninfected references (table 2). When we controlled for severity of illness and underlying conditions, we found that mdr acinetobacter infected patients were more likely to have both longer hospital and icu lengths of stay than uninfected references (table 3). We identified 91 reference patients infected with susceptible acinetobacter who had similar lengths of hospital stay before the index day as mdr acinetobacter infected patients were excluded from the analysis because reference patients could not be identified due to a lack of susceptible references who were hospitalized for long periods . Mdr acinetobacter patients and susceptible references were similar in age and sex; however, mdr acinetobacter patients had higher baseline mean apache and charlson index scores than susceptible references (table 1). The distribution of culture sites among mdr acinetobacter and susceptible reference patients was similar; 50% of each group had respiratory infections, 31% in each group had bloodstream infections, and <10% of both groups had surgical wound, urinary tract, or other sterile site infections (p not significant for all comparisons). A total of 78 (81%) mdr acinetobacter infections and 73 (80%) susceptible acinetobacter infections were identified> 48 h after hospital admission and thus met criteria for nosocomial infection . * apache iii, acute physiology and chronic health evaluation iii . Infected patients had higher mean lengths of hospital stay and icu stay after the index day than susceptible and uninfected references (table 2). In - hospital mortality rates for patients with mdr acinetobacter infections (26%) were higher than for susceptible references (18%) and uninfected references (11%). When controlling for severity of illness with the apache score and for underlying disease with the charlson index in a conditional logistic regression model, association with a longer hospital and icu length of stay was approximately twice as likely for patients with mdr acinetobacter infection as for susceptible references (table 3). Multivariable analysis controlling for severity of illness with the apache score and underlying diseases with the charlson index showed a trend toward more deaths associated with infection with mdr acinetobacter than with infection with susceptible acinetobacter, but the difference was not statistically significant (relative risk 2.6, 95% ci 0.326.1) (table 3). * or, odds ratio; ci, confidence interval . Models include modified acute physiology and chronic health evaluation iii score to control for severity of illness and charlson index to control for underlying disease . When we controlled for severity of illness and underlying diseases, we found that initial discordant antimicrobial drug therapy was not associated with increased mortality rates or hospital length of stay among patients infected with mdr acinetobacter (table 4). However, patients infected with mdr acinetobacter who were treated with initial discordant antimicrobial drug therapy were> 5 as likely to be associated with an increased icu length of stay . * or, model includes modified acute physiology and chronic health evaluation iii score to control for severity of illness and charlson index to control for underlying disease . Reference patients were not identified for 7 mdr acinetobacter patients because there were not enough uninfected patients with extensive hospital length of stay . However, patients with mdr acinetobacter infection had higher baseline mean apache and charlson index scores than references (table 1). Matched univariate analysis of patient outcomes showed that patients with mdr acinetobacter had higher in - hospital mortality rates (26% vs. 11%, p<0.01) and mean hospital and icu lengths of stay after the index day than uninfected references (table 2). When we controlled for severity of illness and underlying conditions, we found that mdr acinetobacter infected patients were more likely to have both longer hospital and icu lengths of stay than uninfected references (table 3). Acinetobacter is emerging as an important pathogen in traditional and nontraditional healthcare settings . Its ability to infected healthy hosts and its propensity to develop antimicrobial drug resistance have caused concern among the infectious diseases community . Our study assessed the clinical outcomes of patients infected with mdr acinetobacter compared with outcomes of patients infected with susceptible acinetobacter strains and patients without acinetobacter infections among a large cohort . We demonstrated that patients infected with mdr strains of acinetobacter have longer lengths of stay in both the hospital and icu than patients infected with drug - susceptible acinetobacter and patients without acinetobacter infection when we controlled for severity of illness . However, the difference was not statistically significant when we controlled for severity of illness . According to nnis, acinetobacter species caused 7% of icu healthcare - associated pneumonias in 2003 compared with 4% in 1986 (p<0.001) (4). The proportion of icu healthcare - associated urinary tract infections and surgical site infections caused by acinetobacter also increased significantly from 1986 to 2003 (p<0.001) (4). Furthermore, the proportions of acinetobacter isolates reported to nnis that were resistant to ceftazidime, amikacin, and imipenem all increased significantly during that period (p<0.001). Healthcare - associated outbreaks of mdr acinetobacter infection have been reported in asia, europe, north america, and among us service members injured in the middle east (79). Investigating the effect of multidrug resistance on clinical outcomes presents multiple methodologic challenges that have been explicitly addressed in our study design . Confounding risk factors associated with mortality rates and antimicrobial drug resistance, such as age, severity of illness, and underlying disease (1821) our results differ from those of researchers who examined outcomes of acinetobacter infections without controlling for these confounders (14,22,23), which makes their findings difficult to interpret . We assessed and controlled for severity of illness and underlying disease with 2 measurements: the apache score, which included age, physiologic parameters, and selected underlying diseases; and a separate charlson index, which included a broader range of underlying diseases . Both measurements have been validated, although the apache score has only been studied in its original form (19,21,24). Because patients infected with acinetobacter have worse clinical outcomes than those who are colonized with the organism (11), we separated acinetobacter infection from colonization on the basis of standardized, validated centers for disease control and prevention (atlanta, ga, usa) nnis definitions for nosocomial infection (16,25) and applied them uniformly to mdr acinetobacter and susceptible references . We compared outcomes of mdr acinetobacter infections with those of 2 reference groups and showed an association of mdr acinetobacter infection with both increased hospital and icu lengths of stay, regardless of the reference group selected . As one would predict on the basis of results of a study by kaye et al ., the effect of multidrug resistance was greater compared with uninfected than susceptible references (15). Because of the lack of a standard definition for multidrug resistance in the literature, we defined multidrug resistance as resistance to all or all but 1 antimicrobial drug class commonly prescribed for treatment of patients with gram - negative infections, with the exclusion of polymyxins (26). First, it is a strict standard and is readily accepted by clinicians as representative of multidrug resistance . Second, it allows for a clear distinction between susceptible and mdr acinetobacter strains because we excluded isolates that showed intermediate resistance (strains resistant to all but 2 commonly prescribed antimicrobial drug classes). The association of mdr acinetobacter infections with worse clinical outcomes could be related to discordant empiric antimicrobial drug therapy . Previous studies that examined the effects of delayed concordant antimicrobial therapy on patient outcomes have shown conflicting results (2729). We examined this issue and found that patients with mdr acinetobacter infections who received discordant empiric antimicrobial drug therapy were not more likely to die or have a longer hospital length of stay than patients who received concordant empiric drug therapy; however, they were more likely to have a longer icu length of stay . On the basis of these results, to what extent discordant empiric antimicrobial drug therapy affects clinical outcomes of mdr acinetobacter infection is not clear . Determining optimal infection control approaches to mdr acinetobacter has been complicated by the lack of agreement on the clinical significance of acinetobacter infections . The hospital infection control practices advisory committee guideline for isolation precautions in hospitals recommends targeting increased infection control efforts toward resistant bacteria judged by the infection control program to be of special clinical and epidemiologic significance (30). We found that mdr acinetobacter infections are independently associated with increased hospital and icu lengths of stay . This finding, combined with increased risk for in - hospital transmission of the organism (31), supports recommendations to implement aggressive control measures to limit the transmission of mdr acinetobacter in healthcare settings . Several limitations of this study merit discussion . Because of the lack of available data to calculate a standard apache iii score for non - icu patients, we modified the apache iii score by excluding variables that were unavailable for non - icu patients . However, our findings support the validity of this scoring system as a measure for severity of underlying illness . Infected patients than in both reference groups and progressed stepwise from no infection to mdr infection . These findings are expected because drug - resistant infections reportedly occur in sicker patients (24,32,33). Univariate analysis showed that a modified apache score was also associated with mortality rates (p<0.001), which further supports its validity as a measure of illness severity . The lack of available reference patients with similar exposure times to several of the case - patients (5 susceptible references and 7 uninfected references) was a second limitation because we were obligated to exclude unmatched mdr acinetobacter infected patients from our analysis . These excluded patients typically had prolonged exposure times and tended to have long hospital and icu lengths of stay after infection . Exclusion of these patients decreased the power of our study and likely biased our results toward showing no difference in hospital or icu length of stay between the groups . Finally, the lack of a difference in mortality rates, according to multivariable analysis, could mean that mdr acinetobacter are not more virulent than nonresistant strains or that the sample size in this study lacked the power to show a difference . Our study indicates that infections with mdr acinetobacter are independently associated with the adverse clinical outcomes of prolonged hospital and icu lengths of stay compared with the outcomes for uninfected patients and those infected with drug - susceptible acinetobacter . This is the first study evaluating length of stay and mortality rates associated with mdr acinetobacter infection while controlling for important confounders such as severity of illness and underlying disease . These data emphasize the need for aggressive infection control strategies to prevent mdr acinetobacter infection and its adverse effects on hospitalized patients.
The basic goal of therapy is to achieve a steady state blood level that is therapeutically effective and nontoxic for an extended period of time . The design of proper dosage regimens is an important element in accomplishing this goal . In conventional oral dosage forms drug dosage this drawback of conventional dosage form can be overcome by formulation of controlled release dosage forms, which provides drug release in an amount sufficient to maintain the therapeutic drug level over extended period of time, with release profiles controlled by the special technological construction and design of the system . The term controlled release has become associated with those systems from which therapeutic agents may be automatically delivered at predetermined rates over a long period of time . Products of this type have been formulated for oral, injectable, and topical use and inserts for placement in body cavities . Controlled release also denotes systems, which can provide some control whether this be of a temporal or spatial nature or both for drug release in the body . Matrix systems offer several advantages relative to other extended release dosage forms like easy to manufacture, versatile, effective, low cost, and can be made to release high molecular weight compounds . Since the drug is dispersed in the matrix system, accidental leakage of the total drug components is less likely to occur, although occasionally, cracking of the matrix material can cause unwanted release . Hypertension is one of the chronic disorders affecting a large number of populations in the world . Hypertension often is defined as a diastolic pressure of more than 90 mmhg because at this value the frequency of complication due to hypertension rises significantly . Hypertension may also refer to increase the blood pressure in any blood vessel, such as pulmonary or portal hypertension . Systemic hypertension may leads to cerebrovascular accidents, myocardial infarction, congestive heart failure, and renal damage . The incidence of morbidity and mortality significantly decreases when hypertension is diagnosed early and is properly treated . Losartan potassium is the first orally active angiotensin - ii antagonist used in the treatment of hypertension either alone (or) in combination of hydrochlorothiazides . It undergoes extensive biotransformation and has an elimination half life 1.5 - 2.5 h and hence it is suitable for oral controlled release . The current study aims at developing oral controlled release tablets of losartan potassium, using matrices hpmc k100 m and carbopol 934p, xanthan gum with chitosan, and trisodium citrate as a cross - linking agent . The developed formulations were evaluated for weight variation, hardness, friability, and in vitro release studies . Xanthan gum, trisodium citrate, di - basic calcium phosphate, magnesium stearate were procured s.d . Table 1 enlists the composition of different formulations prepared using varying amounts of the polymers (i.e., carbopol 934p and hpmc k100 m, xanthan gum, chitosan, trisodium citrate) and dicalcium phosphate as the diluent, along with the fixed quantity of magnesium stearate as lubricant . Drug and the excipients were homogeneously blended and subsequently compressed into flat - faced tablets using multi - punch tablet compression machine (india). Composition of losartan potassium control release matrix tablet (f1-f12) fourier transforms infra - red (ftir) study was carried out to check compatibility of drug with polymers . The spectrum of dried mixture of drug and potassium bromide was run followed by drug with various polymers by using ftir spectrophotometer (thermo nicolet 380, india). The prepared controlled release tablets were evaluated for uniformity of weight using 20 tablets, hardness using 6 tablets (monsanto hardness tester), and friability using 20 tablets (roche friabilator). Five tablets were weighed and triturate, from that transfer an accurately weighed portion of the powder equivalent to about 100 mg of losartan potassium in a 100 ml volumetric flask containing buffer solution and then concentration is measured at max 205 nm . The in - vitro dissolution studies were performed using the usp- ii (paddle) dissolution apparatus at 50 rpm . The dissolution medium consisted of 900 ml of an aliquot (5 ml) was withdrawn at specific time intervals and drug content was determined by uv - visible spectrometer (shimadzu-1700, japan) at 205 nm . Were analyzed as per zero order, first order, higuchi equation models to assess the drug release kinetics and mechanism of release from the tablets . The optimized formulation was subjected for 3 month stability study according to international conference on harmonization (ich) guidelines . The selected formulations were packed in aluminum foils, which were in wide mouth bottles closed tightly . They were then stored at 25c/60% rh, 30c/65% rh, 40c/75% rh for 3 months and evaluated for their permeation study . Table 1 enlists the composition of different formulations prepared using varying amounts of the polymers (i.e., carbopol 934p and hpmc k100 m, xanthan gum, chitosan, trisodium citrate) and dicalcium phosphate as the diluent, along with the fixed quantity of magnesium stearate as lubricant . Drug and the excipients were homogeneously blended and subsequently compressed into flat - faced tablets using multi - punch tablet compression machine (india). Fourier transforms infra - red (ftir) study was carried out to check compatibility of drug with polymers . The spectrum of dried mixture of drug and potassium bromide was run followed by drug with various polymers by using ftir spectrophotometer (thermo nicolet 380, india). The prepared controlled release tablets were evaluated for uniformity of weight using 20 tablets, hardness using 6 tablets (monsanto hardness tester), and friability using 20 tablets (roche friabilator). Five tablets were weighed and triturate, from that transfer an accurately weighed portion of the powder equivalent to about 100 mg of losartan potassium in a 100 ml volumetric flask containing buffer solution and then concentration is measured at max 205 nm . The in - vitro dissolution studies were performed using the usp- ii (paddle) dissolution apparatus at 50 rpm . The dissolution medium consisted of 900 ml of an aliquot (5 ml) was withdrawn at specific time intervals and drug content was determined by uv - visible spectrometer (shimadzu-1700, japan) at 205 nm . In - vitro drug release data were analyzed as per zero order, first order, higuchi equation models to assess the drug release kinetics and mechanism of release from the tablets . The optimized formulation was subjected for 3 month stability study according to international conference on harmonization (ich) guidelines . The selected formulations were packed in aluminum foils, which were in wide mouth bottles closed tightly . They were then stored at 25c/60% rh, 30c/65% rh, 40c/75% rh for 3 months and evaluated for their permeation study . Losartan potassium was dissolved in both ph 1.2 and ph 6.8, further diluted with the same and scanned for maximum absorbance in uv double beam spectrophotometer (shimadzu uv1700, japan) in the range from 190 to 380 nm, using ph 1.2 and ph 6.8 as blank . As shown in figure 1 the ftir analysis of losartan potassium showed characteristic peaks at 3621/cm due to n oh stretching, 2956 due to ar (h), at 1645 because of c - o stretching and 1377 due to c - n stretching . Moreover, we can observe that, as shown in figures 24 the peaks at the same as above with slight variation was observed for the mixture of drug with different polymers like hpmc k 100 m, carbopol934p, xanthan gum, respectively . Hence, it was found that all the polymers used in formulations were compatible with losartan potassium . Flow properties of the granules were evaluated by determining the bulk density 0.244 0.124 to 0.427 0.136, tapped density 0.275 0.091 to 0.526 0.116, angle of repose 16.43 0.53 to 25.90 0.45, and compressibility index 11.27 0.092 to 24.37 0.147 [table 2]. The measured hardness of tablets of each batch ranged between 5.0 0.05 kg / cm and 5.7 0.07 kg / cm [table 3] this ensures good handling characteristics of all batches . Hence, less than 1% in all formulations ensuring that the tablets were mechanically stable . Hence, all the tablets were found to be uniform with low standard deviation values [table 3]. The percentage of drug content was found to be above 90% of losartan potassium, which was within acceptable limits . The in - vitro drug release was studied with usp - ii (paddle type) dissolution apparatus in both stimulated gastric fluid (ph 1.2) and intestinal fluid (ph 6.8 phosphate buffer) for 24 h [table 4]. Ft - ir spectra of losartan potassium ft - ir spectra of losartan potassium with hpmck100 m ft - ir spectra of losartan potassium with carbopol 934p ft - ir spectra of losartan potassium with xanthan gum precompressional parameters of all formulations post compressional parameters of all formulations drug release studies of f1 to f12 the present study reveals to control the drug release by increasing the concentration of chitosan as a cross - linking agent with different polymers like hpmc k100 m, carbopol 934p, xanthan gum . The combination of different ratios of carbopol 934p and xanthan gum with chitosan (f11 and f12) showed better release profile 99.72% and 98.70%, respectively, rather than other combinations like hpmc k100 m and carbopol 934p, hpmc k100 m and xanthan gum [figures 56]. The values of release rate exponent (n), calculated as per the algorithm proposed by higuchi and korsemeyer, ranged between 0.961 and 1.259 . The drug release from matrix system follows zero - order kinetics and the mechanism was found to be diffusion controlled and case ii transport . The selected formulation f11 and f12 were subjected to accelerated stability studies for 90 days at 25c/60% rh, 30c/65% rh, 40c/75% rh, in vitro permeation study was performed on every 30 days and showed negligible change in permeation profile . The formulation subjected for stability studies cumulative percentage drug release vs time profile of formulation f1 to f6 cumulative percentage drug release vs time profile of formulation f7 to f12 the objective of the present was to investigate the possibility of controlling of losartan potassium release from matrix tablet prepared by different polymers . The preformulation studies were carried out, which ruled out the interaction between the drug and polymers . The granules were punched into tablet and evaluated by post compression parameter like weight variation, hardness, friability, and drug content . All formulation showed acceptable flow properties and with required hardness, weight variation, friability, and drug content . The in - vitro drug release was studies with usp xxii dissolution apparatus in both simulated gastric fluid and intestine fluid for a period of 24 h. the results of dissolution studies indicated that formulations f11 and f12 produced controlled effect with 99.72% and 98.70% of drug release over a period of 24 h than compared with other formulations . It can be concluded that the polymer plays a major role in the design of controlled release matrix tablet . The study reveals that the release of drug was low when the matrix tablet contained polymers with increasing concentration of chitosan as a cross - linking agent and also shows anomalous diffusion kinetics . Hence, it clearly manifests that, the necessity of combining different classes of polymers is required to to get an acceptable pharmacokinetic profile.
A. azurea was proposed by omura et al . In 1983 and later on emended by henssen et al . In 1987 and was isolated from soil that produced two water soluble antibiotics, namely, azureomycin a and b. a. azurea strain dsm 43854 was obtained from the open collection of the german collection of microorganisms and cell cultures (dsmz), braunschweig, germany . The strain a. azurea dsm 43854 is a gram - positive bacteria and contains aerial mycelium with white to blue color . Genomic dna was extracted from a 48 hour old culture using zr fungal / bacterial dna miniprep as per manufacturer's instructions . Sequencing resulted in 22,170,928 paired - end reads (insert size of 350 bp) of 101 bp length . A total of 21,919,041 high - quality reads with approximately 480 coverage were assembled using clcbio wb5.5 (http://www.clcbio.com) (word size 55 and bubble size 60) to obtain 154 contigs (n50, 127,182 bp). The functional annotation was carried out by rast (rapid annotation using subsystem technology), trna was predicted by trnascan - se-1.23 and rrna genes by rnammer 1.2 . The genome contains 3 rrna genes (5s23s16s) and 58 aminoacyl - trna synthetase genes . The draft genome of a. azurea consists 154 contigs of 9,223,451 bp with an average g + c content of 69.0% . A total of 8603 coding regions (4406 from a positive strand and 4197 from a negative strand) were found in the genome of which 5396 (63%) could be functionally annotated . The genome coding density is 89% with an average gene length of 948 bp . The annotated genome has 117 genes involved in virulence, disease and defense including 61 genes for resistance to antibiotics and toxic compounds such as tetracycline, vancomycin, arsenic and beta - lactamase (fig . The genome comprises of 55 genes for sulfur metabolism and 47 genes for phosphorus metabolism . The homology searches revealed that the pks gene clusters are supposed to be responsible for the biosynthesis of naptomycin, macbecin, rifamycin, mitomycin, maduropeptin enediyne, neocarzinostatin enediyne, c-1027 enediyne, calicheamicin enediyne, landomycin, simocyclinone, medermycin, granaticin, polyketomycin, teicoplanin, balhimycin, vancomycin, staurosporine, rubradirin and complestatin . The functional comparison of genome sequences available on the rast server revealed the closest neighbors of a. azurea as actinosynnema mirum dsm 43827 (score 536) followed by streptomyces sp . Aa4 (score 432), saccharomonospora viridis dsm 43017 (score 376) and rhodococcus jostii rha1 (score 357). A. azurea was proposed by omura et al . In 1983 and later on emended by henssen et al . In 1987 and was isolated from soil that produced two water soluble antibiotics, namely, azureomycin a and b. a. azurea strain dsm 43854 was obtained from the open collection of the german collection of microorganisms and cell cultures (dsmz), braunschweig, germany . The strain a. azurea dsm 43854 is a gram - positive bacteria and contains aerial mycelium with white to blue color . Genomic dna was extracted from a 48 hour old culture using zr fungal / bacterial dna miniprep as per manufacturer's instructions . Sequencing resulted in 22,170,928 paired - end reads (insert size of 350 bp) of 101 bp length . A total of 21,919,041 high - quality reads with approximately 480 coverage were assembled using clcbio wb5.5 (http://www.clcbio.com) (word size 55 and bubble size 60) to obtain 154 contigs (n50, 127,182 bp). The functional annotation was carried out by rast (rapid annotation using subsystem technology), trna was predicted by trnascan - se-1.23 and rrna genes by rnammer 1.2 . The genome contains 3 rrna genes (5s23s16s) and 58 aminoacyl - trna synthetase genes . The draft genome of a. azurea consists 154 contigs of 9,223,451 bp with an average g + c content of 69.0% . A total of 8603 coding regions (4406 from a positive strand and 4197 from a negative strand) were found in the genome of which 5396 (63%) could be functionally annotated . The genome coding density is 89% with an average gene length of 948 bp . The annotated genome has 117 genes involved in virulence, disease and defense including 61 genes for resistance to antibiotics and toxic compounds such as tetracycline, vancomycin, arsenic and beta - lactamase (fig . The genome comprises of 55 genes for sulfur metabolism and 47 genes for phosphorus metabolism . The homology searches revealed that the pks gene clusters are supposed to be responsible for the biosynthesis of naptomycin, macbecin, rifamycin, mitomycin, maduropeptin enediyne, neocarzinostatin enediyne, c-1027 enediyne, calicheamicin enediyne, landomycin, simocyclinone, medermycin, granaticin, polyketomycin, teicoplanin, balhimycin, vancomycin, staurosporine, rubradirin and complestatin . The functional comparison of genome sequences available on the rast server revealed the closest neighbors of a. azurea as actinosynnema mirum dsm 43827 (score 536) followed by streptomyces sp . Aa4 (score 432), saccharomonospora viridis dsm 43017 (score 376) and rhodococcus jostii rha1 (score 357). The a. azurea dsm 43854 whole genome shot gun (wgs) project has been deposited at ddbj / embl / genbank under the project accession number anmg00000000 of the project (01) and has the accession numbers anmg01000000 and consists of sequences anmg01000001anmg01000154 . The authors declare that there is no conflict of interest on any work published in this paper.
The original 64-item dsqols was designed in germany specifically for people with type 1 diabetes (12). It includes 44 burden items measuring the impact of diabetes on social relations, diet restrictions, physical complaints, daily hassles, and worries about the future . Respondents are asked to rate the extent to which each of the statements meets their point of view on a 6-point likert scale: from perfectly to not at all . A further 10 items measure treatment satisfaction (on a 6-point scale from very satisfied to very dissatisfied), and 10 more assess the personal importance of treatment goals on a 6-point likert scale from very important to totally unimportant . The design of the dsqols was based on interviews with adults with type 1 diabetes, but its precise development and item generation were not described in detail (12). Psychometric validation of the original dsqols was undertaken using data from a sample of 657 people with type 1 diabetes attending general practice in the north rhine region of germany (12). A systematic review of patient - completed health outcome measures for diabetes concluded that there was good evidence for the reliability and internal and external construct validity of the german - language version of dsqols (18). The original german - language version was later revised after further unpublished validation work (u. bott, unpublished observations). Eleven items were retained without modification, but 27 items were amended slightly to aid interpretation (e.g., diabetes restrains my future plans amended to diabetes interferes with my future plans). Six items were omitted because of low item - scale correlations in their original analyses or weak factor loadings (<0.3). Thus, this revised version of the dsqols includes a total of 77 items, comprising 10 individual treatment goal items, 10 treatment - satisfaction items, and 57 diabetes - specific burden items . The validation work presented here is based upon this revised version of the german dsqols . Although the original dsqols was validated in german and not english, it was first described in an english - language journal (12) in which an english version was presented, though this was not a robust translation and was not linguistically validated . The dsqols has not, to our knowledge, been translated into any other languages . The revised german dsqols and its unauthorized english translation were obtained from the authors . An independent translator, bilingual in german and english, who had not seen the questionnaire, carried out a second forward translation from german into u.k . English . Following international guidelines for translation and cultural adaptation of questionnaires (19), the translator aimed for conceptual and cultural equivalence of words / phrases . This second forward translation was compared directly with the first and discussed with a psychologist (d.c . ). Discrepancies with the revised german dsqols were discussed, resolved, and agreed upon between r.l.m . The few discrepancies identified concerned the meaning of particular phrases and conceptual equivalence . To ensure content validity, clinicians and a psychologist reviewed the final english version of the questionnaire to assess its relevance, appropriateness, clarity, and comprehensiveness . Cognitive debriefing (a think - aloud technique) they commented on the questionnaire; its layout, comprehensiveness, redundancy, and ease of understanding and completion; length of time taken to complete it; and any additional comments . Feedback, at this stage of piloting, indicated that the questionnaire was comprehensible and acceptable with one exception . Response options for the 57 burden items were amended slightly so that people were asked to rate their agreement with the statements on a 6-point likert scale labeled very strongly agree to do not agree at all rather than this version was discussed with a further four participants from the same center who indicated that questions and response options made sense and language was clear . The database study collects comprehensive biomedical and psychosocial data from participants at ten centers in the u.k . The irish study is a cluster - randomized trial evaluating two different methods of follow - up of dafne graduates (21). The psychosocial study is a longitudinal evaluation of structured education conducted to identify predictors of qol and glycemic outcomes . Ethics approvals were obtained from the trent research ethics committee (rec), national university of ireland galway rec, and king s college rec, respectively . Inclusion criteria were similar for each study: adults (aged 17 years) with type 1 diabetes of at least 6-months duration who had agreed to participate in the dafne program . Eligible participants were recruited from 10 hospitals in england for the database study, 6 hospitals in ireland for the irish study, and 12 hospitals in england and scotland for the psychosocial study . The dsqols was completed by all participants in each study prior to receiving dafne training along with other psychosocial measures . The addqol (10,22) was completed by a subsample of participants (n = 42) in the irish study at baseline to assess concurrent validity . The addqol provides a composite rating of the average weighted impact (awi) of diabetes, derived from ratings of 18 potentially applicable domains of life (e.g., working life, family life), indicating the individualized impact of diabetes on the domain (i.e., impact 3 to 1, weighted by importance 03). The awi score is derived by dividing the sum of the weighted ratings by the number of applicable domains . Scores for single domains and the awi range from 9 (maximum negative impact of diabetes) to 9 (maximum positive impact of diabetes). Two overview items, scored individually, measure present quality of life [scores ranging from 3 (extremely bad) to 3 (excellent)] and diabetes - dependent qol [scores ranging from 3 (maximum negative impact of diabetes) to 3 (maximum positive impact of diabetes)]. The who-5 (version 5 of the world health organization well - being index) includes five statements (e.g., i have felt cheerful and in good spirits) assessing positively worded depressed mood . Respondents rate their agreement with each item, using a 6-point likert scale from 0, none of the time, to 5, all of the time, in relation to the past 2 weeks (23,24). Items are summed to form a total well - being score (ranging from 0 to 25), with higher scores representing greater well - being (or less depressed mood). A single - item, global measure of life satisfaction was used from the fourth edition of the personal well - being index for adults (25). This asks participants to rate their satisfaction with their life right now on a 10-point likert scale from 0, completely dissatisfied, to 10, completely satisfied . The latter two measures were completed only by participants in the psychosocial study and were used to assess discriminant validity . For all three studies, demographic and clinical data were collected, including the presence of long - term complications of diabetes (retinopathy, nephropathy, neuropathy, or macrovascular disease or sequelae thereof). In order to determine the structure of the 57 dsqols burden items, the database study sample (n = 1,021) was split randomly in two (using spss), with one - half of the sample used for exploratory factor analyses (efas) (n = 510) and one - half used for confirmatory factor analysis (cfa) (n = 511). Experts differ in their recommendations for the minimum sample size required for conducting factor analyses . Comfrey and lee (26) consider a sample size of 300 as good and 500 very good, while gorsuch (27) makes recommendations based on the ratio of participants to items, stating that a minimum of five participants is required per item . Thus, with 57 items, a minimum sample of 285 is required . In a review of studies that recommended minimum sample sizes for this type of analysis, 400 was the upper limit of the recommendations (28). Efa was carried out using maximum likelihood with geomin oblique rotation to obtain standardized estimates . Item - component loadings of> 0.30 were considered significant based on recommendations for minimum loading of an item (29). Cfa was used to confirm the factor structure of the 57 dsqols burden items using the total sample from the database study ., comparative fit index (cfi), a root mean square error of approximation (rmsea), and standardized root mean square residual (srmr) were used to evaluate the fit between the model and the data . A rmsea value <0.08 indicates an acceptable fit to the data, while values <0.05 indicate a good fit to the data (30). Well - fitting models obtain srmr values <0.05, but values as high as 0.08 are deemed acceptable (31). Internal consistency reliability was evaluated using cronbach statistics and item - total correlations . As recommended by bott et al . (12), for facilitation of comparability of the different dsqols scores, crude scores were converted to a 100% scale (score minimum score) 100/(maximum score minimum score). Higher scores on each subscale indicate a better qol (i.e., less negative impact of diabetes) or greater satisfaction with treatment . For calculation of the preference - weighted treatment satisfaction score (pwtss), ratings on each treatment goal are multiplied by the corresponding degree of satisfaction with the achievement of those goals . The sum of those 10 products gives the pwtss, which is converted to a 100% scale . Concurrent validity was assessed by correlating (pearson r) dsqols subscale scores, including the pwtss, with each other and (using a subsample of 42 from the irish study) with scores on another, validated measure of diabetes - specific qol, the addqol (10). Moderate to strong relationships were expected between the dsqols subscales, addqol awi score, and diabetes - dependent qol overview item . Discriminant validity was assessed by correlating (pearson r) the dsqols subscales, including the pwtss, and total score with measures of depressed mood (who-5), generic qol (addqol present qol overview item), and life satisfaction, with weak to moderate correlations expected (32). With data from the database study, known - groups validity was assessed by comparing the scores on the dsqols subscales, including the pwtss, between those with diagnosed diabetes - related complications and those without . It was expected that those with complications would report significantly lower dsqols subscales scores, indicating that diabetes impaired their qol . The original 64-item dsqols was designed in germany specifically for people with type 1 diabetes (12). It includes 44 burden items measuring the impact of diabetes on social relations, diet restrictions, physical complaints, daily hassles, and worries about the future . Respondents are asked to rate the extent to which each of the statements meets their point of view on a 6-point likert scale: from perfectly to not at all . A further 10 items measure treatment satisfaction (on a 6-point scale from very satisfied to very dissatisfied), and 10 more assess the personal importance of treatment goals on a 6-point likert scale from very important to totally unimportant . The design of the dsqols was based on interviews with adults with type 1 diabetes, but its precise development and item generation were not described in detail (12). Psychometric validation of the original dsqols was undertaken using data from a sample of 657 people with type 1 diabetes attending general practice in the north rhine region of germany (12). A systematic review of patient - completed health outcome measures for diabetes concluded that there was good evidence for the reliability and internal and external construct validity of the german - language version of dsqols (18). The original german - language version was later revised after further unpublished validation work (u. bott, unpublished observations). Eleven items were retained without modification, but 27 items were amended slightly to aid interpretation (e.g., diabetes restrains my future plans amended to diabetes interferes with my future plans). Six items were omitted because of low item - scale correlations in their original analyses or weak factor loadings (<0.3). Thus, this revised version of the dsqols includes a total of 77 items, comprising 10 individual treatment goal items, 10 treatment - satisfaction items, and 57 diabetes - specific burden items . The validation work presented here is based upon this revised version of the german dsqols . Although the original dsqols was validated in german and not english, it was first described in an english - language journal (12) in which an english version was presented, though this was not a robust translation and was not linguistically validated . The dsqols has not, to our knowledge, been translated into any other languages . The revised german dsqols and its unauthorized english translation were obtained from the authors . An independent translator, bilingual in german and english, who had not seen the questionnaire, carried out a second forward translation from german into u.k . English . Following international guidelines for translation and cultural adaptation of questionnaires (19), the translator aimed for conceptual and cultural equivalence of words / phrases . This second forward translation was compared directly with the first and discussed with a psychologist (d.c . ). Discrepancies with the revised german dsqols were discussed, resolved, and agreed upon between r.l.m ., d.c ., and the first translator . The few discrepancies identified concerned the meaning of particular phrases and conceptual equivalence . To ensure content validity, clinicians and a psychologist reviewed the final english version of the questionnaire to assess its relevance, appropriateness, clarity, and comprehensiveness . Cognitive debriefing (a think - aloud technique) they commented on the questionnaire; its layout, comprehensiveness, redundancy, and ease of understanding and completion; length of time taken to complete it; and any additional comments . Feedback, at this stage of piloting, indicated that the questionnaire was comprehensible and acceptable with one exception . Response options for the 57 burden items were amended slightly so that people were asked to rate their agreement with the statements on a 6-point likert scale labeled very strongly agree to do not agree at all rather than this version was discussed with a further four participants from the same center who indicated that questions and response options made sense and language was clear . The database study collects comprehensive biomedical and psychosocial data from participants at ten centers in the u.k . The irish study is a cluster - randomized trial evaluating two different methods of follow - up of dafne graduates (21). The psychosocial study is a longitudinal evaluation of structured education conducted to identify predictors of qol and glycemic outcomes . Ethics approvals were obtained from the trent research ethics committee (rec), national university of ireland galway rec, and king s college rec, respectively . Inclusion criteria were similar for each study: adults (aged 17 years) with type 1 diabetes of at least 6-months duration who had agreed to participate in the dafne program . Eligible participants were recruited from 10 hospitals in england for the database study, 6 hospitals in ireland for the irish study, and 12 hospitals in england and scotland for the psychosocial study . The dsqols was completed by all participants in each study prior to receiving dafne training along with other psychosocial measures . The addqol (10,22) was completed by a subsample of participants (n = 42) in the irish study at baseline to assess concurrent validity . The addqol provides a composite rating of the average weighted impact (awi) of diabetes, derived from ratings of 18 potentially applicable domains of life (e.g., working life, family life), indicating the individualized impact of diabetes on the domain (i.e., impact 3 to 1, weighted by importance 03). The awi score is derived by dividing the sum of the weighted ratings by the number of applicable domains . Scores for single domains and the awi range from 9 (maximum negative impact of diabetes) to 9 (maximum positive impact of diabetes). Two overview items, scored individually, measure present quality of life [scores ranging from 3 (extremely bad) to 3 (excellent)] and diabetes - dependent qol [scores ranging from 3 (maximum negative impact of diabetes) to 3 (maximum positive impact of diabetes)]. The who-5 (version 5 of the world health organization well - being index) includes five statements (e.g., i have felt cheerful and in good spirits) assessing positively worded depressed mood . Respondents rate their agreement with each item, using a 6-point likert scale from 0, none of the time, to 5, all of the time, in relation to the past 2 weeks (23,24). Items are summed to form a total well - being score (ranging from 0 to 25), with higher scores representing greater well - being (or less depressed mood). A single - item, global measure of life satisfaction was used from the fourth edition of the personal well - being index for adults (25). This asks participants to rate their satisfaction with their life right now on a 10-point likert scale from 0, completely dissatisfied, to 10, completely satisfied . The latter two measures were completed only by participants in the psychosocial study and were used to assess discriminant validity . For all three studies, demographic and clinical data were collected, including the presence of long - term complications of diabetes (retinopathy, nephropathy, neuropathy, or macrovascular disease or sequelae thereof). In order to determine the structure of the 57 dsqols burden items, the database study sample (n = 1,021) was split randomly in two (using spss), with one - half of the sample used for exploratory factor analyses (efas) (n = 510) and one - half used for confirmatory factor analysis (cfa) (n = 511). Experts differ in their recommendations for the minimum sample size required for conducting factor analyses . Comfrey and lee (26) consider a sample size of 300 as good and 500 very good, while gorsuch (27) makes recommendations based on the ratio of participants to items, stating that a minimum of five participants is required per item . Thus, with 57 items, a minimum sample of 285 is required . In a review of studies that recommended minimum sample sizes for this type of analysis, 400 was the upper limit of the recommendations (28). Efa was carried out using maximum likelihood with geomin oblique rotation to obtain standardized estimates . Item - component loadings of> 0.30 were considered significant based on recommendations for minimum loading of an item (29). Cfa was used to confirm the factor structure of the 57 dsqols burden items using the total sample from the database study ., comparative fit index (cfi), a root mean square error of approximation (rmsea), and standardized root mean square residual (srmr) were used to evaluate the fit between the model and the data . A rmsea value <0.08 indicates an acceptable fit to the data, while values <0.05 indicate a good fit to the data (30). Well - fitting models obtain srmr values <0.05, but values as high as 0.08 are deemed acceptable (31). Internal consistency reliability was evaluated using cronbach statistics and item - total correlations . As recommended by bott et al . (12), for facilitation of comparability of the different dsqols scores, crude scores were converted to a 100% scale (score minimum score) 100/(maximum score minimum score). Higher scores on each subscale indicate a better qol (i.e., less negative impact of diabetes) or greater satisfaction with treatment . For calculation of the preference - weighted treatment satisfaction score (pwtss), ratings on each treatment goal the sum of those 10 products gives the pwtss, which is converted to a 100% scale . Concurrent validity was assessed by correlating (pearson r) dsqols subscale scores, including the pwtss, with each other and (using a subsample of 42 from the irish study) with scores on another, validated measure of diabetes - specific qol, the addqol (10). Moderate to strong relationships were expected between the dsqols subscales, addqol awi score, and diabetes - dependent qol overview item . Discriminant validity was assessed by correlating (pearson r) the dsqols subscales, including the pwtss, and total score with measures of depressed mood (who-5), generic qol (addqol present qol overview item), and life satisfaction, with weak to moderate correlations expected (32). With data from the database study, known - groups validity was assessed by comparing the scores on the dsqols subscales, including the pwtss, between those with diagnosed diabetes - related complications and those without . It was expected that those with complications would report significantly lower dsqols subscales scores, indicating that diabetes impaired their qol . The demographic and clinical characteristics of each study group were very similar (table 1). The mean age ranged from 38 to 40 years, with mean diabetes duration ranging from 16 to 18 years and mean baseline hba1c ranging from 8.3 to 8.8% . Of the 911 (89%) participants for whom data were available, 396 (44%) had one or more long - term complications of diabetes . Sample characteristics and dsqols scores for this analysis, data were available for 995 of 1,021 database study participants . Twenty - four had more than one - half of their data missing; hence, the initial efa was based on n = 491 and the cfa on n = 480 . Regression imputation was used to impute values . For determination of the number of factors to extract from the efa, goodness - of - fit indices, a scree plot of eigenvalues, and a six - factor solution was indicated and appeared to fit the data well with six interpretable factors [= 2,999.2, df = 1,269, cfi = 0.898, rmsea = 0.053, and srmr = 0.031 (table 2)]. This reflected the same factor structure as the revised, 57-item, unpublished german version of the dsqols and mirrored the factor analysis of the original german 44-item burden scale . Only four items had a loading of> 0.3 on a second factor (items 2, 12, 13, and 50), and none had a loading> 0.4 . Factor loadings for the 57 items relating to daily restrictions and burdens [presented in order of strength of factor loadings, with the highest factor loadings presented in boldface (database study efa sample)] a cfa was run on the second half of the database study data . Model fit was good (= 4,182.3, df = 1,524, p <0.001, cfi = 0.85, rmsea = 0.06, and srmr = 0.06) but was improved by allowing nine residuals to covary and by allowing item 41 to cross - load on the social aspects subscale (= 3,665.6, df = 1,514, p <0.001, rmsea = 0.05, cfi = 0.88, and srmr = 0.05). Residuals were covaried for items with very similar content and where we can assume that they share specific variance in addition to the common factor variance . Although improving overall model fit, their inclusion had very little effect on the factor loadings . This model was then run on the full database study dataset, where model fit was slightly better (= 5,453.2, df = 1,514, p <0.001, rmsea = 0.05, cfi = 0.88, and srmr = 0.05), although eliminating the cross - loading did not make the fit appreciably worse (= 5,531.5, df = 1,515, p <0.001, rmsea = 0.05, cfi = 0.88, and srmr = 0.05). The identification of distinct (though highly correlated) dsqols subscales does not preclude the existence of a single underlying diabetes - specific qol scale . A second - order factor analysis, where each of the six factors loaded on a single second - order factor, was conducted . Fit of this model was not appreciably worse than when the factors were allowed freely to intercorrelate (= 5,676.1, df = 1,524, p <0.001, rmsea = 0.05, cfi = 0.88, and srmr = 0.05). Factor loadings of each subscale on the second - order factor were high (0.750.92). A one - factor model did not fit well (= 13,009.1, df = 1,539, p <0.001, rmsea = 0.09, cfi = 0.66, and srmr = 0.07). The seven dsqols subscales each had excellent internal consistency: social aspects (n items = 18, = 0.93), fear of hypoglycemia (n items = 11, = 0.94), dietary restrictions (n items = 8, = 0.89), physical complaints (n items = 10, = 0.89), anxiety about the future (n items = 5, = 0.87), daily hassles (n items = 5, = 0.85), and preference - weighted treatment satisfaction scale (n items = 20, = 0.74). Item total correlations for each subscale were all> 0.5 (r = 0.510.79). Descriptive statistics for the dsqols subscales showed a good distribution of scores and low floor (score of 0) and ceiling (score of 100) effects supporting the reliability of this scale (table 1). The six dsqols burden subscales were significantly intercorrelated (r = 0.520.72, p <0.001). The dsqols subscale scores and the dsqols total score were correlated (moderately to strongly) with the addqol awi score and to a lesser extent (weak to moderately) with the diabetes - dependent addqol overview item (table 3). Correlations between dsqols subscales, addqol, and who-5 well - being and life satisfaction scales (psychosocial study and subsample of irish study) as predicted, all the dsqols subscales had weak to moderate, positive correlations with depressed mood (who-5), generic qol (addqol overview item), and life satisfaction, indicating that they are measuring different constructs (table 3). Participants with diagnosed diabetes - related complications reported significantly lower (worse) scores on each of the dsqols subscales and total score with the exception of the dietary restrictions and daily hassles subscales, which showed no difference (table 4). The demographic and clinical characteristics of each study group were very similar (table 1). The mean age ranged from 38 to 40 years, with mean diabetes duration ranging from 16 to 18 years and mean baseline hba1c ranging from 8.3 to 8.8% . Of the 911 (89%) participants for whom data were available, 396 (44%) had one or more long - term complications of diabetes . Twenty - four had more than one - half of their data missing; hence, the initial efa was based on n = 491 and the cfa on n = 480 . Regression imputation was used to impute values . For determination of the number of factors to extract from the efa, goodness - of - fit indices, a scree plot of eigenvalues, and a six - factor solution was indicated and appeared to fit the data well with six interpretable factors [= 2,999.2, df = 1,269, cfi = 0.898, rmsea = 0.053, and srmr = 0.031 (table 2)]. This reflected the same factor structure as the revised, 57-item, unpublished german version of the dsqols and mirrored the factor analysis of the original german 44-item burden scale . Only four items had a loading of> 0.3 on a second factor (items 2, 12, 13, and 50), and none had a loading> 0.4 . Factor loadings for the 57 items relating to daily restrictions and burdens [presented in order of strength of factor loadings, with the highest factor loadings presented in boldface (database study efa sample)] a cfa was run on the second half of the database study data . Model fit was good (= 4,182.3, df = 1,524, p <0.001, cfi = 0.85, rmsea = 0.06, and srmr = 0.06) but was improved by allowing nine residuals to covary and by allowing item 41 to cross - load on the social aspects subscale (= 3,665.6, df = 1,514, p <0.001, rmsea = 0.05, cfi = 0.88, and srmr = 0.05). Residuals were covaried for items with very similar content and where we can assume that they share specific variance in addition to the common factor variance . Although improving overall model fit, their inclusion had very little effect on the factor loadings . This model was then run on the full database study dataset, where model fit was slightly better (= 5,453.2, df = 1,514, p <0.001, rmsea = 0.05, cfi = 0.88, and srmr = 0.05), although eliminating the cross - loading did not make the fit appreciably worse (= 5,531.5, df = 1,515, p <0.001, rmsea = 0.05, cfi = 0.88, and srmr = 0.05). The identification of distinct (though highly correlated) dsqols subscales does not preclude the existence of a single underlying diabetes - specific qol scale . A second - order factor analysis, where each of the six factors loaded on a single second - order factor, was conducted . Fit of this model was not appreciably worse than when the factors were allowed freely to intercorrelate (= 5,676.1, df = 1,524, p <0.001, rmsea = 0.05, cfi = 0.88, and srmr = 0.05). Factor loadings of each subscale on the second - order factor were high (0.750.92). A one - factor model did not fit well (= 13,009.1, df = 1,539, p <0.001, rmsea = 0.09, cfi = 0.66, and srmr = 0.07). The seven dsqols subscales each had excellent internal consistency: social aspects (n items = 18, = 0.93), fear of hypoglycemia (n items = 11, = 0.94), dietary restrictions (n items = 8, = 0.89), physical complaints (n items = 10, = 0.89), anxiety about the future (n items = 5, = 0.87), daily hassles (n items = 5, = 0.85), and preference - weighted treatment satisfaction scale (n items = 20, = 0.74). Item total correlations for each subscale were all> 0.5 (r = 0.510.79). Descriptive statistics for the dsqols subscales showed a good distribution of scores and low floor (score of 0) and ceiling (score of 100) effects supporting the reliability of this scale (table 1). The six dsqols burden subscales were significantly intercorrelated (r = 0.520.72, p <0.001). The dsqols subscale scores and the dsqols total score were correlated (moderately to strongly) with the addqol awi score and to a lesser extent (weak to moderately) with the diabetes - dependent addqol overview item (table 3). Correlations between dsqols subscales, addqol, and who-5 well - being and life satisfaction scales (psychosocial study and subsample of irish study) as predicted, all the dsqols subscales had weak to moderate, positive correlations with depressed mood (who-5), generic qol (addqol overview item), and life satisfaction, indicating that they are measuring different constructs (table 3). Participants with diagnosed diabetes - related complications reported significantly lower (worse) scores on each of the dsqols subscales and total score with the exception of the dietary restrictions and daily hassles subscales, which showed no difference (table 4). English translation of the german dsqols and to examine its psychometric properties in adults with type 1 diabetes in the u.k . And following forward - backward translation and reconciliation and piloting (with adults with type 1 diabetes and review by clinicians in ireland), face and content validity of the u.k . Examination of the scale structure using efa revealed a six - factor solution, confirmed with two independent cfas, demonstrating good fit of this model to available datasets . The structure reported here reflects the six - factor structure of the 44-burden items from the original german version . When a single factor was fitted to the six dsqols burden subscales, this model provided a very good fit to the data, supporting the use of a dsqols total score . Moderate to strong correlations were demonstrated between dsqols scores as well as between the dsqols scores and the addqol awi score, suggesting that these are assessing similar underlying constructs providing evidence of concurrent validity . Given the mismatch between the structure of the two scales [i.e., the dsqols has six subscales (summarizing its 57 items) and the separate 20-item preference - weighted treatment satisfaction scale, and the addqol has one overall score based on the awi for all 19 domains], the moderate correlations are considered reasonable and the strong correlations highly satisfactory . The weaker correlations between the dsqols subscales and the addqol diabetes - dependent overview item were to be expected, as the latter is not considered sufficient to capture the full impact of diabetes on qol (10). Better scores on the dsqols subscales were associated with greater well - being (less depressed mood), generic qol, and life satisfaction, but the correlations were sufficiently weak to indicate that various scales measure different constructs . Participants with diagnosed complications of diabetes had significantly worse scores on four of six of the dsqols burden subscales, the pwtss, and dsqols total score . This provided support for the ability of this questionnaire tool to discriminate between different groups of respondents . Sensitivity of the dsqols to treatment effects and test - retest reliability has not been demonstrated in this study, although work using the german version has shown that it is sensitive to treatment effects in a comparison of insulin pump and multiple daily injection therapy (33). Work is underway to examine the sensitivity of this instrument for detecting changes in qol after structured education for adults with type 1 diabetes . There is a growing need for valid, reliable, and responsive questionnaires to assess outcomes in diabetes research and clinical practice . Management of type 1 diabetes has evolved from fixed daily insulin doses (as prescribed) to more flexible but complex insulin dose self - adjustment based upon carbohydrate consumption and self - monitoring of blood glucose levels . The evidence presented indicates that dsqols is an appropriate tool for evaluating structured education courses that promote flexible intensive insulin therapy . Like the addqol, the dsqols captures the impact of diabetes on various aspects of life known to be important for qol (e.g., family, friendships, and dietary freedom) (10). However, the dsqols also enables participants to indicate how they feel about specific aspects of type 1 diabetes management, which are increasingly common among those who have received structured diabetes education, such as carbohydrate counting and flexible insulin dose adjustment . The dqol questionnaire (11) previously offered this type of approach to diabetes - specific qol assessment but has become outdated . Unlike existing measures, the dsqols also offers the opportunity to assess individual treatment goals as well as preference - weighted treatment satisfaction in a single instrument . The need for a focus on patient - reported outcomes in addition to biomedical end points the length of the dsqols may be considered a limitation; we believe this is offset by the unique contributions of its subscales, each capturing important aspects of diabetes - specific qol and reducing the need for multiple questionnaires to achieve a holistic assessment . Although its length was not criticized by participants in our studies, a shorter version of the dsqols might be more acceptable to respondents and, hence, promote its wider use in clinical and research environments.
Coronary anomalies are reported in 1 to 5% of coronary angiographic examinations; they are usually asymptomatic, and are discovered accidentally.1 an anomalous origin of the left anterior descending artery (lad) from both right and left sinus of valsalva is considered one of the rarest anomalies.27 the following report describes a patient presenting with an acute coronary syndrome, whose coronary angiography revealed an unusual course of the lad from the right and left coronary arteries . As he stated, he had been suffering from pain without radiation for the past 30 minutes, accompanied by nausea, vomiting, and diaphoresis . He claimed that he had had a previous similar episode the day before his admission, but the pain had resolved spontaneously after about one hour . He had a history of cigarette smoking, hypertension, and respiratory disease, for which he had received no appropriate and regular medical care . No abnormal findings were detected on his physical examination (blood pressure = 140/80 mmhg, heart rate = 60 bpm, and normal breathing and heart sounds). His initial electrocardiogram (ecg) showed a left - axis deviation and left anterior hemiblock with ischemic changes (inverted t wave) on its pericardial leads . He had elevated cardiac troponin, and no other significant abnormalities were detected in his blood tests . He underwent medical management for acute coronary syndrome, and his pain was reduced within his first hour of admission . Echocardiography was performed for the patient and revealed a moderate left ventricular (lv) dysfunction with an lv ejection fraction of 40% and anterior and lateral wall hypokinesia . The patient was scheduled for coronary angiography on the following day . No chest pain or other symptoms the next morning, the ecg showed the evidence of a posterior (lateral) myocardial infarction (mi). The selective angiography of the left coronary artery showed a critical and thrombotic stenosis on the midportion of the lad as well as a moderate lesion on the midportion of the left circumflex (lcx) artery (figure 1). Mild stenoses were also detected at the proximal end of the lad and high obtuse marginatus . The lad ran through the interventricular groove but at the end of the midportion, it deviated from its usual course and transformed to a diagonal and supplied the anterolateral area of the lv . On the right side, the selective coronary artery injection revealed a dominant right coronary artery (rca) and also an anomalous coronary artery arising just after the origin the rca (figure 2). The accessory vessel ran into the left side and coursed into the mid and distal portions of the anterior interventricular groove and supplied the apex area . The culprit lesions on the lad were stented with a drug - eluting stent (des), and the patient was discharged from the hospital with an acceptable condition on the fourth day of his hospitalization . Different types of congenital coronary anomalies have been reported, most of them having been discovered incidentally through routine coronary angiography . A double lad is among the rarest anomalies and its incidence ranges from 0.01 to 0.03% in different studies.5 in their classification, spindola - franko described four types of double lad8: type i iii arises from the left side, and the last type (apparently the rarest) emerges from the right coronary sinus . Here, we present a patient whose coronary anatomy consisted of a double lad type iv . He was admitted to our department with acute coronary syndrome, and his ecg showed evidence of anterior and posterior (lateral) mi . On selective coronary angiography, the lad had a thrombotic lesion on its mid course and it turned toward the anterolateral region, which is usually supposed to be supplied by a diagonal . Probably the lesion at the midportion of the lad temporarily blocked the blood flow in the posterolateral area and caused the mi . On the right side, the rca was dominant, and an anomalous branch arose from the origin of the rca and coursed to the left side through the distal interventricular groove . The septal arteries branching from the anomalous vessel and also its left - sided course proved its identity as the lad . As was mentioned before, the last type of a double lad has a very low incidence . More often than not, the anomaly is suspected by visualization of an avascular area in the distribution of the left coronary artery and the absence of collaterals.3 in the present report, the lad changed its usual destination and ran into the posterolateral area; and the apex, which is usually supplied by the distal portion of the lad, was supplied by the anomalous branch: the second lad . The anatomical and physiological understandings of coronary artery anomalies have both clinical and therapeutical applications . The relationship between an anomalous coronary artery, aorta, and pulmonary trunk and the possibility of the compression of the aberrant vessel by the two great arteries could be a source of different clinical presentations (i.e., angina, syncope, mi, and sudden cardiac death) and sometimes mandate surgical correction . Apart from the interarterial course, recent studies have shown that an intramural course could be identified in some anomalous coronary artery emerging from the opposite valsalva sinus.9 the clinical impact of such entity remains unclear . Fortunately, the course of the anomalous branch usually could be detected by conventional angiography . The operator should always pay attention to the avascular region and search for a possible anomalous circulation . Reported, sometimes the aberrant vessel cannot be found by coronary artery angiography and multi - detector - row computed tomography may be helpful.10 beside the clinical consequences of anomalous vessels, knowing the anatomical variation is crucial at the time of surgery . Grave surgical complications may occur by cutting an aberrant vessel.3 in conclusion, we presented a rare anatomical variation of the lad, known as a double lad type iv . The lad arose aberrantly from the right sinus of valsalva and supplied the area abandoned by the main lad . Operators should always be aware of an anomalous circulation and seek to define its anatomical and clinical roles.
We report a case of a patient who presented with a complex open 3c gustilo anderson fracture who subsequently developed flap failure, failed internal fixation complicated with osteomyelitis of the talus . They vary in severity from minor metatarsal / phalangeal fractures to complicated midfoot and hindfoot injuries . Open fractures are poorly reported since they are rare and usually treated in specialist trauma centres . Reported amputation rates in open midfoot fractures are 30% highlighting their severity, coexisting soft tissue compromise, infection and difficulty covering midfoot injuries with flaps . With the midfoot playing a key role in foot function, soft tissue defects of the foot pose further challenges given the specially adapted architecture to facilitate tendon gliding . A 55-year - old woman presented with an open 3c gustilo anderson fracture . Her medical history included rheumatoid arthritis, osteoarthritis, ischaemic heart disease, diabetes mellitus and asthma . Soft tissues were closed using a free flap from the left thigh and a flap from the right lower limb . Bony injury was treated with open reduction internal fixation with screw fixation of the first and third metatarsals into the talus with restoration of the medial and middle columns achieved using cannulated screws . Additional stability was achieved by plate fixation of the medial and lateral columns (fig . (c and d) radiographs illustrating open reduction internal fixation (orif) (screw fixation of the first and third metatarsals into the talus). The orif using cannulated screws allowed restoration of the medial and middle columns of the foot . (c and d) radiographs illustrating open reduction internal fixation (orif) (screw fixation of the first and third metatarsals into the talus). The orif using cannulated screws allowed restoration of the medial and middle columns of the foot . Four months since the initial presentation, she was readmitted due to foot dorsal flap edge failure for which vacuum - assisted closure was unsuccessful (fig . Figure 2:flap failure on dorsal aspect of foot when patient presented after failed vacuum - assisted closure treatment . Flap failure on dorsal aspect of foot when patient presented after failed vacuum - assisted closure treatment . Primary limb shortening with a talectomy was conducted to reduce the soft tissue deficit and remove infected and necrotic bone, tibiocalcaneal arthrodesis for joint stability using external fixation, and dead space was treated with calcium sulphate mixed with vancomycin and systemic intravenous and oral antibiotics for osteomyelitis postoperatively (figs 3 and 4). The wound was closed after the external fixator was applied . Wound swabs and bone samples revealed enterococcus faecalis and e. raffinosus and diphtheroids . The patient was treated with intravenous teicoplanin and meropenem with oral stepdown to linezolid and ciprofloxacin . (b d) radiographs showing external fixation in situ . Figure 4:external fixation used to facilitate tibiocalcaneal arthrodesis post talectomy . Eight months since the initial presentation, the patient was taken to the theatre where a large defect in the anterior dorsum of the foot, and the external fixator was adjusted in the foot to allow for exploration and debridement . The abductor hallucis was identified and the tendon divided distally and mobilized and rotated to fill in the soft tissue medial defect . Calcium sulphate with vancomycin and gentamycin was inserted into the bony defect, and external fixation frame was adjusted back to its original position . The wound was closed using the abductor hallucis and skin graft from the right lateral leg . Postoperatively the patient was put on intravenous teicoplanin and meropenem with oral stepdown to linezolid and ciprofloxacin . On discharge once the infection was controlled the patient s crp was 6.0, white cell count 7.9 and neutrophils 4.0 . After having the external fixation for 8 months in total, it was removed when fusion was deemed adequate on computed tomography imaging (fig . She was instructed to weight bear while in a plaster of paris cast for 14 days and then a moon boot for 14 days . Two months after this, the patient was mobilizing without issues and was doing well . At 12 months, the patient stated that she is able to mobilize with any mild residual pain controlled with analgesia . (a) anterior posterior view; (b) lateral view . Computed tomography scans illustrating tibiocalcaneal fusion 1 year postoperatively . Midfoot injuries with talar infections can often lead to below - knee amputation with the main goals of treatment being to successfully treat the infection and maintain a functional foot . In adults, most work focuses predominantly on internal fixation techniques or a combination of internal and external fixation . Most reports of arthrodesis following talectomy are for patients with charcot deformities rather than traumatic injuries with osteomyelitis . To successfully treat patients with infected midfoot injuries, calcium sulphate with antibiotics was used intraoperatively in the fusion site with some evidence supporting its use in deep foot infections . Following this, a long course of intravenous antibiotics was used according to the sensitivities of the microorganisms growing in the region . External fixation facilitates soft tissue healing, allows earlier weight bearing, closer monitoring of surgical incision sites and postoperative adjustments . Fabian and colleagues concluded that tibiocalcaneal fusion in seven charcot joint patients using external fixation alone was unlikely to lead to fusion but the fibrous healing was sufficient . Agarwala s group and dennison s group report full fusion in all of their patients undergoing arthrodesis using external fixation [8, 9]. Our results are in concordance with work of agarwala and dennison et al . In that external fixation there is a need for randomized controlled trials to investigate the most appropriate fixation technique for tibiocalcaneal arthrodesis . In conclusion, we report a good outcome treating an open 3c gustilo anderson fracture complicated by osteomyelitis, necrosis and inadequate soft tissue coverage . Our management involved a single - staged talectomy to remove the infected bone and tackle the inadequate soft tissue coverage, external fixation for tibiocalcaneal arthrodesis to achieve joint stability and a combination of bone graft antibiotics and a course of intravenous and oral antibiotics postoperatively to deal with the underlying osteomyelitis.
Both non - pharmacological and pharmacological treatments of breast cancer have negative side effects ranging from the kinesiological to psychological domain, depending on the interaction of treatment characteristics with the physio - pathological and psychological conditions of each subject1, 2 . Upper limb lymphedema is a potential negative consequence of breast cancer surgery and radiation therapy that can appear during the months or even years after treatment ends . A growing body of scientific literature emphasizes the psycho - physical importance of early physical exercise engagement of breast cancer survivors in order to facilitate an early recovery, and to prevent breast cancer recurrence and the onset of all sedentarism - related diseases3 . Currently, various forms of exercise are prescribed following breast cancer treatment . Although walking training, as the most accessible and low cost activity, is the most practised activity, proper exercises for breast cancer survivors should principally aim to correct faulty posture, balance muscle chain lengths, elasticity and strength, improve general physical fitness, prevent lymphedema, reduce mental distress, and activate the immune system4,5,6 . In order to achieve all or most of the described aims, it is very important to plan the correct training and if possible to choose a complete discipline . To furnish a wide - ranging healthy intervention, the recently introduced physical fitness discipline of nordic walking appears to be useful for breast cancer survivors . Nordic walking is a form of brisk walking, utilizing a walking pole, which actively engages the trunk and upper limbs during walking, increasing their range of motion and increasing total body muscle endurance7,8,9,10, and it has positive effects on cardio - metabolic, postural and balance measures in both healthy and pathological conditions11,12,13 . In addition, due to its principal characteristics, it is conceivable to consider nordic walking as an effective discipline against lymphedema14, 15 . Indeed, during nordic walking practice there is an alternating open and close cycle of the hands, creating a pumping effect, theoretically favouring both lymphatic and blood circulation through upper limb muscle contraction, as reported for the pole walking technique7, 9, 16 . As nordic walking and pole walking are not the same discipline, they use different equipment and have a few but substantially different principal characteristics (table 1table 1.nordic walking vs. pole walking characteristicsnordic walkingpole walkingequipment: equipment: light - weight poles come in fixed - length, 2 or 3 sections; poles are adjustable in length and divided into 3 sections; releasable hand strap system that attaches to the handle and is fixed to the pole whilst in use; baskets are interchangeable and useful for preventing poles from sinking into the ground; specially - designed, removable rubber tips and fixed steel tips are angled to assist with push - off; adjustable, locking straps with a different variety of handle types, enable user to maintain contact with grips without causing hand strain; poles are alternately used beside and behind the body in a pushing action; concave, carbide flex tips are designed for optimal performance on a variety of non - paved surfaces; the body s natural gait pattern called the reciprocal gait is accentuated when using nordic walking poles; rubber tips with a flat surface, enable the user to walk indoors or on pavements; to some extent, without losing the natural walking pattern, the stride lengthens, and spinal rotation is the key to achieving walking with attitude . This recruits more muscles but actually often lowers perceived exertion because more muscles are being used. Pole walkers use the poles to transfer body weight onto the pole which helps to share the load and provide stability with the principal aim to take some weight off the lower body joints and to cope with tough conditions underfoot; in general, pole walkers are not seeking to gain such forward propulsion or increase stride in the way nordic walkers do and they plant the poles in front of them at a much more upright angle.created and adapted from the contents of jayah faye paleys blog . Http://adventurebuddies.net/blog/2010/09/nordic-walking-poles-vs-trekking-poles-whats-the-difference/), it is very important to verify the effectiveness of the nordic walking technique on the upper limb circumferences of breast cancer survivors . Taking into account that to maintain natural gait, while the hands are performing the nordic walking characteristic open - close cycle in an alternating manner (fig . 1.hands coordination scheme during nordic walking practice), could be too complex a task for novice nordic walkers with little previous experience of physical exercise, with a consequent delayed beneficial effect on upper limb circumferences, we designed a series of exercises, properly tailored for breast cancer survivors (i.e. The isa method), to enhance the pump effect of the upper limbs and contrasting arthralgia . The aim of this study was to verify the effects of 10 weeks of nordic walking, nordic walking + isa method, walking alone, and walking + isa method on upper limb circumferences and total body water of breast cancer survivors twenty breast cancer survivors (bcs) (mean age, 50.60 3.60 years) were recruited by the department of general surgery specialized in senology of the g. bernabeo hospital (ortona, italy). The inclusion criteria were: age>4055 years; no past or current chemotherapy; no current radiotherapy; current hormonal therapy; cardiovascular and orthopaedic eligibility for nordic walking practice; no endocrine diseases; lymphedema lower than class 2 of the ceap - l classification17; no dieting or use of nutritional supplements; no participation in any exercise programme during the six months prior to the study; and un - employed status . The ethics committee of the g. dannunzio university of chieti - pescara approved this study, and all of the participants gave their written informed consent . After recruitment, the breast cancer survivors were visited by both cardiology and sports medicine specialists to verify their cardiovascular and orthopaedic eligibility for walking and nordic walking practice through medical examination, echocardiography and the maximal stress test . After meeting the medical eligibility criteria, the participants were randomly assigned to one of four different workout groups, which performed nordic walking (nwg), nordic walking + isa method (nw - isag), walking (wg) or walking + isa method (w - isag) workout . Before starting 10 weeks of supervised training, both nwg and nw - isag were introduced to nordic walking, through 10 lessons on the nordic walking technique . After the 10 lessons, two nordic walking instructors of the international nordic walking association (i.e. Inwa) independently verified the proficiency of each participant . After nwg and nw - isag had completed the 10 lessons of nordic walking technique (t0), all the participants underwent anthropometry and body composition analysis, which were repeated at the end of the study (t1). A resting 12-lead electrocardiogram (stress ecg hd+, cardioline, trento, italy) was recorded after 10 min supine rest . Because the majority of participants had never used a treadmill before, the eligibility for aerobic training was assessed through a graded maximal exercise test on a cycle ergometer (cardioline xr50, cardioline, trento, italy), supervised by a sports medicine specialist medical doctor . Participants performed a graded maximal exercise test, the astrand protocol using 3-minute steps18, under continuous electrocardiogram monitoring (stress ecg hd+, cardioline, trento, italy), and blood pressure was measured at the end of each step . The test lasted until the doctor saw absolute or relative indications for clinical graded exercise test termination, according to the italian federation of sports medicine guidelines19 . A second level anthropometrist of the international society for the advancement of kinanthropometry, following the society s guidelines20, measured weight, stretched stature and the following circumferences of the upper limbs: relaxed arm (the circumference at acromiale - radialemedio point), maximal forearm (the maximal circumference of forearm), mid forearm (the circumference at mid - point between radiale and stylion points) and wrist (the wrist circumference at distal region of the stylion point). A stadiometer with a balance - beam scale (seca 220, seca, hamburg, germany) was used to measure weight and stretched stature; an anthropometric tape (cescorf, porto alegre, brazil) was used to measure circumferences and a segmometer (cescorf, porto alegre, brazil) was used to locate the acromiale - radiale medio point and mid forearm . Anthropometric measures were reported to the nearest 0.1 kg and 0.1 cm . Body extracellular water of the participants was assessed using a hand - to - foot electrical bioimpedance technique, and a 50-khz frequency bioelectric impedance analyzer (bia 101, akern, pontassieve, italy). The test was performed 3 h after waking, and immediately after voiding, with the participants undressed in the supine position, the upper limbs separated from the trunk, and the lower limbs separated from each other . All the training groups followed the same training schedule with different contents according to group membership . The 70 min of training, including 15 min of warm - up, 45 min of central phase and 10 min of cool down, was performed three time a week for 10 weeks . From the first to the fourth week, the participants trained at 1011 on the borg rating of perceived exertion (rpe) scale21, from the fifth to the eighth week at 1213 rpe, and from the ninth to the tenth week at 1314 rpe . The participants were familiarized with this scale before beginning the training, and also during the first week of training . The borg scale is particularly useful for prescribing and monitoring exercise intensity in this population, as with the same external load it is possible to have a different internal load due to the side effects of pharmacological treatments (e.g. Fatigue). Exercise trainers checked the exercise intensities of the participants through the talk test22, and checked their compliance with the training sessions . Nwg and nw - isag were conducted and supervised by exercise specialists who were also instructors of the italian nordic walking association, and members of the same international association (i.e. Inwa). Considering the differences between the groups: i) nwg executed the traditional anwi - inwa suggested exercises for warm - up and cool - down, including whole body mobilization exercises during warm - up, and stretching exercises during cool - down23, and nordic walking in the central phase of the training session; ii) wg executed whole body mobilization exercises during warm - up and stretching exercises during cool - down23, 24, and walking in the central phase of the training session; iii) nw - isag executed the isa method during warm - up and both the isa method and stretching exercises during cool - down, and nordic walking in the central phase of the training session; and iv) w - isag executed the isa method during warm - up and both the isa method and stretching exercises during cool - down, and walking in the central phase of the training . During the training period, participants did not practice other forms of exercise and did not have lymphatic drainage . The isa method includes a series of dynamic exercises, propaedeutic for nordic walking, lymphedema and arthralgia, properly tailored for breast cancer survivors . It requires the use of isa balls, foam balls of 6 or 7 cm diameter with different densities, that can be used both alone or with nordic walking poles (fig . This series of exercises has the following objectives: to gently warm - up joints, and to reduce muscular tensions and counteract or prevent upper limb lymphedema . The scheme of execution is the following: the protocol starts with warm - up exercises for the hand and wrist joints, that are executed using only isa balls, followed by multi - joint exercises, actively involving wrists, elbows and shoulders using both nordic walking poles and isa balls applied to them, and by neck exercises, that are executed using only nordic walking poles . The main task performed by participants in the workout with isa balls, was to gently squeeze them, during the forward and the returning phases of each exercise, in order to promote the pumping effect in the upper limbs . After the neck and upper limb exercises, trunk and lower limb exercises were executed using only nordic walking poles . Lower limb exercises were executed following a distal to proximal order, from feet to hip joints . Isa balls applied to nordic walking poles statistical analysis was performed using the sas 9.2 software (sas institute inc ., cary, usa). Although non - parametric tests were performed because of the small sample size, some data are presented as means standard deviation in order to better comprehend the results . Considering the whole sample, the kruskall - wallis test was used to verify whether the groups differed in basal characteristics . Considering each group separately, the mann - whitney test was used to verify whether circumferences of the upper limb, homolateral with surgical intervention for breast cancer, significantly differed from those of the opposite side . The wilcoxon test was used to verify, separately in each group, the significance of changes in the outcome measures at the end of the training period . Table 2table 2.anthropometric and hydration differences of the groupsnwgnw - isagwgw - isagage (years)52.6 2.148.4 1.549.2 5.752.2 2.5weight (kg)78.3 12.560.5 7.465.1 10.764.2 5.1tbw (lt)35.8 4.132.8 432.3 3.133.5 1ecw (lt)19.1 3.217.1 1.316.9 1.617.8 2.2ecw / tbw (%) 53 5.852.7 4.252.2 1.553.2 5.4relaxed arm circ . (cm) 34.6 3.3 * 29.2 2 * 30.6 2.4 * 30.6 1.7max forearm circ . (cm) 33.7 3.1 28.5 1.8 * 29.9 2.4 * 29.6 1.5max forearm circ . 0.516.1 0.7nwg: nordic walking group; nw - isag: nordic walking + isa method group; wg: walking group; w - isag: walking + isa method group; tbw: total body water; ecw: extracellular water; circ . : circumference; max: maximum; homolateral to the surgical intervention for breast cancer; contralateral to the surgical intervention for breast cancer; p<0.05 shows the homogeneity of the groups, which had the same starting values, except for the relaxed arm circumferences, which were higher in the nwg . As nwg had higher relaxed arm circumference than the other groups, and not only on the side homolateral to the surgical treatment, the observed difference was not due to a different grade of lymphedema but to a difference in the group s characteristic . Table 3table 3.analysis of upper limb differences of the groupshomolateral upper limbcontralateral upper limbnwgrelaxed arm circ . (cm)16.1 0.616.1 0.7homolateral upper limb, circumferences taken on the upper limb homolateral to the surgical intervention for breast cancer; contralateral upper limb, circumferences taken on the upper limb contralateral to the surgical intervention for breast cancer; max: maximum; nwg: nordic walking group; nw - isag: nordic walking + isa method group; wg: walking group; w - isag: walking + isa method group; circ ., circumference; * p<0.05 shows that all the upper limbs homolateral to the surgical intervention for breast cancer had circumferences greater than those of the contralateral upper limb except the wrist circumferences, which showed no significant difference . The wilcoxon test showed that while wg showed no significant changes in any of the outcome measures, and increased both total body water and mid - forearm circumference, the other groups exhibited significant reductions (table 4table 4.analysis of variables modifications of the groupsnwgt0nwgt1nw - isagt0nw - isagt1wgt0wgt1w - isagt0w - isagt1weight (kg)78.3 12.578.8 11.960.5 7.460.2 6.665.1 10.765.2 11.264.2 5.164.4 5.1tbw (lt)35.8 435.4 3.932.8 4.132.7 3.732.3 3.133.1 3.4 * 33.5 134.3 1.1ecw (lt)19.1 3.218.5 2.717.1 1.316.8 1 * 16.9 1.617.2 2.317.8 2.217.4 1.8ecw / tbw (%) 53 5.852.1 4.152.7 4.251.7 4.2 * 52.2 (cm)34.6 3.334 3.1 * 29.2 229.1 2 * 30.6 2.430.6 1.930.6 1.729.7 1.5max forearm circ . (cm)24.3 2.323.8 2.3 * 22.9 2.222.2 2.3 * 23.1 1.922.8 1.923.5 0.622.5 0.8mid forearm circ . (cm) 33.7 3.133.8 2.928.5 1.828.2 1.729.9 2.430.1 1.929.6 1.529.5 1.5max forearm circ . (cm)24 2.224 2.522.4 2.122.3 2.322.7 1.723.6 1.522.4 1.121.9 0.8mid forearm circ . (cm)23.2 223.2 2.221 2.321 2.321.7 1.121.8 1.220.7 0.720.3 0.7wrist circ . 1.215.5 0.915.9 0.515.8 0.516.1 0.716.3 0.6nwg: nordic walking group; nw - isag: nordic walking + isa method group; wg: walking group; w - isag: walking + isa method group; tbw: total body water; ecw: extracellular water; circ . : circumference; max: maximum; homolateral to the surgical intervention for breast cancer; contralateral to the surgical intervention for breast cancer; p<0.05). Both nwg and nw - isag showed significantly reduced relaxed arm and maximum and mid - forearm circumferences homolateral to the surgical intervention . Nw - isag also showed significant reductions in extracellular water, the extracellular to total body water ratio and the wrist circumference homolateral to the surgical intervention (table 4). In contrast to wg, which showed no significant reductions in arm circumferences, w - isag showed a significant reductions in the extracellular to total body water ratio, relaxed arm circumference, and both maximum and mid - forearm circumferences homolateral to the surgical intervention (table 4). Nwg: nordic walking group; nw - isag: nordic walking + isa method group; wg: walking group; w - isag: walking + isa method group; tbw: total body water; ecw: extracellular water; circ . : circumference; max: maximum; homolateral to the surgical intervention for breast cancer; contralateral to the surgical intervention for breast cancer; * p<0.05 homolateral upper limb, circumferences taken on the upper limb homolateral to the surgical intervention for breast cancer; contralateral upper limb, circumferences taken on the upper limb contralateral to the surgical intervention for breast cancer; max: maximum; nwg: nordic walking group; nw - isag: nordic walking + isa method group; wg: walking group; w - isag: walking + isa method group; circ ., circumference; * p<0.05 nwg: nordic walking group; nw - isag: nordic walking + isa method group; wg: walking group; w - isag: walking + isa method group; tbw: total body water; ecw: extracellular water; circ . : circumference; max: maximum; homolateral to the surgical intervention for breast cancer; contralateral to the surgical intervention for breast cancer; * p<0.05 taking into account that our pilot study was conducted on a restricted sample and that our results need further confirmation, our study provides interesting preliminary results for optimizing recovery from breast cancer treatment . According to our results, walking training does not seem capable of reducing upper limb circumferences and extracellular body water, so it should not be used alone for the prevention / treatment of upper limb lymphedema . This result should be explained by the fact that there is a lack of active use of the upper limbs, whereas nordic walking actively uses the upper limbs as a propulsive means, one of its main features . Indeed, pellegrini et al.26 showed that the muscle activities of the triceps brachii, latissimus dorsii, biceps brachii and anterior deltoideus muscles, were respectively 16-fold, 40-fold and 3-fold lower in walking than in the nordic walking . Also, each muscle s activation is characterized by a cyclical pattern, with activation of different intensities, according to the phase of walking . The alternating active use of the upper limb muscles supports lymphatic and blood circulation, benefiting from the gravity effect helping to prevent or reduce upper limb swelling . An important result of the present preliminary study is that by coupling the isa method with walking training, it is possible to compensate for the lack of the upper limb pumping effect, a typical negative characteristic of walking training . Indeed, after 10 weeks of training, while wg showed no significant modifications, w - isag exhibited significant reductions in extracellular to total body water ratio, and arm and forearm circumferences . This result could be particularly useful for breast cancer survivors favoring walking training but not nordic walking, and also for those who have to train indoors, using a treadmill, for any reason . In the present study, when the proper nordic walking technique was performed maintaining the natural gait with the hands performing an open and close cycle in an alternating manner, nordic walking alone was able to reduce the upper limb circumferences and extracellular body water . Therefore, even in the absence of the isa method, when the proper nordic walking technique is practised for 10 weeks, reductionts can be achieved in the upper limb circumferences homolateral to the breast cancer surgery site . In conclusion, both a larger study and the use of a more accurate technique for quantifying lymphedema furthermore, the present results may only be applicable to people with lymphedema lower than class 2 of the ceap - l classification . However, the addition of the isa method, during both the warm - up and cool down phases, to 10 weeks of walking - based workout could be useful for the management of lymphedema, walking alone seems not to be of benefit . In order to choose a physical exercise having complete efficacy against breast cancer treatment effects on the side of treatment, particular attention should be paid to nordic walking . Nordic walking has been reported to achieve balanced postural changes in breast cancer - related treatment postural disorders10, increases in upper extremity strength8, improvements in cardio - metabolic and respiratory measures and has been used in the prevention and treatment of upper limb lymphedema . However, in order to elicit beneficial effects, it is necessary to perform the proper technique and achieve consistency in training.
In most people with type 2 diabetes, elevation of plasma glucose is the ultimate consequence of failing beta cell function occurring after extended period of waning insulin sensitivity in peripheral tissues . However, it has been suggested that circulating metabolites in people with diabetes are ultimately responsible for inducing insulin resistance . Thus, several of the circulating factors that are perturbed in people with diabetes such as key metabolites (glucose, branched chain amino acids, and lipids) have been shown to impact target tissue glucose uptake . Since the initial proposal that abnormal lipid metabolism leads to impaired insulin signaling, the search for underlying mechanistic explanations on cellular and tissue level have been intensified and a growing body of observational as well as mechanistic evidence has been generated demonstrating the important contribution of lipids to obesity induced insulin resistance . Deterioration of insulin sensitivity occurs after prolonged ingestions of energy - dense meals in excess of daily caloric requirements thereby introducing a lipotoxic environment in peripheral tissues . In addition acute lipid infusion and consequent increase of lipid excess in non - adipose tissue like muscle is associated with impaired insulin signaling and action . In in obese lipid overloaded individuals it is believed that two elements contribute to the emergence of type 2 diabetes: insulin resistance and lipo - toxicity . The liver and to some extent adipose tissue are viewed as the major contributors of these untoward metabolic perturbations because increased hepatic lipid production and export exceeds the metabolic and storage capacity of peripheral tissues leading to elevated plasma lipid levels . Beside the impaired insulin action mentioned above, sustained exposure to high lipid levels is toxic for pancreatic -cell and normalization of plasma lipids halts progressive deterioration of -cell failure . Although the knowledge about the deleterious effects and the underlying mechanisms of neutral lipids on whole - body insulin stimulated glucose uptake, -cell function and insulin sensitivity is growing, there is still reason to believe that other lipotoxic factors are involved . Over the past decade several investigators have been drawn to study the role of polar sphingolipids as pivotal mediators of lipotoxicity leading to insulin resistance . Five common sphingolipids are easily detected in human plasma: ceramides, glucosylceramides, lactosylceramides, sphingomyelin, and ganglioside gm3 . In particular some sphingolipids, such as ceramides have been associated with metabolic dysregulation leading to diabetes . Admittedly, the current review is rather ceramide centric as most studies have been particularly focused on the negative impact of this class of polar lipids on glycemic control . Before considering tissue ceramide accumulation and underlying molecular mechanisms that possibly mediate negative impact of sphingolipids on insulin signaling, it is worth considering the sources of these polar lipids in the human body . Spingolipids have an important role as structural components of cellular membranes, ceramides serve also as important bioactive lipids in a variety of cellular processes like cell growth and differentiation, inflammation and apoptosis . Every cell in the body has the capacity to de novo synthesize sphingolipids within the endoplasmatic reticulum . Also mitochondria seem capable of contributing to sphingolipid metabolism as many of the enzymes involved in ceramide synthesis are also localized in this organelle . Four sequential reactions lead to the formation of bioactive ceramide: the first, and rate - limiting step is the conjugation of an amino acid (typically l - serine) with the fatty acid palmitoyl - coa catalyzed by the enzyme serine - palmitoyl transferase (spt). The resulting product, sphinganine, is rapidly acylated by (dihydro)ceramide synthase into dihydroceramide which upon subsequently dehydrogenation catalyzed by dihydroceramide desaturase 1 (des1) gives rise to the key intermediate ceramide . In addition to acylation of the sphinganine as a step in de novo ceramide synthesis, ceramide synthases also catalyze re - acylation of sphingosine as part of a salvage pathway (figure 1). Interestingly, six different but closely related ceramide synthases have been identified, which demonstrate tissue specific expression and variable substrate selectivity thereby providing the basis for tissue specific presence of ceramides with varying acyl chain lengths . For example, ceramide synthase cerc2 is widely expressed and preferentially incorporates c20c24 acyl residues in ceramide, whereas cers3 is predominantly expressed in skin and incorporates very long acyl chains up to c34:0 in the resulting ceramides . Ceramide synthase cerc5 seems specifically engaged with c16 ceramide formation, whilst ceramide synthase cerc6 shows a slightly wider substrate selectivity as it is involved in c14, c16, and c18 ceramide synthesis . It is important to emphasize that ceramides with different acyl chain length are generated in specific physiological and pathophysiological contexts in a tissue and cell dependent fashion which is like to constitute the basis for differentially influences of signaling pathways (figures 24). From the endoplasmatic reticulum, ceramides are transported via a specialized carrier system to the cytosolic leaflet of the trans - golgi apparatus membrane where several metabolic fates await the molecules . Thus, in the golgi, ceramide can become glycosylated into glycosylsphingolipids, phosphorylated into ceramide 1-phosphate, or become modified with a polar head turning it into sphingomyelin . Further additions of oligosaccharides and sulfate groups give rise to a broad range of very complex glycol and gangliosphingolipids . Ceramide is also a source of the bioactive signaling molecule sphingosine 1-phosphate (s1p) which upon secretion to the extracellular space acts as a ligand on a family of g - protein coupled receptors, s1p(15). Ceramide can also be formed through the salavage pathway which involves the lysosomal degradation of complex sphingolipids into ceramide . The catabolism of the complex glucosphingolipids is predominantly located to the surface of internal membrane vesicles or at endocytosed lipoproteins . Receptor mediated endocytosis of low - density lipoprotein (ldl) delivers the glycosphingolipids to lysosomal lumen . The degradation of the simplest of the complex sphingolipids, glycosylceramide, is catalyzed through the action of glycosylceramide - beta - glucosidase (gba1). Thus, sphingosine is generated in lysosomes from degradation of complex sphingolipids whereby it has the ability to serve as substrate for ceramide re - synthesis . Involved key enzymes for this part of the salvage pathway are sphingomyleinases and ceramide synthases . The importance of the salvage pathway is emphasized by the rare but clinically very recognizable glycospingolipidoses characterized by defects in sphingolipid degradation pathways due to mutations of specific acid hydrolases . In the circulatory system, sphingolipids are transported as components of plasma lipoprotein associated particles . Thus, ldl particles are the most abundantly loaded with sphingolipids including sphingomyelin and ceramide which is also transported via vldl particles . As mentioned, all tissues are capable of de novo sphingolipid synthesis rendering locally generated sphingolipids a major source of tissue specific accumulation of ceramide . However, as ceramides synthesized in the liver are easily incorporated in ldl and vldl particles, circulating levels of plasma ceramides are most likely of hepatic and to some extent of dietary origin . Sphingolipids are also part of the diet but the daily amounts consumed are relatively modest 0.30.4 g / day and there is no evidence that dietary sphingolipids are essential for healthy growth or even survival . Nevertheless, it is likely that individuals consuming foods particularly rich in sphingolipids will clearly exceed this level . Sphingolipids undergo considerable hydrolysis in all parts of the small and large intestine, and the resulting sphingosine is rapidly taken up intestinal epithelial cells and degraded in to fatty acids . It is possible that some sphingosine escape degradation in the gut epithelium and access systemic circulation, as radiolabeled sphingoid bases given orally to rats can be found as sphingolipids in the systemic circulation . Thus, sphingomyelinase is subject to activation through extracellular signaling pathways which leads to hydrolytic conversion of sphingomyelin to ceramide . A well - known activator of neutral sphingomyelinase is the proinflammatory cytokine tumor necrosis factor alpha (tnf). This way, oxidative stress induced by tnf enhances sphingomyelin degradation and subsequent ceramide synthesis through the salvage pathway . Other components of the innate immune system such as fatty acid activated toll - like receptor activators can trigger ceramide synthesis thereby further enhancing the stimulatory impact of inflammatory cytokines on tissue levels of ceramide and glucosylsphingolipid . Increased substrate availability seems to be the primary trigger of increased de novo ceramide synthesis . During conditions of lipid overload, mitochondrial capacity to oxidize fatty acids becomes saturated, and esterified long - chain acyl - coa chains are channeled away from carnitine plamiotyl transferase 1 (cpt-1). By escaping this cpt-1 mediated entry to mitochondrial -oxidation, long - chain fatty acyl - coa are instead driven towards synthesis of triacylglycerols, and sphingolipids . Serine palmitoyltransferase activity is highly dependent on tissue levels of l - serine and palmitate acyl - coa . Thus, under circumstances characterized by excess caloric intake (in the form of palmitate and serine), ceramide levels increase in peripheral tissues substantially involved in whole body glucose homeostasis (such as skeletal muscle, liver, and adipose tissue). It has been argued that at least part of the lipotoxic effects of palmitate are due to aberrant synthesis of ceramides because of the selectivity of spt-1 for this fatty acid . This view is supported by clinical observations of human volunteers subjected to intravenous infusion of non - esterified fatty acids demonstrating a very tight correlation between concentrations and time course of rising plasma levels of free fatty acids and ceramides as well as an increased ceramide content in the muscle . More acute regulation of ceramide synthesis is mediated via endocrine regulators of metabolism such as glucocorticoids . The acutely induced impairment of glycemic control by dexamethasone is corroborated by prior inhibition of spt suggesting that increased ceramide levels are downstream mediators of glucocorticoids . This hypothesis is further supported by observations that dexamethasone induces hepatic expression of a number of sphingolipid synthesizing enzymes such as spt2, gcs1, and gcs6 . Strangely and in contrast to ceramides, glucosylsphingolipid levels are differentially affected in a tissue dependent fashion during high fat feeding, with elevated levels of gm3 in adipose tissue and concomitantly decreased gm3 levels in skeletal muscle . Actually, this recent study from the summers laboratory has nuanced our understanding of the putatively deleterious role of glycosylceramides on glucose metabolism in peripheral insulin sensitive tissues . Apparently, glycosylceramides impair insulin action in adipocytes whilst in skeletal muscle overexpression of glycosylceramide synthase not only elevates cellular levels of glycosylceramide but also improves insulin action . A variety of diabetic animal models such as leptin signaling deficient db / db mice and zucker diabetic fatty (zdf) rats display profound changes in tissue sphingolipid levels . Also in non - human primates having developed diabetes due to persistent high - fat feeding, plasma levels of ceramide and dihydroceramide are elevated . Interestingly, the rare sphingolipid species, c18:0 deoxysphinganine, which is a marker of increased flux through the serine palmitoyl transferase pathway was also elevated in these diabetic non - human primates suggesting that de novo sphingolipid synthesis could drive the impaired glycemic control in these animals . In people with type 2 diabetes, insulin resistance correlates with plasma levels of ceramide [2427], but longitudinal studies confirming causality of rising ceramide levels preceding development of insulin resistance are missing . In a recent study, examining people in various stages of type 2 diabetes, concluded that plasma levels of long - chain gm3 and ceramide are clearly positively correlated to impaired insulin sensitivity . Although it is obvious that alterations of plasma ceramide and long - chain gm3 levels constitute early markers of impaired insulin action it is not possible to conclude whether these are causal mediators of insulin resistance or passive bystanders of other underlying mechanisms of dysmetabolic syndrome . However, high - fat fed mice lacking gm3 synthase have both lower plasma glucose levels and improved insulin sensitivity compared to high - fat fed wild type mice . This observation suggest that complex sphingolipids are also interfering with insulin action, although the lack of metabolomic profiling of the gm3 synthase null mice makes it difficult to address which sphingolipid species in particular could mediate these untoward effects . Carefully conducted clinical studies scrutinizing the correlation between plasma and tissue levels of sphingolipids are rare and mostly of quite limited size [24,2931]. High quality quantitative analytical methodologies have not been widely available for classification of tissue and plasma sphingolipids, which has made comparison of different reports difficult . Most clinical trials reporting plasma levels of sphingolipids have measured total ceramides accompanied by a limited subfractionation . With recent methodological advancements it has been possible to analyze specific molecular sphingolipid subspecies in a quantitative fashion and with reasonable throughput . Using high - specificity quantitative methods, it has it seems evident that plasma levels of longer chain ceramides (> 16) and ganglioside gm3 (> 18) are associated with impaired insulin sensitivity . However, far more studies are needed to conclusively confirm which of the many sphingolipid species detectable in plasma are the most reliable surrogate markers of metabolic disease . Further, a number of studies have found increased intramyocellular levels of ceramides in skeletal muscle biopsies from obese insulin resistant human volunteers . However, not all clinical observations confirm a connection between muscle ceramides and insulin resistance, as improvement of skeletal muscle insulin sensitivity through endurance training seemingly have no impact on intramyocellular ceramide content in young males . More recently a correlation between homa - ir and total ceramide as well as ceramide c16:0 in subcutaneous and epicardial adipose tissue could be established, which suggest that the bioactive lipid content in this tissue might be more predictive for insulin resistance . Furthermore increased ceramide content in this tissue interestingly, dramatic decrease in body adiposity and improvement of insulin sensitivity as obtained in obese subjects after bariatric surgery is accompanied by reduction of plasma c16:0 and c24:0 ceramides in particular . Numerous in vitro experiments have consistently demonstrated that increased exposure to ceramide and glucosphingolipids impair functional activity of several of the molecular components of the insulin signaling pathway . The primary target of ceramides in the insulin signaling pathway is protein kinase b (pkb)/akt . Two distinct underlying molecular mechanisms appear to be involved in ceramide induced impairment of pkb / akt activity . Ceramide interferes with both a kinase and a phosphatase required for insulin mediated activation of pkb / akt: firstly, ceramide activates cytosolic protein phosphatase-2a (pp2a) which is a serine / threonine phosphatase responsible for pkb / akt dephosphorylation . Dephosphorylation of thr and/or ser in pkb / akt leaves it inactivated whereby translocation to the plasma membrane does not occur . Secondly, upon accrual of ceramide in the outer layer of the cell membrane it accumulates in the caveolin - enriched domains . In this location, ceramide interferes with pkczeta catalyzed phosphorylation of pkb / akt thr whereby pkb / akt sequesters in a repressed state preventing downstream insulin receptor signaling . A third albeit lesser validated mechanism via which ceramide inhibits glucose transport has to do with ceramide enriched microdomains in phosphatidylcholine containing membranes . Due to altered membrane fluidity ceramides interferes with glut4 translocation and fusion to the cell membrane . It has also been proposed that ceramide inhibits the expression of glut4 in 3t3-l1 adipocytes which would synergize aforementioned effects on glut4 translocation . For glycosphigolipids the interaction of gm3 seems to be mediated by a specific lysine residue in the transmembrane domain of the receptor and excess levels of this ganglioside promote the dissociation of the ir from the caveolae hence hindering signal transduction . Consistent with this theory mice lacking gm3 have been reported to show enhanced phosphorylation of the ir . Thus it has been demonstrated that elevation of intracellular levels of very - long chain - ceramides (> 24) through increased cers2 activity promotes proliferation whilst increase in long - chain - ceramides (c16:0 and c18:0) promotes apoptosis . Further, the ratio between very - long - chain ceramides and long - chain - ceramides influences autophagy in a variety of pathophysiological settings . Unfortunately, studies scrutinizing the importance of specific ceramide chain lengths on insulin signaling and glucose uptake are lacking . However, it has been shown that aforementioned ceramide induced activation of pp2a is particularly mediated via c16:0 ceramide suggesting that elevated cers5 and/or cers6 activity could be linked to impaired insulin action . Recently, another very interesting link between ceramide and insulin action was discovered . Through a thorough series of experiments, holland and colleagues demonstrated that adipocyte derived adiponectin imposes its beneficial effects on insulin signaling through effects on sphingolipid metabolism . Apparently, both adiponectin receptors, adipor1 and adipor2 possess intrinsic ceramidase activity which upon receptor activation promotes degradation of intracellular ceramide species to sphingosine-1-phosphate (s1p). However, it cannot be excluded the adiponectin induced s1p formation is also the result of adipor1/adipor2 mediated activation of other ceramidases . Irrespective of the synthesis pathway, holland et al . Further demonstrated that adiponectin induced s1p formation is required as an important messenger between adipor1/adipor2 and ampk activation . The similar beneficial effects on insulin sensitivity are also obtained when acid ceramidase is overexpressed in free fatty acid overexposed myotubes . Whereas the negative impact of ceramide upon insulin signaling affects all studied insulin receptor expressing tissues, a recent study has demonstrated that interference of glucosylceramide with insulin signaling predominantly affects adipose tissue whereas myotubes are unaffected by this sphingolipid . However, the cellular mechanisms have largely been studied using cell systems, and future studies are required to translate these in vitro findings to in vivo models of insulin resistance and humans . Given the evidence that alterations of cellular sphingolipid levels alters insulin action it has been speculated whether therapeutic interventions modifying synthesis and tissue distribution of ceramides and/or complex sphingolipids will improve whole body glucose homeostasis . Unfortunately, studies bridging in vitro observations of deleterious effects of ceramide and gm3 on insulin signaling to conclusive evidence of ceramide induced impairment of whole body glucose homeostasis are not entirely conclusive . So far, clinical phenotypes with impaired insulin action and/or overt diabetes have not been convincingly associated with genetic variations of enzymes involved in sphingolipid synthesis pathways . However, this may simply be due to the fact that people suffering from serious sphingolipidoses exert rather severe phenotypes primarily characterized by neurological complications and early fatality rendering potential metabolic disorders undetected . With the absence of human genetic data it remains to be proven that transgenic animal models carrying gain or loss of function mutations of sphingolipid synthesis enzymes have any translational validity . Mice carrying a tissue wide deletion of gm3 synthase have improved insulin sensitivity in skeletal muscle compared to wild type animals and display a clear resistance against diet - induced impaired insulin function . Apparently, the absence of gm3 synthase has no deleterious effects on vital functions . In contrast, mice lacking other sphingolipid synthesis enzymes have overt phenotypes rendering interpretation of the metabolic consequences of the absence of these specific enzymes difficult . Genetic ablation of dihydroceramide desaturase 1 (des1) affects the animals ability to form ceramide . Animals lacking both alleles encoding des1 are growth retarded and display increased mortality due to a complex phenotype with hepatomegaly, scaly skin, and practically no hair probably resulting a loss of core temperature and impaired liver function . However, heterozygous des1mice are characterized by markedly lower ceramide levels in peripheral tissues with concomitant significant improvements of insulin sensitivity and insensitivity to glucocorticoid induced metabolic impairment . Dependent on substrate acyl chain length one of several ceramide synthases is involved in adding a second acyl chain to sphinganine to form dihydroceramide . Genetic ablation of ceramide synthase 1, which primarily catalyzes c18:0 acylation leads to a severe cerebellar purkinje cell loss and accompanying ataxia . Complete deletion of ceramide synthase 2 leads to cerebral depletion of myelin sheet formation, cerebellar degeneration and increased prevalence of hepatocellular carcinoma . Genetic ablation of ceramide synthase 6 in mice leads to behavioral abnormalities indicating a vital role of c16:0 sphingolipids in central nervous system function . Another more profound phenotype is seen in mice carrying a tissue selective deletion of glucosylceramide synthase (gcs) in the epithelial cells of the intestine . Newborn mice with a villin promoter driven gcs knock - out die soon after birth due to grossly impaired ability to absorb nutrients from intestine . Also adult mice carrying an inducible deletion of the gcs gene in intestinal epithelial cells die shortly after activating the deletion . The malabsorption is caused by grossly impaired ability to form intracellular vesicles trafficking lipids from the apical plasma membrane of the enterocyte to intracellular lipid depots . Obviously, it is impossible to deduct which of the complex glycosphingolipids being formed down - stream of the gcs catalyzed step are required for normal intestinal absorption of lipids, but given the seemingly normal phenotype of gm3 synthase knock - out mice, it seems evident that sphingolipids formed upstream of gm3 synthase are involved . Presence of elevated ceramide levels in plasma as well as tissues of importance for glucose metabolism such as liver, skeletal, muscle, and adipose tissue does not necessarily confirm causality between ceramide exposure and deterioration of insulin signaling . For example, it is well recognized that plasma levels of triglycerides correlate positively as a surrogate marker of insulin resistance whereas data demonstrating that aggressive triglyceride lowering therapy with fibrates and niacin are incapable of improving glycemic control . Although several studies have demonstrated that increased ceramide exposure deteriorate insulin signaling in vitro, it was only recently that in vivo evidence linking plasma levels of ceramides to insulin sensitivity became available . Due to their lipophilic nature however, when using ldl particles as carriers of ceramides it has been possible to elevate plasma ceramide levels to patophysiologically relevant levels in mice with concomitant deterioration of whole body glucose handling due to increased insulin resistance . Interestingly, boon et al . Demonstrated that intraveneous ldl ceramide infusions increase ceramide content in skeletal muscle cell membranes but not in any other examined tissues . Thus, it seems evident that increased plasma levels of ceramide impair glycemic control, but clear cut evidence from in vivo experimentation demonstrating that therapeutic improvement of insulin sensitivity is causally linked to lowering of plasma ceramide levels is still missing . Till this moment, there is no publicly available information about clinical experience with specific inhibitors of sphingolipid synthesizing enzymes in diabetes patients . However, the glycosylceramide synthase (gcs) inhibitor, eliglustat, is currently undergoing late phase clinical development targeting patients with gauchers disease as the inhibition of gcs reduces the substrate load into the glycosphingolipid synthesis pathway . Patients with gauchers disease are characterized by an inborn error of the enzyme glycosylceramide - beta - glucosidase (gba1), which leads to accumulation of glucocerebroside within lysosomes of macrophages . Some patients with this disease show a markedly increased hepatic glucose production, elevated insulin levels and reduced insulin mediated whole body glucose uptake as demonstrated in euglycemic clamp experiments, which might be the result of the increased production of gangliosides like gm3 . However following enzyme replacement therapy some patients gain body weight and develop diabetes, which might be the result of the loss of glucose - consuming macrophages . Therefore it is impossible to extrapolate effects of gcs inhibition on glycemic control from these clinical trials, and only rigorous assessment of the gcs inhibitors in adequate patient populations can tell if inhibition of glycosylceramide production will translate into clinical benefits for people with diabetes . A wide variety of experimental molecules have been tested in cellular in vitro systems as well as in preclinical in vivo models . Although it is likely that myriocin has other molecular targets, it has been widely used as a tool compound to inhibit spt1 activity in a variety of animal models . Thus, myriocin treatment significantly improves glycemic control in both obese and overtly diabetic rodent models . Oral administration of myriocin is associated with moderate weight loss, but as parenteral administration of myriocin does not affect body weight it is reasonable to assume that improved glycemia is not simply the result of negative energy balance . Formal assessment of myriocins chronic effects on whole body energy balance has yet to be conducted but chronic dosing of myriocin (0.30.5 mg / kg / day) to zdf rats significantly improve metabolic control in parallel with dramatic reduction of skeletal muscle and plasma ceramide . In addition to eliglustat, other inhibitors of gcs are available and some of these have been tested in animal models of diabetes . Small molecule compounds like fumonisin b1 and the imonosugar n-(5'-adamantine-1'-yl - methoxy)-pentyl-1-deoxynojirimycin (amp - dnm) have been used in chronic in vivo studies to demonstrate that pharmacologically induced depletion of glycosphingolipids is associated with improved insulin sensitivity in mice . In addition to improved glycemia, ob / ob mice treated with amp - dnm also display improved hepatic lipid deposition, amelioration of cirrhosis markers, and reduced hepatic gluconeogenesis . The data obtained with amp - dnm should be interpreted with caution as this molecule also infers inhibition of the intestinal enzyme sucrose - isomaltase whereby intestinal carbohydrate absorption is likely to be hampered . However, the far more specific inhibitor of gcs, genz-123346, also concomitantly reduces formation of glucosphingolipids and improves insulin sensitivity and corrects hepatosteatosis . Given it becomes possible to decipher which of the ceramide species exert most deleterious effects on glucose homeostasis it may be possible an interesting therapeutic approach could be to target specific cers16 isoforms rather than spt1 . Such approach would potentially provide selective reduction of the unwanted ceramides whilst leaving others unaffected . Further addressing specific ceramide synthases presence of elevated ceramide levels in plasma as well as tissues of importance for glucose metabolism such as liver, skeletal, muscle, and adipose tissue does not necessarily confirm causality between ceramide exposure and deterioration of insulin signaling . For example, it is well recognized that plasma levels of triglycerides correlate positively as a surrogate marker of insulin resistance whereas data demonstrating that aggressive triglyceride lowering therapy with fibrates and niacin are incapable of improving glycemic control . Although several studies have demonstrated that increased ceramide exposure deteriorate insulin signaling in vitro, it was only recently that in vivo evidence linking plasma levels of ceramides to insulin sensitivity became available . Due to their lipophilic nature however, when using ldl particles as carriers of ceramides it has been possible to elevate plasma ceramide levels to patophysiologically relevant levels in mice with concomitant deterioration of whole body glucose handling due to increased insulin resistance . Interestingly, boon et al . Demonstrated that intraveneous ldl ceramide infusions increase ceramide content in skeletal muscle cell membranes but not in any other examined tissues . Thus, it seems evident that increased plasma levels of ceramide impair glycemic control, but clear cut evidence from in vivo experimentation demonstrating that therapeutic improvement of insulin sensitivity is causally linked to lowering of plasma ceramide levels is still missing . Till this moment, there is no publicly available information about clinical experience with specific inhibitors of sphingolipid synthesizing enzymes in diabetes patients . However, the glycosylceramide synthase (gcs) inhibitor, eliglustat, is currently undergoing late phase clinical development targeting patients with gauchers disease as the inhibition of gcs reduces the substrate load into the glycosphingolipid synthesis pathway . Patients with gauchers disease are characterized by an inborn error of the enzyme glycosylceramide - beta - glucosidase (gba1), which leads to accumulation of glucocerebroside within lysosomes of macrophages . Some patients with this disease show a markedly increased hepatic glucose production, elevated insulin levels and reduced insulin mediated whole body glucose uptake as demonstrated in euglycemic clamp experiments, which might be the result of the increased production of gangliosides like gm3 . However following enzyme replacement therapy some patients gain body weight and develop diabetes, which might be the result of the loss of glucose - consuming macrophages . Therefore it is impossible to extrapolate effects of gcs inhibition on glycemic control from these clinical trials, and only rigorous assessment of the gcs inhibitors in adequate patient populations can tell if inhibition of glycosylceramide production will translate into clinical benefits for people with diabetes . A wide variety of experimental molecules have been tested in cellular in vitro systems as well as in preclinical in vivo models . Although it is likely that myriocin has other molecular targets, it has been widely used as a tool compound to inhibit spt1 activity in a variety of animal models . Thus, myriocin treatment significantly improves glycemic control in both obese and overtly diabetic rodent models . Oral administration of myriocin is associated with moderate weight loss, but as parenteral administration of myriocin does not affect body weight it is reasonable to assume that improved glycemia is not simply the result of negative energy balance . Formal assessment of myriocins chronic effects on whole body energy balance has yet to be conducted but chronic dosing of myriocin (0.30.5 mg / kg / day) to zdf rats significantly improve metabolic control in parallel with dramatic reduction of skeletal muscle and plasma ceramide . In addition to eliglustat, other inhibitors of gcs are available and some of these have been tested in animal models of diabetes . Small molecule compounds like fumonisin b1 and the imonosugar n-(5'-adamantine-1'-yl - methoxy)-pentyl-1-deoxynojirimycin (amp - dnm) have been used in chronic in vivo studies to demonstrate that pharmacologically induced depletion of glycosphingolipids is associated with improved insulin sensitivity in mice . In addition to improved glycemia, ob / ob mice treated with amp - dnm also display improved hepatic lipid deposition, amelioration of cirrhosis markers, and reduced hepatic gluconeogenesis . The data obtained with amp - dnm should be interpreted with caution as this molecule also infers inhibition of the intestinal enzyme sucrose - isomaltase whereby intestinal carbohydrate absorption is likely to be hampered . However, the far more specific inhibitor of gcs, genz-123346, also concomitantly reduces formation of glucosphingolipids and improves insulin sensitivity and corrects hepatosteatosis . Given it becomes possible to decipher which of the ceramide species exert most deleterious effects on glucose homeostasis it may be possible an interesting therapeutic approach could be to target specific cers16 isoforms rather than spt1 . Such approach would potentially provide selective reduction of the unwanted ceramides whilst leaving others unaffected . Further addressing specific ceramide synthases although clinical experience with pharmacological tools reducing tissue and plasma levels of sphingolipids is still missing, a solid body of circumstantial evidence is available to justify investment in experimental clinical studies bridging existing gaps in the translation of preclinical data to relevant clinical setting . Most importantly, we are short of thoroughly safety profiled agents that can be applied clinically to deliver graded tissue specific inhibition of enzymes involved in sphingolipid synthesis . Provided such investigational compounds become available it will become possible to link quantifiable tissue specific reductions of sphingolipids to level of improvement of insulin sensitivity in both normal individuals as well as in people with insulin resistance.
Metabolic data from 330 whites from the southern part of germany were included in the analyses . They participated in an ongoing study on the pathophysiology of type 2 diabetes (23). Individuals were included into the study when they fulfilled at least one of the following criteria: a family history of type 2 diabetes, a bmi> 27 kg / m, previous diagnosis of impaired glucose tolerance, or gestational diabetes . They were considered healthy according to a physical examination and routine laboratory tests . As assessed by means of a standard questionnaire, the participants had no history of liver disease such as hepatitis and did not consume more than two alcoholic drinks per day . Data from 16 individuals (6 women, 10 men, age 66 9 years, bmi 24 4 kg / m) undergoing liver surgery because of hepatic carcinoma or liver metastasis were also included in the present study . They tested negative for viral hepatitis and had no liver cirrhosis . Informed written consent was obtained from all participants, and the local medical ethics committee had approved the protocol . Waist circumference was measured at the midpoint between the lateral iliac crest and lowest rib . Furthermore, we measured total and visceral fat with an axial t1-weighed fast spin echo technique with a 1.5 t whole - body imager (magnetom sonata, siemens healthcare) (24). Volunteers were in prone position and images were recorded from fingers to toes with a slice thickness of 10 mm and a gap between slices of 10 mm . Segmentation of images was performed by semiautomatic thresholding based on a matlab routine (mathworks). Visceral fat was quantified in 16 to 21 slices (depending on the size of the volunteer) between femoral heads and diaphragm, not differentiating between intra- and retroperitoneal fat, by manual delineation of the visceral compartment . Fat volume from images was calculated by multiplying the in - plane pixel dimensions with the slice thickness and the number of pixels classified as fat . Volumes between contiguous slices are calculated by simply doubling the volume of the adjacent slice . Liver fat was measured as previously described (23) by localized hmr spectroscopy, applying a single - voxel steam technique with a short echo time (te = 10 ms) and a long repetition time (tr = 4 s) avoiding t2-related signal losses . Volunteers were in supine position, and a single element of the spine array coil was used for acquisition of spectroscopic data . Spectra were recorded in posterior part of segment seven from a volume of interest of 3 3 2 cm in an acquisition time of 2:08 min (32 acquisitions). Volunteers were asked to be in respiration during data acquisition to minimize movement artifacts and resulting line broadening . Postprocessing of spectra was performed by manual integration of water signal (h2o at 4.7 ppm) and sum of methylene (ch2 at 1.3 ppm) and methyl signals (ch3 at 0.95 ppm). Liver fat is given by si((ch2)n + ch3)/si(h2o) 100, where si is the corresponding signal integral in arbitrary units . We obtained venous plasma samples at 0, 30, 60, 90, and 120 min for determination of plasma glucose and insulin . Glucose tolerance was determined according to the 1997 world health organization diagnostic criteria (25). Insulin sensitivity was determined with a primed insulin infusion at a rate of 40 mu / m per min for 2 h as previously described (23). Blood glucose was determined using a bedside glucose analyzer (glucose - oxidase method; ysi, yellow springs instruments, yellow springs, co). Plasma insulin was determined by microparticle enzyme immunoassay (advia siemens healthcare diagnostics, eschborn, germany). Plasma fetuin - a was determined by an immunoturbidimetric method as previously described (18,20). The insulin sensitivity index (in micromole per kilogram per minute per picomole per liter) for systemic glucose uptake was calculated as the mean infusion rate of glucose (in micromole per kilogram per minute) necessary to maintain euglycemia during the last 40 min of the euglycemic - hyperinsulinemic clamp divided by the steady - state plasma insulin concentration . The latter was the mean insulin concentration at minute 100, 110, and 120 of the clamp (mean for all control subjects: 532 15 insulin sensitivity from the ogtt was estimated as proposed by matsuda and defronzo (26). Liver samples were taken from normal, nondiseased tissue during surgery, immediately frozen in liquid nitrogen, and stored at 80c . Tissue samples were homogenized in pbs containing 1% triton x-100 using a tissuelyser (qiagen, hilden, germany) and triglyceride content was quantified using the advia 1650 clinical chemistry analyzer (siemens healthcare diagnostics, eschborn, germany). Frozen tissue was homogenized in a tissuelyser (qiagen), and rna was extracted with the rneasy tissue kit (qiagen) according to the manufacturer's instructions . Reverse transcription of total rna quantitative pcr of tnf- and -actin was performed on the light cycler system (roche, mannheim, germany) using sybr green . Pnpla3 mrna expression was quantified using the quantitect sybr green pcr kit and quantitect primer assay qt00055419 (qiagen) on a roche lightcycler 480 (mannheim, germany). For genotyping, dna was isolated from whole blood using a commercial dna isolation kit (nucleospin, macherey & nagel, dren, germany). The snp rs738409 in pnpla3 was genotyped using taqman assays (applied biosystems, foster city, ca). We also genotyped the snp rs6006460, although it has a very low allelic frequency in european americans and was found to be associated with liver fat only in blacks (21). The taqman genotyping reaction was amplified on a geneamp pcr system 7000 (50c for 2 min, 95c for 10 min, followed by 40 cycles of 95c for 15 s and 60c for 1 min), and fluorescence was detected on an abi prism sequence detector (applied biosystems). The taqman assay was validated by direct sequencing of the snps in 50 control subjects, and both methods gave identical results . The genotyping success rate for the snp rs738409 was 99.9%, and rescreening of 3.3% of the control subjects with the taqman assay gave 100% identical results . Data that were not normally distributed (e.g., liver fat, insulin sensitivity, body fat distribution; shapiro - wilk w test) were logarithmically transformed . To adjust the effects of covariates and identify independent relationships, we first performed forward stepwise regression analyses to identify the variables to be included into a multiple regression model . Next, we performed multivariate linear regression analyses with these variables as independent parameters . To test the effect of the genotype on the metabolically relevant parameters, the parameter to be considered for each dependent variable, two models were applied . In the additive model, the effects of all possible genotypes on the dependent variable were compared; in the dominant model homozygotes for the major c allele were compared with heterozygotes and homozygotes for the minor g allele . The relationship of the snps with insulin sensitivity was also investigated in more lean and more obese control subjects . Men and women were separately divided by the median total body fat content into two groups . The lean men and lean women, as well as the obese men and women, were combined thereafter . Logistic regression with adjustment for covariates was applied to determine the odds ratio of the genotypes for being diagnosed with fatty liver . The statistical software package jmp 4.0 (sas institute, cary, nc) was used . Waist circumference was measured at the midpoint between the lateral iliac crest and lowest rib . Furthermore, we measured total and visceral fat with an axial t1-weighed fast spin echo technique with a 1.5 t whole - body imager (magnetom sonata, siemens healthcare) (24). Volunteers were in prone position and images were recorded from fingers to toes with a slice thickness of 10 mm and a gap between slices of 10 mm . Segmentation of images was performed by semiautomatic thresholding based on a matlab routine (mathworks). Visceral fat was quantified in 16 to 21 slices (depending on the size of the volunteer) between femoral heads and diaphragm, not differentiating between intra- and retroperitoneal fat, by manual delineation of the visceral compartment . Fat volume from images was calculated by multiplying the in - plane pixel dimensions with the slice thickness and the number of pixels classified as fat . Volumes between contiguous slices are calculated by simply doubling the volume of the adjacent slice . Liver fat was measured as previously described (23) by localized hmr spectroscopy, applying a single - voxel steam technique with a short echo time (te = 10 ms) and a long repetition time (tr = 4 s) avoiding t2-related signal losses . Volunteers were in supine position, and a single element of the spine array coil was used for acquisition of spectroscopic data . Spectra were recorded in posterior part of segment seven from a volume of interest of 3 3 2 cm in an acquisition time of 2:08 min (32 acquisitions). Volunteers were asked to be in respiration during data acquisition to minimize movement artifacts and resulting line broadening . Postprocessing of spectra was performed by manual integration of water signal (h2o at 4.7 ppm) and sum of methylene (ch2 at 1.3 ppm) and methyl signals (ch3 at 0.95 ppm). Liver fat is given by si((ch2)n + ch3)/si(h2o) 100, where si is the corresponding signal integral in arbitrary units . We obtained venous plasma samples at 0, 30, 60, 90, and 120 min for determination of plasma glucose and insulin . Glucose tolerance was determined according to the 1997 world health organization diagnostic criteria (25). Insulin sensitivity was determined with a primed insulin infusion at a rate of 40 mu / m per min for 2 h as previously described (23). Blood glucose was determined using a bedside glucose analyzer (glucose - oxidase method; ysi, yellow springs instruments, yellow springs, co). Plasma insulin was determined by microparticle enzyme immunoassay (advia siemens healthcare diagnostics, eschborn, germany). Plasma fetuin - a was determined by an immunoturbidimetric method as previously described (18,20). The insulin sensitivity index (in micromole per kilogram per minute per picomole per liter) for systemic glucose uptake was calculated as the mean infusion rate of glucose (in micromole per kilogram per minute) necessary to maintain euglycemia during the last 40 min of the euglycemic - hyperinsulinemic clamp divided by the steady - state plasma insulin concentration . The latter was the mean insulin concentration at minute 100, 110, and 120 of the clamp (mean for all control subjects: 532 15 insulin sensitivity from the ogtt was estimated as proposed by matsuda and defronzo (26). Liver samples were taken from normal, nondiseased tissue during surgery, immediately frozen in liquid nitrogen, and stored at 80c . Tissue samples were homogenized in pbs containing 1% triton x-100 using a tissuelyser (qiagen, hilden, germany) and triglyceride content was quantified using the advia 1650 clinical chemistry analyzer (siemens healthcare diagnostics, eschborn, germany). Frozen tissue was homogenized in a tissuelyser (qiagen), and rna was extracted with the rneasy tissue kit (qiagen) according to the manufacturer's instructions . Reverse transcription of total rna quantitative pcr of tnf- and -actin was performed on the light cycler system (roche, mannheim, germany) using sybr green . Pnpla3 mrna expression was quantified using the quantitect sybr green pcr kit and quantitect primer assay qt00055419 (qiagen) on a roche lightcycler 480 (mannheim, germany). For genotyping, dna was isolated from whole blood using a commercial dna isolation kit (nucleospin, macherey & nagel, dren, germany). The snp rs738409 in pnpla3 was genotyped using taqman assays (applied biosystems, foster city, ca). We also genotyped the snp rs6006460, although it has a very low allelic frequency in european americans and was found to be associated with liver fat only in blacks (21). The taqman genotyping reaction was amplified on a geneamp pcr system 7000 (50c for 2 min, 95c for 10 min, followed by 40 cycles of 95c for 15 s and 60c for 1 min), and fluorescence was detected on an abi prism sequence detector (applied biosystems). The taqman assay was validated by direct sequencing of the snps in 50 control subjects, and both methods gave identical results . The genotyping success rate for the snp rs738409 was 99.9%, and rescreening of 3.3% of the control subjects with the taqman assay gave 100% identical results . Data that were not normally distributed (e.g., liver fat, insulin sensitivity, body fat distribution; shapiro - wilk w test) were logarithmically transformed . To adjust the effects of covariates and identify independent relationships, we first performed forward stepwise regression analyses to identify the variables to be included into a multiple regression model . Next, we performed multivariate linear regression analyses with these variables as independent parameters . To test the effect of the genotype on the metabolically relevant parameters, the parameter to be considered was set as the dependent variable . The effects of all possible genotypes on the dependent variable were compared; in the dominant model homozygotes for the major c allele were compared with heterozygotes and homozygotes for the minor g allele . The relationship of the snps with insulin sensitivity was also investigated in more lean and more obese control subjects . Men and women were separately divided by the median total body fat content into two groups . The lean men and lean women, as well as the obese men and women, were combined thereafter . Logistic regression with adjustment for covariates was applied to determine the odds ratio of the genotypes for being diagnosed with fatty liver . The statistical software package jmp 4.0 (sas institute, cary, nc) was used . The 330 subjects (130 men and 200 women) had a mean age of 45 (range 1869) years . Anthropometrics and metabolic characteristics of the subjects covered a wide range that was particularly large for total body fat (470 kg), visceral fat (0.210.1 kg), liver fat (0.230.0%), and insulin sensitivity (ogtt: 1.633.4 arbitrary units; clamp: 0.0080.347 mol kg min pm). A total of 105 control subjects had fatty liver (liver fat> 5.56%) (27). Liver fat was higher in males than females (7.3 0.5 vs. 4.8 0.4%, p <0.0001) and correlated positively with age (r = 0.18, p = 0.001), total body fat (r = 0.30, p <0.0001), visceral fat (r = 0.59, p <0.0001), and inversely with insulin sensitivity (ogtt: r = 0.53, p <0.0001; clamp: r = 0.56, p <0.0001). In forward stepwise linear regression analyses including age, sex, liver fat, total fat, and visceral fat, liver fat was the strongest determinant of insulin sensitivity estimated from the ogtt (f ratio: 56) followed by age (f ratio: 9), total fat (f ratio: 9), and visceral fat (f ratio: 5). Similar results were found for insulin sensitivity measured by the clamp (f ratios; liver fat: 39; visceral fat: 12; total fat: 10; and age: 9). In our population, the frequency of the minor g allele of the snp rs738409 in pnpla3 was 0.26, similar to findings in european americans (0.23) (21), and the snp was in hardy - weinberg equilibrium (test; p> 0.05). The snp rs738409 was strongly associated with liver fat content depicting an allele - dose effect . Carriers of the g allele had significantly higher liver fat compared to c allele homozygotes, independently of age, sex, and adiposity (table 1) and even of visceral adiposity (p <0.0001, fig . 1a). Furthermore, g allele carriers had higher odds ratios (cg: 2.15 [95% ci 1.193.91]; gg: 3.71 [95% ci 1.3710.53]) for being diagnosed with fatty liver compared to c allele homozygotes (table 1, fig . 2). However, the predictive effect of the snp for diagnosing control subjects with fatty liver was only moderate (dominant model: positive predictive value of the snp: 0.51; negative predictive value of the snp: 0.61). Associations of the snp rs738409 in pnpla3 with demographic and metabolic characteristics values represent means se . For statistical analyses, nonnormally distributed parameters body weight, bmi, waist circumference, and total body fat were adjusted for age and sex . Isi, insulin sensitivity index, available in 222 control subjects (c / c n = 124; c / g n = 72; t / t n = 26). Relationships of the snp rs738409 c> g (ile148met) in pnpla3 with liver fat (a) and insulin sensitivity (b) in all 330 subjects (tat, total adipose tissue; vat, visceral adipose tissue). Liver fat content in subjects without and with fatty liver and the relationship of the snp rs738409 with liver fat content in subjects having fatty liver (c). Insulin sensitivity in subjects without and with fatty liver and the relationship of the snp rs738409 with insulin sensitivity in subjects having fatty liver (d). Interestingly, the snp was not associated with insulin sensitivity estimated from the ogtt (table 1, fig . 1b) or measured by the clamp (table 1, p = 0.32 after adjustment for age, sex, total fat, and visceral fat). Power analyses revealed that at the -level of 0.05 and at a power of 80% the minimum detectable effect sizes among all three genotypes (genotypes cc, cg, and gg) were 8.5% for insulin sensitivity estimated from the ogtt and 9% for insulin sensitivity measured by the clamp . In a dominant model (genotype cc vs. cg + gg) the effect sizes were 8% for insulin sensitivity estimated from the ogtt and 8.3% for insulin sensitivity measured by the clamp . Furthermore, the snp was not associated with total fat and visceral fat, liver enzymes, high - sensitivity (hs)-crp, or fetuin - a levels (table 1). For the liver enzymes, at the -level of 0.05 and at a power of 80% the minimum detectable effect sizes among all three genotypes were 7.5% for alanine aminotransferase (alt) and 5.5% for aspartate for hs - crp levels, the effect sizes were much larger (all three genotypes: 21% and dominant model: 19%). To address in more detail the relationships of the snp rs738409 in pnpla3 with liver fat and insulin sensitivity, we first divided subjects in those with and without fatty liver . As expected upon definition liver fat was much higher in control subjects with fatty liver (fig . The first noteworthy finding was that the snp was no longer associated with liver fat content, adjusted for age, sex, total fat, and visceral fat, once subjects already displayed fatty liver, possibly because of a ceiling effect . The second interesting finding was that in control subjects with fatty liver, for a very similar liver fat content, carriers of the g allele appeared to be not just equally but actually more insulin sensitive than cc homozygotes, and insulin sensitivity in gg homozygotes was statistically not different compared to control subjects without fatty liver (fig . 1d). Upon this finding, based on the data in the literature showing that pnpla3 is becoming increasingly expressed under energy excess (2831) and because there is an interaction of the snp rs738409 with obesity on insulin sensitivity (32), we next divided the control subjects in more lean and more obese by the median total adipose tissue mass . While in the lean group insulin sensitivity estimated by the ogtt and adjusted for age, sex, total fat, visceral fat, and liver fat was not associated with the genotype (fig . 3a), it significantly increased with increasing copy numbers of the g allele in the obese group (fig . Relationships of the snp rs738409 c> g (ile148met) in pnpla3 with insulin sensitivity in all 330 subjects separated by the median total body fat mass into more lean (a) and more obese (b) control subjects . Because steatosis - induced inflammation is accompanied by insulin resistance, we further investigated in human liver biopsies the relationships of expression of the proinflammatory gene tnf- and of pnpla3 with the triglyceride content according to the genotype . The snp was not associated with tnf- expression (p = 0.64). However, liver triglyceride content correlated positively with the expression of the proinflammatory cytokine tnf- in homozygote carriers of the c allele (n = 6) but not in carriers of the g allele (n = 10, fig . Relationships of hepatic triglyceride content with mrna expression of pnpla3 (a) and tnf- (b) in human liver tissue . Relationships between hepatic triglyceride content and mrna expression of tnf- in c allele homozygotes (c) and g allele carriers (d) of the snp rs738409 c> g (ile148met) in pnpla3 . The 330 subjects (130 men and 200 women) had a mean age of 45 (range 1869) years . Anthropometrics and metabolic characteristics of the subjects covered a wide range that was particularly large for total body fat (470 kg), visceral fat (0.210.1 kg), liver fat (0.230.0%), and insulin sensitivity (ogtt: 1.633.4 arbitrary units; clamp: 0.0080.347 mol kg min pm). A total of 105 control subjects had fatty liver (liver fat> 5.56%) (27). Liver fat was higher in males than females (7.3 0.5 vs. 4.8 0.4%, p <0.0001) and correlated positively with age (r = 0.18, p = 0.001), total body fat (r = 0.30, p <0.0001), visceral fat (r = 0.59, p <0.0001), and inversely with insulin sensitivity (ogtt: r = 0.53, p <0.0001; clamp: r = 0.56, p <0.0001). In forward stepwise linear regression analyses including age, sex, liver fat, total fat, and visceral fat, liver fat was the strongest determinant of insulin sensitivity estimated from the ogtt (f ratio: 56) followed by age (f ratio: 9), total fat (f ratio: 9), and visceral fat (f ratio: 5). Similar results were found for insulin sensitivity measured by the clamp (f ratios; liver fat: 39; visceral fat: 12; total fat: 10; and age: 9). In our population, the frequency of the minor g allele of the snp rs738409 in pnpla3 was 0.26, similar to findings in european americans (0.23) (21), and the snp was in hardy - weinberg equilibrium (test; p> 0.05). The snp rs738409 was strongly associated with liver fat content depicting an allele - dose effect . Carriers of the g allele had significantly higher liver fat compared to c allele homozygotes, independently of age, sex, and adiposity (table 1) and even of visceral adiposity (p <0.0001, fig . 1a). Furthermore, g allele carriers had higher odds ratios (cg: 2.15 [95% ci 1.193.91]; gg: 3.71 [95% ci 1.3710.53]) for being diagnosed with fatty liver compared to c allele homozygotes (table 1, fig . 2). However, the predictive effect of the snp for diagnosing control subjects with fatty liver was only moderate (dominant model: positive predictive value of the snp: 0.51; negative predictive value of the snp: 0.61). Associations of the snp rs738409 in pnpla3 with demographic and metabolic characteristics values represent means se . For statistical analyses, nonnormally distributed parameters body weight, bmi, waist circumference, and total body fat were adjusted for age and sex . Isi, insulin sensitivity index, available in 222 control subjects (c / c n = 124; c / g n = 72; t / t n = 26). Relationships of the snp rs738409 c> g (ile148met) in pnpla3 with liver fat (a) and insulin sensitivity (b) in all 330 subjects (tat, total adipose tissue; vat, visceral adipose tissue). Liver fat content in subjects without and with fatty liver and the relationship of the snp rs738409 with liver fat content in subjects having fatty liver (c). Insulin sensitivity in subjects without and with fatty liver and the relationship of the snp rs738409 with insulin sensitivity in subjects having fatty liver (d). Odds ratios of the genotypes of the snp rs738409 c> g (ile148met) in pnpla3 for predicting fatty liver . Interestingly, the snp was not associated with insulin sensitivity estimated from the ogtt (table 1, fig . 1b) or measured by the clamp (table 1, p = 0.32 after adjustment for age, sex, total fat, and visceral fat). Power analyses revealed that at the -level of 0.05 and at a power of 80% the minimum detectable effect sizes among all three genotypes (genotypes cc, cg, and gg) were 8.5% for insulin sensitivity estimated from the ogtt and 9% for insulin sensitivity measured by the clamp . In a dominant model (genotype cc vs. cg + gg) the effect sizes were 8% for insulin sensitivity estimated from the ogtt and 8.3% for insulin sensitivity measured by the clamp . Furthermore, the snp was not associated with total fat and visceral fat, liver enzymes, high - sensitivity (hs)-crp, or fetuin - a levels (table 1). For the liver enzymes, at the -level of 0.05 and at a power of 80% the minimum detectable effect sizes among all three genotypes were 7.5% for alanine aminotransferase (alt) and 5.5% for aspartate aminotransferase (ast). In a dominant model, the effect sizes were 7% for alt and 5% for ast . For hs - crp levels, the effect sizes were much larger (all three genotypes: 21% and dominant model: 19%). To address in more detail the relationships of the snp rs738409 in pnpla3 with liver fat and insulin sensitivity, we first divided subjects in those with and without fatty liver . As expected upon definition liver fat was much higher in control subjects with fatty liver (fig . The first noteworthy finding was that the snp was no longer associated with liver fat content, adjusted for age, sex, total fat, and visceral fat, once subjects already displayed fatty liver, possibly because of a ceiling effect . The second interesting finding was that in control subjects with fatty liver, for a very similar liver fat content, carriers of the g allele appeared to be not just equally but actually more insulin sensitive than cc homozygotes, and insulin sensitivity in gg homozygotes was statistically not different compared to control subjects without fatty liver (fig . 1d). Upon this finding, based on the data in the literature showing that pnpla3 is becoming increasingly expressed under energy excess (2831) and because there is an interaction of the snp rs738409 with obesity on insulin sensitivity (32), we next divided the control subjects in more lean and more obese by the median total adipose tissue mass . While in the lean group insulin sensitivity estimated by the ogtt and adjusted for age, sex, total fat, visceral fat, and liver fat was not associated with the genotype (fig . 3a), it significantly increased with increasing copy numbers of the g allele in the obese group (fig . Relationships of the snp rs738409 c> g (ile148met) in pnpla3 with insulin sensitivity in all 330 subjects separated by the median total body fat mass into more lean (a) and more obese (b) control subjects . Because steatosis - induced inflammation is accompanied by insulin resistance, we further investigated in human liver biopsies the relationships of expression of the proinflammatory gene tnf- and of pnpla3 with the triglyceride content according to the genotype . The snp was not associated with tnf- expression (p = 0.64). However, liver triglyceride content correlated positively with the expression of the proinflammatory cytokine tnf- in homozygote carriers of the c allele (n = 6) but not in carriers of the g allele (n = 10, fig . Relationships of hepatic triglyceride content with mrna expression of pnpla3 (a) and tnf- (b) in human liver tissue . Relationships between hepatic triglyceride content and mrna expression of tnf- in c allele homozygotes (c) and g allele carriers (d) of the snp rs738409 c> g (ile148met) in pnpla3 . Recently, the first gwa approach searching for genetic variants associated with liver fat identified the rs738409 snp in pnpla3, encoding patatin - like phospholipase 3, also known as adiponutrin, as the variant that was by far most strongly associated with liver fat content in three populations (21). In the present study, using precise measurements of liver fat and body fat distribution we confirmed the strong relationship of the snp with liver fat . (21) we provide novel data that this relationship was independent of total and visceral adiposity, which are important determinants of hepatic steatosis (36,33). Thus, hepatic pnpla3 activity most probably directly affects fat accumulation in the liver, a hypothesis that is supported by our finding of a strong positive correlation of hepatic pnpla3 mrna expression with liver triglyceride content in liver tissue samples . Of note, in the study by romeo this variant was not associated with estimates of insulin resistance in any of the three populations or in more than 14,000 control subjects of the atherosclerosis risk in communities study (21). Considering the strong relationship of liver fat with insulin resistance (36,34), therefore, we further investigated whether the snp rs738409 in pnpla3 was associated with insulin sensitivity estimated from the ogtt and measured by the euglycemic - hyperinsulinemic clamp . The advantage of these techniques for estimating insulin sensitivity compared to the use of fasting values, as done in the study of romeo et al ., is that they provide a more dynamic and precise measurement of this phenotype . Furthermore, the snp was not associated with liver enzymes or hs - crp levels, markers of hepatic and systemic inflammation, which are commonly elevated in insulin resistance (6,14). Because fetuin - a may be involved in fatty liver induced insulin resistance and strongly determines the incidence of diabetes and cardiovascular disease (1620), we further investigated the relationship of the snp with circulating fetuin - a . Although liver fat correlated with circulating fetuin - a (p = 0.01), the snp was not associated with fetuin - a levels . In the study by romeo et al . (21), the snp rs738409 was not associated with alt or ast levels in more than 1,800 blacks or more than 1,000 european americans . Only in 597 hispanics, a significant relationship with alt and ast levels was found . In a recent gwa approach aiming at identifying genes influencing liver enzymes, another snp in pnpla3 (rs2281135), but not the snp rs738409, our finding of no significant association of the snp with liver enzymes is in agreement with the findings of romeo et al . In blacks and european americans nevertheless, we cannot exclude that we may have missed small differences because of the relatively small sample size . In the study by romeo et al ., the relationship of the snp rs738409 with hs - crp levels was not investigated . We did not find a significant relationship of the snp rs738409 with hs - crp levels . For this analysis we had a low power; therefore, we cannot exclude a relationship of the snp with this parameter . Because there was a clear - cut higher liver fat content, but no increase in insulin resistance in carriers of the minor g allele compared to c allele homozygotes, we hypothesized that specifically pnpla3-mediated accumulation of liver fat appears to be metabolically benign . If this was the case, then for a similar amount of liver fat g allele carriers must be more insulin sensitive than c allele homozygotes . Indeed, in more obese control subjects, insulin sensitivity, adjusted for age, sex, total fat, visceral fat, and liver fat, was higher in carriers of the minor g allele . Furthermore, in homozygous g allele carriers with fatty liver, insulin sensitivity was no more significantly different from control subjects without fatty liver, despite the large difference in liver fat . These data support the hypothesis that pnpla3 is involved in the generation of a metabolically benign fatty liver . Because these findings are derived from a more obese smaller subsample of the study population, the effects of pnpla3 may be important particularly in obesity . One of them is the acyl: coa: diacylglycerol acyltransferase 2 (dgat2) gene that encodes the protein dgat2 that catalyzes the final step of triacylglycerol biosynthesis (36). Liver - specific dgat2-overexpressing mice developed hepatic steatosis with a fivefold increase in liver triglyceride content compared to control subjects, but not whole - body or hepatic insulin resistance (37). Conversely, antisense oligonucleotide treatment targeting the dgat2 reduced liver triglycerides in mice fed a high - fat diet, without improving insulin sensitivity or glucose tolerance (38). In agreement with these data we found that a snp in dgat2 was associated with liver fat but not with insulin resistance in humans (39). Another candidate is the elongation of long - chain fatty acids (elovl) gene (elovl6). Elovl catalyzes the conversion of palmitate to stearate as well as palmitoleate to vaccinate, thus regulating the hepatic fatty acid composition (40). Mice deficient for elovl6 developed obesity and hepatic steatosis, but not insulin resistance, hyperinsulinemia, or hyperglycemia under a high - fat diet (41). The paradox of this finding may be because of lipotoxicity (42). According to this concept, triglycerides are probably the least toxic form in which the lipid excess can be stored in ectopic tissues, at least in the short - term . The incorporation of fatty acids into triglycerides, as well as their oxidative degradation, thus represents protection from lipotoxicity . However, when these compensatory mechanisms are overwhelmed, fatty acids induce damage to cells resulting in impaired metabolism (43,44). Several pathways are thought to be operative in this process . Among them, activation of nuclear factor-b and c - jun nh2-terminal kinase, which are involved in insulin resistance (14,45,46), are critical . Besides these proinflammatory pathways fatty acid and diacylglycerol (dag) directly activate protein kinase c-, thus inhibiting hepatic insulin signaling (41,47,48). What is the putative role of pnpla3/adiponutrin in these pathways? Data in the literature strongly support that it probably has no lipase activity (49,50) but rather lipogenic functions in adipose tissue under feeding conditions, particularly under carbohydrate intake (30,31). It was further hypothesized that if this protein has similar functions in the liver, then increased hepatic expression or activity may result in increased triglyceride synthesis (31,49). Pnpla3/adiponutrin was found to have transacetylase functions and uses dag as an acyl acceptor (31,32,49). Therefore, increased activity of the protein may also result in depletion in the hepatic dag and fatty acid content, both of which are involved in lipotoxicity (47,48). Thus, this protective mechanism may result in a metabolically benign phenotype under increased lipid load by partitioning excess hepatic fatty acids to triglycerides that may protect against lipotoxicity . In support of this hypothesis, we found that in carriers of the minor rs738409 g allele, the mrna expression of the proinflammatory gene tnf- in the liver was less strongly associated with triglyceride content compared to c allele homozygotes . What may be the clinical implication of these findings? Because fatty liver is becoming a worldwide epidemic, it is necessary not only to screen for its presence but also for control subjects at the highest risk for fatty liver induced complications . If further studies confirm the role of pnpla3/adiponutrin in the generation of steatosis without complications, then screening for genetic variation in pnpla3 may help to stratify this risk . In conclusion, the snp rs738409 in pnpla3 is strongly, and independently of total and visceral adiposity, associated with fatty liver but not with insulin resistance or estimates of liver injury . Therefore, pnpla3/adiponutrin may be an important key to understand the mechanisms discriminating fatty liver with and without metabolic consequences and may serve as a useful tool for estimating the risk of fatty liver induced complications.
It has been estimated that schwannomas represent only 2 - 6% of all stromal tumors of the digestive tract . There are many synonyms for neurogenic tumors of the digestive tract, namely schwannoma, neurinoma, neurogenic fibroma, neurofibroma, neurilemoma and plexiform neurofibromatosis . These different names are used with the intent of relating them to the structure from which they originate . Because of the differences in the nomenclature used, it remains difficult to precisely establish the correct prevalence of primary tumors of the neural sheath . Although there is some controversy regarding the cell origin, classification and correct naming of gastrointestinal tract schwannomas, there is evidence showing that these neoplasms originate from schwann cells in the neurons of the myenteric plexus . Primary schwannomas of the colon and rectum, unassociated with systemic neurofibromatosis (von recklinghausen disease), are extremely rare . The objective of the present paper was to present a case of benign primary schwannoma of the sigmoid colon, unassociated with von recklinghausen disease, that was histopathologically confirmed by means of an immunohistochemical panel and was successfully treated by means of videolaparoscopic colectomy . The patient was a 71-year - old woman with complaints of tenesmus and hematochezia for 4 months, associated with weight loss of 4 kg . Nine months earlier she had undergone colonoscopy and a sessile polypoid lesion in the sigmoid colon, 0.5 cm in diameter, had been removed . Histopathological evaluation at that time had led to the diagnosis of a hyperplastic polyp in the colon . Even with endoscopic removal of the polyp she continued to present successive episodes of fresh bleeding when evacuating, and this was associated with rectal pain and tenesmus . With these complaints, she sought the coloproctology service of so francisco university, where she underwent another colonoscopy . This second examination found a reddish polypoid lesion of approximately 3 cm in diameter, located in the sigmoid colon 35 cm from the anal margin . The surface of the mucosa covering the lesion was ulcerated and it presented slight local bleeding when in contact with the apparatus . It was removed by means of loop polypectomy . Conventional histopathological examination using the hematoxylin - eosin technique showed that spindle cells were present, arranged in bundles, with dense distribution of nucleus forming palisades in dense fibrillar stroma (fig ., an immunohistochemical panel was performed for anti - cd34 antibodies, desmin, cytokeratins (ae1/ae3), ckit, chromogranin and s-100 protein . 2), while the other antibodies presented negative results (table 1). With the aim of evaluating tumor growth potential, positive results were found in fewer than 5% of the fields analyzed (one mitosis in every ten fields at high magnification), thus suggesting that the neoplasm had a low mitotic rate (fig . 3). The results from the histopathological and immunohistochemical examinations allowed the diagnostic conclusion that this was a case of benign schwannoma of the sigmoid colon with a histological pattern of antoni a type, with a low degree of cell proliferation (fig . The surgical margins of the lesion removed were compromised with neoplasia, and therefore it was decided to perform video - assisted colectomy . The patient's postoperative evolution was uneventful and she was discharged from hospital on the fourth postoperative day . Histopathological examination on the resected colon confirmed that it presented a residual neoplastic lesion with the same characteristics as presented by the polyp that was removed during colonoscopy . The resected margins obtained after surgical resection were free from involvement and there was no neoplastic involvement in any of the 21 lymph nodes examined . At present, the patient is well, without any recurrence of symptom, and a control colonoscopy examination performed 15 months after the colectomy showed normal results . Tumors originating from autonomous nerves of the digestive tract form a distinct but rare subcategory of stromal gastrointestinal tumors, accounting for approximately 1% of all neoplasms affecting the digestive tract . They affect men and women with equal frequency and can appear at any age, but most commonly after the sixth decade of life . When they appear in the digestive tract, the stomach and the small intestine are the segments most frequently involved, accounting for 83 and 12% of such cases, respectively . Schwannomas located in the colon and rectum that are unrelated to von recklinghausen disease are extremely rare . Although they usually evolve asymptomatically, they may in some cases, as in our patient, present bleeding, rectal pain and tenesmus . It is important to highlight that unspecific rectal pain is often confused with the pain of idiopathic proctalgia fugax, which may cause delay in diagnosing the condition . Macroscopically, schwannomas are well - delimited, lobulated tumors that may, in larger cases, present a cystic pattern . From a microscopic point of view, schwannomas are encapsulated neoplasms and two histological growth patterns have been described: antoni a and antoni b. in antoni a type there is dense growth of fusiform cells, compactly arranged in palisades to form verocay bodies . In antoni b, the fusiform cells are more loosely distributed with rounded or elongated nuclei, with a greater quantity of myxoid stroma and xanthomatous histiocytes . These findings also include undifferentiated mesenchymal cells, smooth muscle cells, cells with neural characteristics and cells with mixed differentiation of neural / muscular type . Regarding our patient, the result from the histological examination using the hematoxylin - eosin technique suggested a diagnosis of schwannoma of the sigmoid colon with a cell pattern classified as antoni a. before immunohistochemistry techniques came into routine use, schwannomas were wrongly diagnosed as smooth muscle neoplasms such as leiomyomas and leiomyosarcomas . The use of immunohistochemical panels plays a fundamental role in diagnosing schwannomas and in ruling out other neoplasms of mesenchymal origin . Authors believed that positive immunostaining for s-100 protein and leu7 antigen indicated a neoplasm originating from schwann cells . Strongly positive immunoexpression of s-100 protein and low affinity for cd34, cytokeratins, smooth muscle actin and desmin confirm the possibility of schwannoma in practice . The present case was within these criteria: results identical to these were found from running the immunohistochemical panel that is most commonly proposed . The exact biological behavior of schwannomas is still not fully clear, since only a small number of cases have been published . Consequently, determination of malignity becomes a difficult challenge that cannot always be resolved using conventional histopathological techniques . Many parameters have been studied in relation to tumor behavior and, so far, no single parameter alone allows safe prediction of the degree of malignity . A mitotic activity rate of more than five mitoses per field at high magnification and tumor size greater than 5 cm tend to be associated with a high risk of metastasis or recurrence . We evaluated the number of mitoses by means of the immunohistochemical technique using ki-67 antibodies and found a low rate of cell division, suggesting that this was a low - grade schwannoma . The low mitosis rate, the absence of atypical mitosis figures and the absence of nuclear hyperpigmentation, especially in the necrotic areas found, were also useful for characterizing the benign nature of the lesion . Although schwannomas are considered to be benign tumors, their high recurrence risk must not be ignored . In a study on 303 benign schwannoma cases unrelated to von recklinghausen disease, das gupta and brasfield found that 2% of the tumors evolved with distant metastases . This evidence suggests that, despite the skepticism regarding the possibility of malignant transformation of schwannomas initially considered benign, this possibility does exist and must not be ignored . The most aggressive phenotype relates to the size of the tumor and its proliferative activity rate, and this gives rise to greater recurrence, metastases and lower overall survival rates . The best therapeutic option is complete surgical removal with margins free from neoplastic involvement . Since the risk of malignant transformation is small, broad lymph node resections are not recommended . For tumors with more aggressive behavior, the same surgical criteria should be used, but greater rigor in postoperative follow - up is recommended . The surgical approach depends on the size and location of the tumor and on its histopathological pattern . Minimally invasive surgery using videolaparoscopic access, such as in the present case, may be indicated for tumors located in the proximal colon and rectum . For tumors in the distal rectum, transanal endoscopic resection can be used . The use of radiotherapy or adjuvant chemotherapy still presents conflicting results and is not recommended for routine use . In conclusion, schwannomas of the colon and rectum are tumors that are rarely detected and for which the use of an immunohistochemical panel is important to achieve a definitive histopathological diagnosis . Radical surgical removal is the preferred treatment because it allows improvement of overall survival and disease - free survival rates.
An -transaminase catalyzes the deamination of a primary amine (amine donor) and the concomitant amination of a ketone or aldehyde (amine acceptor), which results in a reaction in which an amino moiety is transferred between two molecules (scheme 1). Unlike -transaminases, -transaminases are not restricted to -amino and -keto acids but can aminate virtually any ketone or aldehyde functionality and deaminate in theory any prim - amine; consequently they are also referred to as amine transaminases . For the transamination reaction the enzyme requires pyridoxal 5-phosphate (plp, 1) as cofactor, acting as an intermediate amine acceptor and electron sink (see mechanism, section 3). Because the amination / deamination is reversible, -transaminases can be used for the preparation of optically pure amines in two fashions: either (a) by kinetic resolution, in which one enantiomer of a racemic amine is converted into the corresponding ketone, leaving the desired amine enantiomer untouched (scheme 1, a), or, more preferred, (b) in an asymmetric synthesis starting from the prochiral ketone (scheme 1, b). The substrates and products of the reaction (amine donor and acceptor, product, co - product) exist in equilibrium which each other, which depending on the substrates' and products' natures might require reaction engineering or follow - up reactions to shift the reaction to the product side . Because, from a thermodynamic point of view, pyruvate is an ideal amine acceptor, -transaminases were at first mainly employed in kinetic resolution . The development of process - adapted enzymes or methods to shift the equilibrium launched the success of this biocatalytic method for the synthesis of amines . The obtained (chiral) amines represent highly valuable target molecules, because they are precursors for numerous synthetic targets, variously for the pharmaceutical industry (alkaloids etc . ), the polymer area (e.g., carbamates, polyurethanes), or for plant protection [e.g., (+) -dihydropinidine]. It is worth noting that chiral amines can alternatively be prepared by employing other type of biocatalysts such as monoamine oxidases, amine dehydrogenases, and imine reductases; this has been the subject of other recent reviews. [1c], a) kinetic resolution of a racemic primary amine by an -transaminase (-ta). B) -transaminase - catalyzed asymmetric amine synthesis and common methods to shift the equilibrium to the product . Although the first records concerning -transaminases date back about 50 years, it took until the end of the last century for these enzymes to be spotted as possible catalysts for synthetic applications . The company celgene demonstrated the first enantioselective production of chiral amines through kinetic resolution of a racemate on a 2.5 m scale . At around the same time investigations into -transaminases for synthetic applications also started in academia, revealing that one of the major problems to overcome was shifting the equilibrium, especially in the case of asymmetric synthesis (scheme 1, b), as well as inhibition by certain carbonyl compounds . In order to circumvent inhibition, the kinetic resolution was performed in a biphasic system with removal of the inhibiting ketone byproduct obtained from the deaminated amine enantiomer from the aqueous reaction medium . Two years later, the energy barrier that had to be overcome in asymmetric synthesis was addressed (scheme 1, b). The target amine was only observed in <10% yield with use of conventional amine donors, although up to 30% conversion was reached when more elaborate or chiral amines were tested as donors . Subsequently a membrane reactor was employed to minimize inhibition by the ketone in a kinetic resolution . However, none of these developments competed in any way with the in those days dominant chipros processes, which employ lipases and run at basf . Nevertheless, these initial studies marked a milestone in the biocatalytic approach to chiral amines and represent the finding and the identification of the hurdles that had to be jumped in order to achieve versatile and applicable synthetic processes . At the beginning of the millennium, these initial studies began to attract the attention of several other researchers in the biocatalytic field . Various groups focused on the asymmetric synthesis of amines with the aid of -transaminases 50 years after the first finding of this class of enzymes . The main challenge in the amination of ketones with alanine, an amine donor widely accepted by the enzymes, is the unfavorable equilibrium constant (e.g., for the transamination of acetophenone with alanine an equilibrium constant of 8.81 10 has been determined)., this means that the equilibrium is far on side of the starting materials and only very small amounts of the desired amine product are obtained (usually <5%). Using an excess of the amine donor was only effective for selected substrates . For instance, 4-methoxyphenylacetone was transformed into the desired amine with 94% conversion with use of a 16-fold excess of alanine, but most other substrates gave generally rather poor levels of conversion . Using other amine donors (e.g., 1-aminotetralin) improved the levels of conversion slightly, but no general approach could be identified and most case studies reported highly substrate - dependent transamination reactions . A first efficient method for equilibrium displacement was the removal of pyruvate the co - product formed from the amine donor alanine by use of a lactate dehydrogenase (ldh). The ldh converts the pyruvate into lactic acid at the expense of nadh (nicotinamide adenine dinucleotide). For the recycling of nadh a glucose dehydrogenase (gdh) in combination with glucose is used nowadays (scheme 1, b, pathway i). The reaction conditions, such as the ph range of the transaminase and the recycling enzyme, must be compatible and a ph shift due to the formed byproduct (e.g., gluconic acid) has to be considered . In another approach a pyruvate decarboxylase removes the pyruvate co - product (scheme 1, b, pathway ii). The formed pyruvate is decarboxylated and the equilibrium is pulled to the product side, delivering the amine in average to good yields (results are comparable to those obtained with the ldh system). A significant drawback of this approach is the formation of acetaldehyde through the decarboxylation process, because acetaldehyde competes with the substrate to be aminated, leading to ethylamine as side product . Other efforts focused on the physical removal of the formed co - product . By using 2-propylamine as amine donor and running the reaction at elevated temperatures, the co - product acetone can be removed by evaporation . High levels of conversion as well as perfect enantioselectivities can be obtained (scheme 1, b, pathway iii). [5a],[13b], to avoid high concentrations of possibly disruptive co - products, recycling of pyruvate to alanine with the aid of an alanine dehydrogenase was envisioned . This recycles the formed pyruvate back to l - alanine at the expense of ammonia and nadh (see scheme 1, b, pathway iv). Recycling of the nicotinamide cofactor was achieved by employing ammonium formate (which additionally also serves as a nitrogen source) and a formate dehydrogenase (fdh). If the complete reaction sequence is considered, this approach constitutes a formal asymmetric reductive amination at the expense of ammonia and formate, yielding chiral primary amines. [13b], in the parlance of conventional organic chemistry, this approach represents a biocatalytic, asymmetric version of the leuckart wallach reaction, a highly efficient reaction frequently used to access amines . It is worth noting that the transition - metal - catalyzed version of the same reaction uses precious rhodium catalysts that either give mixtures of the primary amine, the corresponding alcohol, and the carbamate, or require expensive ligand systems . The outlined biocatalytic version delivered the chiral amines in high yields (mainly> 90%) and with perfect stereoselectivies as the sole products after extraction . Very recently the amination of ketones just at the expense of nh3 and molecular hydrogen was described, with a related system in which fdh / formate were substituted by a hydrogenase and molecular hydrogen . The [nife]-dehydrogenase reduces the oxidized nad cofactor to nadh at the expense of h2 (2 bar)., ee 9299) whereas the r - selective transaminations were more sensitive to the reaction conditions (conv . Ee> 99); nevertheless, the [nife]-dehydrogenase is currently not competitive with established methods . These reports brought -transaminases to the attention of the chemical community, because optically pure primary amines became accessible in a single reaction step from the corresponding ketones . However, one of the challenges for this enzyme - catalyzed amination was, and partially still remains, the amination of sterically demanding ketones possessing two bulky substituents (bulky - bulky ketones). Nevertheless, researchers at merck / codexis have subjected an r - selective transaminase from arthrobacter sp . To directed evolution to provide a variant that accepts bulky - bulky substrates . They successfully applied it to an improved and more efficient production of sitagliptin (2, figure1), and outperformed the previously established transition - metal - catalyzed process by significantly shortening the synthetic route to this important drug in diabetes treatment (for details see section 5.2). An -transaminase variant produced by directed evolution enabled the stereoselective amination of a bulky - bulky ketone for the production of sitagliptin (2), a drug used in the treatment of type ii diabetes . Unfortunately, no s - selective transaminase that generally accepts such bulky - bulky ketones has yet been described; nevertheless, initial attempts have been made to engineer an s - selective transaminase, extending the tolerance from methyl to propyl and hydroxymethyl . Therefore, further efforts to generate s - selective variants could have a significant impact, because a more general and broadly applicable concept for the biocatalytic asymmetric amination of ketones would be established . Notably, -transaminases can be exploited for regioselective conversion of a single ketone moiety in a di- or even triketone system in a more complex molecule . This regioselective approach has been applied to the asymmetric synthesis of all four diastereoisomers of dihydropinidine (scheme 2, a). The diastereoselective reduction of the imine precursor can subsequently be achieved by use either of pd / c in the presence of hydrogen (cis diastereoisomers) or of lialh4 in the presence of a lewis acid (e.g., et3al). C) screening method with a glycine oxidase coupled with a hrp - based colorimetric assay . Another important aspect aside from the shift of the equilibrium is the identification of the appropriate catalyst . Especially when it comes to the creation of variant libraries, fast and reliable detection methods to identify the best catalyst are essential . Alongside other protocols, a protocol involving the lactate dehydrogenase / glucose dehydrogenase system for rapid identification of potential hits among the transaminase enzymes has been reported recently . The change in the ph due to the acidic coproduct can be monitored with an appropriate ph - sensitive dye (e.g., phenol red). Even quantitative results can be read out from 96-well microtiter plates with a plate reader . In another approach the amine donor ortho - xylylenediamine (3a) gives the corresponding aminoaldehyde 3b, which spontaneously undergoes a 5-exo - trig cyclization (scheme 2, b). The isoindole polymerizes, resulting in colored derivatives and thus simplifying the identification of positive hits in the tested library . It is noteworthy that, because the amine donor spontaneously undergoes the outlined degradation after reaction, no other system is required to shift the equilibrium . In another approach a direct uv - based assay for the detection of acetophenone (= 12 mm cm at 245 nm) was envisaged . With this assay, reaction conditions can be optimized very quickly . Nevertheless, the method is substrate - dependent and suffers from interference with the aromatic amino acid residues of the protein . In another assay using glyoxylate as the amine acceptor, the formed glycine was oxidized back to glyoxylate by a glycine oxidase (scheme 2, c). The formed hydrogen peroxide was detected by a colorimetric assay based on horseradish peroxidase (hrp). This approach allows the quick identification of active enzymes, especially because it can be employed as a solid - phase test by use of nitrocellulose membranes . The first r - selective -transaminases described by academia were identified by a computational approach . The crucial amino acids for catalysis having been determined, the brookhaven protein database (pdb) was screened electronically . By that subtle approach seventeen r - selective -transaminases were identified, representing a milestone for the identification of r - selective enzymes, and were then successfully applied for asymmetric synthesis . In another approach to identifying a suitable transaminase quickly, a mix of eight amine donors and seven acceptors was subjected to enzyme transformation in a one - pot procedure . Analysis of the ketone composition after incubation gave a simple overview of which compounds were transformed . This allowed the affinities of the different substrates to the enzymes to be determined quickly, and the catalysts could be arrayed more rapidly with respect to their substrate scope . Another important feature of -transaminases is that they do not only work in buffer but also in organic solvents ., for instance, transaminases work in organic solvents such as methyl tert - butyl ether (mtbe) and isopropyl acetate, with the water activity of the organic solvent used being of high importance for the reaction outcome . In particular, substrates leading to amines, which can form intramolecular hydrogen bonds to a neighboring group, were transformed with high conversion employing a crude enzyme preparation (not immobilized). The stereopreference and -selectivity were not altered in organic media in relation to the results obtained in buffer . Using an immobilized crude enzyme preparation improved the conversion significantly: 1-phenylethylamine, for example, was formed in 87% yield, whereas the system without immobilization gave roughly 40%, even after extended reaction times . Although organic solvents seem to be rather appealing, the formation of the imine between, for example, the substrate ketone and amine donor in an additional equilibrium reaction has to be considered . Aldehydes are superb substrates too and have in particular been aminated in cascade reactions, in which they were formed as reactive intermediates by another biocatalyst through oxidation of a primary alcohol . For example, galactose oxidase from fusarium nrrl 2903 was used to oxidize allylic and benzylic alcohols to the corresponding aldehydes at the expense of innocent molecular oxygen (scheme 3, a). [33a] the reaction sequence was completed by the transamination of the intermediate, yielding the primary amine . All reactions were run simultaneously in one - pot fashion, so all biocatalysts were mutually compatible . In a approach the abstracted hydride of the oxidation step is recycled in the subsequent reductive amination . Thus, an alcohol dehydrogenase (adh) is used to oxidize the primary alcohol to the aldehyde at the expense of nad to give nadh (scheme 3, b). [33c] the formed nadh is reused for the subsequent transamination reaction (recycling of the alanine cofactor), giving back nad for the next oxidation . The result is a redox - self - sufficient process, which formally aminates the alcohol only at the expense of ammonium chloride, circumventing the need for any additional redox reagents . Nadp / nadph = nicotinamide adenine dinucleotide phosphate cofactor (oxidized / reduced form). This approach has been further extended to a biocatalytic system for the preparation of hydrolyzed -caprolactam, the monomer of nylon (scheme 3, c). [33b] this system additionally contained a baeyer again it was shown that all of these biocatalysts function in each other's presence . Comparable chemical approaches require sophisticated transition - metal catalysts, and high temperature and pressure are unavoidable . It is notable that no comparable one - pot route to -caprolactam by chemical approaches has been reported . The biocatalytic sequence to aminate primary alcohols was also extended to secondary alcohols (scheme 3, d, table 1). However, the lower reactivity of the transaminase towards the ketone, as well as the additional complexity due to a chiral starting material, required more elaborate enzymatic systems in order to achieve good levels of conversion . Either a nadh oxidase (nox) or adh/-ta - catalyzed amination of sec - alcohols conversion was determined by gc - fid . Recent studies have established the potential of -transaminases for the dynamic kinetic resolution of -chiral 2-phenylpropanals, which are converted into the corresponding -chiral amines . The stereocenter of the aldehyde precursor is prone to racemization under the reaction conditions, so up to full conversion can be obtained with ee values up to 98% (scheme 4). The enzyme immobilized on polymeric methacrylate beads was shown to be a perfect catalytic system: pumping the substrate, dissolved in mtbe, over the immobilized catalyst gave good yields of the corresponding enantiopure amine . The levels of conversion were almost constant, even over a reaction time of 10 days . However, the long residence times (tr = 3060 min) and the limited cartridge size (0.5 ml volume) at substrate concentrations of 2550 mm resulted in a productivity of the process of only 50 mol h (corresponds to 12 mmol within 10 d). Nevertheless, the proof of the concept and the successful implementation of -transaminases into a flow process have been provided . To allow a general understanding of the mode of the transamination, the mechanism is discussed below . The crucial molecule for the reaction is the cofactor plp (1), together with its reductively aminated form pmp (5, pyridoxamine 5-phosphate). In its resting state, plp (1) forms a schiff base with a lysine residue in the enzyme backbone (a in scheme 5). The c = n bond of the schiff base is attacked by the substrate amine, leading to imine formation between substrate amine and plp (b). This attack is facilitated by a water molecule in the active site and the phenolic oxygen of the plp (1) molecule . The phenolic hydroxy group in the ortho - position stabilizes the schiff base in both cases through a hydrogen bond . A suitably orientated lysine residue then abstracts the proton at the amine carbon, which has become more acidic due to the imine formation, formally creating a carbanion . The proton abstraction initiates isomerization to the resonance methide form (d), which is quenched and rearomatized by the proton of the base from the first deprotonation step (structure e). The newly formed imine is hydrolyzed, releasing the ketone product and an enzyme - pmp complex (f), which is ready for transferring the amino group to another ketone substrate by the reverse pathway, because all steps in the mechanism are reversible . The outlined mechanism has recently been investigated by dft calculations on an active site model, which led to similar conclusions . Mechanism of the deamination (clockwise) and amination (anticlockwise) process with alanine as amine donor and pyruvate as amine acceptor, respectively . A very important feature of the cofactor is its pyridine nitrogen, because the heterocycle, especially in its protonated form, can stabilize the postulated methide form (d) of the cofactor, which is required for efficient catalysis . For example, if deaza - plp (6) is used as cofactor, the enzymatic activity drops by four to nine orders of magnitude . This also reveals another mechanistic detail, because the reaction can be tuned by the strength of the corresponding acid, which protonates the cofactor, allowing nature to adjust the reactivity of the enzyme in question ., the substrate binding in terms of chiral information transfer is based on a large (l) pocket and a small (s) pocket in the active site (see figure2). The basic residue that assists the 1,3-prototropic shift is usually the amine arm of a lysine, which also binds the plp cofactor prior to the entry of the substrate into the active site . B) active site of the -ta from pseudomonas putida with pre - optimized, docked substrate - plp complex [pdb entry 3a8u, picture was prepared with pymol (vs. 0.99rc6)]. These mechanistic investigations have also triggered interest in biomimetic catalytic systems, leading to investigation of an asymmetric transamination catalyzed by chiral lewis acids (e.g., compound 7), albeit with low enantioselectivities (<46% ee, scheme 6). Mimicking transamination with a plp - like amine donor and chiral lewis acid catalyst 7 . Recent x - ray structures of various transaminases and the understanding of the substrate binding have opened the door for rational protein engineering . For example, two variants of the v. fluvialis transaminase that can convert bulky - bulky ketones were developed (although only a narrow substrate spectrum was presented). The key mutations were two amino acid residues in the small pocket of the active site: a valine was changed to an alanine and a tyrosine was mutated to phenylalanine . Through these mutations the same enzyme was used to convert 3-methylcyclohexan-1-one into the corresponding amines (for details see scheme 7 and section 5.1). The wild - type enzyme showed only modest diastereoselectivity (14% de), whereas the l56v variant of the enzyme gave the (r)-amine with 66% de . Even more interesting was the fact that changing the same leucine for isoleucine (l56i) inverted the stereopreference towards the (s)-amine, with 70% de . Combination of an enoate reductase (ered) and an -ta for the preparation of all stereoisomers of 1-amino-3-methylcyclohexanes . Thanks to the broad substrate scope of -transaminases (-tas), their usually high turnover rate, and their remarkable stereoselectivity, along with their environmentally friendly reaction setups, -tas are considered a convenient alternative to classical chemical approaches for the asymmetric synthesis of valuable amine building blocks and bioactive compounds . -ta - catalyzed reactions represent key steps in a wide range of chemo - enzymatic syntheses and, thanks to their compatibility with other enzymes, they are often employed in multiple - enzyme cascade reactions . In the last few years, -ta - catalyzed reactions have been combined with other enzymatic transformations in concurrent one - pot processes for the preparation of highly functionalized molecules. [1b], such multi - enzymatic cascades offer various advantages, such as shortened reaction times and a reduced number of workup steps, allowing high atom - efficiency . -tas have been combined, for example, with an enoate reductase for the synthesis of 3-methyl - cyclohexylamines amines containing two stereocenters . Through the employment of an engineered -ta in the presence of an organic co - solvent (30% dmso) a diastereoselective reduction / transamination sequence was successfully performed in one - pot fashion (89% de max . -tas have also been successfully combined with other biocatalysts such as transketolases, lyases, and hydrolases with particular regard to the formation and cleavage of c c bonds . In a recent example, an -ta was applied together with a thiamine - diphosphate - dependent (thdp - dependent) transketolase in two sequential steps for the production of various amino alcohols on a preparative scale (100 ml, 300 mm substrate concentration). Vicinal amino alcohols are highly valuable intermediates for various pharmaceutical compounds as well as synthons in organic syntheses . Therefore, this cascade was employed for the preparation of the drugs (1r,2r)-norpseudoephedrine (npe, 10) and (1r,2s)-norephedrine (ne, 10) by starting from the inexpensive substrates pyruvate and benzaldehyde (scheme 8, a). In the first step these two molecules were coupled together by the thdp - dependent lyase acetohydroxyacid synthase i (ahas - i) to yield (r)-phenylcarbinol (11). This intermediate keto alcohol was then directly aminated by one of two stereocomplementary -tas, giving access either to (1r,2r)-npe or to (1r,2s)-ne in high yields and with perfect optical purity . The coproduct pyruvate which is produced in the transamination reaction was removed through its consumption as the substrate in the first reaction step . One - pot, two - step cascade for the synthesis of various diastereomers of norpseudoephedrine (npe) and norephedrine (ne) by combining either a) a thdp - dependent lyase (ahas - i) with stereocomplementary -tas, or b) an s - selective -ta with stereocomplementary adhs . C) preparation of all four diastereoisomers of 1,3-amino alcohol 52 . However, this approach is not suitable for the preparation of the complementary (1s,2s)-10 or (1s,2r)-10, because of the lack of an enzyme that affords (s)-11 with sufficient optical purity . As a consequence, a recent report provides an alternative reaction sequence to overcome this limitation . 1-phenylpropane-1,2-dione (12) was used as starting material and was converted into all four n(p)e isomers in two sequential steps by combining an -ta and an adh . Thereby, full stereochemical control was achieved through the stereopreferences of the two enzymes (scheme 8, b). Very recently, 1,3-amino alcohols were accessed by oxidative kinetic resolution of keto alcohol 50 by a ketoreductase in the first step (scheme 8, c). Subsequent transamination with the appropriate biocatalyst yielded each of the four diastereomers of 52 in optically pure form . Another concept involves the stereoselective hydrolytic c c bond cleavage of prochiral bicyclic -diketones by a hydrolase . After bond cleavage as the first step, the esterification of the newly formed free acid with meoh is catalyzed by a cal - b lipase . Subsequently, an -ta converts the ketone moiety into the corresponding amine with perfect diastereoselectivity in the final step of the three - step cascade . By this approach the corresponding cyclohexylamines could be obtained in either cis or trans configurations in moderate to high yields (scheme 9). Diastereoselective synthesis of 3-substituted cyclohexylamines by a three - step cascade sequence employing two hydrolases and an -ta . Multi - enzymatic cascades also play a significant role in the deracemization of rac - amines . One example of such a deracemization is the combination of two stereocomplementary -tas in a one - pot, two - step fashion, which was successfully applied for the preparation of a broad range of -chiral amines in optically pure form (scheme 10, a). A) one - pot, two - step cascade employing two stereocomplementary -tas for the deracemization of racemic amines . B) the procedure was successfully applied for the preparation of both enantiomers of mexiletine (13). Firstly, an r - selective -ta transformed one enantiomer into the corresponding ketone, whereas the s enantiomer remained untouched . In this process pyruvate had to be employed in stoichiometric amounts, serving as an amine acceptor and forming d - alanine as byproduct . After 24 h a second, s - selective -ta was added in order to convert the obtained ketone into the (s)-amine, thus leading to a single enantiomer . Because the order of the -tas can be inverted, both enantiomers can be prepared with high yields and perfect stereoselectivities . In initial studies, this one - pot stepwise deracemization methodology only yielded good results when the biocatalyst from the first reaction step was inactivated by heat treatment after the kinetic resolution had been completed . Otherwise it interfered with the stereocomplementary -ta in the second step and therefore the optical purity of the final amine product was decreased . The applicability of this procedure was demonstrated for the deracemization of the antiarrhythmic drug mexiletine (13) on preparative scale (100 mg). In order to circumvent the heat deactivation procedure, the first step of the cascade was performed with an immobilized -ta (solid support: sol - gel / celite matrix) in a subsequent study . The first enzyme can then be removed by simple filtration after the first reaction step and the economically unviable decomposition of the catalyst can be avoided . To reduce the amount of pyruvate required for the first step (kinetic resolution) an amino acid oxidase (l- or d - aao) was introduced to catalyze the recycling of the formed l- or d - alanine to pyruvate ., this minimizes the amount of the co - substrate to catalytic amounts and improves the overall efficiency of the reaction (scheme 10, b). Nevertheless, an approach that allows the interference of the stereocomplementary enzymes to be avoided relies on a correct and smart selection of the amine acceptor / donor system . By using -ketoglutarate instead of pyruvate as amine acceptor for the s - selective catalyst both the deamination and amination steps can be performed simultaneously, because -ketoglutarate is not accepted by the r - selective -ta . The s enantiomer of the racemic amine is selectively oxidized by a monoamine oxidase to the corresponding imine . Subsequently, the ketone intermediate is converted into the (r)-amine by an -ta (scheme 11, a). The benzylic position of the secondary amine was oxidized to produce the imine, which was again hydrolyzed to afford the corresponding carbonyl functionality . The latter is then reaminated by an appropriate -ta (scheme 11, b). A) cascade reaction combining a monoamine oxidase (mao) and an -ta for the deracemization of 1-phenylethylamine derivatives, based on the rapid hydrolysis of imines . B) dealkylation of sec - amines through the action of a mao and an -ta . Various cascades combining the oxidation of an alcohol with a subsequent -ta - catalyzed amination step have been developed . For example, an oxidation / transamination cascade via an aldehyde intermediate was developed for the preparation of benzylic amines (vide supra; see scheme 3, a). Various benzylic alcohols (50 mm substrate concentration) were successfully transformed into the corresponding amines, and the practical applicability of this enzymatic cascade reaction was also shown in the synthesis of the antifungal compound naftifine (8, figure3). [33a] the already mentioned borrowing hydrogen approach (scheme 3, b) achieved in a redox - self - sufficient cascade is based on the oxidation of the alcohol by an adh and has been employed, for example, for the diamination of 1,-diols. [33c] the amination of decane-1,10-diol was performed successfully on preparative scale (126 mg) in 70% isolated yield . . Another successful application of an oxidation / transamination cascade has been reported for the conversion of the diol isosorbide (9, figure3) originating from renewable resources . The redox - self - sufficient oxidation / transamination cascades have been improved by co - expression of the three required enzymes (adh, -ta, and ala - dh) in a single e. coli host . The applicability of the single - cell catalyst was demonstrated in the amination of aliphatic and aromatic mono- and dialcohols . Because this concept simplifies the catalyst preparation, it represents a more practicable and economic approach . A single - cell catalyst has also been used for the -functionalization of fatty acids in an in vivo one - pot, three - step cascade (scheme 12). The -position of the fatty acid was hydroxylated by a monooxygenase (alkbgt), which also oxidized the primary alcohol to the corresponding aldehyde, but also to the corresponding acid . In the presence of an -ta, this process was successfully transferred to a pilot plant by evonik industries in 2013; it yielded -aminolauric acid, which is the monomer of a sustainable high - performance plastic . In vivo three - step cascade for the terminal amino - functionalization of fatty acids by an alkane monooxygenase (alkbgt) and an -ta . A cascade process can also be based on a subsequent spontaneous chemical reaction that shifts the thermodynamically disfavored amination reaction to completion by removing the product(s) from the reaction mixture . In this context, a transamination / lactamization cascade has been successfully applied for the synthesis of various chiral heterocycles . The initial reductive amination of carbonyl compounds is followed by spontaneous ring closure to afford the corresponding lactams (scheme 13). By this approach, the amination of ethyl 4-acetylbutyrate (14) was accomplished at a concentration of 50 g l, and after cyclization of the intermediate amino ester the product 6-methylpiperidin-2-one (15) was obtained optically pure in> 90% isolated yield . Amination / lactamization cascade for the preparation of 6-methylpiperidin-2-one (15) in high isolated yield and in enantiopure form . These cascades based on the spontaneous subsequent cyclization of the amine product represent highly efficient and scalable methodologies because the equilibrium is driven towards the product side without a significant excess of the amine donor . The combination of biocatalytic steps with common chemical transformations has been increasingly considered for manufacturing routes to various building blocks and pharmaceuticals. [1c], often these chemo - enzymatic routes represent scalable, cost - efficient, and green alternatives, with fewer synthetic steps, reduced waste production, and an improved overall synthetic efficiency . Consequently, -ta - catalyzed reactions have already been integrated into classical synthetic routes, resulting in highly successful chemo - enzymatic processes for the preparation of several chiral intermediates and active pharmaceutical ingredients (apis). One of the first published examples of a chemo - enzymatic route including an -ta - catalyzed amination step was the preparation of the anticholinergic agent (s)-rivastigmine (16), a potent cholinesterase inhibitor used for the treatment of alzheimer's or parkinson's disease . The drug was prepared and isolated in 71% overall yield through a short reaction sequence including the -ta - catalyzed amination of the ketone precursor 17 (45 mm substrate concentration, 100 mg scale) to afford the chiral amine moiety 18, representing the synthetic key step (scheme 14, a). Chemo - enzymatic routes involving -ta - catalyzed key steps for the synthesis of a) the anticholinergic agent (s)-rivastigmine, b) the antidiabetic therapeutic sitagliptin, c) imagabalin, and d) the antiarrhythmic drug vernakalant . The most prominent transamination - based process implemented on industrial scale, and hence a benchmark in the biocatalytic research field, was the synthesis of the antidiabetic drug sitagliptin (2). Directed evolution provided an enzyme that was able to accept the sterically demanding ketone and to tolerate increased concentrations of organic co - solvents (e.g., dmso) and higher temperatures . The combination of these improvements led to a reductive amination of 19, a prositagliptin ketone precursor, at elevated substrate concentration (200 g l) with 2-propylamine as amine donor . The target amine 2 was obtained in 9095% overall yield and in optically pure form (ee> 99%, scheme 14, b). An -ta was also engineered in order to adapt it to the demand for a process for the preparation of (3s,5r)-ethyl 3-amino-5-methyloctanoate (20), a precursor of imagabalin (21, scheme 14, c) and the antiarrhythmic compound (1r,2r)-vernakalant (22, scheme 14, d). In the latter example, directed evolution was used to provide an -ta with inverted diastereoselectivity, and a high selectivity for the recognition of the adjacent chiral center was achieved . Careful choice of the right reaction conditions enabled the racemization of the chiral center to the ketone, leading to a dynamic kinetic resolution and the formation of the desired trans isomer with excellent enantio- and diastereoselectivity (> 99:1 dr,> consequently, this transamination represents the asymmetric key reaction in a five - step chemo - enzymatic route leading to vernakalant (22, 56% overall yield). Identically to the sitagliptin (2) process, 2-propylamine turned out to be the ideal amine donor . However, in some cases the basicity of 2-propylamine has led to side reactions . For instance, a careful choice of amine donor was necessary for the asymmetric key step in the chemo - enzymatic synthesis of the antiallergic drug ramatroban (23, scheme 15, a). Use of the basic 2-propylamine led to enol / enamine formation, followed by oxidation in air to afford the corresponding energetically favored aromatic system . However, by employing the sterically more demanding (r)-1-phenylethylamine (24) as amine donor, the formation of side products could be decreased dramatically and, moreover, the thermodynamic equilibrium was shifted towards the product side even with smaller amounts of amine donor . By this approach the amine intermediate 25 on the synthetic path to ramatroban (23) was prepared successfully on preparative scale (0.5 g) in 96% isolated yield and enantiopure form . This substituted three steps of the previous chemo - enzymatic synthesis, which used lipase- or oxidoreductase - based techniques . Reductive amination of the ketone precursors to a) the antiallergic drug ramatroban (23), and b) the jak2 kinase inhibitor azd1480 (27) by employing -tas and the sterically more demanding 1-phenylethylamine as amine donor . The excellent thermodynamic properties of 1-phenylethylamine (24) as amine donor were also exploited for the multigram preparation of (s)-1-(5-fluoropyrimidin-2-yl)ethanamine (26, 500 g, 20 l scale), a valuable precursor for the synthesis of the janus kinase 2 (jak2) inhibitor azd1480 (27, scheme 15, b). The ketone precursor 28 was aminated by use of an s - selective -ta from v. fluvialis . In order to avoid inhibition due to the high substrate concentration (0.35 m), toluene was added as a co - solvent, resulting in a 97% yield of the target amine 26 . This -ta - catalyzed transformation was integrated into a recently proposed chemo - enzymatic long - term manufacturing route to the jak2 kinase inhibitor azd1480 (27) as a promising alternative to the classical route, showing again the great potential of the combination of bio- and chemocatalysis. [72a] as already mentioned, amination / lactamization cascades or, more generally, amination / cyclization cascades initiated by an -ta - catalyzed step are quite efficient and have therefore been used in various chemo - enzymatic synthetic routes . For instance, biologically active -aminobutyric acid (gaba) derivatives such as 29, which play an important role in nervous system functions, were prepared by this approach (scheme 16, a). A) amination / lactamization cascade initiated by an -ta - catalyzed step giving access to valuable lactams such as 4-phenylpyrrolidin-2-one, a precursor of gaba derivatives . B) the practical applicability of this cascade was shown in the chemo - enzymatic synthesis of the api niraparib . Another application of that strategy has been reported for the preparation of niraparib (30), an inhibitor of the poly(adp - ribose)polymerase involved in numerous cellular processes . Thorough the employment of an -ta - catalyzed dynamic kinetic resolution starting from the racemic open - chain aldehyde 31, the (r)-lactam 32 [chiral building block for niraparib (30)] was obtained on preparative scale (35 g) with high yields (82%) and stereoselectivity (scheme 16, b). Because of the low stability of aldehyde 31 during the preliminary experiments, the transamination step was alternatively performed by starting from bisulfite adduct 33 . This aldehyde surrogate is more stable and liberates the corresponding aldehyde 31 in situ under the basic conditions of the transaminase reaction, resulting in an 84% yield of (r)-lactam 32 . Using the aldehyde surrogate 33 improved the robustness and reliability of the process, making it suitable for large - scale applications . A similar amination / lactamization concept was exploited for the dual orexin receptor antagonist mk-6096 (34), used for the treatment of insomnia (scheme 17, a). The preparation of this therapeutic agent was accomplished on a kilogram scale, leading to 1.2 kg of mk-6096 (34) in nine steps with an overall yield of 13% . In the asymmetric key step, which builds up the -methylpiperidine core 35, the keto diester substrate 36 is converted through an -ta - catalyzed transamination reaction into the corresponding amino diester 37 (5057 g l). In addition to the already favorable thermodynamic equilibrium due to the lactamization step, product formation was further supported by removing the pyruvate byproduct through the action of the ldh / gdh system . Chemo - enzymatic syntheses for the preparation of the dual orexin receptor antagonists a) mk-6096 (34), and b) suvorexant (38), each involving an -ta - catalyzed amination / cyclization step . Suvorexant (38), another dual orexin receptor antagonist already in phase iii clinical trials for the therapy of primary insomnia, has also been produced on a multigram scale by a chemo - enzymatic route including a similar amination / cyclization step (scheme 17, b). A key feature of this compound is the core chiral diazepane ring, which was obtained through the stereoselective amination of ketone precursor 39 by use of the -ta variant from merck / codexis followed by a spontaneous cyclization of the unstable amino mesylate intermediate 40 . In order to avoid the formation of various side products in the cyclization step, a thorough optimization of the ph and the leaving group had to be performed, ultimately giving the 1,4-diazepane ring 41 in good yield and perfect enantiopurity . In this context the amination / imination cascade sequence already described above (see scheme 2, a) leading to dihydropiperidines should be mentioned, because it represents a similar amination / cyclization approach. [22b] nevertheless, standard reactions conditions were used, and no investigations of a potential beneficial effect of the spontaneous cyclization were reported . Besides the synthesis of natural alkaloids, -tas have also proven to be suitable catalysts for the enzymatic synthesis of 17-aminosteroids (scheme 18), which are used as intermediates in the preparation of biologically active steroidal derivatives . Another example showing the potential of combining classical chemical transformations with biocatalytic steps for the development of more scalable and cost - efficient manufacturing routes is the chemo - enzymatic synthesis of the crth2 antagonist mk-7246 (42, scheme 19, a). This compound was reported to be a potential therapeutic agent for the treatment of respiratory diseases . The previous chemical route, consisting of eighteen steps with a 10% overall yield, was optimized by introducing a direct transformation of the ketone precursor 43 into the desired chiral amine 44 by an -ta with excellent stereoselectivity . Consequently, the number of required reaction steps was reduced to nine, starting from commercially available materials . Without the need for any chromatographic purifications the product was obtained in 49% overall yield, thus representing a quite efficient process optimization amenable to pilot - plant scale production . -ta - catalyzed key steps of chemo - enzymatic routes for the manufacture of a) the antiallergic crth2 antagonist mk-7246 (42), b) the anticarcinogenic smoothened receptor (smo) inhibitor 45, and c) the silodosin intermediate 49 . Another concise asymmetric synthesis involving a transamination step has been developed recently for the large - scale commercial supply of compound 45, a smoothened receptor (smo) inhibitor and a new therapeutic for the treatment of a broad range of human cancers . The challenging key step of the synthesis was the establishment of the anti stereocenters on the 2- and 4-positions of the piperidine ring . By means of an -ta - catalyzed transamination of the 4-piperidone precursor 46, both centers the required c-4 amino functionality as well as the anti - configured c-2 stereocenter were generated simultaneously through a dynamic kinetic resolution process . The targeted anti - amine intermediate 47 was obtained in> 10:1 dr and 99% ee in a single step, and therefore the smo inhibitor 45 was prepared in only five steps with 40% overall yield, representing a highly attractive alternative route (scheme 18, b). An enzyme - catalyzed transamination was also considered for the preparation of the amine 49, an intermediate on the pathway to the pro - drug silodosin (48), which is used for the treatment of dysuria and urinary disturbance (scheme 18, c). In the last few years, -ta - catalyzed reactions have been combined with other enzymatic transformations in concurrent one - pot processes for the preparation of highly functionalized molecules. [1b], such multi - enzymatic cascades offer various advantages, such as shortened reaction times and a reduced number of workup steps, allowing high atom - efficiency . -tas have been combined, for example, with an enoate reductase for the synthesis of 3-methyl - cyclohexylamines amines containing two stereocenters . Through the employment of an engineered -ta in the presence of an organic co - solvent (30% dmso) a diastereoselective reduction / transamination sequence was successfully performed in one - pot fashion (89% de max ., scheme 7,b). -tas have also been successfully combined with other biocatalysts such as transketolases, lyases, and hydrolases with particular regard to the formation and cleavage of c, an -ta was applied together with a thiamine - diphosphate - dependent (thdp - dependent) transketolase in two sequential steps for the production of various amino alcohols on a preparative scale (100 ml, 300 mm substrate concentration). Vicinal amino alcohols are highly valuable intermediates for various pharmaceutical compounds as well as synthons in organic syntheses . Therefore, this cascade was employed for the preparation of the drugs (1r,2r)-norpseudoephedrine (npe, 10) and (1r,2s)-norephedrine (ne, 10) by starting from the inexpensive substrates pyruvate and benzaldehyde (scheme 8, a). In the first step these two molecules were coupled together by the thdp - dependent lyase acetohydroxyacid synthase i (ahas - i) to yield (r)-phenylcarbinol (11). This intermediate keto alcohol was then directly aminated by one of two stereocomplementary -tas, giving access either to (1r,2r)-npe or to (1r,2s)-ne in high yields and with perfect optical purity . The coproduct pyruvate which is produced in the transamination reaction was removed through its consumption as the substrate in the first reaction step . One - pot, two - step cascade for the synthesis of various diastereomers of norpseudoephedrine (npe) and norephedrine (ne) by combining either a) a thdp - dependent lyase (ahas - i) with stereocomplementary -tas, or b) an s - selective -ta with stereocomplementary adhs . C) preparation of all four diastereoisomers of 1,3-amino alcohol 52 . However, this approach is not suitable for the preparation of the complementary (1s,2s)-10 or (1s,2r)-10, because of the lack of an enzyme that affords (s)-11 with sufficient optical purity . As a consequence, a recent report provides an alternative reaction sequence to overcome this limitation . 1-phenylpropane-1,2-dione (12) was used as starting material and was converted into all four n(p)e isomers in two sequential steps by combining an -ta and an adh . Thereby, full stereochemical control was achieved through the stereopreferences of the two enzymes (scheme 8, b). Very recently, 1,3-amino alcohols were accessed by oxidative kinetic resolution of keto alcohol 50 by a ketoreductase in the first step (scheme 8, c). Subsequent transamination with the appropriate biocatalyst yielded each of the four diastereomers of 52 in optically pure form . Another concept involves the stereoselective hydrolytic c c bond cleavage of prochiral bicyclic -diketones by a hydrolase . After bond cleavage as the first step, the esterification of the newly formed free acid with meoh is catalyzed by a cal - b lipase . Subsequently, an -ta converts the ketone moiety into the corresponding amine with perfect diastereoselectivity in the final step of the three - step cascade . By this approach the corresponding cyclohexylamines could be obtained in either cis or trans configurations in moderate to high yields (scheme 9). Diastereoselective synthesis of 3-substituted cyclohexylamines by a three - step cascade sequence employing two hydrolases and an -ta . Multi - enzymatic cascades also play a significant role in the deracemization of rac - amines . One example of such a deracemization is the combination of two stereocomplementary -tas in a one - pot, two - step fashion, which was successfully applied for the preparation of a broad range of -chiral amines in optically pure form (scheme 10, a). A) one - pot, two - step cascade employing two stereocomplementary -tas for the deracemization of racemic amines . B) the procedure was successfully applied for the preparation of both enantiomers of mexiletine (13). Firstly, an r - selective -ta transformed one enantiomer into the corresponding ketone, whereas the s enantiomer remained untouched . In this process pyruvate had to be employed in stoichiometric amounts, serving as an amine acceptor and forming d - alanine as byproduct . After 24 h a second, s - selective -ta was added in order to convert the obtained ketone into the (s)-amine, thus leading to a single enantiomer . Because the order of the -tas can be inverted, both enantiomers can be prepared with high yields and perfect stereoselectivities . In initial studies, this one - pot stepwise deracemization methodology only yielded good results when the biocatalyst from the first reaction step was inactivated by heat treatment after the kinetic resolution had been completed . Otherwise it interfered with the stereocomplementary -ta in the second step and therefore the optical purity of the final amine product was decreased . The applicability of this procedure was demonstrated for the deracemization of the antiarrhythmic drug mexiletine (13) on preparative scale (100 mg). In order to circumvent the heat deactivation procedure, the first step of the cascade was performed with an immobilized -ta (solid support: sol - gel / celite matrix) in a subsequent study . The first enzyme can then be removed by simple filtration after the first reaction step and the economically unviable decomposition of the catalyst can be avoided . To reduce the amount of pyruvate required for the first step (kinetic resolution) an amino acid oxidase (l- or d - aao) was introduced to catalyze the recycling of the formed l- or d - alanine to pyruvate ., this minimizes the amount of the co - substrate to catalytic amounts and improves the overall efficiency of the reaction (scheme 10, b). Nevertheless, an approach that allows the interference of the stereocomplementary enzymes to be avoided relies on a correct and smart selection of the amine acceptor / donor system . By using -ketoglutarate instead of pyruvate as amine acceptor for the s - selective catalyst both the deamination and amination steps can be performed simultaneously, because -ketoglutarate is not accepted by the r - selective -ta . The s enantiomer of the racemic amine is selectively oxidized by a monoamine oxidase to the corresponding imine . Subsequently, the ketone intermediate is converted into the (r)-amine by an -ta (scheme 11, a). The benzylic position of the secondary amine was oxidized to produce the imine, which was again hydrolyzed to afford the corresponding carbonyl functionality . The latter is then reaminated by an appropriate -ta (scheme 11, b). A) cascade reaction combining a monoamine oxidase (mao) and an -ta for the deracemization of 1-phenylethylamine derivatives, based on the rapid hydrolysis of imines . B) dealkylation of sec - amines through the action of a mao and an -ta . Various cascades combining the oxidation of an alcohol with a subsequent -ta - catalyzed amination step have been developed . For example, an oxidation / transamination cascade via an aldehyde intermediate was developed for the preparation of benzylic amines (vide supra; see scheme 3, a). Various benzylic alcohols (50 mm substrate concentration) were successfully transformed into the corresponding amines, and the practical applicability of this enzymatic cascade reaction was also shown in the synthesis of the antifungal compound naftifine (8, figure3). [33a] the already mentioned approach (scheme 3, b) achieved in a redox - self - sufficient cascade is based on the oxidation of the alcohol by an adh and has been employed, for example, for the diamination of 1,-diols. [33c] the amination of decane-1,10-diol was performed successfully on preparative scale (126 mg) in 70% isolated yield . Another successful application of an oxidation / transamination cascade has been reported for the conversion of the diol isosorbide (9, figure3) originating from renewable resources . The redox - self - sufficient oxidation / transamination cascades have been improved by co - expression of the three required enzymes (adh, -ta, and ala - dh) in a single e. coli host . The applicability of the single - cell catalyst was demonstrated in the amination of aliphatic and aromatic mono- and dialcohols . Because this concept simplifies the catalyst preparation, it represents a more practicable and economic approach . A single - cell catalyst has also been used for the -functionalization of fatty acids in an in vivo one - pot, three - step cascade (scheme 12). The -position of the fatty acid was hydroxylated by a monooxygenase (alkbgt), which also oxidized the primary alcohol to the corresponding aldehyde, but also to the corresponding acid . In the presence of an -ta, this process was successfully transferred to a pilot plant by evonik industries in 2013; it yielded -aminolauric acid, which is the monomer of a sustainable high - performance plastic . In vivo three - step cascade for the terminal amino - functionalization of fatty acids by an alkane monooxygenase (alkbgt) and an -ta a cascade process can also be based on a subsequent spontaneous chemical reaction that shifts the thermodynamically disfavored amination reaction to completion by removing the product(s) from the reaction mixture . In this context, a transamination / lactamization cascade has been successfully applied for the synthesis of various chiral heterocycles . The initial reductive amination of carbonyl compounds is followed by spontaneous ring closure to afford the corresponding lactams (scheme 13). By this approach, the amination of ethyl 4-acetylbutyrate (14) was accomplished at a concentration of 50 g l, and after cyclization of the intermediate amino ester the product 6-methylpiperidin-2-one (15) was obtained optically pure in> 90% isolated yield . Amination / lactamization cascade for the preparation of 6-methylpiperidin-2-one (15) in high isolated yield and in enantiopure form . These cascades based on the spontaneous subsequent cyclization of the amine product represent highly efficient and scalable methodologies because the equilibrium is driven towards the product side without a significant excess of the amine donor . The combination of biocatalytic steps with common chemical transformations has been increasingly considered for manufacturing routes to various building blocks and pharmaceuticals. [1c], often these chemo - enzymatic routes represent scalable, cost - efficient, and green alternatives, with fewer synthetic steps, reduced waste production, and an improved overall synthetic efficiency . Consequently, -ta - catalyzed reactions have already been integrated into classical synthetic routes, resulting in highly successful chemo - enzymatic processes for the preparation of several chiral intermediates and active pharmaceutical ingredients (apis). One of the first published examples of a chemo - enzymatic route including an -ta - catalyzed amination step was the preparation of the anticholinergic agent (s)-rivastigmine (16), a potent cholinesterase inhibitor used for the treatment of alzheimer's or parkinson's disease . The drug was prepared and isolated in 71% overall yield through a short reaction sequence including the -ta - catalyzed amination of the ketone precursor 17 (45 mm substrate concentration, 100 mg scale) to afford the chiral amine moiety 18, representing the synthetic key step (scheme 14, a). Chemo - enzymatic routes involving -ta - catalyzed key steps for the synthesis of a) the anticholinergic agent (s)-rivastigmine, b) the antidiabetic therapeutic sitagliptin, c) imagabalin, and d) the antiarrhythmic drug vernakalant . The most prominent transamination - based process implemented on industrial scale, and hence a benchmark in the biocatalytic research field, was the synthesis of the antidiabetic drug sitagliptin (2). Directed evolution provided an enzyme that was able to accept the sterically demanding ketone and to tolerate increased concentrations of organic co - solvents (e.g., dmso) and higher temperatures . The combination of these improvements led to a reductive amination of 19, a prositagliptin ketone precursor, at elevated substrate concentration (200 g l) with 2-propylamine as amine donor . The target amine 2 was obtained in 9095% overall yield and in optically pure form (ee> 99%, scheme 14, b). An -ta was also engineered in order to adapt it to the demand for a process for the preparation of (3s,5r)-ethyl 3-amino-5-methyloctanoate (20), a precursor of imagabalin (21, scheme 14, c) and the antiarrhythmic compound (1r,2r)-vernakalant (22, scheme 14, d). In the latter example, directed evolution was used to provide an -ta with inverted diastereoselectivity, and a high selectivity for the recognition of the adjacent chiral center was achieved . Careful choice of the right reaction conditions enabled the racemization of the chiral center to the ketone, leading to a dynamic kinetic resolution and the formation of the desired trans isomer with excellent enantio- and diastereoselectivity (> 99:1 dr,> 99% ee). Consequently, this transamination represents the asymmetric key reaction in a five - step chemo - enzymatic route leading to vernakalant (22, 56% overall yield). Identically to the sitagliptin (2) process, 2-propylamine turned out to be the ideal amine donor . However, in some cases the basicity of 2-propylamine has led to side reactions . For instance, a careful choice of amine donor was necessary for the asymmetric key step in the chemo - enzymatic synthesis of the antiallergic drug ramatroban (23, scheme 15, a). Use of the basic 2-propylamine led to enol / enamine formation, followed by oxidation in air to afford the corresponding energetically favored aromatic system . However, by employing the sterically more demanding (r)-1-phenylethylamine (24) as amine donor, the formation of side products could be decreased dramatically and, moreover, the thermodynamic equilibrium was shifted towards the product side even with smaller amounts of amine donor . By this approach the amine intermediate 25 on the synthetic path to ramatroban (23) was prepared successfully on preparative scale (0.5 g) in 96% isolated yield and enantiopure form . This substituted three steps of the previous chemo - enzymatic synthesis, which used lipase- or oxidoreductase - based techniques . Reductive amination of the ketone precursors to a) the antiallergic drug ramatroban (23), and b) the jak2 kinase inhibitor azd1480 (27) by employing -tas and the sterically more demanding 1-phenylethylamine as amine donor . The excellent thermodynamic properties of 1-phenylethylamine (24) as amine donor were also exploited for the multigram preparation of (s)-1-(5-fluoropyrimidin-2-yl)ethanamine (26, 500 g, 20 l scale), a valuable precursor for the synthesis of the janus kinase 2 (jak2) inhibitor azd1480 (27, scheme 15, b). The ketone precursor 28 was aminated by use of an s - selective -ta from v. fluvialis . In order to avoid inhibition due to the high substrate concentration (0.35 m), toluene was added as a co - solvent, resulting in a 97% yield of the target amine 26 . This -ta - catalyzed transformation was integrated into a recently proposed chemo - enzymatic long - term manufacturing route to the jak2 kinase inhibitor azd1480 (27) as a promising alternative to the classical route, showing again the great potential of the combination of bio- and chemocatalysis. [72a] as already mentioned, amination / lactamization cascades or, more generally, amination / cyclization cascades initiated by an -ta - catalyzed step are quite efficient and have therefore been used in various chemo - enzymatic synthetic routes . For instance, biologically active -aminobutyric acid (gaba) derivatives such as 29, which play an important role in nervous system functions, were prepared by this approach (scheme 16, a). A) amination / lactamization cascade initiated by an -ta - catalyzed step giving access to valuable lactams such as 4-phenylpyrrolidin-2-one, a precursor of gaba derivatives . B) the practical applicability of this cascade was shown in the chemo - enzymatic synthesis of the api niraparib . Another application of that strategy has been reported for the preparation of niraparib (30), an inhibitor of the poly(adp - ribose)polymerase involved in numerous cellular processes . Thorough the employment of an -ta - catalyzed dynamic kinetic resolution starting from the racemic open - chain aldehyde 31, the (r)-lactam 32 [chiral building block for niraparib (30)] was obtained on preparative scale (35 g) with high yields (82%) and stereoselectivity (scheme 16, b). Because of the low stability of aldehyde 31 during the preliminary experiments, the transamination step was alternatively performed by starting from bisulfite adduct 33 . This aldehyde surrogate is more stable and liberates the corresponding aldehyde 31 in situ under the basic conditions of the transaminase reaction, resulting in an 84% yield of (r)-lactam 32 . Using the aldehyde surrogate 33 improved the robustness and reliability of the process, making it suitable for large - scale applications . A similar amination / lactamization concept was exploited for the dual orexin receptor antagonist mk-6096 (34), used for the treatment of insomnia (scheme 17, a). The preparation of this therapeutic agent was accomplished on a kilogram scale, leading to 1.2 kg of mk-6096 (34) in nine steps with an overall yield of 13% . In the asymmetric key step, which builds up the -methylpiperidine core 35, the keto diester substrate 36 is converted through an -ta - catalyzed transamination reaction into the corresponding amino diester 37 (5057 in addition to the already favorable thermodynamic equilibrium due to the lactamization step, product formation was further supported by removing the pyruvate byproduct through the action of the ldh / gdh system . Chemo - enzymatic syntheses for the preparation of the dual orexin receptor antagonists a) mk-6096 (34), and b) suvorexant (38), each involving an -ta - catalyzed amination / cyclization step . Suvorexant (38), another dual orexin receptor antagonist already in phase iii clinical trials for the therapy of primary insomnia, has also been produced on a multigram scale by a chemo - enzymatic route including a similar amination / cyclization step (scheme 17, b). A key feature of this compound is the core chiral diazepane ring, which was obtained through the stereoselective amination of ketone precursor 39 by use of the -ta variant from merck / codexis followed by a spontaneous cyclization of the unstable amino mesylate intermediate 40 . In order to avoid the formation of various side products in the cyclization step, a thorough optimization of the ph and the leaving group had to be performed, ultimately giving the 1,4-diazepane ring 41 in good yield and perfect enantiopurity . In this context the amination / imination cascade sequence already described above (see scheme 2, a) leading to dihydropiperidines should be mentioned, because it represents a similar amination / cyclization approach. [22b] nevertheless, standard reactions conditions were used, and no investigations of a potential beneficial effect of the spontaneous cyclization were reported . Besides the synthesis of natural alkaloids, -tas have also proven to be suitable catalysts for the enzymatic synthesis of 17-aminosteroids (scheme 18), which are used as intermediates in the preparation of biologically active steroidal derivatives . Another example showing the potential of combining classical chemical transformations with biocatalytic steps for the development of more scalable and cost - efficient manufacturing routes is the chemo - enzymatic synthesis of the crth2 antagonist mk-7246 (42, scheme 19, a). This compound was reported to be a potential therapeutic agent for the treatment of respiratory diseases . The previous chemical route, consisting of eighteen steps with a 10% overall yield, was optimized by introducing a direct transformation of the ketone precursor 43 into the desired chiral amine 44 by an -ta with excellent stereoselectivity . Consequently, the number of required reaction steps was reduced to nine, starting from commercially available materials . Without the need for any chromatographic purifications the product was obtained in 49% overall yield, thus representing a quite efficient process optimization amenable to pilot - plant scale production . -ta - catalyzed key steps of chemo - enzymatic routes for the manufacture of a) the antiallergic crth2 antagonist mk-7246 (42), b) the anticarcinogenic smoothened receptor (smo) inhibitor 45, and c) the silodosin intermediate 49 . Another concise asymmetric synthesis involving a transamination step has been developed recently for the large - scale commercial supply of compound 45, a smoothened receptor (smo) inhibitor and a new therapeutic for the treatment of a broad range of human cancers . The challenging key step of the synthesis was the establishment of the anti stereocenters on the 2- and 4-positions of the piperidine ring . By means of an -ta - catalyzed transamination of the 4-piperidone precursor 46, both centers the required c-4 amino functionality as well as the anti - configured c-2 stereocenter were generated simultaneously through a dynamic kinetic resolution process . The targeted anti - amine intermediate 47 was obtained in> 10:1 dr and 99% ee in a single step, and therefore the smo inhibitor 45 was prepared in only five steps with 40% overall yield, representing a highly attractive alternative route (scheme 18, b). An enzyme - catalyzed transamination was also considered for the preparation of the amine 49, an intermediate on the pathway to the pro - drug silodosin (48), which is used for the treatment of dysuria and urinary disturbance (scheme 18, c). Various examples, which have been provided to a significant extent by companies, demonstrate the applicability of -transaminases for the synthesis of valuable targets . Detailed investigation of the substrate scope, as well as a well - understood mechanism and detailed crystallographic analysis of the catalysts' protein structures, have built up a consolidated base for the application of transaminase enzymes on a laboratory scale, as well as on a pilot - plant scale . The interest results from the high demand for chiral amines as building blocks or intermediates within synthetic routes . The broad range of accepted ketone and aldehyde precursors, the robust reaction conditions, and the relatively easy preparation of the catalysts represent a highly attractive alternative to recent amination methodologies . Therefore the increasing number of laboratories focusing on the implementation of this biocatalytic technology is due to the fact that alternative methods from other fields of catalysis are less attractive or lack the robustness of the biocatalytic equivalent . Thus, -transaminases show great potential to become one of the big players in the preparation of (chiral) amines . After his phd in the same group applying enzymes for the preparation of complex organic molecules he spent two years at the mpi in mlheim an der ruhr with prof . Alois frstner, where he worked on natural product synthesis and mechanistic studies involving ruthenium - catalyzed hydrogenations . Judith e. farnberger did her bachelor's studies in environmental system sciences with focus on chemistry at the university of graz . For her master's studies she switched to the tu graz, where she focused on biotechnology and biocatalysis . W. kroutil on -transaminases . After completing her master's studies in 2014 she is now working on her phd in the same group . He did his master's studies at the tu graz and his doctoral studies at the university of exeter (s. m. roberts) and tu graz (kurt faber). After a postdoc in industry (syngenta) he worked as an r&d manager (krems chemie). In 2000 his research interests are in shortening chemical syntheses or in making them more efficient by using biocatalysts . Bio - oxidation and -reduction, c c bond formation, cascades, and systems biocatalysis are some of his research topics.
In the past, advances in technology have caused a decrease in the time spent on physical activities and an increase in the time spent on sedentary behaviors . For instance, viewing television (tv) and spending time on the computer keep both adults and children sedentary for many hours each day [25]. The etiology of obesity is complex and includes biologic, genetic, and behavioral contributors; however, the obesogenic environment that promotes a sedentary lifestyle plays an important role in the obesity epidemic [6, 7]. What is known about the health implications of sedentary behaviors, including weight outcomes and obesity, is summarized in several reviews . Based on cross - sectional studies, previous reviews concluded that there were generally positive associations between viewing tv and indicators of overweight [8, 9]. However, recent reviews of prospective studies are inconclusive, partly due to the poor methodological quality of the studies and conflicting results among the studies [1012]. For other obesity - related health outcomes, that is, type 2 diabetes and mortality from all causes, and cardiovascular diseases (cvd), moderate to strong evidence although the research on sedentary behavior has been dominated by studies on its association with physical health, there is increasing research focusing on the association between sedentary behavior and mental health, especially depression [1316]. A recent review showed positive associations between sedentary behaviors and the risk of depression among adults based on seven observational studies, while four intervention studies showed contradictory results . In addition to depression, there are other common mental health measures, including anxiety and general mental health or mental well - being . However, the link between sedentary behavior and general mental health outcomes has received scant attention . Among the dutch population, there is a 14% yearly prevalence of self - reported poor mental health (defined by the mental health inventory, mhi-5 60). Considering the public health impact of poor mental health, insight into the association with sedentary behavior is relevant . Among adults, hamer and colleagues (2010) found that recreational sedentary behavior by adults, defined by tv- and screen - based activity, was associated with poorer mental health scores . However, sedentary behaviors involve domains other than sitting during leisure, such as sitting at work or sitting during transport . Among working adults, who represent a major part of the adult population, a significant amount of time is spent at work, and the majority of their total sitting time each day is likely to be at work due to the organization of the work [2, 3]. With respect to the observed associations between tv viewing and mental health, several explanations can be proposed . In addition to possible physiologic mechanisms, there are possible behavioral explanations; for example, extended time spent viewing tv may lead to social isolation which adversely affects mental well - being . Another possible explanation is the documented association between tv viewing and unhealthy (snack) food and beverage intake [20, 21]. With respect to the other side of energy balance, it has been hypothesized that tv viewing or other leisure - time sedentary behaviors may be substituted for beneficial physical activity that reduces the risk of depression . Thus, tv viewing may be related to poorer mental health through reduced physical activity and obesity [20, 2224]. It is yet unknown whether these associations also hold true for sedentary behaviors in other domains . For instance, for workers, is the relationship between sitting at work and mental health similar to tv viewing? Also, it is unknown whether the association between sedentary behavior and mental health is the same for workers and nonworkers . To date, evidence on these associations is lacking despite the relevance to reduce obesity and improve mental health . Due to the current lack of knowledge on the relationship between various sedentary behaviors and mental health, the aim of this study was to explore the association between domain - specific sitting with mental health among workers and nonworkers . Weight status has shown to be associated with sedentary behaviors [8, 9], as well as with mental health problems [23, 25]; but the role of weight status in this association is yet unknown . Therefore, the second aim of the present study was to explore the role of weight status in the relationship between the various sedentary behaviors and mental health . Data were derived from the doetinchem cohort study, a dutch, prospective, population - based study among residents from a town (doetinchem) in the netherlands . The data collection began among persons aged 2059 years from 1987 to 1991 as part of the monitoring project on cardiovascular disease risk factors . The cohort is reexamined every five years, and the fifth round (20082012) is ongoing . The measurements of the total study population are completed within a 5-year time frame, and each participant is measured every five years . Response rate was 62% in the first round, and varied between 75 and 79% in subsequent rounds . Starting with the fifth round, data have been collected about the time spent on sedentary behaviors . Since the data collection of the fifth wave is ongoing, only data from the first two years (2008 and 2009) are used in this study . The general aim of the doetinchem cohort study is to study the impact of (changes in) lifestyle behaviors and biological risk factors on health outcomes during ageing . Sedentary behavior was assessed by self - reported time spent sitting during a usual week over the past 12 months . The format of the sitting - time questions was similar to the questions about physical activity, which were designed for the european investigation into cancer and nutrition (epic). The participants were asked to report their weekly sitting time (in hours) spent: traveling by motor vehicle (such as train, bus, car, tram, motorbike, motor) during commuting, work, leisure; sitting at work (behind desk, computer, or meeting); sitting during leisure time while reading and/or studying, tv viewing, sitting behind the computer, other sitting activities (talking with friends, playing games, listening to music, etc . ). Reading and/or studying, sitting behind the computer, other sitting activities (talking with friends, playing games, listening to music, etc . ). From these items, three subscores were calculated by totaling the time spent sitting in each category: hours per week sitting during transport either for work or leisure time, hours per week sitting during work, and hours per week sitting during leisure time (either reading or studying, viewing television, computer time, or other sitting activities). Sitting time per domain was calculated only in those cases for which all underlying sitting activities were not missing . In all other cases, sitting time for the specific domain was considered as missing . Further, the time reported on each sitting activity was maximized at eight hours per day and seven days per week (five days / week for sitting at work) before calculating sitting time per domain . The total time spent sitting during the day was calculated by summing up the time spent sitting in the three domains, that is, transport, at work, and in leisure time . Again, total sitting time was calculated only in those cases for which all underlying domains of sitting were not missing . In all other cases, total sitting time mental health was measured by the mental health inventory (mhi-5), a subscale of the rand 36 . The mhi-5 is used to measure general mental health during the past month [17, 29] and has been found to be a valid and reliable measure of mental health status [29, 30]. The mhi-5 has five questions about feelings of depression and nervousness to be answered on a six - point scale ranging from all of the time the mental health score ranged from 0 to 100 points, calculated by first reversing the coding of the two positively formulated questions and consequently summing the points of each item 5/25100, with a higher score reflecting better mental health . A dichotomous variable was created using a cutoff point of 60 [29, 31], indicating poor (60) versus good (> 60) mental health . Using a single question, the respondents were asked whether they had paid work at the moment of the measurement . They could answer on a seven point scale with answers including yes, as an employee (payroll), yes, self - employed, no, i am housewife / man, no, i am unemployed, no, i am retired, no, i am disabled, and other . For the analyses, those working as an employee and self - employed were considered as a worker, while the remaining respondents, including other, were treated as nonworkers . Body weight and height were measured during a physical examination by trained assistants at the municipal health services with participants wearing light indoor clothing, with emptied pockets and no shoes . Body weight was assessed with a seca balance scale to the nearest 100 g on a calibrated scale . Body height was measured with a stadiometer mounted to the wall while participants stood straight against a wall, with their feet at a 45-degree angle, to an accuracy of 0.5 cm . Body mass index was calculated by body weight in kilograms divided by body height in meters squared . Subsequently, bmi was categorized as healthy weight (bmi 18.524.9 kg / m), moderately overweight (bmi 2529.9 kg / m), and obese (bmi 30 kg / m). Kg / m) (n = 3) were excluded from the present analyses . Potential confounders of the association between sitting and mental health were assessed by means of self - administered questionnaires . Educational level was assessed by the highest schooling achieved and was subsequently classified as low (intermediate secondary school or less), moderate (intermediate vocational or higher secondary education), or high (higher vocational education or university). Household composition was assessed by the question: with which persons are you currently living together using six answer categories: not applicable, i live alone, with a partner, with children up to 18 years of age, with children 18 years or older, with my parents or with other adults). A dichotomous variable was created to distinguish participants living alone from participants living with others . Perceived general health was measured using a question from the rand 36 [29, 30], which was dichotomized as healthy data on alcohol consumption were categorized as 0 glasses / week, 1 - 2 (women) or 13 (men) glasses / week, or 2 (women) or 3 (men) glasses / week . An extended version of the physical activity questionnaire designed for the european prospective investigation into cancer and nutrition (epic) was used . This questionnaire included items on time spent on leisure - time activities (walking, bicycling, odd jobs, and gardening) during the summer and then during the winter . For these activities, the lowest amount of time reported during either summer or winter was used in order to cautiously estimate physical activity levels . In addition, the questionnaire included items on sports and occupational activity irrespective of season . All reported sports were provided with a met - value according to ainsworth's updated compendium of physical activities . Total time (hours / week) spent on moderately intense (4.06.5 mets) physical activity was calculated by taking the sum of the time reported on bicycling, gardening, sports (4.06.5 mets), and moderately intense activity at work (i.e., walking regularly while carrying heavy objects). Time (hours / week) spent on vigorous (6.5 mets) physical activity was calculated by taking the sum of the time reported for sports (6.5 mets). (3.5 hours / week of at least moderate physical activity) or not adhering to the physical activity guideline . Data were available for 1588 men and women, aged 41 to 80 years old, examined in 2008 - 2009 . Participants with missing values for outcome variables and confounders were excluded from the analyses (n = 521). In addition, participants who were underweight (n = 3) were excluded, leaving 1064 men and women for the analyses . Descriptive characteristics (mean and standard deviation or percentage) for all key variables were calculated for the study population as a whole and stratified by working status . The association between sitting time and mental health was determined using a linear regression analysis with the total or domain - specific time spent sitting as the independent variable and the mental health score as the dependent variable . Analyses were stratified by working status . Both crude and adjusted analyses were performed . To explore the role of bmi in the association, one included all covariates (i.e., gender, age, education, household composition, perceived health, physical activity, smoking, and alcohol) but excluded bmi (model 1); one included all covariates and bmi (model 2); and included an interaction term between sitting time and bmi (model 3). The same linear regression analyses were then performed but stratified for weight status as defined by the bmi categories (healthy weight, moderate overweight, and obese adults). All analyses were performed using the sas program, version 9.2 (sas - institute, cary, nc, usa). The mean age of the respondents was 59 years; the mean age of workers was 52 years versus 66 years for nonworkers (table 1). The majority perceived their health as at least good, and 88.6% of the respondents were mentally healthy, although this was slightly higher for the working population, 90.1% . The mean bmi was 26.8 kg / m, and 44.8% of the working population and 48.3% of the nonworking population were moderately overweight . Approximately 13.5% of workers were obese versus 21.8% of nonworkers (table 1). On average, the total time spent sitting across the domains was 40.9 hours per week with higher sitting times for workers than for nonworkers (47.9 hr / wk versus 34.3 hr / wk among nonworkers). The respondents spent most of their sitting time in leisure with an average of 28.3 weekly hours (25.1 hr / wk for workers, 31.3 hr / wk for nonworkers). Tv viewing accounted for the majority of leisure sitting time ranging from 11.6 to 15.0 hours per week . No association was found for sitting during transport or for sitting at work and mental health . For time sitting during transport, there was a significant negative interaction with bmi for the working population (p <0.05) (table 2). Among workers, the time spent sitting in leisure, and particularly the time spent viewing tv, was negatively associated with mental health, both with and without adjustment for bmi (0.11, 95% ci (0.21)(0.002) for total leisure time, and 0.18, 95% ci (0.35)(0.01) for tv viewing time, resp . ). Among the nonworking population, no significant association between total time sitting, or sitting during leisure and mental health was found . However, a significant positive interaction with bmi was apparent for the total time spent sitting and leisure - time sitting (p <0.05). Tables 3(a) and 3(b) present the results of the linear regression models for the association between the sitting time variables and mental health stratified by the three weight - status groups for the working (table 3(a)) and nonworking populations (table 3(b)), respectively . Among the obese workers, a significant negative association was found for the time spent viewing tv (model 2: 0.43, 95% ci (0.84)(0.02)). Adjustment for bmi (model 3) did not change the significant negative association (model 3: 0.42, 95% ci (0.83)(0.01)). There was no association between sitting time and mental health for the healthy weight or moderately overweight workers . Analyses among the nonworking population showed that total time sitting (0.16, 95% ci (0.29)(0.02)) and the time spent sitting during leisure (0.17, 95%ci (0.30)(0.03)) and viewing tv (0.34, 95% ci (0.58)(0.11)) were all negatively associated with mental health for healthy - weight persons but not among the moderately overweight or obese persons (table 3(b)). Among the moderately overweight and obese nonworkers, no significant associations between sitting time and mental health were observed . The results of this explorative study showed no association between time spent sitting during transport or sitting at work and mental health . Only sitting during leisure time and in particular the amount of time viewing tv associations were even more complicated, because both work status and weight status are effect modifiers in these associations . Among nonworking persons, the total time spent sitting, the time spent sitting during leisure, and particularly viewing tv, was associated with a poorer mental health in those with a healthy weight only . In workers, the association between viewing tv and poorer mental health was also apparent among the obese workers only . There are some mechanisms that may explain a relationship between sitting and the risk for poor mental health . First, the favorable effects of physical activity on mental health, especially on depression, have been well documented [22, 24, 34]. If sedentary behaviors substitute time spent on physical activity, the favorable mental health effects of physical activity cannot occur . The negative association found for overall leisure time and tv viewing with mental health is in line with this mechanism; however, the lack of an association between sitting in general and mental health does not support this explanation . Another mechanism refers to the social withdrawal hypothesis, which proposes a positive association between tv viewing time, removal from social interaction, and a subsequent increased risk of depression . The association found in the present study for tv viewing and poorer mental health supports this hypothesis . In addition, the lack of an association for sitting at work and mental health may also support the social withdrawal hypothesis, since most jobs take place within a social context . The finding that the association between sitting and mental health in particular exists for time spent tv viewing might also be explained by the mechanism that tv viewing can be associated with energy - dense snack consumption and snacking behavior, both of which are known to be related to obesity [20, 21]. Moreover, as a possible explanation, depressive symptoms have been associated with unhealthy food choices, leading to weight gain and, in the longer term, obesity [36, 37]. Thus, the association between tv viewing and poorer mental health among the obese workers may be explained by the related unhealthy food consumption while viewing tv . All in all, considering the findings that in case of significant associations leisure time sitting and especially tv viewing was consistently associated with poorer mental health status, it can be argued that it may be the context of the sitting rather than the length of sitting time that is important in the association with mental health . A notable finding of our study is the role of weight status with a clear association between the time spent viewing tv and poorer mental health among healthy weight nonworkers as well as among obese workers . A possible explanation for the differing associations found by weight status among workers is that obese workers consume more unhealthy food and beverages when viewing tv (compared to the healthy weight and moderate overweight workers), which may make them feel guilty, decrease their self - esteem, and negatively impact their mental well - being . However, it should be emphasized that the current status of knowledge in this field is explorative, and an obvious explanation for the present findings cannot be given . Instead, more research is necessary to investigate the relationships suggested by this explorative study before elaboration . First, the data on sedentary behaviors were derived by means of self - report, which challenges reliability and validity . As is well known, subjective methods or self - reports are likely to produce biased measures of the behavior of concern, that is, the amount of sedentary behavior . Because of the increasing awareness of the role of sedentary behavior, it was decided to measure sitting time in the fifth round of the doetinchem cohort . For the present study, we used sedentary behavior questions that were in line with the structure and format of the physical activity questions . The latter were designed for inclusion in the epic study and appeared to be of satisfactory reproducibility and relative validity . Currently, the psychometric characteristics of these sitting questions are unknown, and, until we have better data, future population - based research on sedentary behaviors should develop reliable and valid measurements for various sedentary behaviors . For the present study, we treated the available variables for sitting time rather conservatively, analyzing only respondents with complete data (i.e., no missing values for any variables of sitting time). Although the participants were asked to their working status, no further questions on the profession or job roles were included, which can be considered as a limitation of a study . Further, the respondents of the doetinchem cohort study may not be fully representative of the dutch population because respondents live in one (rural) town in the netherlands and had a very healthy profile with, for instance, a low prevalence of mental illness, which might also have challenged the power of the analyses . The selection of workers may not be compared to the general dutch working population as the workers in the current study were considerably younger than the nonworkers (who averaged 66 years). This may have resulted in disparate (sedentary) time - spending patterns and health status, simply and solely due to age . However, as the age - adjusted analyses did not show notable differences, we believe the age - related impact on the results is negligible . We examined the associations by linear regression analyses and used a continuous measure for sitting behavior . However, it can be argued that the association between sitting time and mental health is not linear, that is, an increased risk for poorer mental health related to an increase in each weekly sitting hour . Instead, using tertiles or another way of categorizing, the amount of sitting time may have shown significant associations given a certain cutoff point for sitting time . In an additional analysis, we examined the associations for categories of tv viewing (<2 hr / day versus 2 hr / day), but this did not change the conclusions (data not shown). First, it is recommended that longitudinal research be performed to confirm the current findings and examine the direction of the relationship . Additionally, it would be more than interesting to test potential behavioral mechanisms . To specify, future research is needed to investigate the mediating role of physical activity, dietary habits, work status, and overweight in the relationship between sedentary behavior and mental health . Finally, as mentioned earlier, the development of reliable and valid measurements covering the entire range of sedentary behaviors is strongly recommended . On the other hand, this study is innovative as it explored the associations between various sedentary behaviors in domains where people spend a substantial part of their day and poor mental health . Another strength is that we used body weight and height, measured by trained and experienced assistants . In conclusion, the present explorative study confirms the relationship between tv viewing time and poor mental health as suggested in earlier studies, with bmi and working status being effect modifiers, but this association does not hold for spending time in other domains of sitting . Further longitudinal research is needed to confirm the results and to determine the causality in the relationship between sedentary behaviors and mental health . In addition, our data suggest that work status and weight status should be taken into account when studying the relationship between sitting and mental health.
Pelvic fractures and in particular crescent fracture dislocations, which are characterised by disruption of the sacroiliac joint with extension proximally as a fracture of the posterior iliac wing, usually occur as a result of high velocity trauma (1,2). Osteopenia and the associated loss of bone trabeculae decreases the elastic resistance of the osseous elements of the pelvis, thus making the pelvis a common location for insufficiency fractures (3). As the general population ages, the number of osteopenic specific pelvic fracture patterns are likely to increase . In cases where surgical fixation is required, less invasive techniques are beneficial in this older population (3). The unique fracture pattern described in this report occurred as a result of the patient falling in such a way as to result in simultaneous sudden flexion of one hip with extension of the contra - lateral hip, into a position known in athletic terms as the front splits . The combination of the torque force produced by the fall and the patients reduced bone mineral density resulted in a unique, unstable pelvic fracture . To our knowledge this is the first reported case of bilateral crescent fractures, and the first reported case of pelvic fracture as a result of this mechanism of injury . The authors have obtained the patient's informed written consent for print and electronic publication of this case report . A 57 year old woman slipped while shopping resulting in a fall, where - upon her right hip flexed to 90 degrees and her left hip extended to 90 degrees, to a point where her perineum came to rest on the floor . This particular fall resulted in a twisting or torque like force being transmitted through her pelvis as she fell . She attributed the increased pain that she was experiencing to aggravation of her long standing back complaint . Prior to her fall she had attended the spinal clinic for her back pain and was scheduled for a bone scan with a view to progressing to facet joint blocks . On attendance at the spinal clinic following her scan it was noted that her low back pain had become more pronounced and she required walking aides in the form of crutches to mobilise . On reviewing the bone scan, further imaging, both plain film and computed tomography (ct) (fig.1 & fig . 2) revealed extensive pelvic fractures with displaced bilateral superior and inferior pubic rami fractures and bilateral posterior ring crescent fractures . She had no previous fractures and prior to her fall worked as a care assistant . Coronal computerised tomography (ct) image demonstrating bilateral posterior iliac wing fractures and sacro - iliac joint disruption three - dimensional ct reconstruction showing both the bilateral crescent and superior and inferior pubic rami fractures following admission, routine blood parameters (including bone profile) were all normal and a pelvic mri scan out - ruled any intra - pelvic soft tissue lesions . Open reduction and internal fixation of her anterior pelvic ring was undertaken through a stoppa approach, both rami fractures were reduced and plated anteriorly and superiorly . At this time bone and soft tissue samples from the anterior ring were sent for analysis . Following reduction and fixation of her anterior pelvis, intra - operative fluoroscopy revealed that her posterior injuries were in an acceptable position . A 3 cm long vertical incision was made over both anterior inferior iliac spines and supra - acetabular screws were placed from the anterior inferior iliac spines to the posterior inferior iliac spines to fix the bilateral iliac wing fractures . Inlet radiograph at 16 months post surgery demonstrating solid fixation and bony healing post - operative recovery was uneventful . Subsequent dual energy x - ray absorptiometry scanning revealed mild osteopenia for which she is being managed medically . Final follow - up at 16 months demonstrated that the fractures had healed, and the patient was pain free and mobilising unaided (fig . These injuries are rotationally unstable, there may also be some vertical displacement but this is limited by the sacrotuberous and sacrospinous ligaments, which typically remain intact (1,2). Our patient sustained bilateral crescent fractures and complete bony disruption of her anterior pelvic ring through inadvertently and suddenly performing what is known in athletic terms as the front splits, where one hip is flexed and the other extended to 90 degrees in neutral adduction / abduction . Although this does not fit with the classic description of high energy trauma, the force imparted to the untrained individual s pelvis in performing such an act would be considerable . Another contributing factor is our patients post - operative diagnosis of osteopenia, the associated loss of bone trabeculae decreases the pelvic elastic resistance making it a common location for insufficiency fractures in post - menopausal women (4). Day et al (5) have classified crescent fractures according to the extent of sacroiliac joint involvement, with type i fractures entering the anterior third of the sacroiliac joint, type ii fractures involving the middle third and type iii fractures limited to the posterior third of the sacroiliac joint . Operative stabilisation of these injuries is recommended and aims to achieve accurate reduction of the sacroiliac joint and stabilisation of the associated pelvic ring fracture, thus facilitating early mobilisation and minimising disability due to post - traumatic malunion and osteoarthritis or instability of the sacroiliac joint (2,3,6 - 9). However both reduced function and ongoing pain are commonly reported even after technically satisfactory surgery (2,7). Pelvic insufficiency fractures are relatively common and should be suspected in older female patients with unexplained hip, groin, buttock, low back pain and/or difficulty with ambulation, particularly if there is any recent history of trauma (10). While the majority of these insufficiency fractures may be treated conservatively our patient required surgical fixation due to the unstable nature of her injury . To our knowledge this is the first reported case of bilateral crescent fractures and also of a pelvic fracture occurring as a result of this unique mechanism of injury.
Children constitute approximately 40% of india's population but information on adverse drug reactions occurring in them is limited . Phenytoin sodium (pht) is one of the commonest antiepileptic drug (aed) used in children in india . The drug has wide pharmacokinetic variability and has a narrow therapeutic range that leads to toxicity . There is some evidence of the association of long - term use of pht and toxicity like cerebellar atrophy . Such cerebellar changes have been reported even with the long - term use of nontoxic levels of phenytoin ., we report a case of reversible cerebellar atrophy induced by pht in a 10-year - old boy . After initiating therapy with pht 10 years back, he was seizure free for 2 years . Patient was also occasionally prescribed clobazam, 5 mg, oral, as and when required . The episodes used to last for a brief period of over 6 - 7 days . Seizures used to occur at every 3 - 4 months interval . The boy had history of birth asphyxia and delay in developmental milestones . After the patient recovered, he was evaluated again due to complaint of difficulty in walking . Cns examination revealed normal mentation with cerebellar signs including gaze - evoked nystagamus, truncal, and appendicular ataxia . Mri scan of the brain was advised and it showed cerebellar atrophy as shown in figure 1 . Serum phenytoin level was high (30 mcg / ml) and pht was withdrawn immediately . Patient was started on valproic acid and followed up . However, a sizeable proportion of patients may develop drug induced adverse effects that include sedation, gum hypertrophy, lymphadenopathy, chorea, ataxia, etc . There are a few reports on cerebellar atrophy after long - term use of pth . These adverse effects are usually reported if the drug serum levels are above the therapeutic range . Our patient presented with severe cerebellar disorder and he was on the drug for 10 years . Hence, a regular monitoring for adverse drug reaction should be considered in patients who are on drugs on long term basis . These reactions could be idiosyncratic or dose - dependent which again may be acute or chronic in nature . Since most of these effects are reversible, it is important to identify the clinical manifestations related to drug toxicity and to manage them appropriately . Also, it warns the need for regular monitoring of plasma concentration, accurate dosing, and identification of adherence issues in patients on phenytoin.
Dyschromatosis is a rare genodermatosis which is characterized by hyper and hypo pigmented macules of variable shape and size . Case one was a 30-year - old male patient who presented with asymptomatic multiple hypopigmented, and hyperpigmented skin lesions all over the body [figure 1a and b] since the age of 10 years . The initial lesions started in the chest and then spread to the entire body in 2 years . There was no history of photosensitivity or handling of any chemical or any history of drug intake . Skin biopsy from the hyperpigmented macules showed the increased melanin pigmentation [figure 2a], and the hypopigmented macules showed a marked decrease in the epidermal basal melanin [figure 2b]. Based on these findings, a diagnosis of dyschromatosis universalis hereditaria (duh) was made . (a and b) case one with multiple hypopigmented and hyperpigmented macules all over the body photomicrograph depicting marked increase in the epidermal basal melanin from the hyperpigmented macules (a) and decrease in the epidermal basal melanin from the hypopigmented macules (b) of all the five cases (h and e, 400) case two was a 22-year - old male presenting to our outpatient department with asymptomatic multiple hypo and hyperpigmented macules all over the body [figure 3] since 12 years . Case two with multiple hypopigmented and hyperpigmented macules all over the body case three was a 14-year - old boy who presented with similar lesions all over the body [figure 4a and b] since the age of 2 years . He also had multiple verucca vulgaris over the left arm and dorsum of hands [figure 4c]. Case three with similar reticulate pigmentation all over the body (a and b); broad nasal bridge, long philtrum (a) with verucca vulgaris on the dorsum of right hand (c) depicts case three and case four with palms showing similar mottled pigmentation case four was the 9-year - old sibling of the 14-year - old boy who revealed similar lesions all over the body [figure 6] since 9 months of age . He had recurrent pyodermas [figure 6a] since birth . On examination, he had molluscum contagiosum lesions [figure 6b] on the face . Both the siblings also had a broad nasal bridge, long philtrum, and high arched palate . The possibility of primary immunodeficiency was kept and baseline immunodeficiency workup was done . His serum immunoglobulin assay was normal and human immunodeficiency virus one and two tests (elisa) were negative . Both the brothers had hypopigmented, and hyper pigmented macules of varying sizes all over the body . Case four with similar reticulate pigmentation all over the body, abscess over the forehead, molluscum contagiosum; broad nasal bridge, long philtrum based on these findings, a diagnosis of duh was made in all the four cases . The other differential diagnosis in all these four cases included xeroderma pigmentosum, dyschromatosis symmetrica hereditaria, dyschromic amyloidosis, and disorders due to chemical exposure such as diphenylcyclopropenone, and monobenzyl ether of hydroquinone . Absence of photosensitivity, atrophy, telangiectasia, eye involvement and benign nature of the condition makes xeroderma pigmentosum unlikely . These lesions were differentiated from dsh in which the lesions occur in a more acral distribution . The disorder was also differentiated from dyschromic amyloidosis by the absence of predominant lesions in the sun exposed areas and absence of amyloid deposits in the papillary dermis . Case five was a 21-year - old male who presented with asymptomatic multiple hypo and hyperpigmented skin lesions over the extremities [figure 7] since the age of 1-year . Biopsy from the hypopigmented macules showed decreased melanin pigmentation whereas biopsy from the hyperpigmented macules showed increased focal melanin in the basal layer . Other possibilities such as duh, and reticulate acropigmentation of kitamura were included in the differentials . Duh was ruled out as it is characterized by more extensive lesions including the non acral / unexposed areas of the body . Further, the disease is differentiated from reticulate acropigmentation of kitamura by the absence of atrophic macules, palmar pits or breaks in the epidermal ridge pattern . Case five with similar lesions over the extremities the features of all these five cases have been summarized in table 1 . Reticulate pigmentary dermatoses (rpd) comprise a rare group of disorders, characterized by hyperpigmented and hypopigmented macules coalescing to form a reticular pattern . The various acral rpd includes reticulate acropigmentation of kitamura, acropigmentation of dohi, acromelanosis heterochromia extremitarium, and dyschromatosis symmetrica hereditaria (dsh). The differential diagnoses of generalized rpd are duh, dermatopathia pigmentoreticularis, naegeli - franceschetti - jadassohn syndrome, and dyskeratosis congenita (dkc). Dyschromatosis is a spectrum of disease which includes duh, dyschromatosis symmetrica hereditaria (dsh) or acropigmentation of dohi and a segmental form called unilateral dermatomal pigmentary dermatosis . Duh, a rare autosomal dominant genodermatosis was first described by ichikawa and hiraga in 1933 . Duh is characterized by the presence of both hyperpigmented and hypopigmented, small, irregular macules distributed symmetrically all over the body . These cases usually do not progress or worsen as age advances, once well established . Theses macules are usually smaller (15 mm), but larger macules measuring up to 15 cm have been reported . The trunk and the extremities are commonly involved . The face is generally not involved, and there is sparing of the palms, soles, and mucous membranes . Various systemic associations including small stature and high - tone deafness, dowling - degos disease, x - linked ocular albinism, tuberous sclerosis have been described . Many other associated conditions have been reported, such as ocular abnormalities, photosensitivity, learning difficulties, mental retardation, epilepsy, insulin - dependent diabetes mellitus, and erythrocyte, platelet and tryptophan metabolism abnormalities . Duh is thought to occur secondary to the interference with the neural - melanocytic interaction in early embryonic life in those who are genetically susceptible . The gene responsible for duh has been mapped to 6q24.2-q25.2 (omim 127500). Because the exact biochemical basis of the gene defect is unknown, the diagnosis generally relies on the external phenotype . Here one case was associated with mental and growth retardation, recurrent respiratory tract infection, verucca vulgaris; and his younger brother had recurrent pyoderma with molluscum contagiosum . Both the brothers had characteristic facies of high arched palate, broad nasal root, and long philtrum . We also report one case of dyschromatosis symmetrica hereditaria in a 21-year - old male patient presenting with similar macules over the extremities . Patients with dyschromatosis symmetrica hereditaria (reticulate acropigmentation of dohi) present with hyperpigmented and hypopigmented macules on the face and the dorsal aspects of the extremities . Skin lesions remain localized on extremities in nearly half of the patients and involve face and extremities in the remaining half . Most cases of dsh are inherited as autosomal dominant, although an autosomal recessive variant of dhs has been reported . Later, novel mutations in the adra1 were reported in chinese families confirming that this gene is responsible for dsh in the different ethnic group . More recently, suzuki et al . Reported 16 novel mutations in the adra1 without identifying such mutations in patients with duh . In a recent ultra - structural skin investigation, nuber et al . Indicated that duh is a disorder of melanosome synthesis rate or melanocyte activity and not a disorder of melanocyte number . Dyschromatosis is a benign condition which is usually not associated with systemic involvement which has to be differentiated from conditions like xeroderma pigmentosum, dkc . We report these cases because of their rare occurrence and characteristic facies of high arched palate, broad nasal root, and long philtrum; recurrent respiratory tract infections, verucca vulgaris, molluscum contagiosum, and pyodermas as an association of duh has not been reported to the best of our knowledge . Duh and dsh can present without a family history of similar complaints which has been rarely reportedduh can be associated with characteristic facies of high arched palate, broad nasal root and long philtrum, recurrent respiratory tract infections, verucca vulgaris, molluscum contagiosum, and pyodermas . Duh and dsh can present without a family history of similar complaints which has been rarely reported duh can be associated with characteristic facies of high arched palate, broad nasal root and long philtrum, recurrent respiratory tract infections, verucca vulgaris, molluscum contagiosum, and pyodermas . Duh and dsh can present without a family history of similar complaints which has been rarely reportedduh can be associated with characteristic facies of high arched palate, broad nasal root and long philtrum, recurrent respiratory tract infections, verucca vulgaris, molluscum contagiosum, and pyodermas . Duh and dsh can present without a family history of similar complaints which has been rarely reported duh can be associated with characteristic facies of high arched palate, broad nasal root and long philtrum, recurrent respiratory tract infections, verucca vulgaris, molluscum contagiosum, and pyodermas . Duh and dsh can present without a family history of similar complaints which has been rarely reportedduh can be associated with characteristic facies of high arched palate, broad nasal root and long philtrum, recurrent respiratory tract infections, verucca vulgaris, molluscum contagiosum, and pyodermas . Duh and dsh can present without a family history of similar complaints which has been rarely reported duh can be associated with characteristic facies of high arched palate, broad nasal root and long philtrum, recurrent respiratory tract infections, verucca vulgaris, molluscum contagiosum, and pyodermas.
It is estimated that about 3% of the world's population has been infected with hcv and 170 million are chronic carriers at risk of developing liver cirrhosis and/or liver cancer . Male gender is thought to be one of the critical factors in the progression of hcv infection . Besides, the development of hepatic fibrosis is faster in postmenopausal than in premenopausal women . In addition, serum total testosterone is associated with increased risk of both advanced hepatic fibrosis and advanced hepatic inflammatory activity in hcv infected men . However, early menopause associated with lack of svr among women with genotype 1 hepatitis c virus infection . Descriptive analytical study included 44 female patients, proven to have chronic hepatitis c infection by polymerase chain reaction (pcr) and 44 control females, age matched to the patients, were selected from healthy blood donors, proven to be negative for hcv on hepatitis c antibody test . Patients were recruited from virology center in ismailia fever hospital, a referral center for treatment of hcv in ismailia under the supervision of the ministry of health as part of the national project for combating viral hepatitis . Patients were subjected to thorough history taking, clinical examination, and routine workup including complete blood picture (cbc), serum transaminases (ast, alt), total bilirubin, albumin, international normalized ratio (inr), alpha fetoprotein (afp), and hcv quantitative pcr . Histopathological examination of histological activity and degree of hepatic fibrosis, of ultrasound guided percutaneous liver biopsy, was performed according to metavir's score . Serum estradiol, progesterone, and total testosterone were assessed using immulite 1000 (siemens, immulite, catalog number lke21 for estradiol, lktw1 for total testosterone, and lkpw1 for progesterone), a solid - phase enzyme - labeled, chemiluminescent immunoassay . The light intensity depends on a chemical reaction using a labeled enzyme and a chemiluminescent compound supplied as the enzyme substrate in excess to assure saturation kinetics . Patients were classified according to their reproductive status to 22 premenopausal and 22 postmenopausal females in each group (patients and controls). Further grouping of female patients according to (1) treatment (combined interferon and ribavirin therapy) response (nonresponders: patients who had detectable hcv rna at weeks 12, 24, and 48; relapsers: patients who had detectable hcv rna 24 weeks after stopping treatment; and responders: patients with sustained virological response (svr) with undetectable hcv rna six months after stopping treatment), (2) viral load (<600,000 and 600,000), and (3) fibrosis stage (f2 and> females included were nonsmokers, of reproductive age group (i.e., with regular menses, not pregnant or lactating), 18 years, and postmenopausal females (i.e., no menstrual period for 12 consecutive months). Chc females having hepatocellular carcinoma (hcc), coinfection with human immunodeficiency virus (hiv), coinfection with hepatitis b virus (hbv), other causes of liver disease (alcoholic, autoimmune, and wilson disease), previous liver transplant, hormone replacement therapy, hormonal contraception, and history of active substance or alcohol consumption were excluded . All regulations adopted by the ethics committee in faculty of medicine, suez canal university, including patient consent were considered and approved . Quantitative parametric variables were presented by mean and standard deviation (sd) and compared by student's t - test . The demographic, clinical, biochemical, and histopathological data of the studied subjects are shown in table 1 . Similar distributions were noted for age, bmi, age at menarche, marital status, reproductive status and the presence of diabetes and/or hypertension in hcv female patients, at reproductive age and menopausal group, and their respective healthy controls . Among the baseline laboratory data platelets count and albumin levels were significantly lower (p = 0.007 and 0.03, resp . ), while inr level was significantly higher (p = 0.005) in the menopausal patients compared to the reproductive aged patients . Menopausal women had worse indicators of disease severity (fibrosis: p <0.001; activity: p = 0.045) and reduced response to treatment (p <0.001) compared to reproductive aged women . Hormonal levels in the studied subjects showed that estradiol level is higher in menopausal patients compared to their healthy controls (p <0.001) (table 1). Similarly, menopausal hcv infected females have significantly higher level of total testosterone than controls (p <0.001). Total testosterone level is lower in reproductive aged hcv infected females than menopausal hcv infected females (p <0.001). Progesterone level in hcv infected females of reproductive age group was higher than in menopausal hcv infected females (p = 0.0014). The relation between fibrosis and hormonal levels in reproductive aged and menopausal patients is shown in table 2 . Estradiol level appeared to be higher in the group with fibrosis stage f2 than the group of fibrosis stage> f2 (p = 0.005) for reproductive aged patients . In menopausal patients total testosterone and progesterone levels were significantly lower (tt: p = 0.002; prg: p = 0.023), while estradiol level was significantly higher (p = 0.003) in group with fibrosis stage f2 than the group of fibrosis stage> f2 . The relation between virological response and hormonal levels in the studied groups is shown in table 3 . While the majority of the reproductive aged women responded to hcv therapy, only 13.6% appeared to be nonresponders and 9.1% were relapsers . In menopausal patients, total testosterone and progesterone levels were higher in the nonresponder group than in the responder group (tt: p <0.001; prg: p no t - test was done for reproductive aged patients as there were great differences in numbers of each group, which cannot be compared statistically . The study of menopausal patients included one patient who showed relapse in response to treatment with hormonal levels (e2 = 97.3, tt = 29.00, and prg = 0.60). Table 4 showed that the comparative relationship of hormonal levels and viral load in both groups (reproductive aged and menopausal females) appeared with no statistically significant value in all variables . Table 5 showed the correlations between hormonal levels in reproductive aged and menopausal patients and the fibrosis stage, activity grade, and virological response . Table 6 showed the relation between estradiol level and fibrosis in reproductive aged and menopausal patients; lower estradiol level was associated with significant increase of fibrosis level in reproductive aged patients between 35 and 50 years and menopausal patients between 47 and 55 years (ra: p = 0.037; m: p <0.001). The relation between estradiol level and virological response in reproductive aged and menopausal patients (table 7) showed that estradiol level was significantly lower with nonresponders in menopausal patients between 47 and 55 years (p = 0.03). The findings of our study reveal that chc infection is associated with elevated levels of estradiol, total testosterone, and progesterone in both pre- and postmenopausal females when compared to their healthy controls . This may be explained by the impaired metabolism of these hormones as a result of the defective liver function in chronic liver disease patients [913]. Menopausal hcv infected women had higher levels of estradiol, total testosterone, and progesterone when compared to their healthy controls (p <0.001, <0.001, and <0.001, resp . ). On the other hand reproductive aged women had statistically nonsignificant increased levels of these hormones when compared to their healthy controls (p <0.28, <0.346, and <0.80, resp . ). Menopausal greek females with hcc females had also higher levels regarding estradiol and testosterone compared to their healthy controls . To our knowledge there were higher significant level of total testosterone and lower significant level of progesterone in menopausal women with chc compared to females of reproductive age with chc, and this was not the case for estradiol level that showed a slight, however, nonsignificant decrease (p = 0.093). On the other hand the comparison between the same groups (menopausal and reproductive aged females) in control women showed higher significant levels regarding estradiol and progesterone levels in reproductive age females (p <0.001, <0.001, resp .) And nonsignificant difference in testosterone level between both groups . Hcv infection is associated with increased hormonal levels of estradiol, total testosterone, and progesterone in both groups reproductive aged and menopausal women; moreover estradiol and progesterone levels decreased with age, while total testosterone level increased with age in hcv group . In addition, although hormonal levels in reproductive aged group were higher than their healthy controls they are of statistically nonsignificant values and appeared to be minimally affected by hepatitis c, while menopausal group had hormonal levels high enough to be statistically significant in all variables compared to their healthy controls, providing evidence that this group was highly affected by hepatitis c. our study revealed that women of reproductive age had lower disease severity as measured by the liver necroinflammation activity and fibrosis compared to older menopausal women . The high estradiol and progesterone levels and low total testosterone level in the reproductive aged patients may in part have protected against the development of severe liver injury . In contrast, menopausal women exhibited greater disease severity, probably due to the decline in estradiol and progesterone levels and the rise in total testosterone level that occurs with menopause development, supporting the concept that the progression of fibrosis in women is not on the same pace: mild during reproductive age and severe after menopause . 2012 conducted a study on four groups of women divided according to their reproductive stage (fully reproductive, premenopausal, early menopausal, and late menopausal) in addition to four age - matched groups of men serving as controls . According to this study they found that liver fibrosis was advanced in the early menopausal hcv infected women compared to fully reproductive or premenopausal women . In addition, late menopausal women had higher liver fibrosis compared with younger women . The favorable role of estrogens in liver disease has also been suggested by shimizu et al ., 2001, and maffei et al ., 2004, two case reports, in which different pathological conditions required prolonged estrogen treatment in two young men, one with hepatitis c and the other with nonalcoholic steatohepatitis . In the first case, the addition of estradiol reduced disease activity and maintained viral loads at lower levels than those observed before treatment . In the second case, it reversed hepatic steatosis and insulin resistance [15, 16]. A number of molecular mechanisms could explain the protective role of e2; for example, e2 inhibits the transforming growth factor- (tgf-) b1 expression and hepatic stellate cell (hsc) activation, thereby suppressing the induction of hepatic fibrosis [1517]. In addition, e2 also downregulates tumor necrosis factor (tnf) alpha, interleukin-6 (il-6), and il-1b, mediators contributing to hepatic necroinflammation and the activation of hscs [1820]. Moreover, e2 possesses antioxidant, antiapoptotic activities in fibrotic liver and cultured hepatocytes [21, 22] that prevented the accumulation of monocytes - macrophages and inhibits proinflammatory cytokine production, whereas progesterone may counteract the favorable e2 effects [23, 24]. The total testosterone level was significantly higher in menopausal hcv infected females compared to reproductive aged hcv infected females . This finding is in agreement with the recently reported positive correlation between testosterone level and increased risk of both advanced hepatic fibrosis and advanced hepatic inflammatory activity in hcv infected men, in which higher unopposed level of testosterone related to higher severity of the disease and increased risk of hcc in men . Potential explanations for the discordant findings of our study and those studies may include differences in underlying target populations, host factors, or difference in viral genotype . Our findings of excess testosterone - associated risk in hcv positive females are consistent with the findings of increased liver cancer risk in males who abuse anabolic steroids, in androgen - treated fanconi anemia patients, in women with hyperandrogenemia secondary to polycystic ovarian disease, and in hbv positive taiwanese males with higher serum testosterone level [2931]. To our knowledge no studies addressing the changes in progesterone level have been conducted yet . Our study showed that menopausal patients had poorer responses to combined therapy than reproductive aged patients (menopause versus reproductive age: p <0.001). Previous studies including genotype 1 (most common genotype in japan and italy) highlighted the same findings [7, 32, 33]. The relationship between hormonal parameters in menopausal women and virological response showed that higher total testosterone and progesterone levels were significantly associated with unfavorable outcomes (p <0.001 and <0.001, resp . ). A number of previous studies suggested, however, a potential link to estrogen secretion [32, 33]. 2012, used raloxifene hydrochloride (rlx) (oral selective estrogen receptor modulator) plus soc (standard of care) treatment in postmenopausal women with genotype 1b chronic hepatitis c; the svr rate was significantly higher for rlx plus soc patients (61.3%) than for soc only patients (34.4%) (p = 0.0051). These inconsistent results may be explained by the difference in host genetic factors, viral genotype (egypt common genotype 4 versus japan common genotype 1), or ethnicity . Impairments in humoral, cellular, and innate immunity in the elderly and modulation of inflammatory factors, such as il-6 and tnf-, at menopause may be another important factor which are responsible for decreasing successful responses to treatment in menopausal patients [7, 35]. Our study revealed that there was a statistically nonsignificant difference regarding viral load values between the two groups . Besides, the comparative relationship of hormonal levels and viral load appeared to be of statistically nonsignificant value in all variables of both groups (menopausal and reproductive aged females). This finding is supported by one in vitro study that treated human hepatoma - derived cell line (huh-7.5 cells) with e2 and prg and found inhibition of hcv virion production (in case of e2 only) but not hcv rna replication or hcv protein synthesis . On the other hand, to our knowledge, no studies were found addressing its relation to total testosterone level . The present study explored the possible involvement of female sex hormones in the pathogenesis and/or progression of liver disease in hcv infected egyptian females . We observed that lower estradiol level is significantly related to fibrosis severity in chc females, while higher total testosterone and progesterone levels are significantly related to fibrosis severity in chc menopausal females only . Besides, higher total testosterone and progesterone levels are related to poorer treatment response in chc menopausal females, while estradiol level is not . Additionally, the detected higher hormonal levels did not have significant relation to viral load in both groups . We suggest that screening of progesterone and total testosterone levels should selectively target females with high grade fibrosis . Our findings underscore the potential favorable effects of antitestosterone treatment to target hcv infected females . We assume that giving hormone replacement therapy to infected menopausal females would not have a beneficial effect regarding hcv course or treatment response.
Differential expression analysis typically results in a long list of differentially expressed genes derived from the comparison of one or more samples . Although the results provide an essentially complete view of the analyzed transcriptomes, their functional interpretation is not always straightforward . Once the differentially expressed genes have been identified and their statistical significance correctly assessed, it is essential to interpret the data to formulate hypotheses about the specific mechanisms involved and to select the most biologically significant transcripts for further validation . The first step of the functional analysis is almost invariably an enrichment analysis (1) aimed at verifying whether a significant number of the identified genes belong to one or more specific pathways or functional categories . This is usually performed by statistically assessing whether a pathway or process is enriched in differentially expressed genes (2). The enrichment analysis should be performed using different classifications of the genes, for example, kegg pathways (3), interpro (4), gene ontology molecular function, biological process and cellular component categories (5). Furthermore, one should explore the effect of selecting different thresholds for the p - value threshold as well as for the ratio of the gene expression values between the experimental system under study and the respective control to define the subset of differentially expressed genes . The matter becomes even more complex if more than two comparisons are required to interpret the experiment . The correct interpretation of the results and, especially, the identification of particularly interestingly genes or functions among the differentially expressed ones are much more effective if associated to a deep knowledge of the biological system at hand and should, therefore, be done by the experimentalists . However, often they are not sufficiently expert to be able to effectively exploit the power of different tools and databases or to perform the comparison of the results of more than one experiment (which usually requires some scripting). This remains true even though there are a number of publicly available servers that allow functional enrichment analysis given a list of genes, the most used of which are david (6,7), g: profiler (8,9), gorilla (10), high - throughput gominer (11), babelomics (12) and genecodis 3 (13). All these tools require the user to provide lists of genes, which implies that the identification of genes the transcripts of which are up- and downregulated needs to be performed separately and in advance . Furthermore, should the user wish to see how the results change when a different p - value or fold - change threshold is applied to identify differentially expressed transcripts, the list has to be rebuilt, resubmitted to the server and the results compared . Two of the aforementioned servers, babelomics and genecodis 3, give the possibility of performing the analysis in parallel on two different lists of genes, for example, upregulated and downregulated ones or deregulated in different experiments, but the burden of comparing the results is still left to the user . The aforementioned considerations prompted us to provide experimentalists with a more user - friendly tool for analyzing their data from a functional point of view . The fidea tool was developed through a number of iterations with our collaborating experimental groups, and we believe that the resulting system is sufficiently easy to use and at the same time complete and flexible to be useful in the functional analysis of differential expression experiments . The fidea server allows the user to directly input the results of a differential expression analysis, for example, by uploading the output of cufflinks (14,15) (one of the most used tools for rna - seq analysis) or, alternatively, a formatted result file that can be easily obtained through other tools such as edger (16) or deseq (17). The input format in the latter case is simple and can be defined by the user (these tools do not have a single output format; therefore, the columns of the file where the different fields are stored needs to be specified). The most commonly used gene ids (gene symbol, entrez gene i d, ensembl gene i d, ucsc gene i d and refseq i d) are accepted as input . They can refer to one of the following species: homo sapiens, mus musculus, drosophila melanogaster, danio rerio and saccharomyces cerevisiae . On loading the input data, the system immediately shows the distribution of genes with p - value below a selected threshold (values> 0.1 are not allowed) thereby permitting to quickly appreciate the fraction of up- and downregulated genes in the specific experiment . The fold change and p - value thresholds can be interactively modified to further filter the data, and this leads to the direct display of the updated distributions (figure 1a). Panel (a) is the first page where, on uploading the data, the user has an overview of the distributions of fold changes and p - values for up- and downregulated genes and can interactively modify the p - value and fold - change thresholds . The results of the goslim analysis are shown as both a heat map (b) and a word cloud (c). Panel (d) shows an example of how data from different experiments can be combined and subsequently analyzed . Panel (a) is the first page where, on uploading the data, the user has an overview of the distributions of fold changes and p - values for up- and downregulated genes and can interactively modify the p - value and fold - change thresholds . The results of the goslim analysis are shown as both a heat map (b) and a word cloud (c). Panel (d) shows an example of how data from different experiments can be combined and subsequently analyzed . If more than one entry for the same gene is present in the input, the user is warned, and information about their annotations is displayed . Once a p - value and a fold change thresholds are selected, the enrichment analysis is performed considering the upregulated and downregulated genes both together and separately . This is relevant, as the detection of a statistically significant enrichment depends on the number of deregulated genes in a functional category compared with what is expected by chance and thereby, in specific cases, the results might differ if the upregulated and downregulated genes are considered together or separately . If a pathway, for example, has a significant number of upregulated genes and a few downregulated genes, the total number of differentially expressed genes in the pathway might turn out not to be statistically significant, whereas computing the enrichment of the upregulated genes separately might highlight an implication of the pathway in the system under study . The categories that are considered for the analysis are kegg, interpro (families, domains, sites and repeats), gene ontology molecular function (all evidence codes), gene ontology biological process (all evidence codes), gene ontology cellular component (all evidence codes) and goslim . The statistical significance of the enrichment is computed using the hypergeometric test, the resulting p - values are corrected using the benjamini and yekutieli fdr method (18). The background distribution is, by default, the distribution of all the genes for the selected organism, but the user can also provide his / her own list of genes . The significantly enriched functional categories (according to the corrected p - value and fold change thresholds selected by the user) can be displayed in different ways . For the analysis performed on the upregulated and downregulated genes taken separately, the user obtains: an interactive dynamic heat map showing the absolute log10 of the corrected p - value . The rows of the heat map can be interactively ordered according to the p - value, the number of differentially expressed genes belonging to the category or alphabetically by category name . The list of the genes contributing to the category can be obtained by clicking on the corresponding cell;an interactive table reporting the category name, the p - value and the corrected p - value, the fold enrichment and the number of differentially expressed genes . On clicking the latter, the system shows the list of the genes;a static publication - ready heat map (figure 1b) reporting the 60 categories with the lowest corrected p - values;a text table (csv format and downloadable). An interactive dynamic heat map showing the absolute log10 of the corrected p - value . The rows of the heat map can be interactively ordered according to the p - value, the number of differentially expressed genes belonging to the category or alphabetically by category name . The list of the genes contributing to the category can be obtained by clicking on the corresponding cell; an interactive table reporting the category name, the p - value and the corrected p - value, the fold enrichment and the number of differentially expressed genes . On clicking the latter, the system shows the list of the genes; a static publication - ready heat map (figure 1b) reporting the 60 categories with the lowest corrected p - values; a text table (csv format and downloadable). For the analysis that considers up- and downregulated genes together, the system provides: a dynamic interactive barplot listing the various enriched categories in ascending order of corrected p - value and the percentage of down - regulated and up - regulated genes in each of them in different colors . The list of the genes contributing to the category can be obtained by clicking on the corresponding bar;a word cloud where the functional categories are shown with a character size related to their enrichment (according to the corrected p - value) and in different colors according to the extent by which the pathways or categories are enriched by up- or downregulated genes (red to blue, respectively) (figure 1c);an interactive table reporting the category name, the p - value and the corrected p - value, the fold enrichment and the number of differentially expressed genes . On clicking the latter, the system shows the list of the genes;a text table (csv format and downloadable). A dynamic interactive barplot listing the various enriched categories in ascending order of corrected p - value and the percentage of down - regulated and up - regulated genes in each of them in different colors . The list of the genes contributing to the category can be obtained by clicking on the corresponding bar; a word cloud where the functional categories are shown with a character size related to their enrichment (according to the corrected p - value) and in different colors according to the extent by which the pathways or categories are enriched by up- or downregulated genes (red to blue, respectively) (figure 1c); an interactive table reporting the category name, the p - value and the corrected p - value, the fold enrichment and the number of differentially expressed genes . On clicking the latter, the system shows the list of the genes; a text table (csv format and downloadable). When more than one experiment is uploaded, the user can obtain a list of genes that are in common among experiments . These can include genes that are upregulated in all the experiments, upregulated in one and downregulated in another and so forth (figure 1d). The results are shown as a venn diagram and as a list of genes that can be directly submitted to the functional enrichment analysis or downloaded . The server is regularly updated in parallel with new releases of ensembl and of the functional classification annotations . As an example, figure 1 and supplementary figures 26 show some of the results obtained using the server for the data described previously (19), the authors of which performed an rna - seq experiment of id2a - deficient retinae obtained from zebrafish embryos in which id2a expression was blocked by morpholino - mediated knockdown . As described by the authors, the data show an enrichment of downregulated genes belonging to the cell adhesion go biological process and an enrichment of upregulated genes in the rna processing and nitrogen compound biosynthesis processes . The different results that can be obtained from the system according to the different functional categories are shown in the supplementary figures . These were obtained using the data from rna sequencing experiments aimed at identifying transcripts expressed in human islets of langerhans under control conditions or following exposure to pro - inflammatory cytokines (20). The perl modules are used to process the input, convert the gene ids, perform the functional annotation and create the textual output files . The r language and the ggplot2 package are used to create publication - quality pdf output images . The server front - end is implemented in standard html markup language using the javascript programming language and ajax technologies using the jquery library . The server runs under the linux (debian) operating system on a machine with 4 #intel xeon e7 - 4820 2.00 ghz processors and 80 gb random access memory . The associations between functional annotations and gene i d are stored in a local mysql database (see supplementary figure s1 for a detailed scheme of the db). Because of the large number of independent databases, the identifiers are, in most cases, redundant . Fidea maps all functional annotations to the ensembl gene ids (21) and converts all supported gene ids (entrez, ucsc, gene symbol and refseq) to ensembl gene ids . Organism - specific ids can also be used, namely, flybase i d, gene and annotation symbol for d. melanogaster, gene name, zfin gene i d for d. rerio and sgd systematic name, primary sgd and gene name for s. cerevisiae . Regardless of this internal conversion, the final results are given using the original gene i d provided by the user . For all three ontologies included in gene ontology (biological process, molecular function and cellular component) fidea applies the true path rule (22): any gene associated with a given go term is always associated with the ancestors of that term leading back to one step before the ontology root . Because of this, fidea also includes an enrichment analysis using the go slim annotations (23,24) that contain a smaller subset of go terms . Functional and structural annotations for protein families, domains and functional sites are retrieved from interpro . We describe here a publicly available and regularly updated server devoted to the functional analysis of differentially expressed genes . The main features of the tool that make it different from what is already available are the possibility of directly processing the results of the differential expression analysis, of interactively modifying the p - value and fold change thresholds used for selecting the genes, of analyzing up- and downregulated genes separately or together and to directly analyze and compare lists of genes obtained from more than one comparisons . This, together with an easy to use interface and with the possibility of displaying the data in different ways (tables, heat maps and word clouds), makes the tool especially appropriate to be used in the functional interpretation of data derived from microarrays or rna - seq experiments by the investigators themselves . In the future, we plan to include the possibility for the user to upload newly sequenced and annotated genomes and to link to information from public data such as, for example, expression levels of the genes of interest in different tissues or disease states . Epigenomics flagship project epigen; kaust [kuk - i1 - 012 - 43]; prin project [20108xyhjs].
When fully activated, the more potent part of the host immune mechanism comes into play, especially when the proper immunogen characterizing a specific antigen expressed by the tumor is delivered at a therapeutic level . Mounting evidence from both in - vitro and in - vivo studies at precision biologics and other research groups suggest that this process is represented mainly through a b cell response, producing the needed levels of the specific igg1 that can bring tumor growth under control 2 - 5 . Under normal circumstances however, the needed level of tumor antigen expression to induce the proper host response is low . Therefore the host attempt to gain control of the situation by the process of tumor surveillance is not an effective mechanism in most circumstances, and progression of disease will be noted . There is no question that the presences of cytotoxic t - cell lymphocytes permeating a neoplastic process have some relevance in helping to achieve a beneficial response . In a recent study from sloan kettering however, in evaluating the presence of til (tumor infiltrating lymphocytes) cells in patients with colorectal carcinoma undergoing surgery for liver metastasis, it was found that the existence of cytoxic cells could be shown to have some benefit, but the presence of t- regulatory foxp3 cd8 cells had a negative outcome in terms of survival 6 . Similarly, facciabene et al . Found that t - regs are potent immunosuppressive cells that help to enhance progression of the malignant lesion thru limiting host immunity and promoting tumor angiogenesis 7 . Data that is now being accumulated from various clinical trials have failed to support present methods being employed or planned, for delivering cytotoxic cells as a definitive approach to controlling both primary and metastatic lesions . Ongoing clinical trials utilizing targeted monoclonal igg1's directed against immunogenic tumor proteins now appears to offer the best opportunity for controlling if not curing the metastatic malignant process when the naked antibody is delivered in combination with other antitumor agents . The major goal for employing this approach is first to have isolated and characterized those immunogenic proteins characterizing the malignancy and subsequently for developing the monoclonal capable of targeting the immunogen which most often represents a mutated or post translational modification of an existing oncofetal protein . The term tumor infiltrating lymphocytes (til) has been applied to those cells derived from the tumor parenchyma and is believed to represent a host response aimed at helping to control tumor growth . One of the first descriptions characterizing this process was introduced in 1949 when moore 8 published his classic paper describing tumor infiltrating immunocytes, associated with breast cancer . The process defined by the pathologist, was termed medullary cancer of the breast . Here, patients with this form of disease were considered fortunate in having a better prognosis with regard to survival based on the presence of the lymphocyte infiltrate . Among several of the first group of patients with breast cancer that we had treated at sloan - kettering, this took place several years after moore published his findings with this form of breast cancer and as such the initial impression was that these patients would have, with little question, a favorable outcome in terms of prognosis . Within months of surgical resection, each of these node negative patients presented with distant metastasis . In attempting to resolve this issue of host protection by an infiltrative lymphocytic process within the tumor, new questions arose, all with regard to the failure to define an improved survival especially in tumors such as medullary carcinoma . It appeared that much of the information describing prognosis for this tumor type was frequently misleading and that medullary cancer of the breast was in reality a high grade malignancy with poor prognosis . 9 reviewed over 100 cases of this so called disease process, dividing the patients into 4 groups based on the level of lymphocyte infiltration it became apparent early on, that the greater the level of lymphocyte infiltration within the breast tissue, the poorer the prognosis . It was very obvious that the presence of tumor infiltrating lymphocytes did not bode well in terms of controlling the malignant process and did not, as originally described, represent a major attempt by the host to control tumor as it continued to grow . This particular finding continued to remain equivocal until dudley and rosenberg 10, in isolating and culturing infiltrating lymphocytes from tumor specimens, now termed till cells, was able to demonstrate some benefit, but still an insignificant response following the isolation, scaling up, and delivery of large numbers of such til cells to the host presenting with metastatic cancer . While a partial response was seen in a few patients with metastatic melanoma, it did not appear to represent, from a clinical point of view, a major change in altering survival of those patients with metastatic disease . In 2006 11 morgan and dudley further demonstrated that the receptor of t - cells could be transferred to immune cells as a form of gene therapy and again when delivered in combination with chemotherapy and high dose il-2, they could demonstrate an occasional beneficial response . The problem that arose however was that in a similar situation, some patients could be shown to have a partial response independent of the use of til cells, when il-2 was given along with chemotherapy . A number of ongoing studies are still being devised and utilized whereby activated t cells are being employed in melanoma studies . Whether any major benefit will be obtained from the data accrued in these studies jamieson has looked into the possibility that infiltrating lymphocytes representing the presence of a high grade inflammatory response in patients with pancreatic cancer does confer some beneficial response . It appears in some instances that the presence of this response does suggest prolongation in survival . Whether any specific cell type such as the presence of nk cells is associated with clinical benefit was not apparent 12 . A further analysis of the possible mechanisms resulting from activation of a cellular immune response appeared in a study by schietinger et al.13 they reported that bystander killing of cancer required the cooperation of cd4 and cd8 cells . Experimental cancers could be eradicated by such t cell combination targeting the tumor stroma as a major factor in bringing the lesion under control . Jiang and mann 14 looked further into the phenomenon and possible benefit of immune cells entering into the tumor matrix . They described the activity of such infiltrating cells with regard to tumor lysis and noted rather, that lymphocytes entering tumor parenchyma appeared in many instances to help chaperone tumor cells within the lesion to the lymphatic and vascular systems, thus enabling the tumor cells to metastasize . No antitumor response was noted by these cells in their association with adjacent malignant cells . They therefore categorized infiltration of tumor by lymphocytes in negative terms and regarded this phenomenon as a failure in the host response, attempting to bring existing tumor under control . Where it was felt that existing immunocytes in the host demonstrated some degree of impaired function, specific monoclonals were developed that could be used to restore these functions 15 . As such immunomodulatory antibodies directed against cytoxic t cell associated antigen 4 (ctla-4/cd52) and programmed cell death ligand 1 (pdl-1/cd274) there have however been a limited number of patients who appear to benefit from such immunomodulatory antibodies . The factors involved here were felt to be possibly being due to an inadequate number of, as well as impaired cytotoxic lymphocyte activity . With this in mind, a more plausible approach appeared to be in directing the immune system to target those immunogenic proteins found on the surface of the tumor; those that characterize the specific tumor system, i.e., colon, pancreas, lung etc . While most foreign cells considered as invaders, such as bacteria and viruses, contain sufficient levels of the target antigen to allow the host immune system to control their presence, when one considers the cancer cell as a potential foreign invader, the level of tumor antigen / immunogen present is too low to allow for effective control . Here one needs to define the tumor associated antigen (taa) and present it to the host in sufficient amounts (threshold level) to allow an effective host immune response to occur . A more rational approach leading to an understanding of how host immunity could be properly as well as effectively activated was described by hollinshead 16 . During the 1980's when the hollinshead vaccine was approved for use in treating patients undergoing surgery for advanced neoplastic lesions, the length of survival among those receiving pooled allogeneic antigen preparations was found to more than double over those undergoing surgery alone whereas recipients receiving the vaccine developed enhancement in both their cell and humoral responses, the one factor that appeared most responsible for improved survival, was the ability to produce an adequate and prolonged level of an igg1 antibody directed against the tumor antigen . Failure to develop a sustained serum level of the antibody capable of targeting tumor antigen expressed on the cell surface membrane, resulted in recurrence in spite of the presence of an adequate t cell response . The important factor here was that the vaccine was specific for the tumor system being treated and that it was delivered at a threshold level of approximately 700 - 1000 gm . This preparation was given at antigenic levels more than 20 times that of the immunogenic proteins present within the patient's own tumor system . This in essence precluded the use of the patients own tumor for developing effective personalized vaccines as had been directed by the fda . In a paper by hollinshead, takita and stewart 17, one can easily recognize the improved and sustained survival seen in lung cancer patients who received a tumor antigen preparation . Pooled allogeneic protein was delivered in the form of a vaccine plus adjuvant following resection . There were no restrictions in the use of such preparations at the time, since hpv, hepatitis b and c and hiv were not considered major threats in producing and delivering such preparations . Results obtained for patients receivng such vaccines in the above study were compared to those having undergone surgery alone and who therefore served as controls 18 (fig.1). On completion of the vaccine trials going into the 1990's and at the suggestion of the fda, it was felt that the pooled allogeneic vaccines could have some form of viral contamination and as such should not be further utilized for therapy . Rather they suggested that the tumor proteins in the vaccine be used to produce monoclonal antibodies and that such antibodies be employed to further define the structure of the pooled proteins by immunoprecipitation and mass spectroscopy . At this particular time, adcc (antibody dependent cell cytotoxicity) was coming into vogue for evaluating the ability of antibodies to induce a form of tumor lysis . Such studies were being performed on carbohydrate antibodies such as 17.1a . As a control, one of our monoclonals targeting colon cancer termed 31.1 was utilized . It is readily apparent that a protein antibody such as 31.1 used to define an immunogenic glycoprotein can be far more effective than what one sees with a carbohydrate antibody such as 17.1a (fig.2). Considering that colon tumor cells in culture, proliferate at about 6 - 10% q 6hrs . One would expect from this data that that nothing less than a 30% adcc would give the needed clinical response . When the monoclonal antibody 17.1a, now termed panorex, was utilized in clinical trials for patients with dukes c2 colon cancer, it was not unexpected to find absence of a significant improvement in survival . One would anticipate that a protein derived monoclonal, with an adcc in excess of 50% and delivered at the right therapeutic dose could achieve a long needed clinical response . This became the target of the therapeutic trials at precision biologics knowing that with monoclonals delivered intravenously, the rapid tumor response seen in a matter of hours could be an effective way for treating patients with recurrent cancer having failed chemotherapy 19 . Animal studies that were performed were planned to demonstrate that the proper igg1's delivered to nude mice presenting with fully established human colon or pancreatic carcinoma could be brought under control . In all such studies comparing nonspecific iggs to those igg'1 derived from the tumor antigen preparations of hollinshead, the antibodies for potential human trials were chimerized since any adcc response would rely on the delivery by the antibody, of nk cells attached to receptors on the human fc . Each of the monoclonals that have been developed by our group for therapeutic use is now in the process of being humanized . In terms of colon and pancreas cancer studies, we are presently in phase iia trials with the chimeric version of the antibody neo 102 targeting an oncofetal protein expressed in both colon and pancreas cancer . Each represents an oncofetal status of the expressed protein, wherein at the time of malignant expression of the lesion a mutation has been characterized which represents either a gene mutation or post translational modification within the core peptide of the corresponding oncofetal protein . The monoclonals that target these proteins are effective in both diagnosing the presence of shed antigen representing tumor markers in the serum, are capable of detecting the presence of early as well as late transformation within normal appearing cells, and when delivered intravenously, can hunt, seek and destroy any cell expressing the antigen . A recent publication by arlen et al from our group covers how our monoclonals effect the clinical activity of colon and pancreas cancer and also serve to diagnose the presence of such lesions by elisa and ihc 20 . Considering that the monoclonals we are employing induce a number of different antitumor responses in addition to adcc and that the effect on tumor can occur within several hrs of administration, it appeared ideal to employ monoclonal antibody therapy in patients with recurrent tumor having failed chemotherapy such as those with metastatic pancreas and colon cancer . We are hoping that as trials progress, that we can show major changes in clinical response when the naked antibody is delivered in combination with chemotherapy and that a possible follow up to the initial antibody approach will be delivery of the antibody conjugated with an alpha emitter and possible addition of immune stimulants to further enhance an overall clinical response . While many different approaches have been investigated in terms of controlling cancer growth including use of those monoclonal antibodies that minimize vascular proliferation or attack epidermal growth factors as well as blocking signaling pathways thru tyrosine kinase inhibitors, we believe that the precision biologic approach using targeted monoclonal therapy is one of the more effective approaches to utilize . When delivered initially as a naked therapeutic monoclonal antibody and later in combination with other antitumor agents, it is felt that this approach can offer the best possibility for achieving a cure, even in the metastatic setting . Later on, as we achieve our goals in targeting recurrent tumors with our therapeutic antibodies, the use of peptide vaccines, several which have already been designed, will be introduced to help prevent the high rate of recurrence of malignancy seen after complex operations such as the whipple (pancreatectomy). Initial evaluation of 12 - 20 mer peptides derived from the epitope binding sites on the altered taa from which the monoclonals have been derived; suggest that such epitopes when delivered in the form of a peptide vaccine can turn on the full immune response . Further on in the future, we may consider employing polyvalent peptide combinations to possibly prevent the development of a malignant disease process similar to what can achieve by employing antiviral vaccines.
Hormones, paracrines, autocrines and other mediators define the permeability of the endothelial barrier, the anti - thrombotic nature of the endothelial cell surface and endothelium - dependent blood pressure regulation (reviewed in current special issue; and in libby 2002; luscher 1990; landmesser and drexler 2007; vierhapper et al . 1990; wojciak - stothard and ridley 2002; palmer et al . Endothelial mechanobiology is a young field of research and little is known about mechanics - dependent signaling pathways . This is mainly due to the lack of proper techniques to quantify mechanics in living cells . Over the last decade, however, considerable progress has been made in various techniques, such as atomic force microscopy, laser tweezers, optical trap, pipette aspiration and microrheology . Experimental science is now equipped with a full tool kit facilitating the investigation of cellular mechanics and its physiological relevance (lee and lim 2007; van vliet et al . . This review will highlight recent advances in the field of endothelial nanomechanics and its impact in endothelial physiology . Mechanobiology of the vascular system can be separated into cell mechanics and mechanical stimuli . On the one hand, external forces like fluid shear stress (fss), vessel wall tension, vascular hydrostatic pressure and cell cell contacts determine the mechanical stimuli in the cardiovascular system . These stresses affect endothelial function via mechanotransduction, i.e., activation of mechanosensitive pathways (tzima 2006; ando and yamamoto 2009; shyu 2009; johnson et al . The corresponding mechanosensors exhibit various elements, including mechanosensitive ion channels, adhesion proteins, tyrosine kinase receptors, or caveolae (liu et al . 2013). Cell mechanics, on the other hand, describes the dynamics of cell (and tissue) elasticity, measured as mechanical stiffness and its impact on endothelial physiology . In more detail, the four most prominent and mechanically distinct compartments in the endothelium are (1) the glycocalyx, (2) the cell cortex, (3) the cytoplasm and (4) the nucleus (kasas et al . 2005; dahl et al . 2008; oberleithner et al . 2009, 2011; martins et al . 2012; weinbaum et al . 2007). Recently, nanomechanics has come into the focus of research as it turned out that the stiffness of the single cellular compartments has a crucial impact on endothelial cell function . To understand the exact meaning of cell mechanics and its impact upon physiological mechanisms, it is important to define the molecular basis of the nanomechanical properties and to characterize their influence on cellular signaling processes . The endothelial glycocalyx (egc) is a thick carbohydrate - rich layer, lining the luminal side of the endothelial surface that consists of proteoglycans and glycoproteins . The proteoglycans are decorated with long carbohydrate side chains, the glycosaminoglycans, among which heparan sulfate is the most prominent in the egc . This mesh serves as a host for specific plasma proteins, soluble proteoglycans and hyaluronic acid . Together, they form a dynamic and complex interface between blood and tissue (fig . 1). The total volume of the egc in the human body is about 1.7 l and its thickness varies from a few hundreds of nanometers in capillaries to a few micrometers in arteries (van den berg et al . 2006, 2008). Due to its high water content and the loose network, the egc is several times softer than the underlying subcellular structures (oberleithner et al . Glycocalyx and cytoskeletal organization of endothelial cells determine the mechanical characteristics of the endothelium cellular nanomechanics . Glycocalyx and cytoskeletal organization of endothelial cells determine the mechanical characteristics of the endothelium one hallmark function of the egc is the transmission of biochemical and biomechanical signals from the blood into endothelial cells . Different processes are known that alter the nanomechanical properties of the egc . As a polyanionic bio - gel, its volume and mechanics are regulated by the respective electrolyte concentration (wolf and gingell 1983; peters et al . It has been shown that an extracellular sodium concentration in the upper physiological range leads to a compact egc (= collapse; oberleithner et al . In contrast, treatment of endothelial cells with the polyphenol - rich compound ws1442 induces an increase in volume (= swelling) of the egc (peters et al . . The specific mechanisms of collapse and swelling depend on dominant interactions in the system (hydrogen bondings, ionic interactions, hydrophobic / hydrophilic properties, etc .) (quesada - perez et al . 2011). Other processes, which modulate the nanomechanics of the egc, are shedding and biosynthesis . Both can be induced by biochemical factors like hormones and enzymes (reitsma et al . 2007) or by fss (gouverneur et al . 2006; zeng and tarbell 2014). Enzymatic digestion of heparan sulfate as well as treatment of endothelial cells with thrombin, lipopolysaccharides, or tumor necrosis factor compromises the structural integrity of the egc leading to reduced egc volume and stiffness (peters et al . In contrast, the biosynthesis of the egc after enzymatic degradation leads to an increase in volume and a decrease in stiffness, as has been shown in vitro (bai and wang 2012). The egc is the very first layer of the endothelium that comes into contact with blood . Thus, alterations of egc nanomechanics lead to a change in the mechanical interaction between blood cells and the egc constituents . It is likely that a collapsed egc can be less deformed by fss and thereby becomes unable to transmit signals into the cell adequately, a condition that can promote cardiovascular disease . Additional to their function as fss transmitters, the proteoglycan - associated heparin sulfate residues serve as attachment points for sodium ions and substances like albumin and other blood - borne proteins, hormones and enzymes (siegel et al . 1996; reitsma et al . 2007; quinsey et al . 2004; kato 2002; li et al . 1998; ballinger et al . 2004 for instance, increased plasma sodium concentration leads to a stiffening of the glycocalyx and simultaneously increases cellular sodium uptake (korte et al . 2a) is supposed to stand for a fully - functional endothelium, whereas a shedded or collapsed egc most likely exerts adverse effects on the vascular system . 2b), facilitates edema formation (salmon and satchell 2012; strunden et al . 2010), cell vessel wall interactions (constantinescu et al . 2003; henry and duling 2000; mulivor and lipowsky 2004), loss of fss perception (thi et al . 2004; mochizuki et al . 2003) and endothelial dysfunction (nieuwdorp et al . 2005, 2006; drake - holland and noble 2012). 2c) has been discussed as being a promoter of vascular diseases (peters et al . C acute collapse leads to similar functional changes as described in b but egc nanomechanics are different egc stiffness in endothelial function . C acute collapse leads to similar functional changes as described in b but egc nanomechanics are different crossing the cell membrane, the first significant mechanical compartment inside the cell is, directly underneath the plasma membrane, the cell cortex . Due to the three - dimensional cytoskeletal organization, the cell cortex as well as the cytoplasm and the nucleus, can be characterized by their distinct cytoskeleton - dependent nanomechanical properties (oberleithner et al . 2009; kasas et al . 2005; dahl et al . 2008; martins et al . 2012). Directly beneath the plasma membrane (50200 nm), actin is organized in form of a dynamic network (fig . 1) (miranda et al . 1974; koning et al . 2008). The cortical web, also known as peripheral actin, is made of cross - linked actin filaments (f - actin) that provide a supportive structure to the plasma membrane and its embedded proteins (pollard and cooper 2009). The organization of the cortical cytoskeleton is highly dynamic as the actin filaments are regulated by a variety of actin binding proteins (dos remedios et al . Additionally, actin polymerization is stimulated by cdc42 and rac1, both members of the rho gtpase family . Cortactin and other proteins, such as filamin or fascin, stabilize the actin web by cross - linking filaments . Destabilization of the cortical actin network due to filament disassembly is induced by cofilin, gelsolin, or rhoa . Finally, motor proteins are able to cross - link actin filaments and simultaneously facilitate the force administration to the cortical web (dos remedios et al . . A high rate of actin polymerization and a dense filament organization go along with a relatively stiff cortex, whereas a depolymerization of f - actin results in cortical softening (kasas et al . 2005). Filamin a and/or -actinin cross - link actin filaments and subsequently lead to an increased stiffness of the actin web (esue et al . 2009; kasza et al . Furthermore, motor proteins (e.g., non - muscle myosin ii) contribute to cortical stiffness as they generate contractile forces within the filament network . By this, motor proteins induce a lateral tension within the cortical network leading to an inward directed tension (paluch et al . There is evidence that nanomechanics of the cell cortex has significant influence on endothelial physiology (hoffman and crocker 2009; paluch et al . In particular, nitric oxide (no) release and barrier function, both hallmarks of endothelial function, appear to be influenced by cortical nanomechanics . In the vascular endothelium, a softening of the cell cortex induces no synthesis and thereby is likely to facilitate vasodilation followed by an increase in tissue perfusion and decrease of blood pressure (oberleithner et al . 2007, 2009; szczygiel et al . 2011). Under certain physiological conditions, plasma potassium concentration can increase locally up to 12 mm, e.g., due to muscle or neuronal activity (nordsborg et al . 2003; kofuji and newman 2004), which induces a rapid decrease in cortical stiffness (oberleithner et al . 2009). This softening of the cell cortex is driven by a membrane potential - dependent depolymerization of the submembranous actin web (callies et al . A decrease in cortical stiffness is generally caused by a destabilization of the cortical actin web, which verifies the physiological link of elasticity, actin organization and endothelial function (fels et al . 2012). Simultaneously, the activity of the endothelial no synthase (enos) increases (fig . Firstly, it has been shown that enos activity is stimulated by an association with g - actin while it is inhibited by an association with f - actin (kondrikov et al . A decrease in cortical stiffness due to f - actin depolymerization may increase the association of enos with g - actin and therefore directly stimulates no release (fels et al . Mechanosensitive calcium channels in a flexible membrane are supposed to be readily activated by shear stress and subsequently increase intracellular calcium levels (knudsen and frangos 1997; kuchan and frangos 1994; galan et al . 2011). As enos is activated by the calcium - binding protein calmodulin, a soft cortex is likely to promote no release . Since no is a vasodilating gas, softening - induced enos activity will lead to increased tissue perfusion furthermore, blood pressure may decrease in case of systemic softening of the endothelial cortex.fig . Softening of the cell cortex, induced by cortical actin depolymerization, decreases membrane abundance of enac and endothelial sodium uptake and increases enos activity and increases endothelial barrier function cortical stiffness influences endothelial function . Softening of the cell cortex, induced by cortical actin depolymerization, decreases membrane abundance of enac and endothelial sodium uptake and increases enos activity and increases endothelial barrier function interestingly, these modulations of cortical stiffness and enos activity are independent of the bulk nanomechanics of the endothelial cells (oberleithner et al . 2009; fels et al . 2012). While, under physiological conditions, potassium concentrations may rise to a larger extent only locally, other mediators potentially act more systemically, i.e., on the whole vasculature . The mineralocorticoid hormone aldosterone, as well as the cytokine tumor necrosis factor alpha (tnf), induce transient cortical softening associated with an increase in no release (fels et al . Interestingly, sustained exposure to aldosterone or tnf results in an opposite effect, described in detail in the subsequent section . In addition to the regulation of enos activity, other vascular mechanisms such as endothelial permeability are influenced by cortical nanomechanics . Since the link between no synthesis and cortical stiffness is the dynamic reorganization of the cortical actin cytoskeleton, it was hypothesized that the stiffness - dependent barrier function is again based on cortical actin dynamics . This hypothesis is verified by the finding that exposure to sphingosine-1-phosphate increases peripheral (cortical) stiffness in pulmonary endothelial cells and thereby increases barrier function . The barrier - enhancing effect is most likely mediated via a signaling cascade including cortactin activation and subsequent actin filament formation in the cell cortex (arce et al . In contrast, thrombin acts as the counterpart in regulation of endothelial permeability as it decreases cortactin in the cortex and at the same time increases permeability (arce et al . Stimulation of myosin activity, as a second important determinant of cortical stiffness, leads to an increase in barrier function (dudek et al . Hence, it may be concluded that a soft cell cortex indicates a physiological function of the endothelium . In analogy to cortical softening, increased polymerization of cortical actin and concomitant stiffening of the endothelial cell cortex has (patho-)physiological consequences in the control of endothelial permeability and the response to hormone action (hall 1984; birukova et al . Endothelial stiffening by the c - reactive protein and the cathelicidin ll-37 peptide is found to have anti - inflammatory effects, possibly due to a decrease in endothelial permeability (kusche - vihrog et al . 2011; byfield et al . These effects contribute to maintaining tissue fluid homeostasis and hence counteract the increased no production and subsequent drop in blood pressure often accompanying acute inflammatory processes and septic shock . 3b), as a cell with a stiff cortex produces reduced amounts of no (oberleithner et al . 2007, 2009; kidoaki and matsuda 2007; fels et al . 2010). The phenomenon increased endothelial cortical stiffness / reduced no release was recently termed stiff endothelial cell syndrome (secs) (lang 2011). Diminished no release and thus a shift of endothelial action towards increased vasoconstriction, is also the hallmark of endothelial dysfunction, a clinical predictor for expecting cardiovascular diseases later in life (endemann and schiffrin 2004; schachinger et al . One of the crucial prerequisites leading to an increase in endothelial stiffness and a reduced no production is a rather high plasma aldosterone level, a major risk factor for vasculopathies . Upon prolonged treatment (> 20 min) with aldosterone, endothelial cells swell (oberleithner et al . Both of these effects are blocked either by the specific epithelial sodium channel (enac) blocker amiloride or by the aldosterone antagonist spironolactone . Both prevent a (further) augmentation in endothelial stiffness upon raising extracellular sodium concentrations from 135 to 145 mm in the presence of aldosterone (oberleithner et al . Incidentally, these two factors, aldosterone and high sodium, also cause an increase in enac surface expression (kusche - vihrog et al . 2008; korte et al . 2012), indicating a key role of aldosterone in controlling enac activity by increasing the channel s abundance at the endothelial cell surface (alvarez et al . 2002; snyder 2002). Enac is widely abundant in various tissues throughout the human body, including epithelia tissues where this sodium channel mediates the rate - limiting step of sodium transport (garty and palmer 1997; golestaneh et al . 2001). In vascular endothelium, enac is different, as the major portion of sodium exits the blood capillary system through a more or less leaky paracellular pathway (mehta and malik 2006). Also, the enac expression level is clearly lower as compared to epithelial tissues (kusche - vihrog et al . Recently, a direct link between enac expression and no release has been established, suggesting the functional role of enac in the vascular endothelium (jeggle et al . 2013). Cells with elevated enac expression exhibit an increase in mechanical cortical stiffness in vitro and ex vivo . Taken together, enac determines cortical endothelial stiffness and plays a major role in endothelial (dys)function contributing to the control of vascular tone . The mechanistic basis of the link between enac and endothelial stiffness most likely relies on the direct interaction of enac with f - actin located in the subapical pool underneath the plasma membrane (mazzochi et al . Alterations in cortex formation upon changes in the enac surface expression could thus also be ascribed to this interaction, as it might increase actin polymerization in this compartment and hence increase cortical stiffness . The sequence of events, whether enac membrane insertion promotes actin polymerization or vice versa, has not yet been elucidated . In addition to chemical mediators, mechanical stimuli affect actin organization (most likely influencing cortical stiffness) and endothelial function . An in vitro increase in hydrostatic pressure, mimicking blood pressure in vivo, induces actin reorganization and affects endothelial permeability (shin et al . Fluid shear stress influences actin reorganization (seebach et al . 2007) and alters the endothelial barrier (tarbell 2010; katoh et al . Finally, substrate stiffness was shown to induce actin polymerization, modulating barrier function in a dose - dependent manner; substrate stiffness simulating physiological conditions improves barrier function while stiffer and softer substrates disrupt barrier function (birukova et al . The elasticity of the cell cortex can be seen as a parameter that determines endothelial physiology in a more general way . For instance, aging cells lose their elasticity due to an increased cytoskeletal organization (sokolov et al . 2006; schulze et al . 2010). Even basic processes that usually occur in cellular life, such as mitosis, differentiation and development, can be related to changes in cortical stiffness (stewart et al . 2011; patel et al . 2012; kidoaki and matsuda 2007; hoffman and crocker 2009). Fountain of youth and guarantees a reasonably low blood pressure and a healthy organism . Apparently, the physiological impact of cortical stiffness on physiological mechanisms is highly tissue - specific . In contrast to the endothelium, a soft cortex can even indicate a pathophysiological state of a cell . In ventricular myocytes, for instance, the relationship between elasticity and no release appears to be different . There, an inhibition of myosin by blebbistatin decreases cell stiffness and simultaneous inhibits nos activity (walsh and cole 2013; dedkova et al . Furthermore, it has been shown that the metastatic behavior of cancer cells directly correlates with the cell s elasticity . Cancer cells with a low elasticity (soft cells) are more likely to spread than stiffer ones (ketene et al . Additionally, breast cancer cells induce softening of the endothelium to ease extravasation, leading to facilitated metastasis formation (mierke 2011). While single actin filaments are predominantly found in the cortex, actin stress fibers (bundles of 1030 filaments) span the whole cytoplasm . They also contribute to focal adhesions and thus are involved in the mechanisms of cell motility (pellegrin and mellor 2007; fletcher and mullins 2010; prasain and stevens 2009). Microtubules are tube - like polymerized protein (tubulin) filaments facilitating the transport of organelles and vesicles . Both microtubules and intermediate filaments determine cytoplasmic (bulk) stiffness (wang 1998; janmey et al . 1991; kasas et al . 2005; herrmann et al . The molecular nature of the contribution of tubulin to cell nanomechanics has been investigated in detail (gardel et al . So far, the microtubule network is supposed to represent a compressive load - bearing component that counteracts the tensile forces generated by the cortical actimyosin web (ingber 2003). The physiological relevance in stiffness - dependent signaling pathways in endothelial cells is, however, still unclear . What is known so far is that microtubule - associated proteins (e.g., map65) directly influence the flexibility of single microtubules, most likely resulting in a change in cellular elasticity (portran et al . Furthermore, in the developing organ of corti, the fibroblast growth factor induces a microtubule - dependent decrease in cell stiffness leading to hearing loss (szarama et al . Intermediate filaments, of which vimentin is the dominant network - forming member in the endothelium, support the three - dimensional organization of the cell and its organelles (kamei 1994). Their mechanical properties as well as their contribution to cell mechanics have been reviewed by herrmann et al . Intermediate filaments play a key role in mechanotransduction as mutation or deletion of several intermediate filament proteins leads to cell fragility, heart failure and muscle dystrophies . Even leucocyte diapedesis and endothelial nitric oxide release depend on proper intermediate filament formation (herrmann et al . Although the role of intermediate filaments in (endothelial) physiology is well documented and the molecular contributions to cell mechanics are known, evidence for a direct link between intermediate filament - dependent mechanics and endothelial function is still missing . Data on intermediate filament and microtubule mechanics and its impact on endothelial physiology indicate that several different nanomechanical signaling pathways exist that await future investigation . Each individual component of the cellular cytoskeleton described in the previous sections is directly linked to the cell nucleus . Plectin (nesprin-3) provides a link to the cytoplasmic network of intermediate filaments (wilhelmsen et al . 2005), whereas nesprin-1/2 mediates binding to microtubules and the actin network (padmakumar et al . Nesprins connect cytoskeletal networks with the intranuclear lamin network via sun 1/2 proteins (haque et al . It is therefore conceivable that all of the mechanical stimuli perceived by the cell through actin, microtubule, or intermediate filament networks are integrated on the level of the nuclear lamina . Similar to the cortical mechanics, the nucleus of an eukaryotic cell could also be an important contributor to the overall mechanics of the cell . Nuclei of several cell types have been shown to be two- to ten - fold stiffer than the respective cytosol (martins et al ., the cell nucleus could be envisioned as being a supramolecular shock absorber capable of withstanding considerable stress (dahl et al . A connection between cytoskeleton and the nuclear envelope further strengthens the notion of a direct involvement of the nucleus in mechanosensing and mechanotransduction (maniotis et al . Recently, the pioneering work from the laboratory of dennis discher demonstrated that the nucleus can serve as an intracellular mechanostat (swift et al . 2013), a structure that is able to sense and respond to changes in the mechanical properties of the cellular environment by changing its own stiffness (fig . Elasticity of the cell nucleus regulates gene expression and endothelial function nuclear elasticity in endothelial function . Elasticity of the cell nucleus regulates gene expression and endothelial function in the light of recent advances in the field of nuclear mechanics, it is tempting to speculate that nuclei of endothelial cells could be directly involved in mediating physiological functions in response to mechanical stimuli . Nuclei of endothelial cells are particularly large in comparison to those of other cell types . Nuclei bulge into the lumina of blood vessels, thus being directly exposed to the shear strain exerted by the blood flow . Consequently, any change in nuclear volume and/or stiffness could have a strong influence on blood flow, in particular in vessels of small inner diameters . According to hagen - poisseulle s law thus, a small change in nuclear volume, as shown and quantified in vascular endothelium in response to aldosterone (oberleithner et al . Bulging nuclei could be a significant hindrance for blood flow, in particular when the nuclei stiffen at the same time . In addition, nuclei of the cells exposed to shear stress stiffen (fig . Apparently, flattening and stiffening of the nuclei could be the consequence of a shape change induced by shear forces . However, the recovery in shape and, at the same time, the maintenance of nuclear stiffness upon release of the shear forces, point towards a more complex nuclear remodeling mechanism . The question, whether the expression of the lamin a network at the nucleoplasmic side a major determinant in the control of the nuclear envelope plasticity (lammerding et al . 2006)is responsible for the nuclear mechanostat function, remains open (swift et al . There is another reason indicating a potential role of lamin a in the regulation of nuclear plasticity . A mutation of lamin a, which results in an irreversible (permanent) anchoring of the mutated product in the nuclear envelope, results in a severe clinical manifestation termed hutchison - gilford progeria syndrome (hgps) (merideth et al . Affected individuals undergo drastically accelerated aging and die in their teens of cardiovascular - related diseases such as stroke or myocardial infarction (gerhard - herman et al . 2012). At tissue level, major arteries of hgps patients demonstrate a severe degeneration of the smooth muscle cell layer (stehbens et al . The role of endothelial cells in the development of the syndrome has not been fully assessed to date . However, at the level of individual cell nuclei, the presence of a mutated rigid lamin a network at the inner side of the nuclear envelope has been linked to significant stiffening of such nuclei (philip and dahl 2008). It is therefore tempting to speculate that stiff nuclei cause an overall stiffening of the endothelial cell . This could result in a severe form of the stiff endothelial cell syndrome (lang 2011). In this case, the ability of the endothelial cell of sensing and responding to mechanical stimuli might be disrupted . As a result, the downstream signaling directed towards vascular smooth muscle is expected to be impaired, possibly explaining the degradation of vascular smooth muscle cell layer in hgps . In summary, the question, whether nuclear mechanics follows mechanical alterations evoked from the exterior environment as postulated by the nuclear mechanostat theory (swift et al . 2013) and/or whether any changes in nuclear elasticity could primarily alter endothelial function, will be an exciting area of cell research in the near future . In conclusion, the elastic properties of the four compartments, (1) glycocalyx, (2) cortex, (3) cytoplasm and (4) nucleus, are mainly determined by the composition of the respective structural elements . The dynamic interactions between those elements with cross - linker and motor proteins determine the mechanical properties of the respective region . Nanomechanics provides information on the physiological state of the endothelial cell in terms of nitric oxide release and barrier function . A soft cell cortex, combined with a soft, well - hydrated glycocalyx, increases no formation, which is a prerequisite for a functionally intact vasculature . Any changes in elasticity at the level of the egc glycocalyx, the cell cortex and the cell nucleus, can have a significant influence on endothelial function in terms of local blood flow, tissue perfusion and, finally, arterial blood pressure.
The natural history for these hernias is progressive enlargement if left untreated and many of these patients undergo elective repair with synthetic mesh for symptomatic or cosmetic reasons . Also, the sequelae of potential complications, such as bowel incarceration or strangulation, result in greater morbidity and mortality in cirrhotic patients . This case report discusses one of such patients, who presented with eviscerated bowel through a long - standing umbilical hernia and describes the surgical management employed . A 50-year - old caucasian male with a long - standing history of cirrhosis, secondary to chronic alcohol abuse and hepatitis c infection, presented to the emergency department with evisceration of his small bowel through an existing umbilical hernia (fig . 1). The patient had a complicated course of liver disease marked by recurrent ascites and hepatic encephalopathy . Two years prior, the patient had his umbilical hernia primarily repaired; however, he developed a recurrence of the umbilical hernia secondary to recurrent and refractory ascites . The patient stated that he suddenly noticed protrusion of bowel through his umbilical skin after a sudden coughing bout several hours prior to presentation . The patient also reported copious drainage of ascitic fluid through the hernia site following the evisceration . Following his surgery, the patient spent 7 days in the icu after which he was transferred to a medical surgical floor and subsequently discharged with normal bowel function and in stable condition . Patients with ascites in the setting of cirrhosis have an 20% chance of developing an umbilical hernia . In the presence of persistently increased intra - abdominal pressure, points of weakness in the abdominal wall are potential sites of herniation . The linea alba is discontinuous at the umbilicus and thus is one point of weakness . Furthermore, this patient had an albumin level of 1.8 g / dl suggesting chronic nutritional deficits that could potentially lead to weakened abdominal fascia . Evisceration of small bowel through an existing umbilical hernia is a rare and potentially fatal complication of umbilical hernia in the presence of recurrent ascites . There is a reported case of omental evisceration through an umbilical hernia in a patient with a similar history of cirrhosis and hepatitis c . Similar to our patient, this occurred following an acute increase in intra - abdominal pressure . Evisceration of abdominal contents puts the patient at risk for incarceration, infection and necrosis . A 2011 study performed by erasmus university researchers found that surgical repair of an umbilical hernia in a patient with ascites due to cirrhosis is preferable to conservative treatment . The complications of the umbilical hernia appear to be a greater cause of mortality and morbidity than the surgical repair . In summary, small bowel evisceration is a rare but serious and potentially fatal complication of umbilical hernia in cirrhotic patients with refractory ascites . This case is the first - in - literature depicting spontaneous evisceration of bowel in a cirrhotic patient with a recurrent umbilical hernia.
In advanced stages, solid tumors can metastasize to various organs, including the central nervous system . In particular, breast, lung and prostate cancer metastases current operative concepts are focused on lesions to the vertebra, while metastases to non - osseous spinal structures are rare and usually associated with advanced disease . The ongoing advancements in oncologic therapies have led to improvements in the life expectancy of cancer patients, even in palliative situations . Therefore, an increasing incidence of the formerly rare symptomatic leptomeningeal metastases (lm) should be expected . Lm cause obstruction of cerebrospinal fluid (csf) circulation and compression of neurologic tissues . The differential diagnosis of lm includes ruling out a wide range of malignant and benign conditions, such as congenital and degenerative lesions, infectious and autoimmune diseases and neurinoma . The radiologic discrimination between metastases and neurinomas is primarily based on distinct neuroimaging features, particularly number, size and growth pattern . Whereas lm are often encountered as multiple small nodules at ower spinal structures (e.g. The cauda equina), presumably due to gravity, neurinomas appear as single lesions in the neuroforamen and might present at any height . The clinical presentation of lm depends on the location and growth - pattern, often resulting in general symptoms such as nausea and head - aches due to interruption of the csf flow and, later signs of myelopathy due to compression of the spinal cord . On the other hand, neurinomas usually affect single nerve roots with typical clinical symptoms in the associated dermatomes and peripheral nerves . The present study reports the first case of a solitary leptomeningeal metastasis, mimicking a benign dumbbell - shaped neurinoma of a cervical nerve - root that was successfully treated with surgery and adjuvant radiochemotherapy (rct). A 47-year - old woman was referred to our institution because of progressive unilateral arm elevation weakness with an onset 8 weeks prior . She presented with a clearly visible atrophy of the biceps and triceps muscles and substantial reduction of both muscular strength in arm elevation and elbow flexion and extension . Neurological examination revealed hyperactive biceps and triceps tendon reflexes and hypesthesia confined to c57 dermatomes, indicating cervical myelopathy . The patient was diagnosed with breast cancer (bc) 9 years earlier and underwent unilateral mastectomy (pt2 m, pn3a, m0, g2, r0, estrogen receptor (er) immunoreactive score (irs) 12, progesterone receptor (pr) irs 4, and human epidermal growth factor receptor 2 (her2/neu) negative). Five years later, supraclavicular lymph node - metastases on her right side were found; again, the patient declined chemotherapy . Six months later, a brain metastasis was diagnosed and rct was initiated (corticosteroids, bevacizumab and capecitabine). The patient rejected being treated with zoledronate for suspected bone metastasis, and she aborted rct 14 months later . Until the occurrence of the current neurologic symptoms, regular follow - up examinations showed that the patient had stable disease . After admission, total spine and cranial magnetic resonance imaging (mri) scans were performed and revealed the previously diagnosed right parietal intracerebral metastasis and a solitary lesion in the cervical spinal canal . The spinal tumor was located in the right neural foramen between c3/4 with an extraforaminal extension, thereby compressing the cervical plexus at levels c35 . Thus, the neuroimaging findings were consistent with a dumbbell - shaped neurinoma (fig . An abdominal staging computed tomography (ct) scan and a three - phase bone scintigraphy showed no further lesions . The case was reviewed at an interdisciplinary tumor board, and according to the histological findings, resection followed by adjuvant therapy was recommended . Surgery was performed under general anesthesia using a ventral approach to the cervical spine, with the patient in the supine position . After microsurgical exposure, the tumor presented as completely intradural with the characteristic appearance of a neurinoma (fig . 2). Following resection of the intraspinal tumor and corpectomy, the vertebral bodies c3 and c4 were replaced (pyramesh - cage, medtronic gmbh, meerbusch, germany) and ventral plate - stabilization (cslp, synthes gmbh, umkirch, germany) from c25 was performed (fig . The intraoperative rapid frozen section showed disorganized nerve root tissue with cell nests of unknown entity . The definitive histological examination of the tissue revealed epitheloid cells with irregular and hyperchromatic nuclei and scattered mitosis arranged in nests embedded in stroma rich in collagen fibers (fig . Immunohistochemical staining revealed that the tumor cells were positive for cytokeratin (ck) 8 (fig . The final histopathology report specified the tumor as a metastatic lesion originating from the previously diagnosed bc . Postoperatively, the patient presented with minor dysphagia, which was treated effectively by logopedic therapy . While the muscular weakness of the arm showed no significant changes during the inpatient stay, there was a clear improvement in the hypesthesia at the c57 dermatomes . The patient was transferred to a medical oncology service and received combined rct . At the last follow - up, 3 months after the operation, the neurologic symptoms were unaltered, and a spinal mri showed no signs of local recurrence (fig . 5). A 47-year - old woman was referred to our institution because of progressive unilateral arm elevation weakness with an onset 8 weeks prior . She presented with a clearly visible atrophy of the biceps and triceps muscles and substantial reduction of both muscular strength in arm elevation and elbow flexion and extension . Neurological examination revealed hyperactive biceps and triceps tendon reflexes and hypesthesia confined to c57 dermatomes, indicating cervical myelopathy . The patient was diagnosed with breast cancer (bc) 9 years earlier and underwent unilateral mastectomy (pt2 m, pn3a, m0, g2, r0, estrogen receptor (er) immunoreactive score (irs) 12, progesterone receptor (pr) irs 4, and human epidermal growth factor receptor 2 (her2/neu) negative). Five years later, supraclavicular lymph node - metastases on her right side were found; again, the patient declined chemotherapy . Six months later, a brain metastasis was diagnosed and rct was initiated (corticosteroids, bevacizumab and capecitabine). The patient rejected being treated with zoledronate for suspected bone metastasis, and she aborted rct 14 months later . Until the occurrence of the current neurologic symptoms, regular follow - up examinations showed that the patient had stable disease . After admission, total spine and cranial magnetic resonance imaging (mri) scans were performed and revealed the previously diagnosed right parietal intracerebral metastasis and a solitary lesion in the cervical spinal canal . The spinal tumor was located in the right neural foramen between c3/4 with an extraforaminal extension, thereby compressing the cervical plexus at levels c35 . Thus, the neuroimaging findings were consistent with a dumbbell - shaped neurinoma (fig . 1a the case was reviewed at an interdisciplinary tumor board, and according to the histological findings, resection followed by adjuvant therapy was recommended . Surgery was performed under general anesthesia using a ventral approach to the cervical spine, with the patient in the supine position . After microsurgical exposure, the tumor presented as completely intradural with the characteristic appearance of a neurinoma (fig . 2). Following resection of the intraspinal tumor and corpectomy, the vertebral bodies c3 and c4 were replaced (pyramesh - cage, medtronic gmbh, meerbusch, germany) and ventral plate - stabilization (cslp, synthes gmbh, umkirch, germany) from c25 was performed (fig . The intraoperative rapid frozen section showed disorganized nerve root tissue with cell nests of unknown entity . The definitive histological examination of the tissue revealed epitheloid cells with irregular and hyperchromatic nuclei and scattered mitosis arranged in nests embedded in stroma rich in collagen fibers (fig . Immunohistochemical staining revealed that the tumor cells were positive for cytokeratin (ck) 8 (fig . The final histopathology report specified the tumor as a metastatic lesion originating from the previously diagnosed bc . Postoperatively, the patient presented with minor dysphagia, which was treated effectively by logopedic therapy . While the muscular weakness of the arm showed no significant changes during the inpatient stay, there was a clear improvement in the hypesthesia at the c57 dermatomes . The patient was transferred to a medical oncology service and received combined rct . At the last follow - up, 3 months after the operation, the neurologic symptoms were unaltered, and a spinal mri showed no signs of local recurrence (fig . These intraforaminal lesions are usually amenable to microsurgical resection with excellent local disease control and good clinical outcome . Differential diagnosis comprises eliminating a multitude of conditions, including primary malignant neoplasms and metastatic disease to the leptomeninges . A range of primary solid malignancies is known to spread into the spine and mimic the growth pattern of intraforaminal tumors . While the incidence of neurinoma reaches 0.30.5/100,000 persons per year, lm of solid tumors are rare and still, lm represents an important neurologic complication of systemic bc with an estimated frequency of 343%, based on clinical research and autopsies . Interestingly, the incidence of lm is on the rise, supposedly because of more effective therapies and therefore, longer survival of bc patients . In neurinomas, a dumbbell - shaped growth pattern accounts for approximately 6% of the cases and these most often affect the cervical followed by the lumbar spine . In contrast, in neuroimaging and autopsy, lm usually occurs as multiple small nodules . Yet, with mri they present with a signal similar to nerve sheath tumors, which tend to be greater in size and occur as solitary masses . While neurinomas are usually located close to cervical and lumbar nerve roots, lm are most frequently found in the lumbar and sacral regions among the conus and cauda equina . This might be explained by the possible mechanisms of metastasis: besides direct transdural invasion, hematogenous or lymphatic dissemination, the most likely route is tertiary spreading from brain tumors via the csf and the effect of gravity might explain the caudal location of the lm . Therefore, localization and growth pattern are the most important indicators for the differential diagnosis . Still, in the present case, the localization, growth pattern and mri signal were concordant with a cervical neurinoma . Typical clinical signs of spinal neurinomas are segmental pain, root pain and motor deficits with varying onset and course, usually progressing slowly . Lm on the other hand are typically associated with headaches and nausea due to disruption of the csf circulation and neurologic deficits of sensory and motor function in the case of compression of the spinal cord or nerve roots . The majority of motor sensory dysfunction caused by lm is found to be of a myelopathic pattern rather than the effect of a single nerve root, and most often affects the lower extremities . While the initial manifestation of lm can occur between several weeks and 17 years following the primary diagnosis of bc, rapid deterioration after the clinical diagnosis is common and the prognosis is poor . Mean survival after diagnosis of lm is about 7.5 months and one - year survival is 1022% . The described case presented with an atypical clinical presentation, consistent with a large neurinoma affecting the cervical plexus . Lm therapy is palliative and aims to prevent further neurologic deterioration and improve the quality of life . For lm, radiotherapy is widely accepted, yet has not been proven to affect overall survival, and systemic as well as local chemotherapy are the focus of recent studies . Until now the present case report emphasizes the importance of the differentiation between benign neurinomas and solitary lm in cancer patients . Surgical treatment combined with adjuvant or neoadjuvant therapy however, a literature search shows that no conclusive optimal treatment has yet been put forth . Considering the growing number of medium- and long - term cancer survivors, future studies should focus on the improvement of diagnostic and therapeutic measures for patients with lm . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . We have no personal or financial conflicts of interest related to the preparation and publication of this manuscript . Following the statutes of the local ethics committee of the university hospital of cologne, no judgment is necessary for case reports with retrospective data - collection of clinical data when the informed consent of the patient is available . C.k.b . Was involved in conception and design of the study, interpretation of the data, and writing of the manuscript . Were involved in the literature analysis and critical review of the manuscript; p.e . And all authors approved the final version of the manuscript.key learning pointsrecognizing the importance of the differentiation between benign neurinomas and solitary leptomeningeal metastasis in cancer patients.recognizing, that surgical treatment combined with adjuvant or neoadjuvant therapy can improve neurologic function and lessen pain.a literature search shows that no conclusive optimal treatment has yet been put forth.considering the growing number of medium- and long - term cancer survivors, future studies should focus on the improvement of diagnostic and therapeutic measures for patients with leptomeningeal metastasis . Recognizing the importance of the differentiation between benign neurinomas and solitary leptomeningeal metastasis in cancer patients.recognizing, that surgical treatment combined with adjuvant or neoadjuvant therapy can improve neurologic function and lessen pain.a literature search shows that no conclusive optimal treatment has yet been put forth.considering the growing number of medium- and long - term cancer survivors, future studies should focus on the improvement of diagnostic and therapeutic measures for patients with leptomeningeal metastasis . Recognizing the importance of the differentiation between benign neurinomas and solitary leptomeningeal metastasis in cancer patients . Recognizing, that surgical treatment combined with adjuvant or neoadjuvant therapy can improve neurologic function and lessen pain . Considering the growing number of medium- and long - term cancer survivors, future studies should focus on the improvement of diagnostic and therapeutic measures for patients with leptomeningeal metastasis . Recognizing the importance of the differentiation between benign neurinomas and solitary leptomeningeal metastasis in cancer patients.recognizing, that surgical treatment combined with adjuvant or neoadjuvant therapy can improve neurologic function and lessen pain.a literature search shows that no conclusive optimal treatment has yet been put forth.considering the growing number of medium- and long - term cancer survivors, future studies should focus on the improvement of diagnostic and therapeutic measures for patients with leptomeningeal metastasis . Recognizing the importance of the differentiation between benign neurinomas and solitary leptomeningeal metastasis in cancer patients . Recognizing, that surgical treatment combined with adjuvant or neoadjuvant therapy can improve neurologic function and lessen pain . Considering the growing number of medium- and long - term cancer survivors, future studies should focus on the improvement of diagnostic and therapeutic measures for patients with leptomeningeal metastasis.
The societal burden of seasonal influenza epidemics is quite heavy, with approximately 3 - 5 million cases and 250,000 - 500,000 estimated deaths worldwide every year and a large economic impact, which includes both direct and indirect costs [2, 3]. Conventionally, attention has been directed toward influenza a, which accounts for the majority of influenza cases in most seasons [4 - 7]. Since the 1980s, influenza b viruses have belonged to two antigenically distinct lineages, called the victoria and yamagata lineages; this has constituted a challenge for seasonal influenza vaccines, as only one influenza b strain is included in the trivalent vaccine . Studies in the united states have shown that the frequent influenza b vaccine mismatches of recent years have been associated both with substantial increases in cases, hospitalizations and deaths (up to 970,000 cases, with 8200 hospitalizations and 485 deaths annually, in the usa), and with high influenza - related medical costs and costs due to productivity loss . Despite the important role of influenza b, much of the published scientific literature regarding the epidemiology of influenza has focused on influenza a, and we still have a relatively poor understanding of the global epidemiology and disease burden of influenza b. several studies have reported on the burden of disease attributable to influenza b in a single season, or during consecutive seasons in a single country [12, 13]. In order to improve our understanding of the burden and epidemiology of influenza b, we reviewed the influenza b viruses circulating in italy from 2000 to 2015 . In italy, the influenza sentinel surveillance system (influnet) was implemented nationwide in the 1999 - 2000 season by the influnet working group . Influnet is based on the voluntary participation of an average of 830 (range 648 - 902) general practitioners (including paediatricians) per year, covering about 1.5 - 2% of the national population in all italian regions . The system aims to monitor the incidence of influenza - like illness (ili) and to determine the extent, timing and severity of seasonal epidemics . Gps are asked to report ili cases (defined as acute onset of fever + respiratory symptoms + one of the following symptoms: headache, general discomfort, asthenia) weekly (from week 42 to week 17) using standardized forms . Specific information regarding age (0 - 14, 15 - 64,> 64 years) and influenza vaccine status are also collected . We excluded the first years of data collection and focused the analysis on influnet data collected from the 2005/2006 to 2014/2015 seasons . Influenza virological surveillance in italy is routinely carried out, between week 46 and week 17 of the following year, by the national who (world health organization) influenza centre at the istituto superiore di sanit (nic - iss), in collaboration with a network of 15 peripheral laboratories located in 14 of the 21 italian regions . The main objective of these activities is to rapidly characterize the influenza viruses circulating in the country and to identify antigenic variants emerging in human populations during the winter season, in order to update the vaccine composition, in collaboration with the who and ecdc (european centre for disease prevention and control). During the virological surveillance period, sampling kits are sent out to a random sample of gps participating in the influnet surveillance system, who collect throat swabs from the first ili patients seen each week . Collected swabs are then sent to the regional reference laboratories for influenza diagnosis, and the isolated strains are characterized at the regional laboratory or directly sent to the nic - iss for further molecular and antigenic analyses . Overall results obtained throughout the country are reported to the niciss weekly by means of web - based electronic forms . Every year, approximately 2000 samples are collected, with a proportion of positive specimens of about 34% . A web - based data collection form for the surveillance of severe confirmed hospitalised cases and deaths due to pandemic influenza was drawn up in mid - september 2009 . Since then, regional and local authorities have filled in forms during the influenza season (october - april); the data are analysed weekly at the national level (by the iss and the ministry of health). Our analysis included virological surveillance data collected from the 2010/2011 to 2014/2015 seasons, as all confirmed cases during the 2009/2010 season were due to a / h1n1pdm09 virus . In italy, the influenza sentinel surveillance system (influnet) was implemented nationwide in the 1999 - 2000 season by the influnet working group . Influnet is based on the voluntary participation of an average of 830 (range 648 - 902) general practitioners (including paediatricians) per year, covering about 1.5 - 2% of the national population in all italian regions . The system aims to monitor the incidence of influenza - like illness (ili) and to determine the extent, timing and severity of seasonal epidemics . Gps are asked to report ili cases (defined as acute onset of fever + respiratory symptoms + one of the following symptoms: headache, general discomfort, asthenia) weekly (from week 42 to week 17) using standardized forms . Specific information regarding age (0 - 14, 15 - 64,> 64 years) and influenza vaccine status are also collected . We excluded the first years of data collection and focused the analysis on influnet data collected from the 2005/2006 to 2014/2015 seasons . Influenza virological surveillance in italy is routinely carried out, between week 46 and week 17 of the following year, by the national who (world health organization) influenza centre at the istituto superiore di sanit (nic - iss), in collaboration with a network of 15 peripheral laboratories located in 14 of the 21 italian regions . The main objective of these activities is to rapidly characterize the influenza viruses circulating in the country and to identify antigenic variants emerging in human populations during the winter season, in order to update the vaccine composition, in collaboration with the who and ecdc (european centre for disease prevention and control). During the virological surveillance period, sampling kits are sent out to a random sample of gps participating in the influnet surveillance system, who collect throat swabs from the first ili patients seen each week . Collected swabs are then sent to the regional reference laboratories for influenza diagnosis, and the isolated strains are characterized at the regional laboratory or directly sent to the nic - iss for further molecular and antigenic analyses . Overall results obtained throughout the country are reported to the niciss weekly by means of web - based electronic forms . Every year, approximately 2000 samples are collected, with a proportion of positive specimens of about 34% . A web - based data collection form for the surveillance of severe confirmed hospitalised cases and deaths due to pandemic influenza was drawn up in mid - september 2009 . Since then, regional and local authorities have filled in forms during the influenza season (october - april); the data are analysed weekly at the national level (by the iss and the ministry of health). Our analysis included virological surveillance data collected from the 2010/2011 to 2014/2015 seasons, as all confirmed cases during the 2009/2010 season were due to a / h1n1pdm09 virus . From the 2005/2006 to 2014/2015 seasons, an estimated average number of approximately 4,800.000 ili cases were reported to the surveillance system (tab . The national database that was used for the analysis included 40,000 ili cases, with testing of samples from cases that occurred between 2000/2001 and 2011/2012 . During the study period, several waves of infections by influenza a and b viruses were observed in italy (fig . 1). In detail, 11,488 influenza cases were confirmed in the study period: 9,842 influenza a cases and 1,646 influenza b cases . Influenza a and b viruses co - circulated during most influenza seasons, with numbers of influenza b infections approaching or exceeding those of influenza a virus during three seasons in the study period considered (2001/02, 2007/08 and 2012/13). The number of samples tested for influenza viruses by pcr in italy increased by a factor of 1.5 over this period, from an average of 2,774 per season in the period 2000 - 2007 to an average of 4,312 per season in 2008 - 2012 . Influenza b appeared to be relatively more frequent among older children; a(h1n1)pdm2009 among young and older adults, and a(h3n2) among the elderly . On average, the proportion of influenza b cases on the total of tested samples was 23% (range <1 - 78%) (fig . 2). Distribution of estimated influenza - like illness cases and cumulative incidence by season, italy, 2005/2006 2014/2015 . Distribution of confirmed severe cases, by influenza virus, italy, 2010/2011 2014/2015 . Number of influenza a and b virus infections, italy, 2000/2001 2011/2012 . Influenza b circulation as a proportion of the total percentage of all circulating influenza strains, italy 2001/2002 2010/2011 seasons . From 2010/2011 to 2014/15, on a total of 1,545 severe confirmed influenza cases reported to the surveillance system (tab . I), 102 were confirmed influenza b virus - infected individuals admitted to icu; 2 were pregnant (both in the third trimester); 7 needed extracorporeal membrane oxygenation (ecmo) treatment, and 24 died . The median age was 63 years (range 0 - 92), 58 were male, and 16 were vaccinated almost 15 days before symptom onset . The median age of the individuals who died was 76 (range 39 - 85). Of the 102 severe influenza b patients, 73 belonged to groups recommended for vaccination (65 years and older or a clinical risk group), but only 16 had actually received the seasonal influenza vaccination . Most of the influenza b cases were reported during the 2012/2013 season, when the b virus co - circulated with the a / h1n1pdm09 . From 2010/2011 to 2014/15, on a total of 1,545 severe confirmed influenza cases reported to the surveillance system (tab . I), 102 were confirmed influenza b virus - infected individuals admitted to icu; 2 were pregnant (both in the third trimester); 7 needed extracorporeal membrane oxygenation (ecmo) treatment, and 24 died . The median age was 63 years (range 0 - 92), 58 were male, and 16 were vaccinated almost 15 days before symptom onset . The median age of the individuals who died was 76 (range 39 - 85). Of the 102 severe influenza b patients, 73 belonged to groups recommended for vaccination (65 years and older or a clinical risk group), but only 16 had actually received the seasonal influenza vaccination . Most of the influenza b cases were reported during the 2012/2013 season, when the b virus co - circulated with the a / h1n1pdm09 . Our results on influenza b virus infections in italy are timely, in view of the recent introduction of a tetravalent influenza vaccine containing influenza b viruses of both the victoria and yamagata lineages . Our study reveals that influenza b virus was the predominant overall cause of influenza in two of the 13 influenza seasons from 2000/01 through 2012/13 . However, circulation of the b virus during the inter - pandemic season was always demonstrated . Similar patterns of influenza b virus circulation have been described in the us, europe and hong kong [12 - 13]. In italy, the proportion of influenza b cases in the study period averaged 23% (range <1 - 78%), a value similar to the european (23% (1 - 60%)) and us (24% (<1 - 44%)) averages . In our study, <1% of all ili cases are tested for influenza each season, and very few b viruses were antigenically and genetically characterized, thus reducing the opportunity to identify the co - circulation of the two lineages in italy . However, evidence from two northern italian regions clearly demonstrated a complete or partial mismatch in the 2001/2002, 2004/2005, 2005/2006, 2007/2008, 2008/2009, 2010/2011, and 2011/2012 seasons; this was almost always due to co - circulation of the two lineages [15 - 17]. Influenza is generally recognised as an important disease which causes high excess mortality among the elderly, although children have been shown to play an important role in its transmission [18 - 19]. Unlike the influenza a(h3n2) virus, the b virus predominantly infects children and young adults and is generally recognised as a mild influenza virus . A large study conducted in the us reported that 25% of all influenza - related mortality could be attributed to influenza b virus . This is higher than the percentage seen in the present study, in which influenza b infections accounted for 6% of all influenza virus - related deaths (24/428) during the period considered, but is similar to figures reported for scotland . Among those admitted to icu with influenza b infections, influenza immunisation is recommended in italy for specific groups with an increased risk of complications following influenza infection (e.g.> 65 years old,> 6 months with chronic conditions, healthcare personnel, pregnant women in their second or third trimester etc . ). Only 16% of those treated in icu who should have been vaccinated had received the seasonal influenza vaccine, and 70% of those treated in icu were included in the target categories of national recommendations . The magnitude of the problem created by mismatching between circulating influenza b strains and the influenza b lineage contained in the vaccine varies by season . The most striking recent examples occurred during the 2005 - 2006 and 2007 - 2008 seasons . In 2005 - 2006, the influenza b component of the northern hemisphere influenza vaccine was of the b / yamagata lineage, but 81- 91% of the circulating influenza b viruses antigenically characterized in the us and europe were of the b / victoria lineage, and influenza b was found in 34 - 60% of all samples . Similarly, in 2007 - 2008, the influenza b component of the vaccine was of the b / victoria lineage, but 98 - 99% of the circulating influenza b viruses characterized in the us and europe belonged to the b/ yamagata lineage . Unfortunately, as very few b influenza viruses in italy were genotyped, information on the antigenic characteristics of circulating b viruses was not available at the national level . Our study demonstrates that influenza b virus infections are associated with substantial morbidity and that influenza surveillance and interventions including vaccination and treatment are still suboptimal . Incorporating viral and epidemiological data will help obtain more accurate estimates of influenza disease burden and result in a better selection of strategies for influenza prevention and control.
All authors of this article declare that they qualify for authorship as defined by icmje http://www.icmje.org/#author . Each author has participated sufficiently in the study and take public responsibility for appropriate portions of the content of this article . As this is a case report without patient identifiers, approval from institutional review board (irb) is not required at our institution . To ensure the integrity and highest quality of cytojournal publications, the review process of this manuscript was conducted under a double blind model (authors are blinded for reviewers and vice versa) through automatic online system.
Cu includes physical urticaria, chronic idiopathic urticaria (ciu), and urticarial vasculitis . Approximately, 30 - 40% of patients with ciu have histamine - releasing auto - antibodies directed against either the high - affinity ige receptor, or less frequently, the fc portion of human ige . Clinical studies over the last decade have established that 27 - 61% of ciu patients, depending on the method of antibody detection, have these circulating antibodies in their blood . These autoantibodies are responsible for causing the activation of basophils or mast cells leading to histamine release, which is the central event in cu . The simplest screening method to identify the group of patients with cau is the autologous serum skin test (asst). Intra - dermal injection of autologous serum in these patients elicits an immediate - type wheal and flare response indicating the presence of a circulating histamine - releasing factor in the blood . Patients with cau traditionally suffer from a more severe urticaria with a greater number and wider distribution of wheals, more severe pruritus, and more frequent systemic symptoms . These patients also need systemic steroids more commonly than those with a negative asst . In a recent placebo controlled study, auto - hemotherapy (injection therapy with the patients own blood) was shown to have a beneficial role in cau patients . In another recently conducted trial, autologous serum therapy (ast) was also found to be fairly effective in cu, including cau . In this trial, patients with cu were given weekly intramuscular injections of autologous serum and were monitored for any improvement in the total urticaria severity score (tss). The study reported excellent results and a prolonged remission with this treatment option in patients with cu including cau . We conducted this prospective, open label trial of ast in patients with cau and assessed its efficacy in reducing the tss at the end of treatment protocol as well as over the next 3-months of follow - up . Patients presenting to the outpatient clinic of our department with a diagnosis of cu from february 2010 to february 2011 were assessed for any underlying cause by means of a proper clinical examination and relevant investigation and those with no identifiable cause were assessed for the presence of autoantibodies by performing an asst . Patients with a positive asst were then asked for their consent of participating in this open - label study . Seventy such consecutive patients were recruited for this therapeutic trial after a proper approval from our institutional ethics committee . Patients willingness to come for weekly intramuscular injections and for regular follow - up period was given particular importance during the inclusion process . Patients with a predominantly physical urticaria, patients with other systemic illnesses requiring treatment and pediatric and pregnant patients were excluded from the study . After inclusion into the study, the patients demographic details were recorded and the severity of their urticaria was calculated on the basis of tss . All patients were on antihistaminic drugs at the time of inclusion, and they were advised to continue them in the minimum possible dose . The patients were told to take an h1 antihistamine orally only if their symptoms demanded so . If the patients were on systemic steroids or immunosuppressive drugs, an attempt was made to withdraw the drugs in a gradual fashion, and then stop them completely . Such patients were included in the study after a run - in period of at least 6-weeks after complete withdrawal of these drugs . After calculating the baseline tss, the patients were administered injections of autologous serum intramuscularly in the buttocks once weekly for a total of nine doses . To prepare the autologous serum, 5 ml of the venous blood was withdrawn, and centrifuged at 2000 rpm for 10 min . In this manner, 2 ml of serum was collected in a disposable syringe and was immediately injected back into the patient intramuscularly . During this treatment period of 9 weeks, antihistaminics were allowed only on a need basis . The patients were instructed to keep short - acting antihistaminic drugs at home and to consume the same when absolutely necessary . No other systemic drugs were allowed except the life - saving drugs such as antihypertensives, antidiabetics, anticonvulsants, etc ., each patient was asked about any perceivable reduction in the severity of urticaria as well as the need for antihistaminic drugs at every follow - up injection visit and the same was recorded in the response chart . At the end of the treatment period, the tss was again calculated and the patients were instructed to come for follow - up every 2-weeks for the 1 month and then monthly for the next 2 months . Antihistaminic agents were again allowed only on a need basis . At every follow - up visit, the response to treatment was recorded and the need for antihistaminic drugs was specifically noted down . The final assessment of the patients was carried out at the last follow - up visit, i.e., 3 months after the completion of treatment protocol . Calculation of total urticaria severity score the overall response to the treatment protocol was assessed based on any reduction in the tss from the baseline value at the end of treatment period, and at the last follow - up visit . The response to treatment was rated as excellent (76 - 100% reduction), good (51 - 75% reduction), fair (25 - 50% reduction), and poor (<25% reduction). This score six separate parameters were taken into account as mentioned in table 1 . After calculating the baseline tss, the patients were administered injections of autologous serum intramuscularly in the buttocks once weekly for a total of nine doses . To prepare the autologous serum, 5 ml of the venous blood was withdrawn, and centrifuged at 2000 rpm for 10 min . In this manner, 2 ml of serum was collected in a disposable syringe and was immediately injected back into the patient intramuscularly . During this treatment period of 9 weeks, antihistaminics were allowed only on a need basis . The patients were instructed to keep short - acting antihistaminic drugs at home and to consume the same when absolutely necessary . No other systemic drugs were allowed except the life - saving drugs such as antihypertensives, antidiabetics, anticonvulsants, etc ., each patient was asked about any perceivable reduction in the severity of urticaria as well as the need for antihistaminic drugs at every follow - up injection visit and the same was recorded in the response chart . At the end of the treatment period, the tss was again calculated and the patients were instructed to come for follow - up every 2-weeks for the 1 month and then monthly for the next 2 months . Antihistaminic agents were again allowed only on a need basis . At every follow - up visit, the response to treatment was recorded and the need for antihistaminic drugs was specifically noted down . The final assessment of the patients was carried out at the last follow - up visit, i.e., 3 months after the completion of treatment protocol . Calculation of total urticaria severity score the overall response to the treatment protocol was assessed based on any reduction in the tss from the baseline value at the end of treatment period, and at the last follow - up visit . The response to treatment was rated as excellent (76 - 100% reduction), good (51 - 75% reduction), fair (25 - 50% reduction), and poor (<25% reduction). This score six separate parameters were taken into account as mentioned in table 1 . After calculating the baseline tss, the patients were administered injections of autologous serum intramuscularly in the buttocks once weekly for a total of nine doses . To prepare the autologous serum, 5 ml of the venous blood was withdrawn, and centrifuged at 2000 rpm for 10 min . In this manner, 2 ml of serum was collected in a disposable syringe and was immediately injected back into the patient intramuscularly . During this treatment period of 9 weeks, antihistaminics were allowed only on a need basis . The patients were instructed to keep short - acting antihistaminic drugs at home and to consume the same when absolutely necessary . No other systemic drugs were allowed except the life - saving drugs such as antihypertensives, antidiabetics, anticonvulsants, etc ., each patient was asked about any perceivable reduction in the severity of urticaria as well as the need for antihistaminic drugs at every follow - up injection visit and the same was recorded in the response chart . At the end of the treatment period, the tss was again calculated and the patients were instructed to come for follow - up every 2-weeks for the 1 month and then monthly for the next 2 months . Antihistaminic agents were again allowed only on a need basis . At every follow - up visit, the response to treatment was recorded and the need for antihistaminic drugs was specifically noted down . The final assessment of the patients was carried out at the last follow - up visit, i.e., 3 months after the completion of treatment protocol . Calculation of total urticaria severity score the overall response to the treatment protocol was assessed based on any reduction in the tss from the baseline value at the end of treatment period, and at the last follow - up visit . The response to treatment was rated as excellent (76 - 100% reduction), good (51 - 75% reduction), fair (25 - 50% reduction), and poor (<25% reduction). Out of the total of 70 patients recruited for the study, 11 patients dropped out of the treatment schedule after one or more injections only . Thus, a total of 59 patients completed the study protocol, and were included in the final analysis of the study results . Mean age of the patients was 34.5 11 years with a range of 15 - 60 years . The mean duration of urticaria in the study population was 2.8 years with a range from 3 months to 10 years . About two - thirds (40 out of 59) of our patients did not show any response to the treatment regimens with no significant change in their tss while on treatment . Only 19 patients out of the total of 59 (32%) showed some response by way of a reduction in their tss while they were on treatment with the weekly injections . 5 patients (9% of the study population) achieved a 75 - 100% reduction in tss while on treatment, and thus were categorized as showing an excellent response . Ten other patients showed a good response (50 - 75% reduction) while four patients showed a fair response (25 - 50% reduction in tss) at the end of the treatment regimen [table 2]. Characteristics and response of study group both the responders as well as non - responders were followed up for the next 3 months for any relapse and any further changes in tss . While all the non - responders continued to remain unresponsive during this follow - up period with the regular need for h1 antihistaminics, relapse was seen in 12 patients among the responder group within this period . Thus, at the end of 3-month follow - up we had only seven patients (12.5% of study population) who could be labeled as completely or partially cured with the therapeutic regimen . Among these seven patients, there were five patients who were in complete remission at the end of 12-weeks follow up (tss of 0). These patients had attained a complete remission during the treatment regimen and then remained so over the follow - up period also . There were two more patients who showed 50 - 75% reduction in their tss at the last follow - up visit as compared with the baseline . The mean duration of urticaria in responders and non - responders was 1 and 2 years respectively [table 2]. Similarly, the mean tss at baseline did not differ between these two groups (p = 0.051, unpaired t - test). The mean tss recorded in responders was 12.8 2.2 against 14.1 2.2 in the non - responder group [table 2]. The mean age recorded in the responder group was 28.3 8.9 years in comparison with 37.5 10.7 years for the non - responder group . However, going by the overall low - percentage of patients responding to treatment, this difference does not attain much significance . The male - female ratio was 2:17 among responders against 28:12 among non - responders (p <0.001, chi - square test) [table 2]. This is because of the fact that the moment antihistaminics are withdrawn in these patients, they tend to develop a relapse . This makes this condition quite frustrating for the sufferer, and it is really difficult for the treating physician to make the patients understand why they should need antihistaminic so regularly in their life . To add to it, there are patients who are not able to control their symptoms by antihistaminics alone, and need systemic steroids or other immunosuppressive drugs on a regular or recurrent basis . This is more common in patients with cau who classically have a more severe disease than patients with negative asst . The reason behind this exclusion was that the biological plausibility of autologous serum as a treatment option seemed to be more in cases with a blood - borne or immune origin . Staubach et al . In their study on auto - hemotherapy have also found their asst - positive patients to respond more than the asst - negative ones . The treatment protocol was tolerated well and none of the patients reported any side effects . In our study, 32% patients (19 out of 59) showed some positive response to ast during the treatment period . This was evident in the form of a reduction in tss in these patients . Among the 19 responders, 5 patients went into a complete remission, and their tss scores decreased by 75 - 100% of their baseline values during the treatment . Rest of the responders (14 patients) the response was partial with only 25 - 75% reduction in tss scores . More importantly, the therapeutic efficacy of autologous serum proved to be temporary in the majority of the responders also . This was evident in the form of a relapse of symptoms in 12 cases out of the total of 19 responders . Thus, at the end of the 3-month follow - up period, the therapeutic efficacy could be maintained only in seven patients accounting for only 12.5% of the total study population . Our study results are not in conformity with those reported by bajaj et al . Who have shown a significant percentage of their cu patients responding really well to autologous serum injection treatment . The relative lack of efficacy of ast in our patients cannot be explained easily . One of the possible reasons could be the inclusion of the only the cau group in our study . This subgroup of patients is expected to have a relatively more severe disease than other counterparts . Ast has been reported to prevent relapse of symptoms for as long as 2 years . We followed up our patients for only 12 weeks after the last autologous injection to assess the suppressive effect of treatment . However, we found 7 of our 19 responders relapsing within just 3 weeks after the end of treatment . Further follow - up of the study group showed 5 more relapses in the 2 and 3 month . Thus, the therapeutic response could be maintained only in 36.8% of the responders, which constituted just 12.5% of the whole study population . In addition, we found a dramatic decline in the tss during the first few weeks of treatment in our responder group as evident from table 2 . However, the decline in tss could not be maintained in any of these patients in the follow up period . This is contrary to what has been reported by bajaj et al . In their study where patients showed a continuous decline in tss during follow - up period as well our study results indicate that ast may not be such an efficacious treatment option in patients with cau . As we did not use a placebo arm in our study, a large placebo controlled study in a larger population group is warranted to clarify the conflicting results . Autologous serum therapy does not seem to offer any significant therapeutic benefit in patients with chronic urticaria.only a minority of patients show a temporary response to the treatment option and this positive response does not last beyond the treatment period . Autologous serum therapy does not seem to offer any significant therapeutic benefit in patients with chronic urticaria . Only a minority of patients show a temporary response to the treatment option and this positive response does not last beyond the treatment period.
The most frequent sites of bleeding in patients with haemophilia are the soft tissues, the joints, the urinary tract, but much more rarely the gastrointestinal tract . The complications of intramural bleeding are acute intestinal obstruction, but also rupture of the haematoma in the lumen or the peritoneal space . We present the case of a haemophiliac patient who was admitted as an emergency due to distended abdomen, nausea, vomiting and the clinical picture of ileus . The native abdomen in a standing position presented air fluid levels with moderate distension of the accompanying bowel loops . A nasal probe was inserted and the symptoms of ileus disappeared, but after taking food by mouth, the picture of ileus returned . Ct of the abdomen and pelvis was performed, which showed circular, high density thickening of the walls in places in the area of the jejunum, indicating haemorrhage, but also the formation of haematoma in the wall structure . After administering factor viii, the symptoms of ileus ceased, and the patient recovered completely . This unusual presentation of haemophilia with bleeding in the wall of the small intestine is very rare and has only been seen in a few cases in the world . Ct diagnosis defined the cause of the obstruction and saved the patient from an unnecessary surgical procedure . Haemophilia is a congenital blood ailment characterized by the lack of coagulating factor viii (haemophilia a) or factor iv (haemophilia b). The most frequent sites of bleeding are the soft tissue, the joints, the urinary tract, and much more rarely the gastrointestinal tract (1). Gastrointestinal haemorrhage has an incidence of 17.525% in haemophiliacs and causes death in 4% of this population overall (2). The complications of intramural bleeding are acute intestinal obstruction, but also the rupture of the haematoma in the lumen or in the peritoneal space (3). This case presents a patient with haemophiliac ileus of the small intestine, where ct diagnostics defined the cause of the obstruction and saved the patient unnecessary surgery . The patient was admitted in the evening as an emergency case, due to a distended abdomen, nausea, vomiting and the clinical picture of ileus . The native abdomen in a standing position presented air fluid levels with moderate distension of the relevant bowel loops (figure 1). A nasal probe was inserted and the symptoms of ileus disappeared, but after taking food by mouth, the picture of ileus returned . Laboratory test results: wbc 11/00, rbc 6.35, hct 0.503, hgb 166 . A - ptt 84.8 (rv:26 - 28 s), antihaemophilic factor a (ahg - a), f - viii <0.05 (rv:0.7 - 1.5 j). Ct of the abdomen and pelvis was performed, which showed circular high density thickening of the walls in places in the area of the jejunum, indicating haemorrhage, but also the formation of haematoma in the wall structure . The presence in places of air fluid levels suggested disturbed passage through the bowels (figures 2 and 3). In the area of the jejunum circular high density thickening of the walls in places, indicating haemorrhage, but also the formation of haematoma in the wall structure . After administering factor bleeding in the gastrointestinal tract in haemophiliacs is not rare, and is usually manifest either in melena or per rectum . Bleeding less often occurs in the intestinal wall, with the symptoms of intestinal obstruction . In this case, intramural bleeding had occurred in the small intestine (figure 2) and the intramural haematoma was the cause of paralytic ileus and intestinal obstruction . The most probable physiopathology of intramural haematomas of the bowel is characterized by the spread of the terminal arterial vessels as they leave the mesentery and penetrate the muscular layer of the intestinal wall (3). An intramural haematoma may also cause intussusception, as another form of ileus (4). As bleeding is the most frequent cause of acute abdominal pain in haemophiliacs, an acute abdomen should be deemed to be bleeding, until proven otherwise by diagnostic methods (ct). It is a very useful method in diagnosing intramural haematoma, defining the area of the haemorrhage and revealing possible complications . Most intramural haematomas can be treated conservatively and spontaneous resolution occurs, where bleeding is treated by prompt compensation of factor viii . Correct diagnosis and a multi - discipline approach are imperative in order to avoid unnecessary explorative procedures.
Lansoprazole is a racemic mixture composed of equal proportions (50:50) of (r)-lansoprazole (also known as dexlansoprazole) and (s)-lansoprazole . These two enantiomers have been quantified separately in blood after ingestion of lansoprazole 30 mg in healthy volunteers and it was found that the mean maximum plasma concentration (cmax) and area under the plasma drug concentration - time curve (auc) values were 3- to 5-fold greater for dexlansoprazole than (s)-lansoprazole.16 this suggests that the hepatic clearance of lansoprazole is stereoselective in favor of the (s) enantiomer leading to higher systemic exposure of and in vivo residence for dexlansoprazole as compared to its antipode, (s)-lansoprazole . Dexlansoprazole is highly bound to plasma proteins (96.1%98.8% bound) and has an apparent volume of distribution of 40.3 l in subjects with gerd.17 the elimination of dexlansoprazole is via the hepatic route; biotransformation to oxidative metabolites occurs via cyp2c19 and cyp3a4 with subsequent conjugation to inactive products and elimination in the urine and feces . In vitro data suggest that cyp2c19 displays more specificity for r- than s - lansoprazole, and that cyp3a4 is more specific for s - lansoprazole.18 dexlansoprazole does not appear to be eliminated unchanged in the urine . The elimination half - life of dexlansoprazole is approximately 12 hours in healthy subjects and in patients with symptomatic gerd; this is similar to other ppi . The dual delayed release formulation (ddr) employed in delivering dexlansoprazole is a more significant factor in prolonging drug residence time in the body after oral administration than the inherently slower clearance of dexlansoprazole as compared to the (s)-enantiomer . The ddr formulation delivers 2 drug inputs in the proximal and more distal small intestine . Distinct ph - dependent releases of drug are designed to occur from two types of enteric - coated granules housed in a gelatin capsule . Upon dissolution of the outer capsule in the stomach, the first type of granule is designed to release quickly after the granules reach the proximal duodenum providing an initial drug release profile similar to that of lansoprazole and resulting in an initial peak in plasma dexlansoprazole concentrations within 1 to 2 hours of capsule ingestion . The second release from the remaining granules is designed to release farther along the gastrointestinal tract at the distal portion of the small intestine and creates a second drug peak in plasma dexlansoprazole concentrations within 4 to 5 hours of capsule ingestion . The purpose of the second release is to provide a greater amount of drug to be absorbed later in the dosing interval in order to provide extended duration of acid suppression . Therefore, the resulting time - concentration profile of dexlansoprazole mr reveals a two - peaked pattern that extends to approximately 12 hours after a dose is ingested (figure 1). The relationship between exposure of dexlansoprazole following administration of dexlansoprazole mr and its pharmacodynamic effect measured as intragastric ph has been described using an emax model.19 a total of 83 healthy subjects met the entry criteria for 2 studies, and were included in this combined analysis . Subjects were administered 30, 60, 90, and 120 mg of dexlansoprazole mr in randomized crossover fashion in these two separate studies . The systemic exposure of dexlansoprazole measured as cmax and auc values was dose - proportional and time - independent . These two pharmacokinetic and pharmacodynamic studies confirmed that the ddr technology used in the dexlansoprazole mr formulation prolonged drug exposure; pharmacokinetic and pharmacodynamic modeling suggested that doses lower than 30 mg may result in therapeutically suboptimal intragastric ph control . Furthermore, it was demonstrated that doses higher than 90 mg would be unlikely to provide additional clinically meaningful pharmacologic response . In a retrospective analysis using data from 2 separate but similarly designed studies the pharmacokinetic profiles of dexlansoprazole mr 60 mg and lansoprazole 60 mg were compared after 5 days of dosing in healthy volunteers, demonstrating that the tmax for both regimens occurred 1 to 2 hours after administration, and that the second peak for dexlansoprazole mr occurred 4 to 5 hours after administration.20 the results from this single post - hoc analysis also showed that the mean residence time for dexlansoprazole mr was nearly double that of lansoprazole at equivalent doses of 60 mg once daily (5.5 hours vs 2.9 hours, respectively).21 the pharmacokinetics, pharmacodynamics, and safety of three dosing regimens of dexlansoprazole mr (60, 90, and 120 mg) and lansoprazole 30 mg were assessed in an open - label, multiple - dose, single - center, four - period, crossover study in 40 subjects.22 after 5 days of once daily administration dexlansoprazole mr 60 mg produced statistically significantly greater mean 24-hour intragastric ph compared to lansoprazole 30 mg (4.55 vs 4.13, respectively, p <0.001); a statistically significant increase in% time 24-hour intragastric ph> 4 was also observed (71% vs 60%, respectively, p <0.01) (figure 2). The 90 mg dose of dexlansoprazole mr produced 24-hour intragastric ph> 4 for 70% of the time . The pharmacodynamic effect of dexlansoprazole mr 120 mg was similar to that of the 90 mg dose . The clinical significance of these differences remains unknown, but the ddr formulation of dexlansoprazole mr appears to provide pharmacodynamic benefit beyond that of lansoprazole most likely due to the extended duration of effective plasma concentration . The impact of food on the pharmacokinetics and pharmacodynamics of dexlansoprazole mr was evaluated in 46 healthy subjects who completed all dosing regimens in a randomized, 4-period, open - label, crossover study.23 placebo was administered in 4 regimens: after a 10-hour fast, 30 minutes before, 5 minutes before, or 30 minutes after a high - fat breakfast on day 1; dexlansoprazole mr 90 mg was administered in the same fashion for each crossover period on day 3 . Plasma concentrations of dexlansoprazole were measured on day 3 and 24-hour intragastric ph was assessed on days 1 and 3 . Pharmacokinetics of dexlansoprazole in the fed conditions (administered 5 minutes before and 30 minutes after a high - fat breakfast) when compared to the fasted state displayed at least a 1.09-fold greater increase (using the point estimates) in cmax and auc for the fed state (figure 3). The data also showed that the systemic exposure of dexlansoprazole after dexlansoprazole mr was administered 30 minutes before a high - fat breakfast was bioequivalent to that obtained following administration of dexlansoprazole mr under fasted state . The differences in the pharmacodynamic parameters measured as mean 24-hour intragastric ph and% time 24-hour intragastric ph> 4 were not considered to be clinically meaningful between any of the periods which signified both a lack of food effect and a lack of effect of timing of food intake relative to dosing with dexlansoprazole mr on intragastric ph profile . Because ppi are traditionally administered before the morning meal, it is important to determine if a ppi with extended release properties such as dexlansoprazole mr can be taken at different times during the day which may offer greater dosing flexibility . The influence of time of day of dexlansoprazole mr administration on pharmacokinetic and pharmacodynamic variables was assessed in 44 healthy subjects who completed all regimens in a 4-period, randomized, crossover fashion in which drug was administered daily for five days 30 minutes before breakfast, lunch, dinner, or a bedtime snack . Plasma drug concentrations and 24-hour intragastric ph were assessed on day 5 of each period.24 systemic exposure of dexlansoprazole when dosed before breakfast was bioequivalent when dosed before lunch, dinner or an evening snack, and minimal but statistically significant differences were found in mean 24-hour intragastric ph between dosing at breakfast and at lunch (0.2 difference in ph) and in% time 24-hour intragastric ph> 4 between dosing at breakfast and at bedtime snack (7% difference). No other significant differences in 24-hour intragastric ph were found between breakfast and the other mealtimes . Therefore, the dosing versatility of dexlansoprazole mr appears to extend beyond the lack of an effect by food into the realm of dose timing flexibility . The impact of dose timing on the pharmacodynamic effects of other ppi has been previously studied . Rabeprazole dose timing was studied in a crossover fashion in 20 gerd patients, and a significantly greater% time intragastric ph> 4 was observed when the dose was given once daily in the morning vs the evening.25 dosing lansoprazole in the morning produced no differences in intragastric ph (mean 24-h ph or% time ph> 4) than evening dosing in healthy subjects in one study.26 however, morning dosing of lansoprazole in another study was significantly more effective than evening dosing at intragastric ph control for all time periods during the day except for overnight, when the two dosing methods were comparable.27 an alternative method of dexlansoprazole administration was studied in 50 healthy subjects in a two - period, randomized, crossover study where dexlansoprazole mr 90 mg was ingested after a 10-hour fasting period as either an intact capsule with water or after the capsule was opened and the granules were sprinkled over applesauce and swallowed.28 no significant differences in either auc or cmax were found between the two methods, and bioequivalence was established for dexlansoprazole mr regardless of whether given whole with water or sprinkled over applesauce . Drug interactions remain a potential concern for any compound that undergoes extensive hepatic metabolism, including ppi . Four separate studies were conducted in healthy subjects in which dexlansoprazole mr 90 mg was given once daily for 9 to 11 days with a single dose of a test substrate . The test substrates for the in vivo assessment of cyp enzyme activity included diazepam 5 mg (a substrate for cyp2c19 and cyp3a), phenytoin 250 mg (cyp2c9 and cyp2c19), theophylline (given as intravenous aminophylline 400 mg, cyp1a2), and warfarin 25 mg (cyp2c9).29 no significant differences in cmax or auc of any substrate were detected when given concomitantly with dexlansoprazole mr . Furthermore, the pharmacodynamic impact of coadministration of dexlansoprazole mr with warfarin as measured by change in inr was not significant . Therefore, no significant pharmacokinetic and pharmacodynamic (for warfarin only) drug drug interactions were found in these studies with dexlansoprazole mr . At the time of this review no studies have been conducted with dexlansoprazole and clopidogrel, so the effect of the two drugs when given together is unknown . Due to complete metabolism in the liver to inactive metabolites and the absence of unchanged drug excreted in the urine, dexlansoprazole mr is not expected to undergo accumulation in kidney dysfunction, and no dose adjustment is required in patients with renal impairment . Accumulation of dexlansoprazole concentrations occurred in subjects with moderate (child pugh class b) hepatic impairment, but not in mild impairment (child pugh class a).30 due to this finding, studies were not conducted in patients with severe hepatic impairment . Thus, the lower dexlansoprazole mr dose of 30 mg should be considered in moderate hepatic impairment, and no dosage adjustment is required in mild impairment . The clinical development program for dexlansoprazole mr was the largest for any ppi to date and comprised 6 pivotal studies in more than 4500 patients . The goals of this program were to establish the efficacy and safety of dexlansoprazole mr in the treatment and maintenance of erosive esophagitis and in the control of symptomatic nonerosive gerd . Two identically designed trials evaluated the efficacy and safety of dexlansoprazole mr vs lansoprazole in the healing of erosive esophagitis.33 both trials were randomized and double - blinded and compared dexlansoprazole mr 60 mg and 90 mg with lansoprazole 30 mg once daily . All doses were given once daily within 60 minutes of the morning meal to maintain blinding, and the duration of treatment was 8 weeks . All patients were adults (age> 18 years) with endoscopically proven erosive esophagitis . Exclusion criteria included the presence of helicobacter pylori infection or barrett s esophagus . Esophagogastroduodenoscopy (egd) was performed at baseline (to establish the presence of esophageal erosions) and at 4 and 8 weeks . The primary endpoint was the percentage of patients with endoscopic evidence of healing at 8 weeks, and secondary endpoints included the percentage of subjects with moderate - to - severe (los angeles [la] grades c and d) erosive esophagitis who were healed at 8 weeks, and all grades healed at 4 weeks . The target proportion of patients with la grade c and d disease was 30% as consistent with fda guidance that this subgroup of disease presents specific challenges to healing . The symptoms of erosive esophagitis were recorded by diary twice daily: upon awakening each morning to capture any symptoms experienced overnight and upon retiring each evening to capture any symptoms experienced while awake . The rigor of this recording method was intended to minimize the recall bias that may arise from once daily symptom recording . The primary method of analysis of the healing rate was the crude rate; this analysis method classifies any subject who does not complete the study (eg, no data for week 8 endoscopy) as a complete treatment failure . This is in contrast to life - table analysis, the statistical methodology historically used in ppi trials, in which the probability is calculated that a patient would have healed had he remained in the study and received the final egd . As such, in life - table analysis the patient who does not complete the trial is considered a partial failure . The crude rate is an inherently more stringent analysis method, and typically yields lower healing rates than life - table . Both dexlansoprazole mr erosive esophagitis healing trials were designed to test for noninferiority; the dexlansoprazole mr doses shown to be noninferior were then tested for superiority to lansoprazole 30 mg for primary and secondary efficacy endpoints . For each study, a sample size of 520 patients per treatment group provided at least 95% power at the 0.025 level of significance to detect noninferiority between dexlansoprazole mr and lansoprazole, assuming equal healing rates of 87% at week 8 . Erosive esophagitis healing rates at week 8 for both dexlansoprazole mr doses were superior to lansoprazole in one study (study 1); 60 mg of dexlansoprazole mr was noninferior and 90 mg was superior to lansoprazole in the other study (figure 4). Healing at week 4 was> 64% for all groups using both crude rate and life - table analysis methods . Healing of moderate - to - severe erosive esophagitis was significantly greater with dexlansoprazole mr 60 mg than lansoprazole in study 1 and both doses were noninferior to lansoprazole in study 2 . The median percentage of 24-hour heartburn - free days was greater than 80% in patients who received either dose of dexlansoprazole mr; this was comparable to lansoprazole . Subjects who experienced healing of erosive esophagitis in either of the two healing studies mentioned previously were eligible for enrollment in one of two studies designed to evaluate the maintenance of healing over a 6-month period . One study compared dexlansoprazole mr 30 mg and 60 mg with placebo34 and the other study compared 60 mg and 90 mg doses with placebo.35 the placebo - controlled design was consistent with the standard comparator of other esophagitis healing maintenance studies . The final endoscopy of the previous healing study was considered the baseline assessment of healing for this maintenance study and was followed by endoscopies at 1, 3, and 6 months to document persistence of healing . The primary efficacy endpoint was the percentage of subjects who maintained healed erosive esophagitis at 6 months . Secondary efficacy endpoints included the percentage of days without daytime or nighttime heartburn and the percentage of nights without heartburn . Symptoms were recorded by subjects twice daily in a manner identical to the erosive esophagitis healing studies . The enrollment of the study that compared dexlansoprazole mr 30 mg and 60 mg with placebo was 445 subjects, and the withdrawal rate from study medication was 83% for the placebo group and 34% for each dexlansoprazole mr group, mostly due to relapse of erosive esophagitis . Maintenance of healing rates were significantly higher for both dexlansoprazole mr doses compared to placebo, and this finding was consistent for all grades of erosive esophagitis and for moderate - to - severe disease . The median percentage of 24-hour heartburn - free days and median percentage of nights without heartburn was statistically significantly higher for all doses of dexlansoprazole mr than placebo, with 96% of 24-hour periods and 99% of nights being reported as heartburn - free over 6 months for dexlansoprazole mr 30 mg vs 29% of 24-hour periods and 72% of nights for placebo (figure 5). The control of nonerosive gerd symptoms remains a therapeutic challenge for practitioners, because the true etiology of the symptoms may or may not be due to acid or may be unknown . A clinical trial compared two different doses of dexlansoprazole mr (30 and 60 mg) with placebo in subjects with normal esophageal mucosa on egd.36 this study identified patients with heartburn - predominant complaints for at least 6 months and for 4 of the 7 days prior to screening for enrollment, but no minimal severity of symptoms was required . Besides egd, no objective assessments of esophageal disease such as ph - metry were conducted and no attempts were made to identify or exclude patients with functional heartburn . Study medication was administered in a blinded fashion once daily in the morning for 28 days . Subjects recorded heartburn symptom assessments twice daily as described for the erosive esophagitis healing and maintenance studies, and investigator assessments occurred at baseline and at 2 and 4 weeks of the study . The primary endpoint was the percentage of 24-hour periods that were free of heartburn symptoms over 28 days, and the secondary endpoint was the percentage of daytime periods and nighttime periods without heartburn . The results demonstrated that a majority of the 24-hour periods were heartburn - free in the groups that received dexlansoprazole mr (median percentage 54.9% for the 30 mg group) compared with 18.5% for the placebo group (figure 6). The dexlansoprazole mr 30 mg group also experienced significantly greater nighttime periods (median percentage of nights 80.8% vs 51.7% for placebo) and daytime periods (median percentage of days 63.0% vs 26.9% for placebo) that were symptom - free . It is important to note that no nighttime symptom requirement was necessary for enrollment into the study; this may partially explain the relatively large placebo response for this endpoint . The percentage of patients during the study who experienced 24-hour heartburn - free days over the first 3 days of treatment was significantly greater for dexlansoprazole mr treatment groups than placebo . The percentage of patients with 24-hour heartburn - free days by each study day is presented in figure 7 . Two identically designed trials evaluated the efficacy and safety of dexlansoprazole mr vs lansoprazole in the healing of erosive esophagitis.33 both trials were randomized and double - blinded and compared dexlansoprazole mr 60 mg and 90 mg with lansoprazole 30 mg once daily . All doses were given once daily within 60 minutes of the morning meal to maintain blinding, and the duration of treatment was 8 weeks . All patients were adults (age> 18 years) with endoscopically proven erosive esophagitis . Exclusion criteria included the presence of helicobacter pylori infection or barrett s esophagus . Esophagogastroduodenoscopy (egd) was performed at baseline (to establish the presence of esophageal erosions) and at 4 and 8 weeks . The primary endpoint was the percentage of patients with endoscopic evidence of healing at 8 weeks, and secondary endpoints included the percentage of subjects with moderate - to - severe (los angeles [la] grades c and d) erosive esophagitis who were healed at 8 weeks, and all grades healed at 4 weeks . The target proportion of patients with la grade c and d disease was 30% as consistent with fda guidance that this subgroup of disease presents specific challenges to healing . The symptoms of erosive esophagitis were recorded by diary twice daily: upon awakening each morning to capture any symptoms experienced overnight and upon retiring each evening to capture any symptoms experienced while awake . The rigor of this recording method was intended to minimize the recall bias that may arise from once daily symptom recording . The primary method of analysis of the healing rate was the crude rate; this analysis method classifies any subject who does not complete the study (eg, no data for week 8 endoscopy) as a complete treatment failure . This is in contrast to life - table analysis, the statistical methodology historically used in ppi trials, in which the probability is calculated that a patient would have healed had he remained in the study and received the final egd . As such, in life - table analysis the patient who does not complete the trial is considered a partial failure . The crude rate is an inherently more stringent analysis method, and typically yields lower healing rates than life - table . Both dexlansoprazole mr erosive esophagitis healing trials were designed to test for noninferiority; the dexlansoprazole mr doses shown to be noninferior were then tested for superiority to lansoprazole 30 mg for primary and secondary efficacy endpoints . For each study, a sample size of 520 patients per treatment group provided at least 95% power at the 0.025 level of significance to detect noninferiority between dexlansoprazole mr and lansoprazole, assuming equal healing rates of 87% at week 8 . Erosive esophagitis healing rates at week 8 for both dexlansoprazole mr doses were superior to lansoprazole in one study (study 1); 60 mg of dexlansoprazole mr was noninferior and 90 mg was superior to lansoprazole in the other study (figure 4). Healing at week 4 was> 64% for all groups using both crude rate and life - table analysis methods . Healing of moderate - to - severe erosive esophagitis was significantly greater with dexlansoprazole mr 60 mg than lansoprazole in study 1 and both doses were noninferior to lansoprazole in study 2 . The median percentage of 24-hour heartburn - free days was greater than 80% in patients who received either dose of dexlansoprazole mr; this was comparable to lansoprazole . Subjects who experienced healing of erosive esophagitis in either of the two healing studies mentioned previously were eligible for enrollment in one of two studies designed to evaluate the maintenance of healing over a 6-month period . One study compared dexlansoprazole mr 30 mg and 60 mg with placebo34 and the other study compared 60 mg and 90 mg doses with placebo.35 the placebo - controlled design was consistent with the standard comparator of other esophagitis healing maintenance studies . The final endoscopy of the previous healing study was considered the baseline assessment of healing for this maintenance study and was followed by endoscopies at 1, 3, and 6 months to document persistence of healing . The primary efficacy endpoint was the percentage of subjects who maintained healed erosive esophagitis at 6 months . Secondary efficacy endpoints included the percentage of days without daytime or nighttime heartburn and the percentage of nights without heartburn . Symptoms were recorded by subjects twice daily in a manner identical to the erosive esophagitis healing studies . The enrollment of the study that compared dexlansoprazole mr 30 mg and 60 mg with placebo was 445 subjects, and the withdrawal rate from study medication was 83% for the placebo group and 34% for each dexlansoprazole mr group, mostly due to relapse of erosive esophagitis . Maintenance of healing rates were significantly higher for both dexlansoprazole mr doses compared to placebo, and this finding was consistent for all grades of erosive esophagitis and for moderate - to - severe disease . The median percentage of 24-hour heartburn - free days and median percentage of nights without heartburn was statistically significantly higher for all doses of dexlansoprazole mr than placebo, with 96% of 24-hour periods and 99% of nights being reported as heartburn - free over 6 months for dexlansoprazole mr 30 mg vs 29% of 24-hour periods and 72% of nights for placebo (figure 5). The control of nonerosive gerd symptoms remains a therapeutic challenge for practitioners, because the true etiology of the symptoms may or may not be due to acid or may be unknown . A clinical trial compared two different doses of dexlansoprazole mr (30 and 60 mg) with placebo in subjects with normal esophageal mucosa on egd.36 this study identified patients with heartburn - predominant complaints for at least 6 months and for 4 of the 7 days prior to screening for enrollment, but no minimal severity of symptoms was required . Besides egd, no objective assessments of esophageal disease such as ph - metry were conducted and no attempts were made to identify or exclude patients with functional heartburn . Study medication was administered in a blinded fashion once daily in the morning for 28 days . Subjects recorded heartburn symptom assessments twice daily as described for the erosive esophagitis healing and maintenance studies, and investigator assessments occurred at baseline and at 2 and 4 weeks of the study . The primary endpoint was the percentage of 24-hour periods that were free of heartburn symptoms over 28 days, and the secondary endpoint was the percentage of daytime periods and nighttime periods without heartburn . The results demonstrated that a majority of the 24-hour periods were heartburn - free in the groups that received dexlansoprazole mr (median percentage 54.9% for the 30 mg group) compared with 18.5% for the placebo group (figure 6). The dexlansoprazole mr 30 mg group also experienced significantly greater nighttime periods (median percentage of nights 80.8% vs 51.7% for placebo) and daytime periods (median percentage of days 63.0% vs 26.9% for placebo) that were symptom - free . It is important to note that no nighttime symptom requirement was necessary for enrollment into the study; this may partially explain the relatively large placebo response for this endpoint . The percentage of patients during the study who experienced 24-hour heartburn - free days over the first 3 days of treatment was significantly greater for dexlansoprazole mr treatment groups than placebo . The percentage of patients with 24-hour heartburn - free days by each study day is presented in figure 7 . The safety and tolerability of dexlansoprazole mr was evaluated in more than 4500 patients in seven trials of the phase 3 clinical development program . Treatment - emergent adverse events were reported in which any such event that occurred after the ingestion of the first dose of study medication was recorded and analyzed . The strictness of this reporting method contrasts with reporting of treatment - related events which requires the investigator to deem an adverse event to be related to the study medication in order to be reported . The most commonly reported treatment - emergent adverse events (with a frequency of 2%) from all clinical studies of dexlansoprazole mr are presented in table 1 . Diarrhea was the most common adverse event leading to discontinuation form dexlansoprazole therapy in controlled clinical studies (0.7%).20 the elevation of plasma gastrin concentrations by ppi is a well - established class effect that is due to the compensatory increase in afferent hormonal input of parietal cell acid production . The trophic effects of gastrin on the gastric mucosa and evidence of ecl - cell hyperplasia in animals have led to potential controversy about the long - term use of ppi in humans . Mean plasma gastrin auc24 increased by approximately 3.5-fold compared with baseline values after 5 days of dosing with dexlansoprazole mr 90 mg or 120 mg; this magnitude of increase was similar to that of lansoprazole 30 mg in a crossover study in healthy subjects.37 gastrin parameters started to decline within 3 days after drug discontinuation, and returned to baseline within 7 days after the last dose of drug . Thus, the changes in gastrin associated with dexlansoprazole mr appeared to be modest, reversible, unrelated to dose, and similar to other ppi . Elevations in serum gastrin concentrations were higher in the dexlansoprazole mr groups than in the lansoprazole group in the erosive esophagitis healing studies, but were within the expected range for ppi.33 gastrin elevations also occurred in all dexlansoprazole mr groups in the maintenance and nonerosive gerd studies compared to placebo.34,36 these elevations were also within the range expected for patients receiving ppi . Gastric biopsies obtained at the final visit in patients enrolled in either of the maintenance of erosive esophagitis studies revealed no findings of neuroendocrine cell proliferation or adenocarcinoma.34,35 finally, no changes in the cardiac rhythm (including q - t interval) were detected in healthy volunteers who received a single dose of dexlansoprazole mr 90 mg or 300 mg.38 no consistent, clinically important changes in laboratory results, vital signs, or physical examinations were observed . Dexlansoprazole mr is a ppi administered by a unique delivery system that extends the duration of active plasma concentrations of drug beyond conventional ppi . It is available in two dosage strengths, 30 and 60 mg, and is currently approved for 3 clinical indications: healing of erosive esophagitis at a dose of 60 mg orally once daily for up to 8 weeks, maintenance of erosive esophagitis healing at a dose of 30 mg orally once daily for up to 6 months, and relief of symptomatic nonerosive gerd at a dose of 30 mg orally once daily for 4 weeks . In 2 large active - control studies of dexlansoprazole mr it showed healing rates of all grades of erosive esophagitis consistent with lansoprazole, and this healing was maintained for up to 6 months in nearly two - thirds of patients at either dose in another placebo - controlled study . In addition, dexlansoprazole mr provided complete relief of heartburn symptoms for a median of 55% of 24-hour periods over 28 days in patients with symptomatic nonerosive gerd . The safety profile of dexlansoprazole because dexlansoprazole mr can be taken without regard to food or time of day it is more convenient for individuals who find compliance with meal - associated dosing of medication difficult or eat at irregular times . The prolonged duration of acid suppression provided by dexlansoprazole mr addresses the short half - life of conventional ppi and offers a novel approach to extending gastric ph control in patients with selected acid - related disorders.
The acute phase response represents an evolutionarily conserved mechanism of inflammatory events designed to rapidly react to infections, wounds, and injuries . It can lead to a dramatic increase (up to 1000 fold) in the levels of acute phase proteins (apps) in the circulation and, ultimately, brings about resolution of the inflammatory reaction [1, 2]. Serum amyloid a (saa) one of the major apps in humans saa originates from an evolutionarily conserved multigene family ranging from invertebrates (with a wound - healing role in sea cucumbers), vertebrates, to humans, where it represents an accurate and sensitive marker of inflammation . Human saa1 and saa2 are the inducible isotypes (addressed jointly as saa1/2, with over 95% sequence identity); saa3, was thought in the past to be a pseudogene, not expressed in humans; however, recently there has been a report of its mammary - associated expression found in milk . There have been three acute phase saa isotypes reported in the mouse saa1, saa2, and saa3, with saa3 being the primarily extrahepatic isoform . Saa is a small protein (104 amino acids in length), 11.7 kda in size, lipophilic, and poorly soluble in aqueous solution, originally described as a component of normal serum . Saa fragments were found in amyloidosis, and the accumulation of these fibrils can lead to organ failure and ultimately death . Murine and human saa have been shown to form hexamers in solution, which can lead to the formation of membrane channels that could be involved in important pathological roles [10, 11]. Saa1/2 has a variety of multiple functions in humans, among them it acts as a cytokine and chemokine, induces matrix metalloproteinases, interferes with platelet functions, replaces apo - a1 in high density lipoprotein particles in the circulation during inflammation, binds cholesterol and influences its efflux, and plays a role in host defense [10, 1218]. In physiological concentrations (100200 nm as measured in sera), saa is thought to act in homeostasis of inflammatory events, while at prolonged higher pathological concentrations (above 1000 nm) saa could act in a degradative manner causing injury to tissues and cells during chronic inflammatory conditions . The expression of saa has also been shown in nonhepatic epithelial cells and can play a role in tumorigenesis . Its ability to opsonize gram - negative bacteria could contribute to the epithelial defense mechanism against these bacteria . Saa is measured routinely in sera or plasma in the veterinary field (especially useful in equine, bovine, porcine, and also bird and fish pathologies) and has proven to be a relevant biomarker and predictor of many diseases in humans (among them cardiovascular diseases). Saa was identified as an independent risk predictor of mortality following acute myocardial infarction and indicated to play a causal role in atherogenesis [23, 24]. Saa mrna expression has been localized to many different human tissues, including atherosclerotic plaques, where saa protein is thought to play an active pathogenic role . Some of the strongest signals in this study were observed in endothelial cells lining the lumen of coronary arteries and in macrophage - derived foam cells . The expression of saa mrna within cultured human primary coronary artery endothelial cells (hcaec) was first reported in 2007 and these cells were also shown to be highly responsive to human recombinant saa1/2, as an inflammatory stimulus, indicating a strong positive feedback onto its own synthesis . However, very little is known about the localization of saa within these cells, whether it is released and could act locally at the extracellular level or saa remains in hcaec and could influence endothelial function in an intracellular manner . So, our objective was to determine the localization of intracellular saa in hcaec and to elucidate possible associations of saa with particular cytoskeletal elements . Rabbit anti - saa polyclonal antibodies were a gift from professor ernst malle (institute of molecular biology and biochemistry, medical university of graz, austria). The anti - saa antibodies used for the immunofluorescent staining were raised against synthetic peptides of saa ranging from the indicated amino acid sequences: 2744 (pab 3), 5972 (pab 5), and 6884 (pab 6). For the immunoblot analysis, eight separate anti - saa polyclonal antibodies were used, ranging in consecutive order, as raised against synthetic saa peptides from pab 1 to pab 8 . (saa 117, saa 1430, saa 2744, saa 4063, saa 5972, saa 6884, saa 7994, saa 89104, resp . ). Cells were cultured in egm-2 m medium (lonza, walkesville, usa) containing 5% fetal bovine serum at 37c in a humidified atmosphere and 5% co2 . For immunofluorescent staining, hcaec were used through passage 5 of subconfluent (8085% confluency) cell cultures . Cells were fixed in 4% paraformaldehyde for 30 min at 37c, then washed in pbs . For actin staining, cells were labelled with phalloidin - fluorescein isothiocyanate (fitc) (2 m in 20% methanol) (sigma, germany). For saa, -tubulin, and vimentin, cells were incubated with rabbit antibodies against saa and/or mouse antibody against vimentin (dako, usa) or -tubulin (sigma, germany) and with the appropriate secondary antibodies conjugated with fitc or tritc (sigma, germany). The von willebrand factor was determined with immunofluorescence microscopy (abcam, cambridge, great britain). For labelling of endomembranes, a lipophilic stain 3,3-dihexyloxacarbocyanin iodide (dio6) was used . It mainly labels endoplasmic reticulum and mitochondria (molecular probes manual). A stock solution of membrane marker vibrant dio6 (0.5 mg dio6/ml ethanol) (invitrogen, molecular probes, leiden, the netherlands) was freshly prepared, and a 0.5% dilution of dio6 in culture medium was added to cells for 3 min . After washing in pbs, the coverslips with cells were embedded with antibleaching medium vectashield containing the nuclear stain diamidinophenylindole dilactate (dapi) (vector laboratories, burlingame, calif, usa) and observed with a fluorescence microscopes (nikon eclipse te 300 and axioimager z1, carl zeiss) supplemented with apotome device for generation of optical sections . In order to determine the colocalization between saa and mt, saa and vim, the pla assay (olink bioscience, uppsala, sweden) was performed according to the manufacturer's protocol . In brief, fixation, permeabilization, blockade, and incubation with primary antibodies were performed as described in the section 2.3 . Subsequently, the cells were incubated with the secondary mouse plus and rabbit minus antibodies . After hybridization and ligation of the oligonucleotides, the dna was amplified by addition of an amplification mixture . A detection mixture detected the amplicons resulting in red fluorescence signals . In the final step, the nuclei were counterstained with dapi and the cells were mounted with mounting medium (vector laboratories, burlingame, calif, usa). Cells were analyzed with a 63x objective on a fluorescent microscope axioimager z1 (carl zeiss) supplemented with apotome device for optical sections generation . Human recombinant saa (5.3 g / cm gel) (peprotech ec ltd ., after transfer to nitrocellulose membranes (100 v, 250 ma, 35 min), blocking was performed in tbs with 5% milk . As primary antibodies, following washing, secondary incubation was done with antirabbit hrp conjugate (biorad, munich, germany) at 1: 200 dilution with subsequent western blot luminol reagent (santa cruz, calif, usa) and chemiluminescent detection performed following manufacturer's instructions . In order to determine the distribution of saa within hcaec and its colocalization with cytoskeletal elements, endomembranes, and the nucleus, fluorescent labeling of these components was performed in spread nonconfluent cells . To confirm the endothelial nature of these cells, the von willebrand factor was determined (figure 1(a)). Labeling of saa together with phalloidin confirmed that the majority of actin filaments were at the cell periphery and clearly separated from the location of saa which is mainly concentrated in the central part of the cells (figure 1(b)). Vimentin was organized as a network spreading from the nuclear region toward the cell periphery and was generally distributed in the same cell area as saa . However, double labeling of vimentin and saa revealed a rare colocalization of the two signals and thus gave a very low probability for their codistribution (figure 1(d)) with antivimentin . The labeling of saa in many locations, especially in the cell periphery of hcaec cells, largely fits in with the linear pattern of microtubular labeling providing a high probability for the actual colocalization with this cytoskeletal component (figure 1(c)). The attachment of saa to microtubules is limited to small spots of saa labeling while larger clumps of saa (could be possible multimerization of saa) appear to be nonattached to any of the labeled structures (figure 1(e)). To evaluate the data showing colocalization by double labeling of saa with microtubules and vimentin filaments, we performed the pla method demonstrating close proximity of labeled proteins (maximum distance between proteins that still enables reaction is 30 nm). The strong reaction product confirmed the colocalization of saa and tubulin (figure 1(g)) while a weak reaction product in the case of saa and vimentin (figure 1(h)) makes specific colocalization very improbable . The negative control by omitting primary antibodies gave a completely negative result (data not shown). Often the strongest saa staining was observed in the nucleus (figures 2(a) and 2(a')) and in the area closely surrounding the nucleus where the majority of endomembranes are concentrated (figure 2(c)). To find out if saa colocalizes with endomembranes, especially endoplasmic reticulum, golgi apparatus, or transport vesicles, endomembranes were labeled with a lipophilic stain dio6 that preferentially labels membranes of the endomembrane system and the mitochondrial membranes (figures 2(b) and 2(c)). The double labeling of dio6 with saa did not show any specific colocalization of the two labels making functional connection of saa to endomembranes doubtful . Surprisingly, intense labeling of saa was found in tubular protrusions extending from the cells (figure 2(d)). Saa was found at the tips of shorter extensions, probably filopodia, and also in longer nanotubes bridging neighboring cells . Occasionally, saa labeling was detected in dilatations of nanotubes (white arrows) described as gondolas in our previous work and in extracellular membrane vesicles of cells that were attached to the bottom of the tissue culture dishes, labeled with dio6 (white arrowheads). In order to determine potential multimerization of saa, polyclonal anti - saa antibodies against specific human synthetically derived anti - saa antibodies bound to different multimers of saa following immunoblotting (figure 3), including dimers, trimers, and higher multimers . Anti - saa antibodies against saa peptides 1, 4, and 7 gave a similar pattern on the immunoblots, with a strong signal around 20 kd, whereas anti - saa antibodies against saa peptides 3, 5, 6, and 8 gave the strongest monomer band signal, with higher bands appearing also at multimers and potentially indicating conformational epitopes . The cellular localization and potential functions of saa are largely unknown in extrahepatic tissues . To determine the location of saa in endothelial cells, hcaec were double labeled for codistribution of this protein with cytoskeletal elements, endomembranes, and nucleus . There was no apparent colocalization of saa found with either actin filaments and very rare with vimentin (figures 1(b) and 1(d)). However, this paper is the first, to our knowledge, indicating colocalization of saa with microtubules in hcaec (figures 1(c) and 1(e)). The colocalization was further confirmed with the pla method indicating the distance of less than 30 nm for the two proteins (as evaluated and confirmed by the manufacturer) between saa and tubulin . The pla method has recently been determined as comparable to fret (fluorescence resonance energy transfer) method in case of semiquantitative and qualitative analysis . The positive reaction with pla makes it rather unlikely for saa to be located inside any transport vesicles attached to microtubules by motor proteins, because in this case, the distance should largely exceed the maximum value enabling the reaction and even more the vesicle membrane would probably prevent the ligation process required for the reaction product to form . In conclusion, saa seems to be directly attached to microtubules giving this protein a new potential role as a cytosolic protein distinct from the already known secretory version of this protein, which is mainly found in the serum ., saa - like protein had been detected using anti - saa antibodies in human placentae . Saa localized to the cytoplasm of cells within the mesenchymal stroma (thought to be fibroblasts), to fetal stem vessel endothelium, and to perivascular tissue . Saa had been shown to be localized to 10 nm intermediate filaments which form characteristic perinuclear bundles following treatment with vinblastine, which disrupts microtubules in cultured embryonic fibroblasts . Saa - like material has also been shown previously to be present intracellularly in cultured human endothelial cells, specifically in huvec . In that study, saa was found to be localized in an irregular filament - like staining pattern in the perinuclear regions of huvec . Our results showing colocalization of saa with microtubules (figure 1, antitubulin panels) explain the perinuclear concentration of saa because of the well - known and, in our figures, well - documented concentration of microtubules close to the nucleus . We have previously shown differential mrna expression of saa in hcaec versus huvec, indicating endothelial cell specificity . In our paper (figures 2(a) and 2(a')), there is a persistent immunofluorescent labeling of saa also observed in the nucleus of hcaec that varied considerably among cells, which could point to an additional role of saa in the regulation of gene expression . A similar nuclear distribution of saa was found in macrophages where an implication for saa - dependent gene regulation was proposed . In this study, saa (or its fragments) was detected proceeding the perinuclear region and further the nucleus . Within 60 min, saa was found in the cytoplasm with subsequent localization at the plasma membrane and further extrusion from the cell . This study was the first to follow the path of saa through a particular cell type . Both murine acute phase isoforms of saa1.1 and saa2.1 bind well to the plasma membrane, with only saa2.1 taken up by the cell at 37c and later detected in the nucleus . This suggests that the two isoforms have differential localizations and distinct physiological roles in cells . This might very well be the case also in humans, and a more detailed analysis of the saa isotypes and their locations within cells would be prudent in the future . In addition to its putative intracellular functions, saa seems to be involved in intercellular communication based on its location in nanotubes (figure 2(d)). Intercellular nanotubes (icns) are recently described thin protrusions that can connect cells which are several cell diameters apart . The discovery of saa localized in nanotubes and their dilatated regions (figure 2, bottom micrograph) previously described as gondolas indicate a possible exchange of saa among cells and the role of this molecule in intercellular communication . Numerous extracellular vesicles (microparticles or exosomes) containing saa (possibly arising from the budding of the plasma membrane) also point to the proposed role in intercellular communication . Since saa has been implicated in host defense, as having beneficial functions in the protection against microbes [12, 15, 33], we speculate that saa localization could be an important additional prerequisite for this process to occur, especially in epithelial cells . The microtubular association of saa in correlation to the recently found microtubular involvement in bacterial internalization into epithelial cells points to a possible contribution of microtubules bearing saa in the epithelial resistance to bacterial infection . In 2002, two groups almost simultaneously reported on acute phase saa being able to form channels in planar lipid bilayer membranes at physiological concentrations and, thus, play a role in host defense, by placing a severe metabolic strain on bacterial cells [10, 11]. Electron microscopy by wang et al . Revealed that these channels were formed by saa subunits arranged in hexamers, and circular - dichroism spectrum deconvolution and secondary structure prediction suggested that saa contains ~50% residues in an -helical conformation and below 10% in structure . Later studies indicated that these hexamers could be totally dissociated into monomers by urea treatment, with a concerted loss of its -helical structure . We have confirmed that, upon addition of 6 m urea to human recombinant saa, there is an apparent lack of self - multimerization and only monomers are recognized by anti - saa antibodies from human sera on an immunoblot . Since the studies by wang et al . Were performed on murine saa and little information is available in this regard concerning human saa, the immunoblots we performed (figure 3 and) indicated that similar multimerization was occurring for human saa . No x - ray crystallographic data is currently available for saa, but it appears that the structure and function of this important acute phase protein is modulated in vivo upon binding to apolipoproteins and/or other factors into complexes in the circulation . Intracellular associations of saa multimers within eukaryotic cells have been largely unaddressed; however, they could provide important clues to how saa functions within these cells and whether its locations are influenced by these interactions . Saa localizes with microtubules in untreated hcaec, but not with actin filaments or vimentin . These data indicate that saa can be attached to microtubules and can possibly be transported between neighboring cells by means of nanotubes or budding vesicles . Staining for saa is also found in the nucleus which indicates that saa might have nuclear - specific functions . Intra- and intercellular saa could play different roles in the physiological state, depending on the environment where it is located . On the basis of the distribution in endothelial cells, saa can be predicted to contribute also to the antibacterial barrier function of this epithelium.
Quadricuspid aortic valve (qav) is a rare congenital anomaly with an incidence of 0.010.04% . It is far less frequent as compared to bicuspid (12%) or unicuspid aortic valve anomaly . In recent decades, there has been increased awareness of qav because of better imaging techniques such as transthoracic, transesophageal echocardiography (tee), and cardiac magnetic resonance imaging (mri). This increased awareness has contributed to our knowledge of classification, clinical course, and management of this rare congenital condition . More than half of the patients with qav will require surgical intervention at some point in their life to treat the aortic insufficiency . A 39-year - old hispanic male was seen in his primary care physician's office for follow - up of his hypertension . Patient denied any exertional shortness of breath, chest pain, palpitations, orthopnea, or paroxysmal nocturnal dyspnea . Cardiac auscultation revealed a diastolic murmur of grade 2/4 in the second right intercostal space . Transthoracic echocardiogram was done for the evaluation of this new diastolic murmur, which showed normal left ventricular chamber size with an ejection fraction of 55% . The aortic valve was poorly visualized and showed evidence of mild to moderate aortic insufficiency with valve anatomy suspicious of qav . The aortic valve was found to be quadricuspid [figure 1 and video 1] with aortic root measuring 2.40 cm with vena contracta measuring 4.55 mm . There was evidence of moderate aortic insufficiency [figure 2 and video 2]. Since the patient was asymptomatic, he was counseled regarding the condition and need for regular follow - up with the cardiologist . 39-year - old hispanic male was examined by his primary care physician for follow - up of his hypertension . Transesophageal echocardiography image shows quadricuspid aortic valve in short axis view, cusp 1, 2, and 3 are equal in size whereas cusp 4 is the accessory cusp and is smaller in size . Rvot: right ventricle outflow tract; la: left atrium; ra: right atrium . 39-year - old hispanic male was examined by his primary care physician for follow - up of his hypertension . Qav is a rare congenital anomaly, which is usually diagnosed in the fifth or sixth decade of life when it causes aortic regurgitation . Several different anatomical variations of qav have been described, hurwitz and roberts classified them into seven groups: type a - four equal cusps; type b - three equal cusps and one smaller cusp; type c - two equal larger cusps and two equal smaller cusps; type d - one large, two intermediate, and one small cusp; type e - three equal cusps and one larger cusp; type f - two equal larger cusps and two unequal smaller cusps; and type g - four unequal cusps . Our patient had type b quadricuspid with three equal cusps and one smaller cusp as shown in figure 1 . This is the most common type and is often associated with regurgitation due to the unequal shear stress . One of them is abnormal septation of the embryologic truncus arteriosus . In general, after septation of the arterial trunk, three mesenchymal swellings develop into semilunar leaflets of the aortic and pulmonary trunks . In qav, however, the fourth cusp arises during the early stage of truncal septation, resulting in either a different number of primordial aortic leaflets or abnormal cusp proliferation . It usually appears as an isolated congenital anomaly but may also be associated with other malformations, the most common being coronary artery anomalies . Development of the aortic valve leaflets occurs just after the development of the coronary artery origins from the sinuses of valsalva and it is possible that these two groups of anomaly may therefore be embryologically related . It is very important to diagnose these associated anomalies before repair or replacement of aortic valve to avoid ostial obstruction . Aortic dilatation and other structural cardiac abnormalities were relatively common among patients with qav . In our patient, the physiopathology of the valve dysfunction is poorly understood: anatomical abnormalities of the cusps could induce unequal shear stress leading to fibrosis and incomplete coaptation . The characteristic echocardiographic finding in short - axis view is an x - shaped commissure pattern during diastole and a rectangular appearance during systole . However, transthoracic echocardiography may be suboptimal for recognizing qav and associated malformations due to the poor acoustic window . Tee provides reliable imaging of heart valves and other structures even in complex congenital heart diseases . Recently, cardiac mri has also been used for the diagnosis of qav and other associated congenital cardiac anomalies . With more liberal use of tee, computed tomography, and mri the importance of diagnosing this congenital anomaly in asymptomatic adults lies in the fact that more than 50% of these people will require valve repair / replacement in the fifth or sixth decade of life because of worsening aortic regurgitation or stenosis . Hence, patients with qav should have regular follow - up and have aortic valve repair / replacement at an appropriate time before left ventricle decompensation to avoid morbidity, mortality, and complications . The importance of diagnosing qav lies in the fact that majority of these patients will require surgery for aortic insufficiency . Once diagnosed patients should be closely followed so that aortic valve replacement / repair is done before the left ventricular decompensation occurs . 39-year - old hispanic male was examined by his primary care physician for follow - up of his hypertension . Transesophageal echocardiography shows quadricuspid aortic valve in short axis view 39-year - old hispanic male was examined by his primary care physician for follow - up of his hypertension.
The world health organization states that primary school children population is the most vulnerable group to acquire infection diseases such as parasites while their development is related to the environmental contamination as well as to the quality of consumed food . From an epidemiological, socioeconomical, and ecological point of view, the county populations possess favourable conditions that allowed children to acquire intestinal infections with a greater frequency . Particularly, in famaill city, in the province of tucumn, argentina, there is little information related with epidemiologic data on children parasitoses . For that reason, the present work deals with the study of parasite - related infections detected in primary school students from the institution no . The aim of this work was to assess the prevalence of intestinal parasites in the former population in order to obtain accurate epidemiological data that can be used to program prevention schemes in this particular age group . For the cohort study, a group of 149 children from kindergarten and primary level of the school no . 124, famaill city, tucumn, was selected and monitored through the summery station . Famaill, located 30 km in the south of tucumn capital district, has 32.000 habitants . The famaill district is situated in the central area of the province, limited at the north with the lules district, at the east with the leales district, at the south with the monteros district, and at the west with the taf del valle district . The personal affiliation (name, sex, and age) of each student was registered . A serial stool specimen was requested from each person, and the anal swab method for enterobius vermicularis eggs was used . Each student was provided with two bottles containing 5% formalin, and an informative - explicative meeting for children, parents, and teachers was conducted prior to the sampling process . After collecting the stool samples, they were analysed at the lab station by direct smear and through the concentration method described by melvin and brooke . The diagnostic elements were visualized with and without staining by lugol or carbol fuchsine by optic microscopy . Formalin - preserved stool samples and the modified ziehl - neelsen carbol - fuchsine staining of formalin - ether concentrates were used from the recovery and identification of cryptosporidium spp . Diagnosis the stool samples were subjected to the koga agar plate method . From the total 149 children selected for this study, 70 were females (47%) and the rest males (53%). The studies were adjusted to the conditions of the universal declaration of human rights (1948), ethical standards instituted by the nuremberg code (1947), the helsinki declaration (1964), and subsequent amendments regulated by the national law no . No significant differences were found on regard of age and sex of the infected population . 13 endoparasite species were diagnosed but among them the protozoa were more frequently found than the helminths . Blastocystis hominis (54.4%), entamoeba coli (35.6%), and giardia lamblia (24.8%) were the most prevalent protozoa . Among helminths, enterobius vermicularis (27.5%) and ascaris lumbricoides (20.8%) were the most frequent (table 1). Only 20 children (13.4% of the total population studied) did not present any parasite; in 36 children (24.2%) it was found only one parasite species while 62.4% of the total population was infected by two or more parasite species (table 2). It is important to remark that in all cases, the sanitary and social conditions of the studied children habitats were highly inappropriate and most deficient . It was found that more four - five (86.6%) of the students, aged 4.7 to 14, in the considered school were infected by intestinal parasites . This data is coincident with the data shown by previous works dealing with intestinal parasites in similar populations in tucumn [5, 6] but the prevalence is higher than the prevalence of these infections in other argentinean provinces [7, 8]. Compared to other south american countries the prevalence detected in this study can also be considered high as mercado et al . In chile and cabrera et al . In peru described a 55.8% and 77.8% of intestinal parasite prevalence, respectively . Among the protozoa, blastocystis hominis was the most prevalent parasite, this concurred with most of the epidemiological studies made in many other countries and it points out that this parasite is an emergent pathogen with the highest prevalence . Milano et al . Determined an endoparasite prevalence of 73.5% in 113 infants (between 0 and 14 years) from north east argentine (nea) urban area . In that work, blastocystis hominis (59.0%) and enterobius vermicularis (47.0%) were the more frequent protozoa and helminths, respectively . Menghi et al . Studied the prevalence of intestinal parasitoses by protozoans and helminths in an aboriginal community from salta, argentine . They found that the more frequent protozoa were blastocystis hominis (58.9%), entamoeba coli (51.8%), giardia lamblia (27.7%) and entamoeba histolytica / e . Dispar (24.1%). In our study, we determined similar prevalence levels of blastocystis hominis (54.4%) and giardia lamblia (24.8%). A minor incidence of entamoeba coli (35.6%) in school children from famaill city was found, and under our work conditions we were unable to identify others species of this protozoan . Have evaluated the prevalence of blastocystis hominis (18.93% 5.93%) and its clinical relevance in 162 preschool children living in bolivar city, venezuela . In the half of the studied children this protozoan was the only parasite . Giardia lamblia was identified with a frequency of 39.13%, and they have concluded that blastocystis hominis was a relatively frequent intestinal parasite among the preschool children evaluated . In addition, the results obtained by wang et al . Showed that blastocystis hominis in humans from huainan area (703 stool specimens examined) have a very low prevalence (3.70%), which was not related to gender and living circumstances, but they observed statistically significant association between presence of diarrhoea and infection . Among helminths, the occurrence of ascaris lumbricoides and enterobius vermicularis was important . Our results (27.5%) and those of milano et al . (47.0%) fully indicated that the prevalence rate of enterobius vermicularis infections was very high compared to other countries . Our present data shows that the prevalence was much higher than that reported in western and southern islands of the republic of korea by park et al . (18.1%); in some rural communities of ogun state - nigeria (0.3%) by agbolade et al ., and in cape town, south africa (0.6%) by adams et al . . The risk of e. vermicularis infection among school children can increase by inadequate personal hygiene, the biting nails habit, and not washing hands before meals . Surprisingly, only one case of hookworm was detected, although historically famaill was considered an important area of hookworm prevalence (9.2%). In our work, there was found a lower frequency than in previous works [11, 18], where hookworms (58.0%), hymenolepis nana (31.2%), and strongyloides stercoralis (24.1%) were reported as the most frequent helminths . Detected of 1.8% strongyloides stercoralis infection, in school children, while in this study we found this helminth with a frequency of 2.7% . In addition, taranto et al . Studying the clinical and parasitological status of a wichi aboriginal community living in the suburbs of tartagal, northern salta, argentina, determined that the most frequent helminths were strongyloides stercoralis (50.5%). Special techniques [4, 21] are required for detection of strongyloides infection and, for this reason, in past researches, the fecal levels have often been undervalued or ignored . According to pawlowski all regions cited in this paragraph might be considered endemic areas for strongyloides stercoralis infection because the prevalence rate was determined between 1 and 5% . Our results indicated that the overall prevalence rate of pinworm infections was rather low and the multiple infections were outstanding because of high frequency (62.4%). It has been showed before that the main source of infection for protozoa is the ingested water . The high prevalence of this kind of parasites suggests that further studies must be done about the water quality in this community to accurate determination of the infection source of these parasites . This study showed intestinal parasitosis as critical problem of public health in children from areas where the lack of adequate sanitation conditions and unsuitable supply of water today coexist . Intestinal parasitosis is a social problem with important consequences as poor school performance and impaired quality of life . This is one of few studies for determining parasitic prevalence in primary school children of north west argentine (noa) region . Because of this, it is very important and we propose that regular screening and treatment programs should be started . In addition, health education on personal hygiene is required and the uneducated women should be aided with specific programs . A multispectral government action is needed.
With the development of enhanced radiation technology and interventional techniques, effective diagnosis and treatment are possible for patients with coronary and other peripheral vascular diseases . However, therapeutic effects always come with complications, including vascular perforation, dissection, and contrast - induced nephropathy (cin). Among these complications, cin has been demonstrated to be associated with irreversible renal insufficiency, prolonged hospitalization, and high cost . Additionally, cin has unfavorable early and late prognosis . Therefore, it is important to diagnose cin and provide treatment as soon as possible, which depends on the early diagnosis . Contrast - induced nephropathy, also referred to as contrast - induced acute kidney injury, has become the third leading cause of hospital - acquired acute kidney injury . Half of these cases are caused by repeated exposure to contrast media during cardiac catheterization and coronary angiography (cag). Contrast - induced nephropathy is defined as an increase in serum creatinine (scr) concentration> 0.5 mg / dl or a minimum of 25% increase from baseline within 72 h after contrast administration, without evidence of other causes . Detection of serum creatinine is the foundation for the diagnosis of cin; however, the scr level may not be determined quickly enough to reflect decreased renal function, and scr level is affected by factors such as age, sex, and muscle mass . In conclusion, scr is not a perfect glomerular filtration rate (gfr) biomarker and is not sensitive enough to detect early changes in gfr . Thus, there is great need for a more sensitive and reliable biomarker for predicting the occurrence of acute kidney injury (aki) or cin . Numerous clinical trials have been sought to find discover an appropriate biomarker for early and precise assessment of renal function [68]. Disappointingly, many biomarkers have been confirmed to be useless, including neutrophil gelatinase - associated lipocalin, urinary liver type fatty acid - binding protein (l - fabp), and urinary kidney injury molecule 1 . Serum cystatin c (cys c) is a non - glycosylated protein with low molecular mass (13 kda). It is a cysteine protease inhibitor synthesized by all nucleated cells and released into the blood by glomerular filtration . Most importantly, external factors have little effect on the serum level of cys c. previous studies have demonstrated its utility in detection of diabetic mellitus and hypertensive nephropathy . In the present study we sought to determine the ability of cys c to predict the occurrence of cin in patients who underwent cag and intervention, and we compared the sensitivity and specificity of cystatin c and serum creatinine in the diagnosis of cin . From january 2015 to may 2015, a total of 300 consecutive patients who underwent only diagnostic coronary angiography for suspected coronary heart disease were enrolled in the study . It was funded by the national natural science foundation of china (no . 81200153), the science foundation of health department, sichuan province (no . 20120213), the science foundation of science and technology department, sichuan province (no . 2015sz0180), and the science foundation of the science and technology department, sichuan province (no . The exclusion criteria included: 1) patients with chronic nephropathy (ckd stage 2 to 4); 2) patients with other contrast exposure within 1 week, or exposure to nephrotoxic drugs; 3) patients with previous kidney transplantation, cardiac dysfunction, thyroid disorder, or cancer; 4) patients who were unable to understand the study content or provide consent; 5) patients younger than 18 or older than 80 years old; and 6) patients simultaneously participating in other studies . Patient data were recorded for feasibility analysis at admission, including sex, age, body mass index (bmi), left ventricular ejection fraction (lvef), hypertension, and diabetes mellitus, as well as use of oral medicines, especially angiotensin - converting enzyme inhibitors / angiotensin receptor blockers (acei / arb), and statins . Fasting baseline renal function and serum level of cys c were measured as basal indicators 24 h before cag . As another important evaluation indicator, estimated gfr (egfr) was calculated by the levey modification of the modification of diet in renal disease (mdrd) formula . A standard dose (35 ml / kg) of iodinated contrast medium (iohexol, ge pharmaceutical, shanghai) was used . In the process of angiography, we recorded the operation time and the infusion dose of contrast medium . Serum samples were collected at 12, 24, and 48 h after cag for measuring postoperative levels of cys c and creatinine . All blood samples were analyzed by the clinical laboratory in our hospital . According to the definition of cin, we calculated the change in creatinine and confirmed the occurrence of cin . Then, all the patients were assigned into 2 groups based on whether cin occurred . After grouping, we compared the collected demographics, medication usage, exposure to contrast medium, and serum levels of cys c and creatinine at different time points . Results are expressed as mean standard deviation (sd) for continuous variables and frequencies for categorical variables . Differences between groups were examined by nonparametric test and chi - square test for continuous and categorical variables, respectively . Other variables that were significantly associated with outcome were fed into the model in a stepwise procedure . An alpha value of 0.05, corresponding to a p value <0.05, served as the criterion for establishing statistical significance . The diagnostic sensitivity and specificity for the early diagnosis of cin based on the serum level of cys c and scr at 24 h from january 2015 to may 2015, a total of 300 consecutive patients who underwent only diagnostic coronary angiography for suspected coronary heart disease were enrolled in the study . It was funded by the national natural science foundation of china (no . 81200153), the science foundation of health department, sichuan province (no . 20120213), the science foundation of science and technology department, sichuan province (no . 2015sz0180), and the science foundation of the science and technology department, sichuan province (no . The exclusion criteria included: 1) patients with chronic nephropathy (ckd stage 2 to 4); 2) patients with other contrast exposure within 1 week, or exposure to nephrotoxic drugs; 3) patients with previous kidney transplantation, cardiac dysfunction, thyroid disorder, or cancer; 4) patients who were unable to understand the study content or provide consent; 5) patients younger than 18 or older than 80 years old; and 6) patients simultaneously participating in other studies . Patient data were recorded for feasibility analysis at admission, including sex, age, body mass index (bmi), left ventricular ejection fraction (lvef), hypertension, and diabetes mellitus, as well as use of oral medicines, especially angiotensin - converting enzyme inhibitors / angiotensin receptor blockers (acei / arb), and statins . Fasting baseline renal function and serum level of cys c were measured as basal indicators 24 h before cag . As another important evaluation indicator, estimated gfr (egfr) was calculated by the levey modification of the modification of diet in renal disease (mdrd) formula . A standard dose (35 ml / kg) of iodinated contrast medium (iohexol, ge pharmaceutical, shanghai) was used . In the process of angiography, we recorded the operation time and the infusion dose of contrast medium . Serum samples were collected at 12, 24, and 48 h after cag for measuring postoperative levels of cys c and creatinine . All blood samples were analyzed by the clinical laboratory in our hospital . According to the definition of cin, we calculated the change in creatinine and confirmed the occurrence of cin . Then, all the patients were assigned into 2 groups based on whether cin occurred . After grouping, we compared the collected demographics, medication usage, exposure to contrast medium, and serum levels of cys c and creatinine at different time points . Results are expressed as mean standard deviation (sd) for continuous variables and frequencies for categorical variables . Differences between groups were examined by nonparametric test and chi - square test for continuous and categorical variables, respectively . Other variables that were significantly associated with outcome were fed into the model in a stepwise procedure . An alpha value of 0.05, corresponding to a p value <0.05, served as the criterion for establishing statistical significance . The diagnostic sensitivity and specificity for the early diagnosis of cin based on the serum level of cys c and scr at 24 h were calculated by use of roc curve analysis and auc assessment . A total of 300 patients (179 males, 121 females) with a mean age of 63.479.92 were included in the final study . According to the definition of cin, patients with a> 25% relative increase of serum creatinine, or an increase in concentration of serum creatinine of at least by 44 mmol / l from the baseline 48 h after cag, we analyzed and compared the demographics of the 2 groups . As is shown in table 1, patients in the cin group were significantly older than those in the non - cin group (p=0.048), and the cin group had a higher proportion of females than the non - cin group (p=0.037). However, the differences in the ratio of hypertension, diabetes mellitus, smoking, and cardiac dysfunction were not statistically significant . Medication history was also recorded to analyze the effect on renal function, though there were no obvious distinctions between the 2 groups (all p>0.05). Previous researchers have used infusion dose of contrast medium and the exposure time as important indicators of cin, and we demonstrated the importance of these 2 indicators in our study . Patients in the cin group received significantly larger doses of contrast medium (p=0.040) and the operation time was longer compared to the non - cin group . Comparison of basal renal function and serum level of cys c showed no significant differences between the 2 groups . As an important procedure in our study, we measured the serum levels of creatinine and cystatin c at various time points . Compared vertically, the rise in serum cys c was the maximum at 24 h, which was significantly higher than baseline (p<0.001). Then, the level declined, but still remained higher at 48 h (p<0.01). The serum level of creatinine in the cin group peaked at 48 h (p<0.001) and was not significantly different at 24 h. egfr had decreased at 24 h and had even more obviously decreased at 48 h (p<0.001). It is obvious that the change in serum level of cys c occurred prior to the change in serum level of creatinine . In the non - cin group, the differences in scr and cys c before and after the procedure were both non - significant . Compared horizontally, the difference in cys c level between the 2 groups became apparent at 24 h (p<0.001) and lasted until 48 h. the serum level of scr in the cin group was significantly higher than that in the non - cin group only at 48 h, and the difference was not obvious at 24 h. moreover, compared with non - cin group, egfr decreased from 24 h to 48 h in the cin group, and both differences were significant (p<0.001). Table 2 shows that the change in serum level of cys c became significantly different before that of scr . To study the significance of cys c and scr in cin the area under the curve (auc) of cys c at 12 h and 24 h was 0.735 (95% ci: 0.6480.823, p=0.000) and 0.928 (95% ci: 0.8700.987, p=0.000), respectively, and the optimum cut - off level was 1.315 mg / l (sensitivity=79.3% and specificity=55.4%) and 1.55 mg / l (sensitivity=82.8% and specificity=97.8%), respectively . The auc of changes in cys c between baseline and 12 h and 24 h were 0.758 (95% ci: 0.6680.847, p=0.001) and 0.936 (95% ci: 0.8790.992, p=0.000), respectively, and the optimum cut - off level was 0.185 mg / l (sensitivity=79.3% and specificity=95.3%) and 0.26 mg / l (sensitivity=89.7% and specificity=95.6%), respectively . The auc was 0.923 (95% ci: 0.8750.972, p=0.000) and the optimum cut - off level was 17.15% (sensitivity=79.3% and specificity=87.8%). When we chose the serum level of creatinine at 24 h for roc analysis, the auc was 0.733 (95% ci: 0.6400.825, p<0.001) and the optimum cut - off level was 73.55 mol / l (sensitivity=89.7% and specificity=43.5%). According to the results in table 3, although the aucs of cys c at 24 h and cys c changes at 24 h were similar, serum cys c with concentration changes> 0.26 mg / l had higher sensitivity (89.7% vs. 82.8%) but lower specificity (95.6% vs. 97.8%) for differentiating cin and non - cin . A total of 300 patients (179 males, 121 females) with a mean age of 63.479.92 were included in the final study . According to the definition of cin, patients with a> 25% relative increase of serum creatinine, or an increase in concentration of serum creatinine of at least by 44 mmol / l from the baseline 48 h after cag, we analyzed and compared the demographics of the 2 groups . As is shown in table 1, patients in the cin group were significantly older than those in the non - cin group (p=0.048), and the cin group had a higher proportion of females than the non - cin group (p=0.037). However, the differences in the ratio of hypertension, diabetes mellitus, smoking, and cardiac dysfunction were not statistically significant . Medication history was also recorded to analyze the effect on renal function, though there were no obvious distinctions between the 2 groups (all p>0.05). Previous researchers have used infusion dose of contrast medium and the exposure time as important indicators of cin, and we demonstrated the importance of these 2 indicators in our study . Patients in the cin group received significantly larger doses of contrast medium (p=0.040) and the operation time was longer compared to the non - cin group . Comparison of basal renal function and serum level of cys c showed no significant differences between the 2 groups . As an important procedure in our study, we measured the serum levels of creatinine and cystatin c at various time points . Compared vertically, the rise in serum cys c was the maximum at 24 h, which was significantly higher than baseline (p<0.001). Then, the level declined, but still remained higher at 48 h (p<0.01). The serum level of creatinine in the cin group peaked at 48 h (p<0.001) and was not significantly different at 24 h. egfr had decreased at 24 h and had even more obviously decreased at 48 h (p<0.001). It is obvious that the change in serum level of cys c occurred prior to the change in serum level of creatinine . In the non - cin group, the differences in scr and cys c before and after the procedure were both non - significant . Compared horizontally, the difference in cys c level between the 2 groups became apparent at 24 h (p<0.001) and lasted until 48 h. the serum level of scr in the cin group was significantly higher than that in the non - cin group only at 48 h, and the difference was not obvious at 24 h. moreover, compared with non - cin group, egfr decreased from 24 h to 48 h in the cin group, and both differences were significant (p<0.001). Table 2 shows that the change in serum level of cys c became significantly different before that of scr . To study the significance of cys c and scr in cin, we chose the serum levels at different time points for roc analysis . The area under the curve (auc) of cys c at 12 h and 24 h was 0.735 (95% ci: 0.6480.823, p=0.000) and 0.928 (95% ci: 0.8700.987, p=0.000), respectively, and the optimum cut - off level was 1.315 mg / l (sensitivity=79.3% and specificity=55.4%) and 1.55 mg / the auc of changes in cys c between baseline and 12 h and 24 h were 0.758 (95% ci: 0.6680.847, p=0.001) and 0.936 (95% ci: 0.8790.992, p=0.000), respectively, and the optimum cut - off level was 0.185 mg / l (sensitivity=79.3% and specificity=95.3%) and 0.26 mg / l (sensitivity=89.7% and specificity=95.6%), respectively . The auc was 0.923 (95% ci: 0.8750.972, p=0.000) and the optimum cut - off level was 17.15% (sensitivity=79.3% and specificity=87.8%). When we chose the serum level of creatinine at 24 h for roc analysis, the auc was 0.733 (95% ci: 0.6400.825, p<0.001) and the optimum cut - off level was 73.55 mol / l (sensitivity=89.7% and specificity=43.5%). According to the results in table 3, although the aucs of cys c at 24 h and cys c changes at 24 h were similar, serum cys c with concentration changes> 0.26 mg / l had higher sensitivity (89.7% vs. 82.8%) but lower specificity (95.6% vs. 97.8%) for differentiating cin and non - cin . Contrast - induced nephropathy is a well - known complication that can be observed after some enhanced radiologic and angiographic examinations and treatments . The injury is generally mild and transient but can result in lasting renal dysfunction and it is associated with increased morbidity and mortality . One is the influence of renal hemodynamics caused by contrast medium exposure and the other is the direct cytotoxicity of contrast medium to renal tubular epithelial cells . In addition, there are no effective therapies for the acute kidney injury caused by contrast medium, so the only option is to prevent it from happening . Nowadays, serum level of creatinine is widely used and recognized as a diagnostic clinical indicator of cin . However, scr could be affected by numerous factors like age, sex, and muscle mass . Because of the reserve capacity of the kidneys, concentrations of scr can be within the reference range with a certain degree of impaired renal function . In our study, the level of scr increased significantly 48 h after exposure and was obviously higher than in the non - cin group (p<0.001). Therefore, scr is not efficient and accurate enough as a diagnostic indicator of cin . These limitations prompted us to look for another indicator that can reflect damaged renal function in early stages . The results showed that the serum level of cys c significantly increased at 24 h in cin patients, which was before the increase in scr . The variation tendency of cys c in the non - cin group was not obvious, as opposed to the increase in the cin group (p=0.121 vs. p<0.001). Cys c is a 13-kda non - glycosylated protein that is a cysteine protease inhibitor . It is produced by almost all nucleated cells at a constant rate and removed from the blood by glomerular filtration . The kidneys are the only organs that clear cys c, and the serum level of cys c only depends on gfr . Therefore, in theory, the concentration change of cys c can reflect the change of gfr more sensitively than scr . Bachorzewska - gajewska et al . Found the same variation tendency of cys c after contrast medium exposure . Their study including 410 patients with chronic kidney disease indicated that cys c is a reliable biomarker and predictor for the early diagnosis of cin . However, the form of cys c used for cin diagnosis is still in dispute . Our study again verified the significant predictors of cin, including age, female sex, the dose of contrast medium, and the exposure time . Most importantly, we revealed the potential association between the increase of cys c and the occurrence of cin . A certain increase of the concentration of cys c is sensitive and specific for the prediction of cin after contrast medium exposure . Despite of the achievements of our study firstly, we only included patients with normal renal function at baseline, which limited the observations of the significance of cys c in patients with chronic kidney disease . Then, we excluded patients who underwent pci from our study, leading to insufficient contrast medium exposure . In addition, we analyzed the different forms of cys c for the early diagnosis of cin and results showed similar significance among these indicators . Therefore, the best form of cys c for the diagnosis of cin still remains uncertain . In conclusion, our study demonstrated that the change in concentration of cys c is superior to scr as a biomarker in the early detection of cin . We found that the changed concentration of cys c is superior to scr as a biomarker in the early detection of cin.
Critical care practice is beginning to look toward more specific cellular, biochemical, and genetic interventions in order to make a significant impact on patient outcomes . In addition to the extensive cellular, biochemical, and genetic body of research in process today, the science of epigenetics has become a more frequent focus within the critical care literature over the past 5 + years . Though epigenetics may appear to be relatively new to us in the critical care discipline, it has actually been studied for over 70 years and was first described by conrad waddington in 1942 as the branch of biology which studies the casual interactions between genes and their products, which bring the phenotype into being [1, 2]. In simpler terms, epigenetics is the study of changes in the function of genes that do not involve changes in the dna sequence . It is the study of how the same sequence of dna can produce significantly different phenotypes as a result of differing biochemical changes that alter gene availability for protein production [1, 3]. What makes this even more fascinating than a nature versus nurture discussion is that there are a small number of known genes in which specific biochemical modifications can impact the phenotype of offspring and are thus inheritable yet do not alter base pair sequencing of dna . A classic example of this is seen on chromosome 15 in angelman and prader - willi syndromes where dna methylation is involved in genomic imprinting of parental germ line cells, impacting the phenotype of the offspring depending upon whether the affected chromosome is paternal or maternal in origin [46]. Children with prader - willi syndrome inherit an affected paternal chromosome 15, resulting in short stature, poor muscle tone, and hypogonadism; many of these children also have learning disabilities . Children who inherit an affected maternal chromosome 15 may develop angelman syndrome, which is associated with developmental delays, ataxia; they also may have epilepsy and microcephaly . Of even more importance to critical care, epigenetic changes of somatic cells can be propagated to progeny of those cells within an individual, impacting phenotypic expression during the course of critical illness . For example, epigenetic changes altering the effectiveness of immune cells to respond to pathogens could persist in new immune cells which inherited the epigenetic changes . These prior epigenetic changes could thus have a direct effect on an individual's ability to respond to sepsis in the future . Interest in critical care has focused on dna methylation, histone modification, and microrna (mirna). Decreased gene expression may result from downregulation of genes (the transcription of rna from specific gene sequences is inhibited or arrested). Increased gene expression may result from upregulation of genes (increased transcription of rna from targeted genes). However, for genes which provide a messenger rna (mrna) template for protein production, additional factors can influence the amount of protein produced from mrna; for example, how often each mrna is used for transcription and how quickly the mrna is degraded can influence the amount of protein produced . More specifically, dna methylation (as the result of enzymes known as dna methylases) is the attachment of methyl groups (ch3) to cytosine bases within a dna sequence; demethylation is removal of these methyl groups . As the quantity and pattern of dna methylation increases, gene transcription into messenger rna (mrna) decreases; demethylation can increase gene transcription . Methylation patterns in dna can be transmitted to daughter cells during mitosis or transmitted to offspring as a result of meiosis [1, 7, 8]. Furthermore, since dna is an extremely long molecule, it must be coiled and folded in order to fit into a nucleus (figure 1). Histones are the nuclear proteins that direct the winding and coiling of dna into nucleosomes and then chromatin . Histone proteins have extremely long tails which are susceptible to methylation, acetylation, ubiquitination, phosphorylation, and so forth at multiple locations . When histone tails are modified (histone modification), they alter the way in which dna will coil around a histone octamer (four histones with dna coiled around them to form a nucleosome). The nucleosomes continue to fold and coil into chromatin, and multiple chromatin coils create a chromosome . In addition to gene sequence availability being limited by dna methylation, how tightly chromatin is condensed will also impact the availability of gene sequences to interact with transcription proteins in order for mrna to be transcribed and then translated into proteins [8, 9]. Noncoding rnas are also involved in modifying phenotype through various mechanisms, such as posttranscriptional and transcriptional interference pathways, in which they may alter chromatin and/or dna methylation processes to further stabilize gene silencing . Roles for mirnas in central nervous system injury and in acute lung injury have been postulated, although experimental evidence in critical care subjects is lacking . The extent of dna methylation, histone modification, and microrna activity may impact the function of genes without any alterations in the dna sequence . When gene expression is altered, the potential for significant phenotypical alterations to pathology, disease progression, and short- and long - term outcomes exists . Within critical care, research regarding the influence of genetics is in its early stages, and investigators are just beginning to look toward the science of epigenetics for explanations for patient and population differences in susceptibility to illness, clinical course, and outcomes . In the following sections, epigenetic regulation, in which gene expression is altered and may significantly impact critical illness outcomes, can occur through direct methylation of dna cytosine bases resulting in downregulation of genes . Alternatively, demethylation might upregulate expression of genes . An example of downregulation through methylation in acute illness has been associated with the pathological processes associated with acute kidney injury (aki). Aki is a common complication in critical care patients, with an incidence greater than 510%, contributing to an increase in morbidity and mortality . Previous animal studies have suggested that altered expression of the klk1 gene, which results in the transcription / translation of the serine protease kallikrein, may be related to aki . Kallikrein is involved in the biochemical reaction in the kidney to produce kallidin, which pharmaceutically appears to have vasodilator and natriuretic properties in animals . Additionally, increased concentrations of kallikrein have been shown to be protective in animals, diminishing renal cell death by apoptosis and inflammation . Kang and colleagues prospectively compared hospitalized patients with established or incipient (early) aki from ischemia, nephrotoxins, sepsis, and other causes to healthy nonhospitalized and icu patient controls . In particular they were looking for the increased methylation of the promoter region of the klk1 gene . The promoter region of a gene is a dna sequence where the enzyme rna polymerase binds to start mrna transcription from the gene; the degree and pattern of methylation of promoters can regulate gene expression . Kang and colleagues hypothesized that gene silencing by methylation of the klk1 gene promoter and thus the subsequent decrease of urine kallikrein may be associated with established aki . Contrary to their expected findings, they found that established aki patients, compared to controls, had significantly greater dna methylation of klk1 as expected but also had significantly higher levels of urine excreted kallikrein, which was not expected . Interestingly, the established aki patients also had significantly lower average systolic blood pressure, increased heart rate, and increased epinephrine concentrations . Epinephrine is known to increase kallikrein concentrations in the urine, most likely as part of the systemic regulation of hemodynamic instability in acute illness . Two significant contributions to the state of epigenetic science in acute illness can be derived from the work of kang et al . . First, it further advances our understanding of how epigenetic modification may be trumped by other regulatory mechanisms . Second, this study provides an expanded perspective of the complexity of system regulation, highlighting the fact that even at the genetic level focusing on a single targeted therapy solution may need to give way to other more novel therapeutic approaches . Another type of epigenetic mechanism, histone acetylation, is now a potential therapeutic target in critical illness . As previously discussed, dna is more or less accessible for transcription depending upon how it is wound around histones in the nucleus . Acetylation of histones occurs when acetyl groups are added to specific amino acids (lysines) comprising the histones . Inhibitors of histone acetylation have been examined in animal models of hemorrhagic shock and lps - induced sepsis; inhibiting histone acetylation reduces immune responsiveness during the acute episode, and has been associated with better outcomes . Caution is warranted because not all cells respond similarly to pharmacologic agents targeted to histone modification, and acetylation inhibitors affect cellular proteins in addition to histones . Although histone modifiers are currently being explored as therapeutic agents, there is additional reason for caution because of emerging evidence about the sequella of histone modifications on immunity following sepsis . Patients who survive sepsis have profound and long lasting immunosuppression which can impede appropriate response to pathogens; 5- and 8-year survival is shorter compared to age - matched people who have not had severe sepsis . Evidence is accumulating that this consequence of critical illness is associated with epigenetic changes in immune cells . In a recent review of epigenetic mechanisms after sepsis, carson iv and colleagues provided several possible examples . Direct suppression of proinflammatory activity by epigenetic mechanisms has been hypothesized as cause for lipopolysaccharide (lps, a major component of gram - negative bacterial cell walls) tolerance . For example, in macrophages exposed to lps (either in the laboratory or in a patient experiencing sepsis), an initial brisk proinflammatory response is followed by histone modifications to promoter regions of interleukin i beta and tumor necrosis factor alpha; these histone modifications reduce subsequent macrophage response to lps resulting in immunosuppression . This has been demonstrated in animal models as well as in monocytes sampled from critically ill patients . Mirna is highly expressed in central nervous system tissues, and research suggests that they play a role in neurodevelopment and neural plasticity . Temporal alterations in expression of mirnas localized at areas of central nervous system injury have been demonstrated in rodent models of spinal cord injury, traumatic brain injury, and brain ischemia [13, 14], although studies examining mirna in human trauma victims have not yet been reported . Likely targets of these mirnas have been identified by computational analysis and computer modeling based on sequence homology and include genes involved in inflammation and in neural signaling as well as other genes previously identified as important in response to specific central nervous system injuries . Madathil and colleagues propose that in the response to acute cns injury, some mirnas might have a neuroprotective effect while others might have a neurotoxic effect . Thus, the epigenetic regulation mediated by mirnas in the cns is complex, and the effects in patients with cns trauma or cerebrovascular accident will likely be difficult to be definitively determined . Mirnas contribute to differentiation and regulation of the immune system and have been implicated in chronic pulmonary diseases with an inflammatory component, including asthma, chronic obstructive pulmonary disease, and cystic fibrosis . There has been recent speculation that mirnas might also be involved in acute lung injury (ali), including acute respiratory distress syndrome (ards, the most severe manifestation of ali). Rodent models of ali / ards, which initiate acute injury by administration of lps, have provided some support for the involvement of mirnas in the pathogenesis of ali, but human data are not available . Better understanding of the positive and negative effects of mirnas on the course of critical illness would be beneficial in at least two ways . First, it would help to elucidate mechanisms underlying pathogenesis and protective response; this could identify potential targets for pharmacotherapeutic or nonpharmacotherapeutic interventions . Second, in the future mirnas could themselves be targets for intervention, with a goal of enhancing regulatory effects related to protective responses and suppressing regulatory effects associated with pathogenesis . Warren and colleagues investigated whether epigenetic data could improve on standard severity of illness scoring in trauma patients . Both acute physiology, age, and chronic health evaluation (apache) and injury severity score (iss) are well - validated tools which are widely used in clinical practice to score severity of illness [17, 18]. Building on the idea that gene expression changes early in trauma and critical illness might be prognostic of events occurring later in the hospital course, gene expression data could provide a snapshot predictive of likely outcome . In order to examine this concept, warren and colleagues first developed a reference gene expression profile from the leukocytes of 10 healthy adults to calculate a reference score for each of 54,000 plus gene probe sets . Genomic response on the same gene probe sets of critically ill adult subjects within the first 12 hours of blunt trauma was compared to the healthy reference values by calculating difference from reference for each gene and then summing the differences, resulting in a difference from reference (dfr) score for each subject . They found that dfr scores, calculated early in the course of trauma, were positively associated with important clinical outcomes such as time on ventilator and length of stay . Since warren and colleagues examined a single time point 12 hours after trauma, this study does not provide information about the magnitude of genetic expression changes over time nor when the optimal time to measure might be . A second group of investigators refined this approach by retrospectively identifying 63 genes whose expression varied in trauma subjects over the course of 28 days of hospitalization and were significantly different between those with complicated and uncomplicated recovery . Of the 63 genes, two - thirds they found that a newly developed commercial multiplex system to rapidly quantify rna (nanostring dfr, nanostring technologies, seattle, wa) was a better predictor of complicated outcome (versus intermediate or uncomplicated outcome) than standard microarrays, apache, or iss score . Cuenca and colleagues noted that current technologies are limited by the time required for processing samples; additional research into rapid technologies will be necessary . They further suggest that their data support a role for therapeutic agents that target adaptive immunity and gene expression data as indicators of likely response to biological response modifiers . Interestingly, temporal gene expression patterns in dendritic cells of 10 patients over the first four days following trauma identified upregulation of genes involved in antigen presentation . However, the gene expression in dendritic cells was not associated with severity of illness scores . The differential expression of genes between subsets of cells (such as leukocytes and dendritic cells) and temporal changes in expression within a cell subset complicates the ability to develop predictive epigenetic measures of severity and outcomes . Analogous to the left shift in a white blood cell differential count, it may be essential to examine multiple genetics expression profiles from multiple cell types simultaneously to fully understand response . Important predictive patterns may emerge from such an approach, although technical considerations preclude this approach in the clinical setting at present . Stratification by genetic risk profile could inform when to initiate targeted therapy, who is most likely to benefit, and whether patients are responding to prescribed therapies . This information will be most useful if it can be assessed early in the course of critical illness . However, the specific epigenetic mechanisms underlying the changes in gene expression were not elucidated in the above studies [16, 19, 20]. The state of the science in understanding the role of epigenetic regulation as it relates to the pathology of critical illness, clinical course, and outcomes is evolving rapidly yet still well within its infancy . Available research exists primarily within the lab, animal, and preclinical realm and thus has yet to be translated to the direct care of the critically ill person . Epigenetic tools and methodologies continue to evolve and improve, bringing the possibility of real time data to the point of care for therapeutic intervention closer to reality . Better identification and understanding of the role of epigenetic modifications that are associated with the complex regulatory and disregulatory processes of the disease state is essential and it is apparent that our approach to therapeutically target epigenetic modifications to improve outcomes may only be a single component of even more complex novel therapies to come.
Written informed consent was obtained from the parents, and assent was obtained from the subjects . The institutional review board at ut southwestern medical center approved this study, which began in august 2006 and ended in may 2008 . Participants were randomized to either the mi or sde group based on a sex - stratified schedule . A third education session was planned (t2) if a1c continued to be 9% . Three diabetes educators were assigned to the mi arm and trained on motivational interviewing at a 2-day workshop . (3), journal articles (4), and guidance from the mi trainer and psychologist . The remaining six educators were assigned to the sde arm and did not receive additional training . Educators used a comprehensive checklist compiled using core content recommended by the american diabetes association (ada) on medication, monitoring, acute complications, and lifestyle (5). All audiotapes were coded using the motivational interviewing treatment integrity 3.0 (miti 3.0) coding system (6). The coder attended a 2-day workshop on miti 3.0 and was blinded to the treatment groups . A1c (measured via a dca vantage analyzer) and psychosocial measures were collected at baseline and at 3, 6, and 9 months (t3). Psychosocial measures included the center for epidemiologic studies depression scale (ces - d) (7), the epidemiology of diabetes interventions and complications quality of life questionnaire (edic - qol) (8), and the summary of diabetes self - care activities (9). The mixed - model procedures of proc mixed in sas version 9.2 (sas institute, cary, nc) were used for the primary analysis . Baseline values of a1c and each baseline psychological measure were included as covariates in the respective analyses . The main effect of treatment group and the treatment group time period interaction effect were examined . Cohen's d was interpreted as the effect size estimator for the between - subject treatment group effect . A1c (measured via a dca vantage analyzer) and psychosocial measures were collected at baseline and at 3, 6, and 9 months (t3). Psychosocial measures included the center for epidemiologic studies depression scale (ces - d) (7), the epidemiology of diabetes interventions and complications quality of life questionnaire (edic - qol) (8), and the summary of diabetes self - care activities (9). The mixed - model procedures of proc mixed in sas version 9.2 (sas institute, cary, nc) were used for the primary analysis . Baseline values of a1c and each baseline psychological measure were included as covariates in the respective analyses . The main effect of treatment group and the treatment group time period interaction effect were examined . Cohen's d was interpreted as the effect size estimator for the between - subject treatment group effect . A total of 26 participants were randomized to the mi group and 28 to the sde group . Six - month data (t2) were available on 21 and 23 patients in the mi and sde groups, respectively (table 1). Four patients each in the mi and sde groups had a third education session at t2 . Baseline characteristics, a1c, psychosocial measures, and miti 3.0 least squares (ls) means are adjusted for each respective baseline measure . F statistic was used to test for omnibus mean difference on each measure between the two treatment groups over 6 months of follow - up . * children's health insurance program (chip)/children with special health care needs (chscn). Primary outcome variable, least squares means for a1c, adjusted for baseline over 6 months of follow - up . Overall competence of the clinician in using mi based on a global rating scale of 15, where 1 is low spirit and 5 is high spirit . The score for beginning proficiency and competency are 3.5 and 4, respectively . #giving information, education, providing opinion without advising . Fidelity to mi would correspond to lower scores on this variable . * * asking permission before giving advice, affirming, emphasizing control, and supporting the participant . Number is based on frequency of occurrences . Fidelity to mi would correspond to higher scores on this variable . After adjusting for baseline a1c, the pattern of omnibus least squares (ls) mean a1c values differed between groups (f = 4.84, df = 1, 42.1, p = 0.03) over the 6 months of follow - up; the sde group had lower a1c (least squares mean 10.31, se 0.32) than the mi group (least squares mean 11.35, se 0.34) (d = 0.66, medium effect size). No overall time period effect emerged (f = 0.33, df = 2, 34.8, p = 0.72) and no treatment group time interaction effect was found (f = 0.20, df = 2, 34.8, p = 0.81) (table 1). After controlling for baseline, there were no differences between the groups on any psychosocial outcome, none of which improved in either group (table 1). There were 21 subjects in the mi group and 22 in the sde group with interpretable tapes and miti scores . The groups differed on all indicators of fidelity to mi in the expected direction (p <0.001, repeated - measures anova) (table 1). After adjusting for baseline a1c, the pattern of omnibus least squares (ls) mean a1c values differed between groups (f = 4.84, df = 1, 42.1, p = 0.03) over the 6 months of follow - up; the sde group had lower a1c (least squares mean 10.31, se 0.32) than the mi group (least squares mean 11.35, se 0.34) (d = 0.66, medium effect size). No overall time period effect emerged (f = 0.33, df = 2, 34.8, p = 0.72) and no treatment group time interaction effect was found (f = 0.20, df = 2, 34.8, p = 0.81) (table 1). After controlling for baseline, there were no differences between the groups on any psychosocial outcome, none of which improved in either group (table 1). There were 21 subjects in the mi group and 22 in the sde group with interpretable tapes and miti scores . The groups differed on all indicators of fidelity to mi in the expected direction (p <0.001, repeated - measures anova) (table 1). Although we hypothesized that lack of motivation more than poor knowledge impedes good metabolic control, we found that one brief intervention followed by a short education session could decrease mean a1c levels by 1% . Subsequent sessions did not further affect the a1c, and the positive effect was maintained at 9 months . We should have assessed knowledge of diabetes pre- and posteducation to show that improved knowledge played a role in our results . However, we did find a higher amount of given information in the sde group compared with the mi group by miti scoring . The lack of efficacy of mi in our study is consistent with a recent trial in adult patients with poorly controlled type 1 diabetes (10). In contrast, mi improved both metabolic control and psychosocial measures over a 12-month period in teens with diabetes (11), but this study had more interventions over a longer period than ours . This was a small study that detected a treatment effect in the direction opposite to that hypothesized . Perhaps the educators in the mi group were not proficient in mi compared with other studies (1113), but the miti demonstrated good fidelity of our intervention to mi principles . In conclusion, brief motivational interviewing - based counseling with no pre - established level of educational content does not lead to improved metabolic control, whereas ongoing education is important for teens with poorly controlled diabetes . We did show that we could train diabetes educators in mi with adequate proficiency . Before translating research to clinical practice future studies should compare structured diabetes education and sde plus motivation in a multicenter setting for a longer follow - up period.
High prices allow pharmaceutical companies not only to recoup their development costs but also to turn healthy profits that satisfy their investors and fund research on other drugs in their pipelines . Through patents and other market exclusivities, the federal government grants drug makers limited monopolies on their products with the understanding that eventually drugs will lose this protection and will go down in price . So, what is a policymaker to do when the price of an off - patent drug goes up instead? This question is hardly hypothetical . In august 2015, turing pharmaceuticals acquired the marketing rights to daraprim (pyrimethamine), a drug used to treat parasitic infections like malaria and toxoplasmosis . Within one month, turing announced that it would raise the price per tablet of daraprim from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$13.50\ to\ \$750}$\end{document}a 5500 per cent price hike for a drug that has been on the market for over 60 years and off patent since the 1970s . Facing bad press, social media backlash, and even the outrage of presidential candidates turing pledged it would roll back its price increase before settling on only minor adjustments to its original pricing strategy . Turing pharmaceuticals is not alone in trying to purchase the rights to old drugs and squeeze higher revenues out of them a strategy that detractors label drug profiteering. Since 2013 similar moves by other companies have inflated the prices of drugs that treat not only rare diseases like toxoplasmosis but also common conditions like heart failure and growing threats like multidrug - resistant tuberculosis . These price increases are of national concern since the profits that they generate could well be at the expense of public health and the general welfare . Yet recent scrutiny from lawmakers and the public has not necessarily changed the calculus for drugmakers considering turing - like tactics . Fundamentally, off - patent drugs can be extremely lucrative for companies that purchase the rights to manufacture and market them . These companies stand to make substantial returns on relatively small investments, especially if they can charge high prices for the drugs that they acquire . Indeed, since they are legally obliged to act in the interest of their shareholders, corporations are likely to raise the prices of off - patent drugs to the full extent the market will bear . To continue with the turing example, the company has the power to set a high price for daraprim because the drug's limited patient population, the absence of competing manufacturers, and a lack of therapeutic alternatives have all created an effective monopoly . However, considering all of these forces, it is unclear that turing engaged in anticompetitive behavior to obtain its market position . Thus, federal and state governments might not be able to use antitrust law to challenge turing or companies like it . Instead, governments may need to use unconventional approaches to encourage potential competitors and to rein in the prices of off - patent drugs . In this note, i focus on policy solutions that have attracted less media attention, like expanded compounding, over those that have already been discussed at length elsewhere, like drug reimportation from canada . First, however, i outline the extent of the high - cost off - patent drug problem, drawing special attention to the negative impact of high drug costs on public health outcomes and public spending, and i discuss some of the problem's underlying causes . Old, off - patent drugs are becoming increasingly expensive . Rising prices for off - patent drugs have come in two forms: (i) increased rates for single - source drugs that is, drugs with only one manufacturer driven by savvy investors who spot opportunities to earn monopoly profits; and (ii) spikes in the price of multisource generic drugs due to manufacturer mergers and manufacturing disruptions . Both types of price increases have been alarmingly large often tenfold or more but i focus in this note on the case of single - source drugs that have recently changed hands . Canadian company valeant pharmaceuticals purchased two drugs commonly used to treat cardiovascular conditions isuprel (isoprenaline) and nitropress (sodium nitroprusside)and raised their prices by up to 500 per cent, seemingly overnight . Rodelis therapeutics bought cycloserine, a drug used to treat multidrug - resistant tuberculosis, from an affiliate of nonprofit purdue university and raised the price of a course of treatment from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$500\ to\ \$10,800}$\end{document}the most substantial hike yet . What turing, valeant, rodelis, and others share is the view that many off - patent drugs are undervalued assets, at least relative to prices that insurers and patients with no therapeutic alternatives are willing to pay . By this logic the original owners of these off - patent drugs underpriced their products because they lacked the profit motive to charge more, as in the case of purdue and cycloserine, or they neglected them in favor of more lucrative drugs in their product portfolio, as in the case of glaxosmithkline, the long - time manufacturer of daraprim . However, this economic argument in favor of higher prices disregards the negative effects of high drug prices on health outcomes and on public spending through programs like medicare and medicaid . Like many off - patent drugs, daraprim, nitropress, and cycloserine are considered these drugs allow for timely responses to infectious disease outbreaks and enable modern intensive care . High costs can saddle society with a heavy disease burden due to reduced medication adherence that is, fewer patients starting or sticking to a course of necessary prescribed medication . Thus, keeping off - patent drug costs low can often be considered a public health imperative . Arguably the rationale that would support low prices for off - patent drugs also supports lower prices for expensive innovator drugs with clear public health benefits for example, the hepatitis c treatment sovaldi (sofosbuvir). Up to five million americans suffer from a chronic hepatitis c infection, which is the leading cause for liver cancer and liver transplantation in the united states . As of january 2016, the average wholesale price for sovaldi is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$1200\ per\ pill}$\end{document}, or \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$100,800}$\end{document} for a 12-week course of treatment . To date private insurers and government payers have covered sovaldi, but the cost of treatment has been a significant strain on their budgets . Between january and march 2014 alone, medicaid in the state of massachusetts spent \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$23.3\ million}$\end{document} on sovaldi . In an attempt to contain costs, payers now cover treatment with sovaldi only for patients with advanced liver disease . From the perspective of both public health and public spending, the high price of sovaldi has led to suboptimal outcomes . However, from the perspective of the free market, sovaldi's status as an innovator drug justifies its high price . As i discuss in the remainder of this note, off - patent drugs are just as affected as innovator drugs by this tension between legitimate public and private interests . The high cost of off - patent drugs is, at its heart, about shortages: most commonly, a shortage of patients to take these drugs and/or a shortage of drugmakers to make them . As a treatment for a parasitic disease of tropical origin, daraprim is the archetypal example of a drug with a limited patient population in the united states . Although it is estimated that 22.5 per cent of adults in the usa carry the parasite toxoplasma gondii, most of these carriers rarely get ill . However, individuals who are immunocompromised due to comorbid hiv infection, immunosuppression following an organ transplant, or chemotherapy, for example can experience recurring bouts of disease with severe symptoms like seizures and confusion . Toxoplasmosis being a rare disease does not ipso facto make treatments for the disease unprofitable . Indeed, over the past decade pharmaceutical companies have profited massively from the key difference here is that treatment with daraprim lasts just six weeks, which limits the potential value of its sales relative to orphan drugs that must be taken for life . In 2010, sales of daraprim totaled just \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$667,000\ from\ \$12,700}$\end{document} prescriptions . By contrast, many orphan drugs cost hundreds of thousands of dollars per patient per year . Given this disparity, the market is unlikely to prioritize the development of therapeutic alternatives to daraprim . Generic competition is similarly unlikely . In principle, the newly high price of daraprim would encourage generic drugmakers to produce substantially cheaper bioequivalent competitors . In practice, however, several barriers to entry keep generic competitors out of the market despite favorable price signals eg the limited patient population and treatment duration relative to other drugs that could be produced, as discussed above, and restricted distribution tactics that hinder the regulatory approval of generics . Makers of single - source drugs like daraprim will continue to possess de facto monopolies on the manufacture and sale of these drugs until at least one competitor is granted approval to sell a generic alternative . In most cases, the assumption is that more than one generic competitor will enter the market and prices will drop precipitously as a result, even though consolidation in the generic drug industry has cut down the number of potential players . The reality, however, is that sometimes no generic competitors enter the market and the prices never drop . Daraprim remains without a generic competitor in 2016, about four decades after the patent on pyrimethamine expired, and its price is higher than ever . Off - patent single - source drugs like daraprim are ripe for price jumps precisely because they lack competitors . Whoever owns the rights to one of these drugs has all the power to set its price until the government encourages competitors to emerge or asserts the public interest in regulating seemingly legal monopoly profits . In this section, i evaluate two kinds of policy solutions that the government could employ to rein in the cost of off - patent single - source drugs: explicit price controls and moves to promote competition . The list of policy prescriptions here is by no means an exhaustive one, and i focus only on specific aspects of these policies that i think have received comparatively little attention from scholars and the media . Explicit price controls for off - patent drugs are a natural response to the high cost of off - patent drugs, though they are rarely discussed in the united states . Price controls in the usa have a complicated history, especially in response to perceived price gouging. The federal government last tried imposing widespread price controls to reduce inflation in the early 1970s . Then, congress passed the economic stabilization act of 1970, which authorized the president to freeze prices and wages temporarily in an attempt to stabilize them . President nixon exercised this authority with mixed results; initial progress against inflation eventually led to meat and fuel shortages . Opponents of pharmaceutical price controls could point to this historical example to claim that capping prescription drug prices (and thus, spending) would lead to shortages of vital drugs and could even cause the expensive drug development pipeline to run dry . As a counterpoint to this argument, even switzerland home to pharmaceutical giants like novartis and roche sets maximum allowable prices on drugs for sale within its borders . Indeed, unlike in the united states, the governments of many other oecd countries make frequent use of government fiat and negotiating power to drive down the cost of prescription drugs branded and generic, patented and off patent alike . Their methods are too diverse to enumerate in full, but here i compare and contrast three tactics with those employed by the us government . The first, reference pricing, is a widespread method of calculating a country's drug reimbursement rates as some function of (i) that drug's prices in several peer nations and/or (ii) the average price of therapeutically comparable drugs in that country itself . Approach (ii) is actually very similar to how medicaid computes federal upper limits to reimbursement, so reference pricing could be practical in america . The second, value - based pricing, relates drug prices to quality - adjusted life years (qalys), a metric of disease burden that captures improved health due to treatment . Norway's use of cost - per - qaly to pick one of many therapeutically comparable drugs has translated into major savings, like paying 71 per cent less than medicare for the same osteoporosis treatment . By statute, however, medicare explicitly cannot consider cost - per - qaly when calculating its reimbursements . The third, the imposition of profit controls, requires market intervention by the government at a scale and scope well beyond the american norm . The united kingdom limits drugmaker profits by capping its annual spending on pharmaceuticals and requiring drugmakers to foot the bill or cut drug prices going forward if spending exceeds this cap . Admittedly, state - run and state - funded healthcare systems like those in norway and the uk facilitate extensive government regulation of prescription drug prices, and neither country has a pharmaceutical lobby as active as the united states. One could argue more generally that high drug prices in america subsidize low prices elsewhere . Indeed, a department of commerce report from 2004 concluded that american consumers would benefit most from the elimination of pharmaceutical price controls abroad, not the imposition of price controls at home . Still, the role of the center for medicare and medicaid services (cms) as the dominant payer for american healthcare should give it substantial leverage in dealing with pharmaceutical companies . If medicare eventually were allowed to negotiate drug prices with drug makers as several lawmakers have proposed being able to reference lower prices for the same drugs in peer countries could strengthen medicare's negotiating position nevertheless many scholars have argued that medicare's ability to negotiate drug prices would be fundamentally impaired by its inability to walk away from many negotiations . Medicare part d is required to cover all or substantially all drugs in six protected classes that tend to be among the most expensive . If negotiations or fiat cannot lower off - patent drug prices, perhaps government encouragement of market forces could have the same effect . The fda could begin to address the lack of market competition for expensive off - patent drugs by maintaining a list of single - source off - patent drugs, much like the list it currently maintains of drugs in short supply . Companies who apply to produce these drugs could be rewarded with expedited processing of their applications and fee waivers, though such incentives may require congressional authorization and others may be needed as well . Importantly, these actions could not be taken in response to the cost of the drug alone, as the fda explicitly cannot consider costs when approving a drug or its generic competitors . Is that limited access tantamount to a shortage, and would the expedited approval of generic competition constitute appropriate relief? The fda recognizes the importance of a steady supply of many medicines; it requires that manufacturers promptly notify the agency if they intend to stop producing prescription products that are life supporting, life sustaining, or intended for use in the prevention or treatment of a debilitating disease or condition. The fda can alleviate resulting drug shortages by taking actions like reimporting drugs, or expediting the approval of new drug suppliers . Especially with congressional authorization, the fda might be able to exercise its shortage power to expedite generic competition for single - source off - patent drugs especially since public health experts consider many of these drugs to be essential medicines . That said, the fda might be able to increase drug supply without congressional involvement by encouraging the expansion of compounding pharmacies, though this policy option is not without controversy . In october 2015, imprimis pharmaceuticals (in conjunction with the payer express scripts) announced it would sell a daraprim competitor for less than \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$1\ per\ tablet}$\end{document}, or far less than the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$750}$\end{document} that turing demands . Imprimis is a compounding pharmacy, which means that it fills doctor - prescribed, patient - specific formulations of mixtures of drugs . Though compounding was originally intended for patients with needs unmet by the market, custom - compounded versions of off - patent drugs may be viable alternatives to their expensive commercial counterparts, especially if the patient population is small . But compounded substitutes alone compounding pharmacies are limited in what they can provide relative to traditional dispensaries . By statute, compounders may not produce drug products that are essentially copies of a commercially available drug product. In the case of imprimis's daraprim competitor, this limitation is actually an asset . The compounded tablet contains not just pyrimethamine but also a form of folic acid called leucovorin that reduces pyrimethamine's adverse side effects . Of course, not all drugs have such natural synergistic partners, so in general it may be difficult to work around the ban on copies . Additionally, compounded drugs are not fda - approved, nor are their manufacturing processes necessarily fda - regulated so over - reliance on compounding may expose the public to very real risks of contamination and adulteration . In response to recent scandals, congress established standards and safeguards for compounding to protect consumers health and safety . Under the drug quality and security act, outsourcing facility that the fda inspects regularly to ensure that compounding occurs under the supervision of a licensed pharmacist according to current good manufacturing practices (cgmp). Though certification as an outsourcing facility does not guarantee that a compounder's drugs are safe, it does help consumers, physicians, and payers pass judgment on the quality and trustworthiness of compounders . In the face of market failures that have discouraged drugmakers from producing generic competitors to off - patent drugs that serve small patient populations, expanded compounding by certified compounders could expand access to drugs very quickly and practically . Many of the same active pharmaceutical ingredients in off - patent drugs are available for compounders to purchase in bulk . With its \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$1\ per\ dose}$\end{document} daraprim competitor, imprimis has demonstrated that compounding can be cost - effective and that payers are willing to cover compounded drugs if their value proposition is clear . The fda should continue to allow arrangements like the one between imprimis and express scripts that could increase drug access while decreasing costs . However, out of an abundance of caution, the rigor of the fda's inspections should scale up with the number of patients to which a compounder provides drugs . Since the daraprim saga began in september 2015, the high prices of pharmaceuticals in general, and of off - patent drugs in particular, have become political issues and topics of everyday conversation in the united states . The media and the public have been quick to condemn turing and its leadership for what they see as rampant corporate greed, but they have been slower to accept that the public interests and private incentives that exist in tension in the turing story are both legitimate . The american economy is set up to reward players who best exploit market opportunities, and in some sense turing simply fulfilled its obligations to its shareholders by raising the price of undervalued daraprim . That said, policymaking clearly has a role to play to ensure that private profits do not come at unbearable costs to public health and the general welfare . This note discussed how the federal government might rein in high drug prices, through explicit price controls that restrain the market or through pro - competitive policies that use the market to expand the supply of off - patent drugs that are currently single - sourced . Some of the questions and considerations raised here may apply not only to small molecule drugs but also more broadly to increasingly prevalent biologic treatments and their generic biosimilars . However, policymakers choose to reconcile high drug costs with public health and public spending concerns, their decisions over the next decade could transform how we make, take, and pay for all drugs on or off patent.
Nearly three decades have passed since the first successful clinical lung transplant was performed and has become the preferred treatment option for a variety of end - stage pulmonary parenchymal or pulmonary vascular disorders . Due to the shortage of available organs as well as the advancement of disease in most transplant candidates, a full array of preoperative tests is needed in order to consider these patients appropriate applicants . As part of the preoperative workup of these patients, investigation of cardiac function with echocardiography and catheterization has been long considered the norm, yet predictors of outcome from these tests are not well defined . The risk posed by cardiac dysfunction must be assessed individually based on severity of disease, presence of end - organ damage, and ease of control with standard therapies . Patients with moderate or severe ventricular systolic dysfunction are typically excluded from lung transplantation; however, there is a paucity of data regarding the prognostic significance of abnormal left ventricular diastolic function or elevated pulmonary pressures . The study was approved by the university of california, los angeles (ucla) institutional review board . All patients who underwent a bilateral or unilateral lung transplant at ucla medical center from 2002 to 2009 were analyzed (394 patients) by chart review in order to evaluate the prognostic significance of preoperative markers of diastolic function, including invasively measured pulmonary capillary wedge pressure (pcwp) and echocardiographic variables of diastolic dysfunction . Diastolic dysfunction was assessed by traditional echocardiographic variables of abnormal diastolic function, including a> e and a> e. criteria for lv diastolic dysfunction were obtained from the 2009 ase guidelines . Exclusion criteria included any patients undergoing re - transplant, patients with lack of presurgical echocardiographic or catheterization data performed at ucla, and patients with systolic left ventricular function less than 40% were excluded . We identified 111 patients who had pretransplant echocardiographic as well as catheterization data performed at ucla medical center . Echocardiographic information was rereviewed by a blinded cardiologist (ja) to ensure the accuracy of the reports . Additionally, pulmonary artery pressures from preoperative catheterizations were analyzed to assess adverse clinical events posttransplant . For comparing time until each clinical endpoint between groups, p values were computed utilizing cox proportional hazards models . For comparing differences between the nondiastolic dysfunction and diastolic dysfunction groups, p values were calculated using the t - test for quantitative variables or chi - square test for categorical predictors . If the sample size was too small for the chi - square approximation to be accurate, fisher's exact test was used instead . The kruskal - wallis test was used for subgroup analysis of primary lung pathology due to the skewed distribution of these variables . If a significant effect was observed, follow - up pairwise wilcoxon rank sum tests with dunn - sidak adjusted p values were used to test for specific differences between groups . All statistical analyses and plots were performed using r (version 2.13.1) and ibm spss (version 19). Subjects ranged from 22 to 70 years of age (62 male and 49 female) and were transplanted for a variety of disease processes including forty - three cases of idiopathic pulmonary fibrosis, twenty - two of chronic obstructive pulmonary disease, twelve of scleroderma, eight of sarcoidosis, eight of usual interstitial pneumonia, eight of isolated pulmonary hypertension, four of cystic fibrosis, four of various rare etiologies, and two of alpha-1 antitrypsin deficiency cases . In all, 29 (26.1%) patients met criteria for diastolic dysfunction . Kaplan - meier curves were constructed, which did not show statistically significant differences of survival between diastolic dysfunction and normal diastolic function groups for all investigated endpoints (figure 1). Comparative boxplots were constructed which showed no difference in mortality between each subtype of diastolic dysfunction (figures 2 and 4). Catheterization data was reviewed and based upon this information, 20 (19.8%) patients were categorized into mildly elevated pcwp (1620 mmhg) and 9 (8.9%) patients with moderate / severely elevated pcwp (> 20 mmhg) (table 2). Mildly and moderately / severely elevated pretransplant pcwps were not associated with adverse clinical events posttransplant (p = 0.30) (figure 3). Additionally, catheterization profile data between diastolic and nondiastolic dysfunctions did not reveal any statistically significant variables between the two groups, including systolic pulmonary artery pressures (spap) (p = 0.77), diastolic pulmonary artery pressures (dpap) (p = 0.68), mean pulmonary artery pressures (mpap) (p = 0.84), mean pcwp (p = 0.17), cardiac output (p = 0.23), cardiac index (p = 0.21), and left ventricular ejection fraction (p = 0.99) (table 3). Lastly, a subgroup analysis of primary lung pathology did reveal did not reveal any mortality difference between groups (p = 0.176) (table 4) (figure 5). Based upon kruskal - wallis test with dunn - sidak adjusted pairwise comparisons, pulmonary artery pressures were elevated and statistically significant in the pulmonary artery hypertension group in comparison with other groups . Additionally, mean pcwp was statistically lower in the chronic obstruction pulmonary disease group when compared to other groups (p = 0.05). Over the last twenty years, there has been a steady growth in the number of lung transplant operations performed worldwide with concurrent improvement in both short - and long - term outcomes . Various studies have shown some utility in the preoperative workup of certain variables that may exclude certain candidates from lung transplant . Strong negative predictors of one year survival include use of extracorporeal membrane oxygenation, renal failure, age, total bilirubin> 2.0 mg / dl, cardiac index <2 l / min, steroid dependence, smoking, and body mass index [46]. However, pre - existing coronary artery disease has been shown to have acceptable early and medium - term outcomes . Overall, many guidelines have been developed to help risk - stratify candidacy of potential transplant recipients; however, there has been a lack of data regarding short- and long - term outcomes of left ventricular diastolic dysfunction as well as elevated pcwp . Given the scarcity of organs as well as the fact that nearly 20% of lung transplant recipients die within the first year of transplantation, we may be failing to identify those at high risk for severe early complications ., the mitral inflow velocity profile is used to characterize left ventricular (lv) filling dynamics . The e velocity (e) represents the early mitral inflow velocity and is influenced by the relative pressures between the left atrium (la) and lv, which, in turn, are dependent on multiple variables including la pressure, lv compliance, and the rate of lv relaxation . The a velocity (a) represents the atrial contractile component of mitral filling and is primarily influenced by lv compliance and la contractility . In a less compliant heart, a greater proportion of this blood is pushed into the ventricles during atrial systole . In this scenario, the emphasis of ventricular filling during late diastole increases the (a) component of the e / a ratio causing a reversal of the ratio, hence an indication of diastolic dysfunction . Left atrial volume has also been described as an excellent biomarker of the chronicity of diastolic dysfunction and of cardiovascular disease risk . Parameters of diastolic function such as early diastolic velocities measured as e prime (e), the e to late diastolic filling (a) ratio (e/a), and the transmitral to mitral annular early diastolic velocity ratio (e / e) have all been shown to predict mortality and cardiovascular events [13, 14]. The early diastolic velocity of the mitral valve annulus (e) reflects the rate of myocardial relaxation . When combined with measurement of the early transmitral flow velocity (e), the resultant ratio (e / e) correlates well with mean left ventricular end - diastolic pressure, hence a marker for la pressure . Left ventricular diastolic dysfunction is a relatively common finding seen on doppler echocardiography; while multiple studies demonstrate abnormal diastolic function assessment to be associated with increased cardiovascular comorbidity, it can hold varying prognostic significance depending on underlying cardiac ventricular function . It has been shown that mortality is higher in hospitalized patients with depressed left ventricular ejection fractions of less than 39% . Additionally, diastolic dysfunction has been recognized as a strong predictor of mortality in acute myocardial infarction and congestive heart failure [1720]. However, isolated diastolic dysfunction has significant clinical implications as well . There is much heterogeneity regarding the prognosis of patients with diastolic dysfunction, with mortality ranging from 1.3% to 17.5% . Multiple studies have shown prognostic significance of doppler indexes of left ventricular diastolic dysfunction where patterns of abnormal relaxation increase the risk of cardiovascular events [2225]. In one study among 3,107 patients undergoing cardiac catheterization, the small subgroup (1.7%) with diastolic dysfunction, defined as those with high lv end - diastolic pressure and no systolic dysfunction, coronary heart disease or lv dilation had a high risk of future cardiac morbid events . This association between echocardiographic markers of abnormal relaxation and decreased survival, even in those with no history of chf, suggests that echocardiography may help identify those who are predisposed to adverse outcomes . Given that many lung transplant candidates are excluded with systolic depression, further evaluation of isolated diastolic dysfunction may help identify those at high risk for complications . There has been much investigation into doppler echocardiography and comparison with swan - ganz catheterization measurements . Studies have shown that hemodynamic data acquired by echocardiography, including estimation of right atrial, pulmonary artery systolic, and pcwps; cardiac output; and pulmonary vascular resistance, correlate to those of invasive catheterization values [27, 28]. Although correlation is good, estimation of systolic pulmonary artery pressure by echocardiography is frequently inaccurate in patients with advanced lung disease and leads to considerable over - diagnosis of pulmonary hypertension [29, 30]. In addition, technical limitations of the echocardiogram in this patient population often preclude estimating pulmonary artery systolic pressure . Although echocardiography can help estimate preoperative variables for lung transplant candidates, it should be used in conjunction with invasive catheterization rather than replacing it as the sole cardiac assessment modality . Ben - dor and associates have shown that the prevalence of significant coronary artery disease (cad) among lung transplant candidates may be low but cannot be accurately predicted by risk factors . The presence of preoperative mild or moderate cad has been shown not to result in increased perioperative morbidity or mortality or significantly affect the short - term or long - term survival in comparison with recipients without cad . Transplantation remains the only therapeutic option for selected patients with advanced pulmonary arterial hypertension (pah) who continue to deteriorate despite optimal medical therapy . Given the current shortage of donor organ availability worldwide, there is a need for inclusion of more discriminatory markers of pah prognosis in donor - lung allocation scores to identify patients at risk and optimize survival to transplantation . Have demonstrated that increased preoperative pah is an independent risk factor for the development of grade 3 primary graft dysfunction within the first 48 hours after transplant . Additional studies have also shown this correlation between elevated pah and primary graft dysfunction [3639]. The relatively high early (30 days and 3 months) mortality in pah lung transplant recipients in part reflects primary graft dysfunction, a syndrome characterized by noncardiogenic pulmonary edema, hypoxemia, and diffuse alveolar damage within the first 72 hours following lung transplant [37, 4042]. Because most pah patients are receiving chronic warfarin further, following single lung transplant, allograft blood flow is increased in patients with a preoperative diagnosis of pah compared with emphysema [34, 43]. Hence, estimation of pah variables is a critical component in the lung transplant workup . Despite these previous studies, our data reveals no end - point difference between patients with normal, mildly elevated, and moderate - severely elevated pah . Although no statistically significant difference is found, there is indeed a unfavorable trend with regard to mortality in pulmonary hypertension patients . Given the small power in this subgroup analysis, further analysis of this patient population is necessary to access its clinical impact . The objectives of therapy for left ventricular diastolic dysfunction include improvement of preload and afterload hemodynamics . Ace inhibitors and angiotensin inhibitors may provide some additional benefit given their reduction in both pre- and afterload as well as interstitial fibrosis . Additionally, heart rate control is also imperative given its prolongation of left ventricular filling to counterbalance the resistance of inflow due to the stiffened ventricle . This is a retrospective single - center review and has inherent limitations associated with all retrospective studies . The lung transplant patients are also highly selected in accordance with our selection protocol . As a result, there may have been a selection bias as the study does not include recipients and experience from other centers . In summary, there are many different factors that need to be accounted for when deciding to evaluate and list patients for lung transplantation . A team approach incorporating the surgeon, pulmonologist, and cardiologist is necessary to ensure optimum outcomes in this difficult and challenging group of patients . Pretransplant recipient variables significantly influence early and late survival following lung transplantation, suggesting that some patients face a higher than average risk of mortality during the first year after transplant, as well as severely diminished longer - term survival, that challenges the goals of equitable organs allocation . Further investigation regarding transplant variables are needed to help develop better guidelines, which will ultimately help with optimal utilization of these scarce organs . The present study demonstrates that prelung transplant invasive and echocardiographic findings of elevated pulmonary pressures, and abnormal left ventricular diastolic function are not predictive of adverse posttransplant clinical events.
Hvrbase was originally started as compilation of hypervariable region i (hvri) and hypervariable region ii (hvrii) mitochondrial sequences (1,2). These regions are situated in the non - coding mitochondrial control region and play an important role in population genetics (3,4). With some exceptions, mitochondrial dna (mtdna) follows a maternal clonal inheritance pattern without recombination (57). Therefore, population genetics analyses allow studying the population history of maternal inherited mitochondrial genomes . Furthermore, mtdna variation correlates with the geographic origin of the population, and has been linked to a wide range of degenerative diseases, preferentially affecting the central nervous system, heart, muscle, renal and endocrine systems, and is generally used in forensic comparisons (810). Hvrbase++ focuses on aspects of population genetics and collects meta information like ethnic groups and spoken languages for each individual . For this reason, moreover, meta information is linked to a geographical information system (gis), which allows intuitive searches supported by geographical maps to obtain additional information about countries . This interactive map searching feature and the presence of meta information predestine hvrbase++ as a database for population genetics analysis . Among other databases, like mitomap (11) as a general resource for mtdna - related data and the mtdna population database (12) for forensic studies, hvrbase++ contributes to the wide area of mtdna analysis . Wherever in the course of a phylogenetic analysis mitochondrial data are used which at best reflect matrilineal history, a closer look at nuclear dna (ndna) is indispensable to answer questions concerning phylogenetic history in their entirety . When drawing a comparison between evolutionary pathways of the pyruvate dehydrogenase e1 (pdha1) subunit and mtdna, j. hey showed that variation at nuclear genes and mtdna are not both consistent with a common demographic history (13). While both hypervariable regions of mtdna are commonly used for phylogenetic studies, no equivalent sequence markers exist when dealing with nuclear dna . With hvrbase++ genes that code for the human immune defence, and non - coding regions around microsatellite dna markers, are promising candidates for ndna sequence markers owing to their mutation rate (3). Moreover, the detection of nuclear mitochondrial - like sequences called numts in the last decade has shed doubts whether mtdna data have been classified correctly (1416). To meet these concerns, researchers have begun to incorporate nuclear markers in their studies . It is a matter of fact that hvrbase++ now carries nuclear markers as well . In hvrbase++ lineage in contrast means a piece of dna from possibly different individuals, which share the same nucleotide sequence . If different sequence sources were available, they have been chosen in the following order: (i) public databases like genbank (17), (ii) supplemental data from publications, (iii) data manually extracted from publications and (iv) data requested from authors . After collecting and extracting sequences and meta information for a gene or region, a global nucleotide alignment was created . For the hvri and hvrii regions, hvrbase++ carries a manual alignment (2) and an alignment generated with mafft (18). Automatically calculated alignments can be obtained from hvrbase++ for complete mitochondrial genomes and nuclear sequences, respectively . A procedure checks sequence alterations in genbank and updates the data in the next release . It is worth noting that every single update step is logged in our database system and can be traced via the hvrbase++ web interface . Meta information must be attributable to each sequence in the paper and consider: (i) geographic origin, (ii) population, (iii) spoken language and (iv) bibliographic information . Owing to those filtering criteria, not all data from publications and most of the forensic data, for example the comprehensive forensic dataset from mtdna population database (12), could not be integrated into hvrbase++ . Since there is no unique way to gain the above named meta information either from publications or from sequence files, it is difficult to build a fully automated tool that identifies meta information that is located in different resources . Synonyms and context - dependent meanings of a word may pose a challenge as well . Where it is easy for humans to associate certain information, it is a hard task for computers . Seeing that bibliographic information, like authors, publication date, journal and pubmed publication identifier are standardized . Each country is assigned to just one continent, e.g. In hvrbase++ turkey is assigned to asia, the canary islands belong to the sovereign territory of spain . All 258 language entries in hvrbase++ have been adapted to comply with the sil (summer institute of linguistics) and iso / dis 639 - 2 language code standards respectively from ethnologue vol . 14 (19). In order to avoid information loss and to compensate the incompleteness of any of the standards the following example clearly shows the hassle of associating a mother tongue of an individual deduced from a publication with the sil or iso language codes . It is known that a certain tongue belongs to the niger - kordofanian language family . Niger - kordofanian is a collective language code only used in the iso standard whose languages can be found throughout southern and central africa as well as in sub - saharan western africa . Since that language family does not have a sil code, a more in - depth knowledge about the very tongue (e.g. Language name and habitation of a tribe) would be essential to find a suitable sil code . Sequence data and accompanying information are extracted and stored in hvrbase++ via perl programs that use object - oriented modules from the bioperl - project (20) and the perl dbi module . The web client is based on the apache web server technology . For the geographical interface, a map server (mapserver version 4.6 from the university of minnesota) is integrated into the web client using geographical maps from publicly available resources . Umn mapserver provides the core functionality of a gis system for an intuitive data access from dynamically created geographical maps . The hvrbase++ database now comprises not only hvri and hvrii sequences but also mitochondrial genomes and nuclear sequences from several chromosomal loci . Not surprisingly, human sequences are overrepresented with a total amount of 20 037 sequences (table 2). Table 3 displays an excerpt from the human hvri dataset gathered from 103 publications which encompasses sequences from 89 countries and 220 ethnic groups . The amount of nuclear markers in hvrbase++ is currently not very high because the compilation is at an early stage . We feel confident that it will get more and more important to sequence and analyze nuclear genes for studies in population genetics due to possibly contradicting histories of nuclear genes and mtdna (3,21). Figure 1 shows the sequence increase of hvri / ii, mitochondrial genomes and nuclear sequences for all available publications within the past 25 years . The new geographic map search interface is the centre of the web interface, which provides an intuitive search method and presents the results clearly structured . On the other hand, the well - tried form - based search function from hvrbase is recommended for more systematic searches . Supported sequence output formats the form - based and map searches in combination make it possible to find any kind of sequence available from a sampled individual . Sequence patterns can be detected within genes for a whole sequence or a given range . Moreover, regular expressions allow for complex motif searches . Each country (or continent) is pictured in the world map and colour - coded, depending on the number of sequences from the respective country . More detailed information is displayed at the bottom of the world map after choosing a country from the map . Although hvrbase++ represents a large compilation of hvri and hvrii sequences, completeness cannot be claimed . The collection of mitochondrial genomes and nuclear genes will be extended, and gaps will have to be closed in future releases . . We would also be grateful to receive already published sequences that are missing in our collection . This database gives easy access to freely available sequences without altering them in any way . That means we have not checked the data for typos or any other kind of sequence errors that might have occurred between their acquisition and their publication (2224). Our intention is not to fix putative errors in other publications and finally to hold in our hand another dataset . This could cause confusion by the use of sequences in comparative analyses from two different sources . We recommend our colleagues to control their datasets carefully and to follow the instructions proposed by bandelt et al . Since there is no common way to update sequences from non - public databases, we have done this manually . As we aim at a high quality of data, we will welcome any cues regarding programming bugs, misinterpretations or other discrepancies . In hvrbase++ the term sequence represents a piece of dna from one individual . A lineage in contrast means a piece of dna from possibly different individuals, which share the same nucleotide sequence . If different sequence sources were available, they have been chosen in the following order: (i) public databases like genbank (17), (ii) supplemental data from publications, (iii) data manually extracted from publications and (iv) data requested from authors . After collecting and extracting sequences and meta information for a gene or region, a global nucleotide alignment was created . For the hvri and hvrii regions, hvrbase++ carries a manual alignment (2) and an alignment generated with mafft (18). Automatically calculated alignments can be obtained from hvrbase++ for complete mitochondrial genomes and nuclear sequences, respectively . A procedure checks sequence alterations in genbank and updates the data in the next release . It is worth noting that every single update step is logged in our database system and can be traced via the hvrbase++ web interface . Meta information must be attributable to each sequence in the paper and consider: (i) geographic origin, (ii) population, (iii) spoken language and (iv) bibliographic information . Owing to those filtering criteria, not all data from publications and most of the forensic data, for example the comprehensive forensic dataset from mtdna population database (12), could not be integrated into hvrbase++ . Since there is no unique way to gain the above named meta information either from publications or from sequence files, it is difficult to build a fully automated tool that identifies meta information that is located in different resources . Synonyms and context - dependent meanings of a word may pose a challenge as well . Where it is easy for humans to associate certain information, it is a hard task for computers . Seeing that bibliographic information, like authors, publication date, journal and pubmed publication identifier are standardized . Each country is assigned to just one continent, e.g. In hvrbase++ turkey is assigned to asia, the canary islands belong to the sovereign territory of spain . All 258 language entries in hvrbase++ have been adapted to comply with the sil (summer institute of linguistics) and iso / dis 639 - 2 language code standards respectively from ethnologue vol . 14 (19). In order to avoid information loss and to compensate the incompleteness of any of the standards the following example clearly shows the hassle of associating a mother tongue of an individual deduced from a publication with the sil or iso language codes . It is known that a certain tongue belongs to the niger - kordofanian language family . Niger - kordofanian is a collective language code only used in the iso standard whose languages can be found throughout southern and central africa as well as in sub - saharan western africa . Since that language family does not have a sil code, a more in - depth knowledge about the very tongue (e.g. Language name and habitation of a tribe) would be essential to find a suitable sil code . Sequence data and accompanying information are extracted and stored in hvrbase++ via perl programs that use object - oriented modules from the bioperl - project (20) and the perl dbi module . The web client is based on the apache web server technology . For the geographical interface, a map server (mapserver version 4.6 from the university of minnesota) is integrated into the web client using geographical maps from publicly available resources . Umn mapserver provides the core functionality of a gis system for an intuitive data access from dynamically created geographical maps . The hvrbase++ database now comprises not only hvri and hvrii sequences but also mitochondrial genomes and nuclear sequences from several chromosomal loci . Not surprisingly, human sequences are overrepresented with a total amount of 20 037 sequences (table 2). Table 3 displays an excerpt from the human hvri dataset gathered from 103 publications which encompasses sequences from 89 countries and 220 ethnic groups . The amount of nuclear markers in hvrbase++ is currently not very high because the compilation is at an early stage . We feel confident that it will get more and more important to sequence and analyze nuclear genes for studies in population genetics due to possibly contradicting histories of nuclear genes and mtdna (3,21). Figure 1 shows the sequence increase of hvri / ii, mitochondrial genomes and nuclear sequences for all available publications within the past 25 years . The new geographic map search interface is the centre of the web interface, which provides an intuitive search method and presents the results clearly structured . On the other hand, the well - tried form - based search function from hvrbase is recommended for more systematic searches . Supported sequence output formats the form - based and map searches in combination make it possible to find any kind of sequence available from a sampled individual . Sequence patterns can be detected within genes for a whole sequence or a given range . Moreover, regular expressions allow for complex motif searches . Each country (or continent) is pictured in the world map and colour - coded, depending on the number of sequences from the respective country . More detailed information is displayed at the bottom of the world map after choosing a country from the map . Although hvrbase++ represents a large compilation of hvri and hvrii sequences, completeness cannot be claimed . The collection of mitochondrial genomes and nuclear genes will be extended, and gaps will have to be closed in future releases . . We would also be grateful to receive already published sequences that are missing in our collection . This database gives easy access to freely available sequences without altering them in any way . That means we have not checked the data for typos or any other kind of sequence errors that might have occurred between their acquisition and their publication (2224). Our intention is not to fix putative errors in other publications and finally to hold in our hand another dataset . This could cause confusion by the use of sequences in comparative analyses from two different sources . We recommend our colleagues to control their datasets carefully and to follow the instructions proposed by bandelt et al . Since there is no common way to update sequences from non - public databases, we have done this manually . As we aim at a high quality of data, we will welcome any cues regarding programming bugs, misinterpretations or other discrepancies . Accumulation of hvri, hvrii, mitochondrial genomes and nuclear sequences over the last 25 years . Geographical map interface in hvrbase++ . The upper frame contains elements for searching sequences, the search results are displayed in the map and at the bottom . Additional information for each gene is displayed in separate tables (data not shown). Sequences are accessible by selecting them from the table . Assignment of language names to the sil and iso / dis 639 - 2 codes in hvrbase++ for the mitochondrial dataset this year, the sil and iso / dis 639 - 2 codes have converged . Number of sequence categories in humans, great apes and neanderthalers across all sequence types in hvrbase++ human hvri datasets over six continents note that the last row does not depict the arithmetic sum in columns 2, 59 as some relevant subsets overlap across continents.
Diabetes mellitus is strongly associated with cardiovascular disease morbidity and mortality, accelerating the vascular aging process and in particular the pathogenesis of atherosclerosis . Diabetic nephropathy is a highly important cause of morbidity and mortality in patients with type 1 and type 2 diabetes mellitus, either directly and as a risk factor for cardiovascular disease.1 in particular, diabetic kidney disease occurs in 20% to 40% of patients with diabetes mellitus and is the leading cause of chronic kidney disease and end - stage renal disease.2 recent evidence shows that an early multipharmacological approach is able to slow the progression of diabetic nephropathy to end stage renal disease (esrd), the disease rarely stops and slightly regresses just in few selected and optimally treated patients.3 in this context, there is a strong need for new agents able to significantly modify the patient disease history . The aim of this review is to evaluate the potential role of glycosaminoglycans (and in particular sulodexide) as antiproteinuric and kidney protective drugs . Glycosaminoglycans (gags) are long unbranched mucopolysaccharides consisting of a repeating disaccharide unit . Apart from hyaluronan, which is uniquely synthesized without a protein core and is spun out by enzymes at cell surfaces directly into the extracellular space, the other gags are usually added to protein cores in the golgi apparatus to yield proteoglycans.4 it has been proposed that hemodynamic alterations and structural changes in glomerular basement membrane glycosaminoglycans may play a role in the pathogenesis of proteinuria . The glomerular filtration barrier consists of fenestrated glomerular endothelium, podocyte foot processes / slit diaphragms, and intervening glomerular basement membrane . Its characterization as both a size- and charge - selective barrier emerged from studies conducted decades ago . The charge selectivity phenomenon is receiving renewed attention now that the identities and mechanisms of synthesis of relevant molecules are known.5 attention has focused on glomerular basement membrane heparan sulfate proteoglycans, long considered primary charge barrier components, even if recent in vivo manipulations of glomerular heparan sulfate proteoglycans redefined (but not excluded) their role or their anionic charge in glomerular filtration.6 in fact an experimental model of non - diabetic mice, knock - out for the ext1 gene encoding a subunit of heparan sulfate co - polymerase, develops a proteinuria that is less impressive than that expected from the available knowledge on renal physiology.7 however, a relatively large body of evidence supports the notion that glomerular capillary wall and mesangial alterations in diabetic nephropathy involve pathobiochemical alterations of glycoproteins in these structures . Evidence in experimental animals rendered diabetic reveals that the administration of heparin and other anionic glycoproteins can effectively prevent the biochemical alterations that promote albuminuria.8 moreover, in renal biopsies of different human primary proteinuric diseases, pronounced tubulointerstitial heparan sulfate proteoglycans alteration are evident and strongly related to the inflammatory processes.9 moreover, gags strongly influence thickness, integrity and permselectivity of the endothelial glycocalyx, a luminal layer composed of several proteoglycans and a special class of heavily glycosylated glycoproteins . Glycocalyx composition is strongly alterated in diabetes patients, who typically show early sign of renal damage . The recent demonstration that angiopoietin-1 also modifies basal kidney - microvessel permeselectivity acting on the glomerular glycocalyx further supports the key role of this glycocalyx and glycocalyx composition on glomerular function.10 angiotensin ii receptor blockers are renin angiotensin system (ras) modulators with known antiproteinuric activity.11 angiotensin ii inhibits heparan sulfate synthesis, while heparins modulate angiotensin ii signaling in glomerular cells, inhibiting aldosterone synthesis and lowering proteinuria in diabetes patients (but less in other forms of proteinuric renal diseases).12 in this context, heparinoids have been considered as potentially useful antiproteinuric drugs that could have synergistic effects with ras modulator.13 sulodexide is a highly purified mixture of gags composed of a fast - moving heparin fraction (80%) and dermatan sulfate (20%), with a low molecular weight, a high oral bioavailability, and antithrombotic and profibrinolytic activity.14 it also appears to be a promising treatment for diabetic proteinuria partially resistant to ras blocking agents.15 sulodexide concentrates in renal parenchyma for a long time after administration.16 from preliminary trials it has been supposed that sulodexide reduces albuminuria acting in vivo as a heparinase inhibitor that reaches the glomerular capillary wall and prevents heparan sulfate degradation, thus allowing reconstruction of heparan sulfate content and restoration of glomerular basement membrane ionic permselectivity.17 recent in vitro experiments on umbelical human veins demostrated that sulodexide supplementation restores the glycocalyx structure and barrier properties by increasing the trans - endothelial albumin leakage induced by hyperglycemic conditions.18 the antiproteinuric effect appears to be mainly related to the basal proteinuria and consequently to the duration of treatment.19 moreover, at least a part of the renal histological degradation observed in diabetes is related to inflammatory processes . Sulodexide seems to have powerful antinflammatory activity in experimental models.20 in a model of cultured human umbilical endothelial cells exposed to high glucose concentration, sulodexide suppresses cellular inflammation and prevents glucose cytotoxicity:21 sulodexide is able to reverse the glucose - related cell release of free oxygen radicals, monocyte chemotactic protein-1 (mcp-1) and interleukin-6 (il-6), and the inactivation of cell - repairing mechanism enabling the exposition to glucose . Moreover, in rats with streptozocin - induced diabetes, sulodexide exerts direct endothelial protective effects.22 a large number of studies, mainly carried out in type 1 and 2 diabetes patients, have strongly suggested the potential role of sulodexide as an antiproteinuric agent (table 1). The majority of these studies, however, were small, had an open design, were of short duration, and involved inhomogeneous patient categories . However, at least 15 out of 16 studies, involving 594 patients, reported a significant antiproteinuric effect of sulodexide . It remains to be clarified if sulodexide could exert an additive antiproteinuric effect in patients treated with fully dosed angiotensin - converting enzyme inhibitor (acei) or an angiotensin receptor blocker (arb). In a pilot study, return to normoalbuminuria or a decrease in albumine: creatinine ratio (acr) of at least 50% from the baseline value was achieved in 25.3% of patients with persistent albuminuria in spite of being treated with the maximum recommended dose of an acei or an arb.23 interestingly, a very favorable trend for an increased rate of therapeutic success was obtained in the sulodexide group receiving the daily dose of 200 mg (33.3% versus 15.4% of patients receiving placebo; p = 0.075), which was the more effective dose also in the largest published study.24 in particular, this trial clearly showed for the first time that sulodexide, 200 mg / day for 4 months, was able to significantly decrease albuminuria (both versus placebo and baseline) independently of the concomitant administration of acei, but at an unspecified daily dosage . The decrease in the albumin excretion rate at the end of treatment was 40% and 46% versus baseline in patients receiving or not receiving acei, respectively (p <0.05). To the best of our knowledge only one trial has tested the effect of endovenous sulodexide administration on renal disease other than that caused by diabetes.25 in this trial the researchers enrolled patients with bioptic diagnosis of different glomerulonephritis, and observed after 1 month of treatment that overall 85% of patients experienced a significant reduction in proteinuria, which was significantly more impressive in patients with mesangiocapillary than in those with membrano- and mesangioproliferative glomerulonephritis . Moreover, the decline of proteinuria was more relevant in gag(+) patients with important proximal tubular necrosis and moderate to severe myofibroblast infiltrates than in gag() patients with mild interstitial involvement.26 on the basis of the above - cited preclinical and clinical evidence, the use of sulodexide has also been suggested by experts for the treatment of serious chronic kidney diseases (ckd) other than those caused by diabetes . The most interesting is probably the management of the membranoproliferative glomerulonephritis type ii (or dense deposit disease), a rare and serious renal genetic disease which affect 2 to 3 people per million and leads to renal failure within 10 years in 50% of affected children, with a worse prognosis after kidney transplantation than other genetic glomerulonephritis.27 however new trials have to be carried out to confirm these preliminary results and hypotheses . It is well known that diabetes patients are more likely to develop vein insufficiency and their related sequelae . The antithrombotic effects of sulodexide in patients affected by deep vein thrombosis28,29 and venous leg ulcers30,31 have been adequately investigated in different clinical trials . However, there is some evidence that sulodexide could also reduce the arterial disease risk, which is usually very high in diabetes patients with ckd,32 through a large number of pharmacological actions (table 2). Two different meta - analyses of the available clinical trials have show that sulodexide treatment improves the pain - free walking distance in patients affected by peripheral occlusive artery disease.33,34 this effect could be related to different sulodexide activities . First, the sulodexide - treated patients have higher peak flow and rest flow in the lower limbs.35 moreover, sulodexide treatment improves the patient s lipid and hemorrheological profile.36 in particular, sulo - dexide improves the typical lipid components of metabolic syndrome, which is a predictor of both ckd worsening and cardiovascular disease risk in ckd patients.37 recent data also support a significant anti - inflammatory action of sulodexide in the endothelial cells and a protective effect of the drug against glucose cytotoxicity . The experiments were performed on in vitro cultured human umbilical endo - thelial cells kept for 7 days in standard medium or in the same medium but supplemented with glucose . Sulodexide inhibited the intracellular generation of free radicals in a dose - dependent manner (by up to 32%), as well as monocyte chemotactic protein-1 (mcp-1) (by up to 60%) and il-6 (by up to 69%). Cells cultured in a medium with glucose generated more free radicals (+ 20%) and released more mcp-1 (+ 113%) and il-6 (+ 26%). Cell monolayers treated with glucose had a decreased ability to heal after mechanical injury (28%). All these glucose effects were reversed when cells were exposed to sulodexide simultaneously.19 in the long term, it is also possible that sulodexide exerts anti - atheromasic effects . In experimental models, sulodexide protects endothelium from external injuries as demonstrated by a reduced number of desquamated endothelial cells.38 sulodexide could then stop the earliest phase of atherosclerosis, at the level of endothelial dysfunction, improving endothelium - dependent relaxation in small arteries.39 in a more advanced atherosclerosis phase, sulodexide inhibits neointimal proliferation after vascular injury of the carotid artery, as shown in an experimental model of restenosis after balloon angioplasty.40 furthermore, in vitro heparin and heparinoids inhibit the proliferation of the vascular smooth muscle cells.41 this antiproliferative effect has also been supposed to be valid in humans, but only preliminary data are available.42 it has also been shown in humans that sulodexide treatment could also improve some clinical parameters in patients with vascular dementia.43 consequently it has also been used to prevent ischemic cerebral damage in patients with antphospholipid antibodies.44 finally, different gags have been reported to be of benefit to the ischemic myocardium by preserving contractile function and reducing tissue injury . In a rabbit model, sulodexide also attenuated myocardial ischemia / reperfusion injury and the deposition of c - reactive protein in areas of infarction without affecting hemostasis.45 the prognostic value of most of these observations has yet to be demonstrated, but they appear to be interesting working hypotheses, especially in patients with either ckd and preclinical signs of cardiovascular diseases . Preclinical and clinical evidence directly or indirectly support the hypothesis that new, adequately designed, long - term studies need to be carried out to investigate the potential role of sulodexide for proteinuric ckd management in diabetes patients, in particular to understand which kind of patients could obtain the most clinical advantage from this therapeutic approach . Presently, there is a clear lack of preventive and therapeutic tools for proteinuric syndromes, and each new active compound needs to be evaluated, in order to widen the therapeutic arsenal against ckd . Considering the previously reported large spectrum of its pharmacological properties, sulodexide seems to be able to play an important role in the treatment of these patients because of its actions not only at the renal level, but also on the whole vessel tree, which is usually severely affected in diabetes patients with ckd . In conclusion, a relatively large body of literature supports the antiproteinuric and nephroprotective effects of gags and sulodexide; however more basic clinical research is needed to understand which factors influence the drug s efficacy and, consequently, which patients could therefore benefit most from this treatment.
Cervical and shoulder dysfunction in office workers is usually due to the work environment, including job and sociopsychological risk factors1 . The resulting pain and functional impairment affect the muscles, skeleton, ligaments, cartilage, and nervous system, and result in musculoskeletal dysfunction2 . Shoulder pain and functional disorders are related to abnormal motion and the position of the scapula when it is stabilized3 . Cervical pain leads to impaired function, decreased occupational performance, and quality of life dissatisfaction including social and economic loss4 . Weakness of the lower trapezius has a negative effect on scapular movement, with an increase in shoulder joint weakness, because the lower trapezius is the primary muscle maintaining the appropriate posture and alignment of the shoulder joint5, 6 . Therapeutic interventions for shoulder pain include hyperthermia, cryotherapy, transcutaneous electrical nerve stimulation, strengthening exercises8, and stabilization exercises9 . Most of these interventions can relieve pain but are inefficient at preventing the recurrence of pain and maintaining normal function3 . The stability of the shoulder joint is important; however, the stability and strength of the muscle are more important because the shoulder is very mobile3 . Postural stabilization is the state of maintaining a balanced body position, with the muscle and skeleton in a specific space, and the ability to maintain the center of mass10 . Exercise stabilizes the scapula through active movements of the muscles surrounding the scapula, and maintains the effective length and tension of upper arm movement11 . Rehabilitative ultrasound images (rusi) evaluate muscle mass, structure, and composition . It is easy to control and accurately visualizes muscle structure and movement12 . In this study, a stability exercise was prescribed for normal scapular location and muscle balance in order to determine the effect on scapular stability and rusi, and to provide basic information for the rehabilitation of patients with shoulder pain . A total of 38 office workers receiving physical therapy at seoul h hospital, who voluntarily agreed to active participation, were included in this study . The stability exercise for the shoulder was performed two times per week, at 40 min per session, for a total of 6 weeks . The general characteristics of the subjects in the stability exercise group were as follows: 19 office workers (6 males and 13 females), mean age 36.2 5.5 years, mean height 168.0 8.1 cm, and mean weight 57.8 11.3 kg . On the other hand, the subjects in the manual therapy group had the following characteristics: 19 office workers (6 males and 13 females), mean age 35.8 4.1 years, mean height 167.2 7.3 cm, and mean weight 60.2 14.2 kg . The present study was approved by the sahmyook university institutional review board (syuirb2015 - 014). The objective of the study and its requirements were explained to the subjects, and all participants provided written consent, in accordance with the ethical principles of the declaration of helsinki . The scapular exercise for the shoulder joint was designed to correct the abnormal location of the scapula3 . The exercise involved the upper trapezius, levator scapulae, suboccipital, sternocleidomastoid, and pectoralis major and minor muscles (all in a shortened state) in lengthening and stretching, with 10 sets of 10-s sessions . The following exercises were performed: isometric contraction in the supine position, retracting the subject s chin for deep cervical flexor enhancement; closed chain knee push - up for the serratus anterior; cow position and cat position for 10 sets of 10 s each to increase mobility of thoracic and cervical musculature; prone row and modified prone cobra, as suggested by arlotta et al.13, to deactivate the upper trapezius and maximize lower trapezius activation; cow position, cat position, modified cat position, dead bug position, and plank, at 10 sets of 10 s each for cervical, thoracic, and shoulder movement . The manual therapy program consisted of 23 min of soft tissue mobilization of the upper trapezius, levator scapulae, suboccipital, sternocleidomastoid, pectoralis major and minor, deep cervical flexor, serratus anterior, rhomboid, and middle and lower trapezius muscles, with prone thoracic mobilization, prone selected thoracic mobilization, cervical mobilization, and thoracic mobilization . The forward head horizontal distance (fhhd) for cervical stability was measured with the exbody somatometric system (pa-2010sm; steps system inc ., the subjects were measured from the side in a natural position while wearing shorts and shirts; a marker was placed on the tragus and acromion process, and the forward head position was evaluated by measuring the distance between the tragus and acromion process . To assess changes in the rounded shoulder posture (rsp), the length was measured to 1/20 mm by using a vernier caliper . With the supine method, this was used to measure the length of the pectoralis major; however, it has good reliability (intraclass correlation coefficient, 0.88) with or without symptoms in the shoulder related to the effect of the scapular location on the shoulder joint14 . An upper limb closed chain exercise test was used for the stability of the upper limb (sul)15 . In the performance of the closed chain exercise test, the starting position, which had a width of 90 cm, was marked on the floor, and both hands of the subjects were placed on the marker dots in order to form a push - up position . To reduce changes in position, placement of one hand over the other was counted as one, performed for 15 s, and the number was counted . Between test performances, the subjects were allowed a 1-min break; measurements were performed two times, and the mean value was used16 . In this study, a portable rusi device (ugeo h60; samsung medison, seoul, korea) was used to examine the structural properties of muscles . Ultrasound examination was performed at 612 mhz in two - dimensional b - mode linearity, at t8 level, r=0.77 (muscle thickness) for the lower trapezius structural examination17; an average of two repetitions was used to measure values . The spss 18.0 program (spss inc . The shapiro - wilk test was used to determine the distribution of the general properties and outcome measures of the subjects . The paired t - test was used to compare the pretest and posttest results of fhhd, rsp, sul, and rusi within each group, and the independent t - test was performed to compare the two groups before and after training in the scapular stability exercise group, the fhhd was 9.5 cm before the training and 7.8 cm after the training, which was statistically significant (p<0.001). The right - side rsp showed a statistically significant decrease of 0.6 mm (p<0.001). The left - side rsp showed a statistically significant decrease of 0.5 mm (p<0.001). The sul showed a statistically significant increase of 4.3 (p<0.001). In the manual therapy group, the right - side rsp showed a statistically significant decrease of 0.1 mm (p<0.001). The left - side rsp showed a statistically significant decrease of 0.1 mm (p<0.001). The scapular stability exercise group showed greater improvements than the manual therapy group in fhhd, left and right rsp, sul, and left and right lower trapezius in rusi (table 1table 1.comparison of shoulder stability and rusi within and between groups (n=38)parametersvalueschange valuessseg (n=19)mtg (n=19)sseg (n=19)mtg (n= 9)beforeafterbeforeafterbefore - afterbefore - afterfhhd (cm)9.5 2.47.8 1.98.4 2.38.2 2.31.7 0.80.2 0.2rt rsp (mm)10.9 1.910.3 1.89.7 2.09.5 2.00.6 0.30.1 0.1lt rsp (mm)10.5 2.09.9 1.89.2 2.19.0 2.10.5 0.30.1 0.1sul (numb)9.5 3.213.7 2.88.8 3.59.3 3.74.3 1.20.5 0.5rusi in rt lt (mm)3.6 0.93.9 0.93.3 1.23.4 1.20.3 0.20.1 0.1rusi in lt lt (mm)3.4 0.83.7 0.83.1 1.13.2 1.10.3 0.20.1 p<0.05, * * p<0.001: significant difference within the group, p<0.05, p<0.001: significant difference between groups; sseg: scapular stability exercise group; mtg: manual therapy group; fhhd: forward head horizontal distance; rsp: rounded shoulder posture; sul: stability of the upper limb; rusi: rehabilitative ultrasound images; lt: lower trapezius; lt: left; rt: right). P<0.05, * * p<0.001: significant difference within the group, p<0.05, p<0.001: significant difference between groups; sseg: scapular stability exercise group; mtg: manual therapy group; fhhd: forward head horizontal distance; rsp: rounded shoulder posture; sul: stability of the upper limb; rusi: rehabilitative ultrasound images; lt: lower trapezius; lt: left; rt: right postural cervical pain decreases muscle endurance, and increases muscle fatigue and functional impairment18; thus, working in an upright sitting position affects muscle length and tension to maintain low muscle activation19 . In this study, the fhhd was 9.5 cm before the training and 7.8 cm after the training, a decrease of 1.7 cm that was statistically significant (p<0.001), in the scapular stability exercise group . In the manual therapy group, the fhhd was 8.4 cm before the training and 8.2 cm after the training, a decrease of 0.2 cm (p<0.05). The scapular stability exercise group showed greater improvement than the manual therapy group in the fhhd . If the forward head position is severe, the distance between the tragus and acromion process increases; if the distance decreases, deep cervical flexor activation increases, and sternocleidomastoid and anterior scalene muscle activation decreases, thereby stabilizing the cervical position . In the forward head position and round shoulder position, the upper trapezius and pectoralis major and minor have increased activity, inducing scapular and thoracoscapular position change, which causes abnormal cervical alignment and decreased shoulder stability20 . The upper, middle, and lower trapezius, and serratus anterior muscles are involved in shoulder joint stabilizing motion21 . Therefore, in this study, isometric contraction was applied to enhance the upper, middle, and lower trapezius and serratus anterior strength in shoulder stabilizing exercises . As a result, the right - side rsp was significantly decreased by 0.6 mm (p<0.001), and the left - side rsp was significantly decreased by 0.5 mm (p<0.001). The sul was 9.5 before the training and 13.7 after the training, a statistically significant increase of 4.36 (p<0.001), in the scapular stability exercise group . The scapular stability exercise group showed greater improvements than the manual therapy group in the sul and left and right rsp . These results are considered to be due to the prone row and modified prone cobra, which were performed to minimize the upper trapezius activity and maximize the lower trapezius activity . According to rusi, if lower trapezius muscle activation increases, then the muscle bulk changes22 . Day and uhl22 applied repetitive arm raises on 14 normal subjects in their 20s, and found considerable differences in the thickness of the lower trapezius (p<0.01). In this study, the right - side lower trapezius in rusi was significantly increased by 0.3 mm (p<0.001), and the left - side lower trapezius was significantly increased by 0.3 mm (p<0.001) in the scapular stability exercise group . The scapular stability exercise group showed greater improvement than the manual therapy group in the left and right lower trapezius in rusi . The increases in muscle thickness in the scapular stability exercise group indicate increases in muscle mass and strength . This study provides basic material to aid in the development and promotion of individualized stability exercises, which can be applied in the work environment to improve shoulder stability in office workers . A limitation of this study is the generalization of the results because the results are based on a selected group of participants office workers with shoulder pain.
The online version of this article (doi:10.1007/s13555 - 015 - 0084 - 3) contains supplementary material, which is available to authorized users . Finasteride 1 mg is used successfully all over the world for the treatment of androgenetic alopecia in male pattern baldness . Various clinical trials have established finasteride s efficacy in adult men with predominant vertex, anterior and midscalp region [2, 3]. On average, common side effects are loss of libido, erectile dysfunction and decreased ejaculate volume . These side effects were found in less than 0.5% of patients . To assess the huge difference [2, 11] in reporting the side effects, we conducted a 2-year randomized, questionnaire - based research study on patients receiving finasteride 1 mg tablets for androgenetic alopecia . For this, we used a questionnaire based on the international index of erectile function (iief) (supplementary table 1). This checks five domains: erectile function, orgasmic function, sexual desire, intercourse satisfaction and overall sexual satisfaction . A higher iief score indicates better sexual function and low score (below 25) indicates erectile dysfunction . The aim of the present study was to evaluate an age - matched comparison and evaluation of sexual function in patients treated by finasteride 1 mg for early androgenetic alopecia by using iief . Inclusion criteria were age 1840 years, who came for an outpatient consultation for male pattern androgenetic alopecia, which was diagnosed using the norwood hamilton s grading of male pattern alopecia with grade 3 to 5 on treatment with finasteride 1 mg, with good physical health . Exclusion criteria were patients being treated for various other causes of hair loss other than androgenetic alopecia . Those selected patients were briefed about the iief questionnaire and, with their consent, the questionnaire was provided for completion . A mean duration of approximately 16 weeks of medication was consumed by the patients at the time of answering the questionnaire . Our controls were 586 patients who attended outpatient consultation for various other non - hair related diseases such as psoriasis vulgaris, lichen planus, allergic contact dermatitis, irritant contact dermatitis, nail disorders, etc . The resultant scores of erectile function domain and iief domain of both the study group taking finasteride 1 mg and their age - wise control group were analyzed with the ibm software package (spss statistics, ny, usa). All procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1964, as revised in 2013 . Both the study group and controls were asked to answer the iief questionnaire anonymously to avoid any identity on sexual weakness . The results were compared in an age - wise manner . Comparing the age - wise finasteride - consuming patients and the control group, there was no statistical difference between the groups regarding their sexual function in total iief score or in any of the five domains mentioned . 1) show the scores in the erectile function domain (a) and international index of erectile function domain (b) in patients on finasteride and their controls.fig . 1age controlled 3d graphs showing the scores of domain in erectile function (a) and international index of erectile function domain (b) in patients on finasteride and their controls with age and scores both depicted in y axis age controlled 3d graphs showing the scores of domain in erectile function (a) and international index of erectile function domain (b) in patients on finasteride and their controls with age and scores both depicted in y axis the main mechanism in androgenetic alopecia is miniaturization of hair follicles from terminal to vellus hair due to the effect of androgen, especially dihydrotestosterone . Testosterone is converted by 5 alpha reductase to 5 alpha dihydrotestosterone, which is five times more potent than testosterone . This dihydrotestosterone binds to the androgen receptors of the genetically marked hair follicle and leads to miniaturization of that hair follicle . Finasteride is an azasteroid type 2 isoenzyme, 5 alpha reductase inhibitor, which inhibits dihydrotestosterone conversion from testosterone . This type 2 isoenzyme is present in the hair follicles and its activity is important in controlling the end organ hyper - reactivity causing androgenetic alopecia . Observation of eunuchs and prepubertal boys highlighted the role of testosterone in the induction of androgenetic alopecia . Therefore, it is evident that finasteride should not cause any side effects, relating to sexual health, as there will be no decrease in the quantity or quality of the testosterone level . However, clinical trials conducted by leyden et al . And kaufman et al . Resulted in 2% of patients experiencing sexual side effects such as the loss of libido, erectile dysfunction and decreased ejaculate volume . In this study, patients taking finasteride 1 mg for androgenetic alopecia and the control group were provided with the iief questionnaire and their responses analyzed . The results indicated that erectile and sexual function was not reduced compared to the controls . So, not only theoretically, finasteride was found to be a comparatively safe drug in this indian male population . This study was conducted in the indian context on the basis of the iief and the european study by tosti et al . . Further studies should be conducted in a multi - center, double - blind manner . In both our study and the study conducted by tosti et al ., sexual and erectile function of those subjects who were orally treated with finasteride was not reduced compared with their age - related controls . Supplementary material 1 (pdf 301 kb) supplementary material 2 (docx 19 kb) all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1964, as revised in 2013 . This article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made.
Sensitivity and specificity, which are defined as the number of true positive decisions / the number of actually positive cases and the number of true negative decisions / the number of actually negative cases, respectively, constitute the basic measures of performance of diagnostic tests (table 1). When the results of a test fall into one of two obviously defined categories, such as either the presence or absence of a disease, then the test has only one pair of sensitivity and specificity values . However, in many diagnostic situations, making a decision in a binary mode is both difficult and impractical . . There may be a considerable variation in the diagnostic confidence levels between the radiologists who interpret the findings . As a result, a single pair of sensitivity and specificity values is insufficient to describe the full range of diagnostic performance of a test . Consider an example of 70 patients with solitary pulmonary nodules who underwent plain chest radiography to determine whether the nodules were benign or malignant (table 2). According to the biopsy results and/or follow - up evaluations, 34 patients actually had malignancies and 36 patients had benign lesions . Chest radiographs were interpreted according to a five - point scale: 1 (definitely benign), 2 (probably benign), 3 (possibly malignant), 4 (probably malignant), and 5 (definitely malignant). In this example, one can choose from four different cutoff levels to define a positive test for malignancy on the chest radiographs: viz . 2 (i.e., the most liberal criterion), 3, 4, and 5 (i.e., the most stringent criterion). Therefore, there are four pairs of sensitivity and specificity values, one pair for each cutoff level, and the sensitivities and specificities depend on the cutoff levels that are used to define the positive and negative test results (table 3). As the cutoff level decreases, the sensitivity increases while the specificity decreases, and vice versa . To deal with these multiple pairs of sensitivity and specificity values, one can draw a graph using the sensitivities as the y coordinates and the 1-specificities or fprs as the x coordinates (fig . 1a). Each discrete point on the graph, called an operating point, is generated by using different cutoff levels for a positive test result . An roc curve can be estimated from these discrete points, by making the assumption that the test results, or some unknown monotonic transformation thereof, follow a certain distribution . For this purpose, the assumption of a binormal distribution (i.e., two gaussian distributions: one for the test results of those patients with benign solitary pulmonary nodules and the other for the test results of those patients with malignant solitary pulmonary nodules) is most commonly made (1, 2). The resulting curve is called the fitted or smooth roc curve (fig . The estimation of the smooth roc curve based on a binormal distribution uses a statistical method called maximum likelihood estimation (mle) (3). When a binormal distribution is used, the shape of the smooth roc curve is entirely determined by two parameters . The first one, which is referred to as a, is the standardized difference in the means of the distributions of the test results for those subjects with and without the condition (appendix) (2, 4). The other parameter, which is referred to as b, is the ratio of the standard deviations of the distributions of the test results for those subjects without versus those with the condition (appendix) (2, 4). Another way to construct an roc curve is to connect all the points obtained at all the possible cutoff levels . In the previous example, there are four pairs of fpr and sensitivity values (table 3), and the two endpoints on the roc curve are 0, 0 and 1, 1 with each pair of values corresponding to the fpr and sensitivity, respectively . The resulting roc curve is called the empirical roc curve (fig . Because the roc curve displays the sensitivities and fprs at all possible cutoff levels, it can be used to assess the performance of a test independently of the decision threshold (5). One of the most popular measures is the area under the roc curve (auc) (1, 2). Auc is a measure of the overall performance of a diagnostic test and is interpreted as the average value of sensitivity for all possible values of specificity (1, 2). It can take on any value between 0 and 1, since both the x and y axes have values ranging from 0 to 1 . The closer auc is to 1, the better the overall diagnostic performance of the test, and a test with an auc value of 1 is one that is perfectly accurate (fig . The line segment from 0, 0 to 1, 1 has an area of 0.5 (fig . 2). If we were to rely on pure chance to distinguish those subjects with versus those without a particular disease, the resulting roc curve would fall along this diagonal line, which is referred to as the chance diagonal (fig . A diagnostic test with an auc value greater than 0.5 is, therefore, at least better than relying on pure chance, and has at least some ability to discriminate between subjects with and without a particular disease (fig . 2). Because sensitivity and specificity are independent of disease prevalence, auc is also independent of disease prevalence (1, 5). Auc can be estimated both parametrically, with the assumption that either the test results themselves or some unknown monotonic transformation of the test results follows a binormal distribution, and nonparametrically from the empirical roc curve without any distributional assumption of the test results (figs . Several nonparametric methods of estimating the area under the empirical roc curve and its variance have been described (6 - 8). The nonparametric estimate of the area under the empirical roc curve is the summation of the areas of the trapezoids formed by connecting the points on the roc curve (fig . The nonparametric estimate of the area under the empirical roc curve tends to underestimate auc when discrete rating data (e.g., the five - point scale in the previous example) are collected, whereas the parametric estimate of auc has negligible bias except when extremely small case samples are employed (2, 4). For discrete rating data, however, when discrete rating data are collected, if the test results are not well distributed across the possible response categories (e.g., in the previous example, those patients with actually benign lesions and those patients with actually malignant lesions tend to be rated at each end of the scale, 1 = definitely benign and 5 = definitely malignant, respectively), the data may be degenerate and, consequently, the parametric method may not work well (2, 4). Using the nonparametric method is an option in this case, but may provide even more biased results than it normally would (2). For continuous or quasi - continuous data (e.g., a percent - confidence scale from 0% to 100%), the parametric and nonparametric estimates of auc will have very similar values and the bias is negligible (2). Therefore, using either the parametric or nonparametric method is fine in this case (2). In most roc analyses of radiological tests, discrete rating scales with five or six categories (e.g., definitely absent, probably absent, possibly present, probably present and definitely present) are used, for which the parametric method is recommended unless there is a problem with degenerate data . An auc of a test obtained from a group of patients is not a fixed, true value, but a value from a sample that is subject to statistical error . Therefore, if one performs the same test on a different group of patients with the same characteristics, the auc which is obtained may be different . Although it is not possible to specifically define a fixed value for the true auc of a test, one can choose a range of values in which the true value of auc lies with a certain degree of confidence . The 95% ci gives the range of values in which the true value lies and the associated degree of confidence . That is to say, one can be 95% sure that the 95% ci includes the true value of auc (9, 10). In other words, if one believes that the true value of auc is within the 95% ci, there is a 5% chance of its being wrong . Therefore, if the lower bound of the 95% ci of auc for a test is greater than 0.5, then the test is statistically significantly better (with a 5% chance of being wrong or a significance level of 0.05) than making the diagnostic decision based on pure chance, which has an auc of 0.5 . Since auc is a measure of the overall performance of a diagnostic test, the overall diagnostic performance of different tests can be compared by comparing their aucs . The bigger its auc is, the better the overall performance of the diagnostic test . When comparing the aucs of two tests, equal auc values mean that the two tests yield the same overall diagnostic performance, but does not necessarily mean that the two roc curves of the two tests are identical (3). The curves are obviously not identical . Although the aucs and, therefore, the overall performances of the two tests are the same, test b is better than test a in the high fpr range (or high sensitivity range), whereas test a is better than test b in the low fpr range (or low sensitivity range) (fig . The equality of two roc curves can be tested by using the two parameters, a and b, instead . Because the shape of a binormal smooth roc curve can be completely specified by the two parameters, a and b, the equality of the two roc curves under the binormal assumption can be assessed by testing the equality of the two sets of parameters, a and b, i.e. By comparing the two sets of values from the two roc curves . The null hypothesis and alternative hypothesis of the test are h0: a1 = a2 and b1 = b2 versus h1: a1 a2 or b1 b2, respectively, where 1 and 2 denote the two different roc curves (2, 3). According to this method, the roc curves and, consequently, the diagnostic performances of different tests are considered to be different, unless the roc curves are identical: in other words, unless they yield equal sensitivities for every specificity between 0 and 1 or equal specificities for every sensitivity between 0 and 1 (4). In some clinical settings, when comparing the performances of different diagnostic tests, one may be interested in only a small portion of the roc curve and comparing the aucs and the overall diagnostic performance may be misleading . When screening for a serious disease in a high - risk group (e.g., breast cancer screening), the cutoff range for a positive test should be chosen in such a way as to provide good sensitivity, even if the fpr is high, because false negative test results may have serious consequences . On the other hand, in screening for a certain disease, whose prevalence is very low and for which the subsequent confirmatory tests and/or treatments are very risky, a high specificity and low fpr is required . If the cutoff range for a positive test is not adjusted accordingly, almost all of the positive decisions will be false positive decisions, resulting in many unnecessary, risky follow - up examinations and/or treatments . In figure 3, although the aucs and overall performances of the two tests are the same, in the former diagnostic situation requiring high sensitivity, test b would be better than test a, whereas in the latter situation requiring a low fpr, test a would be better than test b. auc, as a measure of the overall diagnostic performance, is not helpful in these specific diagnostic situations . The diagnostic performance of a test should be judged in the context of the diagnostic situation to which the test is applied . And, depending on the specific diagnostic situation, only a portion of the overall roc curve may need to be considered . One way to consider only a portion of an roc curve is to use the roc curve to estimate the sensitivity at a particular fpr, and to compare the sensitivities of different roc curves at a particular fpr (fig . 4). Another way is to use the partial area under the roc curve (fig . Partial roc area is defined as the area between two fprs or between two sensitivities . The partial area under the roc curve between two fprs, fpr1 = e1 and fpr2 = e2, can be denoted as a(e1 fpr e2) (2). Unlike auc, whose maximum possible value is always 1, the magnitude of the partial area under the roc curve is dependent on the two fprs chosen . Therefore, the standardization of the partial area by dividing it by its maximum value is recommended and jiang et al . The maximum value of the partial area between fpr1 = e1 and fpr2 = e2 is equal to the width of the interval, e2 - e1 . The partial area index is interpreted as the average sensitivity for the range of fprs or specificities chosen (1, 2). Unlike in the case of many laboratory tests, the interpretation of most radiological tests is qualitative and there are several ways to express the reader's confidence in the presence of a disease, namely a binary result which is either positive or negative for the disease, a discrete rating scale such as a five - point scale, and a continuous or quasi - continuous scale such as a percent - confidence scale from 0% to 100% (2). The first approach is inadequate for roc analysis, however, the second and third approaches are appropriate (2). In most of the roc analyses of radiological tests which have been conducted to date, (13) performed a study to assess how the estimates of performance on roc curves are affected by the use of a discrete five - point scale versus a continuous percent - confident scale . They compared the aucs obtained with the two different scales in the case of abdominal cts used for detecting abdominal masses and suggested that the discrete rating or continuous scales are often not significantly different, and can be used interchangeably in image - evaluation roc studies, although they recommended continuous scales for routine use in radiological roc studies, because of their potential advantages in some situations (13). Having as many categories as possible or using a continuous or quasi - continuous scale is desirable theoretically (14) and has been shown to produce results essentially equivalent to those of discrete scales, when the latter produce well - distributed operating points (15). Several software programs that are frequently used for roc analysis are available on the internet . Rockit, which is available at http://xray.bsd.uchicago.edu/krl/roc_soft.htm (accessed december 31, 2003), is a program for parametric roc analysis that combines the features of rocfit, labroc, corroc2, clabroc and indroc . It estimates the smooth roc curve and its auc, 95% ci of auc, and the parameters a and b on the basis of a binormal distribution . Rockit tests the statistical significance of the differences between two paired (i.e., two roc curves from the same group of patients), partially paired, or unpaired (i.e., two roc curves from two different groups of patients, viz . The difference between two aucs (i.e., the difference in the overall diagnostic performance of the two tests) is tested with the z test . Differences in the parameters a and b of two roc curves (i.e., the equality of the two roc curves) are tested using the bivariate chi - square test, as presented by metz et al (2, 4). Rockit also estimates the sensitivity at a particular fpr and tests the statistical significance of the difference between the two sensitivities on the two curves at a particular fpr by means of the z test . Plotroc.xls, which is available at http://xray.bsd.uchicago.edu/krl/roc_soft.htm (accessed december 31, 2003), is a microsoft excel 5.0 (microsoft, redmond, wa, u.s.a .) Macro sheet which takes the a and b parameter values based on the assumption of a binormal distribution to plot a smooth roc curve . Medcalc (medcalc software, mariakerke, belgium), which is available at http://www.medcalc.be (accessed december 31, 2003), is a statistical package that offers nonparametric roc analysis . It provides the empirical roc curve and nonparametric estimate of the area under the empirical roc curve with its 95% ci, based on the method developed by hanley et al . A comparison between two paired roc curves is available and the statistical significance of the difference between two aucs is calculated with the z test, as described by hanley et al . Chicago, il, u.s.a .) Also provides the empirical roc curve and nonparametric estimate of the area under the empirical roc curve and its 95% ci, which are calculated using a method similar to that of medcalc . Partarea.for, which is available at http://www.bio.ri.ccf.org/research/roc (accessed december 31, 2003), is a fortran program designed to estimate the partial area under the smooth roc curve between two fprs, based on the method developed by mcclish (11). It also tests the statistical significance of the difference between the two partial areas of two roc curves using the z test . This program should be used in conjunction with a parametric program such as rockit . To estimate the partial area, it requires the a and b parameter estimates, along with the variances (a) and (b) and the covariance (a, b) of an roc curve, which can be obtained by means of a parametric program . When comparing two partial areas of two roc curves it also requires the covariances (a1, a2), (a1, b2), (b1, a2) and (b1, b2), which can be obtained using a parametric program (note: the subscripts 1 and 2 denote two different roc curves). This program needs to be compiled before it can be used on a dos or windows - based computer . The roc curve is a plot of test sensitivity along the y axis versus its 1-specificity or fpr along the x axis.in roc analyses of radiological tests, discrete rating scales with five or six categories are widely used, however, it would be preferable to have as many categories as possible or to use a continuous or quasi - continuous scale for data collection.auc, which is interpreted as the average value of sensitivity for all possible values of specificity, is a measure of the overall performance of a diagnostic test . Auc can take on any value between 0 and 1, where a bigger value suggests the better overall performance of a diagnostic test.the nonparametric estimate of the area under the empirical roc curve tends to underestimate auc when discrete rating data are collected, whereas the parametric estimate of auc has negligible bias, except when extremely small case samples are employed . Therefore, when discrete rating scales are employed, the use of a parametric method is recommended.the diagnostic performance of a test should be judged in the context of the diagnostic situation to which the test is applied . The partial roc area and sensitivity at a particular fpr are useful indicators, when only a portion of the entire roc curve needs to be considered . The roc curve is a plot of test sensitivity along the y axis versus its 1-specificity or fpr along the x axis . In roc analyses of radiological tests, discrete rating scales with five or six categories are widely used, however, it would be preferable to have as many categories as possible or to use a continuous or quasi - continuous scale for data collection . Auc, which is interpreted as the average value of sensitivity for all possible values of specificity, is a measure of the overall performance of a diagnostic test . Auc can take on any value between 0 and 1, where a bigger value suggests the better overall performance of a diagnostic test . The nonparametric estimate of the area under the empirical roc curve tends to underestimate auc when discrete rating data are collected, whereas the parametric estimate of auc has negligible bias, except when extremely small case samples are employed . Therefore, when discrete rating scales are employed, the use of a parametric method is recommended . The diagnostic performance of a test should be judged in the context of the diagnostic situation to which the test is applied . The partial roc area and sensitivity at a particular fpr are useful indicators, when only a portion of the entire roc curve needs to be considered . If the data are actually binormal or if a known function can transform the data so that it follows a binormal distribution, parameters a (the standardized difference in the means of the distributions of the test results for those subjects with and without the condition) and b (the ratio of the standard deviations of the distributions of the test results for those subjects without versus those with the condition) can be estimated directly from the means and standard deviations of the distributions of those subjects with and without the condition . Thus, we will have a = (u1 - u0) / 1; b = 0 / 1 where ui is the mean and i is the standard deviation of the test results, i = 0 (without the condition), 1 (with the condition). For discrete rating data, we hypothesize discrete rating scale test results, t0 (without the condition) and t1 (with the condition) as a categorization of two latent continuous scale random variables, t0 and t1, respectively, each of which has a normal distribution . For a discrete rating scale test result, ti, which can take on one of the k - ordered values, where i = 0 (without the condition) or 1 (with the condition), we assume that there are k - 1 unknown decision thresholds c1, c2,..., ck-1, so that if ti c1, then ti = 1 if cj - 1 <ti cj, then ti = j, j = 2, 3,..., k - 1 if ti> ck - 1, then ti = k because we assume that both t0 and t1 have normal distributions, then t0 ~ n (0, 0); t1 ~ n (1, 1) where 0, 1 are the means and 0, 1 are the variances of the normal distributions . Therefore, we will have a = (1 - 0) / 1; b = 0 / 1
Selenium is an essential trace dietary nutrient that may actively protect against damage from free radicals and reactive oxygen species produced during oxidative stress; for example, through its role as an essential component of numerous selenoproteins in critical antioxidant systems . Despite its central role in antioxidant defense systems and putative involvement in the development of chronic diseases, the major determinants of selenium levels in free - living humans are not well - understood . Of course selenium is consumed in the diet, but non - dietary factors, such as gastrointestinal absorption, tissue uptake, protein incorporation, or tissue metabolism or depletion, could also affect concentrations in the body . For example, older age, alcohol intake, and cigarette smoking [3 - 6] have been associated with lower selenium levels, suggesting that non - dietary individual or environmental factors (e.g., related to oxidative stress) may alter selenium stores . However, these prior studies were generally small and did not fully adjust for dietary consumption or other potential confounding factors . Investigations through large studies have been limited by challenges in estimating selenium consumption from dietary questionnaires due to significant variation in selenium contents of similar appearing foods . Additionally, measuring selenium contents of foods is limited by considerable geographic variability, and more importantly, only identifies potential selenium sources rather than what is actually consumed in the population . For example, a food that contains a high selenium level but is rarely consumed will contribute minimally to selenium exposure in the population . Advanced neutron activation analysis (naa) measurements now allow precise measurement of selenium levels in toenails, providing an objective biomarker of long - term exposure in populations . Toenail selenium concentrations are well correlated with selenium intake as well as selenium levels in serum or whole blood . In addition to individual behavioral determinants, geographic variation could play a strong role in selenium exposure . Selenium levels in foods vary directly with concentrations in the soil or water from which the food is derived . Conversely, in modern industrialized nations, foods are grown, processed, and transported from around the country and indeed the globe, potentially eliminating any significant residual geographic variation in exposure compared to, for example, developing nations . Unfortunately, most previous studies of selenium levels in free - living populations have been conducted in geographically relatively limited cohorts limiting ability to evaluate any independent contributions of geographic variation . To elucidate each of these issues, we investigated the independent dietary, demographic, lifestyle, and geographic determinants of selenium levels, as assessed by objective biomarker levels in toenails, in 3,902 u.s . Our main aims were to determine the major independent dietary predictors of selenium levels; whether lifestyle and demographic factors that might influence oxidative stress, such as age, smoking, adiposity, physical activity, and alcohol use, are independent predictors of selenium levels after adjusting for diet, and whether significant geographic variation would remain after accounting for differences in diet, demographic, and lifestyle factors . The population and design of the health professionals' follow - up study (hpfs) and nurses' health study (nhs) have been described . Briefly, the hpfs is a prospective cohort study among 51,529 male u.s . Health professionals aged 40 - 75 years at enrollment in 1986, and the nhs is a prospective cohort study among 121,700 female u.s . Registered nurses aged 30 - 55 years at enrollment in 1976 . The hpfs included participants from all 50 states and the district of columbia, puerto rico, guam, and the virgin islands; the nhs included participants from 11 major u.s ., we included 1,997 hpfs participants and 1,905 nhs participants who were randomly selected as controls from prior or ongoing nested case - control studies of cancer or cardiovascular disease (cvd) outcomes, after excluding 278 individuals who did not complete the food frequency questionnaire, left 10 food items blank, or had implausible energy intake (<500 kcal / d or> 4,500 kcal / d), and 46 individuals with toenail selenium concentrations> 1.5 g / g that could reflect exogenous contamination or considerable excess ingestion of selenium supplements . Between 1982 - 1984 for women subjects and in 1987 for the men, participants were asked to provide toenail clippings from all 10 toes and return them for storage and analysis . Overall, 68% of hpfs participants and 52% of nhs participants returned toenail samples . The baseline characteristics, including age, smoking status, alcohol intake, body mass index, and total calorie intake, of those supplying toenail samples were very similar to those not providing clippings among both in men and women . Before analyzing the toenail clippings, selenium levels were quantified using neutron activation analysis (naa) at the university of missouri research reactor by laboratory personnel blinded to all participant characteristics . The validity, reproducibility, and reliability over time of these biomarkers have been described [8,9,15 - 17]. Samples of toenail clippings from all toes were combined at the time of collection, providing a time - integrated measure of exposure over approximately the prior year . Other long - term depots such as hair and fingernails can be contaminated by use of selenium - based anti - dandruff shampoos, and blood selenium levels provide a measure of more short - term status . In prior analyses from these cohorts, we have shown that toenail selenium is an excellent biomarker of usual exposure . Toenail selenium concentrations respond to long - term changes in dietary intake, correlate with supplement use, and correlate with selenium levels in serum or whole blood . Toenail selenium concentration at one time point is a reliable predictor of future exposure, with a spearman correlation (r) of 0.48 (p <0.001) for levels assessed in toenail samples obtained 6 years apart . This is only modestly lower than correlations of 0.6 - 0.7 typically observed, over a similar time interval, for widely used epidemiological measures such as blood pressure . In both cohorts, demographics, lifestyle habits, other health information, and disease status were assessed by validated self - administered questionnaires every 2 years since enrollment . For this analysis, we used the reports closest in time to the collection of toenail samples from each participant . Smoking status was assessed as never, former, and current, with 1 - 14, 15 - 34, and 35 or more cigarettes per day . Bmi was calculated using self- reported body weight and height as the ratio of weight in kilograms to the square of height in meters; self - reported weight has been validated against technician - measured weight (r = 0.96) among both men and women in these cohorts . Because physical activity levels were assessed in different ways in the two cohorts, including only semi - quantitative measures in the nhs in this time period, we calculated sex - specific quintiles using a series of questions on the types and quantities of different activities, as described previously . Usual dietary habits and alcohol consumption were assessed by means of validated food frequency questionnaires that inquired about usual intake of foods over the prior year, including open - ended questions, specific questions on types of breakfast cereals and oils and fats used for cooking, and the use of dietary supplements including multivitamins, selenium, and other dietary supplements . The nhs dietary questionnaires in 1980 and 1982 included limited numbers of foods, while the 1984 cycle included a full questionnaire but was administered in the year after the toenail sampling for most participants . To minimize misclassification yet still capture dietary intake at or before the time of toenail sampling, we used the average values of all food items reported in the 1980 - 1984 nhs questionnaires . For the hpfs, we utilized data from the full dietary questionnaire administered in 1986, the year before toenail collection in that study . Multivariate linear regression was used to test associations of the demographic, lifestyle, and dietary factors with log - transformed toenail selenium levels as the dependent variable . To increase interpretability and minimize multiple comparisons of dietary factors, in preliminary analyses the 131 food items assessed in the food frequency questionnaires were grouped into 21 categories based on groupings of similar types of food and unadjusted spearman correlations between individual food items and toenail selenium . States were initially evaluated separately, evaluating fully multivariable - adjusted means of toenail selenium for each state . The states were then grouped into 5 geographic regions based on similarities of toenail selenium levels and geographic locations . The 5 defined regions were west, midwest - north, midwest - south, south, and northeast + other (alaska, guam, and puerto rico, that had relatively few numbers of participants and similar selenium levels as northeastern states). Linear spline regressions were used to assess potential non - linear relations between toenail selenium and covariates including age, physical activity, bmi, alcohol intake, and dietary factors . Multivariable stepwise regressions, both backward and forward methods (p = 0.05 for exit / entry), were used to identify the independent dietary determinants of selenium levels, adjusting for age, sex, smoking status, physical activity, multivitamin use, selenium supplement use, obesity, alcohol intake, and geographic region . Foods that were selected in both forward and backward stepwise regression models were considered to have independent relationships with selenium . Coefficients were corrected for measurement error in the dietary questionnaires, compared with weighed diet records over 12 months . Potential effect modification was assessed between smoking, sex, and supplement use separately using the wald test for statistical significance of multiplicative interaction terms in the multivariable - adjusted linear regression model . Data analyses were conducted using sas version 9.1 (sas institute inc, cary, nc), with two - tailed alpha = 0.05 . The population and design of the health professionals' follow - up study (hpfs) and nurses' health study (nhs) have been described . Briefly, the hpfs is a prospective cohort study among 51,529 male u.s . Health professionals aged 40 - 75 years at enrollment in 1986, and the nhs is a prospective cohort study among 121,700 female u.s . Registered nurses aged 30 - 55 years at enrollment in 1976 . The hpfs included participants from all 50 states and the district of columbia, puerto rico, guam, and the virgin islands; the nhs included participants from 11 major u.s ., we included 1,997 hpfs participants and 1,905 nhs participants who were randomly selected as controls from prior or ongoing nested case - control studies of cancer or cardiovascular disease (cvd) outcomes, after excluding 278 individuals who did not complete the food frequency questionnaire, left 10 food items blank, or had implausible energy intake (<500 kcal / d or> 4,500 kcal / d), and 46 individuals with toenail selenium concentrations> 1.5 g / g that could reflect exogenous contamination or considerable excess ingestion of selenium supplements . Between 1982 - 1984 for women subjects and in 1987 for the men, participants were asked to provide toenail clippings from all 10 toes and return them for storage and analysis . Overall, 68% of hpfs participants and 52% of nhs participants returned toenail samples . The baseline characteristics, including age, smoking status, alcohol intake, body mass index, and total calorie intake, of those supplying toenail samples were very similar to those not providing clippings among both in men and women . Selenium levels were quantified using neutron activation analysis (naa) at the university of missouri research reactor by laboratory personnel blinded to all participant characteristics . The validity, reproducibility, and reliability over time of these biomarkers have been described [8,9,15 - 17]. Samples of toenail clippings from all toes were combined at the time of collection, providing a time - integrated measure of exposure over approximately the prior year . Other long - term depots such as hair and fingernails can be contaminated by use of selenium - based anti - dandruff shampoos, and blood selenium levels provide a measure of more short - term status . In prior analyses from these cohorts, we have shown that toenail selenium is an excellent biomarker of usual exposure . Toenail selenium concentrations respond to long - term changes in dietary intake, correlate with supplement use, and correlate with selenium levels in serum or whole blood . Toenail selenium concentration at one time point is a reliable predictor of future exposure, with a spearman correlation (r) of 0.48 (p <0.001) for levels assessed in toenail samples obtained 6 years apart . This is only modestly lower than correlations of 0.6 - 0.7 typically observed, over a similar time interval, for widely used epidemiological measures such as blood pressure . In both cohorts, demographics, lifestyle habits, other health information, and disease status were assessed by validated self - administered questionnaires every 2 years since enrollment . For this analysis, we used the reports closest in time to the collection of toenail samples from each participant . Smoking status was assessed as never, former, and current, with 1 - 14, 15 - 34, and 35 or more cigarettes per day . Bmi was calculated using self- reported body weight and height as the ratio of weight in kilograms to the square of height in meters; self - reported weight has been validated against technician - measured weight (r = 0.96) among both men and women in these cohorts . Because physical activity levels were assessed in different ways in the two cohorts, including only semi - quantitative measures in the nhs in this time period, we calculated sex - specific quintiles using a series of questions on the types and quantities of different activities, as described previously . Usual dietary habits and alcohol consumption were assessed by means of validated food frequency questionnaires that inquired about usual intake of foods over the prior year, including open - ended questions, specific questions on types of breakfast cereals and oils and fats used for cooking, and the use of dietary supplements including multivitamins, selenium, and other dietary supplements . The nhs dietary questionnaires in 1980 and 1982 included limited numbers of foods, while the 1984 cycle included a full questionnaire but was administered in the year after the toenail sampling for most participants . To minimize misclassification yet still capture dietary intake at or before the time of toenail sampling, we used the average values of all food items reported in the 1980 - 1984 nhs questionnaires . For the hpfs, we utilized data from the full dietary questionnaire administered in 1986, the year before toenail collection in that study . Multivariate linear regression was used to test associations of the demographic, lifestyle, and dietary factors with log - transformed toenail selenium levels as the dependent variable . To increase interpretability and minimize multiple comparisons of dietary factors, in preliminary analyses the 131 food items assessed in the food frequency questionnaires were grouped into 21 categories based on groupings of similar types of food and unadjusted spearman correlations between individual food items and toenail selenium . States were initially evaluated separately, evaluating fully multivariable - adjusted means of toenail selenium for each state . The states were then grouped into 5 geographic regions based on similarities of toenail selenium levels and geographic locations . The 5 defined regions were west, midwest - north, midwest - south, south, and northeast + other (alaska, guam, and puerto rico, that had relatively few numbers of participants and similar selenium levels as northeastern states). Linear spline regressions were used to assess potential non - linear relations between toenail selenium and covariates including age, physical activity, bmi, alcohol intake, and dietary factors . Multivariable stepwise regressions, both backward and forward methods (p = 0.05 for exit / entry), were used to identify the independent dietary determinants of selenium levels, adjusting for age, sex, smoking status, physical activity, multivitamin use, selenium supplement use, obesity, alcohol intake, and geographic region . Foods that were selected in both forward and backward stepwise regression models were considered to have independent relationships with selenium . Coefficients were corrected for measurement error in the dietary questionnaires, compared with weighed diet records over 12 months . Potential effect modification was assessed between smoking, sex, and supplement use separately using the wald test for statistical significance of multiplicative interaction terms in the multivariable - adjusted linear regression model . Data analyses were conducted using sas version 9.1 (sas institute inc, cary, nc), with two - tailed alpha = 0.05 . The average age of participants was 60 9 y in men and 53 6 y in women (table 1). Approximately one - half of the study participants were overweight or obese, and 11% of men and 39% of women were current smokers . Selenium supplement use was uncommon, used by only 7% of men and 3% of women; multivitamin supplements were more common, taken by 45% of men and 42% of women . Linear spline models suggested linear relationships between toenail selenium and covariates; thus, these were evaluated as continuous variables in the multivariable models . Among the 21 food groups evaluated, consumption of beef, breads (including cakes, muffins, and other breads), coffee, dairy products, eggs, and white rice were identified in multivariable stepwise regression models as independent determinants of selenium levels . Consumption of beef and bread products were each associated with higher levels, whereas consumption of coffee, dairy products, eggs and white rice were each associated with lower levels . To understand whether other demographic and lifestyle factors were associated with selenium after accounting for diet, we then performed multivariable - adjusted analyses including adjustments for each of the identified dietary factors, and multivariable - adjusted results were similar in men and women, so the combined results are shown, adjusted for gender (table 2). Even adjusting for diet as well as other lifestyle and environmental factors, selenium levels were 0.62% lower for every 5 years of older age (95% ci: 0.29, 0.96), and were 6.3% lower in women vs. men (95% ci: 4.9, 7.6). This sex difference was consistent in analyses excluding current smokers and stratified by geographic region (data not shown). Several key lifestyle factors also remained independently associated with selenium levels after adjustment for demographics and diet (table 2). Higher bmi was associated with higher selenium levels, with 1.2% higher levels for each 5 kg / m (95% ci: 0.3, 2.2). Compared with never smokers, current smokers had significantly lower selenium levels, with an additional dose - response relationship for the number of cigarettes smoked: selenium levels were 5% lower in those smoking 1 - 14 cigarettes per day, 9% lower in those smoking 15 - 34 cigarettes per day, and 10% lower in those smoking 35 or more cigarettes per day . Alcohol consumption was also associated with selenium levels, with 1.5% lower levels for each drink per day (95% ci: 1.1, 2.0). As expected, the use of selenium supplements was associated with 6.9% higher selenium (95% ci: 4.3, 9.5). Even after adjustment for each of these demographic, lifestyle, and dietary characteristics, significant geographic variation in selenium levels was identified (table 2). Compared to participants residing in southern midwestern states, those living in the west, midwest - north, and south had significantly higher toenail selenium levels (west: 8.9% higher, 95% ci: 7.2, 10.6; northern midwest: 7.4% higher, 95% ci: 5.5, 9.4; and south: 2.8% higher, 95% ci: 0.9, 4.7). There was little evidence that these relationships varied by sex, smoking, or supplement use . Overall, men in the northwestern states generally had higher levels of selenium than those in the southeastern states . The highest levels of selenium were found in wyoming, south and north dakota, nebraska, and washington state; the adjusted means of toenail selenium in these states were 1.00, 0.97, 0.96, 0.94, and 0.94 g / g, respectively . States with the lowest selenium levels were north carolina, kentucky, pennsylvania, nevada, and south carolina, in which adjusted selenium means were only 0.77, 0.77, 0.77, 0.76, and 0.75 g / g, respectively . It would be expected that selenium levels in the body should be affected by dietary factors and supplement use, and both were identified here as independent determinants . However, although the magnitude of these observed relationships is likely to be underestimated due to some misclassification in estimation of diet, even so these dietary factors explained only a modest relative proportion of overall variation in selenium levels . Notably, several other demographic and lifestyle factors were independent determinants of selenium levels, including smoking, alcohol intake, age, and sex . Furthermore, geographic residence remained a strong independent predictor, even after adjustment for types of foods consumed and each of the other independent determinants of toenail selenium . Beef and bread products are recognized as good sources of selenium, and bioavailability of selenium from these foods is relatively high . However, consumption of white rice was also negatively correlated with selenium levels in our study . This could be explained by findings that consumption of high glycemic index (gi) foods leads to higher oxidative stress . Selenoproteins are important components of several critical antioxidant systems, such as glutathione peroxidase, that actively protect against damage from free radicals and reactive oxygen species . Thus, it is possible that consuming foods that induce oxidative stress, such as high gi foods, could deplete selenium levels . It is also possible that foods such as white rice, which are typically refined and depleted of phytochemicals, could be replacing other higher - selenium foods in the diet . Interestingly, intakes of coffee, dairy products, and eggs were each inversely associated with selenium levels . Our findings support the need for further study of potential effects of these foods on selenium levels . We observed a dose - response relationship between the number of cigarettes currently smoked and toenail selenium levels, consistent with findings from previous studies [3 - 5], even after multivariable adjustment for dietary habits, demographics, and other lifestyle factors . Reported that compared to nonsmokers, current smokers have lower consumption of selenium as estimated from dietary questionnaires, suggesting that lower selenium levels in smokers could at least partly reflect dietary differences . However, we identified current smoking as a significant predictor of lower selenium levels even after adjustment for other dietary and non - dietary determinants . Although residual confounding from unmeasured dietary factors and measurement error in the observed dietary factors cannot be excluded, the magnitude and observed dose - response support biological plausibility of a causal relationship . Cigarette smoking is known to increase oxidative stress [33 - 35], with a positive dose - response relationship per number of cigarettes smoked, and biomarkers of oxidative stress are reduced substantially within 2 weeks of smoking cessation . These results support our findings of lower selenium levels in current but not former smokers, and the lowest levels among those who smoked the most cigarettes per day . Our findings indicate that factors which promote oxidative stress, such as current smoking, may directly affect tissue selenium levels, for example by increasing selenium utilization and causing depletion of tissue selenium stores . This concept of selenium depletion is further supported by the relationships we found between some other non - dietary characteristics and selenium levels . For example, older age was associated with lower toenail selenium levels, consistent with previous reports, which may be explained by increased oxidative damage as a function of aging . In addition, we observed alcohol - related reductions in selenium levels, a finding supported by reports that alcohol consumption induces oxidative stress . Thus, our findings together support a new hypothesis, in which factors that promote oxidative stress may deplete selenium levels in the body . Prior studies of selenium levels have found inconsistent sex differences [4 - 6,42 - 44]. The sex differences we observed should be interpreted conservatively since these were two separately recruited cohorts . Interestingly, prior findings have also been inconsistent in terms of whether oxidative stress levels are higher in men or women . The reasons for these discrepancies in relationships between sex and both selenium and oxidative stress status are unknown, and further investigation of these issues is warranted . Although the extensive transport system of food products in the united states is thought to reduce variability in the selenium contents of foods in different regions, significant geographic heterogeneity in selenium levels was observed, even after accounting for dietary habits, demographics, and other lifestyle factors . This could be due to significant variation in the selenium contents of foods in different u.s . Regions, or to residual confounding from unmeasured differences in other dietary habits or lifestyle characteristics between regions . Whereas our findings cannot definitively distinguish between these two possibilities, our evaluation and adjustment for multiple dietary habits, demographic characteristics, and lifestyle factors suggests that the former explanation may be more plausible . Previous studies have shown inconsistent geographic distributions of selenium in crops and human levels in the u.s ., and most prior studies in humans have not reported the independent effect of geographic variation adjusted for other potential selenium determinants, including diet and lifestyle factors . Our study provides unique geographic information about the distribution of selenium levels, adjusted for other major determinants, in two large u.s . Cohorts . This analysis has several strengths . Rather than measuring selenium content in foods and estimating exposure, we assessed actual tissue biomarkers of selenium levels in 3,902 free - living men and women from across the u.s ., providing a better estimate of actual exposure to selenium in the population . Selenium levels were evaluated in toenails using well - established methods, providing a valid and reproducible biomarker of long - term levels . The cohort size and standardized assessment of a wide variety of participant characteristics allowed multivariable - adjustment for several demographic, lifestyle, and dietary factors, including multiple potential dietary sources of selenium, minimizing residual confounding . We concurrently evaluated multiple potential determinants, providing the best evidence to - date of how each of these demographic, lifestyle, and dietary factor may independently influence long - term selenium levels . The participants were americans of higher socioeconomic status and mostly white, and our findings may not be generalizable to other socioeconomic groups or nations . On the other hand, there is little reason to expect that the biological effects on selenium levels of some factors, such as smoking, might vary substantially in other socioeconomic groups, races, or countries . Population, and thus the geographic findings should be viewed qualitatively rather than as definitive for the u.s . Although extensive covariate information was collected using validated instruments, some residual confounding due to unmeasured or imperfectly measured factors may remain . In summary, we identified several independent dietary, and interestingly, non - dietary predictors of selenium levels in the u.s . The findings were consistent with expected effects of oxidative stress, suggesting that tissue selenium, and potentially selenium - related anti - oxidant defenses, may depend on the balance between dietary consumption vs. depletion by oxidant stressors . Finally, although we identified a number of independent determinants of selenium - providing critical information for future studies examining selenium levels and chronic disease - a large proportion of the total variance was left unexplained . Future studies, including the examination of genetic factors, are needed to better understand the biological pathways through which environmental and genetic determinants affect selenium concentrations in the human population.
Endometriosis is defined as the existence of endometrial - like tissue outside the uterus which is associated with pelvic pain and infertility and is seen as much as 10% in women in reproductive age and 50% in women with chronic pelvic pain or infertility. [25] the most common clinical symptoms of endometriosis include infertility, pelvic mass, dysmenorrhea, pelvic pain, deep dyspareunia, and urinary and cyclic bowel alterations . Pathogenesis of this disease is complex and multi factorial; despite extensive studies its etiology has remained ambiguous . A combination of various published theories, which strived to explain endometriosis impaired immunologic response, genetic predispositions and inflammatory components as possible causes of this disease. [1120] ca125 is the cell surface antigen and it is expressed by derivatives of coelomic and mullerianepithelia it is the most common indicator for diagnosis of endometriosis. [132124] due to its limitation, it usually increases in advanced stage of endometriosis and yet because of the low sensitivity of this assay its utilization is restricted in detection of minimal or mild endometriosis, therefore it is not suitable for routine screening . Showed that the accuracy of ca125 testing is still limited suggesting transvaginal ultrasonography for initial screening of endometriosis . It is broadly accepted that endometriosis is a pelvic inflammatory process that is related to distort functioning of immune cells in the peritoneal area . C - reactive protein (crp) level rises radically during inflammation and therefore it is a member of the acute phase reactant . In the clinical practice this protein is supplemented as a marker of on - going inflammation and as for monitoring infectious process . The first of these showed that crp in stage iii and iv in women with endometriosis more likely in those with more advanced disease . More recently did not find significant difference in serum level of crp between patients with endometriosis and healthy controls . Diagnosis of endometriosis is a challenging theme; and despite the broad search for innovative laboratory tests and advances in imaging technologies there are still no easy, non - invasive diagnostic tests available but due to inflammatory process of endometriosis, still crp level may be target of initial screening . Therefore, the difference between peritoneal level of crp in women with endometriosis and healthy cases is hypothesized . 392 women who were subject to laparoscopy for the evaluation of infertility or pelvic pain at the isfahan fertility and infertility centre were considered . The patients with hypertension, coronary arterial diseases, diabetes, renal diseases, active pelvic inflammatory disease or polycystic ovarian syndrome were excluded . After laparoscopy the patients were allocated into two groups; women with (group i, n = 90) and without (group ii, n = 89) endometriosis . This study was approved by ethical committee of isfahan university of medical sciences the venous blood samples were obtained from all patients before laparoscopy . The peritoneal fluid samples were also centrifuged and the supernatant were stored at -20 c until measurement . The serum and peritoneal levels of crp were measured using enzyme immunoassay kit (monobind inc ., briefly, samples were added to a streptavidin coated wells, and then biotinylated monoclonal and enzyme labelled antibodies were added . Reaction between the crp antibodies and native crp formed a complex that bind with streptavidin . After incubation and washing, the enzyme crp antibody bound conjugate is separated from unbound one . 392 women who were subject to laparoscopy for the evaluation of infertility or pelvic pain at the isfahan fertility and infertility centre were considered . The patients with hypertension, coronary arterial diseases, diabetes, renal diseases, active pelvic inflammatory disease or polycystic ovarian syndrome were excluded . After laparoscopy the patients were allocated into two groups; women with (group i, n = 90) and without (group ii, n = 89) endometriosis . The peritoneal fluid samples were also centrifuged and the supernatant were stored at -20 c until measurement . The serum and peritoneal levels of crp were measured using enzyme immunoassay kit (monobind inc ., briefly, samples were added to a streptavidin coated wells, and then biotinylated monoclonal and enzyme labelled antibodies were added . Reaction between the crp antibodies and native crp formed a complex that bind with streptavidin . After incubation and washing, the enzyme crp antibody bound conjugate is separated from unbound one . There was no statistically significant difference between patients suffering endometriosis and control group in age, respectively: [28.9 (range: 1944) versus, 30.2 (range: 2442)]. The data for crp levels in serum and peritoneal from the patients with endometriosis (case) and non - endometriosis (control) the results indicated that the serum and peritoneal levels of crp were significantly different between case and control groups (p <0.05). No significant difference in serum level of crp between patients with endometriosis and healthy controls was detected; however there was significant difference in peritoneal level of crp between case and control groups (p <0.05). Crp levels in serum and peritoneal from the patients with endometriosis (case) and nonendometriosis (control) the star () indicates significant difference from control group (p <0.05). There was no statistically significant difference between patients suffering endometriosis and control group in age, respectively: [28.9 (range: 1944) versus, 30.2 (range: 2442)]. The data for crp levels in serum and peritoneal from the patients with endometriosis (case) and non - endometriosis (control) is demonstrated in figure 1 . The results indicated that the serum and peritoneal levels of crp were significantly different between case and control groups (p <0.05). No significant difference in serum level of crp between patients with endometriosis and healthy controls was detected; however there was significant difference in peritoneal level of crp between case and control groups (p <0.05). Crp levels in serum and peritoneal from the patients with endometriosis (case) and nonendometriosis (control) the star () indicates significant difference from control group (p <0.05). The serum and peritoneal levels of crp between women with endometriosis and infertile women without endometriosis was compared in the present study . No significant difference between the serum level of crp between the two groups was found, which also complies with the findings of matarese et al . And xavier et al . According to the findings compared to the control group, the crp level of the peritoneal fluid were higher in patients with endometriosis (p<0.05). Pelvic endometriosis is a chronic inflammatory disease that is in association with a general inflammatory response in the peritoneal cavity . Macrophage constitutes 82- 99% of the all the cell population of peritoneal fluid. [3739] literature has repeatedly reported an increase of total peritoneal fluid cell numbers, cell concentration and macrophages in endometriosis patients in compare to the control. [4043] the study of dunselman et al . Also confirmed that there is an increase in the number and concentration of peritoneal cells in patients with endometriosis as compared to the control group . The rise in the number of peritoneal macrophages in women with endometriosis may signify that the endometrial tissue in the peritoneal cavity is recognized as a foreign entity that should be eliminated, thus cells such as retrograde endometrial tissues are killed by peritoneal macrophages and their presence concludes into inflammatory process . Previous studies also reported that the peritoneal fluid mononuclear cells in women with endometriosis are more than in controls and that most of these cells have a more differentiated phenotype . . A severe inflammatory process will conclude into considerable change of the number of peritoneal cells . In vitro studies indicated that crp can be produced by vascular and organ - specific cells in response to inflammatory stimulus. [4650] furthermore, the study of haider et al . Demonstrated that the peripheral blood mononuclear cells (pbmc) also contribute to the crp production . The concentration of complement factors, acute - phase proteins and immunoglobulins in the abdominal cavity may be increased after vascular permeability has changed in patients with endometriosis . Moreover, in an advanced stage of differentiation, macrophages secret some of the acute phase proteins and complement factors . It is likely that the increase of crp in peritoneal fluid of endometriosis patients is resulted from peritoneal macrophages producing them in response to the local inflammation in peritoneal cavity . Many studies maintain this notion, proposing that various local products such as cytokines are secreted by the activated macrophages in the peritoneal fluid of women with endometriosis. [375356] the peritoneal macrophages are strong producers of inflammatory cytokine. [5760] in the peritoneal fluid of women with endometriosis there is an increased number of cytokines and pro inflammatory cells . Assumes that cytokines can be produced by immune competent cells as well as by endometrial implant . Moreover, they can also be produced by ectopic endometrial tissue. [6264] macrophages are the major source of cytokines . Cytokines that are originated in bone marrow circulate as monocytes and move to different body cavities, and cytokines that are released abundantly during inflammatory process can also stimulate crp activation in peripheral blood mononuclear cells . Crp is a member of the class if acute phase reactants and it rise dramatically during inflammatory processes occurring in the body . It seems that the other cause of this increment in crp level is due to a rise in the peritoneal concentration of some cytokines, which is produced by macrophages that induced crp production . Our findings suggested higher peritoneal fluid crp level in endometriosis patients in comparison to non - endometriosis patients, but no differences in serum level . However, it is further recommended that a combination of different markers might be helpful in this regard and other studies can investigate to find such useful markers.
Pre - eclampsia (pe) is a pregnancy associated disorder known by hypertension and proteinuria . The etiology of pe is not fully understood and a great number of mechanisms are proposed as the disease pathophysiology; however, the only definite cure of this syndrome is delivery . It is a general consensus on the role of disruption between vascular generation and anti - angiogenic responses in creating pe . In addition, immune mal - adaptation hypothesis suggests that pe is the result of an inappropriate regulation of the normally t helper 2 deviated response during the pregnancy . In this way recent reports suggest that pe is associated with a th1 predominant profile while activation of the immune system leads to alteration in cytokine profile and defect in the acquisition of invasive phenotype by trophoblasts in pe patients . The first 2 stages of disease cause dysfunction in uteroplacental perfusion and oxidative stress while the 3 stage of pe is due to the release of inflammatory and angiogenic factors, which could lead to maternal endothelial damage and systemic inflammatory response . Cytokines, growth factors, and adhesion molecules have been proposed as important mediators for successful placentation as well as endothelial function . Over past decades, multiple analyses of cytokines provided substantial insight into the key players of the maternal immune system involved in pe . Tumor necrosis factor- (tnf-) is an inflammatory cytokine produced by human uterine and placental cells at the early and late stages of gestation and promotes the regulation of trophoblast growth and invasion . Furthermore, tnf- could inhibit deeply integration and invasion of trophoblasts in maternal endometrium, which leads to pe . Interleukin-15 (il-15), which is also a proinflammatory cytokine, has profound effects on natural killer (nk) cells and their cytotoxicity activation . Regarding to the role of nk cells in the pathogenesis of pe, il-15 could be a key player in development of disease . Interleukin-10 (il-10) as an anti - inflammatory cytokine is produced by some subpopulations of t lymphocytes, monocytes, macrophages, and cytotrophoblasts . Production of this cytokine is considered to play an important role in maternal immune tolerance of the fetus in normal pregnancy . In this study, we compared the serum levels of tnf-, il-15, and il-10 in iranian pe women with normotensive ones . The study was a case - control study, in which serum samples of 84 pregnant women were studied . 44 pe (cases) and 40 normotensive (controls) pregnant women were enrolled in this study . These 2 groups were selected among the women admitted to a university associated hospital of tehran university of medical sciences . Pe patients were diagnosed by hypertension (blood pressure 140/90 mm hg) and proteinuria (at least 2 + on dips teak examination or 300 mg/24 h on at least 2 occasions 6 h apart) after the 20 week of gestation . The pe women were under the supervision and treatment of obstetrics and gynecology specialist during pregnancy . The normotensive control group consisted of healthy women with uncomplicated pregnancy who referred for normal routine check - up examinations to a university associated hospital . Pregnant women with pre - gestational diabetes mellitus and chronic hypertension were excluded from the study . 5 ml of venous blood sample were taken from both groups before beginning of the active phase of labor . Serum levels of tnf- and il-10 were measured using a sandwich elisa test due to manufacturer's instruction (bender medsystems, austria). The levels of il-15 were assayed by using il-15 sandwich elisa kit (r&d systems, minneapolis, mn). In above mentioned elisa kits routine procedures were done in this order; coating the plate with capture antibody, blocking the plate, adding standards, and unknown samples, washing, adding the biotin conjugated specific antibody, washing, applying enzyme - linked streptavidin, and finally adding chemical substrate . Optical density of color chemicals that produced in the wells of the plate were read and the concentrations of cytokines were measured according to plots . The serums that their cytokine levels were beyond the upper limit of the kit were diluted for assessment . For all mentioned cytokines, standard curves were plotted and the concentrations were calculated according the manufacturer's instruction . Student's t - test was used for comparison between serum levels of two groups . P value there was no statistically significant difference related to age and gestational age at the time of sampling between two groups; however, there were higher systolic and diastolic pressures in pe group compared to normotensive one (p values: 0.01 and 0.03 respectively for systolic and diastolic blood pressures). The women with pe showed significantly higher serum concentrations of tnf- and il-15 (p values: 0.001 and 0.01 respectively) relative to the control group . In comparison, levels of il-10 in the serum of normotensive pregnant women were significantly higher than pe patients (p value = 0.01). Clinical characteristics of the preeclamptic and normotensive women serum levels of tumor necrosis factor- in preeclamptic (pe) and normal subjects . Each bar represented 44 pe and 40 normotensive pregnant women serum levels of interleukin-15 in preeclamptic (pe) and normal subjects . Each bar represented 44 pe and 40 normotensive pregnant women serum levels of interleukin-10 in preeclamptic (pe) and normal subjects . Results of this study demonstrated that in women having pe, compared to women with a normal pregnancy, inflammatory th1-type responses are increased; while anti - inflammatory responses are decreased . The higher levels of pro - inflammatory cytokines (tnf- and il-15) and lower levels of il-10 in the pe group suggest an increased inflammatory status in pe during last months . Sharma et al . And xie et al ., in agree with our results, found that the level of inflammatory cytokines such as tnf- increased significantly in preeclamptic patients compared with health controls . Furthermore, laskowska et al . In consistent with us, indicated that tnf- increased in pe patients and suggested this cytokine may be play a role in pathogenesis and consequences of pe . In general, these studies demonstrated that tnf- is a potent pro - inflammatory cytokine, its primary biological activity includes inflammation and it may contribute to the abnormal placental invasion . However, afshari et al . And jonsson et al . Observed no significant changes of tnf- in pe women compared to normal pregnant women . . Showed upraised serum levels of il-15 in pe cases compared to normotensive ones . In line with this finding, el - baradie et al . In their study indicated that serum levels of il-15 and il-16 were elevated in pe relative to normotensive pregnant women . In contrast lu et al . Represented not elevated levels of il-15 in pe subjects compared to normal women . In normal pregnancy, it seems that in pe th1-type cytokines such as tnf- and ifn- induce trophoblastic apoptosis, inhibit differentiation and invasion of trophoblast, and finally, may be involved in the incomplete invasion of trophoblast to spiral arteries; pathologic processes that are integral parts of pe . Our findings showed higher levels of il-10, which is an anti - inflammatory cytokine in sera of normal pregnant women . In concordance with our results, sharma et al . Showed that il-10 was decreased significantly in pe patients compared to normal pregnant women . Inversely, bakheit et al . And xie et al . Found higher serum levels of il-10 in pe women and jonsson et al . Observed no significant difference in il-10 levels between normotensive and pe women . These contradictory results of various studies could be related to sampling in different stages of pregnancy . Pe as an inflammatory process starts from the first steps of placentation; however, this inflammatory grade lasts until parturition . Consequently, upraised levels of pro - inflammatory cytokines in our study may be the perquisite of pe . Recognition of early detectable inflammatory markers could be a great help to predict and observe pe patients more accurately.
Cirrhosis is characterized by circulatory changes corresponding to a hyperkinetic state with arterial vasodilatation, decreased systemic vascular resistance, and increased cardiac output . Hyperkinetic state and vasodilatation worsen in parallel with the deterioration in liver function . In patients with end - stage cirrhosis, arteriolar vasodilatation is no longer compensated by an increase in cardiac output, resulting in a state of arterial underfilling . Arterial underfilling, in turn, results in the activation of vasoconstrictor systems, which causes intense intrarenal vasoconstriction and a marked decrease in glomerular filtration rate (gfr) and eventually leads to hepatorenal syndrome (hrs). The increase in creatinine can be abrupt (type i hrs) or follow a more progressive course (type ii hrs). A first set of criteria had been proposed in the mid-'90s to better differentiate hrs from other causes of acute renal failure in cirrhosis, the absence of improvement with volume expansion being central in the definition of hrs . However, these criteria proved to be too restrictive . For instance, ongoing bacterial infection was considered an exclusion criterion although experience shows that hrs frequently is triggered by infections . The diagnostic criteria were revisited in 2007 in order to be less restrictive . However, these criteria still have some limitations . Firstly, it has been shown that a substantial proportion of patients who are undergoing transjugular renal biopsy and who have a clinical diagnosis of hrs do have intrinsic kidney changes, especially tubulointerstitial injury resulting from either comorbidities or chronic ischemia . Secondly, the limit of a creatinine level of more than 1.5 mg / dl to define hrs may be inappropriate . Indeed, owing to muscle wasting, some cirrhotic patients with a serum creatinine level of below 1 mg / dl may already have a marked decrease in true gfr . In the previous issue of critical care, a group of experts, including not only hepatologists but also nephrologists and intensivists, reported the results of a workshop aimed at reviewing current knowledge in the field of hrs and proposing new classifications, based on the widely used rifle (risk, injury, failure, loss, and end - stage kidney disease) criteria, of all forms of renal impairment in cirrhosis . The group proposed the term' hepatorenal disorder' to define any kind of kidney disease that is functional or structural in nature in patients with cirrhosis . Acute kidney injury is considered at an earlier stage in patients with a creatinine increase of at least 0.3 mg / dl within 48 hours and/or a 1.5 or more increase in creatinine from baseline . This new classification may help initiate specific therapy at an earlier stage and increase the chance for recovery . This classification is also more appropriate to identify any kind of kidney injury within a wide spectrum of causes of acute, chronic, and acute - on - chronic kidney diseases in cirrhosis . However, even if the patients are identified at an earlier stage, the revised classification does not clearly differentiate those who may benefit from medical therapies of hrs (that is, terlipressin or noradrenaline) from those who may not . In addition, this classification does not help address the important issue of reversibility after liver transplantation . In most western countries, the model for end - stage liver disease (meld) score determines priority for allocation in liver transplantation . Since creatinine is one of the three components of the meld score (along with bilirubin and international normalized ratio), the proportion of patients undergoing liver transplantation with renal insufficiency has significantly increased in the meld era . The rate of post - transplant chronic renal failure has also increased with a 5-year cumulative incidence that may exceed 20% . Finally, the number of combined liver and kidney transplantations has also increased with declining outcomes, raising the issue of overuse and misuse in combined transplantation . Overall, circulatory changes in cirrhosis necessarily have a deleterious impact on the course of any chronic kidney disease, regardless of the cause and mechanisms . A challenging issue is to determine more accurately the potential for improvement with liver transplantation alone, by reversing hyperkinetic state, in order to better identify those who need a combined liver and kidney transplantation and those who do not . In theory, hrs is a functional disorder that is fully reversible with liver transplantation . However, as discussed above, a number of patients with hrs have intrinsic kidney changes that may not improve after transplantation . Therefore, another issue is to better identify the subgroup of hrs patients who are likely to rapidly develop end - stage renal failure after transplantation . Unfortunately, in patients who have end - stage cirrhosis complicated by hrs and who are not candidates for transplantation, therapies such as terlipressin or albumin dialysis provide only a modest survival benefit . In the majority gfr: glomerular filtration rate; hrs: hepatorenal syndrome; meld: model for end - stage liver disease.
It is estimated that 6~8% of the children, and 4% of the adult have immunoglobulin (ig) e - mediated hypersensitivity to food ag . The prevalence of food allergy has increased rapidly across the world in last few decades . Research in the area of food allergy has advanced rapidly in recent years . However, the etiology and pathogenesis of food allergy are not fully understood . Symptoms of food allergy vary from slightly abdominal discomfort to life - threatening anaphylactic shock reactions . Food allergy reactions involve not only the intestinal tract, but other body systems as well, such as the skin, airway and cardiovascular system . The gastrointestinal tract has been described as the body's largest immunologic organ . A single epithelial layer lines the gastrointestinal tract and receives multiple daily exposures to a variety of proteins from foods and microorganisms . Although antigen in the intestine exposures are complicated and frequent, the result of these exposures is tolerance or development of allergy when proteins do not luminal digested completely . M cells in peyer's patches can take up particulate antigens and deliver them to dendritic cells . Soluble antigens are thought to cross the epithelium through transcellular or paracellular routes directly leading to t cell or macrophage encounters . The timing of initial exposure to a food allergen also likely influences the development of tolerance . Oral antigen dose also seems important in determining which of two distinct effector mechanisms mediates the development of tolerance . In animal models, high doses of antigen lead to lymphocyte anergy or clonal deletion .. haptens are low molecular weight chemicals (usually less than 500 daltons), which are low reactive organic molecules that can bind to proteins and peptides, rendering them allergenic . Allergic reactions to chemical haptens occur, in the overwhelming majority of cases, as an inflammatory skin reaction to direct contact with the hapten . The key feature of food allergy is a th2-predominant allergen - specific immune response, with the production of ige antibodies specific for the food allergen . The t cells of t - helper (th)2 phenotype are known to be involved in the development of allergic disease . Th1 cells release type 1 cytokines such as interferon (ifn)-, while the major cytokines secreted by th2 cells are interleukin (il)-4, il-5, and il-13 . These cytokines play an important role in the production of antigen - specific ige and in mucus secretion, muscle contractility, and eosinophilia . Thus, the activation of th2 cells is a critical step in the immune mechanisms of food allergy . Yet it still remains unclear what are the initial steps of intestinal sensitization in human beings . The hygiene hypothesis postulates that limited exposure to bacterial and viral pathogens during early childhood results in an insufficient stimulation of t helper (th)1 cells, which in turn cannot counterbalance the expansion of th2 cells and results in a predisposition to allergy . While yielded conflicting results also raising the possibility that this model may be something of an over simplification . Immunologic adjuvants are often included in vaccines to stimulate the immune system's response to the target antigens . Cholera toxins, freund's adjuvant, etc are necessary in developing allergic animal models . There is a causal relationship between the increasing environmental pollution and the fast increasing of allergic diseases . The exogenic and endogenic noxious agents contributing to the total environmental load are primarily acting through immunotoxic, sensitizing and neurotoxic mechanisms in animal experiments and in humans . Beside classic allergic - triggering factors, toxic environmental agents (formaldehyde, industrial and traffic smog, wood preservatives, microbial toxins, additive - rich food, nicotine, alcohol, pesticides, solvents, amalgam - heavy metals) are increasingly incriminated as causal factors for the complex symptomatology . Studies showed that the intestinal mucosal barrier permeability is essential to prevent antigen uptake, while there are conflicting results concerning allergic diseases in inflammatory bowel diseases (ibds), some studies suggest an increase of atopic diseases, whereas others have noted no difference from control populations . One explanation for the obviously increase in atopic disease in developed countries over the last 50 years has been the hygiene hypothesis; a reduced exposure to pathogenic microorganisms . Hapten exposure via other surfaces such as the skin and airways might also be important in promoting atopic disease . The hapten - atopy hypothesis was put forward that oral and cutaneous exposure to chemicals generally and to haptens in particular, may have also contributed to the increased prevalence of atopic disease . Consistent with this hypothesis it is apparent that over 40 years, with the huge increase in atopic diseases, there has also been an increase in dietary hapten exposure through processed food, formula milk and oral antibiotic and drug uses . Local lymph node activation and increased total serum ige levels are suggested to be predictive parameters of airway hypersensitivity caused by low molecular weight (lmw) chemicals . Studies showed that increased total serum ige after topical sensitization is associated with immediate - type specific airway reactivity after inhalation challenge in bn rats and thus may be a valuable parameter in testing for respiratory sensitization potential of lmw compounds . Other studies compared rates of atopic dermatitis between patients with allergic contact dermatitis arising out of individual fragrance chemicals with known oral / cutaneous exposure against exclusively cutaneous exposure . Their results showed that patients allergic to individual fragrances with dietary exposure have reduced rates of atopic dermatitis . This may indicate that patients with atopic dermatitis have heightened oral tolerance to dietary haptens, in contrast to the known close association of atopic dermatitis with food - protein allergy . Interactions with foreign proteins / haptens in the gastrointestinal (gi) tract have a tolerogenic influence on interaction elsewhere such as in the skin . So they speculate that hapten exposure through the gi tract in the form of formula milk, antibiotics and food additives, through the skin in the form of skin care products and through respiratory tract in the form of airborne chemicals, will be potential to hamper any epithelial tolerance mechanisms to self - proteins and peptides, which may predispose to atopy / protein allergy while at the same time the haptens may induce self - tolerance . Trinitrobenzene sulfonic acid (tnbs) is a chemical hapten that binds to tissue proteins and is capable of stimulating cell - mediated immunity . As a strong experimental sensitizer, tnbs was used in vitro in induction of allergic contact dermatitis, tnbs is a classical skin contactant which can induce delayed hypersensitivity reactions when applied to the skin because it haptenates body proteins with trinitrophenyl (tnp) groups and renders such self - protein immunogenic to the immune system . While, when tnbs is introduced into the colon of susceptible mice via intra - rectal instillation, it induces t cell - mediated immune response in the colonic mucosa, in this case leading to a massive mucosal inflammation characterized by the dense infiltration of t cells and macrophages throughout the entire wall of the large bowel, tnbs - colitis is regarded as thl t cell - mediated inflammation . Another study showed that intratracheal (it) inoculation of 2,4,6-trinitrobenzene sulfonic acid (tnbs) led to maximal ear swelling 24 hr after challenge on the ear with 2,4,6-trinitrochlorobenzene (tncb) in carrier . The possibility was speculated that the alveolar macrophages in the lung possess a similar capability for antigen presentation of hapten in the induction of allergic contact dermatitis as does the langerhans cell . While it is still not clear whether tnbs as a representative hapten can combine the food proteins and play an important role in the inducing of food allergy, further research is needed to reveal the underlying mechanism . The intact protein antigens absorption into the intestinal tissue is regarded to be a prerequisite in the development of intestinal sensitization . Most food allergens are water soluble glycoproteins with molecular weight from 10 - 75 kd and stable proteins that are resistant to the intestinal digestive effects, and may be absorbed in a relatively intact form to be able to trigger an immune response . Examples are ovalbumin (ova) and milk casein protein . As a model food antigen chemical haptens, in contrast with food proteins, are low molecular weight (usually <500 d) and have the ability to bind with proteins or peptides, rendering them antigenicity . With the increases of atopic diseases, dietary hapten exposure has distinctly increased in different ways, such as processed food, oral antibiotic, formula milk and drug use . Contact dermatitis to chemical haptens may occur when direct contact with the haptens, while there are rarely studies about the reactions to haptens on other epithelial surfaces being reported . Cutaneous hapten exposure may also be important in the development of atopic dermatitis, one possible mechanism by which haptens interfere with protein tolerance is through their known ability to covalently bind to peptides and proteins and thus alter their immunogenic profiles . Thus, this modifications may cause atopic diseases, and most of the data are form experimental studies on contact allergy . If haptens do bind to skin proteins, then it may possibly be expected that these chemicals would also bind similarly to food proteins . It is still unknown about how hapten exposure on different epithelial surfaces such as the intestine, and the role of hapten in the pathogenesis of food allergy . Further experimental studies about the effect of hapten on oral tolerance to food proteins are needed.
Be that as it may, 5% of all cases of syncope are usually of cardiac origins and are thus known as cardiac syncope . Pulmonary embolism is a relatively rare cause of cardiac syncope, which may explain why it is frequently ignored.1 the variability of presentation sets the patient and clinician up for potentially missing the diagnosis . Presentation with abrupt onset of pleuritic chest pain, shortness of breath, and hypoxia is rarely the case . Studies of patients who die unexpectedly of pulmonary embolism reveal that they complained of nagging symptoms often for weeks before death related to pulmonary embolism . Forty percent of these patients had been seen by a physician in the weeks prior to their death.2 when syncope is the presenting symptom of pulmonary embolism, it should raise the clinical suspicion for a massive clot burden or saddle embolism requiring prompt treatment . A 52-year - old man was referred to our hospital because of two episodes of syncope within a fortnight . He had suffered from pleuritic chest pain and dry coughs for the previous two weeks, and antibiotics prescribed for pneumonia by an internist failed to prevent the exacerbation of the symptoms . The internist subsequently referred the patient to a cardiologist, who subjected him to an exercise stress test (to rule out coronary artery disease), during which he developed non - sustained ventricular tachycardia . The following day, he suffered a one - minute syncope while talking a walk in his yard . He was, therefore, once more referred to our hospital by the internist to evaluate ventricular tachycardia as a cause of syncope . When the patient arrived at our hospital, he had anxiety and had a respiratory rate of 30/min, pulse rate of 120/min, and supine blood pressure of 100/60 mmhg . Additionally, the patient s lungs were clear and his heart sound and lower limb were normal . Chest x - ray revealed mild cardiomegaly, dilated right descending pulmonary artery, and oligemia in the right lung (figure 1). On echocardiography, the left ventricle was normal; however, the right heart was dilated and trabeculated and there was also right ventricular dysfunction . The patient denied any history of deep vein thrombosis and mentioned only a six - hour car travel more than three weeks earlier . His family history for venous thromboembolism was weakly positive and one of his nephews had a history of pulmonary thromboembolism . At this point, lung ct angiography was performed to rule out pulmonary embolism as the main cause of acute right ventricular enlargement . The ct angiography demonstrated bilateral pulmonary artery thrombosis from the first division of the right and left pulmonary arteries to the distal ones (figures 2 & 3). With a diagnosis of pulmonary embolism, the patient underwent thrombolytic therapy with recombinant tissue plasminogen activator (r - tpa) 100 mg over a 90-minute period, which brought about immediate improvement in the patient s condition . The following day, his symptoms improved dramatically, his respiratory rate decreased, his o2 saturation rose from 85% to 98%, and his blood pressure remained stable in different positions . Ct angiography showed improved right ventricular function and decreased right ventricular size and pulmonary arteries (figures 4&5). The diagnosis of acute pulmonary embolism is amongst the most challenging problems encountered in clinical practice . Despite the awareness amongst physicians of the risks associated with a delay in the diagnosis of pulmonary embolism, it was not initially considered in this case because of the following reasons: firstly, syncope is an uncommon presentation of pulmonary embolism, occurring in only 14% of patients . The most common symptoms are dyspnea (82%), pleuritic chest pain (49%), and cough (20%).3 secondly, the patient had no history of deep vein thrombosis . The exact number of the symptoms and signs of deep vein thrombosis in patients with a diagnosis of pulmonary embolism is not clear, but one study reported deep vein thrombosis in 62% of patients with pulmonary embolism.4 and thirdly, our patient had severe right ventricular enlargement with severe trabeculations . The occurrence of non - sustained ventricular tachycardia in the exercise test gave rise to other diagnoses, including arrhythmogenic right ventricular dysplasia, which justifies the syncope and right ventricular dilation . Although arrhythmogenic right ventricular dysplasia is more common in younger patients, we considered it as one possible diagnosis because of the patient s having developed non - sustained ventricular tachycardia during the exercise test and his dilated right ventricle with trabeculations.5 the patient experienced three episodes of presyncope in the ccu, but his rhythm during these episodes was sinus bradycardia . We concluded that ventricular tachycardia was not the mechanism of syncope / presyncope and performed ct angiography to confirm pulmonary embolism as the culprit for the syncope . The patient had a weak family history of pulmonary embolism, hinting at the presence of hypercoagulable states such as activated protein c (apc) resistance, factor v leiden, anti thrombin iii deficiency, and protein c and s deficiency . For the evaluation of hypercoagulable states, family history remains the most rapid and cost - effective method of identifying a predisposition to venous thrombosis.6 whereas management with anticoagulants alone is typically sufficient for low - risk patients, more aggressive treatments such as thrombolysis, embolectomy, and inferior vena cava (ivc) filters are recommended for higher - risk patients . Thrombolytic therapy should be considered in all patients with massive pulmonary embolism and hypotension associated with deep vein thrombosis in the popliteal area or higher.7 the main indications for thrombolytic therapy include ongoing hypoxia, respiratory distress, pulmonary hypertension, and right heart failure because thrombolytic therapy often achieves an impressive and almost an immediate clinical benefit in these clinical settings.8 the patient s right ventricular failure and progressive course prompted us to candidate him for thrombolysis . The other option in management would have been embolectomy, which is performed either with a catheter or during open heart surgery . Embolectomy via open surgery is reported to have improved the survival rate to 89% in twenty - nine emergent pulmonary embolism cases.9 although interventional catheter - based catheter fragmentation and suction embolectomy are also available for pulmonary embolectomy in some institutions, open surgical embolectomy is indicated in patients who have contraindications to thrombolytic therapy, persistence of thrombi in the right heart or pulmonary arteries after pulmonary embolism, or severe hemodynamic compromise with cardiovascular collapse . Early surgical treatment must also be considered in patients whose course deteriorates in spite of aggressive medical therapy depending on the series . The overall mortality rate after pulmonary embolectomy varies from 16% to 46%, with a mean mortality rate of 26% . These findings suggest that earlier surgical intervention may result in improved survival.10 we can conclude that surgical embolectomy is warranted in patients with severe hemodynamic instability on the basis of clinical impression, after other causes of hemodynamic collapse have been ruled out . An experimental catheter embolectomy used in cardiac catheterization appears promising.11 ivc filters are an appropriate option for patients with high bleeding risks . The insertion rate of ivc filters has increased in recent years; this increase, however, has occurred without proven improved safety and efficiency.12 another important point in the management of this patient was the optimal duration of anticoagulation . Despite the fact that the patient had a weak family history of hypercoagulable states, a proper course of action required his management as a case of idiopathic venous thromboemboli and with an indefinite duration of oral anticoagulant (warfarin) therapy.13
Underweight and overweight are two spectrums of nutritional disorders that result from under- and over - nutrition, respectively . Due to the experience of nutrition transition in developing countries, while overweight and obesity in childhood as a global crisis have been linked to insulin resistance, type 2 diabetes, hypertension and coronary artery disease in adulthood, underweight in earlier life has been associated with the incidence of infection, hypertension and obesity in adulthood . About 33% of world adult population were obese in 2005 and the projections for 2030 are that about more than 57% of adult population would be affected . In iran, national estimates indicate that almost 16% and 22% of 15 - 35 years old people are overweight and obese, respectively . Published data about under - nutrition and wasting among iranian children and adolescents are scant and updated results are present for underprivileged areas . A nationwide study concluded that 17.3% and 17.7% of iranian school students were underweight and overweight or obese, respectively . Therefore, it seems that iran faces double burden of disease; a phenomenon that has been known in many other developing countries . This is particularly important in deprived districts of the country zabol, a city which is located in sistan va baluchestan province, south eastern of iran . Iranian national anthropometrics nutritional indicators survey in 1988 showed that under - nutrition (stunting (34.5%), under - nutrition (22.5%) and wasting (7.5%) is the major problem of this province . Another study done in 2009 showed that the prevalence of underweight, overweight, and obesity based on centers for disease control (cdc) are 16.2%, 8.6% and 1.5% respectively, in adolescent girls living in this province . These rates were calculated using world health organization (who), first national health and nutrition examination survey (nhanes i), and international obesity task force criteria (iotf), and were similar to those obtained based cdc criteria . This study was, therefore, undertaken to estimate the prevalence of underweight, overweight, and obesity among adolescents in zabol by the use of an age - specific national and three international references (cdc 2000, who 2007 and iotf). In this cross - sectional study, 837 adolescent (483 girls and 354 boys) with the mean age of 13.2 years were selected by the use of a clustered random sampling method from adolescents studying in nine zabol guidance schools . Demographic data about age, parents education and occupation was gathered using a questionnaire filled by participants . Weight was measured by a digital scale (seca, germany) to the nearest 0.1 kg, without shoes and minimum clothes . Height was measured with a non - stretchable tape meter which was located on a vertical wall to the nearest 0.1 cm . Body mass index (bmi) was calculated as weight in kilograms divided by height in meters squared . Underweight, overweight, and obesity were defined based on suggested cut - points by four different criteria . We used cdc 2000, recently published cut - points by who, and iranian national cut - points . Based on these cut - points, underweight was defined as those with bmi <5 percentile, overweight as those with bmi between 85 and 95 percentile and obesity as those with bmi 95 percentile . Underweight, overweight, and obesity were also defined by the use of iotf suggested cut - points for bmi in 2000 and 2007 . Furthermore, mean prevalence of underweight, overweight, and obesity was compared between different criteria using analysis of variance (anova) and difference between each two criteria was examined using bonferroni post hoc test . In this cross - sectional study, 837 adolescent (483 girls and 354 boys) with the mean age of 13.2 years were selected by the use of a clustered random sampling method from adolescents studying in nine zabol guidance schools . Demographic data about age, parents education and occupation was gathered using a questionnaire filled by participants . Weight was measured by a digital scale (seca, germany) to the nearest 0.1 kg, without shoes and minimum clothes . Height was measured with a non - stretchable tape meter which was located on a vertical wall to the nearest 0.1 cm . Body mass index (bmi) was calculated as weight in kilograms divided by height in meters squared . Underweight, overweight, and obesity were defined based on suggested cut - points by four different criteria . We used cdc 2000, recently published cut - points by who, and iranian national cut - points . Based on these cut - points, underweight was defined as those with bmi <5 percentile, overweight as those with bmi between 85 and 95 percentile and obesity as those with bmi 95 percentile . Underweight, overweight, and obesity were also defined by the use of iotf suggested cut - points for bmi in 2000 and 2007 . Demographic differences were searched for by the use of chi - square test . Furthermore, mean prevalence of underweight, overweight, and obesity was compared between different criteria using analysis of variance (anova) and difference between each two criteria was examined using bonferroni post hoc test . Mean age and its standard error of the studied population was 13.14 1.04 year and mean bmi was 18.5 0.13 kg / m . In the whole population, girls were significantly older than boys (p <0.05) while mean bmi was not significantly different among genders (p = 0.9) [table 1]. Overall, fathers were mostly government or self - employed and mothers worked as labor or farmer . Most of fathers in this population had high school diploma or had lower education, and this was true for males too, although this was not true for girls mothers, who were mostly illiterate . General characteristics of zaboli adolescents * prevalence of underweight, overweight, and obesity, separately by sex are indicated in table 2 . The highest prevalence of underweight was seen by the use of national iranian cut - off points (27.2%) followed by iotf cut - off points (25.8%) and their difference was not significant . National criteria indicated that the prevalence of underweight is significantly higher among boys than that in girls (p = 0.03) while this was not true for iotf criteria (national: 31.8% vs. 25.4%; iotf: 23.6% vs. 27.6%). The use of both cdc 2000 and who 2007 cut - offs revealed a significantly lower prevalence compared to national and iotf criteria (about 18%) underweight while the prevalence is not statistically significant among genders (cdc 2000: 18.2% vs. 17.5%; who 2007: 17.4% vs. 19.7%) [table 2]. Prevalence of underweight, overweight and obesity among zaboli adolescents based on different criteria * the use of iotf criteria revealed that over weight is prevalent among 10.8% of adolescents, without any significant difference among genders (9.7% vs. 11.7%) [table 2]. When we used national, cdc 2000 and who 2007 cut - off points, we reached 2.4%, 9.4% and 8.8% prevalence rates of overweight respectively (2.5% vs. 2.3% for national, 8.5% vs. 10% for cdc 2000 and 10% vs. 7.9% for who 2007) and males did not have difference in overweight prevalence with females . Using these criteria, overweight did not differ in prevalence among boys and girls while prevalence rate shown by national cut - offs was statistically different compared to other criteria [table 2]. The highest prevalence of obesity was obtained by the use of who 2007 criteria (7.5% for total population) with a significant difference with other cut - offs . Although, obesity was more prevalent among boys than girls, the difference was not significant (8.5% vs. 6.8%). Obesity was significantly more prevalent in boys than girls based on all other criteria (4.2% vs. 0.6% for iotf, p <001; 5.7% vs. 2.3% for iotf, p = 0.01, and 2.5% vs. 0.6% for national, p = 0.02). Figure 1a presents the age categorized prevalence of underweight, overweight, and obesity based on who cut - offs . As shown the prevalence of underweight was highest among 15 years old (23.1%) while overweight and obesity was mostly prevalent in 11 year adolescents (11.8% and 8.8% respectively). For cdc 2000 cut - offs [figure 1b], underweight, overweight, and obesity had the highest prevalence in 14 year (19.6%), 11 year (17.6) and 14 year (4.1%) adolescents, respectively . Considering iotf cut - offs [figure 1c], highest prevalence of underweight, overweight and obesity was among 15 (33.3%), 11 (17.6%) and 15 year (3.8%) adolescents while for national cut - offs [figure 1d] the prevalence was highest among 11 year (41.2%), 15 year (5.1%) and 15 year (3.8%) adolescents, respectively . Prevalence of underweight, overweight and obesity based on age using world health organization (a) centers for disease control (b) international obesity task force (c) and national (d) criteria our findings indicated that underweight is prevalent among almost 18.4% and 18.7% of zaboli adolescents by the use of cdc 2000 and who 2007 cut - off points, respectively . The prevalence rates reached 25.8% and 27.2% by iotf and iranian national criteria, respectively . The highest prevalence of overweight was obtained by iotf cut - points (10.8%) followed by cdc 2000 criteria (9.4%), while who 2007 and national iranian cut - points resulted in 8.8% and 2.4% respectively . 7.5% of the studied population were found to be obese by who 2007 definition, while this rate was 3.4%, 2.2% and 1.5% by cdc 2000, iotf and national iranian cut - points, respectively . Our analysis also showed that iotf and national criteria reveal significantly higher prevalence of underweight, while national criteria shows a significantly lower rates of overweight, while who 2007 tend to approximate higher rates of obesity compared to other criteria in this sample . Last published report on this region of iran (sistan va baluchistan province), slides back to 2009, by montazerifar et al ., in which they stated that prevalence of underweight is 16.2% and 10.1% based on cdc and who criteria respectively . The prevalence of overweight was reported to be 8.6%, 8.8% and 8.4% using cdc, iotf and who criteria respectively while obesity prevalence was similar based on all mentioned criteria and was reported as 1.5% . In comparison to our results, the prevalence of underweight, overweight, and obesity is increased, and this raise is tangible particularly for underweight . This shows that underweight is still the major nutritional problem in adolescents living in that district of iran, while overweight and obesity are becoming more prevalent too, showing that double burden of malnutrition is becoming a problem and implementing a preventive strategies are necessary . While underweight has its own negative consequences on health and quality of life, overweight, and obesity has long been considered as a predisposing factor that affects individual's health . Yet, the importance of obesity and overweight among children has not been accentuated as much until recently . Overweight children and adolescents are at greater risk of being overweight as adults, and adults who are overweight are at higher risk of numerous health problems including hypertension, coronary heart disease, gallbladder disease, non - insulin dependent diabetes, and some cancers . In iran, an increasing trend in the prevalence of obesity has recently been documented in youth, and adults . Furthermore, it has been reported that the prevalence of metabolic syndrome among iranian children is comparable to those in western societies . A high prevalence of the hypertriglyceridemic waist phenotype among iranian children has also been documented, which could make them to cluster metabolic abnormalities . Therefore, childhood obesity is a major crisis in iran that should be taken into account by health sector to use a preventive approach in this regard . There is a lack of agreement about the definition of overweight and obesity in childhood and adolescence, and the absence of a universal definition has led to inability to monitor the worldwide development of childhood obesity . Distribution - based cut - off values, such as 85 and 95 percentiles of bmi has been proposed and used most often in literature . Who has released the updated cut - off points for percentiles of bmi in 2007 . In may 2000, the iotf childhood obesity working group published standard definitions for overweight and obesity in childhood . These cut - off points were, however, not chosen on the basis of their empirical relation to risk factors; rather, they were derived by identifying age- and sex - specific bmi values corresponding to cut - offs for overweight (bmi = 25) or obesity (bmi = 30) in adults . The results of previous reports from iran and other middle eastern countries, have always been difficult to interpret as they have relied on different definitions and until now there is no report on the prevalence of overweight comparing iranian national cut - points with those of who 2007, cdc 2000 and iotf in children and adolescents; the dorosty et al . Study, however, did compare iranian national reference cut - points with those of iotf but this was done only in children aged 2 - 5 years residing in rural provinces of iran . Therefore, the information provided by this study shed light to some extent on the magnitude of the problem based on different definitions . Our findings reflect the difference in prevalence estimates based on different definitions . In the whole population, estimates of underweight obtained from cdc 2000 cut - points were lower than those obtained by using national or iotf, while no significant difference in the estimates was found between cdc 2000 cut - points and who 2007 cut - offs . Getting back to the prevalence of overweight and obesity, estimates obtained by the use of iranian cut - points were lower than those found by cdc 2000, iotf and who 2007 cut - offs . Other investigators have also showed a discrepancy in estimates based on different criteria in other countries . Showed that prevalence of overweight and obesity are always lower with iotf criteria than the national criteria, even in usa . . Showed that the prevalence of overweight by using iotf cut - points was significantly higher in the 2 - 3 years iranian children than when using iranian cut - points . However, we have no children aged 2 - 3 years in the present study . The recently recommended cut - off points for bmi in iranian children have provided us the opportunity to identify prevalence based on national criteria . Our study gives appropriate data against which estimates from other studies in middle eastern countries and elsewhere can be compared with the same methodology . The double burden of disease we found in the current study is not unique for iranian children . Among turkish adolescent girls, the prevalence of underweight, overweight, and obesity have been reported to be 11.1%, 10.6% and 2.1%, respectively . In a similar study in qatari adolescent girls, the prevalence of underweight among chinese youngsters aged 15 - 20 was has been reported to be 35.9 . Therefore, despite the rising trend of obesity worldwide, problems of malnutrition and nutrient deficiencies still dominate the public health nutrition agenda in our area . First, using a population representative sample of zabol, we found the coexisting high prevalence of underweight and overweight in iranian population of children and adolescents . Second, the lack of definition - based comparative studies from this part of the world makes our study findings interesting . Our participants were selected only from zabol one of the big cities of sistan va baluchistn province, while the situation may be different particularly in rural areas . Studies with bigger sample size which cover both urban and rural areas of this economically deprived province are recommended . This study indicates the coexisting high prevalence of underweight and overweight among guidance - school students of zahedan, iran . Because nutritional patterns and physical activity behaviors develop during childhood, preventive approaches addressing children and adolescents are required to deal with the problem of underweight, overweight, and obesity.
Vitamin d is a fat - soluble vitamin with hormonal functions, and concentrations of serum 25-hydroxyvitamin d (s-25(oh)d) are largely determined by ultraviolet light exposure, dietary intake, and supplementation . However, recent evidence from various research reports has suggested a role in the progression of chronic diseases such as diabetes mellitus and cardiovascular diseases but with inconsistent results [2, 3]. Vitamin d deficiency is an important public health problem worldwide, and although the middle east receives ample sunshine, people living in this region (15 to 36n) have high prevalence of hypovitaminosis d across all age groups [5, 6]. This has been attributed to several factors including limited exposure to sunlight, low dietary intake of vitamin d2, dark skin color, clothing, and religious practices that restrict sunlight exposure [6, 7]. The high prevalence of diabetes and obesity in the united arab emirates (uae) has motivated concern about hypovitaminosis d, since several studies have reported increased vitamin d deficiency in persons with obesity and type 2 diabetes mellitus (t2d) compared to healthy controls [5, 8]. Most studies have focused on vitamin d status and the incidence of diabetes, while few have evaluated the relationships between vitamin d status and various pathophysiological and metabolic parameters in patients with t2d . Although some epidemiological studies have shown s-25(oh)d to be associated with insulin sensitivity and glucose tolerance, the relationships between vitamin d status and metabolic parameters in various ethnic groups are not well known, a situation that leaves ample scope for further investigation into the relationship between vitamin d status and clinical variables in patients with obesity and t2d . Information about vitamin d status in adults in the middle east with obesity and t2d is scarce . Furthermore, the relationship between hypovitaminosis d and different metabolic parameters has not been studied in depth . To our knowledge no studies have been published about the population residing in the uae with obesity and t2d . The present study was designed to determine vitamin d status and search for possible associations between serum vitamin d concentration and metabolic parameters in persons with obesity and t2d in this country . This cross - sectional study was done at rashid center for diabetes and research, a tertiary diabetes care facility in ajman, uae . The uae is situated in the northern hemisphere between 22 and 26.5 north of the equator . A total of 2101 patients registered from december 2010 to december 2013 were reviewed based on the inclusion and exclusion criteria, and 309 men and women were randomly selected for data analysis . The inclusion criteria were uae nationality, age between 30 and 60, diagnosis of t2d, and body mass index (bmi) 30 kg / m . Participants were excluded if they were diagnosed with type 1 diabetes and had a history or evidence of parathyroid or calcium related diseases, history or evidence of endocrine diseases including hyperthyroidism, hypothyroidism, adrenal disease, and pituitary disease, or history of major renal, liver, heart, blood, or neurological disease, as judged by the investigating physicians . All patients gave their written informed consent acknowledging the use of their data for the study as approved by the regional ethics committee of the ministry of health, uae . All patients were examined by a physician at their first visit to the center, and demographic data, medical history, presence of comorbidities, and medications used were recorded as part of standard clinical practice in the health care information system . A standard pretested questionnaire was completed by a subgroup of 154 participants assisted by a study staff member, in order to record information about outdoor exposure to sunlight, use of sunscreens, clothing, skin color (fitzpatrick scale), and intake of food sources rich in dietary vitamin d2 . Anthropometric measurements (height, weight, waist circumference (wc), and body composition) were also recorded . Body weight and height were measured with an electronic balance and stadiometer (seca, hamburg, germany, capacity: max 250 kg, range: 110 cm/43 ins to 200 cm/79 ins) and recorded to the nearest 0.1 kg or 0.1 cm . Body composition was determined by bioelectric impedance with an inbody-230 analyzer (biospace, dogok - dong, south korea). Systolic and diastolic blood pressure were measured in the right arm while the participant was seated and after he or she had rested for at least 10 min . A fasting (12 hours) venous blood sample (8 ml) was collected and used to determine glycemic profile (fasting blood glucose (fbg), hba1c, and c - peptide), cardiometabolic parameters (serum cholesterol, triglycerides (tg), high - density lipoprotein cholesterol (hdl - c), low - density lipoprotein cholesterol (ldl - c), apolipoprotein a (apo a), apolipoprotein b (apo b), c - reactive protein (crp)), markers of calcium homeostasis (serum 25(oh)d, calcium, phosphorus, parathyroid hormone (pth), and alkaline phosphatase (alp)), and serum creatinine . All values were measured with a roche cobas 6000 analyzer (mannheim, germany). Serum 25(oh)d was measured with an immunochemiluminescence method in a diasorin liaison analyzer (saluggia, italy). The analyzing laboratory participated in the vitamin d external quality assessment scheme (deqas). All parameters were measured at the same time or close to the date of s-25(oh)d determination . Vitamin d status was recorded based on serum concentration of 25(oh)d as severely deficient (<25 nmol / l), deficient (<50 nmol / l), insufficient (<75 normal distribution of all the data sets was confirmed by histogram plots, and the results were presented as the mean standard deviation . Pearson's correlation coefficient was calculated to identify bivariate associations between s-25(oh)d and other covariates . Additionally, the participants were classified into subgroups based on gender, medication use, glycemic profile, and fat mass to determine the strength of the relationships of metabolic markers with s-25(oh)d . We also stratified our sample into subgroups based on s-25(oh)d status for comparison with one - way anova, and the bonferroni method was used for post hoc comparisons . To evaluate predictors of 25(oh)d status we used regression analyses with age, bmi, wc, fat mass, ldl - c, total cholesterol, and tg . The criterion for statistical significance (two - tailed tests) was p 0.05 . Table 1 shows the participants' responses to the questionnaire on factors affecting vitamin d status, that is, lifestyle, dietary intake, and vitamin d supplementation . Seventy - nine percent of the participants had a skin score of 4 and 5, that is, brown to dark brown skin characterized by easy tanning . The dietary intake of foods rich in vitamin d2 and vitamin d3 supplementation are also shown . Sixty - eight percent of the participants were on oral antidiabetic drugs only, whereas the rest were on both insulin and oral antidiabetic drugs . Figure 1 illustrates s-25(oh)d status in participants with obesity and t2d and the distribution in men and women of the categories of vitamin d status according to cut - off values . (<50 nmol / l) in 83.2% of the participants, and only 4.5% of them had a normal s-25(oh)d status (> 75 nmol / l) was higher in women than in men (p <0.05). The clinical characteristics of our participants and the associations of s-25(oh)d with different metabolic parameters are shown in table 2 . The mean levels of fbg, hba1c, ldl - c, and crp were higher than the recommended target, and hdl - c levels were lower (ada guidelines). Serum 25(oh)d was positively associated with age and negatively associated with weight, bmi, wc, and fat mass, whereas no association was evident with lean body mass . In addition, s-25(oh)d was positively associated with calcium and inversely related to pth and alp (p <0.01). The lipid profile and apo b level were associated with s-25(oh)d, but no significant association was observed between s-25(oh)d and blood pressure, glycemic profile, crp, creatinine, or apo a. we divided the participants into subgroups based on glycemic control (hba1c <7%, 7% to 9%, and> 9%), gender, duration of diabetes (<5, 5 to 10, 10 to 15,> 15 years), and medication use (oral antidiabetics only versus insulin therapy plus oral antidiabetics) to search for further associations between these variables and vitamin d status . However, there were no significant differences between the quartiles, and no associations were found with glycemic profile (data not shown). The association between s-25(oh)d and hdl - c, ldl - c, total cholesterol, and tg was stronger in males (r = 0.21, 0.36, 0.33, and 0.29, resp .) Than in females (r = 0.12, 0.09, 0.09, and 0.11, resp . ), whereas the association with apo b was stronger in females (r = 0.21 in women versus 0.06 in men). In addition, we found a significant association between s-25(oh)d and ldl - c (r = 0.21), cholesterol (r = 0.22), and tg (r = 0.18) (p <0.01) in the subgroup of patients on oral antidiabetic medication only . Table 3 compares the results for different metabolic variables across three categories of vitamin d status according to cut - off values for s-25(oh)d . There were no significant differences between these subgroups in any of the variables in the glycemic profile . The values for the cardiometabolic variables, that is, ldl - c, cholesterol, tg, apo b, and crp, decreased steadily in subgroup with 25-nmol / l higher s-25(oh)d . As s-25(oh)d status improved, calcium levels increased, whereas pth and alp levels decreased . Linear regression analysis identified pth (= 1.67, p <0.001), calcium (= 45.6, p <0.001), and alp (= 0.21, p <0.001) as factors associated with serum vitamin d status . The main finding in this cross - sectional study is the very high prevalence (83.2%) of vitamin d deficiency (<50 nmol / l), with a mean s-25(oh)d of 33.8 20.3 this was similar to the mean s-25(oh)d value reported for patients in saudi arabia with diabetes and obesity (35.5 30.6 nmol / l, 39.18 18.72 nmol / l) [5, 11]. However, our observed mean was far lower than the value reported for japanese patients with diabetes (42 17.7 nmol / l) and a sample of patients in the usa (57.15 the discrepancy between our results and the findings in other ethnic groups may reflect ethnic differences, lifestyle factors, and differences in the dietary intake of fortified foods . Our results confirm and augment the body of evidence that vitamin d deficiency is alarmingly high among people in the uae with diabetes and obesity . In the present study there was no significant difference in vitamin d status between males and females (35.1 19.2 nmol / l versus 33.3 20.7 nmol / l), a finding consistent with an earlier study of people in saudi arabia with diabetes and obesity . Nevertheless, severe vitamin d deficiency (<25 nmol / l) was more frequent in females than the males (45.6% versus 37.3%). The higher percentage of severe deficiency may be attributable to differences between study populations in lifestyle factors, cultural practices, and fat mass [14, 15]. Vitamin d is a nutrient that is derived from dietary sources, and up to 80% is produced by synthesis in the skin under the influence of ultraviolet - b radiation from sunlight . In the present study the low levels of s-25(oh)d may be a result of restricted exposure to direct sunlight, insufficient vitamin d intake, or both . Forty - two percent of our participants were exposed to direct sunlight for less than 5 min / day, and they often avoided exposure in the afternoons due to high temperatures . About one - fourth (24.2%) wore a sunscreen before going outdoors, and all participants wore their traditional attire (an abaya for females and a kandoora for males) outdoors, which reduced the surface area exposed to direct sunlight . The black clothing (abaya) worn by female participants blocks 100% of ultraviolet - b radiation . Moreover, darker skin produces less vitamin d than lighter shades of skin, and 79% of our participants had brown to dark brown skin . Although the consumption of milk, yoghurt, and cheese was fairly high with 64% consuming these items 1 or 2 times per day, it is not known whether milk sold in the uae is adequately fortified with vitamin d. studies from the usa and canada show that fortified milk did not contain the amount of vitamin d claimed on the label . Our participants consumed considerable amounts of fish but not the oily sea fishes that are rich in vitamin d3 . Hence, we assume that the frequency of consumption of foods rich in vitamin d2 may be insufficient to contribute to the daily recommended dietary allowance of 600 iu / day . Some of our participants also reported consuming cod liver oil (17.6%) and vitamin d supplements (24.2%), but the average dose was 400 iu vitamin d3/day . Our results indicate a positive relationship between s-25(oh)d and age, as supported by similar evidence in the middle east region [5, 6]. This relationship may be partly elicited by multivitamin supplementation in elderly patients in clinical practice, which may have contributed to increased s-25(oh)d in this age group . It is well established that obesity is associated with vitamin d deficiency, and our data confirm previous reports of a negative association between s-25(oh)d and bmi, fat mass, and wc [15, 21]. Low levels of s-25(oh)d have been attributed to sequestration of vitamin d by the adipose tissue, dilution of ingested or cutaneously synthesized vitamin d in the enlarged fat mass, reduced release of vitamin d into the systemic circulation, and low exposure to direct sunlight due to reduced physical activity [15, 24]. Serum levels of 25(oh)d correlated negatively with wc after adjustment for confounders such as bmi, fat mass, and age . As suggested by cheng et al . In 2010, the vitamin d system is known to be altered in persons with obesity, and this may have implications for the development of both obesity itself and its comorbidities . Our study adds to the evidence that serum vitamin d status is not associated with the glycemic profile in emiratis with obesity and t2d . However, the association of serum 25(oh)d with c - peptide (r = 0.17) and homa - ir (r = 0.16) was significant (p <0.01) in the subgroup of participants who were using oral medications, whereas no association was observed with duration of t2d . Previous studies have reported inconclusive results regarding the association between vitamin d status and hba1c [5, 8, 25], and the lack of a clear trend among different studies suggests that ethnicity may have an effect on this relationship . However, a randomized clinical trial to study the effect of vitamin d3 supplementation in patients with t2d found no effect on glycemic profile . Our results confirmed the association between 25(oh)d, pth, and calcium that has been described in the literature . Our findings also indicate that there are a negative relationship between s-25(oh)d and ldl - c, cholesterol, tg, and apo b and a positive relationship with hdl - c . Similar associations with lipid profile parameters were found in 108 patients from iran with t2d . Moreover, vitamin d was inversely related to atherogenic dyslipidemia in some studies but not in others . A review of 22 cross - sectional studies showed a positive association between vitamin d and hdl - c resulting in a favorable ratio of ldl - c (or cholesterol) to hdl - c [2729]. There was also consensus between studies on the negative relationship between vitamin d and tg . Although there is no general agreement among interventional studies regarding the effects of 25(oh)d on lipid levels, it has been suggested that vitamin d can modify the lipid profile via both direct and indirect effects . Vitamin d may decrease serum tg through a regulatory action that increases the activity of lipoprotein lipase in persons with obesity . In vitro studies have found that pth decreases lipolysis (by increasing the level of cystolic calcium) and increases the expression of fatty acid synthesis [32, 33]. Calcium influences lipid levels by interfering with fatty acid absorption via the formation of insoluble calcium fatty complexes in the gut; this results in an increase in the conversion of cholesterol to bile acids . A strong association between s-25(oh)d and apo b was also observed in our study, as in an earlier report in normal adults . The association of s-25(oh)d with cardiometabolic parameters in our study population also appeared to be influenced by other factors such as the duration of diabetes (12.0 7.5 years) and bmi (36.9 6.0 kg / m). Two particular strengths of our study are that we selected a fairly large sample and included individuals who comprised a homogenous emirati population of people with obesity and t2d who share a similar lifestyle . A potential limitation of this study was that the information on dietary intake was obtained from self - reports, which should be considered with due caution . The main finding of this cross - sectional study is the very high prevalence of vitamin d deficiency in our sample of the emirati population with obesity and t2d . Serum concentrations of 25(oh)d were not associated with any particular characteristics of the glycemic profile but were strongly associated with bmi, wc, and fat mass, markers of calcium homeostasis and cardiometabolic parameter . Although our study design was cross - sectional and no inferences should be drawn regarding causality effects, our findings, together with previous research in other settings, suggest that an adequate vitamin d status may help prevent the development of cardiometabolic disease - related processes.
The root of scutellaria baicalensis georgi is a widely popular herbal medicine in asia; its main active constituents are flavonoids include baicalin, wogonoside, baicalein, and wogonin . The flavonoids have been shown to be correlated to circumstance, its content changes between various conditions, even has a very fine daily periodicity oscillation . About 1200 years ago, it was realized that the qualities varied according to producing regions with specific environmental stress as tridax procumbens does . The chinese government promulgated good agriculture practice for chinese crude drugs to control various factors affecting the production quality of medicinal plant materials and further to ensure that traditional chinese medicine herbs are authentic, safe, effective, and consistent in quality . Besides china, many countries have taken a series of standardized measures concerning quality control of the production of raw materials for natural medicines, but all these pay attention to production procedure, not to specific active ingredient relevant to the effect . Research has so far proved that intense light and drought are responsible for the quality of radix scutellariae, but detailed mechanisms remained unclear . The plant cannot search for suitable circumstance by moving and therefore often face various adversities such as intense light, drought which do great harm to the plant . The nature of damage derives from the production of reactive oxygen species (ros). To avoid or alleviate the damage, an exceptional metabolic mechanism, secondary metabolism, was created and hence the environmental stress, ros, and secondary metabolism are intimately connected together . There are many types of ros, the ros first generated is o2 in plant, then it is dismutated to h2o2 by superoxide dismutase (sod). Sodium dithionite (na2s2o4) is a substance which can generates o2, it has the potential to mimic natural biological process and lead to the increased the production of secondary metabolites . The secondary metabolites of plant possess various pharmacological activities, usually are basic to treating various disease . Thus, it is probable that na2s2o4 be applied to enhance the quality of radix scutellariae . Meng xiangcai, cultivated for 2 years, at the medicinal garden of the heilong university of chinese medicine . It was divided equally into three parts on september 20, 2015, each parts were saturated with na2s2o4 of 0.004, 0.4, and 40 the fresh roots of 10 individual plants were collected separately at the 0~4 day, discarded xylem . 1.0 g sample comprising approximately 0.1 g of every plant was refrigerated at 80 for determination of h2o2 . Similarly, 1.0 g 3 samples were used for sod, catalase (cat), and polyphenol oxidase (ppo), 0.1 g for phenylalanine ammonia lyase (pal) gene expression . The rest of fresh roots was dried at 55, then pulverized for determination of baicalin, wogonoside, baicalein, and wogonin . H2o2 were determinated with plant h2o2 elisa kit (purchased from shanghai yu ping biotechnology limited company, made in the usa). Sod activity (u), assayed based on the reduction of nitroblue tetrazolium (nbt), was defined as the activity of enzyme that caused 50% of inhibition of nbt reduction . Cat activity, monitoring the decrease of h2o2 at 240 nm for 1 min at 25c, was calculated as the activity of enzyme that caused a reduction in absorbance at 240 nm of 0.01/min . Targeted rnas were extracted with the plant polyphenols polysaccharide kit (abigen corporation, beijing, china). Reverse transcription was performed using the hifi - mmlv cdna first - strand synthesis kit . Real - time polymerase chain reaction (pcr) was carried out to detect gene expression . The reaction system contained 10 l 2 ultra sybr mixture, 0.4 l (10 m forward primer, 0.4 l (10 m) reverse primer, 2 l template, and 6.8 l dh2 o. the program of real - time pcr was as follows: 95c for 10 min, followed by 45 cycles of 95c for 15 s, and 60c for 60 s. abi 7500 applied biosystems (american) was used for real - time pcr, and the 2 method was used for data analysis . 0.25 g of the root power (d <0.1 mm) was put in a 25 ml volumetric flask, then 70% methanol was added to extract the total compounds under ultrasonic condition for 30 min; finally, the supernatant was filtered with a 0.22 m microporous filter for ultra performance liquid chromatography analysis . The trial samples are based on a beh c18 column (2.1 mm 50 mm, 1.7 m). The mobile phases were composed of (a) acetonitrile with 0.1% formic acid (b) h2 o with 0.1% formic acid . The gradient program as initial 25% a for 5~15 min, and 25% a 54% a between 15 and 22 min, then kept 54% a from 22 to 23 min, 54% a 25% a for 23~25 min, and 25% a. the flow rate was set at 1 ml / min, and the column temperature was set at 30c . The detection wavelengths of baicalin, wogonoside, baicalein, and wogonin were 277, 279, 274, and 275 nm, respectively . Meng xiangcai, cultivated for 2 years, at the medicinal garden of the heilong university of chinese medicine . It was divided equally into three parts on september 20, 2015, each parts were saturated with na2s2o4 of 0.004, 0.4, and 40 the fresh roots of 10 individual plants were collected separately at the 0~4 day, discarded xylem . 1.0 g sample comprising approximately 0.1 g of every plant was refrigerated at 80 for determination of h2o2 . Similarly, 1.0 g 3 samples were used for sod, catalase (cat), and polyphenol oxidase (ppo), 0.1 g for phenylalanine ammonia lyase (pal) gene expression . The rest of fresh roots was dried at 55, then pulverized for determination of baicalin, wogonoside, baicalein, and wogonin . H2o2 were determinated with plant h2o2 elisa kit (purchased from shanghai yu ping biotechnology limited company, made in the usa). Sod activity (u), assayed based on the reduction of nitroblue tetrazolium (nbt), was defined as the activity of enzyme that caused 50% of inhibition of nbt reduction . Cat activity, monitoring the decrease of h2o2 at 240 nm for 1 min at 25c, was calculated as the activity of enzyme that caused a reduction in absorbance at 240 nm of 0.01/min . Targeted rnas were extracted with the plant polyphenols polysaccharide kit (abigen corporation, beijing, china). Reverse transcription was performed using the hifi - mmlv cdna first - strand synthesis kit . Real - time polymerase chain reaction (pcr) was carried out to detect gene expression . The reaction system contained 10 l 2 ultra sybr mixture, 0.4 l (10 m forward primer, 0.4 l (10 m) reverse primer, 2 l template, and 6.8 l dh2 o. the program of real - time pcr was as follows: 95c for 10 min, followed by 45 cycles of 95c for 15 s, and 60c for 60 s. abi 7500 applied biosystems (american) was used for real - time pcr, and the 2 method was used for data analysis . 0.25 g of the root power (d <0.1 mm) was put in a 25 ml volumetric flask, then 70% methanol was added to extract the total compounds under ultrasonic condition for 30 min; finally, the supernatant was filtered with a 0.22 m microporous filter for ultra performance liquid chromatography analysis . The trial samples are based on a beh c18 column (2.1 mm 50 mm, 1.7 m). The mobile phases were composed of (a) acetonitrile with 0.1% formic acid (b) h2 o with 0.1% formic acid . The gradient program as initial 25% a for 5~15 min, and 25% a 54% a between 15 and 22 min, then kept 54% a from 22 to 23 min, 54% a 25% a for 23~25 min, and 25% a. the flow rate was set at 1 ml / min, and the column temperature was set at 30c . The detection wavelengths of baicalin, wogonoside, baicalein, and wogonin were 277, 279, 274, and 275 nm, respectively . S. baicalensis were treated with 0.004, 0.4, and 40 mol / l of na2s2o4, h2o2 contents in roots reduced by approximately 50% at the 1 day, from 21 to 11 mol / ng, then gradually increased . H2o2 contents reduced by approximately 50% at the 1 day after treated, then gradually increased, indicating that redundant reactive oxygen species may be swiftly eliminated by either antioxidases or flavonoids sod activities changed little for the 0.0040.4 mol / l of na2s2o4, slightly increased for the 40 mol / l . All cat activities were raised at the 1 day, then gradually decreased, which exhibited a tendency to be running counter to the h2o2 [figure 2]. Superoxide dismutase activities changed little for the 0.0040.4 mol / l, slightly for the 40 mol / l . The application of na2s2o4 increased pal gene expression slightly for the 0.004 mol / l, remarkably for the 0.4 and the 40 mol / l, furthermore last a long time [figure 3]. The application of sodium dithionite increased phenylalanine ammonia lyase gene expression slightly for the 0.004 mol / l, remarkably for the 0.4 and the 40 mol / l, and led to enhanced biosynthesis of flavonoids the effects of na2s2o4 on flavonoids may be classified into two sets: flavone glycosides and aglucones . The glycosides changed little at different stages, but the aglucones were remarkably elevated at the 1 day, then decreased . The baicalein increased from 0.1% to 0.28%, the wogonin from 0.045% to 0.09% [figure 4]. Initially, ppo activities were raised, then, gradually decreased [figure 5]. The glycosides with less activitie changed little at different stages, but the aglucones with more activities were remarkably elevated at the 1 day, then decreased to prevent reactive oxygen species reducing too much activities of polyphenol oxidase in the roots of scutellaria baicalensis . It accords with that of aglucon except for the pal, above all physiological parameters have a tendency to recover its original state . It is easily dismutated to relatively stable and membrane - permeable h2o2 either nonenzymatically or by sod catalyzed the reaction, then h2o2 is converted to innoxious h2 o by cat, guaiacol peroxidase (pod), or ascorbate peroxidase (apx), and by this way, much of severe damage can be relieved . However, contrary to the anticipation, the h2o2 contents decreased by approximately 50% at the 1 day after 0.00440 mol / l na2s2o4 treated, then a gradual increase started [figure 1]. The enzymic components of the antioxidative defense system include sod, cat, and apx and so on . Sod is a major antioxidant enzyme, increased activity of sod is often correlated with increased tolerance of the plant against environmental stresses . There are many antioxidant constituents, such as cat, pod, asa - gsh cycle, and apx, responsible for quenching h2o2 . Among them, cats are unique as they do not require cellular reducing equivalent, have a very fast turnover rate and thus are critical for maintaining the redox balance during the oxidative stress . Therefore, cell damage is subject to inhibition by both sod and cat . At the 1 day after the s. baicalensis plants were treated with na2s2o4, the activities of both sod and cat in roots had grown somewhat [figure 2], which presented the same effects as many stress conditions did . Increased activities of both sod and cat contributed to abating cell damage, which indicated that antioxidases maybe play a role for eliminating ros . Because increase of both sod and cat, especially the sod, change a little, it seems impossible to result in major changes in h2o2 content . Here, we must mention that the least increased sod activities of 0.440 mol / l na2s2o4 may be due to the heavy use of na2s2o4 . Causes damage to biomolecules, whereas at moderate concentration function as the second messenger in intracellular signaling cascades that mediate several responses in plant cells . O2 /h2o2 generated in chloroplast have been proved to be responsible for triggering signaling pathways that ultimately induce changes in gene expression . In this study, the expression of pal, a rate - limited enzyme responsible for the synthesis of flavonoids, was markedly upregulated [figure 3], led to increased production of baicalin, wogonoside, baicalein, and wogonin [figure 4]. Flavonoids play a crucial role in protecting cells from oxidative damage, they not only directly involve in quenching ros, but also chelate transition metal ion fe to reduce fenton reaction . Fenton reaction convert o2 and h2o2 to the most reactive oh and cause great damage to biomolecules, even death . The previous research proved that under the stress, the flavonoids contribute more significantly than the antioxidases . In our study, the pals were highly expressed, the antioxidases slightly increased, flavonoids must be do excellent service in eliminating ros . The baicalin and wogonoside change slightly, but the baicalein and wogonin had great changes, roughly doubled . The fat - soluble analog usually was the greatest effective, it may be related to fact that the fat - solubility can diffuse through aquaporins in the membranes and over larger distances within the cell . Second, the baicalein and wogonin possess two hydroxy groups, with more effective than its counterparts . It has proved that the absorptivity of baicalein is more than 7 times that of the baicalin, the antibacterial activity is 2~5 times as that of the other flavonoids, the activity inhibiting interleukin-1 converting enzyme is 1~3 times as the other related substances . The baicalein, not the other flavone, has been shown to be high level in famous region drug (mean high - quality medicinal materials), even as one of the useful indicators to adopt for the quality control of s. baicalensis . Which reminding us that baicalein plays a crucial role in antioxidation . Third, less aglucon and more glycoside present in cells of s. baicalensis, once the environmental stresses befall, the conversion of less active glycoside into more active aglucon immediately ensue . Moreover, the biosynthesis of aglucon precedes glycoside, it is necessary to keep aglucon high level under stress from na2s2o4 . In a natural state, more flavonoid glycosides and less aglycones exist in normal cell, even considered baicalin as a state baicalein stored . Therefore, aglycones are the most major physiological parameters to assess the quality of radix scutellariae . With increased antioxidase activities and flavonoids, redundant ros were gradually eliminated, followed by a surplus of flavonoids which, in turn, would make ros keep too low and disrupt the cellular homeostasis in such a condition . Along with increased flavonoids, the activities of ppo also were gradually raised to eliminate redundant baicalein and wogonin [figure 5], therefore, the baicalein and wogonin begin to decline after the 1 day . It is easily dismutated to relatively stable and membrane - permeable h2o2 either nonenzymatically or by sod catalyzed the reaction, then h2o2 is converted to innoxious h2 o by cat, guaiacol peroxidase (pod), or ascorbate peroxidase (apx), and by this way, much of severe damage can be relieved . However, contrary to the anticipation, the h2o2 contents decreased by approximately 50% at the 1 day after 0.00440 mol / l na2s2o4 treated, then a gradual increase started [figure 1]. The enzymic components of the antioxidative defense system include sod, cat, and apx and so on . Sod is a major antioxidant enzyme, increased activity of sod is often correlated with increased tolerance of the plant against environmental stresses . There are many antioxidant constituents, such as cat, pod, asa - gsh cycle, and apx, responsible for quenching h2o2 . Among them, cats are unique as they do not require cellular reducing equivalent, have a very fast turnover rate and thus are critical for maintaining the redox balance during the oxidative stress . Therefore, cell damage is subject to inhibition by both sod and cat . At the 1 day after the s. baicalensis plants were treated with na2s2o4, the activities of both sod and cat in roots had grown somewhat [figure 2], which presented the same effects as many stress conditions did . Increased activities of both sod and cat contributed to abating cell damage, which indicated that antioxidases maybe play a role for eliminating ros . Because increase of both sod and cat, especially the sod, change a little, it seems impossible to result in major changes in h2o2 content . Here, we must mention that the least increased sod activities of 0.440 mol / l na2s2o4 may be due to the heavy use of na2s2o4 . Causes damage to biomolecules, whereas at moderate concentration function as the second messenger in intracellular signaling cascades that mediate several responses in plant cells . O2 /h2o2 generated in chloroplast have been proved to be responsible for triggering signaling pathways that ultimately induce changes in gene expression . In this study, the expression of pal, a rate - limited enzyme responsible for the synthesis of flavonoids, was markedly upregulated [figure 3], led to increased production of baicalin, wogonoside, baicalein, and wogonin [figure 4]. Flavonoids play a crucial role in protecting cells from oxidative damage, they not only directly involve in quenching ros, but also chelate transition metal ion fe to reduce fenton reaction . Fenton reaction convert o2 and h2o2 to the most reactive oh and cause great damage to biomolecules, even death . The previous research proved that under the stress, the flavonoids contribute more significantly than the antioxidases . In our study, the pals were highly expressed, the antioxidases slightly increased, flavonoids must be do excellent service in eliminating ros . The baicalin and wogonoside change slightly, but the baicalein and wogonin had great changes, roughly doubled . The fat - soluble analog usually was the greatest effective, it may be related to fact that the fat - solubility can diffuse through aquaporins in the membranes and over larger distances within the cell . Second, the baicalein and wogonin possess two hydroxy groups, with more effective than its counterparts . It has proved that the absorptivity of baicalein is more than 7 times that of the baicalin, the antibacterial activity is 2~5 times as that of the other flavonoids, the activity inhibiting interleukin-1 converting enzyme is 1~3 times as the other related substances . The baicalein, not the other flavone, has been shown to be high level in famous region drug (mean high - quality medicinal materials), even as one of the useful indicators to adopt for the quality control of s. baicalensis . Which reminding us that baicalein plays a crucial role in antioxidation . Third, less aglucon and more glycoside present in cells of s. baicalensis, once the environmental stresses befall, the conversion of less active glycoside into more active aglucon immediately ensue . Moreover, the biosynthesis of aglucon precedes glycoside, it is necessary to keep aglucon high level under stress from na2s2o4 . In a natural state, more flavonoid glycosides and less aglycones exist in normal cell, even considered baicalin as a state baicalein stored . Therefore, aglycones are the most major physiological parameters to assess the quality of radix scutellariae . With increased antioxidase activities and flavonoids, redundant ros were gradually eliminated, followed by a surplus of flavonoids which, in turn, would make ros keep too low and disrupt the cellular homeostasis in such a condition . Along with increased flavonoids, the activities of ppo also were gradually raised to eliminate redundant baicalein and wogonin [figure 5], therefore, the baicalein and wogonin begin to decline after the 1 day . Na2s2o4 can act as an unfavorable factor to generate o2, which is then converted into h2o2, oh, and other ros . Based on this theory, organisms treated with na2s2o4 can be used as basic models for studying environment stress . Furthermore, na2s2o4 has strong reducing ability, easily transforms into noxious nahso4, and it is widely applied as the dechlorination agents in tap water, beer bottle disinfectant, bleaching agent, and food leavening agent . The application of na2s2o4 to s. baicalensis is also reasonable and practicable to enhance the quality of radix scutellariae.
Degenerative disease of the lumbar spine is often caused by compression of neural elements, which results in radicular pain and neurogenic claudication, weakness, numbness / tingling, and pain in the lower back / buttocks . Decompression of the spinal canal (dsc) is a common surgical procedure employed for various diseases of the lumbar spine, such as lumbar disc herniation (ldh), spinal stenosis (ss), and lumbar spondylolisthesis to alleviate intraspinal compression and subsequently relieve symptoms of nerve compression . However, dsc often involves the internal vertebral venous plexuses, as well as soft tissue in vertebral / paravertebral regions, and can cause massive blood loss from surgical wounds . Thus, the use of continuous negative pressure drainage (cnpd) after surgery has become routine to prevent nerve compression caused by hematomas in surgical incisions as well as to reduce the incidence of postoperative bacterial infection . It has been reported that cnpd after dsc and internal fixation can lead to tremendous blood loss and subsequent postoperative hemorrhagic anemia . In recent years, several surgeons have suggested that placement of a drainage tube in wounds weakens the hemostasis of the tamponade effect in closed cavities, which increases postoperative blood loss . The aim of this study was to determine whether improved intermittent clamping of a drainage tube helps to reduce the drainage amount and avoid complications after dsc and internal fixation . This was a randomized, unblinded, prospective study, which was approved by the local medical ethics committee . A total of 156 patients with degenerative spinal disease who underwent dsc and internal fixation for the first time were enrolled from january 2012 to december 2014 . All patients received same surgical procedure with single- or two - segment total laminectomy and posterior lumbar interbody fusion . A random number list was generated by computer and offered to every patient, patients who met inclusion criteria were randomly divided into intermittent - clamped drainage (icd) group and cnpd group according to the odevity of hospital admission order by another researcher: an icd group (n = 78), which included patients who received improved icd, and a cnpd group (n = 78), which included patients who received cnpd . The drain tube was placed under the deep fascia at the end of surgery in all patients within 10 min after the commencement of wound closure . These surgeries were performed by the same group of surgeons according to the standard practice at the china - japan friendship hospital . The mean patient age was 55.8 years (range, 4270 years) with a mean disease history of 10.9 months (range, 312 months). Demographic and clinical data of the patients all data were expressed as mean sd or n. icd: intermittent - clamped drainage; cnpd: continuous negative pressure drainage; ds: lumbar degeneration spondylolisthesis; ldh: lumbar disc herniation; ss: spinal stenosis; sd: standard deviation; bmi: body mass index . Patients were included in the study if they met the following criteria: ldh, ss, or lumbar degeneration spondylolisthesis (ds) of the lumbar spine who underwent dsc of single or two segments involving internal fixation using lumbar pedicle screws, placement of a silicon drainage tube (diameter, 5 mm) into the wound, and no complications related to drainage . Patients with preoperative use of anticoagulants; intraoperative injury to the dura and nerve, postoperative leakage of cerebrospinal fluid (csf), severe abnormalities in liver function, and abnormalities in coagulation (i.e., prothrombin time, prothrombin ratio, and activated partial thromboplastin time) were excluded from the study . We used a visualized and convenient method to estimate pressure in the drainage cavity in the icd group . The density (g / m) and pressure (centimeters of water, cmh2o) of fluid in the drainage cavity drainage fluid (1 ml) was collected and weighed to determine the density according to the following formula: = m / v, where denotes density, m is the fluid mass, and v is the fluid volume . Pressure in the drainage cavity was estimated with the patients in the supine position using a ruler at the same vertical level as the drainage cavity (0 cm). Then, the medical staff would raise the drainage tube to the 35 cm mark to observe and record the level of the drainage fluid [figure 1]. Pressure was calculated using the following liquid pressure formula: p = g h, where p is liquid pressure, g is the gravity at the surface of the overlaying material, is the density of the liquid, and h is the height of the liquid column . Pressure in the drainage cavity could be represented by the level of drainage fluid . In the icd group, if deterioration of neural function (e.g., hypesthesia, weakening of ankle activity) was absent and pressure in the drainage cavity was <35 cmh2o, the drainage tube was clamped for the first 6 h. at each postoperative time point (i.e., 6 h, 12 h, 24 h, 48 h, and 72 h), the tube was opened for 10 min or upon reaching a drainage amount of 1020 ml . If pressure in the drainage cavity was <35 cmh2o, the drainage tube was clamped . In the cnpd group, the drainage was removed in both groups if drainage amount in 24 h was <50 ml . Data collection was then conducted by medical staff who were blinded for the study purposes . Drainage amount at each postoperative time point (i.e., 6 h, 24 h, 48 h, and 72 h) and total drainage amounts as well as the color and characteristics of the drainage in both groups were recorded . In addition, the hemoglobin (hb) level was measured in 24 h and 48 h postoperatively . If deterioration of neural function was observed, computed tomography (ct) and magnetic resonance imaging (mri) of the lumbar region were performed . And all statistical analyses were performed using spss software (ibm - spss, inc ., student's t - test was performed to compare the following variables: patient age, body mass index (bmi) index, operating room time, estimated blood loss, baseline and postoperative hb, and postoperative temperature . This was a randomized, unblinded, prospective study, which was approved by the local medical ethics committee . A total of 156 patients with degenerative spinal disease who underwent dsc and internal fixation for the first time were enrolled from january 2012 to december 2014 . All patients received same surgical procedure with single- or two - segment total laminectomy and posterior lumbar interbody fusion . A random number list was generated by computer and offered to every patient, patients who met inclusion criteria were randomly divided into intermittent - clamped drainage (icd) group and cnpd group according to the odevity of hospital admission order by another researcher: an icd group (n = 78), which included patients who received improved icd, and a cnpd group (n = 78), which included patients who received cnpd . The drain tube was placed under the deep fascia at the end of surgery in all patients within 10 min after the commencement of wound closure . These surgeries were performed by the same group of surgeons according to the standard practice at the china - japan friendship hospital . The mean patient age was 55.8 years (range, 4270 years) with a mean disease history of 10.9 months (range, 312 months). Demographic and clinical data of the patients all data were expressed as mean sd or n. icd: intermittent - clamped drainage; cnpd: continuous negative pressure drainage; ds: lumbar degeneration spondylolisthesis; ldh: lumbar disc herniation; ss: spinal stenosis; sd: standard deviation; bmi: body mass index . Patients were included in the study if they met the following criteria: ldh, ss, or lumbar degeneration spondylolisthesis (ds) of the lumbar spine who underwent dsc of single or two segments involving internal fixation using lumbar pedicle screws, placement of a silicon drainage tube (diameter, 5 mm) into the wound, and no complications related to drainage . Patients with preoperative use of anticoagulants; intraoperative injury to the dura and nerve, postoperative leakage of cerebrospinal fluid (csf), severe abnormalities in liver function, and abnormalities in coagulation (i.e., prothrombin time, prothrombin ratio, and activated partial thromboplastin time) were excluded from the study . We used a visualized and convenient method to estimate pressure in the drainage cavity in the icd group . The density (g / m) and pressure (centimeters of water, cmh2o) of fluid in the drainage cavity drainage fluid (1 ml) was collected and weighed to determine the density according to the following formula: = m / v, where denotes density, m is the fluid mass, and v is the fluid volume . Pressure in the drainage cavity was estimated with the patients in the supine position using a ruler at the same vertical level as the drainage cavity (0 cm). Then, the medical staff would raise the drainage tube to the 35 cm mark to observe and record the level of the drainage fluid [figure 1]. Pressure was calculated using the following liquid pressure formula: p = g h, where p is liquid pressure, g is the gravity at the surface of the overlaying material, is the density of the liquid, and h is the height of the liquid column . Pressure in the drainage cavity could be represented by the level of drainage fluid . In the icd group, if deterioration of neural function (e.g., hypesthesia, weakening of ankle activity) was absent and pressure in the drainage cavity was <35 cmh2o, the drainage tube was clamped for the first 6 h. at each postoperative time point (i.e., 6 h, 12 h, 24 h, 48 h, and 72 h), the tube was opened for 10 min or upon reaching a drainage amount of 1020 ml . If pressure in the drainage cavity was <35 cmh2o, the drainage tube was clamped . In the cnpd group, the drainage was removed in both groups if drainage amount in 24 h was <50 ml . Data collection was then conducted by medical staff who were blinded for the study purposes . Drainage amount at each postoperative time point (i.e., 6 h, 24 h, 48 h, and 72 h) and total drainage amounts as well as the color and characteristics of the drainage in both groups were recorded . In addition, the hemoglobin (hb) level was measured in 24 h and 48 h postoperatively . If deterioration of neural function was observed, computed tomography (ct) and magnetic resonance imaging (mri) of the lumbar region were performed . And all statistical analyses were performed using spss software (ibm - spss, inc ., student's t - test was performed to compare the following variables: patient age, body mass index (bmi) index, operating room time, estimated blood loss, baseline and postoperative hb, and postoperative temperature . The following demographic parameters did not differ significantly between the icd and cnpd groups: age, gender, bmi index, operating room time, estimated blood loss, and baseline hb level [table 2]. The cnpd group had significantly lower levels of hb than those in the icd group after surgery (p = 0.04) [table 2]. The temperature in the first 24 h after surgery was higher in the icd group as compared to the cnpd group, but there was no significant difference (p = 0.20), and it resolved by the next 24 h following surgery . Observation parameters of intermittent - clamped drainage group and continuous negative pressure drainage group all data were expressed as mean sd . Icd: intermittent - clamped drainage; cnpd: continuous negative pressure drainage; sd: standard deviation . The mean pressure in the drainage cavity and drainage density were 34.5 2.9 cmh2o and 1.1 0.1 g / m, respectively . The drainage amount was significantly greater in the cnpd group as compared to the icd group in 6 h to 48 h (p <0.01). Especially in the first 24 h, the mean drainage amount in the icd group was significantly less than those in cnpd group (p <0.01). However, there was no significant difference between the two groups after 48 h (p = 0.34). The mean total drainage amount (in ml) of the one- and two - segment procedures was significantly greater in the cnpd group than the icd group (272.1 55.2 and 363.2 62.3 vs. 95.6 32.1 and 112.2 33.2, respectively, p <0.01). Drainage amount of 66 cases (84.6%) in the icd group was significantly reduced at 24 h after surgery . Moreover, the duration of drainage in these patients was 2448 h after the surgery . On the other hand, drainage amount in cnpd group was reduced significantly at 4872 h after the surgery . Postoperative drainage amount (ml) at different time points all data were expressed as mean sd . Icd: intermittent - clamped drainage; cnpd: continuous negative pressure drainage; sd: standard deviation . During the drainage period, all patients received ultrasound examination of the drainage cavity which revealed that small hematoma and hydrops were found but did not result in neurologic deterioration . However, neural function deteriorated in five patients (two in the icd group and three in the cnpd group), but this deterioration was not related to postoperative drainage . Results of emergency ct and mri of the lumbar spine in these patients showed compression without obvious hematoma formation requiring drainage in three patients due to abnormal positioning of pedicle screws . Two of these patients underwent exploratory surgery within 12 h of primary surgery to adjust the pedicle screws, which resulted in marked improvement . Recovery of nerve function was observed in the rest of the three patients after treatment for dehydration and trophic nerves . The average follow - up period was 13 months; eight patients were lost to follow - up for no identifiable reason . The follow - up of these cases shows that wound infection or nerve compression caused by hematoma was not found . Cnpd is routinely used to prevent postoperative complications, such as epidural hematoma and associated neurologic compromise, following lower lumbar spine surgery . However, several orthopedic surgeons have recently suggested that placement of a drainage tube compromises hemostasis of the tamponade effect in closed cavities because cnpd cannot entirely circumvent hematoma formation . Some researchers have reported that cnpd promotes infection and even sometimes provokes a surgical site infection . Furthermore, it has been reported that 37% of blood loss occurs within 2 h and 55% occurs within 4 h after total knee arthroplasty . Thus, some authors have suggested that application of short - term clamped drainage in the early postoperative stage could reduce blood loss through the tamponade effect . This theory is also applicable to postoperative management after internal fixation of the lower lumbar spine . Irrespective of how long cnpd was employed, bone defect and bone cavities caused by the internal fixation frame could not be filled, and cnpd only led to further blood loss primarily from the venous plexuses and capillaries after dsc and internal fixation . According to pascal's law, pressure exerted anywhere in a confined incompressible fluid is transmitted equally in all directions throughout the fluid such that the pressure variations (initial differences) remain the same . Similarly, the drainage cavity becomes confined with the use of a clamped drainage tube so that the drainage fluid has the same pressure as the surrounding soft tissues and blood vessels . It has been reported that the pressure of the venous plexus ranges from 10 to 22 cmh2o and capillary pressure is about 34 cmh2o . In our study, the pressure in the drainage cavity was about 34.5 2.9 cmh2o, through observation of the fluid level in the elevated drainage tube, which is easy to operate with direct reading compared to using central venous pressure measuring device . Hence, blood in the drainage cavity could reach the same level of pressure as bleeding venous plexuses and capillaries [figure 2], resulting in cessation of blood loss . On the contrary, therefore, the pressure of the drained fluid is much less than that of the venous plexus and capillaries, which could result in increased blood loss [figure 3]. The results of our study are compatible with this point by comparing the drainage amount between the two groups, especially in the icd group the mean drainage amount in the first 24 h was significantly less than the amount of blood loss using cnpd . We also compared statistics between the two groups in the mean total drainage amount of the single- and two - segment procedures, and these results were positive . Therefore, clamped drainage can lead to raised pressure in drainage cavity, contributing to hemostatic effect, which is similar to tamponade effect by using clamped drainage after total knee arthroplasty . However, it remains uncertain whether clamped drainage could cause compression of the spinal cord and nerve, especially compression of the cauda equina . Fortunately, these consequences or other postoperative complications were not observed in the two groups, which suggest that the spinal cord in lower lumbar canal and cauda equina may be able to withstand the pressure from drainage fluid in these patients . However, long - term surgical procedure could cause more local tissue injury and bleeding, we did not know whether similar results can be obtained in long - term surgical procedure and these still need further study . P1: pressure within the injured venule; p2: pressure of the drainage fluid . P1: pressure within the injured venule; p2: pressure of the drainage fluid . At present, there is no consensus on an optimal duration of clamped drainage, as some researchers believe that a longer clamping period is associated with an increased risk of postoperative complications, such as delayed wound healing, skin edge necrosis, hematoma, and infection . Moreover, drainage fluid in closed cavity is a potential risk factor, which may provide the circumstance for bacterial colonization . It was reported that the use of drainage tubes for more than 24 h may increase the risk of infection, and the infection rates range from 0.7% to 11.9% after lumbar surgery . In our study, not only the duration of drainage in both groups of patients was more than 24 h, but also the drainage needed clamping or opening by manual operating, so these may increase the incidence of infection . However, there was no statistically significant difference in postoperative temperature between the two groups in the present study [table 2], and wound swelling and purulent exudate were not observed . Moreover, when drainage was opened in the icd group, the off - clamped procedure was operating out of drainage cavity and the tube was natural flatted, so liquid back could not happen . Our drainage method also plays a role of safety valve to monitor pressure in drainage cavity . Active bleeding could destroy the balance of pressure in drainage cavity which is mainly because of injury of the arterioles . At this time, drainage fluid would be over 35 cm mark and drained out due to gravity and siphon principle, which lead to reduced pressure in drainage cavity to avoid nerve and soft tissue compression . Besides, the nerve function symptoms in the lower limbs was carefully observed in the icd group . The color of the drainage fluid was also monitored, if the color change to clear that indicated cerebrospinal fluid (csf) leakage . In the cnpd group, the prevalence of csf leakage after surgery of the lower lumbar spine has been reported to be 2.319.37%, which may be due to placement of a drainage tube . In particular, cnpd can lead to clot absorption and negative pressure in the vicinity of arachnoidal wounds, which accelerates csf leakage and adversely affects arachnoidal wound repair . Therefore, postoperative treatment and nursing should focus on the prevention of headaches due to low intracranial pressure, impaired wound healing, infection, and other complications associated with csf leakage . Although it was a prospective design, the operators were not blinded to the type of surgery . This study was unable to compare the different types of lumbar spinal canal decompression and lumbar interbody fusion . Moreover, mri was used for observing the postoperative hematoma, but its three - dimensional volume was not measured . This study focused on comparing efficacy between the two - drainage method in controlling blood loss and complications, so it did not include functional scoring systems or patient satisfaction . In conclusion, the present study showed that improved intermittent clamping of the drainage tube after lower lumbar internal fixation can significantly reduce blood loss and did not lead to obvious deterioration of neural function caused by compression of hematomas, wound infection, or other complications . Hence, improved intermittent clamping is an effective, convenient, and safe method for routine use in lower lumbar surgery . It is essential to focus on the effect of clamping drainage with long - segment surgical procedure and complex lumbar disease in the further investigation, as well as the effect of clamping on long - term functional outcomes and patient satisfaction . This work was supported by a grant from the china - japan friendship hospital project foundation (no . This work was supported by a grant from the china - japan friendship hospital project foundation (no.
The core symptoms of adhd are inattention, hyperactivity, and impulsivity . In most descriptions of adhd in the 1980s and the early 1990s, it seemed that hyperactivity had to be present in every case as a striking symptom, but with growing knowledge of adhd it became evident that not all patients - in particular girls - present hyperactivity . Since 1994, with the fourth edition of the diagnostic and statistical manual of mental disorders (dsm iv) three types of adhd have been differentiated: combined type (6 or more symptoms of hyperactivity / impulsivity as well as of inattention); inattentive type (6 or more symptoms of inattention); hyperactive / impulsive type (6 or more symptoms of hyperactivity / impulsivity). After puberty, hyperactivity often changes to inactivity; therefore, adhd often is not accepted as a diagnosis in adults . Adults with adhd seem to have a problem with willpower: activity can be overexerted, but if a task is not attractive to the person, this results in a lack of effort . Or, inattention can change to hyperfocussing, when the person is attracted by a task . With adults, differing patterns of comorbidity and symptom heterogeneity pose new conceptual, diagnostic, and treatment challenges . While core symptoms are often overt problems in children, in adults subtler executive dysfunction appears . Even though the growing consensus is that adhd is a disorder of executive functions (ef), the details of the ef / adhd connection remain unclear and may be far more complex in adults . In table i examples are given for the changes of the 18 dsm - iv symptoms from childhood to adulthood . The 6-question adult self - report scale -v1.1 (asrs - v 1.1) screener (http://www.hcp.med.harvard.edu/ncs/fpdir/adhd) is a subset of the who's 18-question adult self- report scale - v1.1 (asrs - v1.1) symptom checklist . Four or more checkmarks in the darkly shaded areas may indicate that the symptoms are consistent with adult adhd (figure 1). Wender developed a set of characteristics to specify both childhood criteria and current adhd symptoms . He pointed out affective lability, which is not mentioned in dsm - iv, as a frequent symptom in adult adhd . The prevalence of adhd in children according to dsm - iv criteria varies from 2.4% to 19.8% . The largest follow - up study, which investigated 197 chinese children after 15 years, showed a rate of persistence of 70%: generally, the degree of prevalence (1% to 6% in adults) depends on the view of the reporter in the initial assessment . Most instruments consist of some form of self - report, and in adulthood it is often not possible to ask information of parents or persons with a close relationship to the patient . Patients with adhd are often not aware of their symptoms, or do not report the severity of symptoms . Neurochemical, neurophysiological, and radiological attributes were noted, proving, in particular, abnormalities in the dopaminergic and noradrenergic system . Genetic investigations showed increased evidence that genetic components were present in most cases of adhd, which is now seen as the psychiatric disease with the highest heritability . Neuroimaging studies with magnetic resonance imaging (mri), photon - emission tomography (pet), and single photon - emission computed tomography (spect) suggest involvement of striatal structures in adhd . Molecular genetic studies described an involvement of a polymorphism of the dopamine transporter (dat) 1 gene in adhd (eg, a higher rate of homozygosity of the 10-repeat allele in the 3' untranslated region of exon 15 of the dat gene on chromosome 5p15.3). With regard to the suspected striatal impairment in adhd and the known effect of methylphenidate on the dat mainly localized in this section of the brain, since the end of the 1990s dat has been investigated in patients with adhd . This is carried out by using radioactive marked ligands which are known to bind effectively with the dat system . A group of investigators from boston used altropane marked with iodine-123; our group from munich and philadelphia used the cocaine derivative trodat-1 marked with technetium 99 m . Both studies showed a clearly higher availability of dat in the striatum of adult patients with adhd compared with the normal healthy controls . While dat availability was found to be raised to 17% in the investigations using trodat-1 compared with the control collective (figure 2), the group using altropane demonstrated a rise of 70% in 6 patients; this percentage was reduced to around 30% in a larger group of 19 patients on continuation of the altropane study (spencer t, personal communication). Meanwhile, a rise in dat availability was also detected in the basal ganglia of children with adhd by means of an [i] n-(3-iodopropen-2-yl)-2-carbo - methoxy-3-(4-chlorphenyl) tropane (ipt)-spect investigation, following initial results with n--fluoropropyl-2 -carboxymethoxy-3 -{4-iodophenyl} tropane (fp - cit). Interestingly, a rise in the dat could not, be detected in a spect investigation with -cit26; this could be due to the extremely slow kinetics of -cit (measurement 1 day after application) or another specificity of this radiotracer, which also binds with serotonin transporters and possibly holds other substructures of dat compared with altropane, fp - cit, ipt, or trodat-1 . Our own initial results revealed that the dat was raised not . Only in the hyperactive - impulsive and combined type, but also in the inattentive type of adhd (figure 3). It, may be deduced from a neurochemical view that with an increase in dat, which transports dopamine back from the synaptic cleft, less dopamine is available in the synaptic cleft of dopamine - dependent neurons . The results obtained by our group showed not, only the impairment of dat but also reported for the first, time in vivo and intraindividually in patients with adhd, that impaired metabolism can be improved with methylphenidate: on administration of 5 mg 3 times daily it was seen that there was a clear reduction in dat availability in all patients after a period of 4 weeks (figure 2). With this very low dose, most of these patients demonstrated a lower concentration of dat than did the control group . In a study involving six children with adhd, an ipt - spect investigation confirmed a marked reduction in dat density under administration of methylphenidate . Regarding normal healthy individuals, other authors were able to show evidence of a similar reduction in dat under methylphenidate in a pet investigation with [c - ll] cocaine . In conclusion, the spect investigations on dat confirmed the supposition that with adhd an impairment is present mainly in the dopaminergic system . Our initial results show that, nonresponders to methylphenidate do not reveal raised dat in striatum prior to therapy, whereas the responders seem to have a high dat availability (figure 4). It should be noted, for possible diagnostic applications of spect, that the dat concentration decreases with increase of age and that nicotine may influence dat availability . The lowering of dat with increasing age may be an explanation for our observation, that most, adults need lower doses of methylphenidate compared with children and adolescents . Nicotine seems to have a similar effect on the dat as do stimulants (figure 3). Investigating potential reasons for the lower elevation in the trodat-1 study compared with the altropane study, we found a subgroup of patients with relatively little increase in dat despite severe clinical impairments; further questioning of these patients revealed that all of them were cigarette smokers . Comparison of 11 smoking nonmedicated patients with adhd with sex- and agematched nonsmoking drug - naive adults with adhd showed significantly higher dat density in the nonsmoking patients, despite higher adhd scores for the smokers . This finding suggests that nicotine may act, directly on dat in the same manner as stimulants . In a self - trial, dat availability was reduced by over 50% 5 hours after intake of 20 mg methylphenidate in a slow - release formulation; wearing a nicotine skin patch, equaling 10 to 20 cigarettes daily, for 5 hours . In the same subject 3 months later, an effect similar to that of methylphenidate was seen (figure 5), confirming the view that the lowering of dat after use of nicotine is not a sign of a neurochemical adaptation associated with chronic exposure to nicotine . Further evidence comes from the reevaluation of a woman with adhd, who was smoking 15 cigarettes per day at, the time of first investigation with trodat-1, showing no remarkable elevation of dat; 4 weeks of intake of 3x5 mg methylphenidate led to a marked reduction similar to the other patients in this group . One year later, the patient stopped the nicotine and methylphenidate intake; 2 years after the first investigation she returned with increased complaints of adhd . At this time she underwent another trodat-1 spect scan, presenting with a 19% elevation compared with the first scan with nicotine and a 61% elevation compared with the second scan with nicotine and methylphenidate (figure 6). This finding is in accordance with the opinion that, the effect, of nicotine on dat does not result, in a persistent, loss of dat . In this context, it is of interest that an investigation with [i]-cit spect showed no altered striatal uptake in smokers versus controls, a potential parallel to the above mentioned findings of no dat elevation in adhd with this method . Most patients need multimodal therapy: psychoeducation concerning the special aspects of adhd is essential . Many patients have problems with their self - esteem due to a misunderstanding of the symptoms and a childhood with parents suffering from adhd - especially impulsivity - and they need additional psychotherapy . Treatment with stimulants is the drug therapy of first choice and is approved in the usa for adults (dmethylphenidate and amphetamines); stimulants for adult adhd are as effective as in children . An investigation performed in the year 2000 in germany showed that only 0.024 of the adults registered in the public health system - that is 90% of the adult, population - was treated with methylphenidate in germany at, this time (figure 7). That is about one out of 40 000 and includes all kinds of treatments, including for narcolepsy and other psychiatric diseases . In the treatment, of adults with adhd we start with a daily dose of 5 mg, reaching 15 mg methylphenidate after 14 days of treatment . Titration up to 40 mg follows, if the patient needs more than the initial end point of the 15 mg dose . But more than 70% of our patients did not tolerate doses above 30 mg without having marked side effects . With higher doses, they also described a state resembling the impairments they experienced before the treatment . Most, of them had a good stabilization with a combination of methylphenidate in a dose up to 20 mg and additional antidepressants . With all patients when methylphenidate has no positive effect on depressive or other comorbid symptoms, we start an additional medication after 4 weeks of treatment . Some patients do not tolerate methylphenidate well; they feel more depressed after starting the methylphenidate medication, but they are not as inattentive as before the beginning of therapy; in this situation we change from methylphenidate to amphetamines; some patients have more benefits from this kind of stimulants acting in dual ways . When selecting the additional medication it, is important to regard the comorbid disorder . We experienced good clinical response with the following medication: depression: venlafaxine 18.75 - 150 mg / d depression combined with severe distraction: amisulpride 25 - 100 mg / d ocd: sertraline 50 - 100 mg / d borderline syndrome: venlafaxine 37.5 mg -150 mg / d slight autistic symptoms: fluoxetine 10 - 20 mg / d the use of tricyclic antidepressants is problematic, as the long - term effect is not as good as that of treatment with new antidepressants . This substance does not influence the dopamine in the striatum, but in the prefrontal cortex, where dopamine transport is mediated by norepinephrine transporter.
Esophageal cancer is the 7th most common cancer in iran and it also is among the ten most common cancers in the world . Iran is a well - known region with a high prevalence for this cancer, mostly from the north and north east of the country . In the national report of the registered cancer cases in iran in 2007, esophageal cancer with an incidence rate (asr) of 6.4% stood for the 7th most common cancer . Esophageal cancer is the 7th leading cause of cancer related death in iran and has the 7th highest disability - adjusted life years (dalys) among all cancers in iranian population which had been estimated to be about 15920 years in year 2002 . Its prevalence is increasing as the population is getting old; its highest incidence rate is around the age of 60 - 80 .however, according to a report by yavari and et al . Iran s highest incidence was between the age of 50 and 70 based on their studied population . Its prognosis is usually undesirable and median survival after esophagectomy for patients with localized tumor is 15 - 18 months, and 5-year survival rate is 20 - 25% . The risk of esophageal cancer increases with constant exposure to stimulants, hot beverages, alcohol and smoking . It has a higher incidence rate in society with a low economical state, severe malnutrition, low vitamin, fruit and vegetable intake and also high consumption of alcohol and cigarettes in various studies conducted in china, relative risk of patients with a family history of esophageal cancer was around 2.9% of cases . Its prevention is based on early diagnosis, special attention to modifiable risk factors, particularly tobacco, alcohol and fast food consumption . The symptoms of esophageal cancer usually appear 3 to 4 months prior to diagnosis and such symptoms vary depending on initial involved segment of esophagus . Dysphagia is seen in more than 90% of cases while a weight loss over 5% of body weight occurs in 5% and its presence is associated with a worse prognosis . Less common symptoms such as hoarseness, cough and progressive lesions with invasion to other organs result in symptoms such as hematemesis, hemoptysis, dyspnea and cough secondary to bronchoesophageal and tracheoesophageal fistula . Considering most studies on statistic for epidemiologic indexes in esophageal cancer are implemented in other parts of the world, we aim this study which is to determine epidemiologic index of esophageal cancer patients provides better information on epidemiological characteristic of such cases and also a reliable base for future complementary studies . This is a cross - sectional prospective study based on medical history and other collected data from 238 esophageal cancer patients referred to omid hospital between 2001 and 2010 . No distant metastases, 2 . A karnofski score of 70 and over for the performance status . At the beginning of study, informed consent was obtained from patients for neoadjuvant chemoradiation treatment . The collected data included age, sex, race, occupation, residential location, addiction history, alcohol and smoking habits, dysphagia grading (i, ii, iii, iv, v), weight loss, nausea and vomiting, lack of appetite and paraclinic tests: cbc, liver function tests, sonography or ct scan of abdomen, barium swallow and also anatomic location of tumor, lesion type in endoscopy, lesion length and also type and grade of tumor pathology . Twenty two point three percent of patients were younger than 50 years and 77.7% were older . 63% were fars, 13% were turkmen and 24% were from other ethnic groups . Regarding the occupation, 30% were farmers, 45% were housewives and 25% had other jobs; they came mostly (72.3%) from the rural areas . Twenty percent (33.3% of males and 8.5% of females) had a history of smoking, 22.3% (31.5 of males and 14.6% of females) were addicted and 1.3% of patients had alcohol consumption (table 1). The most common anatomical site was the middle (53.4%), lower (44.5%) and upper (2.1%) segment of esophagus (table 2). Considering clinical signs and symptoms, most patients (93.7%) complained about dysphagia over an average duration of 3.4 months . Also 24%, 53% and 23% of patients had grade i and ii, iii, iv and v dysphagia, respectively (table 3). Amongst patients whom their clinical symptoms were registered completely, 84% had weight loss i.e. 21% (1 - 5 kg), 17% (5 - 10 kg) and 16% more than 10 kg . Nausea was recorded in 39% and vomiting in 27.7% . Before treatment, anemia, leukopenia and thrombocytopenia were detected in 39%, 2.1% and 0.6% of cases, respectively (table 3). Barium swallow results were abnormal in 65.5% and normal in 6.4%; it was not performed in 28.1% of cases . At the beginning of the study, all patients had an abdominal sonography with no metastases . On endoscopy, 51.3% of lesions were polypoid, vegetative and fungoid while in 48.7% were ulcerative, ulcerovegetative and infiltrative . The mean lesion length according to endoscopy and barium swallow was 5.7 cm; the tumor length was less than 5 cm in 52.5% and more in 47.5% (table 2). The most common pathology was squamous cell carcinoma with 99.1% prevalence . According to tumor grading, 34.2% were well differentiated, 51.3% were moderately differentiated and 14.5% were poorly differentiated (table 3). In this prospective cross sectional study, epidemiologic status of esophageal cancer was evaluated in a specific area i.e. The northeast of iran and cases were selected from patients who were referred to omid hospital for undergoing neoadjuvant chemoradiation treatment . The goal and reason for selecting this study group was to ensure that their data are usually precisely registered in the form of a protocol . The reported data in this study included: age, sex, race, location, smoking and addiction history . Prevalent clinical symptoms including dysphagia (and its grade), weight loss, anemia, nausea and vomiting . Many esophageal cancer reports belong to regions of the world where this type of cancer is considered prevalent . The incidence rate in the northern china, iran, and russia and around the caspian sea is 100 per 100,000 populations . The mean age of the patients was 59 years in our study . In recent report from cdc in iran the mean age at the time of diagnosis in u.s . Is 69 years, whereas in our study the mean age was 10 years lower . Considering that these patients were candidates for preoperative chemoradiation protocol; this difference is partially related to bias in patient selection . In another study the mean age of 190 esophageal cancer patients chosen for chemoradiation protocol, was 65 years . The effect of race on the incidence rate has been investigated in several studies . In cumings study which was performed on 1801 esophageal cancer (scc) patients in u.s, the incidence rate was 5 and 1.3 in 100,000 in both white and black population respectively . However, adenocarcinoma had a higher incidence rate amongst the whites (8 vs. 3.3 in 100,000). Despite considerable distance between our center and golestan province, various studies have revealed that residents who are living around the caspian sea are at a greater risk for developing this type of cancer . Possible reasons include a diet deficient in fruits, vegetables and animal proteins as well as dry and thick bread which consists of silica fibers; hot tea, smoking, drugs and burnt opium . Smoking, drug and alcohol consumption are the main factors causing this type of cancer in western countries . However, few studies have shown no significant correlation between such factors and esophageal cancer . In the current study 19.7% of affected cases were smokers and 22.3% were drug abuser . Study in babolsar, a northern city of iran, 19.3% had a positive smoking history but only 7.9% were addicts . Smoking tobacco and drinking of alcohol fortunately in iran due to religious beliefs alcohol consumption is not popular, but smoking and drug abuse are most probably important factors . As reported by heeying kimm and et al . In korean men, alcohol and smoking are indecency associated with increased risk of esophageal cancer but they do not interact synergistically . Considering the characteristics of developed tumors, it should be noted that adenocarcinoma has a very small portion in comparison to scc in esophageal tumors in our country . The incidence rate of adenocarcinoma has increased over the past two decades in western countries and at the moment it is more common than scc, for example only 40% of esophageal cancers in u.s . Are scc . However in some regions of the world with a high incidence rate for this type of cancer, scc is more prevalent than adenocarcinoma . In developed countries where adenocarcinoma has drastically increased, this cancer is associated with reflux and obesity [13, 14]. Amongst our 238 cases, other studies in iran have also confirmed the predominance of scc over adenocarcinoma . According to a study reported by farhoudi et al . 86.3% and 7.3% of cases showed scc and adenocarcinoma respectively . Also considering that the current study was performed on patients who had undergone surgery after chemoradiotherapy, only cases with mediastinal esophagus involvement were investigated . In 53.4% of patients, tumors were localized in the middle third of esophagus and 43.3% in the lower third as described by hajian studies . In farhoudi study in mashhad the lower third was also considered as the most common site . In the current study, the lesion types considered as effective factors of prognosis and they were polipoid, vegetative and fungoid in 51.3% as well as ulcerative, ulcerovegetative and infiltrative in 48.7% of cases . In summary, scc comprised more than 99% of all esophageal cancers in our patients and this was also the prominent type in northeast of iran . In our patients,
Primary cysts have no clear aetiology and tend to arise spontaneously, while secondary cysts result from a known aetiology such as trauma, surgery or medications [1, 2]. Primary iris cysts may arise from either the iris pigment epithelium (ipe) or the iris stroma [2, 3]. In rare instances, an ipe cyst may dislodge and pass from the posterior chamber through the pupil, resulting in a free - floating cyst in the anterior chamber . We describe such a case, where a free - floating iris cyst within the anterior chamber was observed in the setting of recurrent iritis . We also discuss the complications, significance of iritis and management of free - floating iris cysts . A 39-year - old male with a 5-year history of mild recurrent iritis (6 episodes) affecting the right eye was found to have a free - floating iris cyst of approximately 0.5 by 0.8 mm within his right anterior chamber (fig . Mobilisation of the cyst occurred with head tilt but never caused pain or visual compromise (fig . There were small fluctuations in the size of the iris cyst but no gross or rapid enlargement . His past medical history included reactive arthritis, and he tested positive for hla - b27 . There was no past history of ocular surgery or trauma, and no family history of ocular disease . All episodes of mild iritis affected the anterior segment only and were treated effectively with dexamethasone ophthalmic drops for 26 weeks . He did not have keratic precipitates on his corneal endothelium, anterior or posterior synechiae . The differential diagnosis includes iris stromal cyst, iris or ciliary body melanoma, adenoma of the ipe and medulloepithelioma . Ipe cysts have been associated with ocular complications such as angle closure glaucoma, plateau iris syndrome, and secondary pigment dispersion syndrome . However, these complications are uncommon . A case series of 234 patients found that none of the ipe cysts grew larger after a mean follow - up period of 35 months . In particular, no visual or ocular complications were reported in patients with free - floating iris cysts . A study of 62 patients sought to determine current or prior ocular disorders associated with iris cysts [1, 7]. Four patients had a history of iritis; however, ocular inflammation was either mild or in remission in 3 of the 4 patients [1, 7]. Only 1 patient presented with severe iritis and a large iris cyst, which regressed in size upon resolution of the iritis . In another study of 14 patients with iritis, 3 patients showed evidence of new iris cyst formation . This suggests that ocular inflammatory disorders may contribute to the development of iris cysts or cause pre - existing cysts to enlarge . However, the paucity of further evidence means that the full extent of this relationship remains theoretical . In our patient we could not find an association between the small fluctuations in the size of the iris cyst and his episodes of iritis . Asymptomatic non - progressive iris cysts are best left alone, and the indications for surgical removal include significant visual disturbances, rapid increase in cyst size over a short period of time, evidence of recurrent iridocyclitis, corneal endothelial touch by the cyst or secondary glaucoma [3, 5]. The use of neodymium - doped yttrium aluminium garnet laser to collapse the iris cyst has also shown favourable results in symptomatic patients [3, 9, 10]. Our patient remained asymptomatic; thus, surgical removal or laser treatment was not warranted . Few have been implicated in causing visual disturbance or ocular complications, warranting their removal . The paucity of available evidence means that the association between recurrent iritis and the development or progression of free - floating iris cysts remains inconclusive.
An initial search using three different search engines: google (www.google.com), yahoo (www.yahoo.com), and ask jeeves (www.ask.com) for the term thumb sucking habit was performed on 20 march 2014 . It was found that google (www.google.com, mountain view, ca) incorporated the vast majority of the links to websites which the other two search engines produced and, therefore, the search for this investigation was conducted using google . As it is unlikely that patients will investigate beyond the first few pages of a search, the initial 100 links generated by google were considered . Images of all websites in the study were stored for any necessary future analysis . The discern instrument discern is a validated rating tool that can be used by health professionals and the general public to assess the quality of health information contained on the internet . The discern instrument asks 16 questions related to the quality of a medical information website table 1 . Each question is given a score from 1 to 5, with 1 being no, 2 to 4 being partially, and 5 being yes . The last question pertains to the overall quality of the website and is rated 1 (poor) to 5 (good quality). This requires compliance with these eight criteria: authority (give qualifications of authors), complementarity (information to support, not replace), confidentiality (respect the privacy of site users), attribution (cite the sources and dates of medical information), justifiability (ability to back claims), transparency (accessibility, provide valid contact details), financial disclosure (provide details of funding), and advertising (clearly distinguish advertising from editorial content). The hon website was used to confirm the validity of each site presenting an hon seal . Websites were included in the investigation if they provided information pertaining to the thumb sucking habit . Websites that were unrelated to search term or only provided a list of website links were removed . Sponsored links and banner advertisements were excluded as they are normally ignored . For profit websites were excluded: if their only intention was to sell a product, if the site promised quick and unrealistic dramatic results, made claims that one remedy will cure a variety of illnesses through some miraculous breakthrough, or used excessive sensational writing . Journal articles, news, video feeds, academic press, abstracts listings, discussion group, and duplicate sites were also eliminated . Websites were included in the investigation if they provided information pertaining to the thumb sucking habit . Websites that were unrelated to search term or only provided a list of website links were removed . Sponsored links and banner advertisements were excluded as they are normally ignored . For profit websites were excluded: if their only intention was to sell a product, if the site promised quick and unrealistic dramatic results, made claims that one remedy will cure a variety of illnesses through some miraculous breakthrough, or used excessive sensational writing . Journal articles, news, video feeds, academic press, abstracts listings, discussion group, and duplicate sites were also eliminated . Sixty - four of the 100 websites were excluded from the analysis as they did not meet inclusion criteria . Of the remaining 36 websites that were scored, discern indicated the majority of websites fell well below the maximum score . The maximum score achieved by one of the websites according to the discern tool was 55 of 80, and the lowest score achieved was 16 of 80 . The five websites with the highest quality information in relation to thumb sucking was: children.webmd.com: 55healthmantra.com: 54medicinenet.com: 44users.forthnet.gr: 41ivillage.com: 37 . Children.webmd.com: 55 users.forthnet.gr: 41 discern scores for the 36 websites in relation to the hon seal, out of 36 websites only three had hon seal . As of today, there are no standards required for medical information on the internet, taking advantage of this; some websites that appear to be educational are actually promotional in nature while others may be inefficient, incomplete, out of date, difficult to understand, or contain conflicting information . This is the first study investigating the quality of information available on the internet relating to thumb sucking habit, at a single moment in time . We used google as the internet search engine for this investigation after an initial search using yahoo and ask jeeves as well found that there was considerable overlap among the websites that google would find . The other search engines such as bing (www.bing.com) and aol (www.search.aol.com) are also available . Google was selected because is the most popular search engine, examines all aspects of a pages content and the content of the pages linking to it . No one can buy a higher ranking with their software, which makes it an easy way to find high - quality sites . In addition, it may find many pages that are off - line for many other search engines, it updates their index very often by recalculating the page rankings of each of the websites and the fluctuations usually occur toward the end of the month . The results of our study indicated that very few sites achieve high standards according to the discern tool . In fact, none of the websites scored five points in all the 16 questionnaires . The discern project is based at the division of public health and primary care of the institute of health sciences of the university of oxford (united kingdom), and is financed by the british national health service executive research and development program . It has been designed to help users to evaluate the quality of written information on treatment options, and to facilitate the generation of evidence - based data . The discern is a validated and reliable instrument . In our study, the item does it describes how treatment choices can affect quality of life? Yielded a very low score in all the websites, which were assessed, which is in line with lopez - jornet and camacho - alonso . Although discern has been criticized for not analyzing the quality of the information on websites in significant detail . When compared to other tools such as the jama benchmarks, the discern tool has been shown to have good internal consistency and is user - friendly . In this respect, clinical teams can use the discern tool to evaluate websites that patients may suggest to determine if the information they are likely to find is of use for other patients . The discern questionnaire is a valid and reliable instrument for analyzing written consumer health information . It is the first standardized quality index of consumer health information that can be used as a critical appraisal tool to evaluate health information by not only health professionals, but also by patients and the general population . This questionnaire was derived systematically with the input of an expert panel, health information providers and patients from a self - help group . This study found that discern score was highly rated among the initial search results displayed and was same with the hon seal . The health on the net foundation criteria were developed by a swiss - based nonprofit, nongovernmental organization that provides certification of websites based on an ethical standard aimed at offering quality health information . Health on the net is established in 1995 and is one of the first uniform resource locator to guide both lay people and those in the medical profession to reliable sources of healthcare information on the internet . Sites may display the hon code seal if they agree to comply with the standards listed, and they are subjected to random audits for compliance . The external accreditation of quality of health - related websites is not an easy task as it would be an enormous and costly task requiring a large staff with expertise in varying fields to monitor thousands of medical sites . Hon's mission is to guide internet users to reliable, understandable, accessible, and trustworthy sources of medical and health information . Therefore, the internet users do not have a way to identify the quality sites unless; they have a medical background or perform a scientific immersion in the topic . In light of the results of the present study, the internet is a potentially powerful tool for patients to search for health - related information, there are many sources that when encountered, may mislead them about their diagnosis, treatment, and potential outcomes . In the extreme, patients may feel a false empowerment to self - diagnose and treat, leading to disastrous results . Despite these concerns, it is likely that the use of the internet by patients will continue to increase in the future . It is, therefore, important for the patients to exercise caution when relying on the internet for health - related information . Patients should be counseled to avoid commercial websites, except for the most reputable sites and look for the hon code seal of compliance for transparency and accountability . It appears that the principles of clarity and full disclosure of sources are still only practiced by a minority of the websites at this point . It is our hope that by raising awareness of the poor overall quality and content of the internet information, better accountability may be active or, at least, that patients may become best informed that information on the internet is not accurate or up to date . Apart from the quality of health information on the web, patients also find many websites, presenting health information using highly technical language . Scientific presentations may be advantageous for researchers and clinicians; however, this specialized language can be overwhelming and confusing, especially if it is not properly explained . Therefore, it is also imperative to systematically assess the presentation of online health information using readability algorithms to ensure that such information is easily assessable to lay audiences in their native language . Patients seeking thumb sucking habit information on the internet should be encouraged to exercise caution and to utilize only well - known sited and those that display the hon code seal of compliance with transparency and accountability practices . By directing patients to validated websites on the thumb sucking habit
A small percentage of intracranial meningiomas appear to have a malignant potential [13]. These rare histological subtypes characterized as malignant (grade iii) and atypical (grade ii) exhibit aggressive clinical behavior and are less studied than the classic benign (grade i) tumors [2, 4]. Objective of this study was to evaluate the incidence of atypical and malignant meningiomas and estimate their effect on recurrence, morbidity, and mortality . The postoperative behavior of the meningioma was followed and an effort was made to assess whether tumor's location, histopathological subtype, and the extent of surgical resection were predictive factors for recurrence . From 1992 to 2007, thirty - two patients with grade ii or iii meningioma, were treated surgically by the staff of the neurosurgical department of thessaloniki g. papanikolaou hospital . This study is a part of an observational retrospective study that comprised 353 patients with intracranial meningiomas who were operated at our department that period . Hospitalization files, medical charts, and neuroradiological images obtained for the patients with meningioma, were analyzed with respect to clinical, operative, and laboratory pathological data . Postoperative follow - up examinations, carried out by the department's neurosurgeons were also used for this study . The endpoint for recurrence was given by a computerized tomography scan (ct) or magnetic resonance image (mri), showing a meningioma at a location contiguous with the previous surgery . The patients were brought in for follow - up examinations and neuroimaging controls at 3 and 6 months after surgery and then every year . They were evaluated via clinical examination or when that was not possible, by telephone interview . Living patients interviewed by telephone described their symptoms referable to brain tumor . For deceased, relatives supplied information and reported if death had occurred due to the tumor or by unrelated causes . The karnofsky scale was used to evaluate the patients' outcome after the operation . Tumors were divided into types based on world health organization criteria, with grade i subtypes characterized as meningothelial, fibrous, psammomatous, transitional, stroviloid, epithelioid, angiomatous microcytic, secretory, chordoid . Grade ii meningiomas are mentioned as atypical and grade iii as malignant . For evaluating resection, this scale divides the extent of resection into 5 grades: grade i: complete removal;grade ii: complete removal with coagulation of dural attachment; grade iii: complete removal, without coagulation of dural attachment or resection of involved sinus or hyperostotic bone;grade iv: subtotal resection;grade v: decompression biopsy . Grade i: complete removal; grade ii: complete removal with coagulation of dural attachment; grade iii: complete removal, without coagulation of dural attachment or resection of involved sinus or hyperostotic bone; grade iv: subtotal resection; grade v: decompression biopsy . For patients with resection grades iv and v, endpoint for recurrence was enlargement of the remaining tumor, shown on mri or ct . The spss system (version 15.0.1) was used for statistical analysis of the experiment's results data . Meningiomas of histological grading ii and iii accounted for 8.8% of all tumors in our series (table 1). The average patient's age was 49 5 years at the time of surgery and the mean follow - up time was 4.3 years . Follow - up control for patients with nonbenign meningiomas revealed that grade iii meningiomas recurred at a rate of 75% and grade ii meningiomas at a rate of 41.6% (table 1). Survival rates for three, five, and ten years for these subtypes were much lower than the rest of the meningioma patients (table 2). Three - year survival rate was 66.6% for atypical meningiomas, 33.3% for malignant meningiomas, and 86.3% for patients with grade five - year survival rate was 58.3% for atypical and 8.3% for malignant meningiomas, while for benign cases it raised to 74.3% . Finally, ten - year survival rate was 33.3% for atypical and 0% for malignant meningiomas . On the contrary, six patients with malignant meningioma and two with atypical meningioma experienced tumor - related death . Patients with grade ii resection (complete resection with coagulation of the dura) presented recurrence at 49% and grade iii (complete resection of tumor, without coagulation of the dura or removal of affected sinus or bone) patients recurred at a percentage of 67%, while 100% of grade iv and v patients developed tumor enlargement . The extent of surgical tumor removal was significantly associated with recurrence (p <0.001). Atypical and malignant meningiomas appeared to be more complex in resection than grade i tumors . V in the simpson scale, while the rate of nontotal tumor resection for the rest was 23.8% . More commonly, parasagittal (25%), convexity (18%), and tentorium (15%) tumors appeared in our series . Metastases appeared at the parotid gland, the thoracic spinal cord, and a different site of the brain . The majority (72%) of recurrences were observed within two years from surgery and 96% within five years from surgery . According to some studies, malignant meningiomas comprise between 4.7 and 7.2% of meningiomas, whereas atypical meningiomas account for 1.0 to 2.8% [1, 3, 4]. The most known factor associated with their appearance is cranial irradiation [1, 68]. Though meningiomas are considered to be benign tumors, recurrence is observed frequently, with rates that vary between series [4, 8, 9]. The best accepted factor for prediction of recurrence is the 1957 simpson grading system for completeness of resection, which evaluated invasion of the venous sinuses, tumor nodules in adjacent dura, and infiltration of unresected bone by meningothelial cells as chief causes for recurrence . The recurrence rates that simpson refers to were 9% for grade i, 16% for grade ii, 29% for grade iii, 39% for grade iv, and 100% for grade v, respectively . These are peritumoral brain edema [2, 10], increase of neovascularization, cellular pleomorphism, nuclear atypia, the presence of macronuclei, atypical mitoses, necrosis, and brain invasion [8, 12]. In our series, recurrence was observed at a rate of 41.6% for grade ii tumors . For grade iii meningiomas, recurrence rate was 75% . Besides the histological aggressive features we also found that recurrence was significantly associated with resection extent, according to simpson grading system . Tumor location was not significantly related with meningioma reappearance, with the exception of certain locations whereas total resection was impossible . The rate of recurrence diminishes with time from operation . Within 5 years from surgery, 96% of tumor reappearances three patients (37.5%) of the patients with malignant meningiomas developed a metastasis (parotid gland, thoracic spinal cord, and a different site of the brain). This shows that there is a high tendency of these tumors to develop metastases . The role of radiotherapy is well established in the treatment of atypical and malignant meningiomas [1, 1316]. Patients with these types of tumor are sent for radiotherapy postoperatively, if total resection is not possible . This is more frequent at tumor locations with difficult or high - risk access, where the surgeon tends to be less aggressive . Conventional external beam radiation is being used for years and stereotactic radiosurgery is reported for unresectable tumors [3, 17]. In addition to that, lower recurrence rates were observed in patients undergoing immediate postoperative radiation . Another study supports that any tumor remnant radiologically demonstrated on postoperative imaging should be treated with radiosurgery and that postoperative radiotherapy after a first - time resection should be reserved for tumor remnants too large for radiosurgery and for which a second - stage operation is not planned . In our study, five patients with grades ii and iii meningiomas were sent for stereotactic radiotherapy after incomplete tumor resection . Further regression of the tumor was reported (by the treating radiotherapists) in three of them . Another important issue to be cleared is whether meningiomas sometimes progress histopathologically to a higher grade and develop aggressiveness after they are operated . Some series have shown that up to 2% of all benign meningiomas transform into malignant . This is supported by other studies also [3, 7], but other writers reject it . In our series, we had one patient with grade i meningioma which progressed to grade ii according to the histopathological result of the second resection . Atypical and malignant meningiomas appear to be distinct entities with poor prognosis, despite the surgical intervention . Radical tumor excision is the most effective treatment, as it determines the patient outcome, and it should always be applied . In cases of subtotal resection, radiotherapy should be applied, as it seems to delay tumor's reappearance.
Http://www.ebi.ac.uk/ena/data/view/lt699840-lt700186 north america harbors broadly terrestrial saline environments, including the great salt plains district . The gps is one of the most remarkable reservoirs for microbial community with variability of tolerance to saline stress . It is a distinguish area of the salt national wild refuge in the north - central region of oklahoma . The area is featured by a very large salt flat (~ 65 km) of mud flats and sand bars, which covered by a small layer of thasassohaline salt evaporates . The few studies that have investigated the microbial diversity in gps sediments in usa have improved our knowledge on the microbial community,,,,,,, but the comprehensive knowledge of microbial diversity and function in the gsp is still rarely uncovered . There are no studies available on the diversity of bacterial community in gsp using high - throughput dna pyrosequencing technologies and bioinformatics . Therefore, in order to gain new perception into bacterial diversity, and reveal the impact of soil types in shaping the microbial communities in gsp, we investigated the microbial diversity of thirty samples collected from vegetated and salt flat soils during the months of june to december 2009 . This study focuses on the gsp soil samples that were collected from vegetated soils, and salt flat soils that comprise the most habitats in the ecosystem . Samples were collected in triplicate in a sealed sterile containers from the surface (8 cm) and subsurface (15 cm) soils of the gsp . Soil metagenomic dna was recovered using (powersoil dna isolation kit (mobio laboratories, carlsbad, ca). We analyzed the bacterial community by amplifying the v1 and part of v2 regions of bacterial 16s rrna gene using pcr . Pyrosequencing was implemented for 200 cycles on a roche 454 gs - junior sequencing instrument according to the manufacturer's protocol (454 life science, usa). The quality filtration, trimming and chimeric processes for the raw data were performed by mothur software . The clean sequences were analyzed with silve analysis pipeline, then clustered using a 97% similarity cut off into a total of 303,723 paired end reads and 56.4% g + c content for gab (1646 otus), and a total of 144,496 paired end reads and 56.7% g + the final analysis showed that the metagenome sequences were represented by 37 bacterial phyla and candidate divisions (23 common phyla and candidate divisions between gab and gas) (fig . We found less frequency of phyla in the salt flat soils, possibly because of physico - chemical impact of the salinity, and lack of root exudates . The top five represented phyla were proteobacteria being the most dominant phylum in both samples (36.2% in gab and 31.5% in gas respectively), bacteroidetes formed the second abundant one (16.8% in gab and 24.3% in gas respectively), chloroflexi (8.7% in gab and 6% in gas respectively), actinobacteria (8.5% in gab and 5.8% in gas respectively) and firmicutes accounted the less abundant phylum in both samples (6.5% in gab and 6.6% in gas respectively) (fig . However, an unidentified bacterial phyla were detected among the top 13 bacterial phyla in gab (0.54%) and among the top 11 bacterial phyla in gas (2%) (fig . The following groups were found in less abundance: lentisphaerae, chlamydiae, armatimondetes, fibrobacteres, deferribacteres, tenericutes, spirochaetae, elusimicrobia, fusobacteria, wchb1 - 32, tm6, rf3, candidate division od1, candidate division op3, candidate division op11, candidate division sr1, and candidate division ws3 . It is worth mentioning that the operational taxonomic units (otus) richness was higher in the gab samples than in the gas samples, and with only 167 otus shared in both samples . The rare phyla such as npl - upa2, wchb1 - 32, nitrospira, chlamydiae, tm6, tenericutes, elusimicrobia and candidate division op3 exhibited a preference for growth in gab soil samples, whereas phyla; fusobacteria, deinococcus, ta06, candidate divisions op8 and brc1 showed preference for growth in gas (fig . The next generation pyrosequencing evidently revealed the metagenomics of microbiota in the gsp sediments, also can effectively improve our understanding of the microbial composition of the extreme environments, their abundance, diversity and distribution, . However, several metagenome sequences have still remained taxonomically unidentified indicating the existence of a repertoire of unassigned microbes in different habitats of the sediment of gsp . These findings provide molecular evidence of the bacterial community heterogeneity in the gsp, which might be controlled by both subsurface and surface environments . Therefore, the analysis of bacterial community datasets obtained from gsp sediments revealed significant difference between vegetated and salt flat samples . Finally, the bacterial communities in soils of the gsp including gab and gas samples are highly diverse and taxonomically obvious, when reflecting the environmental conditions, soil structures, the influence of rhizosphere on bacterial members' growth and emerging of new or even different lineages.fig . Stratified column charts representing the percentage of frequencies of recovered phyla and candidate divisions from gab and gas samples.b . 2hierarchical clustering heat map generated from taxonomic abundance profile reflecting distribution of bacterial phyla and candidate divisions in the sediments of gab and gas samples of the great salt plains, oklahoma.fig . 2 a. stratified column charts representing the percentage of frequencies of recovered phyla and candidate divisions from gab and gas samples . B. serration visualization of distribution of phyla and candidate divisions between gab and gas samples . Hierarchical clustering heat map generated from taxonomic abundance profile reflecting distribution of bacterial phyla and candidate divisions in the sediments of gab and gas samples of the great salt plains, oklahoma.
Advances in the mechanical properties of resin composites, associated with improvement in adhesive systems, have favored the clinical application of these restorative materials, especially in posterior teeth . In spite of these improvements, the mechanical properties of these materials vary considerably because of the differences in the composition of the organic matrix as well as the type, size, and packing of the inorganic fillers12 . The introduction of new or modified dental products on the market requires the assurance that these materials can be stored for an extended period without any decrease in their performance that may affect safety and efficacy14 . Shelf life is defined as the term or period during which a commodity remains suitable for the intended use9 . On the other hand, expiration date is the termination of shelf life, after which a percentage of the product, i.e., medical devices, may no longer function as originally intended . In order to determine whether a certain product requires a shelf life and assign an expiration date, there are a number of different parameters that must be considered13 . In this way, this product must be analyzed to determine if it is susceptible to degradation that would lead to functional failure and to determine the level of risk that the failure would present9 . Accelerated aging protocols are generally applied to new products to provide experimental data in order to estimate their clinical performance and shelf life claims . In these protocols, products are subjected to stresses that are more severe or more frequently applied than normal environmental or operational stresses for a shorter time14 . Studies on accelerated aging combined with basic stability information on the components (functional chemical groups organized in diverse ways crystalline or amorphous - along with additives such as antioxidants, inorganic fillers, plasticizers, colorants, and processing aids14) may be used to support tentative expiration dates5 . These variations, combined with the different protocols of clinical applications and oral environment, determine the degradation process14 . In a previous study6, it was pointed out that the material condition may affect the propagation stage (second stage of the polymerization reaction attributed to the propagating radical), in which the free radicals react successively with monomers to form a three - dimensional network . Clinicians tend to store the restorative materials at low temperatures, especially the resin composites, in order to " prolong " their shelf life15 . However, these cooled restorative materials are used immediately after being removed from the refrigerator10 . In addition, their manipulative properties are modified, considering that some of the composites are too sticky and tend to flow less at lower temperatures . A consensus that the rheological properties of resin - composites play an important role in terms of restoration longevity exists17 . The viscosity of a resin - composite is directly related to its handling characteristics (placement and shaping on the restored site)19 . In spite of the composite stickiness, manufacturers have modified the composite viscosity, as this manipulative characteristic may allow the formation of macroscopic spaces and microscopic porosities in the restorations23 . Clinically, an unpolymerized resin - composite is applied and exposed while in a varied viscous state and variations in the conversion values can be reached as the rheological properties of composites influence the radical mobility, depending on the viscosity6 . In this way, no objective criteria to support the indication of high viscous composites or " compactable " composites have been provided16 . In addition, the influence of the energy dose as a function of the material condition needs further investigation . As the kinetics of polymerization is dependent upon the energy dose, it could be expected that the longer light exposure time would somehow allow a higher end conversion7, irrespective of the material condition . This study evaluated the mechanical properties (flexural strength and flexural modulus) of different classifications of composites indicated for posterior application as functions of the storage condition (room temperature, aged, oven, refrigerator, and freezer) and the energy dose . The following research hypotheses were tested: (1) the storage temperature can influence the flexural strength of the composites tested; (2) the flexural modulus of the composites stored at different temperatures will be inferior to that observed at room temperature; (3) the energy dose influences the mechanical properties of the composites, irrespective of the storage temperature . In this in vitro study, mechanical characterizations were performed according to the factors: (1) composites, at three levels: filtek p60 (p60), filtek z350xt (xt), and filtek silorane (fs); and (2) material conditions, at five levels: i - control (room temperature - rt, 22c), ii - accelerated aged composites (aa), iii - oven at 37c for 24 h (ov), iv - refrigerator at 2c for 24 h (rf), and v - freezer at -15c for 24 h (fz); (3) energy dose, at two levels: i - 24 j / cm, ii - 48 j / cm . Thirty experimental groups were obtained of the product among the combinations of the factors under study . Bisgma: bisphenol - glycidyl - methacrylate; udma: urethane - dimethacrylate; bisema: bisphenol - a - ethoxy dimethacrylate; tegdma: triethyleneglycol dimethacrylate; pegdma: poly(ethylene glycol) dimethacrylate manufacturer's information (3 m espe, st . Paul, mn, usa) bis-3,4-epoxycyclohexylethylphenyl - methylsilane and 3,4-epoxycyclohexylcyclopolymethylsiloxane note: the brand name filtek silorane is used in other countries as filtek ls and filtek p90 the composites underwent a simplified protocol for accelerated aging (also called the " 10-degree rule ") according to the collision theory based on the arrhenius model . The composite syringes were stored at 37c in an oven for 12 weeks . According to clark5 (1991), the accelerated aging protocol can be calculated by means of a mathematical formula, as follows: r = accelerated aging rate; rt = room temperature (22c); et = elevated temperature (37c); q10 = reaction rate coefficient (2). According to this protocol, for each 10c increase above the room temperature, the reaction rate doubles5 . In this way, as the rt was equivalent to 22c, r corresponds to 2 (37 - 22=15; 15/10=1.5). Thus, the accelerated aging rate was based on the increase of 15c in the storage temperature, which is 1.5 squared (r=1.5=2.83). Finally, in order to estimate the aging time equivalent to that which would occur at room temperature, r was multiplied by the storage time (12x2.83), which represents approximately 9 months of aging . It is important to mention that the same lot numbers were used for the material condition levels of " room temperature " and " aged " . In addition, care was taken to ensure that the composites were not expired after the accelerated aging protocol (simulating a 9-month shelf life)7 . After the storage time respective to the experimental groups had elapsed, the syringes were kept untouched until room temperature was reached . An infrared thermometer (general tools & instruments, irt-206 gun - style infrared thermometer, new york, ny, usa) was used to evaluate the syringe temperatures . The composites were applied to a teflon mold (822 mm), positioned over a polyester strip (n=10). After filling the mold to excess, the material surface was covered with a mylar strip and a glass slide and compressed to extrude excess material . All restorative materials were photoactivated using an led light - curing unit (bluephase, ivoclar vivadent, schaan, liechtenstein) with a power density of 1200 mw / cm for 20 s (energy dose of 24 j / cm) or for 40 s (energy dose of 48 j / cm). Prior to testing and throughout the experiment, the power density was monitored using a handheld radiometer (model 100, demetron research corp ., all of the composites selected were shade a3 (an exception was xt: shade a3b). Specimens were then stored in distilled water at 37c for 24 h. prior to the test, the specimen dimensions were measured using a digital caliper (digimatic caliper cd, mitutoyo, japan). The three - point bending test was carried out in a universal testing machine (instron model 3342, instron corp ., canton, ma, usa) at 0.5 mm / min and 5 mm span between supports . S (s) was calculated as follows: flexural modulus (e) was calculated by: where f is the maximum strength in n; l the distance between the rests; b the width of the specimen; h the height of the specimen; and f / y the slope of the linear part of the stress - strain curve . Statistical analysis of s and e was performed with three - way anova and tukey post - hoc test (= 5%). In this in vitro study, mechanical characterizations were performed according to the factors: (1) composites, at three levels: filtek p60 (p60), filtek z350xt (xt), and filtek silorane (fs); and (2) material conditions, at five levels: i - control (room temperature - rt, 22c), ii - accelerated aged composites (aa), iii - oven at 37c for 24 h (ov), iv - refrigerator at 2c for 24 h (rf), and v - freezer at -15c for 24 h (fz); (3) energy dose, at two levels: i - 24 j / cm, ii - 48 j / cm . Thirty experimental groups were obtained of the product among the combinations of the factors under study . Bisgma: bisphenol - glycidyl - methacrylate; udma: urethane - dimethacrylate; bisema: bisphenol - a - ethoxy dimethacrylate; tegdma: triethyleneglycol dimethacrylate; pegdma: poly(ethylene glycol) dimethacrylate manufacturer's information (3 m espe, st . Paul, mn, usa) bis-3,4-epoxycyclohexylethylphenyl - methylsilane and 3,4-epoxycyclohexylcyclopolymethylsiloxane note: the brand name filtek silorane is used in other countries as filtek ls and filtek p90 the composites underwent a simplified protocol for accelerated aging (also called the " 10-degree rule ") according to the collision theory based on the arrhenius model . The composite syringes were stored at 37c in an oven for 12 weeks . According to clark5 (1991), the accelerated aging protocol can be calculated by means of a mathematical formula, as follows: r = accelerated aging rate; rt = room temperature (22c); et = elevated temperature (37c); q10 = reaction rate coefficient (2). According to this protocol, for each 10c increase above the room temperature, the reaction rate doubles5 . In this way, as the rt was equivalent to 22c, r corresponds to 2 (37 - 22=15; 15/10=1.5). Thus, the accelerated aging rate was based on the increase of 15c in the storage temperature, which is 1.5 squared (r=1.5=2.83). Finally, in order to estimate the aging time equivalent to that which would occur at room temperature, r was multiplied by the storage time (12x2.83), which represents approximately 9 months of aging . It is important to mention that the same lot numbers were used for the material condition levels of " room temperature " and " aged " . In addition, care was taken to ensure that the composites were not expired after the accelerated aging protocol (simulating a 9-month shelf life)7 . After the storage time respective to the experimental groups had elapsed, the syringes were kept untouched until room temperature was reached . An infrared thermometer (general tools & instruments, irt-206 gun - style infrared thermometer, new york, ny, usa) was used to evaluate the syringe temperatures . The composites were applied to a teflon mold (822 mm), positioned over a polyester strip (n=10). After filling the mold to excess, the material surface was covered with a mylar strip and a glass slide and compressed to extrude excess material . All restorative materials were photoactivated using an led light - curing unit (bluephase, ivoclar vivadent, schaan, liechtenstein) with a power density of 1200 mw / cm for 20 s (energy dose of 24 j / cm) or for 40 s (energy dose of 48 j / cm). Prior to testing and throughout the experiment, the power density was monitored using a handheld radiometer (model 100, demetron research corp ., all of the composites selected were shade a3 (an exception was xt: shade a3b). Prior to the test, the specimen dimensions were measured using a digital caliper (digimatic caliper cd, mitutoyo, japan). The three - point bending test was carried out in a universal testing machine (instron model 3342, instron corp ., canton, ma, usa) at 0.5 mm / min and 5 mm span between supports . S (s) was calculated as follows: flexural modulus (e) was calculated by: where f is the maximum strength in n; l the distance between the rests; b the width of the specimen; h the height of the specimen; and f / y the slope of the linear part of the stress - strain curve . Statistical analysis of s and e was performed with three - way anova and tukey post - hoc test (= 5%). Figure 3 shows data of s regarding the three factors: composite x syringe storage condition x energy dose . The highest s mean was noted for p60 aa (329.2 mpa), and the lowest for z250 ov (117.3 mpa). The interaction between the factors " composites " and " material condition " was significant . However, the factor " dose " and the triple interaction among the factors were not significant . All of the composites exhibited statistically equivalent s means at room temperature (rt) and freezer (fz) storage (p>0.05). The s means of p60 were not influenced by the storage at lower temperatures (rf and fz), whereas for the silorane composite s mean significantly decreased (p<0.05). On the other hand, only the storage at fz significantly decreased s means of xt; the s mean was not influenced by the rf storage in comparison to that at rt (p>0.05). All the composites exhibited significantly decreased in the s means when the syringes were stored in the oven at 37c for 24 h compared to that of at rt (p<0.05). On the other hand, the simplified protocol of accelerated aging led to a significant increase in the s means for p60 and for filtek silorane (p<0.05). Mean values followed by different capital letters in row and small letters in column: significant (p<0.05) (): standard deviation mean values followed by different capital letters in row and small letters in column: significant (p<0.05) (): standard deviation figure 4 shows the data of e regarding the three factors: composite x syringe storage condition x energy dose . The highest e mean was noted for p60 fz (21.5 gpa) and the lowest for xt ov (13.3 gpa). The interaction between the factors " composites " and " material condition " was significant . The factor " dose " and the triple interaction among the factors were not significant . The factor " storage condition " produced no effect in the e means of the silorane composite (p>0.05). For p60 and xt, storage at ov significantly decreased the e means, whereas the storage at fz significantly increased the flexural modulus (p<0.05). Although the composites tested presented equivalent s means at room temperature, the results were material - dependent when considering the different storage conditions . The simplified protocol of accelerated aging produced an increase in s for the silorane composite whereas all of the other conditions (oven, refrigerator, and freezer for 24 h) produced a significant reduction in this mechanical parameter . On the other hand, filtek p60 was not influenced by neither of the two lower temperatures whereas filtek z350xt showed a significant reduction in s only when stored at the freezer at 37c for 24 h. aging the filtek p60 produced a significant increase in s. the composite filtek z350xt was the only composite not influenced by the simplified protocol of accelerated aging . Storing all of the composites in the oven produced a significant reduction in s. thus, the first research hypothesis raised in the present study was upheld by the experimental data as the storage temperature influences the flexural strength of the composites tested . The simplified approach for accelerated aging used in the present study was based on conducting testing at a single accelerated temperature and then employing the rule stating that the rate of a chemical reaction will increase by a factor q10 (usually of 2), which represents a doubling of the reaction rate for every 10c increase in temperature14 . This type of conservative relationship is indicated for a variety of medical polymers that have been previously characterized14 . The degradation may be primarily chemical - a combination of effects arising from oxidative chain scission, oxidation hydrolysis, changes in crystallinity, and other factors that may be environmentally dependent11 . Chemical crosslinking links molecules, while crystallinity and fillers introduce physical limitations to monomer mobility4 . Under these variations, the rate of radical propagation eventually becomes diffusion - limited and the polymerization rate decelerates, often providing only a limited conversion even in the presence of an unreacted monomer and a population of radicals27 . In this way, the crosslinking will be restricted by the molecular response, depending on the storage temperature, since the degree of freedom for monomer motions is reduced as the these monomers become irreversibly linked . This was particularly true in the accelerated aging composites as significant variations in the flexural strength occurred in comparison to that at room temperature (table 1). In contrast to those results noted after the accelerated aging protocol, in which the s means increased, the s means obtained after storage in the oven at 37c for 24 h significantly decreased for all of the tested composites . One would argue that an enhanced flexural strength would be obtained after the storage in the oven at 37c as the result of an increased conversion given by temperature - derived mobility of polymeric chains and consequent entrapped radical engagement2 . Therefore, it is reasonable to infer that the composites underwent a chemical degradation at shorter storage time (24 h) before a change in the crystallinity would occur throughout the 12-week storage at the same temperature (aging protocol). It could be argued that, by significantly increasing the flexural strength after aging the composite syringes of filtek p60 and filtek silorane would provide better clinical performance . Conversely, the increased flexural strength may not represent improved mechanical properties, despite the equivalence in terms of flexural modulus when compared to that of the means at room temperature . In this way, it was clear that these contradictory results when comparing shorter and longer storages in the oven at 37c have in common the fact that both storage conditions interfere in the composite stability . It is important to highlight that the mechanical properties of composites tested depend on the properties of their constituent materials25 . Thus, when comparing the different composites, the large ranges in the s means were due to the different classifications in the composite formulations, although all tested materials are indicated for restoring posterior teeth . Filtek silorane is filled with a combination of fine quartz particles and radiopaque yttrium fluoride, being classified as a microhybrid resin composite . The filler in filtek p60 is zirconia / silica in a concentration of 83.0% by weight, classified as a hybrid composite . Filtek z350xt is a nanofilled composite with 72.5% of fillers . As these materials are essentially polymeric in nature, their laboratorial and clinical performances are related to the rate of degradation of their inherent structure and configuration over time . In contrast to methacrylate - base composites, the siloranebased composite contains cationic ring - opening monomers, which represent a compensating mechanism for shrinkage stress achieved during polymerization30 . This resin composite combines two main advantages: low polymerization shrinkage, due to the ring - opening oxirane, and an increased hydrophobicity due to the siloxane compound . The silorane - based composite revealed a decreased water sorption, solubility, and associated diffusion coefficient compared to those observed when methacrylate - based composites were tested24 . The elastic modulus of low - shrinking composites and methacrylate - based composite was recently reported as being similar, despite differences in the formulation, even though the silorane composite has higher molecular weight and higher filler content29 . In another study, it was also revealed that the silorane material presents relatively higher flexural strength / modulus and fracture toughness but relatively lower compressive strength and hardness than some methacrylate - based restorative materials20 . In the present study, no significance was noted among the composites in terms of e at room temperature . In addition, none of the composites had the means of flexural modulus affected by the accelerated aging protocol . Different from that observed for flexural strength, all of the storage conditions produced no effect on e of the silorane composite . On the other hand, filtek p60 and filtek z350xt were affected by storage in the oven at 37c for 24 h, significantly decreasing e, whereas the storage in the freezer significantly increased e (p<0.05). In this way, the second research hypothesis, that the flexural modulus of the composites stored at different temperatures will be inferior to that observed at room temperature, was also rejected . In spite of the similarity in terms of the flexural modulus, the flexural strength of the filtek silorane was the only composite negatively influenced by both the lower temperatures and storage conditions . The reasons that explain the lower flexural strength means rely on the fact that the silorane monomer presents a polymerization reaction with a slow onset28 . In addition, the lower temperatures may impact the initial activation energy necessary to form the activated complex, which represents the first two stages of the composite polymerization - initiation and activation3 . This somehow leads to a more reduced extent of the composite monomer conversion that may impact the quality of the polymerization process26 . Resin conversion should be usually optimized in order to resist deterioration of mechanical and chemical properties; strength, hardness, stiffness, and wear resistance . Even the exposure of a 48 j / cm energy dose was not sufficient to compensate the impact on the polymerization process . In this way, based on the results of the present study, it is not recommended to store filtek silorane at low temperatures . It has been advocated that refrigerated syringe composites should be warmed to at least room temperature before clinical application as this procedure might disrupt the material characteristics15 . It is important to point out that the composite syringes underwent the temperature treatment and not the polymerized specimens . In addition, the specimens were produced only when the syringes were at room temperature . Although dental manufacturers recommend that composites be stored at room temperature10, all of the variables that include storage temperature and transportation conditions are not under control . The effect of these variables over the composite clinical performance can be minimized if properly considered . These variables can have an effect in a way that may adversely affect the composite safety or performance18 . Temperature variations, relative humidity, ventilation, visible light and other radiation, vibration, shock, temperature, and humidity are other important factors to be considered, especially when a dental product is shipped between various climatic zones22 . According to clark5 (1991), depending on the shipping or storage conditions, a breakage in a certain medical device, a failure of the barrier properties of a sterile package or degeneration of the device itself may occur . In this way, the question as to how new the dental products available to the clinicians are remains unanswered . The third research hypothesis, which anticipated that the energy dose influences in the mechanical properties of the composites, irrespective of the storage temperature, was rejected . According to the statistical analysis, the factor " dose " and the triple interaction among the factors were not significant for both the parameters tested . A reasonable explanation was that, in the present study, a 24 j/ cm energy dose was sufficient to guarantee the composite polymerization of 2-mm thick specimens . Clinically, it would be important to obtain well polymerized composites with enhanced mechanical properties . On the other hand, an energy dose of 48 j / cm should be used with caution by clinicians considering the increase in the polymerization stress generated when higher energy doses are applied . In addition, the specimens exposed to a low energy dose were stored at 37c for 24 h after photoactivation, and this fact may allow an increased monomer conversion and enhanced mechanical properties similar to that of obtained when a higher energy dose was applied21 . In a previous study7, it was pointed out that the energy dose associated with the bonding approach are determinant factors in terms of the presence of internal gaps for both the methacrylate - based composite and for the silorane - based one . The present study deals with a clinical relevant issue as the syringe storage conditions tested influenced the mechanical properties of different classifications of resin composites . Storage as a function of the temperature proved to influence mostly the composite flexural strength, possibly due to changes in the chemical stability and/or crystallinity (especially at higher temperatures) of the composites and also due to the impact of the quality of the polymerization process (lower temperatures). Although the dental manufacturers may not be able to control all of the variables like the storage temperature and the transportation conditions, their effect on the composite clinical performance can be minimized if properly considered by the clinicians8 . Extrapolations to clinically support and validate the results using different resin - composite categories and filler contents need to be done with caution since future studies are required to evaluate the performance of these composites . Within the limitations of this study, the following can be concluded: the storage condition influences the flexural strength and the flexural modulus of the composites in comparison to that observed at room temperature . The energy dose does not influence the mechanical properties, irrespective of the storage condition . The aging protocol improves the flexural strength of filtek p60 and filtek silorane, whereas storage in the oven at 37c for 24 h impacts the same parameter for all of the composites tested . It seems that the silorane composite should not be stored at lower temperatures, whereas the filtek p60 is not impacted by these temperatures.
Some other causes can be due to postoperative adhesions, duplication cyst, meconium ileus, and internal hernia . According to our knowledge, this is the first report of intrauterine volvulus of terminal ileum without malrotation that was diagnosed by ultrasound . Our case deals with terminal ileum torsion around its axis with twisting of mesenteric vessels . Therefore, it is of medical importance to recognize the radiological signs of bowel torsion as soon as possible . We present a case of volvulus of terminal ileum which was diagnosed and treated surgically in a neonate just 15 h after delivery . A female baby was born preterm at 35-weeks, with parameters appropriate for her gestational age, weighing 2666 g, with apgar 9 - 10 at 1 and 10 min, respectively . Maternal history provided a previous missed abortion, otherwise the mother was a healthy woman who had a normal pregnancy and normal fetal screening follow - up findings . On physical examination of the preterm baby investigational work - up was started including, chest x - ray which was normal, arterial blood gases showed mild metabolic acidosis, blood and urine culture were obtained, and wide spectrum intravenous antibiotics were started . The baby was referred to our radiological department for plain abdominal x - ray at age of 2 h. the x - ray showed a distended and gasless abdomen, except for a small amount of air in the stomach [figure 1]. Female baby at 2 h after birth with distended abdomen diagnosed with intrauterine volvulus of terminal ileum without malrotation . X - ray of abdomen shows distended and gasless abdomen except a small amount of air in the stomach (black arrow). This radiological finding might be normal at this age, but since the baby was crying it was assumed to have more air in the intestine . Thus, we started an upper gastrointestinal study to rule out any cause of intestinal obstruction . The barium study ruled out a malrotation showing a normal gastric, duodenal, and normal location of the treitz ligament [figure 2]. Two hours after the start of the barium study, we noticed lack of propagation of the barium at the level of right lower quadrant of the abdomen . This led us to suspect ileal atresia, which is the most common cause of obstruction after malrotation . Sign with filling defect and a round structure around this end loop [figure 3]. This radiological finding suggested ileal obstruction due to volvulus with presumed duplication cyst as the leading point . Female baby at 2 h after birth with distended abdomen diagnosed with intrauterine volvulus of terminal ileum without malrotation . Female baby at 13 h after birth with distended abdomen diagnosed with intrauterine volvulus of terminal ileum without malrotation . At 13 h, the barium study shows stopage of barium with a beak - like shape of the pre - obstructed bowel (black arrow) with filling defect(white arrow) and a structure containing air around the end loop (arrowheads) immediate ultrasonographic examination of the abdomen was done to confirm the diagnosis . Ultrasound scan showed a target lesion consistent of two loops of bowel, pneumatosis of the bowel wall, and twisting of vessels [figure 4], suggesting a diagnosis of ileal volvulus with intestinal ischemia . Intraoperative findings showed volvulus of terminal ileum with intestinal ischemia and perforation with free meconium in the abdomen . We think that meconium in this case was the main predisposing factor for the volvulus of this baby . Female baby at 13 h after birth with distended abdomen diagnosed with intrauterine volvulus of terminal ileum without malrotation . Ultrasonographic examination of the abdomen shows a target lesion consistent with two loops of bowel, pneumatosis of the bowel wall (arrowheads) and twisting of vessels (white arrow). According to our knowledge, this is the first case of intrauterine volvulus of terminal ileum without malrotation, that was diagnosed definitively by ultrasound and operated on within a few hours after birth thus saving the life of the baby . Neonatal volvulus is secondary to malrotation, and involves twisting of bowel loop with its feeding vessels that leads to ischemia, necrosis, and perforation with fatal complication, if not recognized and treated in time . However, other rare predisposing causes are meckel's diverticulum, duplication cyst, and meconium plug . Diagnosis of volvulus in any suspected neonatal intestinal obstruction by plain film and barium study is extremely difficult especially when malrotation is ruled out . The most common causes of these cases of intestinal obstruction are intestinal atresia that is fatal in the first hours of life if not treated immediately . Based on our case, we suggest: in any case of suspected intestinal obstruction, first we have to rule out intestinal malrotation with an upper gastrointestinal barium study . Once malrotation is ruled out, we suggest immediately performing an ultrasound examination of the abdomen to rule out an ileal volvulus . Thus, ultrasound examination that shows a target lesion bird beak sign of the involved bowel allows to quickly identify this morbid entity without loss of precious time.
The technical details of the arfem system used in this study have been described in detail previously . Briefly, the system essentially is comprised of three core components, a femtosecond laser, a dual element ultrasound transducer, and a sample chamber . Santa clara, ca, usa) that produces 130 fs pulses at a wavelength of 800 nm . The ultrasound transducer has two elements, an outer low frequency, high intensity force - generating element, and in an inner low intensity, high frequency tracking, or a - scan element . The outer force - generating, or pushing, element has a central frequency of 1.5 mhz and a spatial peak, pulse average intensity (isppa) of 125 watts / cm . The a - scan element is driven by a commercial pulser - receiver (panametrics model 5072pr, waltham, ma, usa) at a pulse repetition frequency of 5 khz . The pushing element is driven by an arbitrary function generator (model 3314a; agilent technologies, palo alto, ca, usa) feeding into a 50 db amplifier (eni model 240l; mks instruments, wilmingtom, ma, usa). The focal point of the laser is fixed in space, while the ultrasound transducer can be moved in three dimensions . To ensure that the optical and ultrasonic elements are confocal, the a - scan signal from a laser - created bubble was maximized by adjusting the alignment of the ultrasonic transducer . The 3-d sample stage then is moved independently of the optical and ultrasonic components, which are focused to the same location . The corneal sample is embedded in gelatin within the sample chamber, while the rest of the chamber is filled with degassed, distilled water for acoustic coupling . The chamber itself is mounted to a 3-d microstage, allowing for the placement of the microbubble anywhere within the cornea . The laser is focused through a 0.3 na objective creating a microbubble (d = 22 2 m) within the cornea with a single pulse . Once the bubble has been created and confirmed via a - scan, the measurement sequence is initiated manually and the outer element of the ultrasound transducer generates an acoustic radiation force chirp 2 ms in duration . The acoustic force displaces the microbubble within the cornea, while the displacement of the bubble is tracked by the inner ultrasound element with an a - scan at a pulse repetition frequency of 5 khz . Thus, the position / movement of the bubble in response the acoustic radiation force is measured every 200 s . The elastic modulus is inversely proportional to the bubble displacement and is calculated using: where i is the acoustic intensity, a is the bubble radius, the acoustic intensity and bubble radius are calibrated before the experiment, while maximum bubble displacement is measured experimentally with an a - scan . The raw a - scan rf data are filtered using a 10 mhz high pass filter, and then processed using 1-d cross - correlation between a reference bubble a - scan and the remaining pulse - echoes . The speed of sound m / s) was used in all calculations in place of the speed of sound in cornea for convenience . Six human cadaver eyes from three donors were obtained from the san diego eye bank . Samples were refrigerated and measurements were performed within 3 days of death on average, but no later than 5 days . Basic donor data are provided in the table . Before the experiment, corneas were thinned to a physiologic thickness of 500 to 570 m by inflating the intact globe with 20% dextran solution at 20 mm hg iop . The samples were placed into a suction holder whereby the posterior portion of the globe created a seal with the holder allowing a mild suction force to hold the sample in place . The sample was oriented such that the central corneal surface was orthogonal to the ultrasonic tip of the pachymeter (reichert, inc ., the cornea then was excised, leaving a 2-mm scleral rim, and embedded in a 7.5% gelatin gel within the sample chamber . Experiments were performed only when the corneal thickness was in the physiologic 500 to 570 m range . We obtained arfem measurements in the central cornea (0 mm), at 2.5 mm (mid), and at 5 mm (peripheral) toward the limbus . At each of these locations, the cornea was placed on the gelatin surface in such a way that half of the cornea was flat against the gelatin surface, with the other half curving upward . This was necessary due to the fact that the corneal surface must be perpendicular to the laser beam for optimal bubble creation . Laying the half cornea flat against the gel allowed measurements to be made in the central and peripheral regions without having to reorient the cornea . During the measurements, the cornea was oriented so that the acoustic force and resultant microbubble displacements were perpendicular to the corneal surface . Corneal orientation and arfem measurement locations . Measurements are made at 0 (center), 2.5 (mid), and 5 (peripheral) mm . At each radial position, the sample is flattened against the surface of the gel so that measurements can be made at multiple locations without having to reposition the cornea . The technical details of the arfem system used in this study have been described in detail previously . Briefly, the system essentially is comprised of three core components, a femtosecond laser, a dual element ultrasound transducer, and a sample chamber . Santa clara, ca, usa) that produces 130 fs pulses at a wavelength of 800 nm . The ultrasound transducer has two elements, an outer low frequency, high intensity force - generating element, and in an inner low intensity, high frequency tracking, or a - scan element . The outer force - generating, or pushing, element has a central frequency of 1.5 mhz and a spatial peak, pulse average intensity (isppa) of 125 watts / cm . The a - scan element is driven by a commercial pulser - receiver (panametrics model 5072pr, waltham, ma, usa) at a pulse repetition frequency of 5 khz . The pushing element is driven by an arbitrary function generator (model 3314a; agilent technologies, palo alto, ca, usa) feeding into a 50 db amplifier (eni model 240l; mks instruments, wilmingtom, ma, usa). The focal point of the laser is fixed in space, while the ultrasound transducer can be moved in three dimensions . To ensure that the optical and ultrasonic elements are confocal, the a - scan signal from a laser - created bubble was maximized by adjusting the alignment of the ultrasonic transducer . The 3-d sample stage then is moved independently of the optical and ultrasonic components, which are focused to the same location . The corneal sample is embedded in gelatin within the sample chamber, while the rest of the chamber is filled with degassed, distilled water for acoustic coupling . The chamber itself is mounted to a 3-d microstage, allowing for the placement of the microbubble anywhere within the cornea . The laser is focused through a 0.3 na objective creating a microbubble (d = 22 2 m) within the cornea with a single pulse . Once the bubble has been created and confirmed via a - scan, the measurement sequence is initiated manually and the outer element of the ultrasound transducer generates an acoustic radiation force chirp 2 ms in duration . The acoustic force displaces the microbubble within the cornea, while the displacement of the bubble is tracked by the inner ultrasound element with an a - scan at a pulse repetition frequency of 5 khz . Thus, the position / movement of the bubble in response the acoustic radiation force is measured every 200 s . The elastic modulus is inversely proportional to the bubble displacement and is calculated using: where i is the acoustic intensity, a is the bubble radius, the acoustic intensity and bubble radius are calibrated before the experiment, while maximum bubble displacement is measured experimentally with an a - scan . The raw a - scan rf data are filtered using a 10 mhz high pass filter, and then processed using 1-d cross - correlation between a reference bubble a - scan and the remaining pulse - echoes . The speed of sound m / s) was used in all calculations in place of the speed of sound in cornea for convenience . Arfem experimental setup . Six human cadaver eyes from three donors were obtained from the san diego eye bank . Samples were refrigerated and measurements were performed within 3 days of death on average, but no later than 5 days . Basic donor data are provided in the table . Before the experiment, corneas were thinned to a physiologic thickness of 500 to 570 m by inflating the intact globe with 20% dextran solution at 20 mm hg iop . The samples were placed into a suction holder whereby the posterior portion of the globe created a seal with the holder allowing a mild suction force to hold the sample in place . The sample was oriented such that the central corneal surface was orthogonal to the ultrasonic tip of the pachymeter (reichert, inc ., the cornea then was excised, leaving a 2-mm scleral rim, and embedded in a 7.5% gelatin gel within the sample chamber . Experiments were performed only when the corneal thickness was in the physiologic 500 to 570 m range . We obtained arfem measurements in the central cornea (0 mm), at 2.5 mm (mid), and at 5 mm (peripheral) toward the limbus . At each of these locations, the cornea was placed on the gelatin surface in such a way that half of the cornea was flat against the gelatin surface, with the other half curving upward . This was necessary due to the fact that the corneal surface must be perpendicular to the laser beam for optimal bubble creation . Laying the half cornea flat against the gel allowed measurements to be made in the central and peripheral regions without having to reorient the cornea . During the measurements, the cornea was oriented so that the acoustic force and resultant microbubble displacements were perpendicular to the corneal surface . Measurements are made at 0 (center), 2.5 (mid), and 5 (peripheral) mm . At each radial position, the sample is flattened against the surface of the gel so that measurements can be made at multiple locations without having to reposition the cornea . The mean elastic moduli were 4.2 1.2, 3.4 0.7, and 1.9 0.7 kpa in the central, mid, and peripheral regions, respectively . The mean elastic moduli were 2.3 0.7, 1.6 0.3, and 2.9 1.2 kpa in central, mid, and peripheral regions, respectively . While the anterior cornea was approximately twice as stiff as the posterior cornea in the central and mid cornea, the anterior elastic modulus decreased with respect to the posterior elastic modulus in the peripheral cornea . Multiple comparisons were performed using anova in matlab (mathworks, natick, ma, usa) to determine which location - specific elastic moduli means were different from the others . Statistically significant differences in elasticity could be established between the following regions: the central anterior cornea is stiffer than any other region (p = 0.05); the mid anterior cornea is stiffer than the mid posterior, central posterior, and peripheral anterior cornea (p = 0.05); and the peripheral posterior cornea is stiffer than the central posterior, mid posterior, and peripheral anterior cornea (p = 0.05). No statistically significant differences could be established when comparing arfem elasticity measurements in between all other regions . Elastic modulus in the anterior 150 m of cornea from the center to the periphery . Elastic modulus in the posterior 150 m of cornea from the center to the periphery . The arfem technique used in this study has the significant limitation of being unable to measure the elasticity distribution in the mechanically - loaded cornea and intact globe . Given the nature of the current arfem device, the cornea must be excised from the globe and placed between the laser objective and ultrasound . Additionally, the cornea is laid flat against the gelatin surface in such a way that half of the cornea curves unnaturally upward . The mechanical effect of this curvature is assumed to be negligible based on previous measurements of the central cornea with the natural radius of curvature preserved showing the same 2:1 ratio in elasticity between the anterior and posterior regions . We found the elasticity in the central anterior cornea to be nearly twice the elasticity in the central posterior cornea . Similar results were found using needle indentation, which revealed the same 2:1 ratio in elastic modulus between the anterior and posterior central cornea . Likewise, the mid anterior cornea was twice as stiff as the mid posterior cornea . Structurally, the anterior cornea possesses highly interwoven collagen structure compared to the relative homogeneity in the posterior . Despite this apparent correlation between microstructure and elasticity in the central and mid cornea the peripheral anterior cornea was approximately half as stiff as the central anterior, while the peripheral posterior cornea was approximately 30% stiffer than the central posterior cornea . It is interesting to note that interlamellar cohesive strength in the stroma is twice as strong in the periphery as it is centrally . Though arfem does not measure interlamellar cohesive strength, both results suggest a biomechanical change in the peripheral cornea . Furthermore, the peripheral anterior elasticity is approximately 2/3 that of the peripheral posterior cornea . It appears as though in the periphery, the anterior and posterior corneas nearly reverse elastic moduli relative to each other . Structural data in the literature anterior collagen interweaving, as measured by collagen lamellae angle relative to the corneal surface using nonlinear optical high resolution macroscopy (nlo - hrmac), did not detect a significant difference between the central and peripheral cornea . The wrinkles on the posterior surface in figure 6a are artifacts from the mounting of the sample . Figures 6b to 6d show that the anterior interweaving relative to posterior collagen orientation is preserved from the center to the periphery . Structural differences in the periphery of the cornea may be masked by the shifting orientation of lamellae from central to peripheral . Structurally, the cornea is changing as it nears the limbus, with collagen fibers adopting a more tangential (circumferential) orientation in the periphery, as imaged by wide angle x - ray scattering . Collagen fibers in this orientation would not have been detected in the previous work by nlo hrmac, as the technique does not image en face collagen fibers . While the posterior lamellae continue uninterrupted into the sclera, the anterior interwoven region seems to end abruptly at the limbus . (b d) center, middle, and peripheral measurement locations, respectively . Recently, micro focus x - ray scattering data were used to determine the inclination angles of lamellae relative to the corneal surface as a measure of lamellar interweaving . As expected, inclination angles in the central anterior cornea were the greatest . The same study found that inclination angles in the posterior peripheral cornea were high when compared to the posterior central cornea, suggesting more interweaving in the posterior peripheral cornea . This finding seems to support our observation of an increasing elastic modulus in the peripheral posterior cornea . The effect of increasing inclination angle in the peripheral stroma along with the effect of tangentially oriented collagen fibers on local elasticity is unknown . As the lamellae exit the biomechanical effects of the transition or insertion of collagen lamellae into the sclera also are unknown . Furthermore, the periphery may be subject to different swelling conditions because the peripheral edge of the sample is exposed directly to the gelatin medium . The cornea is, indeed, thicker in the periphery and hydration differences between the anterior and posterior could be exacerbated to the proximity of the measurements to the edge of the sample . In addition to collagen microstructure, proteoglycan (pg) distribution throughout the cornea also may have an effect on local elasticity as measured by arfem . Specifically, it is pertinent to explore any differences in pg distribution between the anterior and posterior cornea, centrally and peripherally . A pg consists of a core protein with one or more covalently attached glycosaminoglycans (gag). The gag is highly polar, negatively charged, and, as such, binds water . The concentration of keratan sulfate, the most prominent pg in the cornea, increases from anterior to posterior in the central cornea . Furthermore, stromal swelling is caused almost entirely by the gel pressure (swelling pressure) generated by negatively charged proteoglycans . When these findings are considered along with the highly interwoven structure of the anterior cornea, it seems reasonable that the anterior cornea is resistant to edema compared to the posterior cornea . Our results also indicated that the peripheral anterior corneal elasticity is approximately half that of the central anterior cornea . With studies showing conflicting accounts of the amount of interweaving in the periphery,, it would be interesting to know the trend in pg distribution in the peripheral cornea . It is possible that local pg concentration and the resultant swelling pressure have an effect on local elasticity as measured by arfem . Unfortunately, the literature does not reveal many telling details about the differences in pg concentration between the central and peripheral cornea . One study looked at total soluble protein concentration between the anterior and posterior cornea, traversing across the cornea from the limbus to the central cornea . They found that total soluble protein concentration in the peripheral anterior cornea was nearly twice that of the central anterior cornea . Though it may appear that this result corroborates our findings between central and peripheral elasticity, the correlation could be entirely coincidental since they were not specifically measuring pg distribution . To truly resolve this issue, a specific measurement of the axial pg gradient in the peripheral cornea would need to be performed . We found that there is a unique distribution of elasticity axially and radially throughout the cornea . While arfem results in the central cornea are in reasonable agreement with other techniques, including needle indentation and torsional rheometry, lack of mechanical data in the peripheral cornea makes comparisons difficult . However, it is clear that the full picture of corneal biomechanics is quite broad, from complex and inhomogenous collagen microstructure to varying concentration of pg throughout the cornea . A better understanding of these variables along with elasticity measurements, especially in the peripheral cornea, would certainly help in completing the picture . Future modifications of arfem to automate the measurement procedure, specifically the movement of the sample with respect to the confocal volume, will result in an elasticity map with greater spatial density and may help provide this information.
Ant was developed by bruno latour, michel callon and john law in the field of science and technology studies during the 1980s . Although it carries theory in its name, ant is better understood as a range of methods for conducting research which aims to describe the connections that link humans and non - humans (for example, objects, technologies, policies and ideas). In particular, ant seeks to describe how these connections come to be formed, what holds them together and what they produce . Researchers using ant are interested in connections between humans and non - humans because they subscribe to the notion that everything that exists in the world is the outcome of an interaction between two or more human and/or non - human entities . Using ant means ascribing equal agency to people and things . While it is true that people use data and do things with them, it is equally true that data make people do things, i.e. They influence their work, they structure organizational practices, make organizations take certain decisions rather than others and produce particular effects and affects . This system of mutual influence between people and objects is what ant calls an actor - network . In other words, ant states that actors (for example, nurses in charge of collecting patient experience data) act in the way they do and are able to produce effects only through their interactions with other human and non - human entities (for example, the technical devices used to collect data, the protocols that regulate their work, the chains of authority they are accountable to, the targets they need to meet). From this perspective, data are what latour has called actants, entities that are endowed with the potential to produce change in, and in turn to be transformed by, the course of action of other actors . Using ant to approach patient experience data has the potential to make two interrelated contributions to existing debates . Firstly, it emphasizes the performative nature of quality improvement, bringing to the fore the ways in which quality improvement emerges or fails to emerge as a result of a contingent series of interactions between various human (individual, institutional) and non - human actors (bureaucratic documents, policies, technologies, targets, etc . ). In the case of patient experience, exploring such performativity of data would mean moving beyond dominant perspectives which see data as inert, open to infinite technical refinement in the service of quality improvement . Rather, it would require recognizing that data collected by health care providers produce effects as a result of specific series of interactions with other actors, e.g. More or less competent hospital staff, sympathetic or indifferent policy makers, efficient or faulty technological devices used for their collection and analysis, etc . Thus, it may be the case that the interaction of data with a particular presentational and analytical technology (e.g. Meridian or powerpoint), makes data more or less compelling to nurse managers, enabling or hampering its journeys to other hospital documents and meetings . Secondly, tracing the movement of patient experience data through a health care organization by focusing on its performativity may also lead to important insights into the structure of an organization . As data travel, and translate into reports, narratives and interventions, they make and reveal alternative organizational relations to those which are officially recognized . For example, whereas hospitals are formally hierarchical institutions with a wide range of fixed roles and responsibilities, the contingent interactions in which data get embedded may reveal alternative decision - making processes, and may bring to the fore the role of certain actors (such as health care assistants or receptionists) who are conventionally marginal, but who nevertheless often come to play an unexpectedly central role in ensuring the quality of care . A flattened perspective such as this, which treats actors as equally important regardless of their assumed place in an institution, is key to more faithfully account for how quality improvement emerges in practice . By moving away from taken - for - granted organizational and institutional structures through which data are supposed to be gathered, analysed and deployed, such an approach requires that better attention is paid to alternative organizational arrangements as well as to forms of agency which would otherwise go undetected, including non - human agency . Thus, in addition to allowing for the role unexpectedly played by certain people within hospitals, the flatness promoted by ant also requires us to pay attention to how quality improvement can be produced or hampered by the agency of specific non - human actors . This would, for instance, mean examining the unorthodox use of certain technologies, or of types of knowledge that are not usually labelled data. Casting a panoramic view over the vast web of relations that practically shape quality improvement is essential to move forward the current debates on patient experience data and their role in health care . As mentioned at the beginning of the paper, it is widely recognized that a discrepancy exists between the proliferation of forms of data collection and the limited ways in which such data are used to inform quality improvement . With its flat approach to the mutually influencing relations between actors, ant holds out the promise of bringing to the surface the processes of interaction and negotiation between actors; it keeps the messy, everyday mechanics of improvement centre stage . Exploring these processes is key to helping organizations learn what data are and how they can be best put to use . If we understand data as not only the product of health care organizational structures but also as involved in creating and sustaining them, we may better show how such data shape quality improvement activities . Recognizing this potentially creative character of data may offer alternative paths to improvements in patient care which would otherwise go undetected . The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article . The views and opinions expressed therein are those of the authors and do not necessarily reflect those of the health services and delivery research programme, nihr, nhs or the department of health . The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: this work was funded by the national institute for health research health services and delivery research programme (hs&dr 14/156/08).
Upper cervical spine instrumentation is always challenging for spine surgeons due to the highly variable pedicle anatomy and vertebral artery anomalies . Particularly, c1 - 2 fixation techniques have been developed in order to overcome those problems, and c1 lateral mass - c2 pedicle screw fixation has been increasingly used since it was introduced in 1994 by goel and laheri3) and modified in 2001 by harms and melcher5). Many published reports describe the technique's superiority to transarticular c1 - 2 fixation and several posterior fusion methods in biomechanics and feasibility when vascular and bony anomalies exist, although the procedure is still challenging and its accuracy does not provide any certainty to surgeons . Because it is a free - hand technique, abumi's method and the fluoroscopy - guided technique have their own limitations in terms of reliability9), so navigation systems have been recently introduced to aid in these procedures . Among them, the computed tomographic (ct)-based navigation system was recently revealed to have excellent results: over 89% accuracy reported, even in the thoracolumbar spine2) and an 85% to 97% accuracy rate in lower cervical spine instrumentation, as reported in previous articles12,13). However, the accuracy rate for the ct - based navigation system at the upper cervical spine level, especially in c1 and c2 instrumentation, has not been reported yet . We have used the ct - based navigation system in several cervical instrumentation surgeries, and report its safety and efficiency through the comparison of previous reports . This retrospective study included 25 patients who underwent upper cervical instrumentation, including c1 lateral mass - c2 pedicle screw fixation, between may 2005 and march 2014 . The patients underwent the usual posterior approach and instrumentation using ct - based navigation systems (steal - station; sofamor - danek, memphis, tn, usa in cases 1 to 4; and navigation cart ii; stryker, kalamazoo, mi, usa in the remaining cases) by one surgeon . Among them, 18 patients who has postoperative ct scans participated in this study and the accuracy of the screw positions at c1 and c2 only was analyzed by a third observer . The usual posterior approaches were used and ultimately, two occipito - cervical fusions, 13 c1 lateral mass - c2 pedicle screw fixations, and three c2 - 3 - 4 posterior instrumentation were performed (table 1). The laminectomies were performed in neurologically compromised patients, and a ct - based navigation system and fluoroscopy were used during the pedicle screw instrumentation procedure (vertex; sofamor - danek, memphis, tn, usa in cases 1 to 11 and synapse system; synthes, west chester, pa, usa in the remaining cases). The precise position of the screw was evaluated by a postoperative computed tomographic scan and categorized into one of three groups: absolute in - pedicle, non - critical breach (pedicle violation <2 mm), and critical breach (pedicle violation> 2 mm). In the prone position, a usual mid - line incision was performed and the reference device was secured at the c2 spinous process after exposure . Navigation procedures included acquiring a preoperative ct image, activating a patient tracker, adjusting the camera angle, registration, tool calibration, and simulation of screw placement . During the registration process, both a point - to - point registration and surface - matching process were used to reduce the mean deviation, and simulation of the screw trajectories was acquired on the navigation monitor (fig . The c1 trajectory was changed from a lateral mass under the c1 posterior arch (cases 1 to 11) to modification of the pedicle screw with a partial removal of the lower c1 arch (remaining cases) (fig . In the prone position, a usual mid - line incision was performed and the reference device was secured at the c2 spinous process after exposure . Navigation procedures included acquiring a preoperative ct image, activating a patient tracker, adjusting the camera angle, registration, tool calibration, and simulation of screw placement . During the registration process, both a point - to - point registration and surface - matching process were used to reduce the mean deviation, and simulation of the screw trajectories was acquired on the navigation monitor (fig . The c1 trajectory was changed from a lateral mass under the c1 posterior arch (cases 1 to 11) to modification of the pedicle screw with a partial removal of the lower c1 arch (remaining cases) (fig . A total of 58 screws, including 26 c1 screws and 32 c2 screws were analyzed . Postoperatively, the precise positions of the c1 lateral mass - c2 pedicle screws were 81.1% (47/58); 8.6% (5/58) of the screws were in a non - critical breach position and 10.3% (6/58) of the screws were critical breaches . Most (5/6) of the critical breaches and all of non - critical breaches were observed at the c2 pedicle screws, and only one case of a c1 lateral mass screw showed a critical breach (p=0.033, kruskal - wallis test). All cases of breach occurred in traumatic instances, except for one case of degenerative spine disease, which resulted in a c2 critical breach (p=0.091, mann - whitney u test). There were three complications (two vertebral artery occlusions and a deep wound infection), but no postoperative instrument - related neurological deteriorations were seen, even in the critical breach cases . In case 1 and case 15, the right c2 pedicle screw protruded over 50% into the vertebral foramen, even though correct navigation procedures were performed . The postoperative ct angiograms showed that retrograde flow from the opposite vertebral artery covered the distal area (fig . One patient (case 14) had a deep wound infection postoperatively and wound revision with massive irrigation was performed in response . According to the 2000 cadaveric study of ludwig et al.10), the accuracy rates of c3 - 7 pedicle screws using the ct - based navigation system are 76% (in pedicle) and 13.4% (non - critical breach). A 2005 clinical study by rampersaud et al.12) reported an 85% accuracy rate in pedicles; and a 13.1% rate of non - critical breaches and 2.2% occurrence of critical breaches in the thoracolumbar spine . In 2012, gelalis et al.2) published a systemic review comparing the free - hand technique, and found that the percentage of the screws fully contained in the pedicle ranged from 69 to 94% overall; those that used fluoroscopy ranged from 28 to 85%, while those using ct navigation ranged from 89 to 100% and those using fluoroscopy - based navigation ranged from 81 to 92% . The authors believe that the present study is the first article regarding c1 - 2 fixation using a ct - based navigation system . In the present study, an 81.1% accurate placement in the pedicle was seen, in addition to an 8.6% rate of non - critical breaches and a 10.3% rate of critical breaches . Those results were not highly satisfactory to the authors, but the c1 - 2 junction has high mobility, which makes precise stabilization inherently problematic as compared with the lower cervical or thoracolumbar spines . Additionally, seven cases were excluded because their screw positions were correct on the postoperative x - ray so ct scans were not taken . The accuracy rate would be higher than reported here if they were involved in the study . Another clinical study by richter et al.13) reported a 97% accuracy rate using a navigation system versus a 91.4% accurate rate using the conventional method for c3 - 6 pedicle screw fixation . A recent article regarding c1 lateral mass - c2 pedicle screw fixation reported a 95.8% correct screw placement14), but the researchers used isocentric c - arm 3-dimensional navigation, which is a more upgraded system than ours . The possible reasons of the relatively higher rate of breach at c2 than c1 in the present study are described below . One reason is that most of the cases were c2 fractures, so relative instability occurred, and it could cause error and change between the preoperative ct scan and intraoperative position of the patient . Another reason may be that the reference device, which was secured to c2 spinous process, could have been touched and therefore moved, unintentionally during the procedure . Finally, the authors recommend that more precision be used, both during the point - to - point registration and the surface - merging during the navigation procedure . A modified c1 trajectory could be helpful to reduce intraoperative bleeding, postoperative occipital neuralgia, and operation time . Although a ct - based navigation system can allow surgeons to perform more precise procedures at the lower cervical and thoracolumbar spine, it still has some problems in the upper cervical spine, due to the region's highly variable anatomy . Even though there were no catastrophic complications, more experiences
Children with new - onset type 1 diabetes were recruited for a randomized, placebo - controlled trial of low - dose oral interferon- for preservation of -cell function (the primary outcome of which will be published in a separate report). Patients had a mean age of 9.4 4.6 years, were enrolled within 6 weeks of diagnosis, and were free of other significant illness (n = 23, 30% female, 91% caucasian). Study approval was obtained from the institutional review board at the national institute of diabetes and digestive and kidney diseases (niddk) at the national institutes of health (nih). Basal rates were continued but morning bolus injections were withheld . For patients on multiple daily injections of insulin, morning doses were withheld . The meal consisted of boost high protein, 7 ml / kg (maximum 400 ml), ingested over 5 min . Blood samples were drawn at 10, 0, 30, 60, 90, and 120 min . Ng / l, with an interassay coefficient of variation (cv) of 18% and an intra - assay cv of 15% . C - peptide concentrations were determined with a competitive chemiluminescence assay at the nih clinical center laboratory . Nmol / l, with an intra - assay cv of 3.4% (at 1.45 nmol / l) and inter - assay cvs of 7.7 and 8.3% at 0.37 and 1.98 nmol / l, respectively area under the curve (auc) for glucagon and c - peptide were calculated using the trapezoidal method . The mean of values obtained at 10 and 0 min was used as the baseline value . Net glucagon and c - peptide secretion following the mixed meal were expressed as auc . Statistical analyses were performed using sas version 9.1 (sas institute, cary, nc). Results were described using frequency distributions, pearson's correlation coefficients, and repeated - measures anova using proc mixed for testing change over time . Opposing change (i.e., positive for glucagon vs. negative for c - peptide, or vice versa) was assessed using a sign test based on the sign of the product of the slopes over time for glucagon and c - peptide . All tests were two - sided, with statistical significance defined as p 0.05 . There were no differences between treatment groups (interferon vs. placebo) for glucagon or c - peptide auc; therefore, all 23 subjects were combined for subsequent analyses . Subjects showed an increase in glucagon secretion following the mixed meal, with peak glucagon levels at 30 min (fig . Glucagon auc progressively increased over the 12-month observation period (p = 0.0008), whereas c - peptide auc progressively declined (p <0.0001) (fig . The magnitude of change was similar for both hormones (37% rise in glucagon vs. 45% decline in c - peptide auc over 12 months). Of the 23 subjects, 18 (78%) showed opposing changes in glucagon and c - peptide auc over time (p = 0.01). The percent rise in meal - stimulated c - peptide [100 (peak fasting)/fasting] declined over time, from 147 22% at month 0 to 85 12% at month 12 . In contrast, the percent rise in meal - stimulated glucagon increased over time, from 63 12% at month 0 to 82 9% at month 12 . Fasting glucagon rose from 40 3 ng / l at month 0 to 46 3 ng / l at month 12 . No significant correlations were found between glucagon auc and a1c, insulin dose, or insulin dose - adjusted a1c (data not shown). The phenomenon of elevated glucagon in response to oral glucose or mixed meal testing has been described cross - sectionally in patients with type 1 and type 2 diabetes, generally of several years duration (25). More recently, porksen et al . (6) reported a 17% rise in post mixed meal glucagon (measured as a single value at 90 min) from 1 to 12 months after diagnosis of type 1 diabetes . In the present study, we demonstrate a progressive, 37% rise in meal - stimulated glucagon secretion over 12 months after diagnosis of type 1 diabetes, paralleled by a 45% decline in c - peptide secretion . Fasting glucagon rose only 15% over 12 months and remained within the normal range of the assay, suggesting that hyperglucagonemia may not be recognized if only fasting blood samples are obtained . As seen in previous studies (7,8), the ability of -cells to secrete insulin in response to a stimulus declined over time in our patients with type 1 diabetes . In contrast, the ability of -cells to secrete glucagon in response to a stimulus increased over time . This suggests that -cell secretory reserve is not diminished by the ongoing autoimmune process in type 1 diabetes . Although the pathophysiology of glucagon excess during hyperglycemia in type 1 diabetes is not well understood, the opposing directions of abnormal glucagon and c - peptide secretion over time support the link between dysregulated glucagon secretion and declining -cell function . These data represent the most detailed time course to date of the progression of abnormal glucagon secretion in type 1 diabetes . We did not observe a significant correlation between glucagon auc and a1c or insulin dose; however, this may be related to small sample size . Nevertheless, the timing and rapid progression shown here suggest that excess glucagon secretion may represent a distinct therapeutic target early in the course of type 1 diabetes.
Adult male wistar rats (harlan, indianapolis, in) were housed in individual cages under specific pathogen free conditions, maintained in a temperature - controlled room with a 12:12-h light / dark cycle and provided with ad libitum access to water and standard laboratory chow (pmi nutrition international) unless otherwise stated . All procedures were performed in accordance with the national institutes of health guidelines for the care and use of laboratory animals and were approved by the animal care committee at the university of washington . To induce udm, rats received two consecutive daily subcutaneous injections (40 mg / kg) of freshly prepared stz (sigma) dissolved in ice - cold sodium citrate (ph 4.5). Subsequently, under isoflurane anesthesia, two groups of diabetic animals (n = 79 per group) received a subcutaneously implanted osmotic minipump (alzet model 2ml4; durect) containing either vehicle (stz - veh) or leptin (stz - lep) at a dosage (150 g / kg / day) calculated to restore plasma leptin levels to nondiabetic control values . Parlow (national hormone and peptide program) and diluted in pbs (ph 7.9). A control nondiabetic group (veh - veh) received sodium citrate rather than stz, followed by implantation of a subcutaneous osmotic minipump containing vehicle (pbs). Finally, to control for the effect of leptin to reduce food intake in rats with stz - induced diabetes (8), an additional group of diabetic animals receiving vehicle were pair fed (stz - veh - pf) to match the intake of stz - lep treated animals as previously described (6). Food intake, body weight, and blood glucose levels were measured daily during the mid - light cycle for 18 days . The experimental paradigm described above was subsequently repeated in separate groups of animals, with the exception that an indwelling catheter was inserted into the left carotid artery as previously described (16), before stz administration to permit blood sampling from conscious, unstressed rats for determination of plasma glucagon, catecholamine, and corticosterone levels . Determinations of body lean and fat mass were made on a separate group of animals using quantitative magnetic resonance 11 days after stz administration (echomri-700tm; echo medical systems, houston, tx). Locomotor activity was assessed by the infrared beam breaks using an opto - varimetrix-3 sensor system (columbus instruments, columbus, oh). Indirect calorimetry was performed on this same group of animals using a computer - controlled calorimetry system (oxymax; columbus instruments) in habituated animals as previously described (17). To determine the effect of leptin replacement on stz - induced insulin resistance, animals from each group were subjected to an insulin tolerance test (itt) on day 16 after stz injection . Briefly, after a 3-h fast mid - light cycle, animals received an injection of insulin (2 units / kg i.p ., humulin r; lilly), and glucose levels were determined on tail - vein blood samples using a hand - held glucometer (accu - chek; roche) at time 0 and at 30-min intervals over 120 min . Urinary glucose was measured using a gm9d glucose direct analyzer (analox instruments, london, u.k .) On urine samples obtained from animals 14 days after stz administration . Tail - vein blood samples were collected in chilled edta - treated tubes for measurement of plasma insulin and leptin on days 0, 1, 2, 3, 4, 7, and 16, and nonesterified free fatty acids (nefas) on day 16 . On day 16, arterial blood for catecholamine, corticosterone, and glucagon assays was collected from conscious, freely moving animals and placed into tubes containing egta / glutathione, edta, and benzamidine (10 l of 1 mol / l)/heparin (1 unit), respectively . Whole blood was centrifuged at 1,500 rpm for 20 min, plasma was removed, aliquoted, and stored at 20c for subsequent analysis . Free fatty acids were measured using a colorimetric assay kit that relies on fatty acid as substrate for enzymatic acylation of coa (wako chemicals). Catecholamine levels were measured in duplicate using a sensitive and specific radioenzymatic assay (18). Glucagon was assayed with a glucagon radioimmunoassay kit (linco research), and plasma corticosterone levels were measured using enzyme immunosorbent assay (diagnostics systems laboratories). To measure tissue insulin sensitivity, 18 days after stz injection, animals were fasted for a 4-h mid - light cycle, injected with either vehicle or insulin (2 units / kg i.p . ), and killed 15 min later . Liver, skeletal muscle (tibialis anterior), and white adipose tissue (wat) (epididymal depot) were excised and snap frozen for subsequent analysis . Tissues were homogenized in t - per lysis buffer (10 l / mg tissue) (pierce) supplemented with protease and phosphatase inhibitor cocktails (roche). Homogenates were centrifuged, pellets were discarded, supernatants were retained for determination of protein content using a micro bca protein assay kit (pierce), and equal amounts of protein were used for each condition in each assay . Insulin - induced activation of pi3k was assessed in tissues by measuring serine phosphorylation of akt (residue 473) using an elisa assay (invitrogen). Liver tissue triglyceride content was determined using quantitative magnetic resonance with the echo 3-in-1 mri machine (echo medical systems). Total rna was extracted from liver and pancreas using trizol b (mrc), quantified by spectrophotometry (nanodrop 1000; thermo scientific, il), and reverse - transcribed (1 g) with avian myeloblastosis virus reverse transcriptase (promega). Rt - pcr was then performed on an abi prism 7900 ht (applied biosystems) using sybr green master mix (applied biosystems). Pcr data were analyzed using the sequence detection system software (sds version 2.2; applied biosystems). Expression levels of each gene were normalized to a housekeeping gene (18s rna) and expressed as a percentage of veh - veh controls . A one - way analysis of variance with a least significant difference post hoc test was used to compare mean values among multiple groups, and a two - sample unpaired student t test was used for two - group comparisons . In all instances, to induce udm, rats received two consecutive daily subcutaneous injections (40 mg / kg) of freshly prepared stz (sigma) dissolved in ice - cold sodium citrate (ph 4.5). Subsequently, under isoflurane anesthesia, two groups of diabetic animals (n = 79 per group) received a subcutaneously implanted osmotic minipump (alzet model 2ml4; durect) containing either vehicle (stz - veh) or leptin (stz - lep) at a dosage (150 g / kg / day) calculated to restore plasma leptin levels to nondiabetic control values . Parlow (national hormone and peptide program) and diluted in pbs (ph 7.9). A control nondiabetic group (veh - veh) received sodium citrate rather than stz, followed by implantation of a subcutaneous osmotic minipump containing vehicle (pbs). Finally, to control for the effect of leptin to reduce food intake in rats with stz - induced diabetes (8), an additional group of diabetic animals receiving vehicle were pair fed (stz - veh - pf) to match the intake of stz - lep treated animals as previously described (6). Food intake, body weight, and blood glucose levels were measured daily during the mid - light cycle for 18 days . The experimental paradigm described above was subsequently repeated in separate groups of animals, with the exception that an indwelling catheter was inserted into the left carotid artery as previously described (16), before stz administration to permit blood sampling from conscious, unstressed rats for determination of plasma glucagon, catecholamine, and corticosterone levels . Determinations of body lean and fat mass were made on a separate group of animals using quantitative magnetic resonance 11 days after stz administration (echomri-700tm; echo medical systems, houston, tx). Locomotor activity was assessed by the infrared beam breaks using an opto - varimetrix-3 sensor system (columbus instruments, columbus, oh). Indirect calorimetry was performed on this same group of animals using a computer - controlled calorimetry system (oxymax; columbus instruments) in habituated animals as previously described (17). To determine the effect of leptin replacement on stz - induced insulin resistance, animals from each group were subjected to an insulin tolerance test (itt) on day 16 after stz injection . Briefly, after a 3-h fast mid - light cycle, animals received an injection of insulin (2 units / kg i.p ., humulin r; lilly), and glucose levels were determined on tail - vein blood samples using a hand - held glucometer (accu - chek; roche) at time 0 and at 30-min intervals over 120 min . Urinary glucose was measured using a gm9d glucose direct analyzer (analox instruments, london, u.k .) On urine samples obtained from animals 14 days after stz administration . Tail - vein blood samples were collected in chilled edta - treated tubes for measurement of plasma insulin and leptin on days 0, 1, 2, 3, 4, 7, and 16, and nonesterified free fatty acids (nefas) on day 16 . On day 16, arterial blood for catecholamine, corticosterone, and glucagon assays was collected from conscious, freely moving animals and placed into tubes containing egta / glutathione, edta, and benzamidine (10 l of 1 mol / l)/heparin (1 unit), respectively . Whole blood was centrifuged at 1,500 rpm for 20 min, plasma was removed, aliquoted, and stored at 20c for subsequent analysis . Plasma immunoreactive insulin and leptin levels free fatty acids were measured using a colorimetric assay kit that relies on fatty acid as substrate for enzymatic acylation of coa (wako chemicals). Catecholamine levels were measured in duplicate using a sensitive and specific radioenzymatic assay (18). Glucagon was assayed with a glucagon radioimmunoassay kit (linco research), and plasma corticosterone levels were measured using enzyme immunosorbent assay (diagnostics systems laboratories). To measure tissue insulin sensitivity, 18 days after stz injection, animals were fasted for a 4-h mid - light cycle, injected with either vehicle or insulin (2 units / kg i.p . ), and killed 15 min later . Liver, skeletal muscle (tibialis anterior), and white adipose tissue (wat) (epididymal depot) were excised and snap frozen for subsequent analysis . Tissues were homogenized in t - per lysis buffer (10 l / mg tissue) (pierce) supplemented with protease and phosphatase inhibitor cocktails (roche). Homogenates were centrifuged, pellets were discarded, supernatants were retained for determination of protein content using a micro bca protein assay kit (pierce), and equal amounts of protein were used for each condition in each assay . Insulin - induced activation of pi3k was assessed in tissues by measuring serine phosphorylation of akt (residue 473) using an elisa assay (invitrogen). Liver tissue triglyceride content was determined using quantitative magnetic resonance with the echo 3-in-1 mri machine (echo medical systems). Total rna was extracted from liver and pancreas using trizol b (mrc), quantified by spectrophotometry (nanodrop 1000; thermo scientific, il), and reverse - transcribed (1 g) with avian myeloblastosis virus reverse transcriptase (promega). Rt - pcr was then performed on an abi prism 7900 ht (applied biosystems) using sybr green master mix (applied biosystems). Pcr data were analyzed using the sequence detection system software (sds version 2.2; applied biosystems). Expression levels of each gene were normalized to a housekeeping gene (18s rna) and expressed as a percentage of veh - veh controls . A one - way analysis of variance with a least significant difference post hoc test was used to compare mean values among multiple groups, and a two - sample unpaired student t test was used for two - group comparisons . In all instances, as expected (8), plasma insulin levels were dramatically reduced by day 2 in all animals that received stz relative to nondiabetic controls, and they remained very low throughout the duration of the study (fig . The effect of stz on plasma leptin levels closely paralleled its effect on plasma insulin levels, with marked reductions observed by day 2 in diabetic animals receiving subcutaneous vehicle (fig . 1b). By design, stz - induced diabetic animals that received continuous subcutaneous leptin exhibited plasma leptin levels comparable with nondiabetic control values throughout the study (fig . Plasma insulin (a), plasma leptin (b), blood glucose (c), and mean daily food intake (d) in stz - induced diabetic animals receiving either vehicle and fed ad libitum () or pair fed (), a physiologic replacement dose of leptin () or nondiabetic controls (). * p <0.05 vs. stz - lep; #p <0.05 vs. stz - veh - pf . As expected, the reduction of plasma insulin levels in animals made diabetic by stz caused marked hyperglycemia (fig . Although marked hyperglycemia was also observed in stz - treated animals that received subcutaneous leptin, the magnitude of this effect was modestly reduced compared with that in diabetic animals receiving vehicle (p <0.05), indicating that leptin deficiency exacerbates (but is not a major cause of) hyperglycemia in rats with udm . This modest glucose - lowering effect of leptin replacement, however, cannot be explained by reduced food intake, because blood glucose was not reduced in stz - induced diabetic animals that were pair fed to the intake of stz - induced diabetic rats receiving subcutaneous leptin . By comparison in diabetic animals receiving subcutaneous vehicle, food intake was increased by day 6 after stz administration and remained elevated compared with nondiabetic controls (fig . Consistent with previous reports (8), diabetic hyperphagia was prevented by maintaining plasma leptin levels in the physiologic range, such that food intake was comparable with that of nondiabetic controls (8) (fig . Although body weight gradually increased in nondiabetic rats during the study, it decreased immediately after diabetes onset in stz - treated rats receiving vehicle and remained significantly below baseline values despite their pronounced hyperphagia (fig . Stz - induced diabetic animals that were pair fed to the intake of leptin - treated diabetic rats exhibited even greater weight loss than diabetic rats fed ad libitum, owing to their reduced food intake . Interestingly, stz - induced diabetic rats that received subcutaneous leptin lost significantly less weight than stz - veh - pf animals, maintaining weight comparable with diabetic rats fed ad libitum, despite consuming less food . Physiologic leptin replacement reduces fat mass and attenuates increased energy expenditure in stz - treated rats . Body weight change (a), percent body fat mass (b), lean body mass (c), and vo2 (d) measured using quantitative magnetic resonance and indirect calorimetry, respectively, in stz - induced diabetic animals receiving either vehicle and fed ad libitum () or pair fed (), a physiologic replacement dose of leptin () or nondiabetic controls (). * p <0.05 vs. veh - veh; #p <0.05 vs. stz - lep ., we subjected a separate cohort of animals to the same protocol and measured body composition analysis and indirect calorimetry 11 days after stz administration . We found that leptin treatment caused a greater loss of body fat mass in stz - induced diabetic animals than was observed in those receiving vehicle (fig . 2b), but also spared lean body mass relative to stz - veh - pf animals (fig . 2c). Moreover, using indirect calorimetry, we found that vo2 was markedly increased in vehicle - treated stz - induced diabetic animals relative to nondiabetic controls, regardless of whether they were fed ad libitum or pair fed and that this hypermetabolic effect was attenuated by physiologic leptin replacement (fig . However, the increased metabolic rate in stz - induced diabetic animals could not be attributed to changes in ambulatory activity (number of beam breaks: 2,953 243 for veh - veh vs. 1,562 87 for stz - veh vs. 2,215 163 for stz - lep vs. 2,927 207 for stz - veh - pf). Respiratory quotient and metabolic heat production are not reported because the assumptions involved in using the respiratory quotient to estimate heat production are not met in abnormal metabolic states, including those characterized by a shift to ketone utilization as a metabolic substrate or during rapid depletion of protein and fat stores (19,20). Nonetheless, these data collectively suggest that increased energy expenditure in stz - veh - pf relative to stz - lep - treated animals probably contributes to their excessive weight loss and depletion of lean mass, despite consuming equal amounts of food . Consistent with a previous report that insulin resistance is progressive over time in rats with stz - induced diabetes (13), we confirmed that the glucose - lowering effect of insulin was markedly diminished on day 16 compared with day 7 after stz administration (p <0.05) (fig . 3a). To determine whether reduced plasma leptin levels contribute to this progressive insulin resistance, animals that received either vehicle or a physiologic replacement dose of leptin were subjected to an itt 16 days after induction of udm with stz . Relative to stz - treated animals receiving vehicle, the ability of insulin to reduce blood glucose was dramatically enhanced in those that received leptin (p <0.05) (fig . 3b). To account for differences in the level of hyperglycemia at the onset of the itt, insulin - induced changes of blood glucose were also analyzed as a percentage of basal values (fig . Regardless of whether blood glucose levels were analyzed as absolute values or as percent basal, physiologic leptin replacement in stz - induced diabetes markedly increased insulin sensitivity via a mechanism that could not be attributed to changes in food intake, since it was not observed in stz - veh - pf animals (fig . 3b physiologic leptin replacement improves insulin sensitivity in stz - treated rats . A: blood glucose levels in stz - induced diabetic animals on day 7 () and 16 () after stz - injection during an insulin tolerance test (2 units / kg). * . Blood glucose levels (b), percent basal blood glucose levels (c), and the inverse integrated area under the percent basal glucose curve (d) in stz - induced diabetic animals receiving either vehicle and fed ad libitum () or pair fed (), a physiologic replacement dose of leptin () or nondiabetic controls () during an itt (2 units / kg) * p <0.05 vs. stz - lep; #p <0.05 vs. stz - veh - pf . To further characterize the impact of physiologic leptin replacement on insulin action in udm, we examined insulin - induced activation of the irs - pi3k - akt signal transduction pathway in liver, muscle, and wat . After intraperitoneal saline, there were no differences in levels of ps473-akt in any tissue among treatment groups, but, as expected, systemic insulin injection significantly increased levels of ps473-akt in liver, muscle, and wat in all groups compared with saline (p <0.05) (fig . The ability of insulin to increase levels of ps473-akt was reduced in stz - treated animals receiving vehicle compared with nondiabetic controls, and this effect was prevented by physiologic leptin replacement (fig . 4a). Furthermore, because insulin - stimulated production of ps473-akt was also reduced in stz - veh - pf livers, the effect of leptin to normalize this response cannot be explained by reduced food intake . In contrast, insulin - induced activation of ps473-akt in skeletal muscle was not affected by either stz - induced diabetes or by leptin administration (fig . Although insulin significantly increased ps473-akt in wat of animals in each group relative to saline - injected controls, the response to insulin was significantly attenuated in all stz - induced diabetic animals relative to that in nondiabetic controls (fig . Effect of intraperitoneal (2 units / kg) insulin ()-induced activation of serine phosphorylation of akt compared with vehicle () in liver (a), muscle (tibialis anterior) (b), and wat (epididymal fat) (c) in stz - induced diabetic animals receiving either vehicle and fed ad libitum (stz - veh) or pair fed (stz - veh - pf) a physiologic replacement dose of leptin (stz - lep) or nondiabetic controls (veh - veh). * p <0.05 vs. veh - veh - veh; #p <0.05 vs. veh - veh - ins . Uncontrolled diabetes is associated with increased circulating levels of both glucagon and corticosterone, and these responses are implicated in diabetes manifestations including insulin resistance, hyperglycemia, and hyperphagia (2123). Based on recent evidence that adenovirally induced hyperleptinemia ameliorates hyperglycemia via normalization of elevated plasma glucagon levels (14), we determined whether maintaining physiologic leptin levels also is sufficient to prevent diabetes - induced increases of plasma glucagon and broadened the hypothesis to include other counterregulatory hormones . Consistent with the aforementioned findings (14), plasma glucagon levels were elevated in stz - treated animals receiving vehicle relative to that in nondiabetic controls, and this elevation was prevented by physiologic leptin replacement (fig . Thus, leptin deficiency appears to be required for the effect of udm to raise glucagon levels . Similarly, plasma corticosterone levels were increased in stz - treated rats, and this effect was also attenuated by leptin replacement (fig . Normalization of both plasma glucagon and corticosterone levels may therefore contribute to improved hepatic insulin sensitivity and modest reduction of plasma glucose induced by leptin replacement, but catecholamines are unlikely to be involved . Arterial plasma glucagon (a), corticosterone (b), norepinephrine (ne) (c), and epinephrine (epi) (d) levels in nondiabetic controls (veh - veh) or in stz - induced diabetic animals receiving either vehicle (stz - veh) or a physiologic replacement dose of leptin (stz - lep). * p <0.05 vs. veh - veh; #p <0.05 vs. stz - lep . To investigate whether changes in plasma or tissue lipid accumulation might contribute to the effect of leptin on insulin sensitivity, we measured both plasma nefa levels and triglyceride content in liver . We found no differences in either plasma nefa levels (day 16) or liver triglyceride content in stz - veh treated animals compared with nondiabetic controls, regardless of whether they were fed ad libitum or pair fed, but these levels were both reduced in diabetic animals that received leptin (fig . Plasma nefas obtained from tail - vein samples (a), hepatic triglyceride content (b) and expression of g6pase (c), pepck (d), pgc-1 (e), and igfbp2 (f) using real - time pcr in nondiabetic controls (veh - veh) or in stz - induced diabetic animals receiving either vehicle and fed ad libitum (stz - veh) or pair fed (stz - veh - pf) or a physiologic replacement dose of leptin (stz - lep). * p <0.05 vs. veh - veh; #p <0.05 vs. stz - lep . To investigate the role of leptin deficiency in the effect of udm to increase hepatic glucose production and hepatic insulin resistance (24), we used real - time pcr to measure hepatic expression of mrna encoding g6pase and pepck in the absence of insulin injection . As expected, levels of both mrna species were elevated in diabetic animals that received vehicle relative to nondiabetic controls (fig . In contrast, hepatic expression of both g6pase and pepck genes was comparable between diabetic animals receiving leptin and nondiabetic controls and was significantly below vehicle - treated diabetic animals . This effect is not attributable to reduced food intake, since pair feeding was without effect (fig . A similar pattern of hepatic expression was seen for mrna encoding peroxisome proliferator activated receptor-coactivator-1 (pgc-1), a transcriptional coregulator implicated in the activation of both g6pase and pepck . Thus, leptin deficiency is required for increased hepatic expression of gluconeogenic genes in udm . By comparison, igfbp2, a recently reported hepatic gene implicated in the action of leptin to suppress hepatic glucose production (15), was increased> 20-fold in stz - induced diabetic rats relative to nondiabetic controls, and this diabetes - induced upregulation was not affected by leptin treatment (fig . As expected (8), plasma insulin levels were dramatically reduced by day 2 in all animals that received stz relative to nondiabetic controls, and they remained very low throughout the duration of the study (fig . The effect of stz on plasma leptin levels closely paralleled its effect on plasma insulin levels, with marked reductions observed by day 2 in diabetic animals receiving subcutaneous vehicle (fig . 1b). By design, stz - induced diabetic animals that received continuous subcutaneous leptin exhibited plasma leptin levels comparable with nondiabetic control values throughout the study (fig . Plasma insulin (a), plasma leptin (b), blood glucose (c), and mean daily food intake (d) in stz - induced diabetic animals receiving either vehicle and fed ad libitum () or pair fed (), a physiologic replacement dose of leptin () or nondiabetic controls (). * p <0.05 vs. stz - lep; #p <0.05 vs. stz - veh - pf . As expected, the reduction of plasma insulin levels in animals made diabetic by stz caused marked hyperglycemia (fig . Although marked hyperglycemia was also observed in stz - treated animals that received subcutaneous leptin, the magnitude of this effect was modestly reduced compared with that in diabetic animals receiving vehicle (p <0.05), indicating that leptin deficiency exacerbates (but is not a major cause of) hyperglycemia in rats with udm . This modest glucose - lowering effect of leptin replacement, however, cannot be explained by reduced food intake, because blood glucose was not reduced in stz - induced diabetic animals that were pair fed to the intake of stz - induced diabetic rats receiving subcutaneous leptin . By comparison in diabetic animals receiving subcutaneous vehicle, food intake was increased by day 6 after stz administration and remained elevated compared with nondiabetic controls (fig . Consistent with previous reports (8), diabetic hyperphagia was prevented by maintaining plasma leptin levels in the physiologic range, such that food intake was comparable with that of nondiabetic controls (8) (fig . Although body weight gradually increased in nondiabetic rats during the study, it decreased immediately after diabetes onset in stz - treated rats receiving vehicle and remained significantly below baseline values despite their pronounced hyperphagia (fig . Stz - induced diabetic animals that were pair fed to the intake of leptin - treated diabetic rats exhibited even greater weight loss than diabetic rats fed ad libitum, owing to their reduced food intake . Interestingly, stz - induced diabetic rats that received subcutaneous leptin lost significantly less weight than stz - veh - pf animals, maintaining weight comparable with diabetic rats fed ad libitum, despite consuming less food . Physiologic leptin replacement reduces fat mass and attenuates increased energy expenditure in stz - treated rats . Body weight change (a), percent body fat mass (b), lean body mass (c), and vo2 (d) measured using quantitative magnetic resonance and indirect calorimetry, respectively, in stz - induced diabetic animals receiving either vehicle and fed ad libitum () or pair fed (), a physiologic replacement dose of leptin () or nondiabetic controls (). * p <0.05 vs. veh - veh; #p <0.05 vs. stz - lep ., we subjected a separate cohort of animals to the same protocol and measured body composition analysis and indirect calorimetry 11 days after stz administration . We found that leptin treatment caused a greater loss of body fat mass in stz - induced diabetic animals than was observed in those receiving vehicle (fig . 2b), but also spared lean body mass relative to stz - veh - pf animals (fig . 2c). Moreover, using indirect calorimetry, we found that vo2 was markedly increased in vehicle - treated stz - induced diabetic animals relative to nondiabetic controls, regardless of whether they were fed ad libitum or pair fed and that this hypermetabolic effect was attenuated by physiologic leptin replacement (fig . However, the increased metabolic rate in stz - induced diabetic animals could not be attributed to changes in ambulatory activity (number of beam breaks: 2,953 243 for veh - veh vs. 1,562 87 for stz - veh vs. 2,215 163 for stz - lep vs. 2,927 207 for stz - veh - pf). Respiratory quotient and metabolic heat production are not reported because the assumptions involved in using the respiratory quotient to estimate heat production are not met in abnormal metabolic states, including those characterized by a shift to ketone utilization as a metabolic substrate or during rapid depletion of protein and fat stores (19,20). Nonetheless, these data collectively suggest that increased energy expenditure in stz - veh - pf relative to stz - lep - treated animals probably contributes to their excessive weight loss and depletion of lean mass, despite consuming equal amounts of food . Consistent with a previous report that insulin resistance is progressive over time in rats with stz - induced diabetes (13), we confirmed that the glucose - lowering effect of insulin was markedly diminished on day 16 compared with day 7 after stz administration (p <0.05) (fig . 3a). To determine whether reduced plasma leptin levels contribute to this progressive insulin resistance, animals that received either vehicle or a physiologic replacement dose of leptin were subjected to an itt 16 days after induction of udm with stz . Relative to stz - treated animals receiving vehicle, the ability of insulin to reduce blood glucose was dramatically enhanced in those that received leptin (p <0.05) (fig . 3b). To account for differences in the level of hyperglycemia at the onset of the itt, insulin - induced changes of blood glucose were also analyzed as a percentage of basal values (fig . 3c). Regardless of whether blood glucose levels were analyzed as absolute values or as percent basal, physiologic leptin replacement in stz - induced diabetes markedly increased insulin sensitivity via a mechanism that could not be attributed to changes in food intake, since it was not observed in stz - veh - pf animals (fig . 3b physiologic leptin replacement improves insulin sensitivity in stz - treated rats . A: blood glucose levels in stz - induced diabetic animals on day 7 () and 16 () after stz - injection during an insulin tolerance test (2 units / kg). . Blood glucose levels (b), percent basal blood glucose levels (c), and the inverse integrated area under the percent basal glucose curve (d) in stz - induced diabetic animals receiving either vehicle and fed ad libitum () or pair fed (), a physiologic replacement dose of leptin () or nondiabetic controls () during an itt (2 units / kg) * p <0.05 vs. stz - lep; #p <0.05 vs. stz - veh - pf . To further characterize the impact of physiologic leptin replacement on insulin action in udm, we examined insulin - induced activation of the irs - pi3k - akt signal transduction pathway in liver, muscle, and wat . After intraperitoneal saline, there were no differences in levels of ps473-akt in any tissue among treatment groups, but, as expected, systemic insulin injection significantly increased levels of ps473-akt in liver, muscle, and wat in all groups compared with saline (p <0.05) (fig . The ability of insulin to increase levels of ps473-akt was reduced in stz - treated animals receiving vehicle compared with nondiabetic controls, and this effect was prevented by physiologic leptin replacement (fig . Furthermore, because insulin - stimulated production of ps473-akt was also reduced in stz - veh - pf livers, the effect of leptin to normalize this response cannot be explained by reduced food intake . In contrast, insulin - induced activation of ps473-akt in skeletal muscle was not affected by either stz - induced diabetes or by leptin administration (fig . 4b). Finally, although insulin significantly increased ps473-akt in wat of animals in each group relative to saline - injected controls, the response to insulin was significantly attenuated in all stz - induced diabetic animals relative to that in nondiabetic controls (fig . Effect of intraperitoneal (2 units / kg) insulin ()-induced activation of serine phosphorylation of akt compared with vehicle () in liver (a), muscle (tibialis anterior) (b), and wat (epididymal fat) (c) in stz - induced diabetic animals receiving either vehicle and fed ad libitum (stz - veh) or pair fed (stz - veh - pf) a physiologic replacement dose of leptin (stz - lep) or nondiabetic controls (veh - veh). * p <0.05 vs. veh - veh - veh; #p <0.05 vs. veh - veh - ins . Uncontrolled diabetes is associated with increased circulating levels of both glucagon and corticosterone, and these responses are implicated in diabetes manifestations including insulin resistance, hyperglycemia, and hyperphagia (2123). Based on recent evidence that adenovirally induced hyperleptinemia ameliorates hyperglycemia via normalization of elevated plasma glucagon levels (14), we determined whether maintaining physiologic leptin levels also is sufficient to prevent diabetes - induced increases of plasma glucagon and broadened the hypothesis to include other counterregulatory hormones . Consistent with the aforementioned findings (14), plasma glucagon levels were elevated in stz - treated animals receiving vehicle relative to that in nondiabetic controls, and this elevation was prevented by physiologic leptin replacement (fig . Thus, leptin deficiency appears to be required for the effect of udm to raise glucagon levels . Similarly, plasma corticosterone levels were increased in stz - treated rats, and this effect was also attenuated by leptin replacement (fig . Normalization of both plasma glucagon and corticosterone levels may therefore contribute to improved hepatic insulin sensitivity and modest reduction of plasma glucose induced by leptin replacement, but catecholamines are unlikely to be involved . Arterial plasma glucagon (a), corticosterone (b), norepinephrine (ne) (c), and epinephrine (epi) (d) levels in nondiabetic controls (veh - veh) or in stz - induced diabetic animals receiving either vehicle (stz - veh) or a physiologic replacement dose of leptin (stz - lep). * p <0.05 vs. veh - veh; #p <0.05 vs. stz - lep . To investigate whether changes in plasma or tissue lipid accumulation might contribute to the effect of leptin on insulin sensitivity, we measured both plasma nefa levels and triglyceride content in liver . We found no differences in either plasma nefa levels (day 16) or liver triglyceride content in stz - veh treated animals compared with nondiabetic controls, regardless of whether they were fed ad libitum or pair fed, but these levels were both reduced in diabetic animals that received leptin (fig . Plasma nefas obtained from tail - vein samples (a), hepatic triglyceride content (b) and expression of g6pase (c), pepck (d), pgc-1 (e), and igfbp2 (f) using real - time pcr in nondiabetic controls (veh - veh) or in stz - induced diabetic animals receiving either vehicle and fed ad libitum (stz - veh) or pair fed (stz - veh - pf) or a physiologic replacement dose of leptin (stz - lep). * p <0.05 vs. veh - veh; #p <0.05 vs. stz - lep . To investigate the role of leptin deficiency in the effect of udm to increase hepatic glucose production and hepatic insulin resistance (24), we used real - time pcr to measure hepatic expression of mrna encoding g6pase and pepck in the absence of insulin injection . As expected, levels of both mrna species were elevated in diabetic animals that received vehicle relative to nondiabetic controls (fig . In contrast, hepatic expression of both g6pase and pepck genes was comparable between diabetic animals receiving leptin and nondiabetic controls and was significantly below vehicle - treated diabetic animals . This effect is not attributable to reduced food intake, since pair feeding was without effect (fig . A similar pattern of hepatic expression was seen for mrna encoding peroxisome proliferator activated receptor-coactivator-1 (pgc-1), a transcriptional coregulator implicated in the activation of both g6pase and pepck . Thus, leptin deficiency is required for increased hepatic expression of gluconeogenic genes in udm . By comparison, igfbp2, a recently reported hepatic gene implicated in the action of leptin to suppress hepatic glucose production (15), was increased> 20-fold in stz - induced diabetic rats relative to nondiabetic controls, and this diabetes - induced upregulation was not affected by leptin treatment (fig . Growing evidence suggests that either impaired or deficient leptin signaling results in the development of insulin resistance and impaired glucose metabolism (1,46,25). Here, we report that leptin deficiency also contributes to the development of progressive insulin resistance and associated neuroendocrine derangements in udm . We found that systemic administration of exogenous leptin at a dose that maintains normal physiologic plasma leptin levels prevented the development of severe, progressive insulin resistance in rats with udm and that this effect could not be explained by leptin - induced changes in food intake or body weight . Moreover, the mechanism underlying this effect appears to preferentially involve the liver, as physiologic leptin replacement in udm reduced hepatic triglyceride content and gluconeogenic gene expression and also restored insulin signal transduction to normal in liver, but not in skeletal muscle or wat . In addition, physiologic leptin replacement in udm reduced body fat while sparing lean mass, attenuated the increased energy expenditure that accompanies udm (26), and normalized elevated levels of plasma glucagon and corticosterone . Taken together, these findings implicate leptin deficiency as a cause of wide - ranging metabolic and neuroendocrine derangements associated with udm . Although insulin resistance is a well - documented complication of udm (1012,27), few studies have sought to identify the underlying mechanism . Some investigators have postulated a role for hyperglycemia, based on a model in which glucose toxicity impairs insulin signal transduction in peripheral tissues (28,29). Consistent with this, insulin resistance in individuals with type 1 diabetes is attenuated when glycemic control is improved (30,31), whereas uncontrolled hyperglycemia induces insulin resistance in these individuals (32,33). Our finding that physiologic leptin replacement prevented udm - induced insulin resistance with only very modest effects to reduce diabetic hyperglycemia, however, suggests that in this study, hyperglycemia per se is unlikely to play a major role . Although reduced food intake might also be expected to contribute to the insulin - sensitizing effects of leptin, this possibility is inconsistent with our finding that diabetic animals pair fed to the intake of those receiving leptin failed to exhibit an improvement of insulin sensitivity . In light of the potent insulin - sensitizing effect of leptin replacement in rats with udm, presumably this reflects the severe insulin deficiency characteristic of this model, such that improved insulin sensitivity has little impact on ambient glucose levels in the absence of insulin therapy . This observation also highlights an important distinction between the effect of physiologic leptin replacement we observed in the current work, and recent work examining the effect of pharmacologic hyperleptinemia in udm (5,14). In the latter, induction of very high circulating leptin levels in rodents with udm resulted in full normalization of hyperglycemia, whereas this clearly was not the case in our study . Thus, normalization of hyperglycemia in udm cannot be achieved simply by physiologic replacement of endogenous leptin, but apparently requires pharmacologic levels of leptin . Complementing our finding that physiologic leptin replacement enhances insulin - mediated glucose lowering in stz - induced diabetic animals, we found that this intervention also restored insulin signaling in liver, but not in skeletal muscle or adipose tissue, as measured by insulin - induction of pakt . The mechanisms underlying this improvement in hepatic insulin signaling remain uncertain but could involve reductions of body fat mass and/or liver triglyceride content . Alternatively, we recently reported that leptin action in the hypothalamic arcuate nucleus improves hepatic insulin action via a mechanism involving the hepatic vagus nerve (6). Thus, additional studies are warranted to determine whether this autonomic mechanism might also contribute to the improved insulin sensitivity after physiologic leptin replacement in udm . Studies have shown that udm is associated with increased plasma glucagon levels and elevated hepatic expression of the gluconeogenic genes g6pase and pepck, and these responses are implicated in the pathogenesis of insulin resistance (34,35) and diabetic hyperglycemia (21,22). Our finding that physiologic leptin replacement in udm dramatically improved insulin sensitivity and normalized elevated levels of both plasma glucagon and hepatic expression of these gluconeogenic genes is consistent with this hypothesis . A recent study reported that hyperleptinemia induced by an adenoviral gene therapy approach ameliorated hyperglycemia in stz - induced diabetes, and this was hypothesized to occur via a suppression of hyperglucagonemia and consequent reduction of hepatic gluconeogenic gene expression (14). Previous studies, however, have not established the extent to which hyperglycemia in udm might be driven by increases of glucagon and associated changes of glucose production . In this context, we note that although plasma glucagon levels and hepatic expression of g6pase and pepck were normalized by physiologic leptin replacement in our study, hyperglycemia was only slightly improved compared with that in diabetic animals that received vehicle . These data suggest that normalization of plasma glucagon levels plays only a minor role in leptin's antidiabetic effects, although it remains possible that hyperglucagonemia contributes to progressive insulin resistance in udm . Further, our findings identify for the first time a role for leptin deficiency in the effect of udm to raise circulating glucagon levels . Hyperglucagonemia and the energy cost associated with increased gluconeogenesis are implicated in the increased metabolic rate in patients with poorly controlled type 1 diabetes, an effect that is reversed by insulin treatment (26). Such a mechanism may also explain the marked increase in energy expenditure in stz - induced diabetic rats relative to that of nondiabetic controls, as this cannot be explained by changes in activity . Changes in food intake are also unlikely to explain this metabolic response to udm, because metabolic rate was increased similarly in stz - veh and stz - veh - pf groups . Although leptin has previously been demonstrated to increase energy expenditure, at least in part via sympathetic activation of brown adipose tissue (36), we found that the elevated metabolic rate induced by udm was attenuated by leptin replacement . Although the mechanism underlying this leptin effect awaits further study, suppression of elevated rates of gluconeogenesis and perhaps other futile cycles seems likely . To our knowledge, this is the first demonstration of an effect of leptin to lower metabolic rate, and it reinforces the concept that the effect of leptin on metabolic regulation is highly context dependent . These data also help explain why leptin - treated diabetic animals lose weight in amounts similar to those for animals receiving vehicle, despite consuming much less food . Indeed, matching the intake of stz - veh animals by pair feeding to that of leptin - replaced rats produced excessive weight loss . These findings collectively suggest that leptin deficiency is a major determinant of hypermetabolism induced by udm . It has been shown that udm is also characterized by increased glucocorticoid secretion and activation of the hypothalamic - adrenal - pituitary (hpa) axis (37,38). Because glucocorticoids both inhibit peripheral glucose uptake in muscle and adipose tissue and induce hepatic expression of g6pase and pepck (39), hpa activation in udm probably contributes to insulin resistance in this setting . Our finding that leptin replacement normalized elevated plasma corticosterone levels in stz - induced diabetic rats provides a plausible mechanism to explain the observed improvement of insulin sensitivity but again suggests that increased circulating glucocorticoid levels are not a dominant cause of hyperglycemia in udm . Also of interest here is the implication that leptin deficiency causes hpa activation in udm, as has been suggested in other conditions (40). Recently, it was reported that systemic administration of leptin upregulates hepatic expression of igfbp2 and adenovirus - induced overexpression of igfbp2 normalizes blood glucose levels in insulin - resistant and udm mice (15). Our finding that hepatic expression of igfpb2 was increased> 20-fold in leptin - deficient stz - induced diabetic animals relative to that in nondiabetic controls, however, suggests that increased hepatic expression of this gene is unlikely to exert salutary effects in the setting of udm, an impression confirmed by the absence of any effect of leptin replacement on igfpb2 mrna levels . Thus, hepatic igfbp2 is unlikely to explain the effect of physiologic leptin replacement to improve insulin sensitivity in udm . Several lines of evidence suggest that insulin resistance occurs in patients with type 1 diabetes (1012,27) and is an independent risk factor for micro- and macrovascular complications in these patients (41,42). However, therapeutic approaches currently available for treating insulin resistance in type 1 diabetes are quite limited . Although intensive insulin therapy in individuals with type 1 diabetes improves insulin sensitivity and glycemic control, the diabetes control and complication trial (dcct) reported that although intensive insulin therapy preserves pancreatic -cell function and improves retinopathy and neuropathy, these benefits are offset by an increased frequency of severe hypoglycemia and weight gain (4345). In contrast, treating type 1 diabetic subjects with lifestyle modifications, such as diet (46) and exercise (47), or pharmaceutical approaches using thiazolidinediones (48) or metformin (49), yield improvements in insulin sensitivity in type 1 diabetic subjects, but not glycemic control . Our current data raise the possibility that a combination therapy approach using both insulin and leptin treatment in type 1 diabetic patients may reduce the amount of insulin required to achieve good glycemic control and also limit weight gain (50). In summary, we report that stz - induced diabetes causes a rapid and severe reduction of plasma leptin levels that precedes the development of severe insulin resistance . The latter effect was prevented by restoration of plasma leptin to normal physiologic levels which also reduced hepatic triglyceride content and restored normal insulin signal transduction in the liver . Moreover, physiologic replacement of plasma leptin levels suppressed the characteristic increase of plasma glucagon and corticosterone levels and elevated hepatic expression of the gluconeogenic genes pepck and g6pase in udm but only modestly reduced the extent of hyperglycemia . These findings also implicate leptin deficiency as a cause of hyperglucagonemia and suggest that although normalization of elevated plasma glucagon levels may contribute to the antidiabetic effects of pharmacologic leptin therapy, other factors must also be involved . We conclude that leptin deficiency plays a major role in the progressive, severe insulin resistance characteristic of udm . This novel finding also raises the therapeutic possibility that supplementing insulin treatment with leptin may be a useful adjunct in the management of type 1 diabetes.
Pelvic digits are rare congenital anomalies that develop in soft tissue. (1 - 4) there are less than twenty reported cases in the literature . The majority of reported pelvic digits are asymptomatic and found incidentally during radiography. (2) to date, there has never been a report describing a patient with a pelvic digit who presents with a chief complaint of dyspareunia . To the best of our knowledge, this is the third reported case of a symptomatic pelvic digit and emphasizes the importance of considering lesions of the bony pelvis in the differential diagnosis of dyspareunia . A 57-year - old caucasian female presented with a chief complaint of more than one year of dyspareunia . Her past medical history includes chronic bilateral knee, hip and ankle pain and had a right total hip arthroplasty that required multiple revisions . She had no pain with hip range of motion and her motor and sensory examinations were intact . Review of her radiographs demonstrated a well - positioned right total hip arthroplasty without any evidence of loosening or wear . However, there was an osseous growth projecting from the inferior aspect of left ischium toward the perineal region . Additional imaging with computed tomography (ct) and non contrast magnetic resonance (mr) were used to further define the lesion . Representative images, including: a plain radiograph (figure 1), 3d reconstructed computed tomography (figue 2) and t1 coronal magnetic resonance imaging (figure 3) indicated a bony excrescence from the inferior aspect of the left ischium measuring 1.7 x 1.1 cm . Review of a previous ct scan from 2 years prior to the most recent study, demonstrated a stable lesion . Plain x - ray: ap pelvis demonstrating pelvic digit arising from the left ischium 3d reconstructed computed tomography demonstrating the pelvic digit magnetic resonance imaging demonstrating a pelvic digit the above studies were suggestive of a pelvic digit . The patient s chief complaint was painful intercourse and she elected to proceed with a resection . Pathology found no evidence of malignancy and the patient was discharged without pain and able to ambulate without support of a walker . The removed pelvic digit had two bony segments that formed a pseudoarticulartion or joint, visible in images a and b. follow up via a telephone communication indicated that her dyspareunia had resolved . Literature reports have suggested various origins of the pelvic digit, including congenital formation, myositis ossificans, or traumatic avulsion. (1 - 3,5,6) in this case, the defining features were that it was well corticated with a pseudoarticulation between bony segments, resembling a digit . Typically this would occur prior to the sixth week of fetal life in the mesynchymal stage. (6,8) in most reported cases the pelvic digit is an incidental finding on radiography . Pandey et al . And maegele report the only other cases of symptomatic pelvic digits in a 35 and a 40 year old man, respectively. (6,9) these patients both experienced chronic hip pain, tenderness to palpation of the affected region and limited range of motion. (6,9) surgical excision was curative for chronic pain and increasing range of motion in both instances. (6,9) in summary, pelvic digits are typically incidental findings on imaging studies . However, in order to facilitate the diagnosis and treatment of pelvic conditions, physicians should be aware that this anomaly can be a source of pain and disability.
Amniotic band syndrome has many synonyms such as, congenital constriction rings, amniotic bands, limb body wall complex, adam complex this syndrome comprises a variety of anatomical abnormalities among newborns, and is associated with intrauterine struggling by the fetus in the uterus, thereby leading to deformations, malformations, or ruptures . Amniotic band syndrome occurs in around 1:1,200 to 1:1,500 live newborns, but lack of correct diagnosis certainly underestimates the real occurrence rate . The clinical manifestations of amniotic band syndrome are extremely variable, and their extent may range from a single abnormality, like a constriction ring, to multiple abnormalities . Almost all cases are sporadic, even though some rare evidences of familial cases have been described . Limb constrictions occur most frequently, ranging in severity from deformity of the distal part of the limb to partial or total amputation . Craniofacial abnormalities are the most serious type, because of the importance of the organs involved . Visceral abnormalities are a rare form of the syndrome, among which gastroschisis is the most frequent type . Generally the diagnosis is made by means of two - dimensional ultrasonography (2dus) at the end of the first or the beginning of the second trimester of pregnancy . Three - dimensional ultrasonography (3dus) in rendering mode allows reconstruction of the surface of the fetus, thus, enabling spatial analysis . In cases of fetal malformation, only three case reports describing the use of 3dus for diagnosing amniotic band syndrome exist in the literature . In two of them, 3dus was used at the end of the first and the beginning of the second trimester, and only one case was in the third trimester . We present a case of amniotic band syndrome diagnosed in the 34 week, in which 3dus enabled clear analysis of this malformation, as well as better understanding and better family counseling . Her prenatal care had begun late, and she had only undergone one ultrasound examination, in the 20 week, that had not shown any fetal abnormalities . All the prenatal laboratory tests were normal, and the patient said that she had not been making any personal use of medicines or using any illicit drugs, and that there were no cases of malformations or chronic diseases like arterial hypertension and diabetes mellitus among members of her family . 2dus showed normal fetal growth, with a weight prediction of 2.242 g, amniotic fluid index (afi) of 140, and anterior placenta . There was an accessory lobe on the left lateral posterior wall, and a membrane (amniotic band) was present between this lobe and the main placental mass . Morphological analysis showed two bands adhering to the right forearm of the fetus, but with normal movements of this limb and its fingers [figure 1]. 3dus was performed using a multifrequency volumetric transducer (accuvix v20; samsung medison, seoul, korea) and clearly showed the spatial relationship between the bands and the body of the fetus, thus proving that the bands had really adhered to the forearm, but without strangling it [figure 2]. The 3d image allowed the parents to gain a better understanding of the condition and enabled better counseling toward a good prognosis for the fetus . The pregnant woman had her delivery scheduled as a caesarian section in the 38 week, and the postnatal phenotypic examination confirmed the diagnosis of amniotic band syndrome without injury to the forearm of the fetus . The newborn underwent surgery to remove the bands on the third day of life and was subsequently discharged in a good general condition . Two - dimensional ultrasonography shows adherence of two amniotic bands to the right forearm of the fetus (white arrows). (a) and (b) three - dimensional ultrasonography in rendering mode, shows amniotic bands adhering to the right forearm of the fetus (white arrows), without constriction rings . Two theories have been formulated in attempts to explain the pathogenesis of amniotic band syndrome . The streeter theory, which was accepted for a long time, takes the view that imperfect local embryonic development would indicate the abnormalities observed . The theory put forward by torpin in 1965 is the one that is most accepted . This author took the view that the problem begins because of rupturing of the amniotic sac, thereby separating the chorion and amnion, such that some of the amniotic liquid goes out into the chorionic cavity . The fibrotic strings formed from the chorion would prevent normal development of some anatomical parts of the fetus, thus resulting in different kinds of abnormalities . According to higginbottom et al ., three mechanisms would explain the role of the bands in originating the malformations: a) interruption of the normal morphogenesis, for example, at the time of the facial fusion process; b) deformation due to compression of parts of the fetus (oligohidramnios) or interlacing of an anatomical part of the fetus by a band; or c) injury to a part of the fetus that had already formed, like in the cases with constriction rings around the limbs . One of the possible causes of an amniotic lesion is maternal abdominal trauma; other, less likely causes might be drug use or ammonites . Some cases of amniotic band syndrome in patients that underwent amniocentesis on the beginning of the 2 trimester and chorionic villus sample have been described . Rare descriptions of intrafamilial repetitions of constriction rings or congenital limb amputation give rise to the assumption that a genetic contribution could occur in some cases . In our case, the patient did not have any antecedents, so we could assume that this case had a sporadic origin . The late diagnosis was a consequence of prenatal care that had begun late and of an ultrasound scan performed in the 20 week that did not show any fetal abnormalities . 3dus enabled spatial analysis on the fetus proving that the bands had adhered to the surface of the right forearm of the fetus . Moreover, 3dus provides proof that the prognosis for the fetus is good when it does not show any strangling of the limb, and it allows better understanding and better parent counseling . Described a case of amniotic band syndrome diagnosed in the 14 week by 3dus, which was associated with severe fetus malformations, and in which the parents decided to terminate the pregnancy . Likewise, hata et al . Described two cases of this syndrome diagnosed in the 13 and 14 weeks, in which 3dus made it possible to conduct analysis on the spatial relationship between the bands and the fetus, as well as enabling counseling for the parents . The case of amniotic band syndrome with the latest diagnosis by 3dus (and the only one in the third trimester until now) was described by paladini et al . These authors described a case in the 28 week, similar to ours, but in their case a constriction ring was observed on the forearm of the fetus and was confirmed after birth . In summary, this is the second case description of late diagnosis of amniotic band syndrome by 3dus . This method was shown to be important for proving that the bands had adhered to the limb of the fetus and showing that the prognosis is good when no constriction ring is demonstrated . In addition, 3dus allowed better understanding of the pathology, better counseling for the parents, and a good prognosis for the newborn.
Copd is a common pathology and, according to the world health organization, will be the third leading cause of death by 2025.1 in france, the prevalence of copd is in ~5%10% of adults> 45 years old.2 its human and social impact is marked, affecting 3.5 millions of individuals, with> 40,000 new cases diagnosed annually,> 100,000 hospitalizations, and> 16,000 deaths.3 moreover, copd is expensive, with direct costs in 2005 estimated at 3.5 billion euros, ie, 3.5% of health care costs.4 the underdiagnosis of copd is high, and two - thirds of the patients are never diagnosed.59 the benefits of early diagnosis of copd remain the subject of debate . However, numerous arguments support copd screening, most notably because forced expiratory volume in 1 second (fev1) declines rapidly at the early stage,10,11 effective treatments exist to diminish dyspnea and the frequency of exacerbations,12 and outcomes of attempts to quit smoking might improve after diagnosis.13,14 in a finnish global screening program, early copd management was able to lower the number of hospitalizations by ~40%.15 furthermore, the diagnosis of copd at the time of hospitalization, as is the case for ~35% of the patients admitted for the first copd exacerbation, evidently seems late.16 the organization of early copd screening has not been formalized, even though the global initiative for chronic obstructive lung disease (gold) group recommends screening of all smokers> 40 years old.12 the diagnosis of copd relies on the spirometric demonstration of airflow obstruction (ao). General practitioners (gps) are first in line to screen for copd, especially because the patient is neither encouraged nor inclined to consult a pneumologist . Notably, in the french zephyr study,> 40% of the patients at risk for copd did not go to a pneumologist for spirometry, despite being prescribed by their gp.17 to counter this reluctance, spirometry in primary care was developed in some european countries . Nonetheless, its use in this context remains very limited in many countries, including france . The obstacles are many: lack of time to conduct the test, absence of gp interest, insufficient training, difficulties in choosing the instruments, etc . We decided to undertake a study on the feasibility of spirometry screening for copd in primary care in france . The time factor was often raised as limiting the implementation of new techniques or strategies in general medicine, where the estimated mean consultation duration is 15 minutes.18 thus, after two education sessions dedicated to spirometry in the framework of copd screening, we examined spirometry duration . The study was approved by the saint - germain - en - laye ethics committee and by the comit consultatif sur le traitement de linformation en matire de recherche dans le domaine de la sant . Ten volunteer gps working in the suburbs west of paris were trained by two pneumologists during two 3-hour continuing education sessions . During the first session, the study protocol was explained and the gps received theoretical and practical training in spirometry and were provided with a portable spirometer (spirodoc coupled to winspiropro software; mir, langlade, france). This instrument allows direct visualization of the flow volume curve and the expiration time . The gps were asked to come to a second session with five test results to pursue their training . Before and after the sessions, a 12-question questionnaire evaluating each participant s knowledge of spirometry, its acceptability and reproducibility criteria, and the diagnostic criterion of ao was completed and graded on 100 points . Moreover, after the inclusion of the first five patients, a pneumologist instructor s evaluation of the quality of the first five spirometry curves was sent to each participating gp . From october 2013 to may 2014, each gp aimed to recruit 20 consecutive patients at risk of developing copd . The inclusion criteria were smoking> 20 pack - years, age> 40 years, and mastery of french . The exclusion criteria were an acute respiratory episode during the 4 weeks preceding inclusion, diagnosed chronic pulmonary disease, and inability to perform spirometry . The patient gave his consent after oral and written information, then the gp ran the spirometry with at least three determinations of slow vital capacity (vc) and three flow volume curves . The gp then had to decide whether the test was interpretable and then about the possible presence of ao . The principal assessment criterion was the total duration of the spirometric examination, including explanations, measured with the computer s clock . The secondary end points were determination of the quality of the curves, spirometry - interpretation concordance (interpretability of the curves and ao diagnosis) between the gp and the pneumologist, and questionnaire grades before and after the training sessions . The acceptability criteria were 1) expiration lasting at least 6 seconds or reaching a plateau on the time volume curve; 2) good start with an early peak flow, curve peaked on top and not flat; and 3) absence of cough artifacts or glottis closing . Reproducibility was defined as fev1 and forced vital capacity (fvc) differences 0.15 l on the two best spirometry curves.19 curve quality was considered optimal when all the acceptability and reproducibility criteria were met and acceptable when all the acceptability criteria were fulfilled but not the reproducibility criterion and the best curve was normal or indicated ao; otherwise, it was uninterpretable . Evolution of participants spirometry knowledge was assessed based on the questionnaire grades obtained before and after evaluating the training sessions, with a maximum grade of 100 . Quantitative variables are expressed as mean standard deviation and range; qualitative variables are expressed as n (%). Two means were compared with student s t - test and wilcoxon signed - rank test, whereas several means were compared with kruskal wallis test . Pneumologist concordance on the possibility to interpret the spirometry curve and ao diagnosis was ascertained with cohen s kappa coefficient . The effect of experience on spirometry duration was evaluated by comparing the first three examinations with spirometries 8, 9, and 10 . A center effect on the duration ten volunteer gps working in the suburbs west of paris were trained by two pneumologists during two 3-hour continuing education sessions . During the first session, the study protocol was explained and the gps received theoretical and practical training in spirometry and were provided with a portable spirometer (spirodoc coupled to winspiropro software; mir, langlade, france). This instrument allows direct visualization of the flow volume curve and the expiration time . The gps were asked to come to a second session with five test results to pursue their training . Before and after the sessions, a 12-question questionnaire evaluating each participant s knowledge of spirometry, its acceptability and reproducibility criteria, and the diagnostic criterion of ao was completed and graded on 100 points . Moreover, after the inclusion of the first five patients, a pneumologist instructor s evaluation of the quality of the first five spirometry curves was sent to each participating gp . From october 2013 to may 2014, each gp aimed to recruit 20 consecutive patients at risk of developing copd . The inclusion criteria were smoking> 20 pack - years, age> 40 years, and mastery of french . The exclusion criteria were an acute respiratory episode during the 4 weeks preceding inclusion, diagnosed chronic pulmonary disease, and inability to perform spirometry . The patient gave his consent after oral and written information, then the gp ran the spirometry with at least three determinations of slow vital capacity (vc) and three flow volume curves . The gp then had to decide whether the test was interpretable and then about the possible presence of ao . The principal assessment criterion was the total duration of the spirometric examination, including explanations, measured with the computer s clock . The secondary end points were determination of the quality of the curves, spirometry - interpretation concordance (interpretability of the curves and ao diagnosis) between the gp and the pneumologist, and questionnaire grades before and after the training sessions . The acceptability criteria were 1) expiration lasting at least 6 seconds or reaching a plateau on the time volume curve; 2) good start with an early peak flow, curve peaked on top and not flat; and 3) absence of cough artifacts or glottis closing . Reproducibility was defined as fev1 and forced vital capacity (fvc) differences 0.15 l on the two best spirometry curves.19 curve quality was considered optimal when all the acceptability and reproducibility criteria were met and acceptable when all the acceptability criteria were fulfilled but not the reproducibility criterion and the best curve was normal or indicated ao; otherwise, it was uninterpretable . Evolution of participants spirometry knowledge was assessed based on the questionnaire grades obtained before and after evaluating the training sessions, with a maximum grade of 100 . Quantitative variables are expressed as mean standard deviation and range; qualitative variables are expressed as n (%). Two means were compared with student s t - test and wilcoxon signed - rank test, whereas several means were compared with kruskal pneumologist concordance on the possibility to interpret the spirometry curve and ao diagnosis was ascertained with cohen s kappa coefficient . The effect of experience on spirometry duration was evaluated by comparing the first three examinations with spirometries 8, 9, and 10 . A center effect on the duration statistical analyses were computed using r software version 3.0.2 . A p - value <0.05 defined significance . The mean age of gps was 55 years (3964 years) and seven were private practice gps who also trained gp residents . Two of them had been trained in spirometry at least 10 years earlier, and one had a spirometer but had never run the test in his practice before the study . The mean mark for questionnaire evaluating spirometry knowledge raised from 44/100 before to 80/100 after the training sessions (p=0.01). During the 8-month inclusion period (october 2013june 2014), the gps recruited 152 patients; five refused to participate . Among the 147 spirometries performed, five were excluded from the analysis because of information missing on the duration of the examination . The mean duration of spirometry was 15.25.9 (537) minutes: 15.06.1 minutes for males and 15.45.8 minutes for females (p=0.70). No association was found between spirometry duration and age (p=0.17) or ao diagnosis (n=41, p=0.21). No center effect was found for the eight centers that performed at least ten spirometries . No experience effect was noted for the spirometry duration comparing the first three spirometries versus spirometries 8, 9, and 10 (p=0.42). Volume curves by two expert pneumologists showed that 58.5% of these curves were of optimal quality, 30.2% were acceptable, and 11.3% uninterpretable (table 2). L, was the least frequently attained quality criterion that was met on only 56.3% of the curves . Pneumologist concordance for the possibility to interpret the spirometry curve was moderate (=0.40) and good for ao diagnosis (=0.62). The gps did not attempt interpretation of the test in four of the 13 spirograms that they did not consider interpretable, and in ten of 15 spirograms for which they did not assess interpretability at all . Ao, defined as prebronchodilator fev1/fvc <70%, was diagnosed in 41 (29%) patients, among whom fev1 values were> 80% of predicted for 68% (gold classification stage i) and between 50% and 80% of predicted for 32% (gold classification stage ii). The results of this study showed that, after 6 hours of continuing education devoted to spirometry, the mean duration of the test performed by participating gps was ~15 minutes . Approximately 60% of their spirometries were of optimal quality, and 30% additional tests were considered acceptable . The gp pneumologist concordance was 0.40 for the possibility to interpret the spirometry curve and 0.62 for ao diagnosis . The consultation time must be prolonged and a dedicated appointment scheduled, meaning the patient has to come back or the test must be delegated to a technician in the office if the practice s organizational structure permits . Should the physician conduct a reversibility test, as recommended by gold to diagnose copd, the duration would be much longer . For copd screening, spirometry duration could, in theory, be shortened because measuring slow vc is not mandatory but to do so raises the problem of insurance reimbursement . Indeed, in france, to be validated for payment, spirometry must include slow vc determination in addition to the flow volume curve . A change in this policy in the context of copd screening moreover, in a different setting where daily tests can be performed, in particular with dedicated technician or nurse, the mean duration of the spirometry might be shortened . With only 58.5% optimal curves, quality might seem insufficient, but this rate is similar to those obtained in other primary - care studies . For example, quality control of 1,271 examinations done in routine practice in the netherlands, using close similar acceptability and reproducibility criteria (acceptable variation between the two best fev1 and fvc up to 0.2 l), achieved an optimal quality rate of 38.8%.20 analysis of 275 patients in a new zealand study achieved 33% acceptable and 13% reproducible (same reproducibility definition) spirometry curves.21 when the spirometries were performed by dedicated technicians, the frequency of tests meeting american thoracic society criteria could be higher . In austria, the frequency reached 71% of spirometries performed in primary care by certified technicians in a copd - screening program.22 in a regional canadian program to improve the management of asthma, the reference rate was 68% in a primary - care center with a dedicated technician, 91% in a university center, and 71% for ten recently trained health care technicians involved in asthmatic patient education.23 these conditions are very different from the routine practice of general medicine in france where it is very unlikely that spirometry will be performed by a trained technician or nurse . The small number of tests in some centers might account for the relatively poor quality results . A learning curve is likely despite the fact that no experience effect has been found in this study, may be due to the small number of tests . Patients with one normal flow volume curve are unlikely to have ao, even if the reproducibility criterion is not fulfilled indeed, it is highly unlikely that a patient with a normal spirometry curve fulfilling acceptability but not reproducibility criteria would have copd . One could argue that, in the context of screening for copd, a normal spirometry would exclude the diagnosis and that any abnormality could prompt the gp to refer the patient for complementary explorations . Pneumologist concordance on the possibility to interpret the curve was moderate (=0.40), while that for ao diagnosis was substantial (=0.62). This better agreement can undoubtedly be explained by a simpler notion based on the sole criterion, prebronchodilator fev1/fvc <0.70, whereas interpretability relies on the quality and reproducibility criteria, which are more complex . These findings underscore the importance of being able to turn to a pneumologist to interpret curves that are not obvious . A brief continuing education program, consisting of two 3-hour evening sessions focused on performing spirometry, it was slightly longer than that proposed by eaton et al, which consisted of 2 hours followed by a 90-minute remedial session 3 months later.21 the duration of our training program was about the same as the duration of the training delivered to ten technicians in the canadian program to improve asthma management, 2 hours twice, guidance for the first six examinations, then an instructor available upon demand; this program achieved spirometry curves satisfying quality criteria and american thoracic society quality for 71% of the 472 examinations analyzed.23 however, it is much less ambitious than that proposed by the european respiratory society hermes program, whose objective went beyond copd screening . This program consists of initial training for 912 hours, writing a personal procedure for pulmonary function test, a questionnaire of 30 multiple - choice questions to assess knowledge on spirometry, a second training session of 710 hours, and finally, practical evaluation.24 to our knowledge, the hermes project did not assess spirometry curves obtained in primary - care settings after completion of training . The continuing education dispensed in our study enabled the acquisition of knowledge, attested by the improved questionnaire grades and 60% optimal quality spirometry curves . The evaluation of the quality of curves was centralized but included, in addition to the objective quantitative criteria (eg, reproducibility, fev1/fvc, and expiration time), qualitative parameters relatively subjective (eg, the notion of a good start and absence of artifacts). The definition criterion retained for ao for this study was prebronchodilator fev1/fvc <70%, whereas the gold group recommends measuring postbronchodilator fev1/fvc . However, in the context of screening, both a fixed fev1/fvc threshold instead of a cut off according to age, and pre - bronchodilator results are considered acceptable to suspect ao presence, despite the risk of over - diagnosis linked to the physiologic fev1/fvc decline with age and the risk of confusion with asthma without a post - bronchodilator reversibility test.25 indeed, a simple, rapidly run, inexpensive test is needed for routine use in primary care and has been used in pervious studies.2628 alternatively one could suggest to perform only a postdilator test, but adding a bronchodilator test, which requires 1015 minutes between inhalation of the bronchodilator and the spirometry, would significantly increase the duration of the test . This study was performed in the french context of primary - care organization and may not be generalizable to other countries . In some countries, spirometry in primary care is not performed by the physician but by other health professionals . In addition, the french insurance system requires the measurement of slow vc, which is not mandatory in other countries and obviously lengthens the duration of the spirometry . They practice in the paris region, and seven of them also train future gps, thus are particularly involved in educating medical residents . One might accord them greater motivation than usual to integrate a new technique into their practices . The 20 patients expected per center was not reached, with only three centers including at least 20 patients during the 8-month recruitment period and three centers enrolling less than ten patients . The explanation given spontaneously by the gps was the lack of time, thereby corroborating the difficulty of introducing into their practices an examination lasting at least the mean duration of a standard consultation . The lack of commitment of doctors to a copd - screening program using spirometry in their office confirms a previously observed obstacle . In a canadian study, 37% of the private practice offices approached refused to participate in spirometry implementation; the frequency reached 50% in an austrian study.22,29 one of the factors explaining this difficulty of implanting spirometry in primary - care settings could be the lack of early training in performing and interpreting pfts in medical school . A recent inquiry concerning 1,261 general medicine residents in france showed that only 4.3% of them thought that they had the competence required to conduct spirometry . Notably, 62.9% deemed this training necessary during their initial medical education.30 finally, the relatively short observation period precluded determination of future use of this tool by our participating gps or the evolution of the quality of these examinations over time . The duration of spirometry is too long to be compatible with the present french primary - care practice and would require a dedicated consultation or delegation of the task to other health professionals . However, the educational effort toward gps was valuable, and the competence of the gps was acceptable . Based on the results of this pilot study, we think that copd screening cannot be improved simply by providing gps with a spirometer and training sessions.
These slight facial asymmetries are acceptable esthetically . However, significant asymmetry may cause functional as well as esthetic problems . The etiology of facial asymmetry can be divided into three components: congenital, developmental and acquired.1,2 however etiology for certain cases remains unknown . Facial asymmetry may be present along with class i or class ii malocclusions, but it most commonly occurs in cases with class iii malocclusions.3,4 depending on the craniofacial structures involved, facial asymmetry can be classified into - skeletal, dental and functional . Dental factors mainly include early loss of deciduous tooth, congenital missing tooth or teeth, and certain habits . Patients having facial asymmetry are evaluated through clinical assessment, cephalography and more recently with the use of three - dimensional imaging techniques . Clinical examination includes a visual inspection of the entire face, palpation to differentiate between soft tissue and bony defects and comparison of dental midline with a facial midline . In addition to the frontal aspect, viewing mandible from an inferior or submental vertex view sometimes helps to determine the extent of mandibular asymmetry in relation to the rest of the face . The dental midline needs to be evaluated in different positions such as in centric relation, open mouth, at initial contact and in centric occlusion . True skeletal and dental asymmetry will not show any change in the midline discrepancies in centric relation and in centric occlusion . Whereas, asymmetry due to occlusal interference may result in functional shift of the mandible on initial tooth contact . In most of the cases, clinical examination needs to be supplemented by other diagnostic aids such as - study models, face bow transfer and various imaging techniques to accurately localize the asymmetric structures . Interpretation of lateral cephalogram in diagnosing asymmetries is of limited value.5,6 panoramic view provides information regarding gross anomalies, supernumerary or missing teeth . Any variations in the shape and height of mandibular ramus and condyles on both sides can be assessed and compared.7 however, the cephalometric postero - anterior projection provides valuable information and helps in proper diagnosis . It can be obtained at centric occlusion and open mouth positions to determine the extent of functional mandibular deviation . More recently the newer imaging techniques like three - dimensional computed tomography and three - dimensional photography are being used to accurately localize the discrepancy . A detailed study of various diagnostic records obtained on the patient is necessary to determine the cause, extent and location of asymmetry . A 17-year - old female patient reported for orthodontic treatment with a chief complaint of irregular teeth and an unesthetic smile . Intraoral findings showed class ii subdivision right malocclusion with severe crowding of upper and lower anteriors, anterior cross bite in relation to upper laterals and lower canines and a lower midline deviation of 3 mm to right (figure 1). Pre - treatment photographs . All the routine essential diagnostic records, which include extraoral radiographs (figure 2) lateral cephalogram (figure 2a), orthopantomogram (figure 2b), photographs and study models were advised . Face bow transfer (figure 3) was recorded on the patient (figure 3a) and transferred on to the articulator (figure 3b), to evaluate the midline shift . In addition to these, two cephalographs with postero - anterior (pa) view (figure 4) in centric occlusion (figure 4a) and open mouth position (figure 4b) were advised to differentiate between skeletal and dental asymmetry . Panoramic radiograph showed that condyle of the left side was slightly larger than the right side, suggesting mild hyperplasia of the left condyle . The lateral cephalometric tracing showed a good anteroposterior skeletal relationship with a vertical growth pattern . Face bow transfer indicated presence of skeletal midline shift, which was confirmed with the radiographic analysis of pa view cephalograms (figure 5) in occlusion (figure 5a) and in open mouth position (figure 5b). (a) in occlusion (b) open mouth position . After assessing patients perception of her facial asymmetry and expectations of treatment results, advisability of surgical correction was not considered . Alignment and leveling of teeth were carried out using pre - adjusted edgewise appliance following extraction of maxillary first premolars and mandibular second premolars . Significant improvement was observed in the patient's dental esthetics including alignment of upper and lower anteriors, achievement of ideal overjet and over bite and angle's class i molar relation (figure 6). The cephalometric evaluation of skeletal and dental changes pre- and post - orthodontic treatment are summarized in table 1 . Panoramic radiograph showed that condyle of the left side was slightly larger than the right side, suggesting mild hyperplasia of the left condyle . The lateral cephalometric tracing showed a good anteroposterior skeletal relationship with a vertical growth pattern . Face bow transfer indicated presence of skeletal midline shift, which was confirmed with the radiographic analysis of pa view cephalograms (figure 5) in occlusion (figure 5a) and in open mouth position (figure 5b). Radiographic analysis of pa view cephalographs . (a) in occlusion (b) open mouth position . After assessing patients perception of her facial asymmetry and expectations of treatment results, advisability of surgical correction was not considered . Alignment and leveling of teeth were carried out using pre - adjusted edgewise appliance following extraction of maxillary first premolars and mandibular second premolars . Significant improvement was observed in the patient's dental esthetics including alignment of upper and lower anteriors, achievement of ideal overjet and over bite and angle's class i molar relation (figure 6). The cephalometric evaluation of skeletal and dental changes pre- and post - orthodontic treatment are summarized in table 1 . When patients complain of facial asymmetry and seek treatment, it is first essential to determine the underlying causes . This entails a thorough case history, radiographic analysis, facebow transfer and imaging studies.8,9 true dental asymmetry can be managed by orthodontic treatment alone using asymmetric extraction mechanics and by use of combination of intraoral elastics . For pronounced tooth irregularities, composite buildups or prosthodontic restorations may be indicated . More severe discrepancies may need orthodontic alignment of teeth to achieve proper occlusion and function . Occlusal splints help in evaluating the presence and extent of functional shift by eliminating habitual posturing and deprogramming of musculature . In cases with contracted maxillary arches leading to shifting of mandible, rapid maxillary expansion may be indicated to achieve proper intercuspation of posterior teeth in centric relation.10 severe skeletal asymmetries require a combination of orthodontic and surgical management . Surgical treatment planning may include orthognathic facial bone contouring surgery, genioplasty and contouring of soft tissues such as the masseter muscle and buccal fat pads.11,12 the extent of soft tissue changes as a result of related skeletal structure mobilization may be difficult to predict accurately.13 if later a second operation is required for adjustment of symmetry, alloplastic implants and fat injections for volume augmentation, as well as bone contouring and liposuction for volume reduction, can be carried out.14 more recent advances in three - dimensional photography have provided a valuable tool in diagnosis and treatment planning of dentofacial asymmetries with their proven accuracy and precision.15,16 however, decisions regarding intervention of dentofacial deformities depend upon the patient's awareness of the esthetic problem, the extent of occlusal deformity and concomitant sagittal or vertical jaw imbalance.17 a systematic and comprehensive examination, diagnosis and treatment plan is requirements for successful management of dentofacial asymmetries . Contributions from soft tissue, dental and skeletal elements leading to facial asymmetry should be evaluated in detail for arriving at an accurate diagnosis . Patient complaints and desires should be addressed carefully before finalizing the treatment plan since they may vary from unrealistic expectations to a total lack of concern even in the presence of severe discrepancies . In the presence of less severe skeletal, dental and soft tissue deviations, intervention with treatment procedures
All animals (charles river, yokohama, japan) were housed under controlled temperature (25 1c) and 12 hr: 12 hr light: dark conditions (lights on at 07:00 hr) with food and water available ad libitum . All of the procedures were performed in accordance with the guidelines for animal care stipulated by the japanese physiological society and approved by the ethics committees of miyazaki university . All efforts were made to minimize animal pain and suffering, and the number of animals used . In the first set of experiments, adult female wistar rats (approximately 10 weeks old) were used . From 1 week prior to sample collection, vaginal smears were taken daily from the rats for determination of the estrous cycle, and accordingly, the animals were subdivided into 4 groups: diestrus (n=9), proestrus (n=7), estrus (n=9) and metestrus (n=16). We showed the plasma amino acid concentration with supplemental table, and the percentage concentration ratios for the various amino acids were also presented as circular profiles relative to the amino acid concentrations of diestrus . In the next experiment, adult female rats were mated on the day of proestrus, and the day after mating was counted as day 1 of pregnancy (p1). Blood samples were taken every 5 days (p5, 10, 15 and 20; n=4). After delivery and during lactation, blood samples were taken from the dams in the same way (l1, 5, 10, 15 and 20; n=4), and we take the samples from the female pups just after weaning (n=6). The percentage concentration ratios for the various amino acids were also presented as circular profiles relative to the concentrations determined just before pregnancy (proestrus). All blood samples were collected into heparinized capillary tubes by the tail tip incision method, and these were centrifuged immediately at 4c and 14,000 rpm for 4 min . We think that the possibility of contamination of amino acids derived from erythrocyte by hemolysis is almost none, since we paid scrupulous attention not to hemolyze at the blood sampling and hemolyzed sample was excluded from the assay . The resulting plasma samples were mixed with 2 volumes of 5% (w / w) trichloroacetic acid and centrifuged immediately at 4c and 10,000 rpm for 20 min to remove the precipitated protein . Ufc5010bk, millipore, billerica, ma, u.s.a . ), and the plasma amino acid concentrations were measured using an automatic amino acid analyzer (l-8800a; hitachi, tokyo, japan). We focused on the 20 amino acids that are the components of proteins: valine (val), leucine (leu), isoleucine (ile), alanine (ala), methionine (met), proline (pro), tryptophan (trp), phenylalanine (phe), tyrosine (tyr), threonine (thr), glutamine (gln), asparagine (asn), serine (ser), glycine (gly), cysteine (cys), lysine (lys), arginine (arg), histidine (his), aspartic acid (asp) and glutamic acid (glu). Briefly, amino acids were separated by cation - exchange chromatography and detected spectrophotometrically after post - column reaction with ninhydrin reagent . All sample collections were performed at the same time (11:3012:30 hr) to minimize any influence of circadian rhythm . All data were expressed as the mean standard error of the mean (sem). In the first experiment, differences between groups at the various stages of the estrous cycle were analyzed by one - way anova and post hoc tukey s test . In the other experiment, data for amino acid levels were analyzed by one - way repeated anova, and changes between time points during the experimental period were analyzed by tukey s test . The sexual difference (fig . 3d) were analyzed by student s t - test . To visualize the results, the concentrations of amino acids among the experimental groups for the 2-dimensional circular plane figures, we plotted the percentage concentration of each amino acid relative to the control level (at diestrus or proestrus). In the three - dimensional figures, principal components analysis (pca) was performed to reduce the dimensionality of the data set and to identify new meaningful underlying variables . To obtain a more accurate result in the latter analysis, we used 40 kinds of amino acids and their metabolic intermediates, including taurine, sarcosine, citrulline, ornithine and hydroxyproline, for pca analysis . The actual concentrations of the various amino acids in plasma are shown in tables 1table 1alterations in plasma amino acid concentrations during the estrous cycle in female rats and age - matched male ratsamino acids(mol / l)diestrus(n=9)proestrus(n=7)estrus(n=9)metestrus(n=16)age - matched male(n=4)valine175.8 6.2182.0 12.1168.9 5.6189.6 4.3157.8 4.8leucine124.4 3.8129.3 7.5126.0 4.0135.2 4.6110.5 4.2isoleucine72.8 2.077.7 5.174.7 2.378.9 1.465.9 3.4alanine408.9 10.7459.5 27.3453.2 24.7444.0 13.4349.1 31.2methionine66.6 3.363.4 4.964.1 1.774.5 2.956.3 3.4proline223.7 8.9217.6 17.0215.1 9.1238.4 5.9170.5 6.5tryptophan141.9 6.8129.9 7.0130.1 6.3145.3 3.6106.1 7.4phenylalanine67.0 2.171.4 4.170.9 2.073.0 1.866.7 1.8tyrosine67.6 2.574.4 5.669.3 2.874.6 3.091.2 4.7threonine320.4 18.0357.3 40.1332.4 25.5363.9 15.4265.5 5.0glutamine650.5 30.4637.5 25.6619.1 20.5689.8 18.4556.3 16.6asparagine51.0 3.248.2 4.244.4 2.153.1 2.244.5 2.8serine261.6 11.2275.4 19.4267.8 9.8283.9 9.8197.5 7.9glycine281.1 13.1283.1 17.5263.8 7.9282.3 8.8255.2 3.8cysteine1.5 0.41.4 0.41.7 0.71.4 0.3ndlysine491.2 19.2479.6 30.4461.9 21.9521.9 20.7336.8 21.5arginine178.5 12.6176.5 4.8196.5 9.0251.7 28.1125.8 14.0histidine58.3 2.359.8 3.157.0 1.662.3 1.851.3 0.6aspartate10.8 1.711.8 1.312.7 1.714.6 1.67.0 1.0glutamate91.3 8.286.4 7.894.3 6.999.7 7.681.6 13.4the data represent the mean standard error of the mean (sem, n=716). ; p<0.05 vs. diestrus by student s t - test ., 2table 2alterations in plasma amino acid concentrations during pregnancyamino acids (mol / l)proestrus (p0)p5p10p15p20valine172.3 17.9247.3 83.1305.8 85.3211.1 61.1201.1 64.6leucine123.6 11.0124.5 6.0119.6 4.0107.5 2.6103.1 9.6isoleucine73.3 7.674.9 3.671.6 2.266.3 1.068.5 7.4alanine414.3 26.3361.6 14.6348.2 15.7373.8 49.7510.6 33.6methionine59.3 4.360.3 4.167.5 4.457.8 5.654.0 3.2proline191.6 12.3186.3 13.0171.7 8.8175.2 12.6184.1 9.1tryptophan119.3 6.2100.6 1.2106.2 6.5101.8 4.362.4 5.5phenylalanine67.8 3.661.1 2.364.5 3.258.8 3.159.8 4.9tyrosine74.8 5.264.0 3.274.4 6.751.9 5.8 50.3 4.9threonine276.0 16.1235.1 13.9240.6 21.0268.7 13.8292.1 23.9glutamine601.1 11.4614.6 20.7623.2 36.4631.1 39.5598.8 24.3asparagine43.1 5.040.1 1.637.4 1.637.7 2.550.9 3.2serine246.4 17.6230.7 6.2207.5 5.3 202.8 8.8 * 221.8 6.3glycine272.2 21.2259.5 9.3232.2 14.0158.1 7.9 * 127.6 3.6cysteinendndndndndlysine435.8 19.8422.1 48.3418.6 31.2527.4 30.9623.4 60.3arginine160.8 20.0174.6 9.4166.2 4.4162.1 24.8140.4 8.7histidine59.3 4.658.9 1.557.8 3.144.8 3.2 * 36.6 2.1aspartate11.9 2.310.3 2.18.3 0.89.2 1.19.0 0.6glutamate87.6 12.582.8 15.478.1 10.480.2 10.183.3 10.6the data represent the mean standard error of the mean (sem, n=4). ; p<0.05 vs. non - pregnant female rats group ., 3table 3alterations in plasma amino acid concentrations during lactation in dams and the pups just after weaningamino acids(mol / l)proestrus (p0)l1l5l10l15l20pupsvaline172.3 17.9130.5 32.2154.6 12.0182.8 1.4168.7 9.8129.2 24.4206.8 10.2leucine123.6 11.097.5 10.9115.6 8.4133.6 3.5129.6 6.5117.7 18.2146.5 8.8isoleucine73.3 7.666.1 4.273.6 5.985.5 1.679.8 4.074.2 11.297.0 3.8alanine414.3 26.3739.3 50.2 * 621.8 41.0585.1 35.2608.9 61.9572.1 44.2738.9 33.5methionine59.3 4.370.0 6.682.5 3.7 * 98.7 4.2 * 99.3 5.3 * 90.5 6.4 * 86.1 2.7proline191.6 12.3288.6 27.7 * 268.7 18.7 * 259.0 8.9 * 268.7 14.9 * 239.4 15.3358.2 39.7tryptophan119.3 6.2106.1 12.8113.3 2.5118.1 7.2115.4 9.9113.7 8.999.5 4.9phenylalanine67.8 3.666.3 4.867.7 4.770.9 2.171.8 6.465.0 6.476.4 5.6tyrosine74.8 5.285.0 8.387.4 10.681.9 6.384.4 7.569.0 9.8148.1 17.3threonine276.0 16.1386.4 60.6390.9 21.2377.4 20.5347.2 17.1316.8 23.4219.5 12.7glutamine601.1 11.4818.9 40.7 * 704.7 43.1711.7 37.1752.6 35.3 * 688.8 25.6626.0 46.6asparagine43.1 5.090.5 9 * 71.4 2 * 84.3 3.1 * 91.7 1.9 * 76.5 2.2 * 75.7 12.9serine246.4 17.6422.5 29.7 * 372.0 30.4 * 366.3 12.4 * 353.0 12.1 * 321.4 15.1300.6 24.0glycine272.2 21.2400.6 34 * 421.6 41.6 * 465.5 20.6 * 461.7 22.7 * 381.3 14.7613.2 25.6cysteinendndndndndndndlysine435.8 19.8686.5 100.8 * 521.1 34.9550.1 30.8489.6 2.6459.8 32.2232.9 16arginine160.8 20213.8 20.8196.5 17.3194.9 8.6182.5 5.5178.7 13.9240.2 26.6histidine59.3 4.656.3 4.566.2 3.378.6 3.4 * 72.3 3.263.2 6.7119.4 7.7aspartate11.9 2.311.4 2.013.4 5.85.5 1.47.2 0.76.8 1.216.9 2.2glutamate87.6 12.576.8 1.793.1 16.766.1 5.865.7 4.871.1 6.6119.3 7.8the data represent the mean standard error of the mean (sem, n=4, 6). ; p<0.05 vs. non - pregnant female rat group,; p<0.05 vs. dams on day 20 of lactation group .. to compare the types of amino acid changes occurring during the estrous cycle, pregnancy or lactation, we displayed the ratios of the respective amino acids at each stage in the form of circular profiles relative to the corresponding values for diestrus or proestrus . The data represent the mean standard error of the mean (sem, n=716). ; p<0.05 vs. diestrus by student s t - test . The data represent the mean standard error of the mean (sem, n=4). ; p<0.05 vs. non - pregnant female rats group . The data represent the mean standard error of the mean (sem, n=4, 6). ; p<0.05 vs. non - pregnant female rat group,; p<0.05 vs. dams on day 20 of lactation group . The levels of the individual amino acids in plasma were almost the same among proestrus, estrus, metestrus and diestrus, and their circular profiles showed no significant differences (fig . 1.alterations in plasma amino acids concentrations (a c, f), body weight (d) and daily food intake (e) at various stages of the estrous cycle in female rats and also in age - matched male rats . The concentrations of individual plasma amino acids are shown as a percentage ratio relative to the concentrations in diestrus females . A: results for proestrus (red line), b: estrus (yellow line), c: metestrus (green line) and f: age - matched males (blue line). The data for body weight and food intake represent the mean standard error of the mean (sem). D, diestrus (white bar); p, proestrus (black bar); e, estrus (gray bar); m, metestrus (diagonal bar). Amino acids indicated by red shading and asterisks showed a significant difference vs. diestrus females (p<0.05)., table 1). On the other hand, the shapes of the circular profiles changed during the course of pregnancy (fig . 2.temporal alterations in plasma amino acid concentrations (a, red line), body weight (b) and food intake (c) during pregnancy in female rats (n=4/group). The concentrations of individual plasma amino acids are shown as a percent ratio relative to the concentrations in non - pregnant female rats (proestrus; n=4, black line). Amino acids indicated by red shading and asterisks showed a significant difference vs. non - pregnant females (p<0.05)., table 2). The plasma ser level decreased significantly in mid and late (p10 and 15) pregnancy, and tyr, gly and his decreased significantly at the late and end stages (p15 and 20) of pregnancy, whereas trp and lys significantly decreased and increased at the end of pregnancy, respectively . Alterations in plasma amino acids concentrations (a c, f), body weight (d) and daily food intake (e) at various stages of the estrous cycle in female rats and also in age - matched male rats . The concentrations of individual plasma amino acids are shown as a percentage ratio relative to the concentrations in diestrus females . A: results for proestrus (red line), b: estrus (yellow line), c: metestrus (green line) and f: age - matched males (blue line). The data for body weight and food intake represent the mean standard error of the mean (sem). D, diestrus (white bar); p, proestrus (black bar); e, estrus (gray bar); m, metestrus (diagonal bar). Amino acids indicated by red shading and asterisks showed a significant difference vs. diestrus females (p<0.05). Temporal alterations in plasma amino acid concentrations (a, red line), body weight (b) and food intake (c) during pregnancy in female rats (n=4/group). The concentrations of individual plasma amino acids are shown as a percent ratio relative to the concentrations in non - pregnant female rats (proestrus; n=4, black line). Amino acids indicated by red shading and asterisks showed a significant difference vs. non - pregnant females (p<0.05). Much larger changes in the circular profiles of plasma amino acids were observed during the lactation period (fig . 3.temporal alterations in plasma amino acid concentrations (a, red line), body weight (b) and food intake (c) during lactation in female rats (n=4/group). The concentrations of individual plasma amino acids are shown as a percentage ratio relative to the concentrations in non - pregnant females (proestrus; n=4, black line). D shows the results of the pups just after weaning (n=6, blue line) compared with the dams on the day 20 of lactation (n=4, red line). Amino acids indicated by red shading and asterisks showed a significant difference vs. each control group (p<0.05)., table 3): many amino acids showed significant increases, and none showed a significant decrease . Plasma pro, ser and gly levels increased continuously from day 1 until day 15 of lactation . The levels of asn and met increased significantly from days 1 and 5 respectively until the end of lactation, ala and lys were increased significantly only on day 1 of lactation, his was increased on day 10, and gln was increased on days 1 and 15 . 3d shows the results of the pups just after weaning compared with the dams on day 20 of lactation . Many amino acids (val, ala, pro, tyr, gly, his, asp and glu) showed significant increases, and only 2 amino acids (thr and lys) were decreased . Temporal alterations in plasma amino acid concentrations (a, red line), body weight (b) and food intake (c) during lactation in female rats (n=4/group). The concentrations of individual plasma amino acids are shown as a percentage ratio relative to the concentrations in non - pregnant females (proestrus; n=4, black line). D shows the results of the pups just after weaning (n=6, blue line) compared with the dams on the day 20 of lactation (n=4, red line). Amino acids indicated by red shading and asterisks showed a significant difference vs. each control group (p<0.05). Pca analysis revealed clear differences in the 3d plots among the groups (fig . 4a and 4bfig . 4.principal component analysis (pca) plots from amino acid concentration data of individuals (a) and median (b) in each experiment . Black plot; male rats age - matched with females in the estrous cycle experiment, blue plot; estrous cycle experiment, red plot; pregnancy period and green plot; lactation period . ). On the pca plot, we added the plasma amino acid levels for an age - matched male group (n=4) to confirm whether or not a sex difference was evident . The positions of each sample were plotted against the axes of the first three components (pc1, pc2 and pc3) in a 3d space and were colored according to each experimental group (black plot; male rats age - matched with the females used in the estrous cycle experiment, blue plot; estrous cycle experiment, red plot; pregnancy period and green plot; lactation period). Pca analysis allowed visual identification of data patterns and highlighted similarities and differences among the reproductive stages in female rats . The dispersion of the points assembled in each group . Principal component analysis (pca) plots from amino acid concentration data of individuals (a) and median (b) in each experiment . Black plot; male rats age - matched with females in the estrous cycle experiment, blue plot; estrous cycle experiment, red plot; pregnancy period and green plot; lactation period . Presentation of the amino acid profiles in a 2-dimensional circular plane, using the levels of amino acids during diestrus or proestrus as controls, demonstrated that the profiles changed during pregnancy and lactation in dams, but not during the estrous cycle . In addition, 3-dimensional pca analysis revealed a different distribution of plasma amino acid levels among reproductive stages or sex, especially in late pregnancy and early lactation in dams . These observations suggest that the levels of amino acids in female rats differ from those in males and that they change according to reproductive stage . Generally, it has been considered that protein metabolism differs between males and females, since the sexes differ considerably in muscle mass and energy consumption . Some of these differences may be correlated with sex steroid hormones: testosterone and estrogen stimulate and inhibit protein synthesis, respectively [14, 27]. Also, it has been reported that ovariectomy causes an increase of bcca and a decrease of ala in plasma . Changes in the circular amino acid profiles in dams during pregnancy or lactation may result from transitional changes in the plasma levels of steroid . On the other hand, in rats during the estrous cycle, there were no significant differences in the circular profiles, even though plasma steroid hormone levels do vary during the cycle . Although the reason for this unexpected result is unknown, it may be results of short term change of steroid levels in estrus cycle . Another possibility is that pregnant or lactating dams have a higher nutritional demand and food intake in comparison with normal rats . The present study also demonstrated an increase of food intake in pregnant and lactating dams . In spite of the increase of food intake during pregnancy, most of the significant changes in plasma amino acid levels were falls, rather than increases . In addition, most of the amino acids that showed reduction during pregnancy were glycogenic amino acids . In pregnant rats, increase of insulin and ketone body, and decrease of glucose are observed in peripheral blood [5, 13]. Therefore, decrease of glycogenic amino acid during pregnancy may be due to promoting the gluconeogenesis for supply of glucose to the fetus . Another possible reason for the reduction in many plasma amino acid levels may have been an increase in the plasma progesterone level . It has been reported that administration of progesterone to humans causes a marked reduction of many amino acids in plasma . However, if progesterone is the main reason for the decrease of amino acids, this does not explain why many amino acids showed increases in their levels in lactating dams, whose plasma progesterone level is high . The only amino acid that showed an increased level in plasma at the end of pregnancy was lys (a ketogenic amino acid). Although the reason for this is unclear, lys is utilized for acetyl - coenzyme a, some of which is employed for cholesterol synthesis . Furthermore, it has been reported that dietary lys and arg are related to plasma cholesterol levels and that a decrease in the ratio of arg to lys is associated with an increase in the plasma cholesterol level . Cholesterol may be necessary for the rapid increase in the level of estrogen at the end of pregnancy for initiation of lactation . In contrast with pregnant dams, all of the amino acids that showed significant changes in lactating dams increased . All of these, except for lys and met, were non - essential and glycogenic amino acids . During the lactation in comparison with pregnancy, therefore, these non - essential and glycogenic amino acids may be for supplying sufficient glucose or amino acid to product the milk in the mammary gland . The increase in the lys level on the initial day of lactation may have been due to the increase observed at the end of pregnancy . Ala was significantly increased in early lactation (l1) and showed a tendency to increase as lactation proceeded . It has also been reported that the expression of amino acid transporter (aat) and lipid synthesis - related genes in the mammary gland is increased more during lactation than during pregnancy in the mouse . In addition, the amino acid concentrations in secreted milk during lactation are different from those of maternal plasma . In the fetus immediately before delivery, amino acid levels are known to be higher than in the mother . On the basis of these observations, we expected that the plasma amino acid levels in rats just after weaning might be higher than in mature rats, and measured the plasma amino acid levels in pups just after weaning . As expected, many kinds of amino acid in plasma showed levels markedly higher than in the dam (fig . It might be generally believed that the increase of food intake results in increase of amino acid levels in blood . Certainly, increase of food intake brings about increase of plasma amino acid levels in hyperphagic animals like the ob / ob mouse . However, this correlation between food intake and plasma amino acid levels did not apply to pregnant rats, since main change in amino acid level in pregnant rats was decrease, but not increase, nevertheless, food intake increased . In lactating dam, however, some amino acids concomitant with food intake increased in the present study also . But, the rises of bcaa were not recognized in lactating dam . Therefore, we supposed that the plasma amino acid levels in lactating dam were influenced by not only food intake, but also metabolic change . In the present study, we showed that imbalance of amino acid profiles strongly reflects the metabolic changes occurring in vivo and that such data would be applicable to various fields, such as diagnosis, treatment with infusion to patient, nutrition for the pregnant women and production of artificial milk.
A 24yearold male presented with 2 weeks of abdominal pain, fever, weakness, and palpable splenomegaly . His complete blood count showed a white cell count of 20,000/cmm, hemoglobin of 6.8 g / dl, and platelet count of 42,000/cmm . Further testing showed prolonged pt and ptt, low haptoglobin, and a very high ddimer suggesting disseminated intravascular coagulation (dic). A bone marrow biopsy was performed (figs 1, 2, 3, 4, 5, 6). The t cells were predominantly atypical t cells, with a composite immunophenotype of cd3 and cd45 being brightly positive, tia1 +, tcr +, cd4, cd8 + (minority, dim), cd56 + (minority, dim), granzyme b on flow cytometry . Testing for epstein barr virus (ebv) and terminal deoxynucleotidyl transferase (tdt) were negative . This confirmed a diagnosis of hepatosplenic gamma delta tcell leukemia / lymphoma . Computed tomography (ct) abdomen (fig . Induction chemotherapy was initiated with hyperfractionated cvad (cyclophosphamide, vincristine, adriamycin, and dexamethasone)/(1a) alternating with highdose methotrexate (mtx) and cytarabine (arac)/(1b). Intrathecal cytarabine (it arac) prophylaxis was also started . A restaging bone marrow biopsy after cycles 1a/1b showed residual disease . Hence chemotherapy was changed to a secondline regimen comprising ifosfamide, carboplatin, and etoposide (ice). A restaging ct scan of the abdomen after cycle 1 of ice showed worsening splenomegaly . Given poor cytoreduction of his leukemia with chemotherapy, progressive multisystem organ dysfunction and worsening performance status he was considered transplant ineligible . He was eventually enrolled in hospice about 6 months from the time of diagnosis . Leishman stain of bone marrow aspirate smear shows an intermediate sized cell with scant cytoplasm and blastoid nuclear morphology with nuclear irregularities . Hematoxylin and eosin stain of the clot section shows a hypercellular marrow with some preservation of trilineage hematopoiesis as well as a subtle, diffuse mononuclear infiltrate . T cells in the thymus comprise two subtypes based on their surface expression of either or tcell receptors (tcr) 1 . The tcr of t cells, which form the majority, is encoded by alpha and beta genes, whereas the tcr of t cell is encoded by the gamma and delta genes 2 . And type t cells originate from a common multipotent double negative precursor in the thymus that homes itself there after originating from the bone marrow precursor lymphoid cells 4 . T cells on the other hand do not express cd4/cd8 coreceptors, and do not require conventional antigen presentation through mhc expression for their activation 4 . Hepatosplenic gamma delta tcell leukemia / lymphoma is a type of tcell nonhodgkin's lymphoma that arises from clonal expansion of t cells which have suffered a derangement of their genetic machinery from unknown reasons . It has been hypothesized that chronic mhc unrestricted antigenic stimulation of t cells seen in chronic infection / inflammation may be a causal factor 5 . This is based on the fact that these occur with a slightly higher incidence in immunosuppressed solid organ transplant recipients and hiv patients where gamma delta t cells are overstimulated by varying antigenic challenges from repetitive infections 5, 6 . Associations with the use of infliximab, malaria, cytomegalovirus (cmv), and ebv have been reported 6, 7, 8, 9 . All patients tend to have splenomegaly and bone marrow involvement 11, 12 . In a case series of 21 patients, the incidence of liver involvement was 67%, that of at least one b symptom was 80%, and that of lymphadenopathy was 13% 11 . This condition has a very aggressive clinical course . In a study by falchook et al ., median duration of complete remission (cr) was 8 months with chop like regimens . Patients who achieved a cr had a median os of 13 months compared with 7.5 months in patients who did not achieve a cr 10 . This disease shows a distinct sinusoidal pattern of infiltration in the splenic red pulp with sparing of the white pulp . Bone marrow morphology is often nonspecific, but is notable for neoplastic cells in the sinusoids in early stages and an interstitial pattern of infiltration in the later stages 10 . Immunohistochemistry (ihc) is classically cd3 +, tcr1 +, tia1 +, cd4, and cd8. Tcr rearrangement shows a clonal rearrangement of the gene of the t cell a hallmark of this disease 10, 12 . After a diagnosis, which is usually made on a bone marrow biopsy and aspiration, we conduct a staging work up that comprises ct scan of the chest, abdomen, and pelvis looking specifically for lymphadenopathy and hepatosplenomegaly . A lumbar puncture (lp) is carried out in all patients for performing a cerebrospinal fluid (csf) flow cytometry and cytopathology for involvement of the nervous system . One prophylactic dose of intrathecal arac is administered at the conclusion of this first lp . All of our cases undergo a multidisciplinary review at a leukemia tumor board meeting prior to initiating treatment . Our standard firstline therapy is hypercvad alternated with mtx and highdose cytarabine (arac) along with intrathecal prophylaxis, to achieve cytoreduction followed by consolidation with allogeneic bone marrow transplant (allosct), if eligible . We assess response with a restaging marrow after completing the first cycle of hypercvad to help arrive at a decision about continuing the same chemotherapy regimen versus switching to an alternative regimen . If hypercvad is not possible given a poor performance status of the patient, we use a clinical trial as our standard secondline approach, if one is available . In the absence of a clinical trial if clinical status is relatively well maintained, then a combination regimen such as ice / dhap / eshap is employed.if clinical status is not favorable, then a single agent approach, such as with romidepsin or pentostatin is considered, unless a poor performance status dictates eligibility for supportive care alone . If clinical status is relatively well maintained, then a combination regimen such as ice / dhap / eshap is employed . If clinical status is not favorable, then a single agent approach, such as with romidepsin or pentostatin is considered, unless a poor performance status dictates eligibility for supportive care alone . Although alemtuzumab may be employed as a single agent, it may not be tolerated by patients with a poor performance status . During their chemotherapy treatments, we offer our patients supportive treatment with prophylactic antibiotics, antivirals, and antifungals, judicious transfusion support, and prophylaxis against tumor lysis syndrome . We routinely involve specialized chemopharmacists and chemonurses to be a part of our support team for the preparation, dosing, and monitoring of chemotherapy . We also involve an appropriate palliative pain service and hospice support service when the clinical need arises . T cells in the thymus comprise two subtypes based on their surface expression of either or tcell receptors (tcr) 1 . The tcr of t cells, which form the majority, is encoded by alpha and beta genes, whereas the tcr of t cell is encoded by the gamma and delta genes 2 . And type t cells originate from a common multipotent double negative precursor in the thymus that homes itself there after originating from the bone marrow precursor lymphoid cells 4 . T cells on the other hand do not express cd4/cd8 coreceptors, and do not require conventional antigen presentation through mhc expression for their activation 4 . Hepatosplenic gamma delta tcell leukemia / lymphoma is a type of tcell nonhodgkin's lymphoma that arises from clonal expansion of t cells which have suffered a derangement of their genetic machinery from unknown reasons . It has been hypothesized that chronic mhc unrestricted antigenic stimulation of t cells seen in chronic infection / inflammation may be a causal factor 5 . This is based on the fact that these occur with a slightly higher incidence in immunosuppressed solid organ transplant recipients and hiv patients where gamma delta t cells are overstimulated by varying antigenic challenges from repetitive infections 5, 6 . Associations with the use of infliximab, malaria, cytomegalovirus (cmv), and ebv have been reported 6, 7, 8, 9 . Median age at diagnosis is 34 years 11 . A slight male gender preponderance exists 11, 12 . All patients tend to have splenomegaly and bone marrow involvement 11, 12 . In a case series of 21 patients, the incidence of liver involvement was 67%, that of at least one b symptom was 80%, and that of lymphadenopathy was 13% 11 . This condition has a very aggressive clinical course . In a study by falchook et al ., median duration of complete remission (cr) was 8 months with chop like regimens . Patients who achieved a cr had a median os of 13 months compared with 7.5 months in patients who did not achieve a cr 10 . This disease shows a distinct sinusoidal pattern of infiltration in the splenic red pulp with sparing of the white pulp . Bone marrow morphology is often nonspecific, but is notable for neoplastic cells in the sinusoids in early stages and an interstitial pattern of infiltration in the later stages 10 . Immunohistochemistry (ihc) is classically cd3 +, tcr1 +, tia1 +, cd4, and cd8. Tcr rearrangement shows a clonal rearrangement of the gene of the t cell a hallmark of this disease 10, 12 . After a diagnosis, which is usually made on a bone marrow biopsy and aspiration, we conduct a staging work up that comprises ct scan of the chest, abdomen, and pelvis looking specifically for lymphadenopathy and hepatosplenomegaly . A lumbar puncture (lp) is carried out in all patients for performing a cerebrospinal fluid (csf) flow cytometry and cytopathology for involvement of the nervous system . One prophylactic dose of intrathecal arac is administered at the conclusion of this first lp . All of our cases undergo a multidisciplinary review at a leukemia tumor board meeting prior to initiating treatment . Our standard firstline therapy is hypercvad alternated with mtx and highdose cytarabine (arac) along with intrathecal prophylaxis, to achieve cytoreduction followed by consolidation with allogeneic bone marrow transplant (allosct), if eligible . We assess response with a restaging marrow after completing the first cycle of hypercvad to help arrive at a decision about continuing the same chemotherapy regimen versus switching to an alternative regimen . If hypercvad is not possible given a poor performance status of the patient, we use a clinical trial as our standard secondline approach, if one is available . In the absence of a clinical trial if clinical status is relatively well maintained, then a combination regimen such as ice / dhap / eshap is employed.if clinical status is not favorable, then a single agent approach, such as with romidepsin or pentostatin is considered, unless a poor performance status dictates eligibility for supportive care alone . If clinical status is relatively well maintained, then a combination regimen such as ice / dhap / eshap is employed . If clinical status is not favorable, then a single agent approach, such as with romidepsin or pentostatin is considered, unless a poor performance status dictates eligibility for supportive care alone . Although alemtuzumab may be employed as a single agent, it may not be tolerated by patients with a poor performance status . During their chemotherapy treatments, we offer our patients supportive treatment with prophylactic antibiotics, antivirals, and antifungals, judicious transfusion support, and prophylaxis against tumor lysis syndrome . We routinely involve specialized chemopharmacists and chemonurses to be a part of our support team for the preparation, dosing, and monitoring of chemotherapy . We also involve an appropriate palliative pain service and hospice support service when the clinical need arises.
Mucormycosis is a rare but aggressive opportunistic fungal infection that is commonly caused by members of the family mucoraceae that include rhizopus, rhizomucor, mucor and absidia . Mucormycosis can cause severe, sometimes fatal disease in susceptible individuals with uncontrolled diabetic ketoacidosis, neutropenia, chronic glucocorticoid use, hematological malignancy, chronic malnutrition and burn patients.13 rhino - orbito - cerebral mucormycosis (rocm) is an uncommon infection in immunocompetent hosts . Rocm invades vessels, soft tissue, nerves, bone and cartilage producing tissue infarction and ultimately leading to tissue necrosis and vessel thrombosis.4 we present a case of an immunocompetent patient who survived rocm due to saksenaea vasiformis, and review the literature of this fatal condition . A 40-year - old healthy male presented with painful swelling in the left eye for two weeks . There was no history of eye trauma, dental carries, recent surgery, sinusitis or skin infection . The visual acuity was 6/60 in the left eye with 2-mm axial proptosis, with conjunctival congestion and limited ocular motility . The pupils were reactive bilaterally, with no evidence of a relative afferent pupillary defect in either eye . The patient was diagnosed with orbital cellulitis in the left eye . However, the primary cause was undetermined . Broad spectrum antibiotic therapy was initiated that included intravenous cloxacillin 500 mg every 6 h, cefuroxime 750 mg every 8 h and metronidazole 500 mg every 8 h. there was minimal clinical improvement with the above regime after one week of hospitalization . The patient presented two weeks later to a tertiary hospital with severe pain and persistent purulent discharge and no light perception in the left eye . Both upper and lower lids were swollen with discharging fistula proximal to the lateral canthus [figure 1]. General examination revealed an alert, afebrile and well - oriented patient with no neurologic deficit . Complete loss of globe structure and fistula formation on presentation plasma glucose, blood urea, full blood count and liver function test were normal . Computed tomography (ct) of the brain and orbit showed destruction of the left eye, with an ill - defined mass and ring enhancement involving left pterygopalatine, inferotemporal fossa and adjacent bony destruction . It extended posteriorly to the orbital apex, causing a widening of the optic nerve canal and the superior orbital fissure . The cavernous sinus showed signs of thrombosis and presence of areas of infiltrate at the left maxillary, frontal and sphenoidal sinuses [figure 2]. (a) ct scan of the orbit showing proptosis and distortion of the left globe (b) ct scan of brain (post contrast) showing an enhancement of the cavernous sinus suggestive of thrombosis a presumptive clinical diagnosis of rocm was made . Intravenous amphotericin b 1.0 mg / kg / day was initiated after a test dose . The patient had no significant side effects due to intravenous amphotericin b. the patient consented to exenteration of left eye and extensive sinus debridement surgery . Histopathology revealed broad, aseptate, long and right angled branching hyphae consistent with mucormycosis [figure 3]. The intravenous amphotericin b stopped after 4 weeks of therapy and he was discharged with instructions to instill topical amphotericin b for another four weeks . Photomicrograph showing aseptate, long broad, slender right angled branching hyphae, which is pathognomonic of mucormycosis postoperatively, the patient refused to repeat imaging and implantation of eye prosthesis due to poor family support and financial constraints . To date, the patient has been followed up for two and a half years with recurrence of rocm . Rocm is usually associated with a fatal outcome especially in immunocompromised patients . For the last decade we reviewed 11 cases of rocm in immunocompetent hosts published in pubmed from 2000 to 2011 . Table 1 summarizes age, gender, presentations, risk factor, causative organism and final outcome . Summary of previous literature on rhino - orbito - cerebral mucormycosis in immunocompetent patients published in pubmed from 2000 to 2011 the presenting age ranged between 16 and 59 years and both genders were equally affected . Nine out of 11 published cases were due to apophysomyces elegans.59 there was only one reported case of rocm caused by saksenaea vasiformis.11 apophysomyces elegans is an emerging pathogen that causes rocm via inhalation . Whereas, saksenaea vasiformis is a soil saprophytic fungus and the only species in the genus saksenaea . In the previously reported cases, 7 immunocompetent patients who survived were infected by apophysomyces elegans.58 among three patients who died, two were infected by apophysomyces elegans and one with saksenaea vasiformis.8911 two of these three patients were above 50 years of age and died due to extensive brain involvement and severe cerebral vascular insult.811 this finding is similar to the findings of hargrove et al.12 that patients older than 46 years with concurrent frontal sinus involvement and fever were less likely to survive orbital mucormycosis . Our patient was very fortunate to survive this fatal condition despite delayed diagnosis and treatment . This is likely due to his relatively young age and the lack of a pre - existing chronic medical illness . To the best of our knowledge, this is the first reported case of an immunocompetent patient with rocm due to saksenaea vasiformis who survived . Our patient and other immunocompetent patients who survived rocm were treated with a combination of systemic amphotericin b, orbital exenteration and adjacent tissue debridement.58 this is consistent with roden et al.,1 who reported a survival rate of 70% for cases treated with antifungal and surgery . In contrast, only 61% of cases treated with amphotericin b deoxycholate only, 57% of cases that underwent only surgery and only 3% of untreated patients survived.1 in conclusion, diagnosis of rocm in immunocompetent patients is always misleading and possibly causes delay in treatment . It is essential to alert the managing ophthalmologist of the emergence of this rare disease among healthy individuals.
A survey in china showed that the number of patients with chronic kidney disease, which gradually leads to end - stage renal disease (esrd), was approximately 119.5 million . According to the chinese national renal data system (cnrds), the united states renal data system (usrds) reported that the mortality rate in 2013 of hemodialysis patients was 172/1000 patient - years . Moreover, dialysis patients risk for fatal hospitalization increased three - fold compared with that of the reference population . Identifying the factors associated with death in maintenance hemodialysis (mhd) patients is vital . Some studies used baseline data of mhd patients to analyze their survival; however, laboratory data characteristics were variable . Some studies report that hemodialysis patients who are expected to die have certain clinical and biochemical characteristics . However, little is known on the state of dialysis patients preceding death, especially in our country . Hence, our study used the most recent data obtained from patients just prior to either a primary endpoint or the end of the study period . This study aimed to determine the characteristics of dying patients and the factors associated with death in mhd patients . This study was approved by the ethics committee of the chinese people's liberation army general hospital . Patients under mhd therapy in 16 blood purification centers from 12 provinces in china from january 2012 to december 2014 were selected . Inclusion criteria were as follows: age 20 years, receiving mhd therapy for at least 3 months, and with laboratory data, including blood pressure, kt / v, hemoglobin, serum albumin, serum calcium, and serum phosphate . Based on survival status, the participants were divided into two groups: the survival group (still alive on december 31, 2014) and the death group (died of any cause within the study period). Patients who were lost to follow - up for any reason began peritoneal dialysis, or received kidney transplant before december 31, 2014, were included in the survival group . Data, including sex, age, primary cause of esrd, dialysis duration, death cause, type of vascular access, dialysis time every week, and laboratory results, were collected retrospectively . Information on the type of vascular access and laboratory results was obtained from the latest hemodialysis records before the primary study endpoints of patient death, lost to follow - up, or the end of the study period . The primary cause of esrd was categorized as primary glomerulonephritis (pgn), diabetic nephropathy (dn), hypertensive nephropathy (htn), and other / unknown . Death causes were classified as cardiovascular events, cerebrovascular events, infection, sudden death of unknown reason, bleeding, cancer, and other / unknown . Dialysis duration was defined as the number of months between their first renal replacement therapy and a primary endpoint or completion of the study . Types of vascular access were arteriovenous fistula (avf), tunneled cuffed catheter (tcc), noncuffed catheter (ncc), arteriovenous graft, and other / unknown . Data were expressed as mean standard deviation (sd) or median (interquartile range) for continuous variables according to their distribution and as percentages for categorical variables . Between - group comparison was performed using the student's t - test or kruskal - wallis test for continuous variables and chi - square test for categorical variables . Variables that affected all - cause mortality (p <0.05) in the univariate analysis were included in the multivariate logistic regression analysis model to determine factors associated with all - cause mortality . All analyses were performed with statistical package for the social sciences software (version 21.0, spss inc ., this study was approved by the ethics committee of the chinese people's liberation army general hospital . Patients under mhd therapy in 16 blood purification centers from 12 provinces in china from january 2012 to december 2014 were selected . Inclusion criteria were as follows: age 20 years, receiving mhd therapy for at least 3 months, and with laboratory data, including blood pressure, kt / v, hemoglobin, serum albumin, serum calcium, and serum phosphate . Based on survival status, the participants were divided into two groups: the survival group (still alive on december 31, 2014) and the death group (died of any cause within the study period). Patients who were lost to follow - up for any reason began peritoneal dialysis, or received kidney transplant before december 31, 2014, were included in the survival group . Data, including sex, age, primary cause of esrd, dialysis duration, death cause, type of vascular access, dialysis time every week, and laboratory results, were collected retrospectively . Information on the type of vascular access and laboratory results was obtained from the latest hemodialysis records before the primary study endpoints of patient death, lost to follow - up, or the end of the study period . The primary cause of esrd was categorized as primary glomerulonephritis (pgn), diabetic nephropathy (dn), hypertensive nephropathy (htn), and other / unknown . Death causes were classified as cardiovascular events, cerebrovascular events, infection, sudden death of unknown reason, bleeding, cancer, and other / unknown . Dialysis duration was defined as the number of months between their first renal replacement therapy and a primary endpoint or completion of the study . Types of vascular access were arteriovenous fistula (avf), tunneled cuffed catheter (tcc), noncuffed catheter (ncc), arteriovenous graft, and other / unknown . Data were expressed as mean standard deviation (sd) or median (interquartile range) for continuous variables according to their distribution and as percentages for categorical variables . Between - group comparison was performed using the student's t - test or kruskal - wallis test for continuous variables and chi - square test for categorical variables . Variables that affected all - cause mortality (p <0.05) in the univariate analysis were included in the multivariate logistic regression analysis model to determine factors associated with all - cause mortality . All analyses were performed with statistical package for the social sciences software (version 21.0, spss inc ., data from 4104 esrd patients from 16 centers were obtained (57.58% male; age 59 years), among whom 620 patients were dead . Table 1 shows that among the 4104 patients, patients with pgn were the most common (n = 1902, 46.35%), followed by those with dn (n = 788, 19.20%) and htn (n = 460, 11.21%). Characteristics of the studied cohort and comparison of the two groups values are presented as median (iqr) or n (%). Pgn: primary glomerulonephritis; dn: diabetic nephropathy; htn: hypertensive nephropathy; avf: arteriovenous fistula; tcc: tunnelled cuffed catheter; ncc: noncuffed catheter; avg: arteriovenous graft; esrd: end - stage renal disease; iqr: interquartile range . The most common cause of death was cardiovascular events (n = 235, 37.90%), followed by cerebrovascular events (n = 126, 20.32%), infection (n = 73, 11.77%), sudden death of unknown reason (n = 36, 5.81%), bleeding (n = 35, 5.65%), cancer (n = 17, 2.74%), and other / the studied group was divided into two groups based on their outcome: the death group (n = 620) and the survival group (n = 3484). The death group had 61.90% males, while the survival group had 46.31% males (p = 0.013). The death group had a significantly higher median age than the survival group (68 years vs. 58 years). The median dialysis duration (35 months vs. 34 months) was not significantly different between the two groups . However, the death group had less patients with 312 months of dialysis duration (15.97% vs. 21.33%) but more patients with 2560 months of dialysis duration (39.19% vs. 30.86%). The percentage of patients with pgn as the primary cause of esrd in the death group was lower than that in the survival group (31.13% vs. 49.05%, respectively), while the percentage of patients with dn (35.81% vs. 16.25%) or htn (15.16% vs. 10.51%) was significantly higher in the death group . Compared with the survival group, the death group had a lower diastolic blood pressure, hemoglobin, serum albumin, serum calcium, serum phosphate, and kt / v . Univariate analysis identified several factors associated with mortality, including sex, age, cause of esrd, type of vascular access, dialysis time every week, diastolic blood pressure, hemoglobin, serum albumin, serum calcium, serum phosphate, and kt / v [table 2]. Subsequently, two multivariate analysis models were built: one model consisted of all significant factors in the univariate analysis, while the other excluded laboratory examination . In the nonlaboratory examination model, sex, age, dialysis duration, cause of esrd, type of vascular access, and dialysis time every week male sex (odd ratio [or] 1.302; 95% confidence interval [ci]: 1.0801.571), age (or 1.042; 95% ci: 1.0351.049), dn (or 2.472; 95% ci: 1.9693.105), htn (or 1.629; 95% ci: 1.2242.169), and dialysis with tcc (or 1.640; 95% ci: 1.2442.161) were independent risk factors for mortality . Dialysis with ncc (or 0.320; 95% ci: 0.1920.532) seemed to be associated with better outcome . Univariate analysis of factors associated with all - cause mortality (n = 4104) pgn: primary glomerulonephritis; dn: diabetic nephropathy; htn: hypertensive nephropathy; avf: arteriovenous fistula; tcc: tunnelled cuffed catheter; ncc: noncuffed catheter; avg: arteriovenous graft; esrd: end - stage renal disease; or: odds ratio; ci: confidence interval . Multivariate analyses of factors associated with all - cause mortality unadjusted for laboratory examination (n = 4104) pgn: primary glomerulonephritis; dn: diabetic nephropathy; htn: hypertensive nephropathy; avf: arteriovenous fistula; tcc: tunnelled cuffed catheter; ncc: noncuffed catheter; avg: arteriovenous graft; esrd: end - stage renal disease; or: odds ratio; ci: confidence interval . Table 4 shows the multivariate analyses of factors associated with all - cause mortality adjusted for laboratory examination . These results show that, after adjustment for laboratory variables, male sex, age, and dn were still significantly associated with higher mortality, while dialysis with ncc was associated with lower mortality . Moreover, we observed that high hemoglobin (or 0.974; 95% ci: 0.9670.981), serum albumin (or 0.939; 95% ci: 0.9150.963), and serum calcium (or 0.585; 95% ci: 0.3460.989) levels were protective factors associated with mortality . Multivariate analyses of factors associated with all - cause mortality adjusted for laboratory examination (n = 4104) pgn: primary glomerulonephritis; dn: diabetic nephropathy; htn: hypertensive nephropathy; avf: arteriovenous fistula; tcc: tunnelled cuffed catheter; ncc: noncuffed catheter; avg: arteriovenous graft; or: odds ratio; ci: confidence interval . Data from 4104 esrd patients from 16 centers were obtained (57.58% male; age 59 years), among whom 620 patients were dead . Table 1 shows that among the 4104 patients, patients with pgn were the most common (n = 1902, 46.35%), followed by those with dn (n = 788, 19.20%) and htn (n = 460, 11.21%). Characteristics of the studied cohort and comparison of the two groups values are presented as median (iqr) or n (%). Pgn: primary glomerulonephritis; dn: diabetic nephropathy; htn: hypertensive nephropathy; avf: arteriovenous fistula; tcc: tunnelled cuffed catheter; ncc: noncuffed catheter; avg: arteriovenous graft; esrd: end - stage renal disease; iqr: interquartile range . The most common cause of death was cardiovascular events (n = 235, 37.90%), followed by cerebrovascular events (n = 126, 20.32%), infection (n = 73, 11.77%), sudden death of unknown reason (n = 36, 5.81%), bleeding (n = 35, 5.65%), cancer (n = 17, 2.74%), and other / unknown (n = 98, 15.81%). The studied group was divided into two groups based on their outcome: the death group (n = 620) and the survival group (n = 3484). The death group had 61.90% males, while the survival group had 46.31% males (p = 0.013). The death group had a significantly higher median age than the survival group (68 years vs. 58 years). The median dialysis duration (35 months vs. 34 months) was not significantly different between the two groups . However, the death group had less patients with 312 months of dialysis duration (15.97% vs. 21.33%) but more patients with 2560 months of dialysis duration (39.19% vs. 30.86%). The percentage of patients with pgn as the primary cause of esrd in the death group was lower than that in the survival group (31.13% vs. 49.05%, respectively), while the percentage of patients with dn (35.81% vs. 16.25%) or htn (15.16% vs. 10.51%) was significantly higher in the death group . Compared with the survival group, the death group had a lower diastolic blood pressure, hemoglobin, serum albumin, serum calcium, serum phosphate, and kt / v . Univariate analysis identified several factors associated with mortality, including sex, age, cause of esrd, type of vascular access, dialysis time every week, diastolic blood pressure, hemoglobin, serum albumin, serum calcium, serum phosphate, and kt / v [table 2]. Subsequently, two multivariate analysis models were built: one model consisted of all significant factors in the univariate analysis, while the other excluded laboratory examination . In the nonlaboratory examination model, sex, age, dialysis duration, cause of esrd, type of vascular access, and dialysis time every week were included . Male sex (odd ratio [or] 1.302; 95% confidence interval [ci]: 1.0801.571), age (or 1.042; 95% ci: 1.0351.049), dn (or 2.472; 95% ci: 1.9693.105), htn (or 1.629; 95% ci: 1.2242.169), and dialysis with tcc (or 1.640; 95% ci: 1.2442.161) were independent risk factors for mortality . Dialysis with ncc (or 0.320; 95% ci: 0.1920.532) seemed to be associated with better outcome . Univariate analysis of factors associated with all - cause mortality (n = 4104) pgn: primary glomerulonephritis; dn: diabetic nephropathy; htn: hypertensive nephropathy; avf: arteriovenous fistula; tcc: tunnelled cuffed catheter; ncc: noncuffed catheter; avg: arteriovenous graft; esrd: end - stage renal disease; or: odds ratio; ci: confidence interval . Multivariate analyses of factors associated with all - cause mortality unadjusted for laboratory examination (n = 4104) pgn: primary glomerulonephritis; dn: diabetic nephropathy; htn: hypertensive nephropathy; avf: arteriovenous fistula; tcc: tunnelled cuffed catheter; ncc: noncuffed catheter; avg: arteriovenous graft; esrd: end - stage renal disease; or: odds ratio; ci: confidence interval . Table 4 shows the multivariate analyses of factors associated with all - cause mortality adjusted for laboratory examination . These results show that, after adjustment for laboratory variables, male sex, age, and dn were still significantly associated with higher mortality, while dialysis with ncc was associated with lower mortality . Moreover, we observed that high hemoglobin (or 0.974; 95% ci: 0.9670.981), serum albumin (or 0.939; 95% ci: 0.9150.963), and serum calcium (or 0.585; 95% ci: 0.3460.989) levels were protective factors associated with mortality . Multivariate analyses of factors associated with all - cause mortality adjusted for laboratory examination (n = 4104) pgn: primary glomerulonephritis; dn: diabetic nephropathy; htn: hypertensive nephropathy; avf: arteriovenous fistula; tcc: tunnelled cuffed catheter; ncc: noncuffed catheter; avg: arteriovenous graft; or: odds ratio; ci: confidence interval . There exists abundant literature on the risk factors for death in mhd patients, which are based on the baseline data obtained from those patients . However, little is known about the clinical and laboratory parameters associated with the status of mhd patients preceding death, especially in our country . In this study, we used the latest records, i.e., before patient outcome identification or end of the study period, to find the characteristics and factors associated with death in mhd patients . The results showed that the death group had more men and more patients with dn and htn . Moreover, patients in the group also had higher age and lower levels of diastolic blood pressure, hemoglobin, albumin, serum calcium, serum phosphate, and kt / v compared with survival group . Multivariate analysis showed that male sex, age, dn, and low hemoglobin, albumin, and serum calcium levels were associated with death in hemodialysis patients . The logistic regression analysis showed that lower hemoglobin and serum albumin were associated with death . The low levels of albumin and hemoglobin might be the result of both inflammatory and nutritional components . Nevertheless, they could also lead to undesirable outcomes . Low hemoglobin level and erythropoiesis - stimulating agents could lead to cardiovascular events, fatigue, and even mortality, while low serum albumin level in dialysis patients was also known to be associated with malnutrition, inflammation, and all - cause and cardiovascular mortality . The result was partly in accordance with the studies that have reported that mhd patients experienced a decrease in serum albumin level in their final stages of life . Numerous reports have demonstrated that a high level of serum calcium and phosphate could cause vascular calcification and even mortality . However, our data showed that serum calcium and phosphate levels of patients in the death group were significantly lower than those of patients in the survival group . Moreover, the logistic regression analysis revealed that lower serum calcium was associated with death . Low serum calcium level could be associated with the hypoalbuminemic status, which might partly explain the results in our study . K / doqi and kdigo guidelines state that, because serum calcium is partly bound to serum albumin, total serum calcium decreases 0.8 mg / dl (0.2 mmol / l) for every 1 g decrease in serum albumin below 4 g / dl (40 g / l). Furthermore, the time before death course is frequently characterized by a loss of regulatory functions in numerous subsystems of dialysis patients; hence, their system cannot react properly to perturbations . We also speculate that the poor diet of patients in their final stages of life might be a cause of the low serum levels of calcium and phosphate . However, we could only provide the results and suggest the phenomena without being able to reason them . Further deep studies are needed to explain these mechanisms and their interactions . In our study, male was an independent risk factor for mortality, and this study showed that more men than women were undergoing hemodialysis treatment, which is consistent with our national hemodialysis registry data and the usrds . In our results, male sex was associated with a 1.437 times risk of death, which is also seen in other studies . Furthermore, the dialysis outcomes and practice patterns study (dopps) analyzed 206,374 patients receiving hemodialysis in 12 countries and found that the survival advantage of women over men in the general population was markedly diminished in hemodialysis patients . The dopps study also found that the male - to - female mortality rate ratio in the general population varied from 1.5 to 2.6 for age groups under 75 years, while that in hemodialysis patients was close to 1 . In the general population, women have longer life expectancy than men, which could be related to a lower prevalence of cardiovascular risk factors and events in women . In hemodialysis patients, men were younger, were less frequently obese, received kidney transplant more frequently, and were less frequently depressed . These factors may partly explain the survival advantage of females in the general population and the lack of that survival advantage in females requiring hemodialysis . According to the cnrds, glomerulonephritis (54.2%) was the most frequent disease among chinese hemodialysis patients in 2015, followed by dn (17.0%) and htn (9.9%). In our study, the leading cause of esrd in the survival group was similar to that in the annual data report of cnrds . However, in the death group, dn (n = 222, 35.81%) accounted for a larger proportion of deaths compared with gn (n = 193, 31.13%). The death group also had a higher proportion of htn patients than that in the report of cnrds . Logistic regression analysis also showed that the risks of death in patients with dn or htn were 2.472 times and 1.629 times higher, respectively, than those of patients with pgn before adjusting for laboratory examination . After adjusting for laboratory examination, dn remained risk factors for death . As reported, the incidence of hypertension, coronary heart disease, and cerebral thrombus in dn patients is higher than those in non - dn patients . The absolute cardiovascular disease (cvd) risk in diabetic patients is two - fold greater than that in persons without diabetes . Conditions associated with diabetes mellitus type 2, such as insulin resistance, hyperinsulinemia, and hyperglycemia, may lead to inflammation, dyslipidemia, endothelial dysfunction, and oxidative stress, which could predispose patients to atherosclerosis and cvd . Patients often used catheters when they initiated hemodialysis; thus, the percentage of ncc use was higher at 312 months than at 1 year after dialysis initiation . In our study, compared with the death group, therefore, we hypothesize that this may explain the apparent advantage of ncc . In this study, we used logistic regression rather than the cox's proportional hazard model . We began the follow - up on january 1, 2012, rather than the time when patients began their first hemodialysis . The survival time in this study should be calculated from the study entry date (january 1, 2012) to the date of death, lost to follow - up, or the end of the study (december 31, 2014). However, patients who started dialysis before the entry date had survived for a period of time, which should be included in their real survival time . Those might affect the cox's proportional hazard model analysis to some extent . First, the laboratory data were obtained from the latest records before patient outcome identification . Second, there were no lipid profile, uric acid, and body mass index (bmi) data in the analysis, which might be associated with death in mhd patients . Considering that not all the patients underwent the lipid profile or uric acid examination in this study moreover, some hospitals did not record patients height or bmi in the hemodialysis record . We, therefore, thought that the bmi data might not be accurate enough and did not include it . Third, as the data were collected retrospectively, information bias to some extent existed . Hence, our data do not reflect the overall mhd patients status in our country . In conclusion, this study revealed the characteristics of mhd patients prior to death and the factors associated with death in mhd patients . Hemodialysis patients preceding death had lower hemoglobin, albumin, and serum calcium levels but higher age . Multivariate analysis showed that male sex, age, dn, low hemoglobin, albumin, and serum calcium levels were associated with death in hemodialysis patients . This study was supported by grants from the national key technology r&d program (no . 2011bai10b08); special fund for nhfpc scientific researchin the public welfare (no . 201502023), the fund of chinese pla 12th five - year plan for medical sciences (no.bws14j040; no . This study was supported by grants from the national key technology r&d program (no . 2011bai10b08); special fund for nhfpc scientific researchin the public welfare (no . 201502023), the fund of chinese pla 12th five - year plan for medical sciences (no.bws14j040; no.
Amyotrophic lateral sclerosis / parkinsonism - dementia complex (als / pdc) is a rare disorder endemic to guam island and the kii peninsula of japan . It shows a unique combination of parkinsonism, amyotrophy, and dementia, and the form of dementia, which shows a phenotype similar to alzheimer's disease (ad), is becoming predominant in the kii peninsula . Although kii als / pdc shows several unique clinical features, including severe atrophy of the frontal and temporal lobes on magnetic resonance imaging (mri), decreased cerebral blood flow in the frontal and temporal lobes on single - photon emission computed tomography (spect), pigmentary retinopathy, and decreased cardiac i - meta - iodobenzylguanidine uptake, a postmortem examination is required for a definitive diagnosis . Since biomarkers for als / pdc have not yet been identified, we analyzed cerebrospinal fluid (csf) biomarkers for kii als / pdc to discriminate it from other neurodegenerative disorders . We collected csf samples from 12 patients with kii als / pdc (6 men, 6 women, mean age 67.9 3.7 years, mean illness duration 5.63 years), nine patients with ad (2 men, 7 women, mean age 61.1 8.7 years, mean illness duration 1.92 years), 11 patients with als (8 men, 3 women, mean age 60.6 12.6 years, mean illness duration 1.1 years), nine patients with parkinson's disease (pd; 7 men, 2 women, mean age 71.3 2.2 years, mean illness duration 4.42 years), and five disease control patients (c; 4 men, 1 woman, mean age 36.2 20.3 years). All of the patients with kii als / pdc were natives of hohara village, which is an area of high als / pdc prevalence on the kii peninsula . We collected csf samples over 10 years; therefore, the period between csf collection and analysis was not standardized . The diagnosis of kii als was made according to the airlie house criteria, since the clinical symptoms of kii als are essentially the same as those of classical als . The diagnosis of kii pdc was made by a unique combination of levodopa - unresponsive parkinsonism and dementia, which are frequently accompanied by amyotrophy of the extremities and/or pyramidal tract signs . Mini - mental state examination (mmse) was used for the evaluation of dementia and cut - off point was 23 (data not shown). The frontal lobes and/or temporal lobes of als / pdc patients showed atrophy on mri and/or a decrease of cerebral blood flow on spect . Csf samples were immediately centrifuged at 1000 g for 15 min and stored at 80c with polypropylene tube . The total tau (t - tau), phosphorylated tau (p - tau), and amyloid beta (a) concentrations were measured with an enzyme - linked immunosorbent assay (elisa) kit using a monoclonal antibody specific for t - tau, p - tau, and a142 (innotest htau ag, phosphor tau(181p), and -amyloid (142), innogenetics, ghent, belgium). Elisa assays were carried out using several samples from each group on the same plate in a randomized manner and were repeated using randomized samples in the same manner in plural times . A factorial anova was performed with csf - t - tau, csf - p - tau, and csf - a42, as dependent variables, with the diagnostic category (ad, als, c, kii als / pdc, and pd) using jmp 9.0 . The ethics committee of mie university graduate school of medicine approved this study and the declaration of helsinki was followed . Csf - a42, csf - t - tau, and csf - p - tau were compared between ad, als, c, kii als / pdc, and pd . The concentrations of csf - t - tau and csf - p - tau were significantly higher in ad (t - tau; 378.0 41.76 pg / ml; p <0.001, p - tau; 42.4 6.78 pg / ml; p <0.028) than in the other groups . However, the concentrations of csf - t - tau and csf - p - tau did not differ significantly between kii als / pdc, als, c, and pd (figures 1(a) and 1(b)). The concentration of csf - a42 was significantly reduced in ad (402.2 56.6 pg / ml; p <0.03) compared to als and c and relatively reduced in kii als / pdc (465.4 53.69 pg / ml; p <0.018) compared to als . Most of the als / pdc patients had csf concentration values that fell below the cutoff based on c (figure 1(c)). The ratios of csf - p - tau to csf - a42 were significantly increased in ad (0.125 0.02) compared with kii als / pdc (0.043 0.02; p <0.008), als (0.035 0.019; p <0.003), pd (0.025 0.02; p <0.002), and c (0.027 0.09; p the concentrations of csf - t - tau, csf - p - tau, or csf - a42 were not related to the clinical parameters (age, sex, illness duration, or dementia) in the kii als / pdc patients . The number of c samples was small and the average age of control patients was low . Generally, csf tau level gradually increase according to age and csf a is not affected by age . Csf tau level of c samples was relatively low, but it was not significant . Thus, the csf values of c were not comparable to those of other groups . Nevertheless, the optimal cut - off values that discriminate c from ad were similar to those in previous reports [6, 7] in which a larger number of control samples were analyzed . Csf tau level of kii als / pdc samples did not increase, although the average age of kii als / pdc group was older than that of ad group . The present study showed that csf - t - tau and csf - p - tau concentrations from patients with kii als / pdc were not increased compared to those in the other disease groups, and a42 concentration in the csf was relatively decreased . The ratio of csf - p - tau to csf - a42 segregates kii als / pdc from ad . Because als / pdc is associated with tau pathology in the absence of amyloid plaques, the expectation was that als / pdc patients would not show the alzheimer's disease (ad) profile of decreased a42 but might show increased t - tau and/or p - tau in the csf . In general, decreased csf - a42 indicates plaque pathology, and increased csf - t - tau and csf - p - tau indicate axonal degeneration and tangle pathology, respectively . Recently, the average age of onset of kii als / pdc is increasing and a deposition is conspicuous in autopsied patients . Therefore, decreased csf - a42 may reflect a pathology in the most recent patients . We analyzed the precise tau isoform of over 10 patients with autopsy - proven als / pdc recently and identified a 3r + 4r type, 4r> 3r type, and a 4r predominant type . The glial tau pathology is particularly related to the 4r isoform, and we consider kii als / pdc to be a 4r - dominant tauopathy (unpublished data). Noguchi et al . Examined the concentrations of csf - t - tau, csf - p - tau, and csf - a42 in patients with progressive supranuclear palsy (psp) and corticobasal degeneration (cbd); the concentrations of csf - t - tau and csf - p - tau did not significantly differ between psp, cbd, and controls, and the concentration of csf - a42 was significantly lower in psp and cbd than in controls . The authors speculated that the absence of an increase of csf - t - tau and csf - p - tau concentrations might reflect 4r tau predominance and a reduction of csf - a42 might suggest deposition or mismetabolism of a . Taken together, csf biomarkers of kii als / pdc might have similar properties to those of 4r tauopathy, psp, and cbd; however the relationship between tau isoform and csf tau level remains to be resolved . Finally, the present findings, in which csf - t - tau and csf - p - tau concentrations were not increased and csf - a42 concentration was relatively decreased, suggest that csf analysis may be useful to differentiate als / pdc from ad, als, and pd . Nevertheless there is a major limitation of the interpretation of the data . The size of each group is small, the age of the control group is much younger, and there were two populations in the ad group regarding the levels tau, p - tau, and a/p - tau . Further study using groups with larger size of subjects is needed to confirm the proposed utility of the csf biomarkers.
Atrial fibrillation (af) affects 12% of the total population, with prevalences increasing with age . If untreated, af increases the risk of ischaemic stroke, heart failure, and mortality . Anticoagulants are very effective and reduce the stroke risk by 60%, and all - cause mortality by 25% . Underdiagnosis of af is, however, common and may at least partly be related to a lack of symptoms, so - called silent af. In patients admitted with an ischaemic stroke in the presence of af, the arrhythmia was unknown in one - fourth to almost half of the patients . Older age and co - morbidities such as heart failure, hypertension, diabetes, prior transient ischeamic attack (tia)/stroke, and vascular disease (cha2ds2-vasc score) drive the risk of thromboembolism . Guidelines recommend to prescribe anticoagulation therapy to af patients with a cha2ds2-vasc score of 1 or more (or 2 or more), independent of whether af is paroxysmal or persistent, screen detected, or diagnosed in patients with symptoms . The 2010 european society of cardiology (esc) guidelines recommend screening for af among those aged 65 years and over in primary care, for instance by pulse palpation during blood pressure measurement, and followed by an electrocardiogram (ecg) in case of irregularity . Practice studies in primary care showed that active pulse feeling is infrequently performed nowadays, and there seems to be room for improvement of (early) detection of af with devices . Non - invasive devices such as specialized blood pressure monitors that automatically detect af (microlife rr monitor), and devices that register single - lead ecgs (alivecor, mydiagnostick) may be considered good alternatives for af screening . The mydiagnostick is an easy to apply device that registers and automatically analyses a single - lead i rhythm strip after holding the device with both hands for one minute . It signals a red light in case of rhythm irregularity suspicious for af, and a green light in case of absence of af . The rhythm strip can be visualized and analysed by linking the device to a computer . A recent validation study showed that the sensitivity and negative predictive value of a green light signal was very good (both 100%) in a cardiology setting with a prevalence of af of 28% . In a pilot study, this device seemed feasible as a screening tool during influenza vaccination in primary care . Every autumn, general practitioners (gps) in the netherlands invite eligible community - dwelling persons for a 1-day influenza vaccination session . Dutch indications for influenza vaccination are: (i) age 60 years or over, and (ii) for younger persons, (a history of) diabetes mellitus, copd, asthma, ischaemic heart disease, or heart failure . This setting provides an ideal opportunity for selective screening of a large population of community - dwelling persons who are at increased risk of af . We aim to (i) calculate the proportion of newly detected cases, (ii) assess feasibility of large - scale screening with a single - lead ecg device during influenza vaccination, (iii) evaluate the patient characteristics most predictive for a new screen - detected diagnosis of af, (iv) determine the cha2ds2-vasc score of novel screen - detected cases and compare these with known cases with af who received influenza vaccination, and (v) identify enablers and barriers to the implementation of screening with the mydiagnostick during influenza vaccination . Ten general practices participated, all located in the northern part of the netherlands, in the vicinity of groningen . These practices had 49 190 community - dwelling persons enlisted and in the year 2013, 15 032 (30.6%) persons were eligible and invited for the yearly influenza vaccination . Eventually, 9450 (62.9%) showed up to receive the influenza vaccination at the 1-day session . We invited a sample of 3269 persons (34.6% of all participants of the influenza vaccination) to hold the mydiagnostick . Patients were invited to participate, irrespective of whether the patient was already known with the arrhythmia . Patients were informed that af mainly affects elderly, that is, those aged 65, and research nurses were instructed to selectively screen people aged over 60, including those already known with af . The management of newly detected cases of af was at the discretion of the participating gp . Two gp nurses perform the registration in one room, and in the second room three to four healthcare workers (a mix of nurses and gps) do the immunization . During the year of the study, thus, one and the same research team could visit each practice and blend screening for af with the immunization programme . Two trained research nurses explained the mydiagnostick to influenza participants older than 60, and two other nurses took care of the handling of the device by patients, the informed consent, and the registration of the results (green or red signalling). The four research nurses received a training of 30 min on the ins and outs of the mydiagnostick device, about asking informed consent, and the filling out of the case record form . Within the logistics of the influenza vaccination every eligible participant received a short lasting instruction on how to hold the device during 1 min and information on the consequences of a green and red signal . Our research team used 10 sticks every evening and was able to screen 160 persons per hour . For the purpose of this study, a cardiologist was present during the influenza vaccination session in all 10 locations, and immediately judged the one - channel ecg on the computer with the stick connected to it . After the screening sessions, the mydiagnostick rhythm registrations of all 3269 participants were analysed . In case of a red light, the ecg recording was analysed by two cardiologists (r.t . And l.j.g .) For the presence or absence of af . In case of conflicting interpretation, the two cardiologists discussed the case to come to consensus . The ecg recordings of the green mydiagnostick results were analysed by one single cardiologist (r.t . ). In this article, we refer to a green mydiagnostick light in combination with no af on the single - lead ecg registration as a negative mydiagnostick result. A red light in combination with confirmation of af on the ecg strip is a positive mydiagnostick result. Of all participants, age and gender were registered, and from a random sample of 220 persons with a negative mydiagnostick result the information on co - morbidities was gathered by scrutinizing the gp's electronic medical files including letters from medical specialists . The same was done in all af cases with the screening, both new and already known cases . For comparison between groups, we used the test or fisher's exact test for dichotomous variables and student's t - test for continuous variables . Medical characteristics between sample with no af at screening (n = 220) and the screen - detected cases (n = 37) were first compared using univariable logistic regression . We included age, male gender, history of stroke or tia and at least one of remaining cha2ds2-vasc score co - morbidities . We used only four predictors for both univariable and multivariable logistic regression analyses because we had 37 new cases of screen - detected af . All analyses were performed with r for windows version 3.1 (the r foundation statistical computing, http://cran.r-project.org). Ten general practices participated, all located in the northern part of the netherlands, in the vicinity of groningen . These practices had 49 190 community - dwelling persons enlisted and in the year 2013, 15 032 (30.6%) persons were eligible and invited for the yearly influenza vaccination . Eventually, 9450 (62.9%) showed up to receive the influenza vaccination at the 1-day session . We invited a sample of 3269 persons (34.6% of all participants of the influenza vaccination) to hold the mydiagnostick . Patients were invited to participate, irrespective of whether the patient was already known with the arrhythmia . Patients were informed that af mainly affects elderly, that is, those aged 65, and research nurses were instructed to selectively screen people aged over 60, including those already known with af . The management of newly detected cases of af was at the discretion of the participating gp . Two gp nurses perform the registration in one room, and in the second room three to four healthcare workers (a mix of nurses and gps) do the immunization . During the year of the study, thus, one and the same research team could visit each practice and blend screening for af with the immunization programme . Two trained research nurses explained the mydiagnostick to influenza participants older than 60, and two other nurses took care of the handling of the device by patients, the informed consent, and the registration of the results (green or red signalling). The four research nurses received a training of 30 min on the ins and outs of the mydiagnostick device, about asking informed consent, and the filling out of the case record form . Within the logistics of the influenza vaccination every eligible participant received a short lasting instruction on how to hold the device during 1 min and information on the consequences of a green and red signal . Our research team used 10 sticks every evening and was able to screen 160 persons per hour . For the purpose of this study, a cardiologist was present during the influenza vaccination session in all 10 locations, and immediately judged the one - channel ecg on the computer with the stick connected to it . After the screening sessions, the mydiagnostick rhythm registrations of all 3269 participants were analysed . In case of a red light, the ecg recording was analysed by two cardiologists (r.t . And l.j.g .) For the presence or absence of af . In case of conflicting interpretation, the two cardiologists discussed the case to come to consensus . The ecg recordings of the green mydiagnostick results were analysed by one single cardiologist (r.t . ). In this article, we refer to a green mydiagnostick light in combination with no af on the single - lead ecg registration as a negative mydiagnostick result. A red light in combination with confirmation of af on the ecg strip is a positive mydiagnostick result. Of all participants, age and gender were registered, and from a random sample of 220 persons with a negative mydiagnostick result the information on co - morbidities was gathered by scrutinizing the gp's electronic medical files including letters from medical specialists . The same was done in all af cases with the screening, both new and already known cases . For comparison between groups, we used the test or fisher's exact test for dichotomous variables and student's t - test for continuous variables . Medical characteristics between sample with no af at screening (n = 220) and the screen - detected cases (n = 37) were first compared using univariable logistic regression . We included age, male gender, history of stroke or tia and at least one of remaining cha2ds2-vasc score co - morbidities . We used only four predictors for both univariable and multivariable logistic regression analyses because we had 37 new cases of screen - detected af . All analyses were performed with r for windows version 3.1 (the r foundation statistical computing, http://cran.r-project.org). In total, 9450 persons participated in the influenza vaccination (mean age 64.1, sd 16.5, years). The 3269 persons (34.6%) who held the mydiagnostick were more often men (49.0 vs. 44.9%) and on average 8.6 years older than the 6181 persons who were not screened (table 1 and figure 1). It was logistically not feasible to ask all eligible persons to participate because providing written informed consent took some time . Table 1patient characteristics of attendees of the influenza vaccination, irrespective of af statuspersons attending influenza vaccinationn = 9450individuals who did not hold the mydiagnostickn = 6181individuals who held the mydiagnostickn = 3269p - valuemen (%) 4375 (46.3)2773 (44.9)1602 (49.0)<0.001mean age in years (sd)64.1 16.560.8 18.369.4 8.9<0.001age 60 years (%) 6795 (71.9)3797 (61.4)2998 (91.7)<0.001age 65 years (%) 5306 (56.1)2749 (44.5)2557 (78.2)<0.001age 75 years (%) 2153 (22.8)1325 (21.4)828 (26.2)<0.001p - value is given for the comparison of individuals who held the mydiagnostick (n = 3269) and those who did not hold this device (n = 6181). Figure 1age distribution of the 9450 persons attending influenza vaccination compared with 3269 screened persons . Attended population: all persons who came for influenza vaccination in 2013 . Screened population: all persons who held the mydiagnostick during this vaccination . Patient characteristics of attendees of the influenza vaccination, irrespective of af status * p - value is given for the comparison of individuals who held the mydiagnostick (n = 3269) and those who did not hold this device (n = 6181). Screened population: all persons who held the mydiagnostick during this vaccination . In total, 193 participants (5.9% of the screened population) had a red signalling with the mydiagnostick . Of them, 121 (3.7% of the screened population) had af on the single - lead rhythm strip according to the cardiologists (figure 2). Eighty - four cases were already known with af, and 37 (1.1% of the screened population) were new screen - detected cases . In 3 of the 193 cases with a red signal, the rhythm strip could not be interpreted by either cardiologist and these were considered as no af. In all 3076 cases with a green light, the cardiologist could confirm sinus rhythm . The 37 new screen - detected cases of af were older, had more co - morbidities such as hypertension (64.9% vs. 43.2%), stroke (18.9% vs. 2.7%), tia (8.1 vs. 0.5%), and copd (10.8% vs. 3.2%) than a random sample of 220 participants of the influenza vaccination, but without af (table 2). The unadjusted odds ratios of a new screen - detected diagnosis of af were 9.78 (95% ci 3.3828.33) for a history of stroke or tia, 0.65 (95% ci 0.321.31) for male gender, 1.09 per year for older age (95% ci 1.051.14), and 1.83 (95% ci 0.853.98) for a history of either diabetes mellitus, hypertension, heart failure, or vascular disease . Multivariable logistic regression showed that age (or 1.09 per year; 95% ci 1.051.14) and a history of ischaemic stroke or tia (or 6.05; 95%ci 1.9319.0) were independent predictors of a screen - detected diagnosis of af (table 3). Table 2baseline characteristics of individuals who held the mydiagnostick divided in new screen - detected cases of af, patients already known with af, and a random sample of patients with no afnewly detected af with screeningn = 37already known with af and a red light with screeningn = 84sample of patients with no afn = 220men (%) 21 (56.8)49 (58.3)101 (45.9)mean age (sd)75.9 (8.6)75.6 (8.3)65.9 (12.4)medical history hypertension (%) 24 (64.9)55 (65.5)95 (43.2) diabetes (%) 9 (24.3)23 (27.4)52 (23.6) heart failure (%) 2 (5.4)18 (21.4)2 (0.9) stroke (%) 7 (18.9)9 (10.7)6 (2.7) tia (%) 3 (8.1)10 (11.9)1 (0.5) vte (%) 2 (5.4)7 (14.3)10 (4.5) peripheral arterial disease (%) 3 (8.1)2 (2.4)7 (3.2) prior myocardial infarct (%) 2 (5.4)10 (14.3)7 (3.2) valvular repair (%) 0 (0)6 (7.1)1 (0.5) cabg / pci (%) 2 (5.4)14 (16.7)19 (8.6) copd (%) 4 (10.8)12 (17.1)17 (7.7) renal disease (%) 3 (8.1)11 (15.7)8 (3.6) pacemaker (%) 0 (0.0)4 (4.8)2 (0.9) vitamin k antagonists (%) 2 (5.4)70 (83.3)5 (2.3) noacs (%) 0 (0.0)7 (8.3)0 (0.0) asa (%) 11 (29.7)7 (8.3)46 (20.9) ace inhibitors (%) 10 (27.0)31 (36.9)55 (25.0) beta - blockers (%) 8 (21.6)59 (70.2)58 (26.4) calcium channel blockers (%) 13 (35.1)21 (25.0)27 (12.3)sample of 220 persons unknown with af and also sinus rhythm on the mydiagnostick single - lead ecg with screening during influenza vaccination.stroke is defined as ischaemic stroke or cryptogenic stroke not being an haemorrhagic infarction.vte = venous thromboembolism, including history of pulmonary embolism and/or deep vein thrombosis.indications for vka in two cases was (1) a history of deep vein thrombosis and lung embolus, and a history of ischaemic stroke . The indications in five cases with a negative mydiagnostick result were (1) a history of more than one deep vein thrombosis or lung embolus, (2) heart valve replacement, and (3) secondary prevention after ischaemic stroke.noac, non - vitamin k antagonist oral anticoagulant . Table 3multivariable logistic regression analysis relating participants characteristics to screen - detected afunivariable analysismultivariable analysisor for screen - detected af95% confidence intervalor for screen - detected af95% confidence intervalage per year1.091.051.141.091.051.14male gender0.650.321.310.560.251.23history of stroke / tia9.783.3828.336.051.9318.98history of one or more remaining co - morbidities of the cha2ds2-vasc score1.830.853.980.910.382.18diabetes mellitus, hypertension, heart failure, and/or vascular disease (coronary heart disease, cabg / pci, myocardial infarction, and/or peripheral arterial disease). Baseline characteristics of individuals who held the mydiagnostick divided in new screen - detected cases of af, patients already known with af, and a random sample of patients with no af sample of 220 persons unknown with af and also sinus rhythm on the mydiagnostick single - lead ecg with screening during influenza vaccination . Indications for vka in two cases was (1) a history of deep vein thrombosis and lung embolus, and a history of ischaemic stroke . The indications in five cases with a negative mydiagnostick result were (1) a history of more than one deep vein thrombosis or lung embolus, (2) heart valve replacement, and (3) secondary prevention after ischaemic stroke . Multivariable logistic regression analysis relating participants characteristics to screen - detected af diabetes mellitus, hypertension, heart failure, and/or vascular disease (coronary heart disease, cabg / pci, myocardial infarction, and/or peripheral arterial disease). The prevalence of screen - detected af cases increased with age, from 0% in those aged <60 years to 4.9% in those aged 85 years and over (table 4). Table 4cases with a red signal with the mydiagnostick divided in those with no af and with af on the rhythm strip, categorized per age category and divided by the number of cases screenedagered light but no af / screened cases%red light but already known af / screened cases%red light and new screen - detected af / screened cases% <605/2711.83/2711.10/2710606410/4412.34/4410.94/4410.9657429/17291.731/17291.814/17290.8758424/7253.337/7255.114/7251.9>854/1033.99/1038.75/1034.9red light with mydiagnostick suggesting irregular heart rhythm and possibly af, but without af after interpretation of the single - lead ecg registration of 1 min by the cardiologist, per number screened individuals per age category.cases with af at moment of screening that was already known per number of screened individuals per age category.screen-detected af cases per number of screened individuals per age category.from 29 cases, 2 were previously diagnosed with paroxysmal af but showed no af at moment of screening.from 24 cases, 7 were previously diagnosed with paroxysmal af but showed no af at moment of screening . Cases with a red signal with the mydiagnostick divided in those with no af and with af on the rhythm strip, categorized per age category and divided by the number of cases screened red light with mydiagnostick suggesting irregular heart rhythm and possibly af, but without af after interpretation of the single - lead ecg registration of 1 min by the cardiologist, per number screened individuals per age category . Cases with af at moment of screening that was already known per number of screened individuals per age category . Screen - detected af cases per number of screened individuals per age category . From 29 cases, 2 were previously diagnosed with paroxysmal af but showed no af at moment of screening . From 24 cases, 7 were previously diagnosed with paroxysmal af but showed no af at moment of screening . Among screen - detected af patients, 2.7% had a cha2ds2-vasc of 0, 18.9% a score of 1, and 78.4% a score of 2 or more . The distribution was similar to cases already known with af (table 5). Table 5cha2ds2-vasc scores for individuals with af, screen - detected cases vs. previously known af casesscreen - detected afn = 37already known afn = 84p - valuemean cha2ds2-vasc score3.4 (1.9)3.6 (1.7)0.49cha2ds2-vasc score 01 (2.7)1 (1.2)0.55cha2ds2-vasc score 17 (18.9)10 (11.9)0.31cha2ds2-vasc score 229 (78.4)73 (86.9)0.23cha2ds2-vasc score is a clinical decision rule used to predict the risk of stroke in patients with af . Scores range from 0 to 9, categories include heart failure (1), hypertension (1), age 65 years (1), age 75 years (1), diabetes mellitus (1), prior ischaemic stroke and/or tia and/or arterial thromboembolism (2), vascular disease (1), and female gender (1).vascular includes coronary heart disease, cabg / pci, myocardial infarction, and/or peripheral arterial disease . Cha2ds2-vasc scores for individuals with af, screen - detected cases vs. previously known af cases cha2ds2-vasc score is a clinical decision rule used to predict the risk of stroke in patients with af . Scores range from 0 to 9, categories include heart failure (1), hypertension (1), age 65 years (1), age 75 years (1), diabetes mellitus (1), prior ischaemic stroke and/or tia and/or arterial thromboembolism (2), vascular disease (1), and female gender (1). Vascular includes coronary heart disease, cabg / pci, myocardial infarction, and/or peripheral arterial disease . Of the 193 individuals with a red signal, 72 (37.3%) had no af on the single - lead i ecg analysed by the two cardiologists . Thirty - four (47.2%) had premature atrial or ventricular complexes, 25 (34.7%) had sinus arrhythmia, and 10 (13.9%) had irregularity caused by artefacts . Three cases had un - interpretable results (0.1% of all cases who held the mydiagnostick); one because of artefacts, one because of a pacemaker rhythm, and one because of the cardiologists thought that it could be either extra systoles or atrial flutter . With a 12-lead ecg one of these three cases was known with paroxysmal af and had dddr pacemaker for bradycardia, and the pacemaker was active at the time he held the mydiagnostick and not during the 12-lead ecg . By screening community - dwelling persons during influenza vaccination in primary care af was detected in 3.7% (2.6% already known cases of af, and 1.1% new cases). The screen - detected cases of af had a similar cha2ds2-vasc score as those already known with af, and the large majority would need anticoagulation . Age (or 1.09 per year, 95%ci 1.051.14) and a history of tia or stroke (or 6.05 95%ci 1.9318.98) were independent predictors for screen - detected af . In a previous study in the uk, community - dwelling person aged 65 years or over from primary care were investigated by systematically taking the pulse followed by a 12-lead ecg if irregular . With this method, 1.6% new cases were detected during 1 year, while 1.0% a year was detected with care as usual . A systematic review including 16 screening studies in persons aged 65 years or over from the community, primary care, or cardiology outpatients clinics showed that screening with pulse palpation resulted in 1.4% new screen - detected cases of af . This is in line with our results achieved by a single screening session during influenza vaccination . Guidelines consider screen - detected af cases to be at increased risk for stroke and eligible for stroke prevention based on the cha2ds2-vasc score . In a substudy of the affirm study, including 481 asymptomatic and 3576 symptomatic af patients, the absence of symptoms (silent af) did not result in a significant difference in mortality after correction for baseline differences (adjusted hazard ratio 1.07, 95% ci 0.791.46) or major events (death, disabling stroke, major central nervous system haemorrhage, or cardiac arrest) (adjusted hr 1.14, 95% ci 0.871.50) compared with af with symptoms . Another study compared the prognosis of 148 asymptomatic and 952 symptomatic af patients during a mean follow - up of 10 years . After adjustment for differences in baseline characteristics a borderline - significant increased risk for ischaemic stroke was seen in asymptomatic patients (hazard ratio 1.8, 95% ci 1.03.8) compared with symptomatic af, whereas asymptomatic patients were more often treated with anticoagulants (40 vs. 21%). The fact that in the present study 27% of patients with screen - detected af already had a history of tia or stroke underlines the importance of detecting silent af . Two previous studies validated the accuracy of the light signal of the mydiagnostick against an immediately followed 12-lead ecg as the reference test . In a case control design with an af prevalence of 28 and 53%, respectively, the negative predictive values were 100 and 93%, and the sensitivities 100 and 94%, respectively . In a screening setting with a low prevalence of (unknown) af, a green light signal with the mydiagnostick will result in a very small number of missing cases (low false negatives). A red signal, however, should be followed by an adequate interpretation of electrocardiographic data, either the 1-min lead i registration recorded by the mydiagnostick or a 12-lead ecg taken immediately after holding the device . Current guidelines on af recommend diagnosing af with either a 12-lead ecg, or a single - lead ecg lasting for 30 s or more . Ambulatory ecg monitors that record two leads of an ecg showed high sensitivity to detect a variety of cardiac arrhythmias, and such devices are widely used nowadays for detecting af in high - risk patients (e.g. After ischaemic stroke). Interpretation of a lead - i ecg by an experienced physician has a high correlation with a 12-lead ecg, with a sensitivity and specificity of 9596 and 9095%, respectively . We could not detect a single novel case of af among 271 persons aged <60 years, which underlines that screening of community - dwelling persons should focus on older individuals, i.e. Aged 60 or 65 years or over . Screening during influenza vaccination is a single time - point screening, and thus, paroxysmal af may be missed . The stroke stop study has demonstrated that repeated measurements during 2 weeks in patients aged 7576 years increases the yield of screening compared with single time - point screening . It may therefore have a large impact on general health of those aged over 60 years . Screening with the mydiagnostick is easily performed; it takes only 1 min and can be done without supervision . In our study, 160 persons per hour were screened with 10 mydiagnosticks by four research nurses . In general, the participants of influenza vaccination were very willing to participate . The main barriers are the need for more personnel and the informed consent procedure . In the present study, silent af was present in 1.3% of all patients 65 years (derived from table 4; 33/2.557 patients). Seventeen per cent of the in total 17 million inhabitants in the netherlands is aged at least 65 years, and influenza vaccination rate in this age category is around 80% . Blending screening with a handheld device with such vaccination could potentially result in screening of 2.3 million people (0.800.1717 million) with as a result up to 30 000 (1.3%) new cases of af that could receive adequate stroke prevention . Therefore, such a screening approach is scalable to make a significant nationwide impact on stroke reduction . A previous study described that screening of community - dwelling people aged over 65 years with 12-lead electrocardiography was cost effective with a participating rate of 50% . Our approach, to screen for af with an easy to use handheld device during an existing influenza vaccination programme, is potentially even more cost effective to reduce ischaemic strokes . For the purpose of the study, the cardiologist was present on the location of screening and immediately judged the ecg from the stick . When implemented on a large scale, the mydiagnostick ecg rhythm strips can be sent to a cardiologist to confirm the presence of af . In our study, in only 3 cases (0.1%), the rhythm strip was not adequately interpretable . We did not screen all participants of the influenza vaccination, but selectively aimed at those aged 60 years or over . This selection was applied because under the age of 60 years af is very uncommon . Secondly, we missed some eligible persons because of time commitment for informed consent, and this could have resulted in more selectively inclusion of more healthy and literate patients . We considered it unlikely that this had substantial impact on our point estimate of screen - detected af, the more because when such a screening is institutionalized a selection towards more healthy and literate persons would also occur . We had information of a random sample of 220 persons with a negative mydiagnostick result . We decided to only assess a random selection of all persons with a negative lightning result for practical and logistic reasons . Higher age in the screened population than in the controls may have resulted in bias towards detecting age as an independent factor . The lead i registrations of the mydiagnostick were interpreted by the cardiologists while having knowledge of the lightning results . Importantly, our aim was the yield of screening, not evaluation of the accuracy of the mydiagnostick . We could not detect a single novel case of af among 271 persons aged <60 years, which underlines that screening of community - dwelling persons should focus on older individuals, i.e. Aged 60 or 65 years or over . Screening during influenza vaccination is a single time - point screening, and thus, paroxysmal af may be missed . The stroke stop study has demonstrated that repeated measurements during 2 weeks in patients aged 7576 years increases the yield of screening compared with single time - point screening . It may therefore have a large impact on general health of those aged over 60 years . Screening with the mydiagnostick is easily performed; it takes only 1 min and can be done without supervision . In our study, 160 persons per hour were screened with 10 mydiagnosticks by four research nurses . In general, the participants of influenza vaccination were very willing to participate . The main barriers are the need for more personnel and the informed consent procedure . In the present study, silent af was present in 1.3% of all patients 65 years (derived from table 4; 33/2.557 patients). Seventeen per cent of the in total 17 million inhabitants in the netherlands is aged at least 65 years, and influenza vaccination rate in this age category is around 80% . Blending screening with a handheld device with such vaccination could potentially result in screening of 2.3 million people (0.800.1717 million) with as a result up to 30 000 (1.3%) new cases of af that could receive adequate stroke prevention . Therefore, such a screening approach is scalable to make a significant nationwide impact on stroke reduction . A previous study described that screening of community - dwelling people aged over 65 years with 12-lead electrocardiography was cost effective with a participating rate of 50% . Our approach, to screen for af with an easy to use handheld device during an existing influenza vaccination programme, is potentially even more cost effective to reduce ischaemic strokes . For the purpose of the study, the cardiologist was present on the location of screening and immediately judged the ecg from the stick . When implemented on a large scale, the mydiagnostick ecg rhythm strips can be sent to a cardiologist to confirm the presence of af . In our study, in only 3 cases (0.1%), the rhythm strip was not adequately interpretable . We did not screen all participants of the influenza vaccination, but selectively aimed at those aged 60 years or over . This selection was applied because under the age of 60 years af is very uncommon . Secondly, we missed some eligible persons because of time commitment for informed consent, and this could have resulted in more selectively inclusion of more healthy and literate patients . We considered it unlikely that this had substantial impact on our point estimate of screen - detected af, the more because when such a screening is institutionalized a selection towards more healthy and literate persons would also occur . We had information of a random sample of 220 persons with a negative mydiagnostick result . We decided to only assess a random selection of all persons with a negative lightning result for practical and logistic reasons . Higher age in the screened population than in the controls may have resulted in bias towards detecting age as an independent factor . The lead i registrations of the mydiagnostick were interpreted by the cardiologists while having knowledge of the lightning results . Importantly, our aim was the yield of screening, not evaluation of the accuracy of the mydiagnostick . Screening with a single - lead ecg device during influenza vaccination in primary care resulted in 1.1% new cases of af and is a feasible option for large - scale screening . Declaration of helsinki and ethical approval: this study complies with the declaration of helsinki . The study was approved by the medical ethics committee of the martini hospital groningen . F.k . Designed the project and did the data collection and statistical analysis, and drafted the first version of the paper . Initiated the project, co - designed the project, analysed single - lead ecg registrations, and revised the paper . L.j.g . F.h.r . Co - designed data collection and analysis plan and revised the paper . M.h . Funding to pay the open access publication charges for this article was provided by robert tieleman . Conflict of interest: all authors have completed the icmje uniform disclosure form and declare: no support from any organization for the submitted work; r.g.t . Is co - inventor of the mydiagnostick and receives royalties from applied biomedical systems (abs) bv . None of the other authors have a financial relationship with any organization that might have an interest in the submitted work in 36 months prior to this study . There are no other relationships or activities that could appear to have influenced the submitted work.
Sinus histiocytosis with massive lymphadenopathy known as rosai - dorfman disease (rdd) was first described in 1965 and identified as a distinct clinicopathologic entity in 196915). Rdd is a rare histiocytic proliferative disorder of unknown etiology usually characterized by painless bilateral cervical lymphadenopathy3). The common clinical findings are fever, lymph node enlargement, leukocytosis, neutrophila, elevation of erythrocyte sedimentation rate (esr), hypergammaglobulinemia and weight loss . Rdd is potentially systemic disease and may affect extranodal sites up to 43% of all rdd patients3). Skeletal involvement as a sole manifestation of rdd is extremely rare, occurring in fewer than 2% of all rdd patients and arise most frequently in long bones such as tibia, femur, humerus, clavicle and bones of the hands2). We present a rare case of thoracic vertebrae compression fracture due to extranodal rdd without lymphadenopathy . A 15-year - old man presented with intermittent midthoracic back pain for about 6 months after slip down during basketball . He had no other symptoms such as fever, chills, malaise and lymph node enlargement . Results of routine hematologic and biochemical laboratory tests include esr and c - reactive protein (crp) showed within reference ranges . A plain radiological examination of thoracic spine revealed collapse of t6 vertebrae with thoracic kyphosis and osteolytic lesion of t12 vertebra body(fig . 1a). Magnetic resonance (mr) image of thoracic spine demonstrated collapse of t6 vertebrae with mild cord compression . The lesions involving t6 and t12 vertebral body showed slightly high signal intensity in t2-weighted mr images (fig . 1b - d) and homogenous enhancement in t1-weighted mr images after the administration of gadolinium(fig . 1e - g). Preoperative computed tomography (ct) scan showed near complete collapse of t6 vertebra body and osteolytic lesion of t12 vertebra . 2) increased tracer activity was shown at the t6, t12 vertebra and epiphysis in whole body bone scan(fig . 1h) the patient underwent a total laminectomy of t6, left - sided facetectomy at t6/7, removal of bone tumor, anterior reconstruction with mesh and pedicle screw fixation at t5 and t7 for pathologic confirmation and stabilization . He was discharged from hospital at postoperative 5 days without complications and additional medications except some pain killers . Histopathologic study of the lesion revealed fibro - osseous tissue showing focal infiltration of large histiocytes representing emperipolesis . These histiocytes were positive for cd68 and s-100, but negative for cd1a in immunochemistry study, that is compatible for rdd(fig . 3). A follow - up ct scan of thoracolumbar spine at one year after operation presented good status of bone fusion on t6 vertebra and bone formation of t12 vertebra body compared with preoperative ct scan that could be considered self - regression (fig . The present case is a rare example of compression fracture caused by isolated extranodal rdd involved the thoracic spine without lymphadenopathy . Rdd typically affects the bilateral cervical lymph nodes causing painless lymphadenopathy characterized by fever, lymph node enlargement, leukocytosis, neutrophila, elevation of esr, hypergammaglobulinemia and weight loss . Most patients with rdd are in their second or third decade of life and there is predominant in males and african - americans3). The etiology of rdd remains unknown; however it is implied that dysfunction of the immune system and an autoimmune process or viral infection such as epsteine - barr virus and human herpes virus type 6 might be the causative factors in some former studies7,9,10). In general, the common extranodal sites include skin, upper respiratory tract, and bone3). Skeletal involvement as a sole manifestation of rdd is extremely rare, occurring in fewer than 2% of all rdd patients and usually occurs in the long bones such as tibia, femur, humerus, clavicle and bones of the hands or skull, and is multiple . Some cases that involved spine were reported in former studies . Some cases of rdd with intraspinal involvement in the form of intradural or epidural mass lesions causing neurologic deficit due to spinal cord compression1,8,16), and vertebra body involvement4,5,14) were reported . Compression fracture due to spinal involvement of rdd had not been reported to the best our knowledge . Rdd is a rare diagnosis with a variety of imaging manifestations13), so usually requires histology for diagnosis . Skeletal lesions of rdd are typically intramedullary osteolytic with either poorly or sharply defined margins and are rarely sclerotic, that can be confused radiographically with langerhans cell histiocytosis (lch), eosinophilic granuloma or other lymphocyte proliferative diseases3,11). The lesion presents low or isosignal intensity on t1- and t2-weighted mr images and intense homogenous enhancement with contrast in most cases, but mr images can be various1). Spinal rosai - dorfman disease similarly tends to be confused with meningioma when presenting as dural disease or as metastatic disease of another cause when presenting as vertebral body disease13). The differential diagnosis of a primary bone rosai - dorfman disease includes more common lesions, such as bacterial osteomyelitis, fungal infections such as histoplasmosis and langerhans cell histiocytosis . Special studies such as histochemistry, immunohistochemistry, and microbiologic cultures can be very useful to reach the correct diagnosis . Both histiocytes of rdd and lch are positive for cd68 and s100 in immunochemistry but histiocytes of rdd are negative for cd1a . Rdd has a typical finding in histopathologic studies, that is emperioplesis; a phenomenon of phagocytosis of intact lymphocytes, plasma cells, erythrocytes or neutrophils . Previous studies for treatment of rdd concluded that most patients with rdd do not require specific therapy and can expect spontaneous regression6,12). If the vital organ is compressed or other life threatening manifestations are existed due to direct nodal or extranodal involvement, surgical debulking and/or radiotherapy can be considered12). Other treatment modalities such as chemotherapy including methotrexate and 6-mercaptopurin, high - dose alphainterferon, steroid or antiviral drugs had been attempted for treatment of rdd . Standardized guidelines for surgical treatment have not yet been established nor have the indications for a surgical approach . The performed operative technique was not different from that used to treat thoracic vertebrae fractures . For this case, it is widely accepted that the goal of surgery for thoracic compression fractures is decompression of the neural elements, correction of spinal deformities, and fusion with stabilization . We identified bone formation of t12 vertebra body in the follow - up ct scan of thoracolumbar spine at one year after operation, that could be considered to be resolved spontaneously . Skeletal involvement of rdd is unusual and sole manifestation of spine vertebra is extremely rare . If the young adult or adolescent have compression of vertebra body, rdd can be considered as our case . Because of its rarity, various clinical manifestations and radiologic findings, it was difficult to differentiate from other disease such as langerhans cell histiocytosis or eosinophilic granuloma on radiologic study alone, so pathologic confirmation was needed . As some former reports did, we could identify that rdd generally has benign clinical course and can be resolved itself.
Kidney transplantation is the treatment of choice for patients who suffer end - stage renal disease (esrd). Survival and quality of life in renal transplant recipients are more than in dialysis patients (1, 2). Unfortunately, organ availability for kidney transplantation is restricted by the growing number of patients waiting for this treatment (3). Additionally, several complications occur after kidney transplantation, including surgical complications (e.g. Fluid collections, urinoma, lymphocele, hematoma, and abscess), incisional hernia, acute kidney injury, infections and allograft rejection (4). Among these complications, the management of acute rejection is very important, because each rejection that is not controlled will destroy the allograft and increase patient s morbidity and mortality (2). There are two international classications for acute allograft rejection: t cell - mediated acute rejection and antibody - mediated acute rejection (amr). T cell - mediated acute rejection was more studied than amr over the past several years . The use of potent immunosuppressive agents has greatly reduced the rate of acute cellular rejection . Consequently, the 1-year graft survival has significantly improved, following kidney transplantation . In recent years, acute and chronic amr are playing serious roles in kidney allograft loss and are considered as important causes that limit long - term outcomes of kidney transplantation (2, 5, 6). Within the few days after kidney transplantation, early acute amr occurs in transplant recipients with anti - hla or donor specific antibodies (dsa) (7). Rejection phenotypes and outcomes are more complex in clinical practice than in the theory . Rejection can be diagnosed by renal biopsy findings, such as c4d deposition in the peritubular capillaries and histological features of inammation, allograft dysfunction, and serologic evidence of circulating antibodies (2). Despite signicant advances in recent years several differential diagnoses have to be considered when amr is suspicious, which include acute ischemic injury, acute calcineurin inhibitor (cni) toxicity, infections and thrombotic microangiopathy (tma). The tma is always the most important differential diagnosis of amr (8). The gold standard for exact diagnosis is renal biopsy (9); however, in many patients, performing kidney biopsy is not feasible due to the patient s low platelet count and lack of personal satisfaction . In these situations, this study was designed to assess the efficacy of routine treatment of amr / tma in iranian kidney transplant recipients, comprising of plasmapheresis and intravenous immunoglobulin (ivig). This 1-year cross - sectional study was performed at the kidney transplantation ward of imam - khomeini hospital complex, affiliated to tehran university of medical sciences, tehran, iran from 1st january 2014 . All kidney transplant recipients, who were administered plasmapheresis and ivig to treat definite or suggested amr or tma, were assessed . All patients in this transplant ward receive rabbit antithymocyte globulin (ratg), as induction therapy, with a cumulative dose of at least 6 mg / kg . They are also administered methylprednisolone 500 mg on the transplantation day and 250 and 125 mg on the next two days after transplantation, which is continued with oral prednisolone 1 mg / kg / day, with rapid taper down during the next days, to reach the dose of 5 mg / day after month one from transplantation . They also receive a cni (mostly tacrolimus) and mycophenolate mofetil as maintenance immunosuppressive regimen . All patients receive intravenous ganciclovir / oral valganciclovir, oral co - trimoxazole and clotrimazole for routine viral, pneumocystis pneumonia, and fungal prophylaxis . Patients demographic and clinical data (sex, age, weight, height, cause of esrd), laboratory findings (including serum creatinine and urea concentrations, urine volume, serum electrolytes, complete blood counts and serum lactate dehydrogenase (ldh) concentration), were gathered in designed forms . The study protocol was approved by local ethics committee of tehran university of medical sciences, tehran, iran . All patients or their representatives provided their informed consent and were assured that their information will be published anonymously . This 1-year cross - sectional study was performed at the kidney transplantation ward of imam - khomeini hospital complex, affiliated to tehran university of medical sciences, tehran, iran from 1st january 2014 . All kidney transplant recipients, who were administered plasmapheresis and ivig to treat definite or suggested amr or tma, were assessed . All patients in this transplant ward receive rabbit antithymocyte globulin (ratg), as induction therapy, with a cumulative dose of at least 6 mg / kg . They are also administered methylprednisolone 500 mg on the transplantation day and 250 and 125 mg on the next two days after transplantation, which is continued with oral prednisolone 1 mg / kg / day, with rapid taper down during the next days, to reach the dose of 5 mg / day after month one from transplantation . They also receive a cni (mostly tacrolimus) and mycophenolate mofetil as maintenance immunosuppressive regimen . All patients receive intravenous ganciclovir / oral valganciclovir, oral co - trimoxazole and clotrimazole for routine viral, pneumocystis pneumonia, and fungal prophylaxis . Patients demographic and clinical data (sex, age, weight, height, cause of esrd), laboratory findings (including serum creatinine and urea concentrations, urine volume, serum electrolytes, complete blood counts and serum lactate dehydrogenase (ldh) concentration), were gathered in designed forms . The study protocol was approved by local ethics committee of tehran university of medical sciences, tehran, iran . All patients or their representatives provided their informed consent and were assured that their information will be published anonymously . Five kidney transplant patients were treated for suspicious / definite amr or tma during the year 2014 at this center . The patient s.t ., a 56-year - old female, with a history of esrd with undiagnosed cause, was admitted in february 2014 for a second renal transplantation . She had a history of renal transplant with hyperacute rejection 6 years ago . Her creatinine was decreased from 5.6 to 0.9 mg / dl, within 5 days after transplantation; however, on day 6 after transplantation, her urine output was significantly decreased and her serum creatinine level rose . Our concern regarded the tma and possibility of acute rejection, although we were unable to perform allograft biopsy, because of her low platelet count . G / kg ideal body weight, for 5 days, which is equal to approximately 460 mg / kg / day . Concomitant with ivig therapy, plasmapheresis was performed daily for four sessions and thereafter, every other day, for three sessions . The ivig doses were infused after plasmapheresis treatment . Due to lack of improvement in kidney function and platelet count, tacrolimus was stopped 16 days after transplantation . Treatment with plasmapheresis and ivig was not effective in this patient and therefore was discontinued . Due to uncontrolled fever and patient s illness, nephrectomy was performed in her case ., a 15-year - old male, with a history of esrd of unknown origin, was admitted in may 2014 for preemptive kidney transplantation from a 14-year - old deceased male . Although his diethylene triamine pentacaetic acid (dtpa) radionuclide scan suggested acute rejection, renal biopsy could not be performed . Plasmapheresis and high - dose of ivig (2 g / kg) were prescribed 2 days after transplantation . He was treated with plasmapheresis for 9 consecutive days and his ivig was divided to these 9 days after each plasmapheresis session (i.e. About 222 mg / kg after each plasmapheresis). He was discharged from the hospital with a serum creatinine level similar to his pretransplant value ., a 40-year - old male, with a history of esrd with undetermined origin, was admitted in june 2014 . His maintenance regimen included tacrolimus, mycophenolate mofetil and prednisolone . During the first few days he showed good allograft functioning . However, 3 days after transplantation, serum ldh level increased and platelet count decreased significantly . Four days after plasmapheresis initiation, ldh decreased and platelet count increased . At day 18 from transplantation, his serum creatinine concentration increased from 1.5 mg / dl to 1.9 and 2.4 mg / dl, during two days . Therefore, his plasmapheresis was continued additionally for four sessions every other day and 1.5 g / kg of ivig was divided to four doses (375 mg / kg each) on the days that patient did not undergo plasmapheresis . After this treatment, his creatinine, a 44-year - old male with a history of esrd with undetermined origin, was admitted in september 2014 and received the kidney from a 37-year - old deceased female . His first renal biopsy, which was performed 5 days after transplantation, showed c4d deposition in peritubular capillaries . Plasmapheresis was performed daily for 5 days and every other day, for five additional sessions . The ivig with a cumulative dose of 2.1 g / kg was administered during 8 consecutive days (i.e. About 263 mg / kg each day), starting the day before plasmapheresis initiation . However, there was no improvement in his renal function . The second biopsy that was done 11 days after transplantation revealed necrosis and vascular congestion, associated with amr . Because of no improvement in his renal function, the third biopsy was done on day 16 after transplantation and showed more than 90% glomerular necrosis ., a 57-year - old female with a history of esrd because of autosomal dominant polycystic kidney disease, was admitted in october 2014 . The biopsy was performed at day 12, showing glomerular basement membrane thickening and subendothelial widening that was compatible with tma . After that, platelet count decreased from 100000 to 39000 cells / microliter and serum ldh level increased . Therefore, she received methylprednisolone pulses for 3 days . She received a cumulative dose of 2.3 g / kg ivig during 4 consecutive days (i.e. About 383 mg / kg at each doses), started with plasmapheresis treatment . Plasmapheresis was performed for a cumulative 15 sessions, six of which were daily and the others every 2 - 3 days . The patient s general condition was deteriorated and despite nephrectomy and antibiotic therapy, the patient unfortunately expired in a sepsis tableau . The patient s.t ., a 56-year - old female, with a history of esrd with undiagnosed cause, was admitted in february 2014 for a second renal transplantation . Her creatinine was decreased from 5.6 to 0.9 mg / dl, within 5 days after transplantation; however, on day 6 after transplantation, her urine output was significantly decreased and her serum creatinine level rose . Our concern regarded the tma and possibility of acute rejection, although we were unable to perform allograft biopsy, because of her low platelet count . Two days later, she received ivig, with a cumulative dose of 2.3 g / kg ideal body weight, for 5 days, which is equal to approximately 460 mg / kg / day . Concomitant with ivig therapy, plasmapheresis was performed daily for four sessions and thereafter, every other day, for three sessions . The ivig doses were infused after plasmapheresis treatment . Due to lack of improvement in kidney function and platelet count, treatment with plasmapheresis and ivig was not effective in this patient and therefore was discontinued . Due to uncontrolled fever and patient s illness, nephrectomy was performed in her case ., a 15-year - old male, with a history of esrd of unknown origin, was admitted in may 2014 for preemptive kidney transplantation from a 14-year - old deceased male . Although his diethylene triamine pentacaetic acid (dtpa) radionuclide scan suggested acute rejection, renal biopsy could not be performed . Plasmapheresis and high - dose of ivig (2 g / kg) were prescribed 2 days after transplantation . He was treated with plasmapheresis for 9 consecutive days and his ivig was divided to these 9 days after each plasmapheresis session (i.e. About 222 mg / kg after each plasmapheresis). He was discharged from the hospital with a serum creatinine level similar to his pretransplant value ., a 40-year - old male, with a history of esrd with undetermined origin, was admitted in june 2014 . His maintenance regimen included tacrolimus, mycophenolate mofetil and prednisolone . During the first few days he showed good allograft functioning . However, 3 days after transplantation, serum ldh level increased and platelet count decreased significantly . Four days after plasmapheresis initiation, ldh decreased and platelet count increased . At day 18 from transplantation, his serum creatinine concentration increased from 1.5 mg / dl to 1.9 and 2.4 mg / dl, during two days . Therefore, his plasmapheresis was continued additionally for four sessions every other day and 1.5 g / kg of ivig was divided to four doses (375 mg / kg each) on the days that patient did not undergo plasmapheresis . After this treatment, his creatinine was decreased to 1.7 mg / dl and relative improvement occurred ., a 44-year - old male with a history of esrd with undetermined origin, was admitted in september 2014 and received the kidney from a 37-year - old deceased female . His first renal biopsy, which was performed 5 days after transplantation, showed c4d deposition in peritubular capillaries . Plasmapheresis was performed daily for 5 days and every other day, for five additional sessions . The ivig with a cumulative dose of 2.1 g / kg was administered during 8 consecutive days (i.e. About 263 mg / kg each day), starting the day before plasmapheresis initiation . The second biopsy that was done 11 days after transplantation revealed necrosis and vascular congestion, associated with amr . Because of no improvement in his renal function, the third biopsy was done on day 16 after transplantation and showed more than 90% glomerular necrosis . The patient h.n ., a 57-year - old female with a history of esrd because of autosomal dominant polycystic kidney disease, was admitted in october 2014 . The biopsy was performed at day 12, showing glomerular basement membrane thickening and subendothelial widening that was compatible with tma . After that, platelet count decreased from 100000 to 39000 cells / microliter and serum ldh level increased . She received a cumulative dose of 2.3 g / kg ivig during 4 consecutive days (i.e. About 383 mg / kg at each doses), started with plasmapheresis treatment . Plasmapheresis was performed for a cumulative 15 sessions, six of which were daily and the others every 2 - 3 days . The patient s general condition was deteriorated and despite nephrectomy and antibiotic therapy, the patient unfortunately expired in a sepsis tableau . During recent years, the use of effective immunosuppressants resulted in the decrease of the rate of acute cellular rejection . However, amr has become an important cause of graft loss during the initial weeks to months after transplantation (7). The incidence of acute graft loss in amr is greater than acute cellular rejection (7). In patients with high levels of dsa, the incidence of graft loss in the first month after transplantation may be as high as 40%, while this rate is less than 10% in patients with a negative dsa (7, 10). Early aggressive treatment of amr may be required to prevent graft loss (7). Dehydration or elevated blood levels of cnis can also cause an increase in serum creatinine concentration . Although renal biopsy and measurement of the serum dsa are helpful, they are not always readily practical or available in the clinical settings (7). Performing renal biopsy therefore, it is indicated to choose a treatment regimen that is helpful for both conditions . During year 2014, we encountered five patients with suspicious amr or tma at our kidney transplant center . Renal biopsy was performed for two of them, suggesting amr in one patient and tma for the other . Therefore, we treated them with plasmapheresis plus ivig; however, only one out of these five patients showed response albeit not completely . The first strategy is to control b - cell activities by removal or dilution of antibodies . We can use plasmapheresis or immunoadsorption for removal of antibodies . By administration of ivig, the second option is to inhibit or deplete of b - cells using antibodies, such as rituximab, that act against cd20 in b - cells surface . The third way is to reduce t - cells . Diminished t - cells can decrease b - cell counts . Inhibitors of t - cell division (mycophenolate mofetil and steroids), inhibitors of il-2 signaling to t - cells (cnis), and t - cell depleting agents such as ratg are three options that decrease t - cells . A fourth target for the managing of amr antibodies that are produced by plasma cell will become bound to graft and activate complement cascade . Therefore, the fth target that has recently been introduced is the xation of complement, which is activated by antibodies . Eculizumabis, a c5 inhibitor, is an option that reduces the dissemination of the complement cascade, even after antibodies have bound to the graft (1, 6, 11). Despite these various options for amr treatment, there is no consensus over which treatment must be selected first in transplanted patients with amr (6 - 8, 11, 12). The importance of this issue is more apparent when we could not perform biopsy, as a gold standard for detecting amr . On the other hand, in several situations we could not distinguish between amr and tma, according to the clinical features therefore, designing a useful treatment strategy that could be used in both amr and tma is very crucial . Nevertheless, the first line of therapy was not indicated by any study (7, 11). The systematic review conducted by roberts et al . Demonstrated that the optimal treatment for amr remains unknown . They recommended a combination treatment for the management of amr that is associated with multiple pathophysiologic pathways . This combination includes plasmapheresis, ivig, immunosuppressants, rituximab, bortezumib and eculizumab (13). As seen, this proposed strategy is too expensive to be applied for all patients with definite or possible amr . The management of tma has also been reviewed in many studies . Almost always, plasma exchange is the first line of tma treatment . The use of corticosteroids is recommended in tma patients with neurological or cardiovascular involvement . With these therapies, there is still a high mortality rate of 10 - 20% and a high relapse rate, of approximately 20 - 50% . The effectiveness of rituximab in decreasing tma relapse and hospitalization duration has been confirmed in a series of studies (14 - 18). A cohort study that has been performed by westwood et al . Revealed that early administration of rituximab for thrombotic thrombocytopenic purpura (ttp) (within 3 days) was associated with faster remission, fewer plasma exchange sessions and shorter duration of hospital stay (14). The efficacy and safety of rituximab in severe ttp was shown by froissart et al . In adults, who responded poorly to therapeutic plasma exchange . One - year relapses and hospitalization duration were decreased in patients who were treated with rituximab, compared with historical controls, who were treated with plasmapheresis (18). In the present study, the effectiveness of plasmapheresis and ivig were investigated in iranian kidney transplant recipients, with suspicious / definite amr or tma . Assessing donor specific antibody kidney biopsy is not performed in patients with thrombocytopenia in most iranian kidney transplant wards, due to legal considerations and fear of bleeding and its ominous consequences . Due to similar clinical and laboratory features of amr and tma, including increased serum creatinine concentration, decreased urine output and platelet count, and increased serum ldh levels, most clinicians consider both situations when selecting treatment . According to the high cost of rituximab and lack of iranian insurance coverage of rituximab by nephrologist s order, a limited number of patients can afford its cost . Therefore, rituximab cannot be easily used as first option in these situations in kidney transplant patients, which determines iranian nephrologists to usually start amr or tma treatment with plasmapheresis plus ivig . Applying these therapies in our patients cohort showed that only one out of five patients (20%), showed only partial response to these treatments . The amr and tma were confirmed only in two patients by biopsy (each in one patient). According to the literature, it seems better to start combination treatments for both amr and tma, with common regimen of plasmapheresis plus ivig, plus rituximab . Almost all patients with tma are at risk of relapse (19, 20). In transplanted patients we aim to decrease the relapse rate, because each tma episode could result in graft failure (20), and rituximab is the required agent (14 - 18). The time of initiation of ivig and plasmapheresis was different between our patients . According to the study by jodele et al . (21) early plasmapheresis could be effective in ttp patients even with multiorgan damage . Therefore, the early use of plasmapheresis and rituximab are recommended in situation in which it is difficult to distinguish between tma and amr . However, according to the high cost and lack of insurance coverage of rituximab for kidney transplant recipients, almost none of our patients could benefit from this drug . Another explanation for the high rate of treatment failure in our patients may be the ineffectiveness of ivig, possibly due to its removal by plasmapheresis . In most studies, it is recommended to administer ivig with maintenance dose of 100 mg / kg after each plasmapheresis, and when plasmapheresis was stopped, the remaining dose of ivig, to a cumulative dose of 2 g / kg, could be administered once (11). In our center, as a routine practice of nephrology attending that has reached to nephrology fellows as well, the cumulative dose of 2 g / kg of ivig is divided into 300 - 400 mg / kg after each plasmapheresis . Due to daily plasmapheresis within the first few days after amr or tma, this ivig administration approach may result in high amount of ivig withdrawal by plasmapheresis . The ivig role in the treatment of amr is more complex than just diluting antibodies, as proposed in several studies (1). The ivig may induce b - cell apoptosis and modulates b - cell signaling (22). It also inhibits antibody binding to the allograft and complement activities, by unknown mechanisms (23). Therefore, removing high amounts of ivig by plasmapheresis, without its replacement, due to not adding removed ivig to the cumulative dose, may explain our high rate of treatment failure . Due to a series of similarities in clinical and laboratory features of amr and tma in kidney transplant recipients, the unavailability of dsa assessment in iranian laboratories, high risk kidney biopsy in several patients, especially in those with thrombocytopenia, and delayed pathology reports of renal biopsy in several iranian kidney transplant centers, it seems reasonable to start amr and tma management concomitantly, in clinical situations . It means that it is better to start plasmapheresis with ivig and rituximab . Due to the lack of iranian insurance coverage of rituximab by nephrologist s order and high cost of this drug, most patients are not able to afford its cost . Based on these clinical limitations our suggestion is to reduce ivig dose after each plasmapheresis to 100 mg / kg (i.e. Replacement dose) to reach the cumulative dose of 2 g / kg . If plasmapheresis treatment is held sooner than the completion of ivig cumulative dose of 2 g / kg, the remaining dose can be administered during one injection.
Gene duplication is one of the most prominent mechanisms by which organisms acquire new functions . Spectacular examples of such gains of function resulting from gene duplications are the evolution of trichromatic vision in primates, the evolution of human beta - globin genes that are involved in the oxygen transport at different developmental stages as well as the expansion of the family of immunoglobulins and other immunity - related genes that shaped the vertebrate immune system [4, 5]. Because of the central role of gene duplication in evolution, there has been a profound interest for a better understanding of how these new functions evolve at the molecular level, for determining at what rate gene duplication occurs [79] and for testing whether the retention of paralogous genes necessarily requires the evolution of new functions [6, 10, 11]. One of the most important challenges has been to determine mechanistically how specific mutations translate into new functions, as establishing sequence - function relationships remains a difficult task . After a gene duplication event, the two sister paralogs are identical copies of their ancestor and encode two identical functions, thus relaxing the selective constraints on each paralog . Under most evolutionary models, both paralogs have to diverge to be retained on evolutionary time scales, otherwise one paralog would be lost and the system would return to its ancestral state (nonfunctionalization). The first one is the acquisition of new functions by one or both of the two paralogs, a mechanism called neofunctionalization [1, 8, 10]. The second mechanism, called subfunctionalization, implies the complementary partitioning of the ancestral function between the two paralogs by losses of functions [8, 10, 13]. These two mechanisms are not mutually exclusive because the ancestral function can be partitioned by subfunctionalization and then one or both paralogs may acquire new functions by neofunctionalization, a mechanism called neosubfunctionalization . An increase in the dosage of a gene product by the addition of a second identical copy of the ancestral gene can also contribute to the retention of paralogous pairs, without the need for the gain or loss of functions [15, 16]. Divergence between paralogs does not necessarily imply a divergence in a specific function but can also involve a change in the regulation of that function . For instance, the regulatory control of a protein function can be modified at the transcriptional or at the posttranslational level . Divergence in expression pattern of duplicated transcript is well documented [1, 10, 17, 18]. . Showed that a large fraction of ancient duplicated gene pairs in yeast shows divergent gene expression patterns . A more recent study showed that nearly half of the genes that duplicated after a whole genome duplication event (wgd) in a forest tree species have diverged in expression by a random degeneration process . However, little is known about the divergence of regulation by posttranslational modifications (ptms), which take place after transcription and translation and directly affect protein activities . Ptms are covalent modifications of one or more amino acids that affect the activity of a protein, its localization in the cell, its turnover rate, and its interactions with other molecules . Although only 20 amino acids are encoded by the genetic code, more than 200 amino acid variants or their derivatives are found in proteins after ptms . Phosphorylation, the addition of a phosphate moiety from an atp donor to a serine (ser), threonine (thr), or tyrosine (tyr) residue by a protein kinase, is by far the best - known ptm, as it is the most common and is involved in the regulation of key biological processes of fundamental and medical interest, such as signal transduction and cell - cycle regulation . Of particular interest for this study is the addition of a phosphate group that brings two new negative charges that allow the formation of a salt bridge or that contribute to the local charge of the protein . Given that a phosphate group is a relatively large molecule, phosphorylation can also have sterical effects . Such properties can notably induce conformational changes of the protein, modify its catalytic activity, or block the access to its catalytic site, which result in the activation or inhibition of the activity of the target protein by direct or allosteric effects . Several of the effects of protein phosphorylation can be mimicked by the negatively charged amino acids aspartic acid (asp) and glutamic acid (glu). Indeed, the biochemical properties of these amino acids are close to those of phosphorylated ser or thr residues . In particular conditions, asp and glu are constitutive functional equivalents of phosphosites in a phosphorylated state . This functional resemblance has been exploited by biochemists by replacing ser and thr residues by asp and glu in proteins of interest in order to mimic their phosphorylated status . A striking example comes from the evolution of the activation induced cytidine deaminase (aid) across vertebrates, an enzyme involved in the generation of antibody diversity . The interaction of this enzyme with the replication protein a (rpa) promotes aid access to transcribed double - stranded dna during immunoglobulin class switch recombination . This interaction requires a negative charge on aid, which is provided by an asp in bony fish . In these organisms, the enzyme is constitutively capable of interacting with rpa . In amphibians and mammals, the function of the asp residue is carried out by a phosphorylatable ser (pser), which allows the regulation of the protein interaction by protein kinases in a condition - specific fashion . Globally, it was shown that pser tends to evolve from or to phosphomimetic amino acids (asp and glu) when gained and lost, respectively, throughout the evolution of eukaryotes [27, 28]. Protein phosphoregulation has been suggested to play a role in the evolutionary fate of paralogous proteins . Most studies done so far focused on the paralogous genes of the budding yeast saccharomyces cerevisiae because its phosphoproteome has been intensely studied [2931]. Using the yeast paralogs that derive from the wgd event, amoutzias et al . Showed that the number of phosphosites on a phosphoprotein is an important determinant for the retention of its duplicated descendants . In a following study, freschi et al . Studied the gains and losses of phosphosites in paralogous phosphoproteins and found that the great majority of them are present in one paralog and not in the other . This divergence was shown to be principally driven by losses rather than gains of phosphosites on one paralog . Finally, kaganovich and snyder found that phosphosites tend to diverge more asymmetrically than nonphosphorylated amino acids, playing thus an important role in paralogous genes divergence and retention . These observations raise the question of where do phosphosites come from and where do they go after a gene duplication . According to the observations on phosphomimetic amino acids described above, gains and losses of phosphosites could represent two distinct types of divergence . On the one hand, the gain or the loss of phosphosites from or to a nonphosphomimetic residue would represent a divergence in the function of the protein . On the other hand, a gain or a loss could occur from or to phosphomimetic residues, leading to a modification of the control of the charged residue by the cell rather than a modification of function per se . Here we test whether this second scenario could have contributed to the divergence of paralogous proteins using the yeast phosphoproteome as a model . All analyses were performed using the dataset we compiled in a previous study, and that is available at http://www.bio.ulaval.ca/landrylab/download/ (dataset 1). This dataset contains 20,342 phosphosites on 2688 proteins from eight large - scale studies [2931, 3539]. It also provides the alignments of all s. cerevisiae wgd paralogous genes with their ancestral sequence and with the orthologs of lachancea kluyveri and zygosaccharomyces rouxii . The alignments were performed using muscle while the ancestral sequence was inferred using the codeml method implemented in paml . We chose to analyze only two species that diverged before the wgd event for the following reasons . The majority of phosphorylation sites are located in disordered regions, and these regions are fast evolving . Alignment of sequences from distantly related species leads to spurious alignments or to alignments that may contain several indels . Indels decrease the number of phosphorylation sites available for the analysis, as ancestral sequences cannot be computed at these positions ., we performed the analyses including an additional species that diverged prior to the whole - genome duplication, and we found that this did not significantly affect our results . Finally, this dataset also provides information about the localization of each residue in ordered or disordered regions of the protein, according to predictions made with disopred . We applied different approaches to study gains and losses coming from or going to negatively charged amino acids . In the first approach, we used the ancestral sequence as a reference to assess the presence of a gain or a loss at a specific position . For the gains, we compared the proportion of phosphomimetic amino acids in the ancestral sequence (asp or glu) going to pser or pthr to the proportion of phosphomimetic amino acids going to cser and cthr . For the losses, we compared the proportion of phosphorylated residues (pser and pthr) coming to asp or glu to the proportion of nonphosphorylated residues (cser and cthr) coming to asp or glu, respectively . We required the ancestral sequence to have a phosphorylatable residue and one of the two paralogs to be phosphorylated at the homologous position . Comparisons of proportions were performed using fisher's exact tests as implemented in r . In our second approach this time we used the sequences of l. kluyveri and z. rouxii as reference . In the case of a gain of phosphosites, we required the presence of the same negatively charged residue (asp or glu) in the reference species as well as in one of the two paralogs and a phosphorylatable residue (ser or thr) in the other paralog . In the case of losses of phosphosites, we required the presence of the same phosphorylatable residue (ser or thr) in the reference species as well as in one of the two paralogs and a negatively charged residue (asp or glu) in the other paralog . All proportions were calculated by dividing the number of sites coming from or going to an asp or a glu by the number of sites that come from or go to any of the 17 nonphosphorylatable amino acids following the same criteria (figure 1). The phosphoproteome of s. cerevisiae is the best described among eukaryotes and has been mapped by mass spectrometry, leading to the identification of high - confidence phosphosites [2931]. We assembled a data set that consists of 2,726 phosphosites (ser, 82%; thr, 16%; tyr, 2%) that belong to one or the other member of the 352 pairs of yeast wgd paralogs for which at least one of the two proteins is a phosphoprotein . We inferred the ancestral sequence for each pair of paralogs using alignments with orthologous sequences from l. kluyveri and z. rouxii, two species that diverged from s. cerevisiae before the wgd event . For each pair, we aligned all five sequences, we mapped the phosphosites on the sequences of the paralogs and analysed phosphosites that diverged, that is, cases where a phosphorylatable residue was present in only one paralog . Under a scenario where gains of phosphosites would result from selection for transitions from phosphomimetic amino acids to phosphorylated residues, we would expect phosphorylated ser or thr (pser and pthr, resp .) To evolve more often from asp or glu than nonphosphorylated ones (cser and cthr, resp . ). Similarly, under a scenario where losses of phosphosites would result from transitions from phosphorylated residues to phosphomimetic amino acids, we would expect pser and pthr to evolve more often to asp and glu than equivalent cser and cthr . In the first case, we compared the proportion of pser and pthr that were gained from asp and glu with that of cser and cthr, that is, all serines and threonines from the same set of proteins that were gained from asp and glu but that are not known to be phosphorylated . In the second case, we compared the ratio of sites that were lost and replaced by phosphomimetic residues in only one paralog with the ratios derived from cser and cthr . We performed the analysis using paralogous ancestral sequences inferred with a likelihood method and also using a parsimonious approach, whereby the ancestral state of phosphosites was inferred based on the conservation of the site in one of the two paralogs and its two orthologs (figure 1(a)). Global results are presented in figure 2, and detailed analyses are presented in figure 3 . A gobal analysis of pser, pthr, asp, and glu shows that phosphosites tend to be lost to asp and glu more frequently than cser and cthr, and this holds true for both likelihood (16.6% versus 12.1%, resp ., however, although there is a tendency towards the gains of phosphosites from asp and glu, the observed differences are not significant (figure 2). When studied separately, phosphosites in ordered and disordered regions show the same global tendency to go toward phosphomimetic amino acids (likelihood: 17.5% versus 10.0% in ordered regions, p = 0.058; 16.5% versus 13.7% in disordered regions, p = 0.086, parsimony: 20.0% versus 8.1% in ordered regions, p = 0.076; 16.7% versus 11.7% in disordered regions, p = 0.110). Further, we found that phosphosites are not preferentially gained from phosphomimetic amino acids in disordered regions, while there is a nonsignificant tendency for this type of transition in ordered regions (likelihood: 16.0% versus 15.7% in disordered regions, p = 0.943; 18.8% versus 13.7% in ordered regions, p = 0.294, parsimony: 14.1% versus 14.2% in disordered regions, p = 1.000; 11.8% versus 10.2% in ordered regions, p = 0.691). This suggests that the effect might be more important in ordered regions of proteins, as would be expected if these residues were playing structural roles . Because the distinction between order and disorder reduces the number sites in each category and does not provide opposite results, we considered both regions simultaneously in the following analyses . We also examined which class of substitution could be contributing to this overall result (figure 3). We first found that pser and pthr that were gained after gene duplication follow trends that are in the expected direction although some of the comparisons are not statistically significant and other results are in the opposite direction (figure 3). However, this detailed analysis showed that pser is significantly more likely to evolve to glu than cser (11.6% versus 5.3%, p = 0.008) while pthr evolves significantly more frequently to asp than cthr (9.8% versus 4.3% resp . Evolutionary events such as gains and losses of phosphosites can lead to changes in protein regulation, thus rewiring the protein regulatory network of the cell . In the literature, there is evidence for gains of new phosphosites coming from negatively charged residues among orthologs [26, 27] as well as cases of losses of phosphosites to these amino acids . The biochemical properties of glu and asp mimic the ones of pser and pthr with the exception that their charge is not regulatable . These observations led us to hypothesize that coding sequence divergence of paralogous genes by neo- and subfunctionalization does not strictly involve the apparition or the partitioning of protein function . Divergence in the regulatory control is well known at the transcriptional level [19, 46] but has not been specifically addressed at the posttranslational level . We tested this hypothesis on the complete set of wgd phosphoproteins of the budding yeast s. cerevisiae . Using two different methods to infer the ancestral state of phosphorylated and nonphosphorylated ser and thr, we found that pser and pthr globally have a tendency to evolve from negatively charged amino acids in paralogous phosphoproteins compared to their nonphosphorylated counterparts . The tendencies observed are in agreement with our hypothesis and with the observations made by pearlman et al . Across eukaryotes . However, the observed differences are not significant, which could be explained by a few nonexclusive scenarios . First, we are looking at a narrow evolutionary window (100 my), which contrasts with the analysis conducted by pearlman et al ., who used aligned sequences from organisms spanning the entire tree of life . Further, the mechanism proposed may apply primarily to few sites and in ordered regions of proteins . Only few phosphosites in these regions could be analysed here since the majority of them are found in disordered regions, which reduces the statistical power of our analysis . Because these nonfunctional sites are not under selective pressure, they may contribute to decrease the signal coming from functional sites . Nevertheless, from our results, we cannot rule out the possibility that gains of phosphosites are not more likely to derive from phosphomimetic residues after gene duplications . A larger sample size, the study of a time window of a different length and a better knowledge of the functional importance of phosphosites may be needed to provide a final answer . Following the same approach, we examined whether phosphorylated residues, when lost, are more likely to be replaced by asp and glu than when nonphosphorylated equivalent residues are lost . We found that this is the case globally and also when considering individual cases for both pser and pthr; pser are more likely to be replaced by glu residues while pthr by asp residues . These results are in agreement with those from kurmangaliyev et al . Who also showed that pser are more likely to evolve to phosphomimetic amino acids than cser in the divergence of orthologs between species . Our results show that the evolutionary trajectories of pser and pthr provide a mechanism for paralogous protein divergence . Our analyses support the hypothesis that divergence between paralogs can be generated by a loss of the posttranslational regulatory control on a function rather than by the complete loss of the function itself . Indeed, the substitution of a phosphosite for an asp or a glu residue may block one paralog into a single constitutive functional state whereas the other one remains regulatable by protein kinases and phosphatases . The genetic code is organized in such a way that transitions between phosphorylatable and phosphomimetic amino acids involve a transition state with an amino acid that is not negatively charged, except for transitions between two asp and two ser codons that involve a tyr residue (figure 4). However, tyr is only rarely phosphorylated in yeast, and tyr residues are not phosphorylated by the serine / threonine kinases, which suggests that this path would not be favoured . . A non negatively charged intermediate could lead to a complete loss of the function that was performed by the negative charge and could thus be deleterious (figure 5(a)). Here we propose that the relaxed constraints that follow a gene duplication event could provide the mean to reach this intermediate state and to go beyond (figure 5(b)). After gene duplication, when one of the duplicated copies is lost, the system is assumed to go back to its ancestral state, a process called nonfunctionalization . However, following our model, the duplicated copy could serve as a backup for a transition period, which would allow the other copy to reach a state that would have been unreachable otherwise [4850]. After the loss of the backup copy, the system would remain different from its ancestral state since the phosphorylation profile and thus the phosphoregulation of this protein has changed . The term nonfunctionalization may thus not be suitable for such cases . In the case of a wgd event, where the vast majority of the duplicated genes are eventually lost and are thought to return back to their ancestral state, these 2-step transitions could potentially lead to a great burst in the evolution of phosphoregulation . Further studies at different time points following gene duplication would be needed to determine how important this mechanism could be for the evolution of phosphorylation networks.
Craniosynostosis (cs) is the premature fusion of one or more of the fibrous joints of the calvaria (cranial sutures). If this synostosis happens early enough in human development, it can lead to alterations in skull shape, reduced cranial growth, increased intracranial pressure, impaired blood flow, impaired vision and hearing, as well as mental retardation [17]. In most cases, there are extensive signaling networks present within the cranial sutures that allow for the coordinated growth of the skull . Fgfrs belong to a family of tyrosine kinase receptors that exhibit a common organization, including two or three extracellular immunoglobulin (ig) like binding domains, a transmembrane domain, and two intracellular tyrosine kinase subdomains . The binding of fgf to fgfr in association with heparin sulphate proteoglycan (hspg) induces receptor dimerization at the cell surface . In calvarial sutures, fgfs are secreted by osteoblasts at the differentiated edge of the bones; they activate receptors involved in both osteoprogenitor cell proliferation and function in the conversion of these cells into differentiated osteoblasts [12, 1422]. Once the fgfr signaling system is established in sutures, long - term skull growth depends on the maintenance and balance between the formation of new bone and the proliferation of the osteoprogenitor cell population as a reservoir of potential new osteoblasts [2, 12]. Genetic mutations in the fibroblast growth factor receptors (fgfr13) are some of the most commonly identified mutations implicated in syndromic craniosynostosis [2332]. The amplified signaling that results from these mutations plays an important role in the overossification at the site of sutures [2, 12, 21]. In addition to the fgfr signaling mutations, twist1 is implicated in craniosynostosis in humans with saethre - chotzen syndrome [3336]. Mutations within twist1, a basic - helix - loop - helix transcription factor, result in twist1 haploinsufficiency, presenting as unilateral or bilateral coronal suture fusion among other facial malformations in patients with craniosynostosis [1, 3335, 37]. Twist1 is known to function as a regulator of mesenchymal lineage specification during skeletal development including within the cranial vault . Twist1 heterozygous knockout mice have been shown to recapitulate the craniosynostosis phenotype of saethre - chotzen syndrome . Previously, we have described a rabbit model with congenital nonsyndromic craniosynostosis of the coronal suture [3944]. Similar to humans, this colony of affected new zealand white rabbits demonstrates autosomal dominant transmission with variable phenotypic expression . The animals present with a broad range of phenotypes for the isolated coronal suture synostosis pathology, including unilaterally or bilaterally affected animals that exhibit suture fusion at birth or with delayed - onset synostosis [4144]. The genetic defect within this rabbit model is unknown, and a lack of molecular tools in rabbits has thus far made mapping genetic defects problematic . Herein, we conducted a molecular analysis of the rabbit colony to determine the cdna coding sequence of twist1 and the full - length sequence of fgfr3 (as the rabbit sequences of these genes were previously unknown). We used snp analysis to determine whether fgfr1, fgfr2, or twist1 were associated with the craniosynostosis phenotype of the rabbit colony . All animal protocols were reviewed and approved by the institutional animal care and use committee (iacuc). A 5 mm ear punch biopsy was obtained from 22 cs rabbits postmortem; the resulting biopsies were stored in rnalater (ambion, austin, tx, usa) for use in genomic dna extractions . For all wt and cs tissue rna purifications, total rna was purified from perisutural calvarial tissue of 10-day - old rabbits using the rneasy mini kit (qiagen inc ., valencia, ca, usa) following manufacturer protocols after homogenization using a homogenizer and an on - column dnase treatment step as previously described . Quality of rna extracted was determined by capillary electrophoresis using an agilent (santa clara, ca, usa) 2100 bioanalyzer as previously described . Rna from 2 wt and 2 cs rabbits was individually subjected to reverse transcription using smartscribe rt (clontech, mountain view, ca, usa) following manufacturer's protocol and utilizing the generacer oligo dt reverse primer (invitrogen, carlsbad, ca, usa) and smarter ii oligo (clontech) for reverse transcription of all cdnas for cloning . To determine rabbit sequence for fgfr3 and twist1, primers were initially designed based on the predicted coding sequence for fgfr3 in ochotona princeps (ensoprg00000002205) from ensembl (http://www.ensembl.org/) and using human twist1 from ensembl (enst00000242261). For fgfr3, ochotona princeps (american pika) various primer sets were designed using vector nti (invitrogen) to amplify the fgfr3 rabbit cdnas in a stepwise manner based on sequence similarity with fgfr3 in ochotona princeps . Using these sequence fragments, a full - length rabbit cdna sequence was determined from one wt rabbit rna sample (data not shown). This sequence is given as supplemental figure 3 of the supplementary material available online at http://dx.doi.org/10.1155/2013/305971 and was used as a baseline to determine whether fgfr3 was structurally mutated in the cs animals . Primers t1 - 1 and t1 - 2, matching human twist1, were used to amplify the rabbit coding sequence of twist1 from one wt rabbit . 1 (invitrogen) supplemented with 2x pcrx enhancer (invitrogen), using the following cycling parameters: 95c for 2 minutes, 43 cycles of 95c for 25 seconds, 62.5c for 30 seconds, 68c for 1 minutes, on an mj tetrad cycler (bio - rad, hercules, ca, usa). Pcr reactions were separated on 1% tae agarose gels, and the resulting primary amplicon of ~600 bp was gel extracted and sequenced . The rabbit twist1 coding region consisted of 627 bp, and an alignment of human to rabbit twist1 is given as supplemental figure 1 . Prepared cdnas from wt and cs animals were used to clone fgfr3 in three steps; first, the majority of the coding region plus the 3 utr were obtained using primers f31 and f3 - 2 . 5 race was performed utilizing the smarter pcr cdna synthesis system following the manufacturer instructions (clontech). Clones consisting of the 5 utr and an overlapping part of the coding sequence were obtained first using primers f3 - 3 with the clontech universal primer mix . Clones consisting of the terminal 3 utr were obtained using primers f35 with the generacer 3r primer . Nested pcr was performed to enrich for 5 and 3 utr target specific pcr products using 1 l purified pcr aliquot from the first round of pcr, the clontech nested 5 primer or generacer nested 3 primer, and primer f3 - 4 (5 utr) or primer f36 (3 utr). Pcr reactions were separated on 0.8% tae agarose gels, and the resulting primary amplicons were gel extracted following standard protocols (qiaquick spin kit, qiagen). The resulting cdna pcr amplimers were subcloned into the pcr4 vector with topo - mediated cloning and transformed into top10 cells by electroporation as previously described . Eight clones were selected for each rabbit cdna; cloned vectors were propagated and miniprepped as previously described . Plasmids were sequenced using m13 forward, m13 reverse, and various custom primers on an applied biosystems (foster city, ca, usa) 3730xl dna analyzer using standard methods . All sequences were compared to the identified rabbit sequence for fgfr3 using the basic local alignment search tool blast genomic dna from cs ear punch biopsies was purified using the tissue lysis protocol for the dneasy genomic dna purification system (qiagen). Genomic dna was eluted in ae buffer and quantified using an nd-1000 spectrophotometer (nanodrop technologies, inc ., wilmington, del, usa). To identify single nucleotide polymorphisms, we first designed primers using vector nti (invitrogen) based on the predicted coding sequence for fgfr1 in rabbit (ensoprg00000002205) from ensembl (http://www.ensembl.org/) and the published rabbit fgfr2 sequence from ncbi (http://www.ncbi.nlm.nih.gov/). 2 (invitrogen) and platinum taq polymerase using primers f1-e9-snpf and f1-e9-snpr (fgfr1) and f2-snpf and f2-snpr (fgfr2); 5% dmso (final concentration) was added to fgfr1 genotyping reactions . The following cycling parameters were used for genomic dna amplification: 95c for 2 minutes, 45 cycles of 95c for 30 seconds, 58.7c for 30 seconds, 68c for 1.5 minutes, on an mj tetrad cycler (bio - rad); 61c annealing temperature was used for fgfr1 instead of 58.7c . Pcr reactions were originally examined on a 1% tae agarose gel, yielding single amplicons of 1472 bp (fgfr1) and 930 bp (fgfr2). Pcr reactions were purified using the nucleospin96 system following the manufacturer's protocol (macherey - nagel, inc ., bethlehem, pa, usa) with elution in 30 l 5 mm tris, ph 8.5 . Purified pcr products were directly sequenced with the sequencing primers f1-e9-snp - seqf (fgfr1) or f2-snp - seqf (fgfr2) on an applied biosystems (foster city, ca, usa) 3730xl dna analyzer using standard methods . Resulting sequencing data were aligned in sequencher (gene codes corp ., ann arbor, mi, usa) to identify snps . Several single nucleotide polymorphisms (snps) were identified while obtaining the rabbit coding sequence for twist1 . Genomic pcr was performed utilizing the accuprime hf system with buffer no . 2 (invitrogen), pcrx enhancer (invitrogen, 2 x final concentration), and platinum taq polymerase using primers t1 - 1 and t1 - 2 (table 1). The following cycling parameters were used for genomic dna amplification: 95c for 2 minutes, 45 cycles of 95c for 30 seconds, 64c for 30 seconds, 68c for 1.5 minutes, on an mj tetrad cycler (bio - rad). Pcr reactions were originally verified on a 1% tae agarose gel, yielding single amplicons of 627 bp (twist1). Pcr reactions were purified using the nucleospin96 system following the manufacturer's protocol (macherey - nagel, inc ., bethlehem, pa, usa) with elution in 30 l 5 mm tris, ph 8.5 . Purified pcr products were directly sequenced utilizing standard sequencing conditions with the sequencing primer t1-snp - seqf (table 1). Resulting sequencing data were aligned in sequencher (gene codes corp ., ann arbor, mi, usa) to identify snps . Our main objective was to determine whether twist1, fgfr1, fgfr2, or fgfr3 were the sites of causative mutation within our rabbit model of craniosynostosis . Because the twist1 sequence in rabbit was unavailable, we initially cloned and sequenced the coding portion of the cdna for twist1 from a wt rabbit, obtaining novel twist1 coding dna sequence . The structural coding sequence of rabbit twist1 cdna is 627 bp long as compared to the 609 bp twist1 coding sequence in humans (ncbi, nm_000474); supplemental figures 1 and 2 present the alignments of the twist1 cdna and protein homologs . Although we did not clone the full cdna sequence, we identified several snps within the rabbit twist1 cdna sequence that made full sequencing unnecessary for our purposes, as described below . The rabbit sequence for fgfr1 was available from ensembl, and we previously published the rabbit sequence for fgfr2 . However, to address fgfr3, we initially cloned and sequenced the entire cdna for fgfr3 from wt rabbit rna template, obtaining novel full - length fgfr3 cdna sequence including 5 and 3 utr sequences . Using the identified fgfr3 cdna sequence, we purified rna from calvariae of 10-day - old rabbits, using two wt and two cs rabbits, and we cloned and sequenced fgfr3 from at least eight different clones in three steps as described in section 2 (figure 1). Rabbit fgfr3 was determined to be 3684 bp long, resulting in a predicted protein of 802 amino acids, as compared to the 4304 bp fgfr3 sequence in humans (ncbi, nm_000142.4) that results in a predicted protein of 806 amino acids; supplemental figures 3 and 4 consist of alignments between the fgfr3 cdna and protein homologs . Multiple isoforms of fgfr3 are known in humans, and several were identified in our rabbit samples as well, including two different 5 utrs and two different 3 utrs . However, there were no differences observed between the wt and cs animals in the types of isoforms present or in their sequences . Although no structural mutation within the coding sequence had been identified, we sought to more conclusively rule out the involvement of twist1 within our rabbit model of craniosynostosis as well . We identified silent single nucleotide mutations within the coding sequence for twist1 while cloning the rabbit twist1 cdna . Snp analysis on genomic dna from 22 cs animals was then performed by sequencing pcr amplimers using primers flanking the chosen snp . The snp was identified as a variation within our animals of c / c, t / t, or c / t (figures 2(a)2(c)). Results of sequencing our 22 animals are reported in figure 2(d); six animals were c / c, three animals were t / t, while 13 animals were c / t . These data indicated that it is extremely unlikely that twist1 is the etiological locus of our craniosynostotic phenotype . We next sought to similarly determine whether fgfr loci were linked to the inherited craniosynostosis observed in our colony by using independent assortment of snps . We sequenced across exons 8 and 9 within fgfr1, including the splice sites flanking both exons . Amplified pcr products from genomic dna obtained from 22 randomly selected yet related cs animals from the craniosynostotic colony made up our test group . There were no mutations within the exons (data not shown), but we identified a mutation within intron 8 . This snp was originally reported as g at ensembl, while our animals variously carry g / g, a / a, or g / a (figures 3(a)3(c)). Results of sequencing our 22 cs animals are reported in figure 3(d); nine animals were g / g, six animals were a / a, and seven animals were g / a . Thus, neither the g nor the a allele cosegregated with the disease phenotype, and a plurality of affected animals actually shared the g / g genotype found in wild type rabbit sequence as reported in ensembl . For fgfr2, after sequencing across exon 9 including the flanking splice sites, we identified an snp, a structurally silent mutation, within the coding sequence . This snp was originally reported as g at ncbi, while our animals display g / g, a / a, or g / a (figures 4(a)4(c)). Results of sequencing from our 22 cs animals are reported in figure 4(d); five animals were g / g genotype, seven animals were a / a, and ten animals were g / a . As with fgfr1, neither the g nor the a allele cosegregates with the affected phenotype, rendering it extremely unlikely that this locus is the site of causative mutation . Twist1 mutations were some of the first genetic defects linked to craniosynostosis in humans [2729]. In addition, mutations within fgfr13 are known to cause craniosynostosis in humans [13, 15]. The sequences of fgfr3 and twist1 (mrna and gene) were previously unknown in rabbits . We have now determined the sequence of fgfr3 cdna in the rabbit and determined that no structural mutations are present to explain the craniosynostotic phenotype, such as the p250r mutation commonly observed in muenke syndrome . We did identify several splice variants within fgfr3, including transcripts containing and lacking the vt amino acid insertion at the end of exon 10; however, these have been previously studied in other animals and in other fgfrs and were present within both wt and cs populations [4749]. All splice variants obtained would result in the same predicted protein of 802 amino acids (or 804 if containing the additional vt amino acids described above). Also identified were two different 5 utrs and two different 3 utrs; however, these variants were also present in both wt and cs animals . The predominant transcript of fgfr3 corresponded to the full - length clone presented and was identical between wt and cs animals . Our one wt rabbit contained only the 627 bp form of twist1, as did all mutant animals tested . Previously, it has been reported in humans that the glycine tract of twist1 in humans can have various numbers of polyglycine repeats . It is possible that these rabbits may also have a variable number of polyglycine repeats, but we did not specifically examine for this, as our snp analysis of twist1 had already ruled it out as the causative locus . Extensive studies within this rabbit colony have shown that the cs phenotype is inherited in an autosomal dominant manner . We used genomic dna obtained from inbred, randomly selected cs rabbits to determine whether the snps we identified in fgfr1, fgfr2, and twist1 were linked to the presence of craniosynostosis . Our data show that the identified snps in fgfr1, fgfr2, and twist1 all segregated independently of the craniosynostotic phenotype, and therefore a mutation within these genes is highly unlikely to be the causative agent of the craniosynostosis within our model . In addition, independent analysis of fgfr2 within this colony identified another snp that also failed to segregate with the craniosynostotic phenotype (data not shown), further supporting our results . These genes play roles in numerous syndromes that involve craniosynostosis, including apert, crouzon, pfeiffer, and jackson - weiss syndromes [2332], but each of these syndromes contains multiple malformations in addition to fusion of cranial sutures . This rabbit colony, however, does not present with syndromic craniosynostosis but rather simple craniosynostosis, with isolated fusion of primarily the coronal suture(s). Previously we have reported that animals have been identified within the colony that exhibit fusion of the metopic suture; however, we believe that these fusion events are likely the result of a multifactorial process and these animals exhibit 100% mortality . Therefore, our studies described herein focused on the molecular characterization of rabbits containing confirmed phenotypes of either wild type or coronal simple craniosynostosis . We previously reported that fgfr2 did not have any mutations detected across the coding sequence within these animals including the mutations that have been observed in human syndromes . The current study indicates that this rabbit model of nonsyndromic craniosynostosis likely does not devolve from any other mutation outside of the fgfr2 coding region and extends this same conclusion to fgfr1 and twist1 . In conclusion, we sought to determine whether either fgfr1fgfr3 or twist1 was the locus of the defect resulting in our rabbit heritable model of craniosynostosis . We provide novel rabbit fgfr3 and twist1 sequence data and detected no obvious mutations comparing wt and mutant animals; through snp analysis, we also eliminate fgfr1, fgfr2, and twist1 as the etiological source of our defect . This is not surprising as most mutations in humans that cause craniosynostosis (including mutations in fgfr13 and twist1) tend to occur in syndromic cases of craniosynostosis, although some reports have described clinical cases where mutations in fgfr3 or twist1 are identified in nonsyndromic craniosynostosis . We have recently determined that tgf receptors 1 and 2 are also unlikely to be the loci of origin in this rabbit model of craniosynostosis . In addition, using snp analysis, msx2 does not appear to be the causative agent of craniosynostosis in these rabbits; this was expected as gain - of - function mutations in msx2 were identified primarily in one family and result in boston type craniosynostosis in humans . This suggests that these animals may contain a mutation of an as yet unknown effector of one of the major pathways involved in craniosynostosis, which may possibly shed light on the 85% of human craniosynostosis that are currently of an unknown origin . Of recent interest, tcf12 has been implicated in human nonsyndromic craniosynostosis, and we intend to investigate its role in this colony as well . Work within this rabbit model has thus far been hampered due to the lack of readily available molecular tools in the rabbit . Recent advances in next generation sequencing may provide a method to rapidly genotype animals where detailed genomic data does not yet exist, providing an avenue to identify the etiology of craniosynostosis in these animals.
Kearns sayre syndrome (kss) is a rare mitochondrial cytopathy, first described at mayo clinic in 1958.1 kss belongs to a group of mitochondrial dna (mtdna) deletion syndromes that also includes pearson syndrome and progressive external ophthalmoplegia (peo).2 classically, kss has a triad of features, including presence of peo, pigmentary retinopathy, and an age of onset younger than 20 years.1,3,4 additionally, one or more of the following features must be present to make the diagnosis of kss: 1) heart block, 2) cerebellar ataxia, or 3) increased cerebrospinal fluid (csf) protein level (> 100 mg / dl).1,3,4 patients with peo who meet some, but not all, of the criteria for kss have been termed as having kss minus or peo plus.2 although the diagnosis of kss is based on clinical criteria, confirmation with muscle biopsy and genetic testing is now routine.3 muscle biopsy reveals characteristic ragged red fibers on trichrome stain and hyperactive fibers with succinate dehydrogenase stain.3 in terms of genetic testing, most patients with kss have large (1.310 kb) mtdna deletions.2,3 treatment of kss includes monitoring for the development of ophthalmologic manifestations and, if present, consideration of their surgical management . Many patients are given supplements, such as coenzyme q10.5 current guidelines recommend permanent pacemaker implantation for patients with neuromuscular diseases with atrioventricular block, and this includes kss.6 clinically, kss is a heterogeneous neurodegenerative syndrome involving the musculoskeletal, central nervous, cardiovascular, and endocrine systems . The current literature on kss primarily consists of case reports or small case series that use clinical diagnostic criteria . In the case series, ptosis, ophthalmoplegia, and cricopharyngeal dysphagia are commonly recognized symptoms.7 onset of disease usually occurs in childhood, with death commonly reported in early adulthood.2 published case series of patients with mitochondrial diseases8,9 have included patients with kss . The largest case series to date incorporated 136 patients with large - scale mtdna deletions and included 33 japanese adults and children with kss.10 this study found an inverse association between the length of the deletion and the age at which kss was diagnosed . Despite these existing studies, kss remains a difficult syndrome to recognize because of the variety of clinical manifestations and the lack of any large case series to date . Because kss is rare, an accurate description of its phenotype is needed for clinicians to recognize the syndrome . Our objective was to characterize these patients with kss in terms of their demographic characteristics, presenting signs and symptoms, diagnostic features, clinical evolution, and associations between disease features and the development of disability . The study cohort was identified by using the previously validated medical index database at mayo clinic, rochester, minnesota.11 the database classified patients with kss using an internal coding system based on the hospital adaptation of the international classification of diseases, eighth revision.11 additional searches, using alternative coding systems such as systematized nomenclature, were completed and revealed no additional cases . This computerized medical record search of patients seen from 1976 through 2009 identified 37 patient cases . One of the identified patients had a family history of kss but no personal diagnosis of the syndrome and was therefore excluded . A second patient did not provide consent to use his medical records for research and was also excluded . Therefore, 35 cases were used for data collection in this study . All diagnoses of kss were confirmed by examining patients medical records for the triad of peo, pigmentary retinopathy, and an age of onset younger than 20 years.1,3,4 additionally, one or more of the following were required for the diagnosis of kss: 1) heart block, 2) cerebellar ataxia, or 3) increased csf protein level (> 100 mg / dl).1,3,4 additional abstracted data included patient demographic characteristics (sex, age at diagnosis, family history of kss, and family history of any mitochondrial disorder); diagnostic features (presence of an mtdna mutation, muscle biopsy results, and protein concentrations in the csf); major presenting symptom leading to the diagnosis of kss; laboratory studies at diagnosis (hematocrit, leukocyte count, platelet count, and levels of hemoglobin, creatinine, calcium, aspartate aminotransferase, creatinine kinase, serum lactate, and pyruvate); relevant clinical features that developed during follow up (ophthalmologic, neurologic, or endocrine); mortality; cardiovascular symptoms (syncope, dilated cardiomyopathy, cardiac arrest, pacemaker implantation, pacemaker indication, and sudden cardiac death); and electrocardiographic (ecg) abnormalities (heart block, conduction delay, axis deviation, and preexcitation). Additionally, the severity of kss was rated by whether the patient was independently ambulatory or used a gait aid or wheelchair . This method was modified from the kurtzke expanded disability status scale.12 continuous data were reported as mean (standard deviation [sd]), and discrete data were reported as number of patients (%). Associations between severity of kss (ambulatory versus [vs] use of gait aid or wheelchair) and patient characteristics (sex and confirmation of kss diagnosis), presence of a genetic mutation, presence of a muscle defect on biopsy, presence of deafness, presence of cognitive decline, and death were determined using a two - tailed fisher s exact text . Statistical analyses were conducted using sas (sas institute inc ., cary, nc, usa). The study cohort was identified by using the previously validated medical index database at mayo clinic, rochester, minnesota.11 the database classified patients with kss using an internal coding system based on the hospital adaptation of the international classification of diseases, eighth revision.11 additional searches, using alternative coding systems such as systematized nomenclature, were completed and revealed no additional cases . This computerized medical record search of patients seen from 1976 through 2009 identified 37 patient cases . One of the identified patients had a family history of kss but no personal diagnosis of the syndrome and was therefore excluded . A second patient did not provide consent to use his medical records for research and was also excluded . Therefore, 35 cases were used for data collection in this study . All diagnoses of kss were confirmed by examining patients medical records for the triad of peo, pigmentary retinopathy, and an age of onset younger than 20 years.1,3,4 additionally, one or more of the following were required for the diagnosis of kss: 1) heart block, 2) cerebellar ataxia, or 3) increased csf protein level (> 100 mg / dl).1,3,4 additional abstracted data included patient demographic characteristics (sex, age at diagnosis, family history of kss, and family history of any mitochondrial disorder); diagnostic features (presence of an mtdna mutation, muscle biopsy results, and protein concentrations in the csf); major presenting symptom leading to the diagnosis of kss; laboratory studies at diagnosis (hematocrit, leukocyte count, platelet count, and levels of hemoglobin, creatinine, calcium, aspartate aminotransferase, creatinine kinase, serum lactate, and pyruvate); relevant clinical features that developed during follow up (ophthalmologic, neurologic, or endocrine); mortality; cardiovascular symptoms (syncope, dilated cardiomyopathy, cardiac arrest, pacemaker implantation, pacemaker indication, and sudden cardiac death); and electrocardiographic (ecg) abnormalities (heart block, conduction delay, axis deviation, and preexcitation). Additionally, the severity of kss was rated by whether the patient was independently ambulatory or used a gait aid or wheelchair . Continuous data were reported as mean (standard deviation [sd]), and discrete data were reported as number of patients (%). Associations between severity of kss (ambulatory versus [vs] use of gait aid or wheelchair) and patient characteristics (sex and confirmation of kss diagnosis), presence of a genetic mutation, presence of a muscle defect on biopsy, presence of deafness, presence of cognitive decline, and death were determined using a two - tailed fisher s exact text . Statistical analyses were conducted using sas (sas institute inc ., cary, nc, usa). Most patients (28 [80%]) had available information in the chart to confirm the treating physicians diagnosis of kss, based on accepted criteria.1,3,4 most patients were male (24 [69%]), and all patients were white except for one, who was african american . The mean (sd) age at kss presentation was 17 (10) years, but the mean age at diagnosis was 26 (15) years . None of the patients had a documented family history of kss, although one patient had a family member with mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes (melas syndrome). Additionally, one patient had a sister with ataxia without a formal diagnosis of a mitochondrial disorder . Fifteen patients (43%) underwent genetic testing for an mtdna mutation consistent with kss, and abnormalities were found in 12 of these (80%). Muscle biopsy was performed in 17 patients (49%), 15 (88%) of whom had results consistent with a mitochondrial myopathy . Csf was tested in only five patients (14%), which showed an increased protein value in only two . In the 16 patients who had no genetic or muscle testing, the diagnosis of kss was made on a clinical basis only; in general, these patients were older . Analysis of the major presenting signs and symptoms leading to the diagnosis of kss (table 2) showed that most patients (22 [63%]) initially had an abnormality of the ophthalmologic system . Of these ophthalmologic presenting symptoms, ptosis was the most common (16 [46%]); the other six patients had retinal pigment in the characteristic salt and pepper13 distribution (three patients), diplopia (two patients), and decreased vision (one patient). Neurologic symptoms were the next most common (six [17%]), which included nonspecific weakness (four), ataxia (one), and hearing loss (one). In one patient (3%), delayed puberty was the initial symptom of kss . At the time of kss diagnosis, no significant abnormalities were found in the hemoglobin, hematocrit, leukocyte count, platelet count, or creatinine, calcium, or aspartate aminotransferase levels in any of the patients tested . However, four of the 20 patients with data available had small increases in creatinine kinase value . <2.3 mmol / l) in six of 18 patients (33%) at diagnosis, with only one patient having a level higher than 5 only four patients (11%) died during the study period (average duration of follow - up of 10.8 years). The mean (sd) age at death was 46 (23) years, and all patients died of sudden cardiac death . An ophthalmologic abnormality developed in all patients as a part of their kss . Peo was present in 31 patients (89%), and ptosis developed in 30 (86%), 17 of whom underwent surgery for ptosis at least once . Pigmentary retinopathy (25 [71%]) and visual loss (ten [29%]) were also noted . Weakness was found in 27 patients (77%), which varied from mild weakness to extreme debility . Other symptoms included ataxia, deafness, cognitive decline, dysphagia, dysarthria, and seizure disorder . Additional clinical features in patients with kss were short stature (ten [9%]), developmental delay (four [11%]), and encephalopathy (two [6%]). Cardiovascular features that developed during follow up (table 3) included syncope and dilated cardiomyopathy as the most frequently described symptoms (six patients each [17%]). One patient died of heart failure, and five (14%) had survived a previous cardiac arrest . Permanent pacemaker / implantable cardioverter - defibrillator (ppm / icd) devices were implanted in eleven patients (31%). The indications for ppm / icd placement included high - grade heart block, bradycardia, a combination of heart block and bradycardia, and widening of the qrs complex . Importantly, the four patients who died all died of sudden cardiac death, and only one of these patients had a ppm / icd in place . The other three patients had no prior ecg changes to indicate ppm / icd placement . Nonetheless, one patient had prior syncope, and one patient had a previous cardiac arrest and ventricular arrhythmias . Heart blocks (eleven [31%]) included first degree, second degree type i, second degree type ii, and third degree . Conduction delays occurred in 23 patients (66%), and ten patients (29%) had an axis deviation . Preexcitation in the form of wolff parkinson white syndrome was seen in two patients (6%), and two patients (6%) had a history of ventricular arrhythmias . At their last visit to mayo clinic, six patients (17%) used a wheelchair, and four (11%) noted some gait instability requiring the use of a gait assist device . Two young adults noted that they were unable to work because of disease - related issues, including heart failure and fatigue . However, 25 of the patients in this study (71%) had no disability from the mitochondrial myopathy . Statistical analysis indicated that the presence of disability, defined as the use of a gait aid or wheelchair, was associated only with cognitive decline (p=0.004). There were no statistically significant associations between disability and patient sex, diagnosis, genetic defect, muscle defect, deafness, or sudden cardiac death (table 4) most patients (28 [80%]) had available information in the chart to confirm the treating physicians diagnosis of kss, based on accepted criteria.1,3,4 most patients were male (24 [69%]), and all patients were white except for one, who was african american . The mean (sd) age at kss presentation was 17 (10) years, but the mean age at diagnosis was 26 (15) years . None of the patients had a documented family history of kss, although one patient had a family member with mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes (melas syndrome). Additionally, one patient had a sister with ataxia without a formal diagnosis of a mitochondrial disorder . Fifteen patients (43%) underwent genetic testing for an mtdna mutation consistent with kss, and abnormalities were found in 12 of these (80%). Muscle biopsy was performed in 17 patients (49%), 15 (88%) of whom had results consistent with a mitochondrial myopathy . Csf was tested in only five patients (14%), which showed an increased protein value in only two . In the 16 patients who had no genetic or muscle testing, the diagnosis of kss was made on a clinical basis only; in general, these patients were older . Analysis of the major presenting signs and symptoms leading to the diagnosis of kss (table 2) showed that most patients (22 [63%]) initially had an abnormality of the ophthalmologic system . Of these ophthalmologic presenting symptoms, ptosis was the most common (16 [46%]); the other six patients had retinal pigment in the characteristic salt and pepper13 distribution (three patients), diplopia (two patients), and decreased vision (one patient). Neurologic symptoms were the next most common (six [17%]), which included nonspecific weakness (four), ataxia (one), and hearing loss (one). In one patient (3%), delayed puberty was the initial symptom of kss . At the time of kss diagnosis, no significant abnormalities were found in the hemoglobin, hematocrit, leukocyte count, platelet count, or creatinine, calcium, or aspartate aminotransferase levels in any of the patients tested . However, four of the 20 patients with data available had small increases in creatinine kinase value . <2.3 mmol / l) in six of 18 patients (33%) at diagnosis, with only one patient having a level higher than 5 mmol / l . Only four patients (11%) died during the study period (average duration of follow - up of 10.8 years). The mean (sd) age at death was 46 (23) years, and all patients died of sudden cardiac death . An ophthalmologic abnormality developed in all patients as a part of their kss . Peo was present in 31 patients (89%), and ptosis developed in 30 (86%), 17 of whom underwent surgery for ptosis at least once . Pigmentary retinopathy (25 [71%]) and visual loss (ten [29%]) were also noted . Weakness was found in 27 patients (77%), which varied from mild weakness to extreme debility . Other symptoms included ataxia, deafness, cognitive decline, dysphagia, dysarthria, and seizure disorder . Additional clinical features in patients with kss were short stature (ten [9%]), developmental delay (four [11%]), and encephalopathy (two [6%]). Cardiovascular features that developed during follow up (table 3) included syncope and dilated cardiomyopathy as the most frequently described symptoms (six patients each [17%]). One patient died of heart failure, and five (14%) had survived a previous cardiac arrest . Permanent pacemaker / implantable cardioverter - defibrillator (ppm / icd) devices were implanted in eleven patients (31%). The indications for ppm / icd placement included high - grade heart block, bradycardia, a combination of heart block and bradycardia, and widening of the qrs complex . Importantly, the four patients who died all died of sudden cardiac death, and only one of these patients had a ppm / icd in place . The other three patients had no prior ecg changes to indicate ppm / icd placement . Nonetheless, one patient had prior syncope, and one patient had a previous cardiac arrest and ventricular arrhythmias . Heart blocks (eleven [31%]) included first degree, second degree type i, second degree type ii, and third degree . Conduction delays occurred in 23 patients (66%), and ten patients (29%) had an axis deviation . Preexcitation in the form of wolff parkinson white syndrome was seen in two patients (6%), and two patients (6%) had a history of ventricular arrhythmias . At their last visit to mayo clinic, six patients (17%) used a wheelchair, and four (11%) noted some gait instability requiring the use of a gait assist device . Two young adults noted that they were unable to work because of disease - related issues, including heart failure and fatigue . However, 25 of the patients in this study (71%) had no disability from the mitochondrial myopathy . Statistical analysis indicated that the presence of disability, defined as the use of a gait aid or wheelchair, was associated only with cognitive decline (p=0.004). There were no statistically significant associations between disability and patient sex, diagnosis, genetic defect, muscle defect, deafness, or sudden cardiac death (table 4). We found that patients with kss all had ophthalmologic symptoms and commonly had neurologic and cardiac involvement . This finding is consistent with current diagnostic criteria for kss.1,3,4 however, the findings of this study, may dispute some commonly held beliefs regarding kss, including lack of certain diseases or laboratory associations, and longevity beyond middle adulthood . Only four of 35 patients in our series died (11%), but all deaths were from sudden cardiac events . Although most of these patients had no ecg changes to indicate the need for ppm / icd placement, our findings support previous recommendations to carefully consider the placement of such devices in patients with kss . Finally, we found that the development of physical disability (need for a gait aid or wheelchair) was significantly associated with cognitive decline but not with other clinical features, such as sex or sudden cardiac death . Extraocular muscles have a high energy requirement, and mitochondria make up approximately 60% of the cell volume in eye muscles.8 not surprisingly, the most common visual abnormality identified in our study was ophthalmoplegia, followed by ptosis and pigmentary retinopathy . Additionally, the characteristic salt and pepper retinopathy was detected in a majority of patients . On the basis of these findings, we believe that the diagnosis of kss should be considered in all young patients with these ocular and visual symptoms . The extent of cardiac abnormalities varied from ecg changes to high - grade heart block, cardiomyopathy, and cardiac arrest . Previous studies have noted the presence of cardiac conduction system abnormalities in patients with kss.14,15 moreover, exercise intolerance has been described in patients with mitochondrial myopathies, including kss.16 less than half the patients (eleven [31%]) received a ppm / icd as prophylactic treatment for the indications of bradycardia or heart block . All of the patients who died in this series succumbed to sudden cardiac death, and only one of these four patients had received a prophylactic ppm / icd . Nonetheless, the other three patients had no ecg changes or symptoms indicating a need for ppm / icd . In the general adult population, the overall incidence of sudden cardiac death has been estimated at 0.1% to 0.2% per year.17 findings from the current study confirm the results from previous studies regarding progressive heart block in patients with kss,9,14,15 support previous calls to consider routine prophylactic ppm / icd placement in patients with kss, and possibly suggest a low threshold for formal electrophysiologic testing in these patients . Yamashita et al10 described 136 patients with mtdna deletions . Using the diagnostic definition of rowland et al,4 they found that 33 (24%) of these patients met the criteria for kss . Deafness, short stature, and insulin - dependent diabetes mellitus were all frequently observed . They also noted that patients with kss had significantly longer dna deletions and more deleted mitochondrial transfer (t) rna than other patients in the series . In contrast to that case series, our study used the treating physician s diagnosis rather than a retrospective application of criteria in patients with a positive genetic test . Therefore, the patients we describe with the clinical diagnosis of kss were more heterogeneous, including some with disease presentation after age 20 years and without peo or pigmentary retinopathy . First, the existing diagnostic criteria require that patients have symptom onset before age 20 years, and it is commonly believed that patients with kss die in early adulthood . However, seven patients (20%) were older than 20 years at disease presentation, and only four (11%) died, at a mean age of 46 years, during the study time frame (mean follow up of 10.8 years). Potential explanations for the finding of diagnosis after age 20 years include recall bias, insidious onset of symptoms, or that milder disease may present at an older age . Second, anemia has previously been noted as a feature of kss but was not a predominant feature of patients in our study.18 third, kss has been associated with several endocrine disorders.19 in this series, we identified patients with short stature, delayed puberty, diabetes mellitus, and hypothyroidism . However, hyperaldosteronism and hypoparathyroidism, which have been reported in previous studies,19 were not observed in our cohort of patients . We found that the development of disability in patients with kss is statistically associated with cognitive decline but not with other clinical features, such as sex or sudden cardiac death . Nevertheless, the lack of association between disability and other clinical features may be reassuring to patients with kss . A single mtdna mutation can result in the expression of multiple phenotypes.20 indeed, we found that multiple phenotypes (ranging from mild to severe disease) were present with the same mtdna mutation . Additionally, mtdna deletions generally occur de novo and thus, usually cause disease in only one family member.20,21 this observation was supported by our study no patient in this series had a family history of kss . Ophthalmoplegia caused by mitochondrial abnormalities represents a heterogeneous group of illnesses, which has given rise to the concept of ophthalmoplegia plus.22 moreover, the original diagnostic criteria for kss were based on a limited number of cases.1,3,4 phenotypic designations such as kss remain useful tools for clinicians to recognize disease . Categorization of patients by signs and symptoms may allow treating clinicians to better predict prognosis and response to treatment on the basis of similar cases in the literature . Keeping the designation of kss may help to alert the physician that cardiac conduction defects may occur and lead to earlier intervention . For example, it is now known that ragged - red fibers seen on muscle biopsy indicate a combined defect of respiratory complexes i and iv.23 moreover, mitochondrial disorders of other complexes or of only i or iv do not generally produce ragged - red fibers . In addition, the brain development engrailed genes are important in protecting neurons against mitochondrial dysfunction.24 novel mtdna deletions are being discovered and suggest that these deletions play a role in the pathogenesis of kss.25,26 constant advances in biochemical markers and expanding genotypes of mitochondrial disorders make diagnosis a challenge.27 this study had limitations . First, it was conducted at a single institution, which may limit external validity; further, only 35 patients were identified; with a larger sample size, potentially more associations between patient disability and clinical features may have been discovered . Second, in retrospective review, not all patients in the cohort had documented evidence in the chart to fulfill all diagnostic criteria for kss . However, this may have been due to incomplete information in the chart or the patient having kss minus or peo plus.2 we were able to confirm a clinical diagnosis of kss in 27 of the 35 patients based on information in the chart . This may explain why only ten patients had short stature and why some patients were older than 40 years . We included all cases (35) in which the treating physician documented their clinical diagnosis of kss in the medical record . Finally, since some of the cases included in the series are decades old, some may not have had the genetic testing, metabolic studies, or muscle biopsy that are now standard because the tests were not available at the time . We report, to our knowledge, the largest case series of patients with kss from a single institution . We found that consistent with the major criteria for diagnosis, ophthalmic involvement presents in most patients at a young age . However, many patients in this series (20%) were older than the suggested cutoff of 20 years at diagnosis and, contrary to common belief, most lived beyond middle adulthood . Additionally, we failed to confirm the prevalence of anemia, hypoadrenalism, and hypoparathyroidism in patients with kss, as had been suggested by previous research . In addition to the conduction system abnormalities that were identified in previous series, our cohort included patients with syncope and sudden cardiac death, which underscores the need to consider formal electrophysiologic studies and prophylactic defibrillators in these patients.
Histone acetylation and deacetylation by histone acetyl transferases and histone deacetylases is involved in the epigenetic regulation in human cells [1, 2]. Recently, this post - translational modification has become a popular molecular target for cancer therapy . Hdac inhibitors (hdacis) have demonstrated significant antitumor activity by hyperacetylation of nucleosomal histones resulting in reexpression of repressed genes that produce growth arrest, terminal differentiation, and/or apoptosis in carcinoma cells . Valproic acid (vpa), an hdaci and an antiepileptic agent, causes marked decrease in proliferation of prostate cancer (pca) cells in vitro and significant reduction in tumor volume in vivo [4, 5]. Multiple pathways including cell cycle arrest, apoptosis, angiogenesis, and senescence contribute to the antitumor effects of vpa . Neuroendocrine (ne) cells are the third and minor epithelial cell type in prostate, in addition to the more abundant luminal secretory cells and basal cells . Ne cells have dual properties of neurons and endocrine cells and are believed to be involved in the regulation, secretion and differentiation of other prostatic cells . Small cell pca and prostatic carcinoid are relatively rare and are considered pure ne tumors with a poor prognosis . Neuroendocrine differentiation thus has been suggested as a poor prognostic sign by some authors, but the exact role of ne differentiation of the prostate remains unclear, and its prognostic importance in prostate cancer still remains controversial [7, 9]. The characteristics of ne differentiation in pca are very much similar to those seen in patients who develop this histologic phenotype in non - small - cell lung cancer . Ne cells in prostate express ne markers such as chromogranin a (cga), synaptophysin, b - tubulin, neural cell adhesion molecule (ncam or cd56), neuron specific enolase (nse), and so forth . Ne cells can be generally identified by electron microscopy or immunohistochemical (ihc) staining with antibodies for ne markers . Recently, some studies have documented increased neuroendocrine markers after in vitro treatment of prostate cancer cell lines with hdacis [9, 12] indicating neuroendocrine transdifferentiation . In contrast, studies done in neuroendocrine tumors such as carcinoid, pheochromocytoma, and small cell lung cancers have shown vpa and other hdacis to exert antitumor effects [1315]. Vpa has been shown to promote apoptosis, reduce ne phenotype and expression of ne markers, and is suggested as a promising therapy for these tumors [16, 17]. Thus the role of hdaci's in neuroendocrine differentiation still remains unclear and has thus warranted further investigation . The goal of this study is to carefully determine whether vpa induces ne differentiation in the pca cell lines, in vivo and in vitro, by studying a variety of markers associated with ne differentiation in numerous pca cell and tumor models . Markers including cga, synaptophysin, and ncam were quantified by ihc in a tissue microarray (tma) format from several vpa - treated human pca cells grown in vitro and in vivo as tumor xenografts in nude mice . Human prostate cancer cell lines lncap, pc-3, and du145 were obtained from american type culture collection (manassas, va), and c4 - 2 line was a gift from dr . All the cells were grown in rpmi 1640 with l - glutamine (cellgro, herndon, va) supplemented with 10% heat - inactivated fetal bovine serum (fbs; life technologies, inc ., carlsbad, ca), 5 g / ml ciprofloxacin hydrochloride (u.s . Biological, swampscott, ma), and 50 g / ml gentamicin (quality biological, inc ., gaithersburg, md). Cells were allowed to grow until 80% to 90% confluent and harvested with 0.05% trypsin/0.53 mmol / l edta (cellgro, herndon, va) before each subsequent passage . Cells were resuspended in 1x phosphate - buffered saline (ph 7.4; biosource, rockville, md), mixed 1x with matrigel (bd biosciences, palo alto, california), and injected (1 10 per injection) subcutaneously into the lateral flanks of male athymic nu / nu mice . Vpa (1 mol / l; vpa sodium salt; sigma, st . Louis, mo) stock was made in pbs and filters sterilized through a 0.22 m filter . For in vitro experiments cell lines were treated with 0, 0.6, and 1.2 mm vpa for 14 days . Medium was replaced every 48 hours with fresh medium containing vpa . For in vivo experiments, animals received 0.4% w / v vpa in drinking water . This has been shown to produce blood levels in mouse comparable to fda approved levels in humans . Animals in treatment arm were treated for 35 days before excision of tumors . In in vivo experiments, chronic treatment implies to long - term treatment with regards to life span . We considered 35 days of treatment in nude mice (with life span of 1 year approx . In our experience) as long - term treatment . Cells treated with different doses of vpa were harvested by trypsinization and resuspended with 5 volumes of cold lysis buffer (ripa buffer, cat #r0278, sigma, st . Louis, mo) and supplemented with protease inhibitor cocktail (roche, indianapolis, in, usa). Equal amounts of proteins were separated by sds - page and the resolved proteins transferred to nitrocellulose membrane . The membrane was blocked for an hour in blocking buffer [100 mm tris - hcl (ph 7.5), 150 mm nacl, 0.1% tween 20] with 5% nonfat dry milk and then incubated with rabbit antiacetylated histone h3 (upstate, charlottesville, va) overnight followed by antirabbit igg peroxidase conjugate (sigma, st . Immunoreactive bands were detected using the enhanced chemiluminescence plus western blotting detection system (amersham biosciences, piscataway, nj) according to the manufacturer's instructions . Anti - cip1/waf1/p21 mouse monoclonal igg (upstate, charlottesville, va), cga (lk2h10) mouse monoclonal antibody (santa cruz biotechnology, inc ., santa cruz, ca), and antimouse igg peroxidase (sigma, st . Louis, mo) were used to normalize protein loading . For in vitro models, cells were harvested and washed in pbs . Resulting cell pellets were incubated for 1 - 2 hr in bouin's fixative (75% saturated picric acid, 20% formalin (40%), 5% acetic acid, rinsed with 70% ethanol, and dehydrated according to standard procedures with ethanol and xylene . Cells were embedded in paraffin following 90 min of incubation in liquid paraffin at 60c . For in vivo models, tumors were excised and portioned on day 35 . Portions were either immediately frozen in liquid nitrogen and stored at 80c or fixed in buffered formalin and subsequently embedded in paraffin . A tissue microarray (tma) of the paraffin embedded materials was generated as described previously . Each array block also contained control normal human prostate tissues and animal xenograft tissues such as bladder, kidney, lung and spleen . Immunohistochemical stains for chromogranin a (clone lk2h10, ventana, tucson, az), synaptophysin (polyclonal, cell marque, rocklin, ca), and ncam / cd56 (123c3.d5, cell marque, rocklin, ca) were performed separately on sections cut from the tma . Stained tma slides were scanned (at 20x magnification setting) using the aperio imaging system and the images were uploaded and viewed using tmaj [20, 21]. Each array spot was then formed into a composite image for viewing and scoring on a personal computer monitor . The specimens showed a varying degree of staining intensity and percentage of cells staining . Therefore strong intensity staining was scored as 3, moderate as 2, weak as 1, and negative as 0 . For each intensity score, the percentage of cells with that score was estimated visually . A combined weighted score consisting of the sum of the percentage of cells staining at each intensity level was calculated for each sample, for example, a case with 50% strong staining, 20% moderate staining, and 10% weak staining would receive a score as follows: (50 3 + 20 2 + 10 1) = 200 . One way anova with post - hoc testing was done to evalauate differences in mean staining score between different groups . The most reliable method to assess ne differentiation in pca is the detection of cga in tumor cells . The ihc staining of sections constructed of cell lines treated for 14 days with vpa was not able to detect any expression of cga (figure 1(a)). In order to verify the absence of cga by the ihc in all the cell lines tested, we performed western blot analysis (figure 1(b)). Results revealed cga expression in these cell lines; however, cga protein levels were reduced in a dose - dependent manner after vpa treatment . Chronic in vitro treatment of c4 - 2 cells with vpa resulted in increased synaptophysin expression (mean weighted score 65(4) at 1.2 mm versus 34(4) at 0.6 mm (p = .002) and 18(4) at 0 mm (p <.001)). Significantly increased expression was also found in pc-3 cells treated at 1.2 mm (mean weighted score 68(2) versus 10(2) in other two groups, p <.001). However, synaptophysin expression was not altered in lncap and du145 cell lines following vpa treatment (figure 2). Chronic in vitro treatment of vpa increased the expression of ncam in lncap (weighted score 8(3) at 0 mm versus 40(3) at 0.6 mm, (p <.001); 40(3) at 0.6 mm versus 65(4) at 1.2 mm, (p = .002). In pc-3 cells, no expression of ncam was seen at 0 and 0.6 mm vpa, but slight expression was seen at 1.2 mm (mean weighted score 20(5)). None or very little ncam staining was seen in c4 - 2 and du145 at either dose (figure 3). We have shown previously that administration of 0.4% vpa in mouse drinking water can achieve plasma vpa levels similar to the levels obtained in human patients . Vpa treatment at these levels was shown to induce acetyl h3k9, p21, and reduce tumor volume, thus confirming the pharmacologic activity of vpa . Animals were sacrificed, and tumors were harvested on day 35 . To investigate the effects of vpa on ne markers of pca tumors in vivo, we evaluated expression of ne markers by ihc on the excised tumors . Ihc did not reveal any cga staining in either treatment or control arms in all cell lines (figure 4(a)). Tmas from c4 - 2 tumors revealed decreased expression of both synaptophysin (mean weighted score 47(10) versus 15(5), p <.001) and ncam (44(9) versus 5(6), p = .002) in treatment arms (figure 4(b)). None of the other arms revealed any significant staining (weighted scores less than 30) for ncam or synaptophysin (figures 4(b) and 4(c)). Thus vpa does not induce any ne markers in the physiologically relevant in vivo setting . Ne cells are considered to be derived from local stem cells and are an example of normal, terminally - differentiated cells without proliferative activity . Ne cells in tumor lesions are phenotypically similar to ne cells in normal prostate epithelium in terms of expression of neuropeptides and biogenic amines . Furthermore, dual epithelial characteristics such as prostatic acid phosphatase and/or psa production and ne marker expression, such as cga, are frequently coexpressed in the malignant phenotype of ne cells . Studies evaluating the role of focal ne differentiation in pca prognosis have reported varied results: some reports indicate a negative correlation with prognosis while some show little or no relationship to prognosis [10, 2328]. Histone deacetylase inhibitors are a promising new class of cancer therapy which have antiproliferative and prodifferentiation properties . For prostate cancer thus vpa, which is capable of inhibiting hdacs classes i and iia, may be a good option for pca therapy . In preclinical models, vpa treatment leads to proliferation arrest and differentiation and apoptosis of cancer cells of various tissue origin, while nominal effects were reported in normal cells [2, 4, 5]. Reported vpa to cause an increase in the secretion of nse in lncap cells (in vitro) which may indicate an ne differentiation . In order to better understand the role of vpa in possibly stimulating ne differentiation in pca cell models, we selected the clinically recommended panel of antibodies for the ihc investigation of ne cells in multiple pca cell lines and xenograft tumors . Chromogranin a or parathyroid secretory protein 1 is a member of the chromogranin - secretogranin family and forms the major constituent in neurosecretory peptide containing dense core granules in ne cells . Cga is highly expressed by cells of neuroendocrine origin, both normal and tumoral, functional and nonfunctional . While neuron specific enolase (nse) has also been used as an ne marker, it is known to be expressed in a variety of non - ne cells and tumors, which has led researchers to question its specificity [30, 31]. Serum cga levels, on the other hand, have been reported to be better predictors of neuroendcocrine differentiation than nse [32, 33]. Thus, cga now is widely regarded as an excellent and more specific marker of ne differentiation . In our study, cga expression was not detected by ihc in either control or treated groups in human prostate cell lines of lncap, c4 - 2, pc-3, and du145 in vitro or in vivo . Western blotting, being more sensitive, revealed low cga expression in these cell lines; which reduced further with vpa treatment in a dose - dependent manner . Histone acetylation and p21 induction (data not shown) confirmed that active vpa doses were achieved as we have previously demonstrated [5, 34]. Our results are further corroborated by similar reduction in ne markers and ne morphology in ne tumors after treatment with hdacis [13, 14, 16]. Have previously demonstrated cga to be an important neuropeptide promoting the growth of prostate cancer cells and its suppression leading to programmed cell death in multiple prostate cell lines . Gong et al . Later found antiapoptotic effects of cga to be dependent on a protein kinase b / akt (an antiapoptotic protein or prosurvival factor) mediated pathway . Also hdacis have been known to downregulate akt phosphorylation in prostate cancer cells taken together, it suggests a link between hdaci's - mediated apoptosis and cga inhibition . Further studies will be required to determine the contribution of cga and akt to the vpa therapeutic effect . Synaptophysin and ncam are other specific and fairly sensitive markers for ne differentiation [38, 39]. In in vitro experiments, these markers showed varying trends (increased synaptophysin staining in c4 - 2 and pc-3 cells but unaltered in lncap and du145; increased ncam in lncap and pc-3 cells but unaltered in c4 - 2 and du145), and no consistent pattern was seen . In in vivo experiments, the staining did not reveal any significant expression of these markers in any of the xenografts except in c4 - 2 tumors where it revealed a downward trend on treatment . The findings in our study do not support any neuroendocrine differentiating role of vpa . On the contrary, cga, a very specific marker, synaptophysin and ncam showed some inconsistent induction following vpa treatment in some cell lines but, in vivo, vpa treatment did not induce any significant expression of any ne markers . 0.4% vpa in mouse drinking water can achieve plasma vpa levels similar to the therapeutic levels obtained in human patients . Tmas from xenografts of different cell lines either did not stain for ne markers or had very little staining without any induction on vpa treatment . Thus, our data clearly demonstrates that vpa does not induce ne differentiation of pca cells in the physiologically relevant in vivo setting.
Community acquired pneumonia (cap) is defined as an acute infection of the pulmonary parenchyma that is associated with at least some symptoms of acute infection, accompanied by the presence of an acute infiltrate on a chest radiograph or auscultatory findings consistent with pneumonia, in a patient not hospitalized or residing in a long - term care facility for 14 days before the onset of symptoms . In the absence of a chest x - ray, the british thoracic society defines pneumonia as symptoms of an acute lower respiratory tract infection, including a cough and at least one other lower respiratory tract symptom, together with at least one systemic symptom and new focal signs on chest examination . The incidence of cap is lowest in the age group of 18 - 24 years and highest in the under-5 and over-65 groups . Given the emergence of antibiotic resistance and the potential hazards of antibiotic treatment failures, a definitive microbiological diagnosis is desirable . The common etiological agents causing cap include streptococcus pneumoniae (20 - 60%), hemophilus influenza (3 - 10%), chlamydia pneumoniae (4 - 6%), mycoplasma pneumoniae (1 - 6%), legionella (2 - 8%), staphylococcus aureus (3 - 5%), gram - negative bacilli (3 - 5%), viruses (2 - 13%). In 40 - 60% cases, no cause is identified and in 2 - 5% cases, two or more pathogens are identified . The main objectives of investigating patients with a clinical diagnosis of pneumonia are to obtain radiological confirmation of the diagnosis, to exclude other conditions that may mimic pneumonia, to obtain a microbiological diagnosis, to assess the severity of pneumonia and to identify the development of complications . Treatment is often empirical and based on the clinical and radiological diagnosis directed at the most common organisms . Hence, its antimicrobial treatment should be based on the distribution of etiological pathogens and their incidence in the community . The present study is an attempt to identify and delineate the microbiological and antimicrobial sensitivity characteristics of cap in a given community and hospital setting . The study was conducted for dissertation purpose at lourdes hospital, ernakulam which is a 750 bedded multispecialty referral hospital catering to both urban and semi - urban population . It was a prospective study of all patients who attended the medical out - patient department and were diagnosed with cap . Data collection was by detailed history, clinical examination and sputum culture and sensitivity pattern . For the latter, the zone of inhibition was calculated by the diameter in mm . Data analysis was by representation as tabulation and bar diagrams and calculation, in percentages, of etiological pathogens and sensitivity patterns . The exclusion criteria were patients below 16 years of age, immunocompromised patients, hospital acquired pneumonia (onset after 4 days of hospitalization), aspiration pneumonia, patients with cystic fibrosis or tuberculosis and pregnant women . Age and gender distribution of cap, in the studied population seven pathogens were isolated by sputum culture [detailed in table 2 and figure 1]. The rate of incidence of the common pathogens based on the distribution in different age groups varied as shown in table 3 . Incidence of etiological organisms of cap, with gender distribution pie diagram showing the aetiological pathogens isolated from the sputum of cap patients in this study incidence of etiological organisms of cap, with age distribution the different antimicrobial agents included in this study are mentioned in annexure 1 . The observed antimicrobial sensitivity patterns of individual pathogens are shown in table 4 . Observed incidence and antimicrobial sensitivity patterns of individual pathogens in the studied population figure 2 depcits the the antimicrobial sensitivity of the most common pathogen in this study (streptococcus pneuominae). Bar diagram showing the antimicrobial sensitivity of the most common pathogen in this study (streptococcus pneumoniae) the rates of sensitivity to these antimicrobial agents shown by all the pathogens taken together are represented in terms of percentage [figure 3]. Here, moderate sensitivity is not taken into consideration . Bar diagram showing the overall sensitivity to the tested antimicrobial agents overall, the common pathogens causing cap showed highest sensitivity to amikacin (44.84%), followed by ofloxacin (43.45%), gentamicin (38.62%), gatifloxacin (37.93%), augmentin and ciprofloxacin (34.48%), ceftriaxone (33.79%) and linezolid (32.41%). The least sensitivity rates are shown to levofloxacin and penicillin g (0.69%), ampicillin and piperacillin - tazobactam (1.38%) and clarithromycin, amoxicillin and cefoperazone (2.07%). A wide array of organisms can cause acute pneumonia and published reports vary in the organisms isolated due to differences in patient groups, presence of epidemic organisms and diligence of the investigation . If sputum is available and the patient has not had prior antibiotic treatment, then a gram stain is sufficient to identify the causative organism . Overnight culture will provide confirmation and the chance to perform susceptibility studies, allowing modification of empirical therapy . The role of sputum as a tool in the diagnostic work - up of patients with cap remains controversial . Both these findings are in agreement with indian and western reports in the literature . Almost as high as 50% normal flora one study from sher - i - kashmir institute of medical sciences, srinagar has emphasized the need for further studies including the serological tests for legionella, mycoplasma and viruses to identify the microbial etiology of cap . For low - risk patients who may be safely treated in an ambulatory setting, the infectious diseases society of america (idsa)-updated guidelines recommend doxycycline, a macrolide or an antipneumococcal fluoroquinolone as preferred agents because these agents have activity against the most likely pathogens in this setting (s. pneumoniae, m. pneumoniae and chlamydophila pneumoniae). The idsa has adopted the new antipneumococcal fluoroquinolones, namely levofloxacin, sparfloxacin, moxifloxacin and gatifloxacin, as preferred agents for the treatment of both ambulatory and hospitalized patients with cap and for penicillin - resistant pneumococcal pneumonia . For empiric treatment of the moderately ill - hospitalized patient, the idsa recommends an extended - spectrum cephalosporin (cefotaxime, ceftriaxone) plus a macrolide or monotherapy with a fluoroquinolone . For hospitalized patients admitted to the intensive care unit, the idsa prefers agents that include combination therapy with an extended - spectrum cephalosporin plus a macrolide or a fluoroquinolone . Monotherapy with a fluoroquinolone is not recommended because data with seriously ill cap patients are limited . The centers for disease control and prevention (cdc) working group suggests that penicillin - resistant s. pneumoniae isolates are uncommon and activity against such organisms is unnecessary for empiric treatment . Their recommendations for first - line therapy of cap include a macrolide, doxycycline or an oral beta - lactam such as cefuroxime, amoxicillin or amoxicillin / clavulanate . The cdc recommends reserving the use of fluoroquinolones for treatment of gram - negative pathogens, patients with beta - lactam allergy or treatment of penicillin - resistant pneumococcal pneumonia . Although this argument may be raised regarding any antibiotic, the concern with the fluoroquinolones is that resistance to one agent affects all agents to some degree . Currently, pneumococcal resistance to the fluoroquinolones is low, but a report from canada has demonstrated an association between increased fluoroquinolone use and resistance in s. pneumoniae . In addition, the potential for development of resistance in other organisms (especially pseudomonas aeruginosa) as a result of the indiscriminate use of fluoroquinolones poses a more ominous threat to this drug class . Here, the common pathogens show an overall sensitivity of 43.45% to ofloxacin, 37.93% to gatifloxacin and 34.48% to ciprofloxacin . The cdc working group recommends amoxicillin - clavulanate (augmentin) as one of the first - line antimicrobials . In our study, s. pneumoniae, which is the commonest etiological agent, showed nearly, 80% sensitivity to amoxicillin - clavulanate . Pneumococcal susceptibility has changed significantly over the past decade . Despite four decades of using penicillin, strains with minimum inhibitory concentrations (mics)> 0.1 mg / ml accounted for 3.8% of isolates in the 1980's; by 1994 - 1995, the rate was 24% and by 1997 it was 43.8% . Penicillin resistance is also associated with resistance to other antimicrobial classes, including cephalosporins, macrolides, tetracyclines and trimethoprim / sulfamethoxazole . Antibiotics less affected by this broad - spectrum resistance include vancomycin, the fluoroquinolones, clindamycin, chloramphenicol and rifampin . Strains are considered as sensitive if the mic is <0.1 mg / ml . It is observed from various studies that most penicillin resistance is relative resistance and is readily treatable with penicillin and/or beta - lactams . Most of the highly penicillin - resistant s. pneumoniae infections may also be treated with beta - lactams . Alternately, doxycycline or respiratory quinolones may be used . Very highly penicillin - resistant s. pneumoniae (mic 6 g / ml) strains are a rare cause of cap, but remain susceptible to ceftriaxone . Studies suggest that empiric macrolide monotherapy should be avoided because approximately 25% of s. pneumoniae strains are naturally resistant to all macrolides . In our study, the rates of sensitivity were 11.72% to erythromycin, 10.34% to azithromycin and 2.07% to clarithromycin . It is ideal for iv - to - oral switch monotherapy in terms of patient compliance, safety and cost . Mortality gradually increased with progressive delays between the time a patient presented and the time the initial dose of an antibiotic was administered . This difference reached statistical significance when the delay exceeded 8 h. many studies conclude that antibiotics should be initiated within 4 h after patient presentation . A final conclusion about the superiority of one antibacterial regimen over another in hospitalized patients with cap cannot be drawn on the basis of the limited data available . Monotherapy coverage of both typical and atypical pathogens in cap is preferred over double - drug therapy . Serological tests to identify some rare organisms were not carried out in this study . Some of these may have been reported as normal flora . Antimicrobials tested for sensitivity in this study have not included the newer, costlier drugs . Both these findings are in agreement with indian and western reports in the literature . Almost as high as 50% normal flora one study from sher - i - kashmir institute of medical sciences, srinagar has emphasized the need for further studies including the serological tests for legionella, mycoplasma and viruses to identify the microbial etiology of cap . For low - risk patients who may be safely treated in an ambulatory setting, the infectious diseases society of america (idsa)-updated guidelines recommend doxycycline, a macrolide or an antipneumococcal fluoroquinolone as preferred agents because these agents have activity against the most likely pathogens in this setting (s. pneumoniae, m. pneumoniae and chlamydophila pneumoniae). The idsa has adopted the new antipneumococcal fluoroquinolones, namely levofloxacin, sparfloxacin, moxifloxacin and gatifloxacin, as preferred agents for the treatment of both ambulatory and hospitalized patients with cap and for penicillin - resistant pneumococcal pneumonia . For empiric treatment of the moderately ill - hospitalized patient, the idsa recommends an extended - spectrum cephalosporin (cefotaxime, ceftriaxone) plus a macrolide or monotherapy with a fluoroquinolone . For hospitalized patients admitted to the intensive care unit, the idsa prefers agents that include combination therapy with an extended - spectrum cephalosporin plus a macrolide or a fluoroquinolone . Monotherapy with a fluoroquinolone is not recommended because data with seriously ill cap patients are limited . The centers for disease control and prevention (cdc) working group suggests that penicillin - resistant s. pneumoniae isolates are uncommon and activity against such organisms is unnecessary for empiric treatment . Their recommendations for first - line therapy of cap include a macrolide, doxycycline or an oral beta - lactam such as cefuroxime, amoxicillin or amoxicillin / clavulanate . The cdc recommends reserving the use of fluoroquinolones for treatment of gram - negative pathogens, patients with beta - lactam allergy or treatment of penicillin - resistant pneumococcal pneumonia . Although this argument may be raised regarding any antibiotic, the concern with the fluoroquinolones is that resistance to one agent affects all agents to some degree . Currently, pneumococcal resistance to the fluoroquinolones is low, but a report from canada has demonstrated an association between increased fluoroquinolone use and resistance in s. pneumoniae . In addition, the potential for development of resistance in other organisms (especially pseudomonas aeruginosa) as a result of the indiscriminate use of fluoroquinolones poses a more ominous threat to this drug class . Here, the common pathogens show an overall sensitivity of 43.45% to ofloxacin, 37.93% to gatifloxacin and 34.48% to ciprofloxacin . The cdc working group recommends amoxicillin - clavulanate (augmentin) as one of the first - line antimicrobials . In our study, s. pneumoniae, which is the commonest etiological agent, showed nearly, 80% sensitivity to amoxicillin - clavulanate . Pneumococcal susceptibility has changed significantly over the past decade . Despite four decades of using penicillin, only modest rates of reduced susceptibility to penicillin strains with minimum inhibitory concentrations (mics)> 0.1 mg / ml accounted for 3.8% of isolates in the 1980's; by 1994 - 1995, the rate was 24% and by 1997 it was 43.8% . Penicillin resistance is also associated with resistance to other antimicrobial classes, including cephalosporins, macrolides, tetracyclines and trimethoprim / sulfamethoxazole . Antibiotics less affected by this broad - spectrum resistance include vancomycin, the fluoroquinolones, clindamycin, chloramphenicol and rifampin . Strains are considered as sensitive if the mic is <0.1 mg / ml . It is observed from various studies that most penicillin resistance is relative resistance and is readily treatable with penicillin and/or beta - lactams . Most of the highly penicillin - resistant s. pneumoniae infections may also be treated with beta - lactams . Alternately, doxycycline or respiratory quinolones may be used . Very highly penicillin - resistant s. pneumoniae (mic 6 g / ml) strains are a rare cause of cap, but remain susceptible to ceftriaxone . Studies suggest that empiric macrolide monotherapy should be avoided because approximately 25% of s. pneumoniae strains are naturally resistant to all macrolides . In our study, the rates of sensitivity were 11.72% to erythromycin, 10.34% to azithromycin and 2.07% to clarithromycin . It is ideal for iv - to - oral switch monotherapy in terms of patient compliance, safety and cost . Mortality gradually increased with progressive delays between the time a patient presented and the time the initial dose of an antibiotic was administered . This difference reached statistical significance when the delay exceeded 8 h. many studies conclude that antibiotics should be initiated within 4 h after patient presentation . A final conclusion about the superiority of one antibacterial regimen over another in hospitalized patients with cap cannot be drawn on the basis of the limited data available . Monotherapy coverage of both typical and atypical pathogens in cap is preferred over double - drug therapy . Serological tests to identify some rare organisms were not carried out in this study . Some of these may have been reported as normal flora . Antimicrobials tested for sensitivity in this study have not included the newer, costlier drugs . We have attempted to identify these in our community and study the pathogens and their sensitivity . The present study has shown s. pneumoniae as the most likely pathogen and either linezolid or amikacin as the most likely effective antimicrobial in cases of cap, in our setting . Keeping the idsa and cdc recommendations in mind, we suggest that the inferences from our study should be considered when initiating antimicrobial therapy in our local setting.
A 37-year - old nigerian trailer mechanic presented to the eye clinic of the university college hospital, ibadan, with gradual blurring of vision and difficulty reading and identifying peoples faces in both eyes over 10 years . Ocular examination showed unaided visual acuity of 6/36, n48 in both eyes (ou). Dilated fundoscopy showed macular atrophy and a beaten - bronze appearance with surrounding yellow white flecks in both eyes (figure 1). The patient s sister, oa, a 43-year - old, presented with similar history . Ocular findings included a visual acuity of 6/36 and similar ophthalmoscopic findings (figure 1). Stargardt s macular degeneration was first reported in 1901 by german ophthalmologist karl stargardt, from whom the disease gets its name.1 the degeneration starts in childhood, but the symptoms may not be apparent until age 3040 years . Progressive central visual loss occurs due to photoreceptor damage,2 and color - vision defects are associated with this disease . The inheritance of stargardt s disease can be autosomal recessive or dominant.3 the most common form of stargardt s disease is the recessive form caused by mutations in the abca4 (formerly abcr) gene on chromosome 1p21-p13 . The mutations cause the production of a dysfunctional protein (the adenosine triphosphate - binding cassette transporter), producing defective transport of n - retinylidene - phosphatidylethanolamine from the disk space to the cytoplasm of rods and cones . This leads to a buildup of a toxic metabolite lipofuscin, which then causes the photoreceptor and retinal pigment epithelial cells to degenerate by way of membrane permeability, lysosomal dysfunction, and the detachment of proapoptotic proteins, leading to a cell - death pathway.4 central vision loss occurs, while peripheral vision usually is retained.5 symptoms include wavy vision, blind spots, blurriness, impaired color vision, and difficulty adapting to dim lighting . Children first notice difficulty in reading, complaining of gray, black, or hazy spots in the center of their vision . They report that a longer length of time is needed to adjust between light and dark environments . Onset of symptoms usually is between 10 and 20 years of age.6 our patients presented with poor central vision dating back 10 years the classical oval, snail - slime, or beaten - bronze foveal appearance may be surrounded by yellow - white flecks, which is suggestive of stargardt s disease . In some cases, a geographic atrophy with bull s eye configuration may be seen.7 the two patients presented with the classical findings, as shown in figure 1 . One needs to bear in mind the phenotypic variability in the abca4 retinopathy, as described by burke et al.8 investigations supporting the diagnosis include fundus photo / autofluorescence showing loss of posterior pole autofluorescence and fluorescein angiography with a dark choroid from blockage of choroidal fluorescence by deposits of lipofuscin.9 the focal or pattern electroretinogram is preferred to a full - field electroretinogram . Studies showed normal full - field electroretinogram in early stages of the disease.10 the visual field will show a central scotoma . Treatment includes supportive measures, such as low - vision devices, photochromic lenses, and genetic counseling . Embryonic stem cell therapy is undergoing consideration.11 our patients were reviewed and given low - vision devices . The inheritance of stargardt s disease can be autosomal recessive or dominant.3 the most common form of stargardt s disease is the recessive form caused by mutations in the abca4 (formerly abcr) gene on chromosome 1p21-p13 . The mutations cause the production of a dysfunctional protein (the adenosine triphosphate - binding cassette transporter), producing defective transport of n - retinylidene - phosphatidylethanolamine from the disk space to the cytoplasm of rods and cones . This leads to a buildup of a toxic metabolite lipofuscin, which then causes the photoreceptor and retinal pigment epithelial cells to degenerate by way of membrane permeability, lysosomal dysfunction, and the detachment of proapoptotic proteins, leading to a cell - death pathway.4 central vision loss occurs, while peripheral vision usually is retained.5 symptoms include wavy vision, blind spots, blurriness, impaired color vision, and difficulty adapting to dim lighting . Children first notice difficulty in reading, complaining of gray, black, or hazy spots in the center of their vision . They report that a longer length of time is needed to adjust between light and dark environments . Onset of symptoms usually is between 10 and 20 years of age.6 our patients presented with poor central vision dating back 10 years . Beaten - bronze foveal appearance may be surrounded by yellow - white flecks, which is suggestive of stargardt s disease . In some cases, a geographic atrophy with bull s eye configuration may be seen.7 the two patients presented with the classical findings, as shown in figure 1 . One needs to bear in mind the phenotypic variability in the abca4 retinopathy, as described by burke et al.8 investigations supporting the diagnosis include fundus photo / autofluorescence showing loss of posterior pole autofluorescence and fluorescein angiography with a dark choroid from blockage of choroidal fluorescence by deposits of lipofuscin.9 the focal or pattern electroretinogram is preferred to a full - field electroretinogram . Studies showed normal full - field electroretinogram in early stages of the disease.10 the visual field will show a central scotoma . Treatment includes supportive measures, such as low - vision devices, photochromic lenses, and genetic counseling . Embryonic stem cell therapy is undergoing consideration.11 our patients were reviewed and given low - vision devices . Families of patients need adequate education and regular exams, especially the younger age - groups . The so - called rare diseases may be common in sub - saharan africa, and detailed retinal examination is important in patients presenting with poor central vision.
Severe hypertension in pediatric patients is thought to be secondary and often related to renovascular disease . For this reason, pediatric nephrologists have become the blood pressure (bp) specialists for children with hypertension . In children, neurological causes of hypertension are often related to increased intracranial pressure whereas cerebrovascular causes are rare . Therefore, it is often presumed that renovascular disease leads to hypertension which leads to neurological disease . We report a case of neurological disease, moyamoya, causing hypertension, leading to partially reversible kidney failure . We present this case to highlight the consideration of moyamoya as a cause of hypertensive renal failure . Paracetamol (acetaminophen) was taken, but offered no relief . Over the next 4 she was taken to a local hospital and was noted to have a focal seizure with left facial and hand twitching which stopped with intravenous lorazepam . After stabilization she was transferred by air to a tertiary care center . Upon arrival she was admitted to the pediatric intensive care unit . She was immediately placed on an intravenous infusion of nicardipine at 0.5 g / kg / min without a bolus dose . An intra - arterial bp catheter was placed to allow titration of the nicardipine infusion . The target bp for the first 8 h was to maintain above 171/105 mmhg (<25% reduction in maximum bp for both systolic and diastolic) to prevent a precipitous drop and avoid inducing irreversible neurological damage . Past medical history was significant for grade iii vesicoureteral reflux (vur) diagnosed at age 12 after ct scan for appendicitis identified acute appendicitis and scarring of the upper poles of both kidneys . She had been seen in an outpatient pediatric nephrology clinic 9 months prior to this presentation . Systolic bp at that time was 120 mmhg; hgb 75.1 mmol / l (12.1 g / dl); serum creatinine was 79.6 mol / l (0.9 mg / dl) [egfr 78 ml / min/1.73 m]; urinalysis with 3 + protein, without hematuria . Current laboratory studies showed a serum creatinine of 415.5 mol / l (4.7 mg / dl). Urinalysis showed 3 + protein and 3 + blood without red blood cells or casts on microscopy . Magnetic resonance imaging (mri)/magnetic resonance angiography (mra) without contrast showed abnormal t2/flair signal in the cortical and subcortical regions of the right parietal temporal lobe and basal ganglia consistent with either subacute infarction in the right mca territory without diffusion restriction or an atypical presentation of posterior reversible encephalopathy syndrome (pres) (figure 1a and b). Renal ultrasound showed small echogenic kidneys bilaterally (right 6.9 cm; left 7.8 cm) with cortical scarring and loss of corticomedullary differentiation . Ultrasound was felt to be consistent with and supported vur nephropathy as the cause of the hypertensive renal failure . Figure 1. (a) mri without contrast enhancement flair signal showing hyperintensity in the right parietal lobe (white arrow), head of caudate nucleus (asterisk) and adjacent white matter . (b) sequential image of series showing hyperintensity in the temporal lobe (short arrow), putamen (double asterisks) and right parietal lobe (long arrow). Figure 2.mra without contrast enhancement using time - of - flight technique shows diminished flow in right mca m1 (white arrow) and bilateral aca a1 segments (black arrows). Mra, magnetic resonance angiography; mca, middle cerebral artery; aca, anterior cerebral artery . (a) mri without contrast enhancement flair signal showing hyperintensity in the right parietal lobe (white arrow), head of caudate nucleus (asterisk) and adjacent white matter . (b) sequential image of series showing hyperintensity in the temporal lobe (short arrow), putamen (double asterisks) and right parietal lobe (long arrow). Mra without contrast enhancement using time - of - flight technique shows diminished flow in right mca m1 (white arrow) and bilateral aca a1 segments (black arrows). Mra, magnetic resonance angiography; mca, middle cerebral artery; aca, anterior cerebral artery . Over the next 96 h intravenous nicardipine (dose range of 210 g / kg / min) and furosemide (0.1 mg / kg / h) were infused in an attempt to normalize bp to less than the 90th percentile for height (126/81 mmhg) (figure 3). Her mental and neurological status returned to baseline without appreciable deficits and she was extubated . Over a 2-week hospital course she was transitioned to oral antihypertensive agents including amlodipine 5 mg twice daily, atenolol 50 mg daily, clonidine 0.1 mg twice daily, lisinopril 2.5 mg twice daily and furosemide 40 mg twice daily (figure 3). Evaluation for autoimmune disease and vasculitis included ana, anca, anti - gbm antibodies all were negative . Repeat mri / mra without contrast showed near complete resolution of previously seen t2/flair hyperintensities although there was no flow in the right m1 and a1 segment . Even with this persistent mra abnormality, her rapid return to normal without neurological deficit and near - complete resolution of flair signal abnormalities was thought to be most consistent with pres . Furthermore, kidney function remained compromised (creatinine peaked at 645.3 mol / l [7.3 mg / dl]; egfr 10 ml / min/1.73 m), and therefore we were reluctant to proceed with a conventional angiogram as it was likely to result in the need for dialysis due to contrast nephropathy . She was discharged home on four antihypertensive agents and furosemide for a target bp at the 50th percentile for height with close follow up . Figure 3.graphical representation of patient's blood pressure, target ranges and medications prescribed during initial hospitalization . Graphical representation of patient's blood pressure, target ranges and medications prescribed during initial hospitalization . Over a 6-month period she remained on three or four antihypertensive medications which were adjusted to target a bp below 112/66 mmhg (50th percentile for height). In addition, she was started on epoetin alpha 2000 units weekly, calcitriol 0.25 g daily, sodium bicarbonate 1300 mg twice daily and calcium acetate 667 mg tab with food for chronic kidney disease (ckd) management . Mol / l (3 mg / dl); egfr 24 ml / min/1.73 m), anemia was treated to a target of <6.8 mmol / l (11 g / dl) (she required no transfusions), and serum phosphorous was consistently less than1.94 mmol / l (6 mg / dl). Each episode was in the context of a presumed vasovagal / pre - syncopal episode . One episode occurred during a hot shower . Upon getting out of the shower, she developed vertigo and ataxia and fell to the floor . Clonidine was discontinued and furosemide was decreased by half the dose to 20 mg twice a day . Atenolol was changed to extended release metoprolol 25 mg and amitriptyline 10 mg nightly was prescribed . A few weeks later the patient noticed a subtle numbness in her left hand and leg . She preferred receiving the epoetin alpha injection in her left thigh because she noticed that it hurt less . Two days prior to readmission, her father stepped on her foot and it did not hurt! On the day of readmission, she developed facial numbness i felt like i was at the dentist and somebody gave me novocain. Her left arm felt heavy and clumsy . She presented to her primary medical doctor who referred her to the er . On physical examination, bp was 126/75 mmhg . She had new left - sided arm weakness with numbness to light touch as well as decreased sensation to pin and temperature on the left side of the face . Although in the past we had been reluctant to use iodinated contrast, in the setting of a new focal deficit, a conventional angiogram of the central nervous system (cns) with iodinated contrast was performed . Figure 4. (a) cns angiogram shows an early time point of the study highlighting a tightly stenosed terminal right internal carotid artery (white arrow) with collateral lenticulostriate vessels (black arrow). (b) later time point of study with asterisk indicating puff of smoke appearance because of the collateral flow through the numerous lenticulostriate vessels . (a) cns angiogram shows an early time point of the study highlighting a tightly stenosed terminal right internal carotid artery (white arrow) with collateral lenticulostriate vessels (black arrow). (b) later time point of study with asterisk indicating puff of smoke appearance because of the collateral flow through the numerous lenticulostriate vessels . Upon the diagnosis of moyamoya, aggressive bp control for a target below the 50th percentile was recognized as potentially detrimental and contributory to her neurological symptoms . She recovered left - sided strength within 24 h. the target bp was revised to maintain a goal between the 50th and 95th percentile (she remained on lisinopril 10 mg twice daily, amlodipine 10 mg daily, metoprolol er 25 mg daily and furosemide 20 mg twice daily). Two weeks after the angiogram identified moyamoya, she underwent a right - sided encephaloduroarteriosynangiosis (edas) with pial synangiosis revascularization . Bp targets remain above the 50th percentile and the calcium - channel blocker and beta - blocker have been discontinued . Paracetamol (acetaminophen) was taken, but offered no relief . Over the next 4 she was taken to a local hospital and was noted to have a focal seizure with left facial and hand twitching which stopped with intravenous lorazepam . After stabilization she was transferred by air to a tertiary care center . Upon arrival she was admitted to the pediatric intensive care unit . She was immediately placed on an intravenous infusion of nicardipine at 0.5 g / kg / min without a bolus dose . An intra - arterial bp catheter was placed to allow titration of the nicardipine infusion . The target bp for the first 8 h was to maintain above 171/105 mmhg (<25% reduction in maximum bp for both systolic and diastolic) to prevent a precipitous drop and avoid inducing irreversible neurological damage . Past medical history was significant for grade iii vesicoureteral reflux (vur) diagnosed at age 12 after ct scan for appendicitis identified acute appendicitis and scarring of the upper poles of both kidneys . She had been seen in an outpatient pediatric nephrology clinic 9 months prior to this presentation . Systolic bp at that time was 120 mmhg; hgb 75.1 mmol / l (12.1 g / dl); serum creatinine was 79.6 mol / l (0.9 mg / dl) [egfr 78 ml / min/1.73 m]; urinalysis with 3 + protein, without hematuria . Current laboratory studies showed a serum creatinine of 415.5 mol / l (4.7 mg / dl). Urinalysis showed 3 + protein and 3 + blood without red blood cells or casts on microscopy . Magnetic resonance imaging (mri)/magnetic resonance angiography (mra) without contrast showed abnormal t2/flair signal in the cortical and subcortical regions of the right parietal temporal lobe and basal ganglia consistent with either subacute infarction in the right mca territory without diffusion restriction or an atypical presentation of posterior reversible encephalopathy syndrome (pres) (figure 1a and b). Renal ultrasound showed small echogenic kidneys bilaterally (right 6.9 cm; left 7.8 cm) with cortical scarring and loss of corticomedullary differentiation . Ultrasound was felt to be consistent with and supported vur nephropathy as the cause of the hypertensive renal failure . Figure 1. (a) mri without contrast enhancement flair signal showing hyperintensity in the right parietal lobe (white arrow), head of caudate nucleus (asterisk) and adjacent white matter . (b) sequential image of series showing hyperintensity in the temporal lobe (short arrow), putamen (double asterisks) and right parietal lobe (long arrow). Figure 2.mra without contrast enhancement using time - of - flight technique shows diminished flow in right mca m1 (white arrow) and bilateral aca a1 segments (black arrows). Mra, magnetic resonance angiography; mca, middle cerebral artery; aca, anterior cerebral artery . (a) mri without contrast enhancement flair signal showing hyperintensity in the right parietal lobe (white arrow), head of caudate nucleus (asterisk) and adjacent white matter . (b) sequential image of series showing hyperintensity in the temporal lobe (short arrow), putamen (double asterisks) and right parietal lobe (long arrow). Mra without contrast enhancement using time - of - flight technique shows diminished flow in right mca m1 (white arrow) and bilateral aca a1 segments (black arrows). Mra, magnetic resonance angiography; mca, middle cerebral artery; aca, anterior cerebral artery . Over the next 96 h intravenous nicardipine (dose range of 210 g / kg / min) and furosemide (0.1 mg / kg / h) were infused in an attempt to normalize bp to less than the 90th percentile for height (126/81 mmhg) (figure 3). Her mental and neurological status returned to baseline without appreciable deficits and she was extubated . Over a 2-week hospital course she was transitioned to oral antihypertensive agents including amlodipine 5 mg twice daily, atenolol 50 mg daily, clonidine 0.1 mg twice daily, lisinopril 2.5 mg twice daily and furosemide 40 mg twice daily (figure 3). Evaluation for autoimmune disease and vasculitis included ana, anca, anti - gbm antibodies all were negative . Repeat mri / mra without contrast showed near complete resolution of previously seen t2/flair hyperintensities although there was no flow in the right m1 and a1 segment . Even with this persistent mra abnormality, her rapid return to normal without neurological deficit and near - complete resolution of flair signal abnormalities was thought to be most consistent with pres . Furthermore, kidney function remained compromised (creatinine peaked at 645.3 mol / l [7.3 mg / dl]; egfr 10 ml / min/1.73 m), and therefore we were reluctant to proceed with a conventional angiogram as it was likely to result in the need for dialysis due to contrast nephropathy . She was discharged home on four antihypertensive agents and furosemide for a target bp at the 50th percentile for height with close follow up . Figure 3.graphical representation of patient's blood pressure, target ranges and medications prescribed during initial hospitalization . Graphical representation of patient's blood pressure, target ranges and medications prescribed during initial hospitalization . Over a 6-month period she remained on three or four antihypertensive medications which were adjusted to target a bp below 112/66 mmhg (50th percentile for height). In addition, she was started on epoetin alpha 2000 units weekly, calcitriol 0.25 g daily, sodium bicarbonate 1300 mg twice daily and calcium acetate 667 mg tab with food for chronic kidney disease (ckd) management . Kidney function improved (creatinine declined to 265.2 mol / l (3 mg / dl); egfr 24 ml / min/1.73 m), anemia was treated to a target of <6.8 mmol / l (11 g / dl) (she required no transfusions), and serum phosphorous was consistently less than1.94 mmol / l (6 mg / dl). Each episode was in the context of a presumed vasovagal / pre - syncopal episode . One episode occurred during a hot shower . Upon getting out of the shower, she developed vertigo and ataxia and fell to the floor . Clonidine was discontinued and furosemide was decreased by half the dose to 20 mg twice a day . Atenolol was changed to extended release metoprolol 25 mg and amitriptyline 10 mg nightly was prescribed . A few weeks later the patient noticed a subtle numbness in her left hand and leg . She preferred receiving the epoetin alpha injection in her left thigh because she noticed that it hurt less . Two days prior to readmission, her father stepped on her foot and it did not hurt! On the day of readmission, she developed facial numbness i felt like i was at the dentist and somebody gave me novocain. Her left arm felt heavy and clumsy . She presented to her primary medical doctor who referred her to the er . On physical examination, bp was 126/75 mmhg . She had new left - sided arm weakness with numbness to light touch as well as decreased sensation to pin and temperature on the left side of the face . Although in the past we had been reluctant to use iodinated contrast, in the setting of a new focal deficit, a conventional angiogram of the central nervous system (cns) with iodinated contrast was performed . Figure 4. (a) cns angiogram shows an early time point of the study highlighting a tightly stenosed terminal right internal carotid artery (white arrow) with collateral lenticulostriate vessels (black arrow). (b) later time point of study with asterisk indicating puff of smoke appearance because of the collateral flow through the numerous lenticulostriate vessels . (a) cns angiogram shows an early time point of the study highlighting a tightly stenosed terminal right internal carotid artery (white arrow) with collateral lenticulostriate vessels (black arrow). (b) later time point of study with asterisk indicating puff of smoke appearance because of the collateral flow through the numerous lenticulostriate vessels . Upon the diagnosis of moyamoya, aggressive bp control for a target below the 50th percentile was recognized as potentially detrimental and contributory to her neurological symptoms . She recovered left - sided strength within 24 h. the target bp was revised to maintain a goal between the 50th and 95th percentile (she remained on lisinopril 10 mg twice daily, amlodipine 10 mg daily, metoprolol er 25 mg daily and furosemide 20 mg twice daily). Two weeks after the angiogram identified moyamoya, she underwent a right - sided encephaloduroarteriosynangiosis (edas) with pial synangiosis revascularization . Bp targets remain above the 50th percentile and the calcium - channel blocker and beta - blocker have been discontinued . Hypertensive crises are caused by severe hypertension and can be divided into two categories: emergent or urgent . Hypertensive emergencies are occurring when there is evidence of evolving injury to the cardiovascular system (heart failure, pulmonary edema), kidneys (renal failure) or cns (seizures, altered mental status, transient ischemia, stroke) due to endothelial damage from shear stress . Hypertensive urgency is defined as the presence of severe hypertension with no acute end - organ damage . This is in stark contrast to adult medicine where it is reported that of the 27% of the adult population affected by hypertension, 1% of these patients will at some point develop a hypertensive crisis . Furthermore, 25% of all adult patient visits to the er are related to hypertension and in one - third of these cases a hypertensive emergency is occurring . In pediatrics, the causes of hypertension and hypertensive crisis vary by age although after the age of 6 years, primary hypertension is the most common cause . However, severe pediatric hypertension, which is commonly defined as a level 20 mmhg above the 95th percentile for height is most often secondary . Renal disease is the most common cause of secondary hypertension and hypertensive crises . In our patient, it was presumed that the presentation of hypertensive encephalopathy was due to renal failure from reflux nephropathy . Reflux nephropathy is a recognized cause of both renal failure and hypertensive renal crisis in adolescent patients . Although our patient's renal failure was precipitous, hypertension is a major risk for progression of ckd and we believed that the hypertensive crisis further accelerated the progression . A kidney biopsy was not performed because it was felt that the renal ultrasound was consistent with chronic vur and therefore was unlikely to change management; while at the same time there would be a high likelihood of bleeding complications due to the uncontrolled hypertension and renal failure during biopsy . She was placed on an intensive bp regime with twice daily monitoring and target bps at or below the 50th percentile based upon favorable outcomes from the effect of strict blood pressure control and ace inhibition on the progression of crf in pediatric patients (escape) trial group ., it was appreciated that the episodes of altered mental status were ischemic in nature and not vasovagal . The aggressive bp control in an attempt to slow progression of ckd and avoid dialysis actually induced transient cns ischemia moyamoya is an occlusive disease of the cerebral vasculature involving the internal carotid arteries with the development of collateral circulation from the leptomeninges and branches of the external carotid . The collateral circulation has the appearance of a puff of smokethe translation for the japanese word moyamoya. Although pediatric moyamoya has been associated with severe hypertension [710], we believe that this case is the first to present as a hypertensive emergency with renal failure and highlights this disease for consideration in the differential diagnosis of hypertensive renal failure (table 1). Table 1.differential diagnosis of severe hypertension and renal failureglomerulonephritis acute post - streptococcal glomerulonephritis lupus nephritis ig a nephropathy with nephritic presentation pauci - immune crescentic glomerulonephritis (see vasculitis below) membranoproliferative glomerulonephritis anti - glomerular basement membrane antibody diseasevasculitis granulomatosis with polyangiitis microscopic polyangiitis churg - strauss polyarteritis nodosaend - stage renal disease vur nephropathy, puv / cakut, nephronophthisishemolytic uremic syndromescleroderma renal crisismoyamoyavur, vesicoureteral reflux; puv, posterior urethral valves; cakut, congenital anomalies of the kidney and urinary tract . Differential diagnosis of severe hypertension and renal failure vur, vesicoureteral reflux; puv, posterior urethral valves; cakut, congenital anomalies of the kidney and urinary tract . There are two possible mechanisms of hypertension related to moyamoya disease: (i) systemic compensation due to cerebral hypoperfusion or (ii) fibromuscular dysplasia of the renal arteries with resultant renovascular hypertension . The occlusive vasculopathy of moyamoya can be systemic and affect the vasculature of a number of organ systems . Renal artery stenosis (ras) occurs in 7% of the japanese population with moyamoya . However, children are disproportionately affected (a breakdown shows that 45% were children) [8, 11, 12]. In a more heterogeneous population, 20% of children with moyamoya also had ras according to a study from great ormond street hospital . A renal angiogram was performed at the time of the cns study (figure 5). No evidence of ras was found, although there was pruning of the distal arteries consistent with chronic kidney disease. Therefore, it seems that in our patient the hypertension was due to compensation from cerebral hypoperfusion . This is again unique as all previous cases of renal failure associated with moyamoya have documented ras . We appreciate that the occlusive vasculopathy of moyamoya can involve small arteries and therefore cannot entirely ascribe the findings of the angiogram to ckd with absolute certainty . Therefore, we support that in the setting of hypertension and moyamoya disease, evaluation of the renal vasculature with imaging and plasma renin levels should be performed and a strong suspicion for ras should be maintained . This technique involves placement of vascularized tissue supplied by the external carotid artery (which is not typically affected by moyamoya) in direct contact with the brain . This then leads to in - growth of new blood vessels vascularizing the underlying ischemic area . The greatest risk for stroke after revascularization is within the first 30 days (reportedly 4% per hemisphere). However, thereafter the probability of being stroke - free at 5 years is 96% [6, 14, 15]. Since surgery we have been able to wean antihypertensive agents, a phenomenon which has been previously described ., this case highlights that moyamoya must be considered in the differential diagnosis of patients presenting with hypertensive emergency and renal failure . Although ckd is a major risk factor of hypertensive emergencies with reports indicating that 79% of adult patients have ckd stage 2 or greater, there are a number of causes that must be considered (table 1). However, the long - term management of ckd with aggressive bp control induced transient ischemia because of moyamoya . Recognition of moyamoya led to surgical revascularization and has changed our medical management to accept higher blood pressures up to the 90th percentile.
Secundum type atrial septal defect (asd) is one of the most common congenital heart defects that occur in adults.1) in the past, asd was closed surgically . Percutaneous device closure of asd has been developed as an alternative treatment to surgery.2) the first percutaneous device closure of asd was performed in 1974.3) percutaneous device closure has several advantages over surgery, including less surgical morbidity, avoidance of a scar and reduced hospitalization duration.4) however, this method of closure is associated with rare early and late complications . We report a rare complication of silent and late device embolization of the asd occluder device into the right pulmonary artery, three months after implantation . A 16 year - old patient presented with dyspnea . Clinical examination revealed normal vital parameters with a fixed split second heart sound and a 2/6 systolic ejection murmur heard best at the left upper sternal border . The patient was initially evaluated by transthoracic echocardiography (tte) and had a typical ostium secundum type asd . Transesophageal echocardiography (tee) confirmed the presence of a moderately large sized secundum asd that measured 20 mm . The aortic rim was almost absent (2 - 3 mm) with other surrounding rims> 7 mm (not thin). The length of the interatrial septum was 45 mm in the longitudinal plane and 48 mm in the shortaxis view . The 30 mm sizing balloon was positioned across the defect and measured by both quantitative angiography and tee at 21 mm . A 24-mm asd septal occluder device (occlutech figulla asd occluder n, international occlutech ab, helsingborg, sweden) was deployed with fluoroscopic and transesophageal echocardiographic guidance . Before releasing the device, fluoroscopy and the " minnesota tug technique " cessation of flow across the interatrial septum was confirmed on tee prior to final deployment of device . Tte was performed 24 hours, seven days and one month after the implantation and confirmed adequate device position with no significant residual shunting . At the third month physical examination, a fixed split second heart sound and a systolic ejection murmur chest roentgenogram showed the asd closure device in the area of the right pulmonary artery (fig . Echocardiography showed device migration into the right pulmonary artery without any significant obstruction to forward flow into the right pulmonary artery (fig . When the patient was interviewed again, he had complained of mild chest discomfort for a short duration during lifting of a heavy object fifteen days prior to being seen . Right ventriculography and fluoroscopy also showed embolization of the device into the right pulmonary artery (fig . 3). Percutaneous removal of the device was not considered because of the position of the device in the right pulmonary artery . The patient was referred for surgical retrieval of the device and closure of the defect, and underwent median sternotomy under general anesthesia, while cardiopulmonary bypass was performed by aorta - bicaval cannulation . Asd closure device was removed out of the right pulmonary artery through arteriotomy performed on the main pulmonary artery, and secundum type asd primary closure operation was performed through the right atriotomy . Following surgical retrieval, the device was macroscopically intact (fig . There were no problems in the postoperative follow - ups; additionally there was no leakage from atrial septum in the follow - up echocardiography . Surgical closure of an asd is the gold standard treatment regardless of the size and number of defects present in any clinical case.2)5) percutaneous transcatheter closure of asd is an established alternative treatment to surgical closure as it has lesser morbidity, shorter hospital stay, lack of a scar, and comparable rates of complications.4 - 6) however, percutaneous device closure is associated with rare early and late complications such as migration or embolization of the device, pericardial effusion, arrhythmias, thrombus formation on the device, and mitral regurgitation and vascular injury.4)7)8) the most frequent complication of percutaneous transcatheter closure of asd is device embolization with incidence ranging from 4% to 21%.9) embolization usually occurs within 24 hours and after that, it is rarely seen . Factors relating to device embolization are associated with the type of device used, larger size of defect, thin rim of atrial tissue, mobility of device postimplantation, use of undersized device and deficiency or absence of aortic rim.2)4)7)8) the aortic rim is very important and a margin <5 mm may predispose to both early and late device embolization.2) our patient had a moderately large secundum asd and very small aortic rim (2 - 3 mm), the combination of which may have resulted in embolization of the device at a late period . Another potential cause of late device embolism is acute change in intracardiac pressure due to physical strain . A sudden increase in afterload to the left heart in conjunction with diminished right heart filling (valsalva) may have favored the migration of the device to the right and subsequently to the pulmonary artery.10) ten weeks after the procedure, when the patient was lifting a heavy object, he had complained of mild chest discomfort for a short duration of time . The history of our patient suggests that an acute change in intracardiac pressure due to physical strain may have dislodged the device . Therefore, we believed that both physical strain and small aortic rim were possible causes for device embolism in our patent . We routinely advise to avoid heavy lifting for 3 months in all asd patients who are treated with percutaneous device closure . Stricter and longer duration of avoidance of heavy lifting should have been recommended for patients with increased risk of device embolism, as in our case . Mashman et al.10) also recommended 6 months of avoidance from strenuous exercise for decreasing embolic risk . Devices usually embolize in the main pulmonary artery.7) if the device embolizes to the pulmonary circulation and impedes pulmonary flow, it may lead to both acute volume and pressure overload of the right ventricular . According to the degree of pulmonary flow impairment, constitutional symptoms usually developed.2) in our patient, it was embolized to the right pulmonary artery . It is fortunate that the device position in the right pulmonary artery was in the longitudinal axis in our patient . Because the pulmonary flow was not influenced by the embolized device, our patient was asymptomatic . If the device is embolized, percutaneous or surgical removal of the device is indicated.7) in our case, percutaneous treatment was not considered because of the orientation of the device in the right pulmonary artery, which precluded snaring the device and the chronicity of the implantation . Device embolism, which is the most frequent complication of percutaneous transcatheter closure of asd, may also occur during late periods of post - implantation . In addition, longer duration of avoidance from physical straining must be recommended for patients who have high risk of device embolization.
Small cell carcinoma of the bladder is a very rare and aggressive histological subtype, and accounts for less than 1% of all bladder tumors.its management is challenging because it presents in the same way of other more frequent histological types, but with a high metastatic power . The diagnosis demands that the pathologist be suspicious and accurate in the analysis of the fragments of a transurethral bladder resection (tur). Multimodal treatment, including radical cystectomy, chemotherapy and radiation therapy should be initiated as soon as possible for a chance of cure and to improve survival . This kind of carcinoma presents metastasis and has a poor prognosis . In the present article we report a case of a male patient with small cell carcinoma of the bladder and the development of the condition, and we aim to show the most current management of this tumor, which has no consensus for treatment in the international literature for being extremely rare . Patient jhc, male, 61 years old, came to the medical service with a complaint of hematuria and hypogastric pain for one year . The urinary tract ultrasound revealed an intravesical tumor, and he was submitted to bladder tur, with a conclusive report for small cell carcinoma of the bladder . Faced with the diagnosis, the attending team chose to perform chemotherapy (received four sessions of cisplatin, gemcitabine and paclitaxel) (figure 1). Figure 1field with the presence of multiple mitoses, salt - and - pepper nuclei when referred to our service, he was submitted to thorax and abdomen computerized tomography (ct) that showed a 6.2x6.0x5.5 cm neoplasm on the left anterolateral wall of the bladder, suggesting invasion of the prostatic urethra . The patent was then submitted to radical cystectomy, with a bricker ileal derivation procedure, performed uneventfully, lasting 5 hours, with no need for blood transfusion . It is important to underscore that the time between the last chemotherapy and surgery was 2 months . The pathology report of the surgical specimen proved small cell carcinoma of the bladder with extravesical extension, perineural and vascular infiltration, and one lymph node affected (left obturator) out of 16 dissected . The patient had pneumonia, was on antibiotics and was discharged 29 days after surgery . He was referred to oncology to discuss adjuvant therapy which was not initiated, because the patient died 4 months after surgery due to pulmonary thromboembolism (figure 2). The first report of small cell carcinoma of the bladder was made in 1981 by cramer et al . Since then, approximately 600 cases were registered in the international literature . It is characterized by its high aggressiveness and poor prognosis, and by the development of metastic disease in about 67% of patients . The small cell carcinoma of the bladder usually affects individuals of the same age, sex and presents the same symptoms and morphology of urothelial carcinoma . That is why it is a diagnostic challenge, depending only on the skills of the pathologist to differentiate it from urothelial carcinoma, which beside the factors already mentioned, has the same radiological aspect of small cell carcinoma of the bladder . Thus, recommendations are based on retrospective studies, reports of individual cases, and protocols for small cell lung carcinoma . Frequently, it presents with mixed histology.molecular studies show a common origin for small cell carcinoma of the bladder and urothelial carcinoma, when coexisting . However, management should be different, since it frequently presents metastases and has a poor prognosis . The pathological diagnosis of this kind of tumor is challenging and requires that the pathologist use immunohistochemical techniques for histological confirmation . As they are histologically identical, the world health organization standardization for small cell lung carcinoma is used . It comprises the following criteria for diagnosis of small cell carcinoma of the bladder: presence of group of small cells with scarce cytoplasm, few organelles, salt and pepper chromatin and high rate of mitoses (> 10 mitoses/10 high power fields). On immunohistochemistry, these tumors express quite an amount of neurospecific enolase, chromogranin, synaptophysin and n - cam (cd-56). The presence of one or more markers allows to establish the diagnosis of neuroendocrine tumor . Pathological staging is based on the consensus for urothelial carcinoma of the bladder (figure 3). Figure 3marker cd-56 that characterizes neuroendocrine tumors isolated therapies whether tur, partial cystectomy or radiation therapy radical cystectomy is considered the best method to eliminate small cell carcinoma of the bladder completely, but it alone is believed to only change survival in stage i and ii tumors . Reviewed 64 cases and concluded that in patients submitted to radical surgery compared to those treated with combined treatment (whether only chemotherapy or radiation therapy or both as adjuvant), there was no increase in survival . In contrast, chemotherapy adjuvant to radical cystectomy resulted in a favorable prognosis in other studies, including meta - analyses . Another alternative is neoadjuvant chemotherapy, recommended by the md anderson cancer center, which reported a 5-year disease free survival in 36% of the group submitted to radical cystectomy alone and of 78% in the group submitted to chemotherapy neoadjuvant to surgery . On the other hand, a canadian group reported ten patients with pt3-t4, n0 lesions with chemotherapy, attaining complete remission in nine of them . The 2-year survival rate for this group was 70% and, 44% in 5 years . Another similar series reported four patients treated with chemotherapy followed by radiation therapy who survived 27 to 60 months . The advantage of this treatment is sparing the organ . Therefore, it is a less invasive treatment when compared to radical surgery, which is related to important rates of morbidity and mortality . Patients with metastatic disease should receive systematic chemotherapy, and the most common treatment regimens are platinum - based (cisplatin and etoposide, carboplatin, etoposide and cyclophosphamide) (figure 2). Given the extremely aggressive and rare disease, little is known about pathogenesis and molecular biology . Data on the ideal approach for this kind of tumor are scarce, showing the importance of reporting such cases and, in this way, defining the best diagnostic and treatment methods . O carcinoma de clulas pequenas da bexiga um subtipo histolgico muito raro e agressivo, correspondendo a menos de 1% de todos os tumores de bexiga.sua abordagem torna - se desafiadora, pois se apresenta da mesma forma que outros tipos histolgicos mais frequentes, porm com alto poder metasttico . O diagnstico exige suspeio e preciso do patologista na anlise dos fragmentos de resseco transuretral (rtu) de bexiga . O rpido tratamento multimodal, incluindo cistectomia radical, quimioterapia e radioterapia, deve ser institudo o mais precocemente possvel, para haver chance de cura e melhora da sobrevida.esse tipo de carcinoma apresenta metstase e tem prognstico ruim . Neste artigo, relatamos o caso de um paciente do sexo masculino com carcinoma de clulas pequenas de bexiga e sua evoluo, assim como buscamos trazer o que h de mais atual no manejo desse tumor que, por sua extrema raridade, no apresenta consenso para o tratamento na literatura mundial . Paciente jhc, masculino, 61 anos de idade, procurou servio mdico com queixa de hematria e dor hipogstrica h um ano . Evidenciada tumorao intravesical em ultrassonografia do aparelho urinrio, foi submetido a rtu de bexiga, cujo laudo foi conclusivo para carcinoma de clulas pequenas de bexiga . Frente a esse diagnstico, a equipe que o acompanhava optou por realizar quimioterapia (recebeu quatro sesses de cisplatina, gencitabina e paclitaxel) (figura 1). Figura 1presena de mltiplas mitoses no campo, ncleos em sal e pimenta ao ser encaminhado ao nosso servio, foi submetido tomografia (tc) de trax e abdome, a qual mostrou neoplasia de 6,2x6,0x5,5 cm em parede anterolateral esquerda da bexiga, com sugestiva invaso de uretra prosttica . Foi, ento, submetido cistectomia radical, com derivao ileal bricker, procedimento realizado sem intercorrncias, com durao total de 5 horas, sem necessidade de transfuso sangunea . Importante ressaltar que o tempo da ltima quimioterapia para a cirurgia foi de 2 meses . O laudo anatomopatolgico da pea cirrgica comprovou carcinoma de clulas pequenas de bexiga com extenso extravesical, infiltrao perineural e vascular presentes, comprometimento de um linfonodo (obturatrio esquerdo) em 16 dissecados . No ps - operatrio apresentou pneumonia, sendo submetido a antibioticoterapia e recebendo alta hospitalar 29 dias aps a cirurgia . Foi encaminhado oncologia para discusso de tratamento adjuvante, que no foi iniciado, pois o paciente faleceu 4 meses aps a cirurgia devido a tromboembolismo pulmonar (figura 2). O primeiro relato de carcinoma de clulas pequenas de bexiga foi feito em 1981 por cramer et al . Desde ento, foram registrados aproximadamente 600 casos na literatura mundial. Caracterizado por sua alta agressividade e mau prognstico, bem como pelo desenvolvimento de doena metasttica em cerca de 67% dos pacientes . O carcinoma de clulas pequenas da bexiga urinria costuma atingir pessoas da mesma idade, sexo e apresentar os mesmos sintomas e morfologia do carcinoma urotelial . Por isso, um desafio diagnstico, dependendo apenas da habilidade do patologista em diferenci - lo de carcinoma urotelial, que, alm dos fatores j citados, apresenta o mesmo aspecto radiolgico do carcinoma de clulas pequenas de bexiga . Assim, recomendaes so baseadas em estudos retrospectivos, relatos de caso individuais e protocolos para carcinoma de clulas pequenas de pulmo . Frequentemente, apresenta - se com histologia mista.estudos moleculares mostram origem comum entre o carcinoma de clulas pequenas de bexiga e o carcinoma urotelial, quando coexistentes . No entanto, seu manejo deve ser diferente, pois, frequentemente, apresenta metstases e tem prognstico ruim . O diagnstico anatomopatolgico desse tipo de tumor desafiador e exige do patologista o uso de tcnicas de imuno - histoqumica para a confirmao histolgica . Como so histologicamente idnticos, no diagnstico de carcinoma de clulas pequenas de bexiga utilizada a padronizao da organizao mundial da sade para carcinoma de clulas pequenas de pulmo, composta dos seguintes critrios: presena de grupos de clulas pequenas com citoplasma escasso, poucas organelas, cromatina em sal e pimenta, e alta taxa de mitoses (> 10 mitoses/10 campos de alto poder). Na imuno - histoqumica, esses tumores expressam muita enolase neuroespecfica, cromogranina, sinaptofisina e n - cam (cd-56). O estadiamento patolgico feito com base no consenso para carcinoma urotelial de bexiga (figura 3). Figura 3marcador cd-56, que caracteriza tumores neuroendcrinos terapias isoladas seja a rtu, a cistectomia parcial ou a radioterapia apresentam benefcio apenas em casos especiais de doena em estgio inicial . Cistectomia radical considerada o melhor mtodo para remover o carcinoma de clulas pequenas de bexiga completamente, mas acredita - se que ela sozinha s altera a sobrevida em tumores de estgios i e ii.cheng et al . Revisaram 64 casos e concluram que, em pacientes submetidos cirurgia radical comparados queles tratados com terapia combinada (seja apenas quimioterapia e radioterapia ou ambas em adjuvncia), no houve aumento da sobrevida.em contrapartida, quimioterapia adjuvante cistectomia radical resultou em prognstico favorvel em outros estudos, incluindo meta - anlises . Outra alternativa a quimioterapia neoadjuvante, recomendada pelomdanderson cancer center, o qual relatou sobrevida de 5 anos sem doena em 36% do grupo submetido cistectomia radical isoladamente e de 78% no grupo submetido quimioterapia neoadjuvante cirurgia.de maneira semelhante, a radioterapia neoadjuvante tambm mostrou - se eficiente . Por outro lado, um grupo canadense tratou dez pacientes com leses pt3-t4, n0 com quimioradioterapia, obtendo remisso completa em nove deles . A taxa de sobrevida desse grupo no perodo de 2 anos foi de 70% e, em 5 anos, de 44%.outra srie na mesma linha relatou quatro pacientes tratados com quimioterapia seguida de radioterapia que sobreviveram de 27 a 60 meses . A vantagem desse tratamento a preservao do rgo . Portanto, trata - se de terapia menos invasiva quando comparada cirurgia radical, a qual est relacionada a importantes taxas de morbidade e mortalidade . Pacientes com doena metasttica devem receber quimioterapia sistemtica, sendo os esquemas teraputicos mais comuns os baseados em platina (cisplatina e etoposida, carboplatina, etoposida e ciclofosfamida) (figura 2). Por se tratar de doena extremamente agressiva e rara, pouco se conhece da patognese e da biologia molecular . H escassez de dados para abordagem ideal desse tipo de tumor, mostrando a importncia de relatar tais casos e, desta forma, definir melhor os mtodos de diagnstico e tratamento.
Endoscopic sphincterotomy (est) is the standard method for enlarging the bile duct opening in the duodenum before stone removal during endoscopic retrograde cholangiopancreatography (ercp). Therefore, subsequent duodenobiliary reflux can occur with bacterial contamination and chronic inflammation of the biliary system, which can lead to long - term problems . Recently, endoscopic sphincterotomy plus large balloon dilation (eslbd) has been reported for treating large common bile duct (cbd) stones . Endoscopic papillary balloon dilation (epbd) is another alternative technique to enlarge the papillary orifice for stone retrieval, with the potential advantage of biliary sphincter function preservation . However, epbd might carry an increased risk of pancreatitis due to edema and/or spasm from dilation trauma [35]. Some previous reports indicated that eslbd reduced the need for mechanical lithotripsy (ml) in large cbd stone extraction, while others did not report any difference . Furthermore, a number of studies, along with a meta - analysis on est vs. epbd, suggested that they were not significantly different in terms of stone clearance rates, while other studies indicated a significantly higher stone clearance rate in the est group . Other published studies and a meta - analysis of 3 randomized controlled trials (rcts) on est vs. eslbd showed that there was no significant difference between est and eslbd in terms of stone clearance rates . The present preliminary study is the first to compare the advantages and disadvantages of these 3 methods (est, endoscopic papillary large balloon dilatation (eplbd), and eslbd), being the first to do so . Therefore, we carried out this preliminary randomized trial to evaluate the benefits and risks of est, eplbd, and eslbd for the extraction of cbd stones . Furthermore, the surgical efficacy, postprocedural safety, and economic factors were compared . The results of this study could provide the basis for large - scale multicenter clinical trials . This was a prospective randomized study conducted in nanfang hospital between july 2011 and december 2013 . The inclusion criteria were: 1) patients aged 18 years and 2) cbd stones confirmed by cholangiogram (10 mm in maximum diameter). The exclusion criteria were: 1) septic shock; 2) acute pancreatitis; 3) coagulopathy (international normalized ratio of> 1.5, partial thromboplastin time greater than twice that of control); 4) platelet count of <50,00010/l; 5) prior sphincterotomy or dilation; 6) biliary strictures; 7) billroth - ii or roux - en - y anatomy; 8) concomitant pancreatic or biliary malignancies; 9) pregnancy; 10) requirement of precut sphincterotomy for bile duct access; or 11) inability to give informed consent . The moderate sedation used for the procedure consisted of a combination of meperidine and diazepam along with anisodamine, as needed for duodenal relaxation . Ercps were performed by experienced endoscopists (n=5) using side - viewing endoscopes (jf-260 or tjf-260; olympus optical co. ltd ., selective cannulation of the bile duct was attempted using a 20-mm cut wire sphincterotome (boston scientific, natick, ma) with a 0.035 guide wire (boston scientific, natick, ma). Patients were randomized using a computer - generated random number table (prepared by a statistician) into the est, eplbd, or eslbd groups after bile duct access was achieved and a cholangiogram confirmed the presence of the cbd stones . The sizes of the stones were estimated based on the size of the duodenoscope mirror body diameter (12 mm). For the est group, sphincterotomy was performed with a 20 mm cut - wire sphincterotome (boston scientific, natick, ma). The length of the incision was decided by the endoscopist according to the size of the stones . The erbe generator (icc 200; erbe, tubingen, germany) with a blended current was also used . For the eplbd group, dilation of the sphincter was performed with a 5.5-cm wire - guided balloon dilation catheter (boston scientific, natick, ma or cook medical, limerick, ireland). The balloon was passed over a prepositioned guide wire and was centered at the sphincter . Under endoscopic and fluoroscopic control, the balloon was gradually inflated with diluted contrast agent until the complete disappearance of the balloon waist . The minimum and maximum diameters of the balloon were 10 and 15 mm, respectively . For the eslbd group, a limited sphincterotomy measuring up to one- to two - thirds of the papilla was first performed, followed by dilation . After the procedure, stones were removed by standard methods, including retrieval baskets (olympus co. ltd ., tokyo, japan) and extraction balloon (cook medical, limerick, ireland). An occlusion cholangiogram was obtained at the end of the ercp, followed by a nasobiliary drain (boston scientific, natick, ma or cook medical, limerick, ireland) insertion for drainage, which was performed in all patients to avoid bias . After ercp, patients were kept in the ward to be monitored for any complications . All patients were interviewed by phone 30 days after ercp in order to assess the potential complications . Secondary outcomes included cannulation time, procedural time, frequency of ml use, 30-day complications and mortality, and procedural cost . The cannulation time was calculated from the time of sphincterotome touching the papilla to a successful selective cannulation of the bile duct . The procedural time was the time from a successful selective cannulation of the bile duct up to the nasobiliary drain insertion . Complication assessment was based on the intent - to - treat principle and were defined and graded according to the cotton et al.s system . Post - ercp pancreatitis was defined as signs and symptoms of acute pancreatitis following ercp, with elevated levels of pancreatic enzymes . The differences between groups were compared using analysis of variance (one - way anova) for parametric data, kruskal - wallis test for nonparametric data, and fisher s exact or pearson chi - square tests for proportions and frequencies . The inclusion criteria were: 1) patients aged 18 years and 2) cbd stones confirmed by cholangiogram (10 mm in maximum diameter). The exclusion criteria were: 1) septic shock; 2) acute pancreatitis; 3) coagulopathy (international normalized ratio of> 1.5, partial thromboplastin time greater than twice that of control); 4) platelet count of <50,00010/l; 5) prior sphincterotomy or dilation; 6) biliary strictures; 7) billroth - ii or roux - en - y anatomy; 8) concomitant pancreatic or biliary malignancies; 9) pregnancy; 10) requirement of precut sphincterotomy for bile duct access; or 11) inability to give informed consent . The moderate sedation used for the procedure consisted of a combination of meperidine and diazepam along with anisodamine, as needed for duodenal relaxation . Ercps were performed by experienced endoscopists (n=5) using side - viewing endoscopes (jf-260 or tjf-260; olympus optical co. ltd ., selective cannulation of the bile duct was attempted using a 20-mm cut wire sphincterotome (boston scientific, natick, ma) with a 0.035 guide wire (boston scientific, natick, ma). Patients were randomized using a computer - generated random number table (prepared by a statistician) into the est, eplbd, or eslbd groups after bile duct access was achieved and a cholangiogram confirmed the presence of the cbd stones . The sizes of the stones were estimated based on the size of the duodenoscope mirror body diameter (12 mm). For the est group, sphincterotomy was performed with a 20 mm cut - wire sphincterotome (boston scientific, natick, ma). The length of the incision was decided by the endoscopist according to the size of the stones . The erbe generator (icc 200; erbe, tubingen, germany) with a blended current was also used . For the eplbd group, dilation of the sphincter was performed with a 5.5-cm wire - guided balloon dilation catheter (boston scientific, natick, ma or cook medical, limerick, ireland). The balloon was passed over a prepositioned guide wire and was centered at the sphincter . Under endoscopic and fluoroscopic control, the balloon was gradually inflated with diluted contrast agent until the complete disappearance of the balloon waist . The minimum and maximum diameters of the balloon were 10 and 15 mm, respectively . For the eslbd group, a limited sphincterotomy measuring up to one- to two - thirds of the papilla was first performed, followed by dilation . After the procedure, stones were removed by standard methods, including retrieval baskets (olympus co. ltd ., tokyo, japan) and extraction balloon (cook medical, limerick, ireland). An occlusion cholangiogram was obtained at the end of the ercp, followed by a nasobiliary drain (boston scientific, natick, ma or cook medical, limerick, ireland) insertion for drainage, which was performed in all patients to avoid bias . After ercp, patients were kept in the ward to be monitored for any complications . All patients were interviewed by phone 30 days after ercp in order to assess the potential complications . Secondary outcomes included cannulation time, procedural time, frequency of ml use, 30-day complications and mortality, and procedural cost . The cannulation time was calculated from the time of sphincterotome touching the papilla to a successful selective cannulation of the bile duct . The procedural time was the time from a successful selective cannulation of the bile duct up to the nasobiliary drain insertion . Complication assessment was based on the intent - to - treat principle and were defined and graded according to the cotton et al.s system . Post - ercp pancreatitis was defined as signs and symptoms of acute pancreatitis following ercp, with elevated levels of pancreatic enzymes . Data were analyzed using spss 13.0 for windows (spss inc ., chicago, il, usa). The differences between groups were compared using analysis of variance (one - way anova) for parametric data, kruskal - wallis test for nonparametric data, and fisher s exact or pearson chi - square tests for proportions and frequencies . From july 2011 to december 2013, 255 consecutive patients were enrolled in the study . Table 1 shows the patient demographics with no difference in baseline characteristics among the 3 groups, except that more patients who underwent eslbd had periampullary diverticulum . There were no differences in cannulation time, guide wire injection time into the pancreatic duct, and time to complete the procedure . A total of 92.9%, 91.8%, and 96.5% of the patients in the est, eplbd, and eslbd groups, respectively, had their stones cleared during the initial ercp (p=0.519). Ml was used in 9.4% (8/85), 14.1% (12/85), and 8.2% (7/85) of the patients in the est, eplbd, and eslbd groups (p=0.419), respectively . The procedural costs were also compared between the groups; the costs of eplbd were higher than est and lower than eslbd (p<0.001). Subgroup analysis was therefore undertaken with the patients classified according to the stone size and stone number . Table 3 shows the complications within 30 days after ercp; they occurred in 4.7%, 4.7%, and 5.9% of the patients in the est, eplbd, and eslbd groups (p=1.000), respectively . The proportion in severity was similar (p=0.693) with no significant difference in the rates of post - ercp pancreatitis, cholangitis, and bleeding among the groups . From july 2011 to december 2013, 255 consecutive patients were enrolled in the study . Table 1 shows the patient demographics with no difference in baseline characteristics among the 3 groups, except that more patients who underwent eslbd had periampullary diverticulum . There were no differences in cannulation time, guide wire injection time into the pancreatic duct, and time to complete the procedure . A total of 92.9%, 91.8%, and 96.5% of the patients in the est, eplbd, and eslbd groups, respectively, had their stones cleared during the initial ercp (p=0.519). Ml was used in 9.4% (8/85), 14.1% (12/85), and 8.2% (7/85) of the patients in the est, eplbd, and eslbd groups (p=0.419), respectively . The procedural costs were also compared between the groups; the costs of eplbd were higher than est and lower than eslbd (p<0.001). Subgroup analysis was therefore undertaken with the patients classified according to the stone size and stone number . The stone clearance rates and frequency of ml use were also similar among the groups . Table 3 shows the complications within 30 days after ercp; they occurred in 4.7%, 4.7%, and 5.9% of the patients in the est, eplbd, and eslbd groups (p=1.000), respectively . The proportion in severity was similar (p=0.693) with no significant difference in the rates of post - ercp pancreatitis, cholangitis, and bleeding among the groups . The aim of the present study was to evaluate the benefits and risks of est, eplbd, and eslbd for the extraction of cbd stones . The stone clearance rate was similar among the 3 groups, as well as the use of ml and the rate and severity of complications . The costs of eplbd were higher than est and lower than eslbd (p<0.001). The rates of the post - ercp pancreatitis, cholangitis, and bleeding were similar among all groups . A number of studies along with a meta - analysis on est vs. epbd have suggested that they were not significantly different in terms of stone clearance rates [4,5,1217], while other studies indicated a significant higher stone clearance rate in the est group . Published studies and a meta - analysis of 3 rcts on est vs. eslbd showed that there was no significant difference between est and esbd in terms of stone clearance rates [69,19]. The results of the present study further suggested similar stone clearance rates for est, eplbd, and eslbd . . Have indicated that there was no significant difference between est and epbd in stones larger than 1015 mm . Furthermore, heo et al . Confirmed the lack of significant difference between est and eslbd in stones larger than 15 mm . In the present study, est, eplbd and eslbd had similar stone clearance rates in stones 15 mm . Several studies and a meta - analysis on est vs. epbd have suggested that epbd resulted in a significantly higher frequency of ml use, while other reports indicated no significant difference . Some other studies and a meta - analysis of 3 rcts on est vs. eslbd have shown no significant difference between est and eslbd in terms of ml use [79,19]. However, the latest rct suggested a significantly higher frequency of ml use in the est group compared with that of the eslbd group . The results of the present study further showed that est, eplbd, and eslbd had similar ml use . This might have been caused by the low number of stones 15 mm in the present study (17.6% of est, 18.8% of eplbd, and 20.0% of eslbd). In a subgroup analysis, watanabe et al . Observed a significantly higher frequency of ml use in the epbd group compared with that of the est group in stones 10 mm . Showed a significantly higher frequency of ml use in the est group compared with the eslbd group in stones> 15 mm, while heo et al . Suggested no significant difference between est and eslbd in terms of ml use . In the present study, est, eplbd and eslbd had a similar frequency of ml use in stones 15 mm . A number of reports on est vs. epbd have indicated no significant differences in the overall complication rate and post - ercp pancreatitis in est and epbd [1214]. A meta - analysis have shown that est and epbd did not have a significant difference in their overall complication rates, but a significantly higher risk of post - ercp pancreatitis was reported for epbd . In addition, a multicenter study in the united states have suggested that epbd had a significantly higher risk of both overall complication rate and post - ercp pancreatitis along with 2 deaths due to pancreatitis following dilation and none with sphincterotomy . Previous studies and a meta - analysis of 3 randomized controlled trials (rcts) on est vs. eslbd reported the complication rates and post - ercp pancreatitis . Likewise, in the present study, est, eplbd, and eslbd had similar complication rate and post - ercp pancreatitis . This might have been due to the adequately enlarged papillary orifices and nasobiliary drains in all patients . On one hand, the proportion of stones 15 mm was low, which could have potentially resulted in a small sample size for the stones 15 mm . Increasing the sample size for the stones 15 mm might detect some differences among est, eplbd, and eslbd in terms of ml use . On the other hand, our study only assessed short - term complications, not long - term complications, which could be important to evaluate the safety of the techniques . This could be easily addressed by patient telephone follow - ups for the assessment of the complications . The present was powered as a superiority trial, and failed to observe differences between groups, but was underpowered to reach non - inferiority conclusions . Therefore, the results of the present study should be used as a basis to plan a multicenter non - inferiority randomized trial of these 3 approaches . In conclusion, est, eplbd, and eslbd might clear cbd stones with equal efficacy and safety . A larger sample size or a non - inferiority trial might be necessary to confirm these results.
Ten isoforms of voltage - gated na channels have been identified that vary in tissue distribution, structure, biophysical properties, and sensitivity to neurotoxins (table 1; chahine et al ., 2005). In standardized nomenclature, the nine confirmed members with> 50% common amino acid identity in the transmembrane and extracellular loop regions have been designated as nav1.1 through nav1.9 . The prefix nav indicates the chemical symbol of the principal permeating ion (na) with the principal physiological regulator (voltage; catterall et al ., 2003). The tenth isoform has not yet been fully identified because it has not been functionally expressed . However, this isoform plays an important role in the detection of body fluid na levels and the regulation of salt intake (watanabe et al ., at least eight of the mammalian subunits are expressed in the nervous system: nav1.1, nav1.2, nav1.3, and nav1.6 are widely expressed in the central nervous system (cns) while nav1.7, nav1.8, and nav1.9 are preferentially expressed in the peripheral nervous system (pns; black et al ., 1996). Gene location and distribution of na channels subunits in subpopulations of drg sensory neurons . * small- (<25 m) and large - diameter (> 30 m) drg neurons . Primary sensory neurons in the dorsal root ganglia (drg) give rise to afferent nerve fibers that convey information about thermal, mechanical, and chemical stimulations from peripheral tissues to the cns . These neurons express a unique combination of tetrodotoxin - sensitive (ttx - s) and tetrodotoxin - resistant (ttx - r) na currents that produce the rapid rising phase of action potentials . Much of what is currently known about the na channels expressed in sensory neurons is derived from electrophysiological studies of cultured drg neurons (cummins et al . Small - diameter drg neurons (<25 m) are the cell bodies of unmyelinated c - fiber nociceptors that preferentially express ttx - r na currents . This contrasts with the myelinated large - diameter (> 30 m) neurons typically associated with low - threshold a - fibers that predominately express ttx - s na currents . Primary sensory neurons express a variety of na channel isoforms that display properties similar to the endogenous ttx - s (nav1.1, nav1.2, nav1.6, nav1.7) and ttx - r (nav1.8, nav1.9) na currents observed in these neurons (black et al ., 1996; dib - hajj et al ., 1998; amaya et al ., 2000; ho and oleary, 2011). In vivo, most na channel subunits are associated with one or more auxiliary subunits (isom, 2002). Four distinct isoforms (1, 4) and two splice variants (1a, 1b) have been identified (table 2). They share a common structure (chahine et al ., 2005) consisting of a single membrane spanning domain, a small intracellular c - terminal domain, and a large extracellular n - terminal domain incorporating an immunoglobulin - like fold similar to that of cell adhesion molecules (figure 1; isom, 2001; yu et al ., 2003) they share an identical n - terminal domain but have a novel c - terminal domain resulting from intron retention (kazen - gillespie et al ., 2000; na channel subunits can be broadly classified based on sequence homology and molecular interactions with subunits . The 1, 1a b, and 3 subunits have similar amino acid sequences and form non - covalent interactions with subunits (isom et al ., 1992; this contrasts with the 2 and 4 subunits, which are best characterized as closely related (sharing 35% amino acid sequence), and which are covalently linked to subunits via a disulfide bridge (yu et al ., 2003). In vivo na channel subunits are believed to form heteromultimeric complexes consisting of one non - covalently associated (1, 3) and one covalently (2, 4) linked subunit (catterall et al . Depending on the composition of the subunit, these interactions have been shown to modulate the gating kinetics, voltage - dependence, and cell surface expression of the associated subunits (catterall, 2000). Subunits also function as adhesion molecules that interact with cytoskeleton proteins, the extracellular matrix, and other molecules that regulate cell migration and aggregation (yu and catterall, 2003; brackenbury et al ., 2008). Schematic representation of a typical subunit, consisting of an nh2-terminal (n) containing an ig loop and the 1a splice site, a cooh - terminal (c) and a transmembrane - spanning segment . Voltage - gated na channels are important determinants of sensory neuron excitability, and changes in the expression and gating properties of these channels have been implicated in the development of neuropathic pain (cummins et al ., 2007; immunohistochemistry and in situ hybridization studies have shown that all four isoforms of subunits and both slice variants are present in drgs (kazen - gillespie et al ., 2000;, 2001; qin et al ., 2003). Given the close physical and functional interactions between and subunits, it is not surprising that these auxiliary subunits are also important contributors to pain sensation (isom, 2001). However, the precise role of these subunits in nociception and neuropathic pain has not been fully elucidated . It has been convincingly demonstrated that the 1 subunit regulates the expression and gating properties of na channels and thereby modulates the electrical excitability of both nerves and muscles (chahine et al ., 2008). Immunohistochemistry and transcript analyses have shown that the 1 subunit is differentially expressed in subpopulations of primary sensory neurons (oh et al ., 1995; black et al ., 1996; takahashi et al ., 2003; zhao et al ., 2011) 1 is abundantly expressed in intermediate- and large - diameter (> 30 m) drg neurons but is present at comparatively low levels in small - diameter (<25 m) neurons . The preferential expression of 1 subunits in medium and large neurons suggests that these subunits may contribute significantly to the excitability of low - threshold a - fibers but play a reduced role in small - diameter nociceptors . This is consistent with rodent models of nerve injury where 1 expression is not significantly altered, suggesting that these subunits do not contribute significantly to the development of neuropathic pain (shah et al . The co - expression of 1 subunits with sensory neuron nav1.7 and nav1.8 na channels in xenopus oocytes accelerates current kinetics and produces a hyperpolarizing shift in steady - state inactivation (vijayaragavan et al ., 2001). In addition, 1 selectively increases nav1.8 current density but has no effect on nav1.7 expression . These findings indicate that 1 subunits regulate both the gating and cell surface expression of sensory neuron na channels in an isoform - specific manner . More recent work using mammalian cell lines revealed a twofold increase in nav1.81 peak current density and hyperpolarizing shifts in both activation and inactivation (zhao et al ., 2011). Studies on subunit chimeras showed that the intracellular c - terminus, but not the membrane spanning or extracellular domains of 1, was critical for retaining the functional regulation of nav1.8 gating (zhao et al ., 2011). The role of 1 subunits in sensory neuron excitability has been addressed using scn1b null mice (lopez - santiago et al ., 2007). The 1 knockouts exhibit numerous neuronal deficits, including symptoms of epilepsy and ataxia consistent with a broad distribution of this subunit in the cns (chen et al . The 1 knockout produces a slight reduction in persistent na current associated with small changes in the amplitudes and gating properties of the predominant ttx - s and ttx - r na currents (lopez - santiago et al ., 2011). Overall, the subtle 1 regulation of drg na channels coupled with the low level expression in small - diameter neurons and the absence of change in models of nerve injury are inconsistent with the idea that 1 subunits contribute significantly to the development of neuropathic pain . There are two splice variants of the 1 subunit, the 1a subunit in the rat and 1b subunit in humans (kazen - gillespie et al ., 2000; these variants have n - terminal domains that are identical to that of the 1 subunit, but have novel c - terminals resulting from intron retention . The retained 1b intron codes for a novel membrane spanning and intracellular domain that shares little sequence homology with 1 (17%) or 1a (33%). When co - expressed in oocytes, the 1b subunit increases peak nav1.2 currents twofold but does not alter the current kinetics or gating properties of the channels (qin et al . The 1a subunit is highly expressed during embryonic development but decreases after birth (kazen - gillespie et al ., 2000). Western blotting analyses have revealed that 1a is expressed in the heart, brain, spinal cord, and drgs . When co - expressed in chinese hamster ovary (cho) cells, the 1b subunit produces a 2.5-fold increase in nav1.2 current density and a slight depolarizing shift in activation (<3 mv), but no change in steady - state inactivation or current kinetics . 1a appears to preferentially increase the cell surface expression of nav1.2 channels, a feature it shares with the parent 1 subunit . These findings suggest that 1b regulation may involve the homologous n - terminal domain that is common to the 1 and 1a variants . The 2 subunit is widely expressed in drg neurons of all sizes (coward et al ., 2001; takahashi et al ., 2003) and throughout the cns, including the spinal cord, cerebral cortex, and cerebellum (gastaldi et al ., 1998). Nav1.2 channels expressed in xenopus oocytes result in currents that display abnormally slow activation and inactivation kinetics (auld et al ., 1988; krafte et al ., co - expressing the 2 subunit induces more rapid activation and inactivation, which is consistent with a shift of nav1.2 channels from a slow to a fast mode of gating (isom et al ., 1995). The slow gating observed in oocytes contrasts sharply with the properties of nav1.2 channels expressed in cho (west et al ., 1992) and tsa201(oleary, 1998; qu et al ., 2001) cell lines, where rapid kinetics similar to those of native tissues are typically observed . In addition to changes in current kinetics, co - expressing the 2 subunit in oocytes results in a hyperpolarizing shift in nav1.2 inactivation (2 mv) and a twofold increase in peak current (isom et al .,, this contrasts with results from tsa201 cells, where the 2 subunit produces small depolarizing shifts (34 mv) in nav1.2 activation and inactivation but no changes in current kinetics or recovery from inactivation (qu et al ., 2001). This suggests that 2 regulation of nav1.2 depends on the host cells used for expression, which may be related to differences in cellular genetic background, post - translational protein modification, or regulation by endogenous signal transduction pathways (west et al ., 1992; qu et al ., 2001 recent work has focused on 2 subunit regulation of na channel isoforms that are preferentially expressed in sensory neurons . The co - expression of nav1.8 and 2 subunits in xenopus oocytes results in a relatively modest depolarizing shift in inactivation (4 mv) but no change in activation, current kinetics, or peak na current (vijayaragavan et al ., 2004). Subsequent studies of nav1.82, nav1.62, and nav1.32 channels expressed in mammalian cells largely confirmed these findings, demonstrating little or no effect of 2 on voltage - dependence, kinetics, or current density (cummins et al ., 2001; zhao et al ., 2011). Similar results have been observed in preliminary studies of heterologously expressed nav1.72 channels (ho et al ., 2011). Overall, the 2 subunit appears to weakly regulate many of the voltage - gated na channels expressed in sensory neurons . This contrasts with studies of null mice, where the knockout of the 2 subunit is associated with reductions in ttx - s na current amplitude, mrna, and protein (lopez - santiago et al ., 2006). This suggests that 2 expression in drg neurons increases ttx - s na current amplitude and accelerates current kinetics, effects that are not widely observed in co - expression studies . The underlying cause of this discrepancy is not known . One possibility is that 2 subunits in native drg neurons interact with endogenous proteins or are the target of signal transduction processes that are not reconstituted in heterologous expression systems . This possibility has gained credence from studies showing that the expression of nav1.3 in drg cells results in a depolarizing shift in activation and faster recovery from inactivation compared to nav1.3 channels expressed in hek293 cells (cummins et al ., 2001). Interactions with endogenous subunits or other cell - specific proteins could account for the observed differences in gating properties . Alternatively, the apparent differences in na channel function observed in knockout and heterologous expression studies may stem from the compensatory upregulation of related subunits and na channel isoforms in null mice (chen et al . Additional studies of the changes in and subunit expression that occur in 2 null mice, or the development of conditional 2 knockouts that reduce the opportunity for subunit compensation, may shed light on the apparent discrepancy between the in vivo and in vitro effects of 2 subunit regulation . Several studies have examined the contribution of 2 subunits to the development of pain behaviors in rodent models of nerve injury . A study investigating subunit expression using rt - pcr and in situ hybridization found that 2 mrna levels in drg neurons are not significantly altered following peripheral nerve injury (takahashi et al ., 2003). However, subsequent studies of 2 protein expression using immunohistochemistry and western blotting revealed that the 2 protein is upregulated following nerve injuries (pertin et al ., 2005). 2 upregulation has been observed in both injured and uninjured sensory neurons, suggesting that the 2 subunit contributes to the excitability of both these populations . This possibility is supported by studies showing that the 2 knockout decreases the expression of ttx - s na channels in drg neurons (lopez - santiago et al ., 2006). Importantly, the mechanical allodynia associated with peripheral nerve injury is attenuated in 2 null mice, which is consistent with a role for this subunit in the development of neuropathic pain (pertin et al ., 2005). In situ hybridization has shown that 3 subunit mrna is highly expressed in small- (<25 m) and medium - diameter (2545 m) drg neurons and to a lesser extent in large - diameter (> 45 m) neurons (shah et al ., 2000, 2001). The cellular distribution of 3 expression extensively overlaps that of ttx - r nav1.8 and nav1.9 channels, which are primarily expressed in nociceptors (akopian et al ., 1996; sangameswaran et al ., 1996 fiber nociceptors following chronic constriction (shah et al ., 2000), spared nerve ligation, and sciatic nerve transection (takahashi et al ., 2003), and in medium - diameter a fibers in the streptozocin rodent model of diabetes (shah et al ., 2001). The upregulation of 3 observed in animal models of nerve injury is consistent with the increase in 3 protein in human drg neurons following avulsion injuries (casula et al ., 2004). The preferential expression of 3 subunits in small drg neurons and their upregulation in models of nerve injury support the idea that 3 is an important contributor to both acute and chronic pain . 3 subunits also appear to play a major role in the development of neuropathic pain . Chronic constriction injury and sciatic nerve axotomy have been shown to induce an increase in ttx - s na currents (cummins and waxman, 1997) that has been linked to the enhanced expression of nav1.3 channels in small- and medium - sized drg neurons (waxman et al ., 1994; dib - hajj et al . The injury - induced increase in nav1.3 expression is paralleled by a similar increase in 3 mrna and protein levels (shah et al . Heterologous expression studies have shown that co - expressing the 3 subunit produces depolarizing shifts in nav1.3 activation and inactivation, faster recovery from inactivation, and slower current kinetics (cummins et al ., one possibility is that the upregulation of nav1.3 channels and 3 subunits may be an attempt by the neurons to compensate for the injury - induced decrease in the expression of nav1.8 and nav1.9 channels (dib - hajj et al ., 1996, 1999; sleeper et al ., 2000). Replacing the slowly gating ttx - r nav1.8 current with the more rapid ttx - s current of nav1.33 channels is predicted to reduce the action potential threshold and promote high - frequency firing, thereby contributing to the hyperexcitability of injured drg neurons (cummins et al ., 2001). However, immunohistochemical analysis suggests that nav1.3 channels are preferentially upregulated in medium to large size drg neurons after nerve injury (kim et al ., 2001; fukuoka et al ., 2008) and therefore may not extensively overlap with nav1.8 channels primarily expressed in small - diameter nociceptors . Early studies of nav1.8 channels expressed in xenopus oocytes found that co - expressing 3 increases na current density and produces a hyperpolarizing shift in activation (shah et al ., 2000). This contrasts with later studies showing that co - expressing 3 in oocytes produces a depolarizing shift in nav1.8 inactivation but no change in current density (vijayaragavan et al ., 2004). Studies on nav1.8 expressed in mammalian cells revealed that 3 causes a 31% decrease in peak current density but no change in activation or steady - state inactivation (zhao et al ., 2011). Collectively, these findings suggest that co - expressing the 3 subunit either has no effect or reduces nav1.8 current density, without altering voltage - dependence or gating kinetics . Similar findings have been reported for the 3 regulation of nav1.6, a rapidly gating ttx - s na channel that is preferentially expressed at the nodes of ranvier of peripheral nerve fibers (krzemien et al ., 2000; tzoumaka et al ., 2000; ulzheimer et al ., 2004) and in large - diameter sensory neurons (black et al ., 1996; fukuoka et al . Heterologous expression studies have indicated that co - expression with the 3 subunit does not alter the peak current density, current kinetics, or voltage - dependence of nav1.6 channels (zhao et al ., the mature 4 subunit protein has a large extracellular ig - like fold, a single membrane spanning segment, and a short cytoplasmic c - terminal domain that is structurally similar to those of the 13 subunits . 4 shares high amino acid identity (35%) with 2 and includes an extracellular unpaired cysteine that enables 4 to covalently associate with na channel subunits via disulfide bonds (yu et al ., 2003). The 4 subunit is highly expressed in drgs and at lower levels in the brain and spinal cord . At the cellular level, 4 is abundantly expressed in large - diameter sensory neurons and at lower levels in intermediate and small neurons (yu et al ., 2003). The co - expression of 4 with the nav1.2 channel in tsa201 cells produces a hyperpolarizing shift in activation (7 mv) but no change in steady - state inactivation (yu et al ., 2003). The effects of 4 on the gating properties of the ttx - s nav1.6 and ttx - r nav1.8 channels have also been studied (chen et al ., 2008; zhao et al ., 2011). Co - expressing 4 produces pronounced hyperpolarizing shifts in activation (17 mv) and steady - state inactivation (9 mv) of nav1.8, and a smaller hyperpolarizing shift (8 mv) in nav1.6 activation (zhao et al ., 2011). 4 subunits produce similar negative shifts in the activation of the neuronal nav1.1 and skeletal muscle nav1.4 channels (yu et al ., 2003; aman et al ., the consistent hyperpolarizing shift in activation produced by the 4 subunit suggests that this subunit may modulate neuronal excitability by causing na channels to activate at more hyperpolarized voltages . Resurgent currents were initially described in purkinje neurons where they were found to promote the discharge of multiple action potentials in response to brief depolarizations (raman and bean, 1997, 1999). Subsequent work found that the open - channel block at depolarized voltages coupled with rapid unblocking and slow na channel deactivation at voltages near threshold produce an inward na current (resurgent current) that transiently depolarizes the neurons (grieco et al ., 2005). These resurgent currents increase excitability and are believed to underlie the high - frequency firing of purkinje neurons (raman and bean, 2001). The cytoplasmic c - terminus of the 4 subunit has emerged as a likely candidate for the endogenous blocking particle responsible for resurgent currents (grieco et al ., 2005; bant and raman, 2010). This possibility is supported by studies showing that sirna targeting scn4b abolishes resurgent currents in cultured cerebellar granule cells and that the exogenous application of synthetic 4 c - terminal peptide (4154 - 167) blocks na currents and induces resurgent currents in inactivation - impaired purkinje neurons . Resurgent currents are substantially reduced in purkinje neurons isolated from nav1.6 null mice, indicating that these channels play an important role in the production of resurgent currents (raman et al ., 1997). However, persistent resurgent currents have been reported in the subthalamic nucleus and purkinje neurons isolated from nav1.6 null mice, suggesting that other na channel isoforms may also produce these currents (do and bean, 2004; grieco and raman, 2004). The role of subunits in the generation of resurgent currents has been further investigated in vitro . Co - expressing the 4 subunit does not induce resurgent currents in heterologously expressed nav1.1 (aman et al ., 2009), nav1.6 (zhao et al ., 2011), or nav1.8 (zhao et al ., 2011) channels, indicating that the association with the intact 4 subunit alone is insufficient to produce resurgent current . Additional proteins or post - translational modifications appear to be required to recapitulate the resurgent currents observed in native neurons (grieco et al ., 2002). These endogenous proteins and regulatory pathways may be highly specific to particular cell types and may thus be absent in the mammalian cells lines that are widely used for heterologous expression and cellular electrophysiology studies (theile and cummins, 2011). Alternatively, 4-mediated resurgent currents may involve cell - specific enzymatic cleavage by proteases such as -site amyloid precursor protein cleaving enzyme 1 (bace1) or other proteases that are required to produce the functionally active blocking peptide (huth et al ., 2011). Resurgent currents are observed in 40% of large - diameter (3550 m) drg neurons and are substantially reduced in neurons from nav1.6 null mice (cummins et al ., 2005)., 1996; fukuoka et al ., 2008; ho and oleary, 2011) and 4 subunits (yu et al ., 2003), further supporting the idea that nav1.64 channels may play a role in these currents . This contrasts with small - diameter drg neurons that do not routinely produce resurgent currents (cummins et al ., 2005) and that express low levels of nav1.6 (black et al ., 1996; fukuoka et al ., 2008; ho and oleary, 2011) and 4 subunits (zhao et al ., 2011). Resurgent currents have recently been implicated in the neuronal hyperexcitability and pain associated with paroxysmal extreme pain disorder (pepd; jarecki et al ., 2010; theile and cummins, 2011). Iv linker of the nav1.7 channel reduces the rate of inactivation, increases the persistent na current, and induces a depolarizing shift in steady - state inactivation (fertleman et al ., 2006; . These changes are consistent with impaired fast inactivation, which increases the probability of open - channel block, a suspected contributor to the generation of resurgent currents (grieco and raman, 2004). When heterologously expressed in cultured drg neurons, the nav1.7i1467 t mutant channel increases both the percentage of neurons displaying resurgent currents and the peak current amplitude (theile et al ., 2011). Computer simulations further support the idea that pepd mutations that alter nav1.7 inactivation induce resurgent currents in drg neurons that contribute to aberrant action potential firing and increased cellular excitability . The evidence supporting a role for resurgent currents in the development of neuropathic pain is compelling and warrants further investigation . All four isoforms (14) and both splice variants (1a, 1b) of subunits are broadly expressed in the pns . These subunits interact with many of the na channel isoforms in sensory neurons and alter the expression, voltage - dependence, and gating properties of these channels . Subunits are differentially expressed in large - diameter mechanoreceptors (1, 4) and small - diameter nociceptors (3). This pattern of subunit expression suggests that these auxiliary subunits may differentially regulate voltage - gated na currents and the excitability of these neuronal populations . Injury - induced changes in subunit expression and the altered functional regulation of the na channels expressed in sensory neurons contribute to the hyperexcitability and ectopic firing of sensory neurons . Current evidence suggests that subunits are important contributors to sensory physiology, nociception, and neuropathic pain . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The foot is the point of direct contact between the body and the surface below . Therefore, muscle force generated from the toes and ankles may play an important role in maintaining stability . A limited number of studies have reported the association between toe grasping strength and postural control . For example, two studies investigated the age - related change in toe grasping strength in males and females and found that toe grasping strength is related to age and declines faster than handgrip strength with increasing age1, 2 . In addition, handa and colleagues1 reported significant correlations between toe grasping strength and static balance with eyes open (r = 0.443, p <0.01) as well as tolerance to falling forward (r = 0.620, p <0.01). Interestingly, postural sway behavior while standing improved following 8 weeks of toe grasp training (consisting of gathering a towel attached to a weight and passing small bags from one place to another) in older adults although the authors did not measure toe grasping strength3 . Perrin and colleagues4 reported that daily physical activity in older adults, even if never practiced earlier in their life, had a positive effect on balance control . Gauchard and colleagues5 investigated the influence of two types of physical exercise (yoga and soft gymnastics vs. jogging, swimming, and cycling) on postural sway balance in older females and found that yoga and soft gymnastics appeared to have the best impact on postural control in simple postural tasks . One difference between these two types of physical exercise is how the foot contacts the ground surface during the exercise . Foot muscles involved in toe grasping may be activated during relatively slow movements of physical activities such as yoga and soft gymnastics . Thus, toe grasping strength may be associated with the duration and intensity of daily physical activity . The purpose of the present study was to test the hypothesis that daily physical activity probably contributes to toe grasping strength in middle - aged and older adults . Fifty - seven japanese women between the ages of 52 and 78 years (mean age, 66.3 6.8 years) were recruited through printed advertisement and by word of mouth from the surrounding area of the university campus in chiba . In this study, female volunteers were chosen because a higher incidence of falls has been reported in japanese females than in japanese males7 . All subjects were free of overt chronic disease (e.g., diabetes, angina, myocardial infarction, arthritic and neuromuscular disorders, cancer, stroke) as assessed by self - report following a general health examination . The main types of sports activities were walking (17 females) and yoga / tai chi (6 females). The study was conducted according to the declaration of helsinki and was approved by the ethics committee for human experiments of toyo gakuen university (2012 - 001). Written informed consent was obtained from all subjects . Subcutaneous fat thickness (ft) was measured using b - mode ultrasound (aloka ssd-2000, tokyo, japan) at 9 sites, as described previously8 . The measurements were taken while the subjects stood quietly with their knees extended and relaxed . A 5-mhz scanning head was placed on the measurement site without depressing the dermal surface . Body density was estimated from ft using an ultrasound - derived prediction equation8 . Percent body fat (% fat) was calculated from body density using brozek s equation9 . Fat - free mass (ffm) was estimated as total body mass minus fat mass . Body mass and standing height were measured to the nearest 0.1 kg and 0.1 cm, respectively, using a height scale and an electronic weight scale . Body mass index (bmi) was defined as body mass (kg)/height (m). 3361, takei, tokyo, japan), as described previously2 . While barefoot, subjects were instructed to maintain a one - legged upright standing position on the dynamometer, put both hands on the wall in front of them, and hold the dynamometer grasping bar with their toes . The distance between the bar and the heel was adjusted to the foot size of each subject such that the distal phalanges of the great toe and fifth toe and the middle phalanges of the second to fifth toes could be placed on the toe grasping bar . Subjects were allowed to perform one test trial, followed by 3 maximum trials, and the best values for right and left feet were averaged and used for data analysis . Maximal toe grasping strength divided by body weight was calculated for evaluating relative toe grasping strength . Test - retest reliability of toe grasping strength has been reported in a previous study10 . Maximum voluntary isometric strength of the knee extensors was determined using a biodex system 3 dynamometer (shirley, new york, usa). Subjects were carefully familiarized with the testing procedures of voluntary force production approximately one week before testing . Each subject was seated on a chair with the hip joint angle positioned at 85. the center of rotation of the knee joint of the right leg was visually aligned with the axis of the lever arm of the dynamometer, and the ankle of the right leg was firmly attached to the lever arm of the dynamometer with a strap . After a warm - up consisting of submaximal contractions, the subject was instructed to perform maximal isometric (mvc) knee extension at a knee joint angle of 80. a knee joint angle of 0 corresponded to full extension of the knee . If mvc strength for the first two trials varied by> 5%, an additional mvc was performed . Knee extension mvc divided by body weight was calculated for evaluating relative knee extension strength . During orientation, participants were shown how to attach the accelerometer (lifecorder ex, suzuken, nagoya, japan) on an elastic belt over their left or right hip and were instructed to record their daily physical activity for 30 days, beginning on the following day . If participants did not use the accelerometer for a couple of days during the testing period, they were requested to record their activity for additional days . To achieve> 90% reliability for estimating the yearly physical activity in older adults,> 30 consecutive observation days are required11 . After the measurements were taken, the recorded activity level data were downloaded to a personal computer . The data were classified into different intensities using 10 activity levels, ranging from 0 to 9, based on the accelerometer signal . Level 0 (corresponding to <0.06 g) denotes immobility, and levels 1 to 9 (corresponding to 0.06 g) denote subtle to vigorous movements . In this study, exercise intensity was categorized into one of 3 activity levels on the basis of the accelerometer signal: light physical activity (levels 13, <3 metabolic equivalents [met]), moderate physical activity (levels 46, 36 met), and vigorous physical activity (levels 79,> 6 met) according to a previous study12 . In addition, the total duration of each level of exercise intensity was calculated . Participants were separated into two groups on the basis of daily step counts measured by an accelerometer: low (n = 28, <8,000 steps per day) and high (n = 29, 8,000 steps per day). Before comparisons were made, dependent variables were tested for normality of distribution by the shapiro - wilk test . The difference between low and high groups was tested for significance by using unpaired student s t - tests, and if any variables were not normally distributed, the mann - whitney u test was used . Pearson product correlations were performed to determine the relationships between accelerometer - determined physical activity level and relative maximum strength (divided by body weight) of toe grasping and knee extension . If any variables were not normally distributed, then spearman s rho correlation was used . Because age was different between the two groups, partial correlations of relative strength with physical activity levels adjusted for age although the high group was approximately 5 years younger than the low group (p <0.01), bmi and body composition (% fat and ffm) were similar between the two groups . Absolute and relative toe grasping maximal strength were greater (p <0.001) in the high group than in the low group . However, both absolute and relative knee extension strength were similar between the two groups . All 3 intensities (light, moderate, and vigorous) of physical activity were higher in the high group compared with the low group (table 1table 1.body composition, physical activity, and muscle strength in middle - aged and older womendaily step counts (steps / day)overalllow (<8,000)high (8,000)n282957age, yrs69 (7)64 (6)66.3 (6.8)height, m1.53 (0.05)1.53 (0.06)1.53 (0.05)body weight, kg52.9 (6.1)51.7 (4.5)52.3 (5.4)body mass index, kg / m22.7 (2.9)22.1 (2.0)22.4 (2.5)body fat,% 27.3 (5.1)26.9 (5.2) 27.1 (5.1)fat - free mass, kg38.3 (3.1)38.2 (3.2)38.2 (3.2)muscle strengthfoot grasping, kg11.9 (3.1)14.9 (3.3)13.4 (3.5)knee extension, nm104 (28)106 (22)105 (25)relative muscle strengthfoot grasping / wt, kg / kg0.23 (0.06)0.29 (0.07)0.26 (0.07)knee extension / wt, nm / kg1.96 (0.48)2.07 (0.45)2.01 (0.46)physical activity, min / daylow48.3 (14.6)71.4 (19.1)60.1 (20.5)moderate10.6 (7.7)33.3 (13.7)22.2 (15.9)vigorous0.6 (0.9)2.4 (1.7)1.54 (1.65)low + moderate59.0 (17.2)104.7 (18.3)82.2 (29.1)moderate + vigorous11.2 (8.1)35.8 (14.6)23.7 (17.1)step counts, steps / day5,456 (1,588)10,406 (1,898)7,974 (3,041)significant difference from low group p<0.01, p<0.001 . Wt: body weight a negative correlation was observed between age and relative toe grasping strength (r = 0.480, p <0.001) and between age and relative knee extension strength (r = 0.307, p <0.05). Relative toe grasping strength correlated positively with light (r = 0.320, p <0.05), moderate (r = 0.345, p <0.01), and vigorous (r = 0.296, p <0.05) physical activity . Relative knee extension strength correlated positively with moderate (r = 0.298, p <0.05), and vigorous (r = 0.358, p <0.01) physical activity, but not with light (r = 0.203, p = 0.131) physical activity . Similarly, both toe grasping and knee extension strength correlated with light plus moderate physical activity as well as moderate plus vigorous physical activity (table 2table 2.pearsons and partial (adjusted for age) correlation coefficients between muscle strength and physical activity in middle - aged and older womenpearson s correlationpartial correlationgraspingknee exgraspingknee ex light + moderate0.4150.306 * 0.290 * 0.217 moderate + vigorous0.350 0.312 * 0.228 0.233 step counts0.4120.330 * 0.283 * 0.242p<0.05, p<0.01 . Grasping, foot grasping strength / body weight; knee ex, knee extension strength / body weight). Average step count also correlated with both toe grasping and knee extension strength (table 2). After adjusting for age, only the duration of light plus moderate physical activity and average step count correlated to toe grasping strength (table 2). p<0.05, p<0.01 . Grasping, foot grasping strength / body weight; knee ex, knee extension strength / body weight in the present study, we tested our hypothesis that daily physical activity may contribute to toe grasping strength in middle - aged and older females . The primary findings of this study were that: 1) the high group (8,000 steps / day) had significantly greater toe grasping strength, but not knee extension strength, when compared with the low group (<8,000 steps / day) strength, 2) toe grasping strength was significantly associated with daily step count, and 3) toe grasping strength significantly correlated with light plus moderate intensity physical activity, but not moderate plus vigorous intensity physical activity . It has previously been reported that accelerometer (or pedometer)-determined physical activity levels dramatically decrease later in life13,14,15 . In japanese, for example, average yearly step counts were approximately 7,000 steps / day for ages 6574 and 5,000 steps / day for ages 758413 . Kitagawa et al.16 reported a mean value of 8,401 (sd 3404) steps / day in older japanese females aged 6187 years (mean age 71 6 years). Similarly, yoshioka et al.17 reported an average number of 7,922 steps / day in middle - aged and older adults (females and males) aged 5069 . Physical activity levels of our subjects were similar to the previous studies with an average value of approximately 8,000 steps / day (mean and sd, 7,974 3,041) in middle - aged and older females (mean age 66 7 years). It is generally believed that participation in regular physical activities may be associated with greater maintenance of muscular strength . In the present study, active females (8,000 steps / day) had 26% higher toe grasping strength compared with females who were not as physically active (<8,000 steps / day), while knee extension strength was similar between the two groups . Furthermore, both knee extension and toe grasping strength correlated significantly to average step count, although the correlation coefficient between step count and toe grasping strength was only significant after adjusting for age . Al.18 investigated the influence of physical activity on muscular strength of knee extensors, plantar flexors, and handgrip in females aged 20 to 89 years . They found that self - reported physically active females were stronger than physically inactive females when absolute strength of the leg muscles was normalized for body weight; however, knee extension strength at ages 6064, 6569, and 7074 were probably similar between the active and inactive females . Leskinen et al.19 reported that active twins had 20% higher knee extension strength than their inactive co - twins, while the active twins had only 4% higher mid - thigh muscle cross - sectional area than that of the inactive twins . Our findings in toe grasping strength support the previous studies, whereas the reasons for the difference in knee extension strength between the present and previous studies are not well known . One possible explanation is that most of the previous studies used questionnaires for evaluating the frequency and/or duration of a given type of physical activity during a typical week, and determination of physical activity profile based on questionnaires may or may not be accurate, especially regarding exercise intensity20,21,22 . Thus, this methodological concern may have affected the results reported by the previous studies . In the present study, toe grasping strength was associated with light plus moderate intensity physical activity . In terms of foot - ground contact time, foot muscles involved in toe grasping may be better activated during light / moderate intensity slow movements than during vigorous intensity fast movements although this may depend on footwear . A previous study examined the effects of low - intensity toe grasp training (which consisted of gathering a towel attached to a weight and passing small bags from one place to another) in older adults and found that postural sway behavior while standing improved following the training3 . Although that study did not measure the change in toe grasping strength, it is expected that muscular functions involved in toe grasping may be improved by relatively low - intensity exercise training . Therefore, results from the present and previous studies together suggest that relatively low - intensity exercise would be suitable for improving toe grasping strength . Another previous study investigated the effect of accelerometer - determined daily physical activity on lower body muscular power in adolescents23 . The results showed positive correlations between muscular power and vigorous intensity physical activity but not with moderate or light intensity physical activity . In that study, the duration of vigorous intensity physical activity was approximately 14 minutes for female adolescents and 25 minutes for male adolescents . In the present study, the average duration of vigorous intensity physical activity was only 1.5 minutes in middle - aged and older females, and the effect of vigorous intensity exercise on knee extension strength appeared to be limited . Therefore, for improving knee extension strength, the advantage of regular physical activity may depend on the intensity and duration of exercise . It is possible that older adults with high levels of physical activity in daily life have better balance control compared with less active individuals . Although aoyagi et al.24 reported no significant association between body sway and level of daily physical activity, many intervention studies have revealed a number of factors that contribute to better balance25 . In particular, gauchard et al.5 reported more improvement in static postural control with yoga / soft gymnastics (proprioceptive exercise) than with jogging / swimming / cycling (bioenergetic exercise). It has been reported that toe grasping strength is associated with static balance with eyes open as well as with tolerance to falling forward1 . Our results, along with those of previous studies, suggest that toe grasping strength may be a contributing factor to the connection between the effects of daily physical activity and balance control . Several limitations of this study should be mentioned . Because patterns of daily physical activity differ between women and men and our subjects were only women although the duration of light / moderate physical activity was associated with toe grasping strength, we did not consider the type of exercise performed during daily physical activity . Additional research into these issues is needed . In summary, active middle - aged and older women had higher toe grasping strength compared with females who were relatively physically inactive . Significant correlations were observed between toe grasping strength and accelerometer- determined physical activity levels, especially the duration of light plus moderate physical activity . These results suggest that toe grasping strength may be associated with the amount of light daily physical activity.
Breast cancer, the most common cancer in women worldwide, accounted for 1.7 million new cases in 2012, comprising a quarter of all new cancer cases . While traditional risk factors for breast cancer include age, family history of cancer, and reproductive and menstrual history, the national cancer institute also recognizes overweight, lack of physical activity, and consumption of alcohol as risk factors . Metabolic syndrome (ms) is a cluster of pathophysiological disorders comprising central obesity, insulin resistance, high blood pressure, and dyslipidemia . Reaven's definition of ms in 1988 was followed by definitions from the world health organization, national cholesterol education program's adult treatment panel iii (ncep atp iii), american heart association / national heart, lung, and blood institute, and the international diabetes federation . These criteria include the presence of three or more of the following: abdominal obesity (waist circumference 35 inches in women), triglycerides 150 mg / dl, high density lipoprotein cholesterol (hdl - c) <50 mg / dl, blood pressure (bp) 130/85 mmhg, and fasting glucose 110 mg / dl . Ms is estimated to be prevalent in at least a quarter of the adults in the americas, in europe, and in india . Ms has been identified as a risk factor for several cancers, particularly breast, pancreatic, colorectal, and prostate cancers [1015]. Individual components of ms, for example, abdominal obesity, high blood glucose, high bp, high triglycerides, and low hdl, are positively associated with the development of certain cancers, most notably breast cancer [1627]. While studies show a positive association of breast cancer with diabetes [19, 2833] and obesity [16, 34, 35], others show a negative association with obesity in premenopausal women [3638]. Mixed results also characterize hypertension [22, 23, 39, 40] and dyslipidemia [22, 41, 42] as risk factors for breast cancer . In addition, although individual components of ms may not be strongly associated with the development of breast cancer, their combination may elevate the risk [13, 14, 4356]. For example, ms may activate different molecular pathways through endocrine, metabolic, and immune cell changes, which in turn influence breast tumorigenesis . Such pathways that enhance breast cancer cell proliferation and inhibit apoptosis include (1) increased levels of circulating estrogen, for example, estradiol [52, 54, 57], (2) higher levels of insulin [58, 59], (3) decreased level of circulating adiponectin, (4) increased plasma leptin concentration, and (5) increased production of proinflammatory cytokines, such as interleukin-6 and tumor necrosis factor alpha . Previous epidemiologic studies on ms and breast cancer risk show contrary results . For example, only four [13, 14, 43, 51] of eight studies [13, 14, 43, 48, 51, 6264] reported a statistically significant association between ms and risk of breast cancer . This might invite a conclusion that the association between ms and breast cancer risk is unknown . However, such an inference would be based on the vote - counting approach, an approach that ignores the magnitude of the association . A recent systematic review and meta - analysis of ms and postmenopausal breast cancer found that ms was moderately associated with the risk of postmenopausal breast cancer . However, to the best of our knowledge, no meta - analytic research has addressed the conflicting results from individual studies of ms and breast cancer risk in all adult women . Therefore, the purpose of this study was to use the aggregate data meta - analytic approach to examine the association between ms and breast cancer risk in women . The a priori inclusion criteria for this study were as follows: (1) observational studies using cohort (both prospective and retrospective), case - control, or nested case - control study designs; (2) studies examining the association between ms (presence of a cluster of three or more metabolic abnormalities) and breast cancer incidence, as defined by the authors; (3) studies with adult females 18 years of age as participants; (4) english - language studies published as journal articles, doctoral dissertations, or masters' theses; (5) published and indexed studies up to june 30, 2012; and (6) studies reporting sufficient data (e.g., rate ratios, risk ratios, odds ratios, standardized incidence ratios, hazard ratios, or frequencies) for calculating a common effect size . Neither lobular carcinoma in situ nor ductal carcinoma in situ breast cancer cases were excluded from the study . Studies not meeting all inclusion criteria were excluded from this review . Excluded studies were those that (1) were not published as full reports, such as conference abstracts and letters to the editors; (2) only examined individual components of ms; (3) measured the ms variables at time of cancer diagnosis; (4) used cancer mortality, rather than incidence, as the outcome; and (5) were published in a language other than english . A comprehensive and systematic search was conducted using four electronic databases: pubmed, cumulative index to nursing and allied health literature (cinahl), web of science, and proquest (from their commencement to june 30, 2012). Since the term ms dates back to the late 1950s, with variations in use as early as the 1920s, the start dates of each of the databases were used as the commencement date for study search: web of science (1900), cinahl (1952), pubmed (1966), and proquest (1861). Major keywords used in the search for potentially eligible studies included metabolic syndrome (insulin resistance syndrome, syndrome x) and breast cancer (neoplasm and breast). Using the most recent publication, trials published as duplicate reports (parallel publications) an initial cut - off point for the inclusion of studies was not used given the difficulty in establishing such a point, as well as our concern about the potential loss of studies that met our eligibility criteria . At the first screening, one author (rb) screened all abstracts and selected articles for full - text examination . At the second level of the study selection process, two of the authors (rb and th) examined the full - text articles and then selected the included studies following mutual discussion and consensus . Two of the authors (rb and th) reviewed every study selected and independently extracted data from studies onto electronic coding forms . Attempts were made to contact authors of three of the original studies for missing information [13, 62, 64], but only one provided the requested information . After initial coding, the two coders (rb and th) reviewed each item for agreement . Using cohen's kappa (k) statistic, the overall interrater agreement rate prior to correcting discrepant items was 0.96 for all included studies . Risk of bias was assessed using a modified version of strengthening the reporting of observational studies in epidemiology (strobe) checklist . The items assessed included (1) study design, (2) adjustments for confounders, (3) selection of participants and their eligibility criteria, (4) measurement of predictor variables, (5) breast cancer diagnosis, (6) study size, (7) handling of missing data, and (8) reasons for nonparticipation of individuals at each stage of the study . A description of the criteria for risk of bias assessment is shown in table 1 . Two of the authors (rb and th) conducted all assessments, independently of each other . Risk estimates were used to examine the association between ms and risk of breast cancer . These were derived from reported relative risks, odds ratios, hazard ratios, incident rate ratios, or standardized incidence ratios, together with corresponding 95% confidence intervals (cis), from the original studies . Where necessary and possible adjusted risk estimates were pooled for analysis from multivariable models in the original studies . However, for two case - control studies that were included [14, 51], adjusted odds ratios were used because of the lack of the requisite data to convert odds ratios to rrs . All rr results were pooled using a random - effects model, an approach that incorporates between - study heterogeneity into the model . A z - score two - tailed alpha value 0.05 was considered to be statistically significant . In addition, 95% cis were calculated for each result from each study as well as for pooled estimates . An alpha level 0.10 for the q statistic was considered to be evidence of statistically significant heterogeneity . While somewhat arbitrary, i values of 25%, 50%, and 75% were considered to represent low, moderate, and high amounts of heterogeneity . Publication bias was assessed using the trim and fill approach of duval and tweedie . In addition, rosenthal's fail - safe n test was used to compute the number of missing null studies that would be needed to nullify the overall pooled rr as being statistically significant . Influence analysis was conducted with each study result deleted from the model once, in order to examine the effects of each on the overall pooled results . Cumulative meta - analysis, ranked by year, was also conducted in order to examine the accumulation of results over time . A separate pooled analysis, limited to postmenopausal women, was conducted because studies show that ms in postmenopausal women increases the risk of breast cancer [13, 14, 43, 48, 51, 62]. In addition, pooled analyses were conducted with the following caveats post hoc: (1) deletion of results from two case - control studies because odds ratios were used instead of rr [14, 51], (2) deletion of results from studies that were not prospective cohort designs [13, 14, 51], and (3) limiting the results to studies that controlled for four or more of the important confounders (as listed in table 1) [14, 43, 48, 51]. Given the potential for diabetes and diabetes medications to affect breast cancer risk, post hoc data analysis was also conducted with studies that included participants with diabetes and/or taking medications for diabetes, deleted from the model [14, 43, 64]. Figure 1 presents a flow diagram of the selection of studies for the meta - analysis . Of the 291 studies screened, 47 (16.2%) were selected for full - text review: 25 from pubmed [14, 4355, 64, 7483], 17 from the web of science [13, 39, 63, 8497], one from cinahl, and four from proquest [62, 99101]. Eight (17.0%) of the 47 studies that underwent a full - text review met the eligibility criteria [13, 14, 43, 48, 51, 6264]. One article presented results for two independent cohorts; thus each cohort was treated independently . The study designs included four prospective cohorts [48, 6264], one retrospective cohort, one prospective nested case - control study, and two case - control studies [14, 51]. The baseline year for cohort inception ranged from 1983 to 2004, with average follow - up ranging between 2.7 and 13.5 years . Six studies conducted analyses on postmenopausal women [13, 14, 43, 48, 51, 62]. The results of each cohort or case - control study were initially reported as a hazard ratio [13, 48, 63], incidence rate ratio [43, 62], standardized incidence ratio, or odds ratio [14, 51]. Methods for exposure assessment, cancer identification, and control of confounders varied across the eight included studies (table 3). Seven studies identified the outcome (breast cancer) through histological reports or medical reports or from a cancer registry [13, 14, 43, 48, 51, 62, 64], while one used self - report . Only three studies examined invasive breast cancer cases [43, 48, 64]. One study also reported on the in situ breast cancer cases but there were only seven such cases in that study . Another study analyzed all breast cancer cases (in situ and invasive) as well as invasive cancers separately, and results remained unchanged . All of the studies were considered to be at low risk for selection of participants and meeting eligibility criteria in addition to providing adequately powered sample sizes . Out of eight studies, a majority were also considered low risk with respect to study design (six studies) and measurement of the outcome variable (seven studies). In terms of handling potential confounders, half the studies were low risk, three were high risk, and one was unclear risk . Missing confounding variables included education, smoking status, alcohol use, family history of cancer, contraceptive use, or hormonal history . Similarly, half the studies had objective measurements of predictor variables, while the remainder relied on self - report, and were consequently considered high risk . Four studies deleted the participants with missing variables in their analyses (high risk), while two did not report how they handled missing data . Lastly, six studies were considered high risk because they did not report the reasons for nonparticipation of subjects at each stage of follow - up . Overall, a statistically significant increase of 47% in the risk for incident breast cancer was observed for adult females with ms (rr: 1.47, 95% ci, 1.151.87; z = 3.13; p <0.002; q = 26.28, p <0.001; i = 69.55%) (figure 2). With the exception of one study, all other studies had rr in the direction of increased risk [13, 14, 43, 48, 51, 62, 64]. Funnel plot results for potential publication bias are shown in figure 3 . Using the trim and fill approach that resulted in two imputations, the risk decreased by 16% but remained significant (rr: 1.31, 95% ci, 1.011.70). Null studies would be needed to nullify the statistically significant association between ms and breast cancer risk in adult females . No statistically significant outliers were identified (p = 0.060.82). With each study deleted from the model once, results remained positive and statistically significant (figure 4). The pooled rr fell within a range of 20% (rr = 1.361.56) and none of the cis for the point estimates was less than 1.0 . Cumulative meta - analysis, ranked by year, revealed that results have been statistically significant since 2011 (figure 5). Deleting the two case - control studies from the model, the rr for incident breast cancer for women with ms decreased by 18% but was still statistically significant with moderate heterogeneity (rr: 1.29, 95% ci, 1.0031.67; z = 1.98; p = 0.05; q = 14.13, p = 0.01; i = 64.61%). When limited to studies with only prospective designs, the rr decreased by 30% but remained statistically significant with very low heterogeneity (rr: 1.17, 95% ci, 1.011.36; z = 2.04; p = 0.04; q = 4.30, p = 0.37; i = 7.04%). When limited to postmenopausal women, breast cancer risk increased by 34% and was still statistically significant with high heterogeneity (rr: 1.81, 95% ci, 1.282.56; z = 3.37; p = 0.001; q = 23.36, p = 0.001; i = 74.32%). When limiting the results to studies that controlled for four or more of the important confounders (as listed in table 1) [14, 43, 48, 51], breast cancer risk increased by 17% and was statistically significant with moderate heterogeneity (rr: 1.64, 95% ci, 1.232.20; z = 3.34; p = 0.001; q = 8.55, p = 0.07; i = 53.21%). Lastly, when data were analyzed after deleting from the model those studies that had participants with diabetes or taking medications for diabetes [14, 43, 64], the rr was slightly larger than the overall finding but the 95% ci included 1.0 (rr: 1.48, 95% ci, 0.922.4; z = 1.61; p = 0.11; q = 17.4, p = 0.02; i = 76.96%). The purpose of this aggregate data meta - analysis was to examine the association between ms and the risk for breast cancer in adult females . Overall, the results suggest that there was a modest positive association between ms and risk of breast cancer . This finding is strengthened by the robustness of results from other analyses . These include (1) examination for publication bias, (2) influence analysis with each study being deleted from the model once, (3) deletion of the two case - control studies with odds ratios from the overall model, (4) limiting the analysis to prospective designs, (5) including only postmenopausal women in the analysis, and (6) limiting the results to studies that controlled for four or more of the important confounders . In addition, the results from cumulative meta - analysis, ranked by year, indicate an increasingly statistically significant association since 2011 . In contrast, despite a slightly increased mean rr, overlapping cis were observed when studies that included participants with diabetes or taking medications for diabetes were deleted from the model [14, 43, 64]. However, whether this reduced precision is the result of these specific characteristics or some other factors, for example, loss of power with a reduced number of studies, is not known . Assessment for risk of bias indicated that a majority of studies were at low risk regarding study design, cancer assessment, and sample size . However, a majority were at high risk or unclear risk in terms of handling of missing data and nonparticipation of subjects at each stage of follow - up . It is suggested that future studies provide complete information on the handling of missing data and on the nonparticipation of subjects at each stage of follow - up . When limited to postmenopausal women, a stronger association between ms and breast cancer was observed . This association was stronger in case - control and retrospective cohort study designs compared to prospective cohort study designs . These findings concur with those from a recent meta - analysis on ms and breast cancer risk in postmenopausal women . Several studies have shown that ms in this group increases the risk of breast cancer [43, 46, 102], suggesting that the etiology of breast cancer may differ among pre- and postmenopausal women . First, obese postmenopausal women produce higher levels of estrogens, which in turn increase the biologically available fraction of circulating estradiol by reducing plasma concentration of sex hormone binding globulin (shbg). Low plasma shbg levels are associated with insulin resistance [104, 105] and other components of ms [106, 107]. Second, adipose tissue produces two adipokines (cytokine - like factors), leptin and adiponectin, that affect breast cancer biology . Higher plasma leptin levels are associated with obesity [54, 57, 109], insulin resistance [110, 111], and ms [112, 113]. Leptin stimulates human breast cancer cell lines, whereas adiponectin acts protectively, inhibiting the growth of these cell lines [57, 108, 114]. Third, insulin has been shown to have a mitogenic effect upon breast cancer cells in vitro through several mechanisms . Moreover, low serum hdl - c concentrations indicate higher circulating bioactive estrogen levels, which in turn may stimulate target breast tissue . The increasing prevalence of ms and its association with breast cancer, among other comorbidities, point toward the critical need to develop public health strategies to manage ms . Given the increasingly large global burden of metabolic risk factors, risk assessment tools can be developed which incorporate ms as a risk factor for breast cancer . Healthcare providers will then be better equipped to identify high - risk women for primary and secondary prevention . This study has several strengths . First, to the best of our knowledge, this is the first systematic review and meta - analysis examining the association between ms and risk of breast cancer in all adult women . The overlapping meta - analysis on metabolic syndrome and breast cancer was confined to postmenopausal women only . Second, a number of other analyses were performed which strengthened the robustness of findings . Third, the results of this study provide direction for future research on this topic . These include (1) the different methods used to assess exposure, identify cancer, control for confounders, and define ms, (2) limiting studies to those published in english, which may have inflated the results, (3) the relatively small number of studies that met the inclusion criteria, (4) the inability of some studies to provide raw data for calculating the rr, (5) the different study designs employed, and (6) the varied populations studied, including those with diabetes and/or taking medications for diabetes . Most notably and with respect to controlling for adiposity, a potential confounder, two of the included studies controlled for bmi [48, 62] but no information was available from the other studies with respect to controlling for bmi or any other obesity - related measures, including such measures of central obesity as waist circumference and waist - to - hip ratio [13, 14, 43, 51, 63, 64]. Given the potential association between breast cancer and adiposity, it may be prudent for future studies to control for this potential confounder . To this point, kabat et al . Suggested that some, but not all, studies have reported an association between increased central adiposity and an increased risk for postmenopausal breast cancer . The inclusion of such information in future studies may be important, given the potential differences in risk according to exposure and disease subtype . In order to inform and undergird a biological rationale for the observed positive association between ms and breast cancer risk in adult females, future research should comprise analyses based on a standard definition of ms and employ objective and standard biomarkers for assessing each ms component . . It would be helpful if future studies examined the relationship between ms and breast cancer risk separately in perimenopausal and premenopausal women since breast cancer in women may be estrogen - independent . Along those lines, not all studies adjusted for hormone replacement therapy, a potential confounder . Furthermore, they need to examine in situ and invasive cancers separately in relation to metabolic syndrome . Finally, a focus on obese women with respect to ms and breast cancer seems appropriate . In conclusion, the overall results of this meta - analysis suggest that there is a modest positive association between ms and risk of breast cancer in adult females.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.